Modulating SASP-Driven Paracrine Effects to Overcome Therapy-Induced Senescence: Senolytic Role of Hesperidin and Quercetin in A549 Lung Cancer Cells

Modulating SASP-Driven Paracrine Effects to Overcome Therapy-Induced Senescence: Senolytic Role of Hesperidin and Quercetin in A549 Lung Cancer Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Modulating SASP-Driven Paracrine Effects to Overcome Therapy-Induced Senescence: Senolytic Role of Hesperidin and Quercetin in A549 Lung Cancer Cells Cordelia Mano John, Iswarya B R This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7011853/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 06 Aug, 2025 Read the published version in Molecular Biology Reports → Version 1 posted 7 You are reading this latest preprint version Abstract Purpose Therapy-induced senescence (TIS) is a double-edged outcome of chemotherapeutic stress, leading to durable cell cycle arrest and the secretion of pro-inflammatory SASP factors that may promote tumour progression and relapse. This study aimed to investigate the senolytic potential of quercetin (QCT) and hesperidin (HDN)—two flavonoids with known anticancer properties—in reversing 5-fluorouracil (5-FU)-induced senescence and SASP-mediated paracrine resistance in A549 lung adenocarcinoma cells. Methods A549 cells were treated with sublethal doses of 5-FU to induce senescence, confirmed by SA-β-gal staining and senescence marker expression (p16, p21). SASP-conditioned media (SASP-CM) were collected from senescent cultures and used to assess chemoresistance, migration, and gene expression profiles. The senolytic efficacy of QCT and HDN was evaluated using MTT assays, scratch assays, AO/EB staining, colony formation assays, X-Gal staining, and RT-PCR. Results Sublethal 5-FU induced robust senescence and increased resistance to subsequent 5-FU exposure in SASP-CM–treated A549 cells. Both QCT and HDN significantly reversed SASP-mediated chemoresistance and inhibited cell migration. HDN exhibited greater pro-apoptotic and senolytic activity than QCT, as evidenced by higher apoptosis rates, enhanced p53 expression, and reduced SASP marker expression. X-Gal and colony formation assays confirmed selective clearance of senescent cells. Conclusion This study demonstrates that HDN and QCT, particularly HDN, possess strong senolytic and SASP-suppressing effects, thereby restoring chemosensitivity in TIS-affected lung cancer cells. These findings support the use of flavonoid-based senotherapeutics as adjunct strategies to overcome therapy-induced resistance and tumour recurrence. SASP A549 therapy-induced senescence 5-fluorouracil cancer chemoresistance Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 1. Introduction Cancer remains a major global health burden, with incidence rates projected to reach 23.6 million new cases by 2030 (Sung et al., 2024). Chemotherapy remains a cornerstone of treatment for advanced and metastatic cancers; however, it is limited by systemic toxicity, tumour heterogeneity, and the emergence of resistance (Ewald et al., 2010). Chemotherapeutic agents like 5-fluorouracil (5-FU) exert their effects by inducing cellular damage, which may lead to apoptosis, necrosis, or—in cases of sublethal stress—a third outcome: cellular senescence. Cellular senescence is a stable form of growth arrest triggered by diverse stressors, including DNA damage, oxidative stress, oncogenic activation, and cytotoxic therapy. Despite differing origins, all senescence subtypes—including therapy-induced senescence (TIS)—converge on cell cycle arrest (Cuollo et al., 202; Salama et al., 2014 ). Senescence is primarily mediated by the p53/p21 CIP1 and p16 INK4a/Rb tumor suppressor pathways, which regulate the G1/S transition by inhibiting cyclin-dependent kinases (Vousden & Lane, 2007 ; Sharpless & Sherr, 2015 ). Although TIS offers initial therapeutic benefit by halting tumor growth, emerging evidence shows that senescent cancer cells can persist, acquire a pro-inflammatory secretory profile known as the senescence-associated secretory phenotype (SASP), and promote therapy resistance, tumor progression, and relapse (Hernandez-Segura et al., 2018 ; Wiley et al., 2017; Coppé et al., 2010 ). Persistent senescent cells have been detected in lung, breast, and colorectal tumours following treatment with agents such as 5-FU and doxorubicin (te Poele et al., 2002 ; Ohtani et al., 2010). Notably, 5-FU induces TIS in both cancerous and non-cancerous cells, characterized by increased SA-β-gal activity, upregulation of senescence markers (p16, p21), and secretion of pro-tumorigenic SASP factors like IL-6 and IL-8 (Orjalo et al.,b 2009; Altieri et al., 2022; Focaccetti et al., 2015 ). In A549 lung cancer cells, TIS has been shown to enhance migratory and invasive potential through SASP-mediated paracrine signalling. Therefore, therapeutic strategies that eliminate senescent cells (senolytics) or suppress the SASP (senomorphics) are being explored as adjuncts to standard therapy (Kirkland & Tchkonia, 2017). Moreover, persistent SASP signalling following 5-FU treatment in lung cancers has been linked to increased tumor regrowth, highlighting the need to mitigate these paracrine effects through senolytics or SASP-targeted interventions (Krtolica et al., 2001 ). As such, modulating the senescence response—particularly the SASP—represents a critical target for overcoming 5-FU–induced chemoresistance and improving therapeutic outcomes. Ongoing researches highlights the potential of polyphenols—naturally occurring compounds in fruits and vegetables—to modulate cellular senescence due to their antioxidant, anti-inflammatory, and signalling pathway-modulating properties. Several natural compounds have emerged as promising senolytics or senomorphics. Flavonoids, in particular, demonstrate strong senescence-regulating effects with low toxicity, making them attractive candidates for cancer senotherapy. A diverse array of dietary polyphenols have emerged as promising senotherapeutic agents with either senomorphic or senolytic activity (Della Vedova et al., 2025 ). Compounds such as resveratrol, kaempferol, apigenin, genistein, luteolin, rutin, oleuropein aglycone, hydroxytyrosol, and pterostilbene primarily function as senomorphics by suppressing the SASP and mitigating oxidative stress and inflammation via key signalling pathways including SIRT1, Nrf2, NF-κB, FOXO, and cGAS/STING. These agents attenuate senescence-related phenotypes without inducing cell death, thereby preserving tissue homeostasis. In contrast, polyphenols like fisetin, EGCG, procyanidin C1, curcumin (and its analog EF24), wogonin, piperlongumine, and the combination of quercetin with dasatinib exhibit senolytic properties by selectively inducing apoptosis in senescent cells through modulation of apoptotic regulators (e.g., Bcl-2, Bax), mitochondrial dysfunction, ROS generation, and autophagic pathways. Notably, several of these compounds such as fisetin and quercetin-dasatinib have advanced into clinical trials for age-related diseases, underscoring their translational relevance. This study evaluates the senolytic and SASP-modulating potential of hesperidin (HDN) and quercetin (QCT) in a model of 5-FU-induced TIS in A549 lung adenocarcinoma cells. We investigated their effects on senescence markers (p16, p21, p53) and SASP components (IL-6, IL-8, MMP3, E-cadherin) within a SASP-conditioned medium co-culture system to mimic the tumor microenvironment. Our findings aim to inform combinatorial treatment strategies that mitigate TIS-mediated chemoresistance and tumor relapse. 2. Materials and method 21. Reagents 5-Fluorouracil (5-FU; HiMedia Laboratories Pvt. Ltd., India) was dissolved in dimethyl sulfoxide (DMSO; HiMedia) to prepare a 100mM stock solution and stored at − 20°C until use. Quercetin dihydrate (QCT; purity ≥ 98%; Sisco Research Laboratories Pvt. Ltd., India) and hesperidin (HDN; purity ≥ 98%; Sigma-Aldrich, St. Louis, MO, USA) were similarly dissolved in DMSO at 100mM and stored under the same conditions. Working solution of compounds were obtained by diluting in culture medium to the desired concentrations immediately before use, ensuring that the final DMSO concentration did not exceed 0.1% (v/v) in any experiment. All chemicals and reagents used were of tissue culture grade. 2.2. Cell Culture The human lung adenocarcinoma cell line A549 was procured from the National Centre for Cell Science (NCCS), Pune, India. Cells were cultured in Ham’s F-12K medium (Kaighn’s Modification; HiMedia Laboratories Pvt. Ltd., India), supplemented with 10% fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific, USA), 50 U/mL penicillin-streptomycin, and amphotericin B (HiMedia Laboratories Pvt. Ltd., India). Cultures were maintained at 37°C in a humidified incubator with 5% CO₂. 2.3. In vitro Cytotoxicity Assay Cytotoxicity was assessed using the MTT assay, as described by Mosmann (1983). Briefly, 5 × 10³ cells/well were seeded into 96-well plates in 100µL of complete medium. After 24 hours of incubation, cells were treated with 5-FU at various concentrations (20–100µM) for 48 hours. Subsequently, 0.5 mg/mL MTT reagent was added to each well and incubated for 4 hours. The resulting formazan crystals were solubilized using 100% DMSO, and absorbance was measured at 570 nm using a microplate reader. Cytotoxicity (%) was calculated using the formula: [Ac – At/Ac] × 100; Ac: control group absorbance; At: treatment group absorbance. 2.4. Sublethal Concentration Sublethal concentrations of 5-FU, required to induce TIS, were determined based on the method described by Salunke et al. (2022). Following IC₅₀ determination via the MTT assay, sublethal doses were calculated as 1/20th, 1/15th, 1/10th, and 1/5th of the IC₅₀ concentration. 2.5. Evaluation of Senescence-Inducing Concentration To determine the optimal sublethal concentration of 5-FU that induces senescence without causing significant cytotoxicity X-gal staining was performed (Dimri et al., 1995 ). 1 × 10⁵ A549 cells were seeded in 12-well plates and treated with 1/20th, 1/15th, 1/10th, and 1/5th fractions of the IC₅₀ concentration of 5-FU. Cells were incubated for 5 days, during which morphological changes characteristic of senescence—such as cellular enlargement, flattening, reduced proliferation, and increased granularity—were monitored under an inverted phase contrast microscope. Following incubation, cells were washed with PBS, fixed with 4% paraformaldehyde for 15 minutes at room temperature, and washed again to remove residual fixative. Then, 300 µL of freshly prepared X-gal staining solution was added to each well. Plates were incubated overnight (16 h) at 37°C, in the absence of CO₂ and protected from light. The following day, senescent cells—identified by blue X-gal staining—were visualized and photographed using a phase contrast microscope. 2.6. Collection of SASP-Conditioned Media SASP-conditioned media (SASP-CM) was collected from senescent A549 cells following the protocol by Rodier et al. (2012). Briefly, 7.5 × 10⁵ A549 cells were seeded in 100 mm culture dishes and treated with 1/5th of the IC₅₀ concentration of 5-FU for 48 hours to induce senescence. Following treatment, cells were washed twice with 1X PBS (pH 7.4) and cultured in fresh complete medium for 5–7 days to allow the development of senescent morphology. Once senescence was morphologically confirmed, the medium was replaced with 6 mL of low-serum medium and incubated for an additional 48 hours to allow SASP factor accumulation. The conditioned media were then collected, centrifuged at 2000 rpm for 4 minutes to remove cellular debris, and passed through a 0.22 µm syringe filter to ensure sterility. The resulting SASP-CM was either used immediately or stored at − 80°C for later use. 2.7. Evaluation of Chemoresistance and Chemosensitization To assess the paracrine influence of SASP-CM on chemoresistance and the potential chemosensitizing effects of flavonoids, the IC₅₀ shift of 5-FU was evaluated using the MTT assay, as described in Section 2.3 . For chemoresistance assessment, 5 × 10³ A549 cells were seeded in 96-well plates and incubated with varying concentrations of 5-FU (20–100 µM) prepared in SASP-CM for 48 hours. To investigate the chemosensitizing effects of HDN and QCT, 5 × 10³ A549 cells seeded in 96-well plate were co-treated with SASP-CM supplemented with increasing concentrations (20–100 µM) of either flavonoid for 48 hours. Cell viability was determined and the IC₅₀ values were calculated to evaluate the impact of SASP on chemoresistance and the potential reversal by HDN and QCT. 2.8. Cell Migration Assay To assess the influence of HDN and QCT on A549 cell migration under SASP-CM exposure, a scratch (wound healing) assay was performed, as described by Valenzuela et al. ( 2019 ). A total of 5 × 10⁵ A549 cells were seeded in 6-well plates and incubated for 24 hours to achieve a confluent monolayer. A uniform scratch was made across the centre of each well using a sterile 200 µL pipette tip. Detached cells and debris were removed by rinsing the wells 2–3 times with PBS. Cells were then treated with SASP-CM containing increasing concentrations of HDN or QCT (20–100 µM). Negative control wells received complete culture medium, while positive controls were treated with SASP-CM alone. Phase contrast images of the wound area were captured at 0, 24, 48, and 72 hours using a Nikon Ti S microscope. Wound closure was quantified using Nikon image analysis software, and the scratch area was measured at each time point to evaluate the effect of treatments on cell migratory capacity. 2.9. Induction of Apoptosis To assess the pro-apoptotic potential of HDN and QCT in A549 cells exposed to SASP-CM, acridine orange/ethidium bromide (AO/EB) dual staining was performed as previously described by Kasibhatla et al. (2006). A549 cells were seeded at a density of 1 × 10⁵ cells/well in 6-well plates and incubated overnight at 37°C in a humidified 5% CO₂ incubator. The cells were treated with SASP-CM alone or in combination with varying concentrations of HDN or QCT (20–100 µM) for 48 hours. Following treatment, cells were washed twice with 1X PBS, and 10 µL of AO/EB staining solution (1:1, each at 10 mg/mL) was added directly to the wells. Cells were then immediately observed under a fluorescence microscope using green-red emission filters. A minimum of 200 cells per sample were examined to distinguish between live, early apoptotic, late apoptotic, and necrotic cells based on differential staining. The percentage of apoptotic cells was calculated and compared across treatment groups. 2.10. Evaluation of Senolytic Effects 2.10.1. SA-β-Galactosidase (X-gal) Staining Assay The senolytic potential of HDN and QCT was evaluated by quantifying the proportion of SA-β-Gal-positive cells using the X-gal staining assay. A549 cells induced into senescence by treatment with 1/5th IC₅₀ 5-FU were exposed to varying concentrations of HDN and QCT (20–100 µM), and SA-β-Gal staining was performed at 3, 5, and 7 days post-treatment to assess the optimal therapeutic window for senolytic intervention. The staining procedure was conducted as described in Section 2.5 , and the number of blue-stained cells (SA-β-Gal positive) was counted under a phase-contrast microscope to quantify the effect of each treatment. 2.10.2. Colony Formation Assay To further confirm the senolytic efficacy of HDN and QCT, a colony formation assay was conducted using previously senescent A549 cells (Saleh et al., 2020 ). Cells were seeded at a density of 1 × 10⁵ cells/well in 24-well plates and incubated overnight at 37°C with 5% CO₂. Senescent populations, induced by prior exposure to 1/5th IC₅₀ 5-FU, were subsequently treated with varying concentrations of HDN and QCT for 48 hours. After treatment, plates were washed with PBS and fixed with 4% paraformaldehyde, followed by staining with 0.1% crystal violet for 30 minutes. Plates were rinsed, air-dried, and imaged. To quantify colony survival, the dye was eluted using 100% methanol, and absorbance was measured at 570 nm using a multimode plate reader. The percentage inhibition of colony formation was calculated using the formula: % Inhibition = [(Ac – At)/Ac] × 100, where Ac is the absorbance of the control (untreated senescent cells) and At is the absorbance of treated groups. 2.11. SASP Gene Expression Profile To evaluate the potential as senomorphic or senolytic impact of HDN and QCT on the expression of SASP genes, semi-quantitative RT-PCR was performed. Total RNA was extracted from A549 cells treated with SASP-conditioned media (SASP-CM), either alone or in combination with 100µmol HDN or QCT, using the TRIzol reagent (Thermo Fisher Scientific, USA) according to the manufacturer’s instructions. RNA concentration and purity were determined using a NanoDrop spectrophotometer, and 1 µg of RNA was reverse-transcribed into cDNA using a first-strand cDNA synthesis kit (PrimeScript™ RT reagent, TaKaRa Scientifc, Japan). PCR amplification was carried out using gene-specific primers (Table 2 ) for key SASP factors including IL-6, IL-8, MMP3, E-cadherin, senescence markers p16, p21, and p53, and housekeeping gene GAPDH. The PCR products were separated on a 2% agarose gel stained with ethidium bromide and visualized using a gel documentation system (ChemiDoc™ XRS + System, Bio-Rad, USA). Band intensities were quantified by densitometric analysis using ImageJ software (NIH, USA). The relative expression of target genes was normalized to GAPDH and expressed as fold change over control. Table 2 List of primers for gene expression analysis S. No. Accession No. Gene Name Forward Primer (5’-3’) Reverse Primer (3’-5’) Amplicon Size (bp) 1 XM_005249745.6 IL-6 ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG 149 2 NM_000584.4 IL-8 TTTTGCCAAGGAGTGCTAAAGA AACCCTCTGCACCCAGTTTTC 194 3 XM_054361701.1 p16 CACGGCCGCGGCCCGGGGTC GGCCCGGTGCAGCACACCA 250 4 NM_001374509.1 p21 CGATGGAACTTCGACTTTGTCA GCACAAGGGTACAAGACAGTG 220 5 NM_001276761.3 p53 TTCCCTGGATTGGCCAGACT ACCATCGCTATCTGAGCAGC 599 6 NM_002422.5 MMP3 ACATGGAGACTTTGTCCCTTTTG TTGGCTGAGTGGTAGAGTCCC 192 7 NM_001317185.2 E-cadherin TACACTGCCCAGGAGCCAGA TGGCACCAGTGTCCGGATTA 103 8 NM_002046.7 GAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC 226 3. Results 3.1. SASP-CM Exposure Induces Chemoresistance to 5-FU in A549 Cells To evaluate whether the secretory profile of TIS cells could influence 5-FU sensitivity in a paracrine manner, A549 cells were cultured in either normal complete medium or SASP-CM and exposed to increasing concentrations of 5-FU for 48 hours. Cell viability was assessed using the MTT assay. As shown in Fig. 1 , cells cultured in normal medium exhibited a dose-dependent decrease in viability, with an IC₅₀ of 85.93 µM. In contrast, cells cultured in SASP-CM showed significantly higher survival across all tested concentrations of 5-FU, with a rightward shift in the dose-response curve and an increased IC₅₀ of 152.26 µM, indicating reduced sensitivity to 5-FU. 3.2 Determination of Sublethal Concentrations of 5-FU To identify appropriate sublethal concentrations for evaluating TIS, the IC₅₀ of 5-fluorouracil (5-FU) in A549 lung carcinoma cells was first established. The IC₅₀ value, determined through dose–response analysis, was found to be 86 µmol. Based on this, sublethal concentrations were calculated as fractions of the IC₅₀: specifically, 1/20th (4.2 µmol), 1/15th (5.7 µmol), 1/10th (8.5 µmol), and 1/5th (17.2 µmol). These concentrations were selected for subsequent experiments to investigate their potential to induce a senescent phenotype without causing excessive cytotoxicity. 3.3 Evaluation of Senescence Induction by Sublethal 5-FU Treatment To determine the senescence-inducing potential of 5-FU, A549 cells were treated with sublethal concentrations for 7 days. Senescence was assessed using senescence-associated β-galactosidase (SA-β-gal) activity via X-Gal staining and nuclear morphology via DAPI staining (Fig. 2A–B). X-Gal staining revealed minimal senescence in cells treated with higher concentrations of 5-FU (IC₅₀, 1/5th, 1/10th, and 1/15th of IC₅₀), as indicated by limited blue staining. In contrast, treatment with the lowest dose (1/20th of IC₅₀; 4.2 µmol) resulted in a pronounced increase in SA-β-gal-positive cells, with visible senescence-associated morphological features such as cell flattening, increased granularity, and enlarged size. Subsequent DAPI staining was used to distinguish between apoptotic and senescent nuclear changes. Untreated control cells displayed uniformly shaped nuclei, while IC₅₀-treated cells exhibited nuclear condensation and fragmentation characteristic of apoptosis. Conversely, cells treated with the 1/20th IC₅₀ dose showed enlarged, irregular nuclei with diffuse DAPI staining, consistent with senescence-associated nuclear morphology. These findings indicate a concentration-dependent divergence in cellular response to 5-FU: higher doses primarily induce apoptosis, whereas lower sublethal doses trigger a robust senescence phenotype. Based on these results, 4.2 µmol (1/20th IC₅₀) was selected for downstream analysis of TIS. 3.4 Quantification of SA-β-gal–Positive Senescent Cells To quantify the extent of senescence induction by 5-FU, the number of SA-β-gal–positive (blue-stained) cells was counted following X-Gal staining after 7 days of treatment. Counts were performed across multiple fields under bright-field microscopy, and the total number of cells per group at 800. The percentage of SA-β-gal–positive cells was calculated for each treatment condition. As shown in Table 1 and Fig. 3 , the control group exhibited minimal basal senescence (1.5%), whereas 5-FU treatment induced a dose-dependent increase in SA-β-gal–positive cells. Notably, the 1/20th IC₅₀ concentration (4.2 µmol) resulted in a pronounced elevation of senescent cells (59%), significantly higher than all other groups ( p < 0.001). Intermediate doses (1/15th and 1/10th IC₅₀) induced moderate senescence (25% and 17.9%, respectively), while higher concentrations (IC₅₀ and 1/5th IC₅₀) showed only modest increases (8.4% and 10.1%, respectively), likely reflecting a shift toward apoptosis rather than senescence at cytotoxic levels. These findings confirm that 5-FU induces maximal senescence at the lowest sublethal dose (1/20th IC₅₀), consistent with the morphological observations described in previous section. Table 1 Quantification of SA-β-gal-positive (blue-stained) cells in A549 populations following 5-FU treatment. Treatment Group Concentration of 5FU SA-β-gal + Cells (n) % Senescent Cells Control No treatment 12 1.5% IC₅₀ 86 µmol 67 8.4% 1/5th of IC₅₀ 17.2 µmol 81 10.1% 1/10th of IC₅₀ 8.6 µmol 143 17.9% 1/15th of IC₅₀ 5.7 µmol 200 25.0% 1/20th of IC₅₀ 4.2 µmol 472 59.0% 3.5. Chemosensitization of A549 Cells by QCT and HDN To investigate whether QCT and HDN could reverse SASP-CM–induced chemoresistance, A549 cells were treated with increasing concentrations (20–100 µmol) of QCT or HDN in the presence of SASP-CM, and cell viability was assessed using the MTT assay. As shown in Fig. 4 , both compounds induced a concentration-dependent increase in cell death. At lower concentrations (20 and 40 µmol), cytotoxic effects were minimal. However, at higher concentrations (80 and 100 µmol), a significant increase in cell death was observed ( p < 0.05 to p < 0.01). Across all concentrations, HDN exhibited a stronger cytotoxic effect compared to QCT, suggesting a more potent chemosensitizing capacity. These results indicate that both QCT and HDN can enhance the susceptibility of SASP-CM–conditioned A549 cells to cytotoxic stress, with HDN demonstrating superior efficacy. This suggests their potential utility in overcoming senescence-associated drug resistance. 3.7. Scratch (wound) healing assay To assess the effect of HDN and QCT on cell migration, a scratch healing assay was performed in A549 cells under SASP-CM exposure. Cells were first cultured to form a confluent monolayer, scratched to generate a cell-free area, and then treated with 1/20th IC₅₀ of 5-FU in combination with increasing concentrations of HDN or QCT. As shown in Figs. 5 and 6 , untreated SASP-CM–exposed cells exhibited enhanced wound closure, with near-complete migration into the scratch zone by 72 hours, indicating that paracrine factors from senescent cells promote migratory behaviour. In contrast, treatment with HDN or QCT significantly impaired wound closure in a concentration-dependent manner. Higher concentrations (80 and 100 µmol) of both compounds were particularly effective in inhibiting migration, resulting in visibly larger unhealed wound areas at 72 hours. This anti-migratory effect may be attributable to the pro-apoptotic or anti-proliferative actions of HDN and QCT under SASP-CM influence. Quantitative analysis of wound closure distances confirmed these observations. Treatment with HDN (Fig. 7 A) and QCT (Fig. 7 B) significantly reduced migration compared to SASP-CM control conditions. Notably, 100 µmol concentrations of both compounds exhibited the strongest inhibition ( p < 0.001), suggesting that HDN and QCT can effectively suppress SASP-mediated migratory responses in A549 cells. These findings indicate that while SASP-CM enhances A549 cell migration, treatment with flavonoids such as HDN and QCT can counteract this effect, thereby offering potential anti-metastatic benefits. 3.8 Induction of Apoptosis Assessed by AO/EB Staining To determine the mode of cell death and evaluate the senolytic potential of HDN and QCT, A549 cells were subjected to AO/EB dual staining following a 5-day treatment with 5-FU, HDN, or QCT under SASP-CM exposure. Acridine orange penetrates all cells and stains nuclei green, whereas ethidium bromide only enters non-viable cells, emitting orange or red fluorescence that distinguishes early and late apoptotic/necrotic stages, respectively. Untreated control cells exhibited uniform green fluorescence and intact nuclear morphology, indicative of viable and healthy cells (Fig. 8 ). Conversely, cells treated with the IC₅₀ concentration of 5-FU demonstrated prominent orange to red fluorescence, with marked nuclear condensation and fragmentation—hallmarks of late apoptosis and necrosis. Sublethal 5-FU (1/20th IC₅₀) alone or in combination with increasing concentrations of HDN or QCT revealed distinct apoptotic profiles. Quantitative analysis (Fig. 9 ) showed that HDN induced a dose-dependent increase in apoptotic/necrotic cell populations. At 20, 40, and 60 µM HDN, only minor increases in cell death were observed (8%, 10%, and 14%, respectively), whereas 80 µM and 100 µM treatments led to significant elevations in apoptosis, with 38% and 65% apoptotic/necrotic cells, respectively. Morphological changes were consistent with late apoptosis at these higher concentrations. In contrast, QCT-treated cells exhibited a more moderate apoptotic response. At 20–60 µM, the majority of cells remained viable with predominantly green fluorescence, and apoptotic percentages remained low (6–11%). At 80 µM and 100 µM, there was a mild increase in red fluorescence and nuclear condensation, with apoptotic/necrotic cell populations reaching 18% and 29%, respectively—considerably lower than those observed in HDN-treated cells at equivalent concentrations. These findings confirm that HDN possesses a more potent pro-apoptotic and senolytic effect on A549 cells under SASP-CM conditions than QCT. The differential apoptotic induction suggests that HDN is more effective in overcoming SASP-mediated survival signals, making it a promising candidate for senescence-targeted therapy in chemoresistant lung cancer. 3.9. X-Gal Staining to Assess Senolytic Activity To evaluate the senolytic potential of QCT and HDN, A549 cells were first induced into a senescent state using 1/20th IC₅₀ concentration of 5-FU. Senescence was confirmed via SA-β-galactosidase (X-Gal) staining, and treatments with QCT and HDN were carried out at concentrations ranging from 20 to 100 µmol over 3, 5, and 7 days. X-Gal staining demonstrated a progressive increase in senescent cell burden over time in the 5-FU–treated group, with minimal staining at day 3, moderate accumulation by day 5, and a peak in SA-β-gal positivity at day 7. Control cells remained negative for SA-β-gal staining throughout the observation period, confirming the specificity of 5-FU in inducing TIS. Treatment with HDN (Fig. 10 ) and QCT (Fig. 11 ) resulted in a clear reduction in the number of blue-stained, senescent cells. This effect was concentration-dependent and was more prominent at day 5, suggesting effective senolytic activity. Notably, the highest concentrations of both compounds (80 and 100 µmol) led to substantial clearance of SA-β-gal–positive cells by day 5. Interestingly, the senolytic effect was somewhat attenuated by day 7, potentially due to either recovery of remaining viable senescent cells or adaptive resistance mechanisms. Overall, both QCT and HDN demonstrated significant senolytic activity in the TIS model. HDN appeared slightly more potent at higher concentrations, while QCT showed broader efficacy across mid-range doses. These results suggest that both flavonoids hold promise as senolytic agents capable of targeting therapy-induced senescent cells in lung cancer models. 3.10. Colony Formation Assay To further evaluate the senolytic efficacy of QCT and HDN, a crystal violet colony formation assay was performed following senescence induction. A549 cells were initially rendered senescent via treatment with 1/20th IC₅₀ 5-FU. Post-senescence, cells were exposed to increasing concentrations (20–100 µmol) of QCT and HDN for 48 hours. Cell viability was assessed by 0.5% crystal violet staining, which marks adherent and viable cells. As shown in Fig. 12 A, senescent A549 cells treated with QCT or HDN exhibited a dose-dependent reduction in crystal violet staining, indicative of decreased viability and cell number. This cytotoxic effect was specific to senescent cells, as control (non-senescent) cells treated with the same concentrations of QCT and HDN displayed minimal change in colony density or staining intensity. Notably, higher concentrations (80 and 100 µmol) of both compounds induced a pronounced decrease in viable senescent colonies, consistent with senolytic activity. Quantitative analysis was performed by solubilizing the stained cells in 100% methanol and measuring absorbance at 570 nm (Fig. 12 B). Senescent cells maintained in SASP-CM and treated only with 5-FU (1/20th IC₅₀) exhibited enhanced survival and proliferation relative to untreated controls, as evidenced by elevated absorbance values. However, treatment with QCT or HDN significantly decreased absorbance in a concentration-dependent manner, confirming their senolytic potency. These findings further validate that both QCT and HDN selectively eliminate senescent cells while sparing non-senescent populations, reinforcing their therapeutic potential in senescence-targeted strategies. 3.11. Gene expression analysis of SASP markers To investigate the transcriptional changes associated with TIS and the senolytic potential of HDN and QCT, RT-PCR was performed to assess the expression of key SASP factors and senescence-associated genes in A549 cells (Figs. 13 & 14 ). Cells were treated with 1/20th IC₅₀ 5-FU alone or in combination with 100 µM HDN (H100) or quercetin (Q100) for 5 days. The expression of IL-6, IL-8, MMP3, E-cadherin, p21, p16, and p53 was evaluated. Treatment with 5-FU alone significantly upregulated SASP-related inflammatory cytokines (IL-6, IL-8) and canonical senescence markers (p21, p16, MMP3, and E-cadherin), confirming successful induction of the senescent phenotype. Co-treatment with HDN (H100) resulted in a marked downregulation of all SASP markers, including a pronounced suppression of p21, p16, and MMP3, alongside a strong ~ 5-fold increase in p53 expression. This suggests HDN promotes apoptosis while attenuating the inflammatory and pro-invasive features of SASP. Interestingly, E-cadherin expression was also significantly reduced in the HDN group, potentially indicating loss of epithelial integrity or reduced cell-cell adhesion in the remaining cell population. In comparison, QCT (Q100) co-treatment also reduced SASP gene expression but to a lesser extent. While moderate decreases in p21, p16, and MMP3 were observed, p53 expression remained largely unchanged, suggesting a comparatively weaker pro-apoptotic and senolytic effect. These results indicate that both flavonoids modulate the SASP transcriptional program induced by sublethal 5-FU treatment, with HDN demonstrating a superior capacity to suppress SASP markers and promote apoptotic gene signatures. 4. Discussion TIS is a key cellular response following chemotherapeutic stress, characterized by cell cycle arrest, morphological changes, and secretion of pro-inflammatory cytokines, collectively known as the SASP. The activation of cellular senescence can play dual roles—offering advantages such as tissue repair and remodelling, while also contributing to negative outcomes like cancer progression when senescent cells persist (Hernandez-Segura et al., 2018 ; Rodier et al, 2011). The persistence of TIS cells following cancer treatment has been increasingly recognized as a contributor to tumour relapse and chemoresistance. Consequently, selectively eliminating these senescent cells has emerged as a promising approach to enhance treatment efficacy and prevent cancer progression. Among natural agents, QCT, a dietary flavonol, was one of the first senolytics shown to act on senescent endothelial and bone marrow-derived mesenchymal stem cells. However, its efficacy is significantly enhanced when combined with the tyrosine kinase inhibitor dasatinib, giving a synergistic disruption of anti-apoptotic pathways and caspase activation (Zhu et al., 2015 ). Despite its therapeutic potential, QCT suffers from poor solubility and low bioavailability, which have been improved by using advanced delivery systems like lipid carriers and nanoparticles. In a study by Lewińska et al ( 2022 ), three structurally modified QCT derivatives (QD1–QD3) were synthesized, with QD3—bearing full acetylation—exhibiting the most potent senolytic effect in etoposide-induced senescent HMEC and MDA-MB-231 cells by promoting apoptosis and suppressing SASP and HSP70 expression. In the present study, we utilised HDN, a citrus flavanone glycoside and QCT, a well-established senolytic. HDN is widely studied for its antioxidant, anti-inflammatory, and cytoprotective properties. Structurally, HDN consists of the aglycone hesperetin linked to a disaccharide rutinose moiety, which significantly influences its solubility and biological activity (Erlund, 2004 ). Despite these pharmacokinetic limitations, HDN itself has demonstrated significant therapeutic potential. Notably, emerging evidence suggests that HDN may modulate DNA damage response pathways. It has been shown to sensitize various cancer cell lines to genotoxic agents by interfering with key DDR regulators such as ATM, ATR, and Chk1/Chk2 kinases, thereby impairing repair of DNA double-strand breaks and promoting apoptosis (Aggarwal et al., 2020 ). Such findings point to HDN not only as a systemic antioxidant but also as a promising adjuvant for cancer therapy by targeting DNA repair mechanisms. Moreover, its ability to suppress oxidative stress-related pathways may synergize with DDR inhibition to enhance anti-tumour efficacy. This study demonstrates the senolytic capabilities of HDN and QCT in countering TIS–associated 5-FU chemoresistance in A549 lung carcinoma cells. We induced senescence using a sublethal dose of 5‑FU at 1/20th IC₅₀ (4.2 µM), resulting in classic senescence hallmarks, including increased SA‑β‑gal activity, flattened morphology, and enlarged nuclei. Notably, higher 5‑FU concentrations triggered apoptosis—evidenced by nuclear condensation and decreased SA‑β‑gal staining—confirming a dose-dependent divergence between apoptosis and senescence (Demaria et al., 2017 ; Kumar & Diekman, 2022 ). Approximately 60% of cells displayed SA‑β‑gal positivity at 4.2 µM 5‑FU, validating the reliability of this concentration for modelling TIS. Similar findings have been reported by De Angelis et al. ( 2006 ), Focaceti et al. (2015), and Bai et al. ( 2024 ), where treatment with 5-FU at varying concentrations and durations—770 µM for 24 hours, 10–1000 µM for 72 hours, and 1 µM for 4 days, respectively—successfully induced TIS in HCT116 cells. Consistent with prior reports, we observed that low-dose 5-FU (1/20th IC₅₀) preferentially induced senescence, as evidenced by elevated SA-β-gal activity, characteristic morphological alterations, and upregulation of canonical senescence markers (p21, p16, MMP3, and IL-6) (Vousden & Prives, 2009 ; Kuilman & Peeper, 2009). The pro-senescent effect of low-dose chemotherapy has been highlighted as a double-edged sword: while initially cytostatic, TIS may promote tumor progression through SASP-driven inflammation and remodelling (Coppé et al., 2008 ; Milanovic et al., 2018). Notably, A549 cells exposed to SASP-CM derived from 5-FU–induced senescent cells showed enhanced resistance to 5-FU, with the IC₅₀ increasing from 86 µM to 152 µM. This observation reinforces the role of SASP factors—such as IL-6 and IL-8—in driving chemoresistance, promoting proliferation of adjacent tumor cells, and inducing EMT (Boccardi & Mecocci., 2021). Supporting the paracrine influence of SASP, Altieri et al. ( 2017 ) demonstrated that 5-FU or sera from capecitabine-treated (a prodrug of 5-FU) patients could induce senescence in EA.hy926 endothelial cells, suggesting that 5-FU–induced SASP may contribute to systemic and tumour microenvironment–mediated resistance. Though cellular senescence prevents malignancy during early tumorigenesis, cell cycle arrest and metabolic reprogramming activates the SASP. SASP components can either support immune surveillance or, in later tumour stages, promote malignancy through EMT induction, angiogenesis, and immune evasion (Yuan et al., 2020 ). In vivo models show that senescent cells contribute to tissue repair and developmental remodelling, with key markers such as p16 and p21 elevated in the tissues. Upon treatment with QCT and HDN in the presence of SASP-CM, we observed concentration-dependent reductions in cell viability, with HDN showing greater potency. In scratch assay, both flavonoids significantly impaired A549 cell migration under SASP conditions, especially at higher doses (80–100 µM), suggesting inhibition of SASP-driven EMT and metastatic behaviour (Valenzuela et al., 2019 ). These findings are consistent with evidence that senotherapeutic agents can disrupt SASP-mediated migration pathways (Xu et al., 2016; Boccardi & Mecocci., 2021). Additionally, AO/EB staining revealed elevated apoptosis and necrosis after flavonoid treatment, with HDN producing strong late-apoptotic signals—supporting its senolytic efficacy. The superior efficacy of HDN over QCT in inducing apoptosis, as reflected by AO/EB staining and increased p53 expression, points toward its stronger senolytic potential. p53 activation is a known mediator of apoptosis in senescent and stressed cells (Vousden & Prives, 2009 ). The observed downregulation of SASP factors by HDN, particularly IL-6, IL-8, and MMP3, further supports its dual anti-inflammatory and senolytic action, potentially limiting the tumor-promoting effects of SASP (Faget et al., 2019 ). The colony formation and X-Gal staining assays confirm the capacity of both flavonoids to selectively eliminate senescent cells, sparing non-senescent populations. QCT and HDN both significantly reduced SA‑β‑gal positivity—particularly by day 5—while crystal violet staining demonstrated decreased colony density in treated cultures, indicating successful clearance of senescent cells. This is based on the concept of a senescence → senolysis or “the one–two punch” strategy for robust tumour cell elimination (Escriche-Navarro et al., 2025). Similar results have been observed in a study by Saleh et al., ( 2020 ) where exposure of senescent A549 cells to ABT-263 led to a marked reduction in SA-β-gal-positive populations, confirming its targeted action against senescent phenotypes. Notably, ABT-263 induced significant apoptotic cell death—as evidenced by increased Annexin-V/PI staining, and the cleavage of PARP and caspase-3—in cells rendered senescent by etoposide, doxorubicin, or ionizing radiation, but not in untreated controls. Also this selective cytotoxicity aligns with the growing interest in senolytic therapies as adjuncts to standard cancer treatment (Kirkland & Tchkonia, 2017; Short et al., 2019 ). But the attenuation of senolytic effects by day 7 may reflect adaptive resistance mechanisms or survival of a more resistant senescent subpopulation, warranting further investigation. RT‑PCR analysis showed that 5‑FU–induced senescence elevated SASP components (IL‑6, IL‑8, MMP3) and senescence biomarkers p21 and p16—consistent with activation of the p53/p21 and p16/Rb pathways (Coppe et al., 2008). Notably, co‑treatment with HDN suppressed these SASP markers and markedly increased p53 expression, indicating a shift towards apoptosis and senescence escape. While QCT also reduced SASP gene expression, its impact was less pronounced and lacked significant p53 activation. These results position HDN as a highly effective anticancer senolytic agent. In summary, HDN significantly outperformed QCT in overcoming SASP-mediated chemoresistance, inhibiting migration, and selectively eliminating senescent tumor cells. This flavonoid holds considerable promise for refining chemotherapeutic approaches by neutralizing the tumorigenic effects of TIS-induced SASP. Future investigations should validate these findings in vivo , explore synergy with established senolytics, and further dissect the mechanistic roles of NF‑κB, TGF‑β, and Nrf2 pathways in HDN–mediated senolysis. Overall, these results underscore the therapeutic potential of HDN in enhancing treatment outcomes by targeting the hidden burden of senescent cancer cells. 5. Conclusion This study demonstrates that HDN and QCT possess notable senolytic activity capable of mitigating TIS and associated chemoresistance in A549 lung cancer cells. By using a sublethal dose of 5-FU to induce senescence, we established a functional in vitro model that mimicked SASP-mediated paracrine signalling and tumour-promoting effects. Our findings reveal that HDN, more effectively than QCT, attenuates SASP markers, restores drug sensitivity, reduces cell migration, and promotes apoptosis, as evidenced by increased p53 activation and loss of SA-β-gal activity. The ability of HDN to selectively eliminate senescent cells and suppress SASP-driven phenotypes underscores its promise as a senotherapeutic adjuvant in cancer treatment. These results support a “one–two punch” strategy wherein chemotherapy is followed by senolytics to eliminate residual senescent cells and prevent relapse. Future in vivo studies and mechanistic analyses involving HDN’s interaction with key signalling pathways such as NF-κB and Nrf2 are warranted to further establish its clinical utility in overcoming TIS-associated tumour progression. Declarations The authors declare no conflict of interest. Clinical trial number: not applicable. Ethics, Consent to Participate, and Consent to Publish declarations: not applicable. Acknowledgements This study was carried out as part of the partial fulfillment of the requirements for the Master’s degree in Biomedical Sciences at the Department of Biomedical Sciences, SRIHER. The authors thank the department for providing the necessary laboratory infrastructure and support. Funding This research was self-funded by the authors. No external funding was received for the conduct of this study. References Aggarwal V, Tuli HS, Thakral F, et al. Molecular mechanisms of action of hesperidin in cancer: recent trends and advancements. Exp Biol Med (Maywood). 2020;245(5):486–497. doi:10.1177/1535370220903671 Altieri P, Murialdo R, Barisione C, et al. 5‑fluorouracil causes endothelial cell senescence: potential protective role of glucagon-like peptide 1. Br J Pharmacol. 2017;174(21):3713–3726. doi:10.1111/bph.13725 Bai SR, Zhao BX, Zhao Q, et al. Oleanolic acid improves 5‑fluorouracil‑induced intestinal damage and inflammation by alleviating intestinal senescence. Sci Rep. 2024;14:21852. doi:10.1038/s41598-024-72536-3 Boccardi V, Mecocci P. Senotherapeutics: targeting senescent cells for the main age-related diseases. Mech Ageing Dev. 2021;197:111526. doi:10.1016/j.mad.2021.111526 Coppé JP, Patil CK, Rodier F, et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 2008;6(12):2853–2868. doi:10.1371/journal.pbio.0060301 Coppé JP, Desprez PY, Krtolica A, Campisi J. The senescence-associated secretory phenotype: the dark side of tumor suppression. Annu Rev Pathol. 2010;5:99–118. doi:10.1146/annurev-pathol-121808-102144 Cuollo L, Antonangeli F, Santoni A, Soriani A. The senescence-associated secretory phenotype (SASP) in the challenging future of cancer therapy and age-related diseases. Biology (Basel). 2020;9(12):485. doi:10.3390/biology9120485 Della Vedova L, Baron G, Morazzoni P, Aldini G, Gado F. The potential of polyphenols in modulating the cellular senescence process: implications and mechanism of action. Pharmaceuticals. 2025;18(2):138. Demaria M, O’Leary MN, Chang J, et al. Cellular senescence promotes adverse effects of chemotherapy and cancer relapse. Nat Med. 2017;23(8):967–975. doi:10.1038/nm.4368 De Angelis PM, Svendsrud DH, Kravik KL, Stokke T. Cellular response to 5‑fluorouracil (5‑FU) in 5‑FU-resistant colon cancer cell lines during treatment and recovery. Mol Cancer. 2006;5:20. doi:10.1186/1476-4598-5-20 Dimri GP, Lee X, Basile G, et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 1995;92(20):9363–9367. doi:10.1073/pnas.92.20.9363 Erlund I. Review of the flavonoids quercetin, hesperetin, and naringenin: dietary sources, bioactivities, bioavailability, and epidemiology. Nutr Res. 2004;24(10):851–874. Escriche-Navarro B, Garrido E, Escudero A, et al. Targeting the senescent surfaceome through DPP4 antibody-functionalized nanoparticles: an application to cancer therapy. Biomaterials. 2025;[Epub Jun 4]. doi:10.1016/j.biomaterials.2025.123461 Faget DV, Ren Q, Stewart SA. Unmasking senescence: context-dependent effects of SASP in cancer. Nat Rev Cancer. 2019;19(8):439–453. doi:10.1038/s41568-019-0156-2 Focaccetti C, Bruno A, Magnani E, et al. Effects of 5‑fluorouracil on morphology, cell cycle, proliferation, apoptosis, autophagy and ROS production in endothelial cells and cardiomyocytes. PLoS One. 2015;10(2):e0115686. doi:10.1371/journal.pone.0115686 Hernandez-Segura A, Nehme J, Demaria M. Hallmarks of cellular senescence. Trends Cell Biol. 2018;28(6):436–453. doi:10.1016/j.tcb.2018.02.001 Krtolica A, Parrinello S, Lockett S, Desprez PY, Campisi J. Senescent fibroblasts promote epithelial cell growth and tumorigenesis: a link between cancer and aging. Proc Natl Acad Sci U S A. 2001;98(21):12072–12077. doi:10.1073/pnas.211053698 Kumar S, Diekman BO. The emergence of senolytic targeting for cancer therapy. Nat Rev Cancer. 2022;22(6):314–328. doi:10.1038/s41568-022-00466-8 Lewińska A, Przybylski P, Adamczyk-Grochala J, et al. Senolysis-based elimination of chemotherapy-induced senescent breast cancer cells by quercetin derivative with blocked hydroxy groups. Cancers (Basel). 2022;14(3):605. doi:10.3390/cancers14030605 Milanović M, Fan DNY, Belenki D, et al. Senescence-associated reprogramming promotes cancer stemness. Nature. 2018;553(7686):96–100. doi:10.1038/nature25167 Ohtani N, Zebedee Z, Huot TJ, et al. Opposing effects of Ets and Id proteins on p16INK4a expression during cellular senescence. Nature. 2001;409(6823):1067–1070. doi:10.1038/35059131 Orjalo AV, Bhaumik D, Gengler BK, Scott GK, Campisi J. Cell surface-bound IL-1α is an upstream regulator of the senescence-associated IL-6/IL-8 cytokine network. Proc Natl Acad Sci U S A. 2009;106(40):17031–17036. doi:10.1073/pnas.0905299106 Salama R, Sadaie M, Hoare M, Narita M. Cellular senescence and its effector programs. Genes Dev. 2014;28(2):99–114. doi:10.1101/gad.235184.113 Saleh T, Carpenter VJ, Tyutyunyk-Massey L, et al. Clearance of therapy-induced senescent tumor cells by the senolytic ABT‑263 via interference with BCL‑XL–BAX interaction. Mol Oncol. 2020;14(10):2504–2519. doi:10.1002/1878-0261.12756 Sánchez-Díez M, Romero-Jiménez P, Alegría-Aravena N, et al. Assessment of cell viability in drug therapy: IC50 and other new time-independent indices for evaluating chemotherapy efficacy. Pharmaceutics. 2025;17(2):247. doi:10.3390/pharmaceutics17020247 Sharpless NE, Sherr CJ. Forging a signature of in vivo senescence. Nat Rev Cancer. 2015;15(7):397–408. doi:10.1038/nrc3960 Short S, Fielder E, Miwa S, von Zglinicki T. Senolytics and senostatics as adjuvant tumour therapy. EBioMedicine. 2019;41:683–692. doi:10.1016/j.ebiom.2019.01.056 te Poele RH, Okorokov AL, Jardine L, Cummings J, Joel SP. DNA damage is able to induce senescence in tumor cells in vitro and in vivo. Cancer Res. 2002;62(6):1876–1883. PMID:11912168 Rodier F, Campisi J. Four faces of cellular senescence. J Cell Biol. 2011;192(4):547–556. doi:10.1083/jcb.201009094 Valenzuela CA, Quintanilla R, Olate-Briones A, et al. SASP-dependent interactions between senescent cells and platelets modulate migration and invasion of cancer cells. Int J Mol Sci. 2019;20(21):5292. doi:10.3390/ijms20215292 Vousden KH, Lane DP. p53 in health and disease. Nat Rev Mol Cell Biol. 2007;8(4):275–283. doi:10.1038/nrm2147 Vousden KH, Prives C. Blinded by the light: the growing complexity of p53. Cell. 2009;137(3):413–431. doi:10.1016/j.cell.2009.04.037 Wiley CD, Campisi J. The metabolic roots of cellular senescence. Nat Rev Mol Cell Biol. 2021;22(8):411–420. doi:10.1038/s41580-021-00347-2 Yuan L, Alexander PB, Wang XF. Cellular senescence: from anti‑cancer weapon to anti‑aging target. Sci China Life Sci. 2020;63:332–342. doi:10.1007/s11427-019-9594-8 Zhu Y, Tchkonia T, Pirtskhalava T, et al. The Achilles’ heel of senescent cells: from transcriptome to senolytic drugs. Aging Cell. 2015;14(4):644–658. doi:10.1111/acel.12344 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 06 Aug, 2025 Read the published version in Molecular Biology Reports → Version 1 posted Editorial decision: Revision requested 18 Jul, 2025 Reviews received at journal 13 Jul, 2025 Reviewers agreed at journal 03 Jul, 2025 Reviewers invited by journal 03 Jul, 2025 Editor assigned by journal 02 Jul, 2025 Submission checks completed at journal 02 Jul, 2025 First submitted to journal 30 Jun, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7011853","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":480158441,"identity":"4d321003-000a-4fc9-9e4b-9053e40075bf","order_by":0,"name":"Cordelia Mano John","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABWElEQVRIie3RPUvDQBjA8SccXJdLu6ak1a+QcoODJf0qOQ4ypYIUSgeHiHBdpK4WRb9CRRDHg0BdQlwD6dBQcHIQBxEU60WlL9YOboL5kzfy5EdyBCAv7y8mswOGCgZwEEAdAH0OHLVb2YXmZ9sqIV/E/QXJTurhYDZYJEsVkyCddNp1UizIdLJ7fdvY6urpY7xn75RODq4enqFeHUgkxnNSjlxaCyOXYOJw2g8TdhoUqOkNecsYDVv9Q3DpQGpda06skODyvgjUWhzX1EXiGAiD6WHJ/Nij6oMDpogwVsiU4NI4I1FDEfTivUl2roj2CtM1RBJsfLxFascIY7MpJBsoggjI76QcYlrzI67ImFNdcJaR7WaPs4vYbaGKpVYYLJFiiNLUb9sbm0cem+jCbhilIUq8J5udxfxSu+/Y1d5N926BLEScn+5aMPu5qxXkukleXl7eP+8d6x57jhoDOJIAAAAASUVORK5CYII=","orcid":"","institution":"Sri Ramachandra Institute of Higher Education and Research Porur","correspondingAuthor":true,"prefix":"","firstName":"Cordelia","middleName":"Mano","lastName":"John","suffix":""},{"id":480158442,"identity":"8cd61f57-c704-460b-a388-ee3a7b7a226a","order_by":1,"name":"Iswarya B R","email":"","orcid":"","institution":"Sri Ramachandra Institute of Higher Education and Research Porur","correspondingAuthor":false,"prefix":"","firstName":"Iswarya","middleName":"B","lastName":"R","suffix":""}],"badges":[],"createdAt":"2025-06-30 14:53:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7011853/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7011853/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11033-025-10904-6","type":"published","date":"2025-08-06T15:58:03+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":86152062,"identity":"999743c7-f598-478d-a25f-ff79fcc3edb3","added_by":"auto","created_at":"2025-07-07 10:17:33","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":30437,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMTT assay.\u003c/strong\u003e Dose-dependent cytotoxic effects of 5-FU (A) in normal media and (B), in SASP-CM on A549 cells. Data are presented as mean ± SD (n = 3). *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.5; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.1; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 vs. control.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7011853/v1/78986908936545d77edfd697.png"},{"id":86151567,"identity":"7468152e-4bee-4f54-b141-0c2d82d61dab","added_by":"auto","created_at":"2025-07-07 10:09:33","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":542317,"visible":true,"origin":"","legend":"\u003cp\u003eMorphological evaluation of senescence in A549 cells following 5-FU treatment. (A) Representative images of SA-β-gal (X-Gal) staining after 7 days. (B) DAPI-stained nuclei showing nuclear morphology at different 5-FU concentrations. Cells treated with 1/20th IC₅₀ (4.2 µmol) exhibited senescence-associated nuclear enlargement, while IC₅₀-treated cells displayed nuclear condensation indicative of apoptosis.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7011853/v1/58d7c099b8b4176fa1987659.png"},{"id":86151560,"identity":"7527502a-db04-4f26-9f8a-a04678c2a3cd","added_by":"auto","created_at":"2025-07-07 10:09:33","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":13695,"visible":true,"origin":"","legend":"\u003cp\u003eQuantification of SA-β-gal–positive senescent cells in A549 cells treated with sublethal concentrations of 5-FU for 7 days. Bars represent the mean percentage of SA-β-gal–positive cells (n = 3). Data are presented as mean ± SEM. ** \u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003e\u0026lt; 0.01 and *** \u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u0026lt; 0.001 vs. control.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7011853/v1/68a8934c2cd26af7e257d79e.png"},{"id":86151564,"identity":"59f8e3c1-c41f-4474-bab4-8ab931410d67","added_by":"auto","created_at":"2025-07-07 10:09:33","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":14879,"visible":true,"origin":"","legend":"\u003cp\u003eChemosensitization of SASP-CM–conditioned A549 cells by (A) HDN and (B) QCT. Cells were treated with increasing concentrations of HDN or QCT (20–100 μmol) in the presence of SASP-CM for 48 hours. Cell viability was measured using the MTT assay. HDN exhibited significantly greater cytotoxicity than QCT across all concentrations. Data represent mean ± SEM of three independent experiments. *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u0026lt; 0.001 vs. untreated SASP-CM–conditioned control.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7011853/v1/9b6e1755b056cd4192498286.png"},{"id":86152063,"identity":"b1d8c246-70bb-4d62-bae7-f40eb48d6572","added_by":"auto","created_at":"2025-07-07 10:17:33","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":446331,"visible":true,"origin":"","legend":"\u003cp\u003eScratch wound healing assay of A549 cells exposed to SASP-CM and treated with HDN. Representative phase-contrast images showing wound closure over 72 hours in cells treated with 1/20th IC₅₀ 5-FU and increasing concentrations of HDN. SASP-CM promoted migration, while HDN treatment significantly inhibited wound closure in a dose-dependent manner. Scale bar = 100 μm.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7011853/v1/f6b76d6984203308143e65d2.png"},{"id":86151578,"identity":"924381f3-117a-402b-a794-61c9e0cc3f29","added_by":"auto","created_at":"2025-07-07 10:09:33","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":406902,"visible":true,"origin":"","legend":"\u003cp\u003eScratch wound healing assay of A549 cells exposed to SASP-CM and treated with QCT. Cells treated with 1/20th IC₅₀ 5-FU and increasing concentrations of QCT showed reduced migration relative to SASP-CM controls. QCT inhibited wound closure in a concentration-dependent fashion. Scale bar = 100 μm.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7011853/v1/8c6fe14aca4492eb866987e6.png"},{"id":86151569,"identity":"85d09704-6155-438d-b74b-868d951080fe","added_by":"auto","created_at":"2025-07-07 10:09:33","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":19790,"visible":true,"origin":"","legend":"\u003cp\u003eQuantitative analysis of A549 cell migration following treatment with (A) HDN or (B) QCT under SASP-CM conditions. Mean wound closure distances were measured at multiple time points. Both compounds inhibited migration in a dose-dependent manner. Data represent mean ± SEM of three independent experiments. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e \u0026lt; 0.01 vs. SASP-CM control.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-7011853/v1/7289168fe725954ad965418a.png"},{"id":86151575,"identity":"f59257e0-95a1-4447-9db7-b44c301a836b","added_by":"auto","created_at":"2025-07-07 10:09:33","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":299418,"visible":true,"origin":"","legend":"\u003cp\u003eAO/EB staining of A549 cells exposed to SASP-CM and treated with HDN or QCT. Fluorescent microscopy images of cells treated for 5 days with increasing concentrations of HDN or QCT in the presence of 1/20th IC₅₀ 5-FU and SASP-CM. Viable cells exhibit uniform green fluorescence (white arrows), early apoptotic cells display condensed green nuclei, while late apoptotic and necrotic cells show orange to red fluorescence (yellow and blue arrows, respectively). Scale bar = 100 µm.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-7011853/v1/dc769096ae9cfc2868a791f9.png"},{"id":86152064,"identity":"9fb96b11-6d78-4ed9-ac85-ce361e9cc19c","added_by":"auto","created_at":"2025-07-07 10:17:33","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":18557,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eQuantification of apoptotic/necrotic A549 cells by AO/EB staining under SASP-CM conditions. \u003c/strong\u003eA549 cells were treated with sublethal 5-FU (1/20th IC₅₀) alone or in combination with increasing concentrations of 20–100 µM (A) HDN and (B) QCT for 5 days under SASP-CM exposure. The percentage of apoptotic/necrotic cells was quantified based on red/orange nuclear fluorescence. Cells treated with 5-FU at IC₅₀ served as a positive control. Data are representative of three independent experiments. ### Control vs. IC₅₀ 5-FU; ***\u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e\u0026lt; 0.001 vs. IC₅₀ 5-FU\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-7011853/v1/18bd4006904983049d694838.png"},{"id":86152069,"identity":"c598585e-4095-43f1-a197-062320affb9a","added_by":"auto","created_at":"2025-07-07 10:17:34","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":370227,"visible":true,"origin":"","legend":"\u003cp\u003eX-Gal staining assay to assess senolytic activity of HDN in A549 cells. Cells were pre-treated with 1/20th IC₅₀ of 5-FU to induce senescence, followed by HDN treatment (20–100 µmol) for 3, 5, or 7 days. SA-β-gal–positive (blue) cells represent senescent populations. HDN reduced the number of senescent cells in a concentration- and time-dependent manner. Scale bar = 100 µm.\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-7011853/v1/4612331d9d288a94355fd182.png"},{"id":86152070,"identity":"49fc0bdb-5c8b-4a58-b37a-39de86a1e506","added_by":"auto","created_at":"2025-07-07 10:17:34","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":385014,"visible":true,"origin":"","legend":"\u003cp\u003eX-Gal staining assay to assess senolytic activity of QCT in A549 cells. Following senescence induction by 5-FU, cells were treated with QCT (20–100 µmol) for 3, 5, or 7 days. A reduction in SA-β-gal–positive cells was observed, most notably at day 5, indicating effective clearance of senescent cells. Scale bar = 100 µm.\u003c/p\u003e","description":"","filename":"11.png","url":"https://assets-eu.researchsquare.com/files/rs-7011853/v1/9724c9da2da0c0dd52023c9b.png"},{"id":86151580,"identity":"215417b1-1e0a-4c2e-af19-71315a4f9709","added_by":"auto","created_at":"2025-07-07 10:09:34","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":124820,"visible":true,"origin":"","legend":"\u003cp\u003eCrystal violet staining and quantification of senolytic effects of QCT and HDN in A549 cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Representative images of crystal violet–stained colonies from senescent A549 cells treated with QCT or HDN at increasing concentrations (20–100 µmol). Reduced staining intensity corresponds to decreased cell viability.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B) \u003c/strong\u003eQuantitative analysis of senolytic efficacy performed by eluting stained colonies with 100% methanol and measuring absorbance at 570 nm. Data are presented as mean ± SEM from three independent experiments. Decreased absorbance reflects effective elimination of senescent cells.\u003c/p\u003e","description":"","filename":"12.png","url":"https://assets-eu.researchsquare.com/files/rs-7011853/v1/13d33f1eb71e6e0622950bfb.png"},{"id":86152074,"identity":"c5b75e29-9149-4836-9e26-58653ec0e693","added_by":"auto","created_at":"2025-07-07 10:17:34","extension":"png","order_by":13,"title":"Figure 13","display":"","copyAsset":false,"role":"figure","size":100325,"visible":true,"origin":"","legend":"\u003cp\u003eRT-PCR analysis of SASP and senescence-associated gene expression in A549 cells. A549 cells were treated with 1/20th IC₅₀ 5-FU alone (control) or in combination with Q100 or H100 for 5 days. Lane 1 – 5-FU (4.2μM); Lane 2 – HDN (100μM); Lane 3 – QCT (100μM). Gel electrophoresis shows amplification products of selected genes, normalized to GAPDH\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"13.png","url":"https://assets-eu.researchsquare.com/files/rs-7011853/v1/6af2f73141ae51ceebb44004.png"},{"id":86152081,"identity":"a78ce6a2-f9a5-4ac5-9925-ee4521f55808","added_by":"auto","created_at":"2025-07-07 10:17:34","extension":"png","order_by":14,"title":"Figure 14","display":"","copyAsset":false,"role":"figure","size":21361,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDensitometric quantification of SASP gene expression in A549 cells.\u003c/strong\u003e\u003cbr\u003e\nBar graph representing fold changes in gene expression (IL-6, IL-8, MMP3, E-cadherin, p21, p16, and p53) relative to the 5-FU–treated control. HDN and QCT groups show differential suppression of SASP markers, with HDN exhibiting a stronger regulatory effect on p53 and other senescence-associated genes.\u003c/p\u003e","description":"","filename":"14.png","url":"https://assets-eu.researchsquare.com/files/rs-7011853/v1/9d5824707ccb7ad93a8dc4c3.png"},{"id":88814216,"identity":"bfbe2ba9-18d5-439b-a652-5a44d1820141","added_by":"auto","created_at":"2025-08-11 16:08:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3906453,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7011853/v1/c8dce38b-9405-4e93-bab6-a7142d15065a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Modulating SASP-Driven Paracrine Effects to Overcome Therapy-Induced Senescence: Senolytic Role of Hesperidin and Quercetin in A549 Lung Cancer Cells","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eCancer remains a major global health burden, with incidence rates projected to reach 23.6\u0026nbsp;million new cases by 2030 (Sung et al., 2024). Chemotherapy remains a cornerstone of treatment for advanced and metastatic cancers; however, it is limited by systemic toxicity, tumour heterogeneity, and the emergence of resistance (Ewald et al., 2010). Chemotherapeutic agents like 5-fluorouracil (5-FU) exert their effects by inducing cellular damage, which may lead to apoptosis, necrosis, or\u0026mdash;in cases of sublethal stress\u0026mdash;a third outcome: cellular senescence.\u003c/p\u003e \u003cp\u003eCellular senescence is a stable form of growth arrest triggered by diverse stressors, including DNA damage, oxidative stress, oncogenic activation, and cytotoxic therapy. Despite differing origins, all senescence subtypes\u0026mdash;including therapy-induced senescence (TIS)\u0026mdash;converge on cell cycle arrest (Cuollo et al., 202; Salama et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Senescence is primarily mediated by the p53/p21\u003csup\u003eCIP1\u003c/sup\u003e and p16\u003csup\u003eINK4a/Rb\u003c/sup\u003e tumor suppressor pathways, which regulate the G1/S transition by inhibiting cyclin-dependent kinases (Vousden \u0026amp; Lane, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Sharpless \u0026amp; Sherr, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Although TIS offers initial therapeutic benefit by halting tumor growth, emerging evidence shows that senescent cancer cells can persist, acquire a pro-inflammatory secretory profile known as the senescence-associated secretory phenotype (SASP), and promote therapy resistance, tumor progression, and relapse (Hernandez-Segura et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Wiley et al., 2017; Copp\u0026eacute; et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePersistent senescent cells have been detected in lung, breast, and colorectal tumours following treatment with agents such as 5-FU and doxorubicin (te Poele et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Ohtani et al., 2010). Notably, 5-FU induces TIS in both cancerous and non-cancerous cells, characterized by increased SA-β-gal activity, upregulation of senescence markers (p16, p21), and secretion of pro-tumorigenic SASP factors like IL-6 and IL-8 (Orjalo et al.,b 2009; Altieri et al., 2022; Focaccetti et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In A549 lung cancer cells, TIS has been shown to enhance migratory and invasive potential through SASP-mediated paracrine signalling. Therefore, therapeutic strategies that eliminate senescent cells (senolytics) or suppress the SASP (senomorphics) are being explored as adjuncts to standard therapy (Kirkland \u0026amp; Tchkonia, 2017). Moreover, persistent SASP signalling following 5-FU treatment in lung cancers has been linked to increased tumor regrowth, highlighting the need to mitigate these paracrine effects through senolytics or SASP-targeted interventions (Krtolica et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). As such, modulating the senescence response\u0026mdash;particularly the SASP\u0026mdash;represents a critical target for overcoming 5-FU\u0026ndash;induced chemoresistance and improving therapeutic outcomes.\u003c/p\u003e \u003cp\u003eOngoing researches highlights the potential of polyphenols\u0026mdash;naturally occurring compounds in fruits and vegetables\u0026mdash;to modulate cellular senescence due to their antioxidant, anti-inflammatory, and signalling pathway-modulating properties. Several natural compounds have emerged as promising senolytics or senomorphics. Flavonoids, in particular, demonstrate strong senescence-regulating effects with low toxicity, making them attractive candidates for cancer senotherapy. A diverse array of dietary polyphenols have emerged as promising senotherapeutic agents with either senomorphic or senolytic activity (Della Vedova et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Compounds such as resveratrol, kaempferol, apigenin, genistein, luteolin, rutin, oleuropein aglycone, hydroxytyrosol, and pterostilbene primarily function as senomorphics by suppressing the SASP and mitigating oxidative stress and inflammation \u003cem\u003evia\u003c/em\u003e key signalling pathways including SIRT1, Nrf2, NF-κB, FOXO, and cGAS/STING. These agents attenuate senescence-related phenotypes without inducing cell death, thereby preserving tissue homeostasis. In contrast, polyphenols like fisetin, EGCG, procyanidin C1, curcumin (and its analog EF24), wogonin, piperlongumine, and the combination of quercetin with dasatinib exhibit senolytic properties by selectively inducing apoptosis in senescent cells through modulation of apoptotic regulators (e.g., Bcl-2, Bax), mitochondrial dysfunction, ROS generation, and autophagic pathways. Notably, several of these compounds such as fisetin and quercetin-dasatinib have advanced into clinical trials for age-related diseases, underscoring their translational relevance.\u003c/p\u003e \u003cp\u003eThis study evaluates the senolytic and SASP-modulating potential of hesperidin (HDN) and quercetin (QCT) in a model of 5-FU-induced TIS in A549 lung adenocarcinoma cells. We investigated their effects on senescence markers (p16, p21, p53) and SASP components (IL-6, IL-8, MMP3, E-cadherin) within a SASP-conditioned medium co-culture system to mimic the tumor microenvironment. Our findings aim to inform combinatorial treatment strategies that mitigate TIS-mediated chemoresistance and tumor relapse.\u003c/p\u003e"},{"header":"2. Materials and method","content":"\u003cp\u003e \u003cb\u003e21. Reagents\u003c/b\u003e \u003c/p\u003e \u003cp\u003e5-Fluorouracil (5-FU; HiMedia Laboratories Pvt. Ltd., India) was dissolved in dimethyl sulfoxide (DMSO; HiMedia) to prepare a 100mM stock solution and stored at \u0026minus;\u0026thinsp;20\u0026deg;C until use. Quercetin dihydrate (QCT; purity\u0026thinsp;\u0026ge;\u0026thinsp;98%; Sisco Research Laboratories Pvt. Ltd., India) and hesperidin (HDN; purity\u0026thinsp;\u0026ge;\u0026thinsp;98%; Sigma-Aldrich, St. Louis, MO, USA) were similarly dissolved in DMSO at 100mM and stored under the same conditions. Working solution of compounds were obtained by diluting in culture medium to the desired concentrations immediately before use, ensuring that the final DMSO concentration did not exceed 0.1% (v/v) in any experiment. All chemicals and reagents used were of tissue culture grade.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Cell Culture\u003c/h2\u003e \u003cp\u003eThe human lung adenocarcinoma cell line A549 was procured from the National Centre for Cell Science (NCCS), Pune, India. Cells were cultured in Ham\u0026rsquo;s F-12K medium (Kaighn\u0026rsquo;s Modification; HiMedia Laboratories Pvt. Ltd., India), supplemented with 10% fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific, USA), 50 U/mL penicillin-streptomycin, and amphotericin B (HiMedia Laboratories Pvt. Ltd., India). Cultures were maintained at 37\u0026deg;C in a humidified incubator with 5% CO₂.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.3. \u003cem\u003eIn vitro\u003c/em\u003e Cytotoxicity Assay\u003c/h2\u003e \u003cp\u003eCytotoxicity was assessed using the MTT assay, as described by Mosmann (1983). Briefly, 5 \u0026times; 10\u0026sup3; cells/well were seeded into 96-well plates in 100\u0026micro;L of complete medium. After 24 hours of incubation, cells were treated with 5-FU at various concentrations (20\u0026ndash;100\u0026micro;M) for 48 hours. Subsequently, 0.5 mg/mL MTT reagent was added to each well and incubated for 4 hours. The resulting formazan crystals were solubilized using 100% DMSO, and absorbance was measured at 570 nm using a microplate reader. Cytotoxicity (%) was calculated using the formula: [Ac \u0026ndash; At/Ac] \u0026times; 100; Ac: control group absorbance; At: treatment group absorbance.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Sublethal Concentration\u003c/h2\u003e \u003cp\u003eSublethal concentrations of 5-FU, required to induce TIS, were determined based on the method described by Salunke et al. (2022). Following IC₅₀ determination \u003cem\u003evia\u003c/em\u003e the MTT assay, sublethal doses were calculated as 1/20th, 1/15th, 1/10th, and 1/5th of the IC₅₀ concentration.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Evaluation of Senescence-Inducing Concentration\u003c/h2\u003e \u003cp\u003eTo determine the optimal sublethal concentration of 5-FU that induces senescence without causing significant cytotoxicity X-gal staining was performed (Dimri et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e1995\u003c/span\u003e). 1 \u0026times; 10⁵ A549 cells were seeded in 12-well plates and treated with 1/20th, 1/15th, 1/10th, and 1/5th fractions of the IC₅₀ concentration of 5-FU. Cells were incubated for 5 days, during which morphological changes characteristic of senescence\u0026mdash;such as cellular enlargement, flattening, reduced proliferation, and increased granularity\u0026mdash;were monitored under an inverted phase contrast microscope. Following incubation, cells were washed with PBS, fixed with 4% paraformaldehyde for 15 minutes at room temperature, and washed again to remove residual fixative. Then, 300 \u0026micro;L of freshly prepared X-gal staining solution was added to each well. Plates were incubated overnight (16 h) at 37\u0026deg;C, in the absence of CO₂ and protected from light. The following day, senescent cells\u0026mdash;identified by blue X-gal staining\u0026mdash;were visualized and photographed using a phase contrast microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Collection of SASP-Conditioned Media\u003c/h2\u003e \u003cp\u003eSASP-conditioned media (SASP-CM) was collected from senescent A549 cells following the protocol by Rodier et al. (2012). Briefly, 7.5 \u0026times; 10⁵ A549 cells were seeded in 100 mm culture dishes and treated with 1/5th of the IC₅₀ concentration of 5-FU for 48 hours to induce senescence. Following treatment, cells were washed twice with 1X PBS (pH 7.4) and cultured in fresh complete medium for 5\u0026ndash;7 days to allow the development of senescent morphology. Once senescence was morphologically confirmed, the medium was replaced with 6 mL of low-serum medium and incubated for an additional 48 hours to allow SASP factor accumulation. The conditioned media were then collected, centrifuged at 2000 rpm for 4 minutes to remove cellular debris, and passed through a 0.22 \u0026micro;m syringe filter to ensure sterility. The resulting SASP-CM was either used immediately or stored at \u0026minus;\u0026thinsp;80\u0026deg;C for later use.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Evaluation of Chemoresistance and Chemosensitization\u003c/h2\u003e \u003cp\u003eTo assess the paracrine influence of SASP-CM on chemoresistance and the potential chemosensitizing effects of flavonoids, the IC₅₀ shift of 5-FU was evaluated using the MTT assay, as described in Section \u003cspan refid=\"Sec4\" class=\"InternalRef\"\u003e2.3\u003c/span\u003e. For chemoresistance assessment, 5 \u0026times; 10\u0026sup3; A549 cells were seeded in 96-well plates and incubated with varying concentrations of 5-FU (20\u0026ndash;100 \u0026micro;M) prepared in SASP-CM for 48 hours. To investigate the chemosensitizing effects of HDN and QCT, 5 \u0026times; 10\u0026sup3; A549 cells seeded in 96-well plate were co-treated with SASP-CM supplemented with increasing concentrations (20\u0026ndash;100 \u0026micro;M) of either flavonoid for 48 hours. Cell viability was determined and the IC₅₀ values were calculated to evaluate the impact of SASP on chemoresistance and the potential reversal by HDN and QCT.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Cell Migration Assay\u003c/h2\u003e \u003cp\u003eTo assess the influence of HDN and QCT on A549 cell migration under SASP-CM exposure, a scratch (wound healing) assay was performed, as described by Valenzuela et al. (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). A total of 5 \u0026times; 10⁵ A549 cells were seeded in 6-well plates and incubated for 24 hours to achieve a confluent monolayer. A uniform scratch was made across the centre of each well using a sterile 200 \u0026micro;L pipette tip. Detached cells and debris were removed by rinsing the wells 2\u0026ndash;3 times with PBS. Cells were then treated with SASP-CM containing increasing concentrations of HDN or QCT (20\u0026ndash;100 \u0026micro;M). Negative control wells received complete culture medium, while positive controls were treated with SASP-CM alone. Phase contrast images of the wound area were captured at 0, 24, 48, and 72 hours using a Nikon Ti\u003cem\u003eS\u003c/em\u003e microscope. Wound closure was quantified using Nikon image analysis software, and the scratch area was measured at each time point to evaluate the effect of treatments on cell migratory capacity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Induction of Apoptosis\u003c/h2\u003e \u003cp\u003eTo assess the pro-apoptotic potential of HDN and QCT in A549 cells exposed to SASP-CM, acridine orange/ethidium bromide (AO/EB) dual staining was performed as previously described by Kasibhatla et al. (2006). A549 cells were seeded at a density of 1 \u0026times; 10⁵ cells/well in 6-well plates and incubated overnight at 37\u0026deg;C in a humidified 5% CO₂ incubator. The cells were treated with SASP-CM alone or in combination with varying concentrations of HDN or QCT (20\u0026ndash;100 \u0026micro;M) for 48 hours. Following treatment, cells were washed twice with 1X PBS, and 10 \u0026micro;L of AO/EB staining solution (1:1, each at 10 mg/mL) was added directly to the wells. Cells were then immediately observed under a fluorescence microscope using green-red emission filters. A minimum of 200 cells per sample were examined to distinguish between live, early apoptotic, late apoptotic, and necrotic cells based on differential staining. The percentage of apoptotic cells was calculated and compared across treatment groups.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Evaluation of Senolytic Effects\u003c/h2\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e2.10.1. SA-β-Galactosidase (X-gal) Staining Assay\u003c/h2\u003e \u003cp\u003eThe senolytic potential of HDN and QCT was evaluated by quantifying the proportion of SA-β-Gal-positive cells using the X-gal staining assay. A549 cells induced into senescence by treatment with 1/5th IC₅₀ 5-FU were exposed to varying concentrations of HDN and QCT (20\u0026ndash;100 \u0026micro;M), and SA-β-Gal staining was performed at 3, 5, and 7 days post-treatment to assess the optimal therapeutic window for senolytic intervention. The staining procedure was conducted as described in Section \u003cspan refid=\"Sec6\" class=\"InternalRef\"\u003e2.5\u003c/span\u003e, and the number of blue-stained cells (SA-β-Gal positive) was counted under a phase-contrast microscope to quantify the effect of each treatment.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003e2.10.2. Colony Formation Assay\u003c/h2\u003e \u003cp\u003eTo further confirm the senolytic efficacy of HDN and QCT, a colony formation assay was conducted using previously senescent A549 cells (Saleh et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Cells were seeded at a density of 1 \u0026times; 10⁵ cells/well in 24-well plates and incubated overnight at 37\u0026deg;C with 5% CO₂. Senescent populations, induced by prior exposure to 1/5th IC₅₀ 5-FU, were subsequently treated with varying concentrations of HDN and QCT for 48 hours. After treatment, plates were washed with PBS and fixed with 4% paraformaldehyde, followed by staining with 0.1% crystal violet for 30 minutes. Plates were rinsed, air-dried, and imaged. To quantify colony survival, the dye was eluted using 100% methanol, and absorbance was measured at 570 nm using a multimode plate reader. The percentage inhibition of colony formation was calculated using the formula: % Inhibition = [(Ac \u0026ndash; At)/Ac] \u0026times; 100, where Ac is the absorbance of the control (untreated senescent cells) and At is the absorbance of treated groups.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.11. SASP Gene Expression Profile\u003c/h2\u003e \u003cp\u003eTo evaluate the potential as senomorphic or senolytic impact of HDN and QCT on the expression of SASP genes, semi-quantitative RT-PCR was performed. Total RNA was extracted from A549 cells treated with SASP-conditioned media (SASP-CM), either alone or in combination with 100\u0026micro;mol HDN or QCT, using the TRIzol reagent (Thermo Fisher Scientific, USA) according to the manufacturer\u0026rsquo;s instructions. RNA concentration and purity were determined using a NanoDrop spectrophotometer, and 1 \u0026micro;g of RNA was reverse-transcribed into cDNA using a first-strand cDNA synthesis kit (PrimeScript\u0026trade; RT reagent, TaKaRa Scientifc, Japan). PCR amplification was carried out using gene-specific primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e2\u003c/span\u003e) for key SASP factors including IL-6, IL-8, MMP3, E-cadherin, senescence markers p16, p21, and p53, and housekeeping gene GAPDH. The PCR products were separated on a 2% agarose gel stained with ethidium bromide and visualized using a gel documentation system (ChemiDoc\u0026trade; XRS\u0026thinsp;+\u0026thinsp;System, Bio-Rad, USA). Band intensities were quantified by densitometric analysis using ImageJ software (NIH, USA). The relative expression of target genes was normalized to GAPDH and expressed as fold change over control.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of primers for gene expression analysis\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS. No.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAccession No.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGene Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eForward Primer\u003c/p\u003e \u003cp\u003e(5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReverse Primer\u003c/p\u003e \u003cp\u003e(3\u0026rsquo;-5\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAmplicon Size (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXM_005249745.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eACTCACCTCTTCAGAACGAATTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCCATCTTTGGAAGGTTCAGGTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e149\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_000584.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIL-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTTTTGCCAAGGAGTGCTAAAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAACCCTCTGCACCCAGTTTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e194\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXM_054361701.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ep16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCACGGCCGCGGCCCGGGGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGGCCCGGTGCAGCACACCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e250\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_001374509.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ep21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGATGGAACTTCGACTTTGTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGCACAAGGGTACAAGACAGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e220\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_001276761.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ep53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTTCCCTGGATTGGCCAGACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eACCATCGCTATCTGAGCAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e599\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_002422.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMMP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eACATGGAGACTTTGTCCCTTTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTTGGCTGAGTGGTAGAGTCCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e192\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_001317185.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eE-cadherin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTACACTGCCCAGGAGCCAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTGGCACCAGTGTCCGGATTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e103\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_002046.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGAAGGTGAAGGTCGGAGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGAAGATGGTGATGGGATTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e226\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003e3.1. SASP-CM Exposure Induces Chemoresistance to 5-FU in A549 Cells\u003c/h2\u003e\n \u003cp\u003eTo evaluate whether the secretory profile of TIS cells could influence 5-FU sensitivity in a paracrine manner, A549 cells were cultured in either normal complete medium or SASP-CM and exposed to increasing concentrations of 5-FU for 48 hours. Cell viability was assessed using the MTT assay. As shown in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e, cells cultured in normal medium exhibited a dose-dependent decrease in viability, with an IC₅₀ of 85.93 \u0026micro;M. In contrast, cells cultured in SASP-CM showed significantly higher survival across all tested concentrations of 5-FU, with a rightward shift in the dose-response curve and an increased IC₅₀ of 152.26 \u0026micro;M, indicating reduced sensitivity to 5-FU.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003e3.2 Determination of Sublethal Concentrations of 5-FU\u003c/h2\u003e\n \u003cp\u003eTo identify appropriate sublethal concentrations for evaluating TIS, the IC₅₀ of 5-fluorouracil (5-FU) in A549 lung carcinoma cells was first established. The IC₅₀ value, determined through dose\u0026ndash;response analysis, was found to be 86 \u0026micro;mol. Based on this, sublethal concentrations were calculated as fractions of the IC₅₀: specifically, 1/20th (4.2 \u0026micro;mol), 1/15th (5.7 \u0026micro;mol), 1/10th (8.5 \u0026micro;mol), and 1/5th (17.2 \u0026micro;mol). These concentrations were selected for subsequent experiments to investigate their potential to induce a senescent phenotype without causing excessive cytotoxicity.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n \u003ch2\u003e3.3 Evaluation of Senescence Induction by Sublethal 5-FU Treatment\u003c/h2\u003e\n \u003cp\u003eTo determine the senescence-inducing potential of 5-FU, A549 cells were treated with sublethal concentrations for 7 days. Senescence was assessed using senescence-associated \u0026beta;-galactosidase (SA-\u0026beta;-gal) activity \u003cem\u003evia\u003c/em\u003e X-Gal staining and nuclear morphology \u003cem\u003evia\u003c/em\u003e DAPI staining \u003cstrong\u003e(Fig.\u0026nbsp;2A\u0026ndash;B).\u003c/strong\u003e X-Gal staining revealed minimal senescence in cells treated with higher concentrations of 5-FU (IC₅₀, 1/5th, 1/10th, and 1/15th of IC₅₀), as indicated by limited blue staining. In contrast, treatment with the lowest dose (1/20th of IC₅₀; 4.2 \u0026micro;mol) resulted in a pronounced increase in SA-\u0026beta;-gal-positive cells, with visible senescence-associated morphological features such as cell flattening, increased granularity, and enlarged size. Subsequent DAPI staining was used to distinguish between apoptotic and senescent nuclear changes. Untreated control cells displayed uniformly shaped nuclei, while IC₅₀-treated cells exhibited nuclear condensation and fragmentation characteristic of apoptosis. Conversely, cells treated with the 1/20th IC₅₀ dose showed enlarged, irregular nuclei with diffuse DAPI staining, consistent with senescence-associated nuclear morphology. These findings indicate a concentration-dependent divergence in cellular response to 5-FU: higher doses primarily induce apoptosis, whereas lower sublethal doses trigger a robust senescence phenotype. Based on these results, 4.2 \u0026micro;mol (1/20th IC₅₀) was selected for downstream analysis of TIS.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n \u003ch2\u003e3.4 Quantification of SA-\u0026beta;-gal\u0026ndash;Positive Senescent Cells\u003c/h2\u003e\n \u003cp\u003eTo quantify the extent of senescence induction by 5-FU, the number of SA-\u0026beta;-gal\u0026ndash;positive (blue-stained) cells was counted following X-Gal staining after 7 days of treatment. Counts were performed across multiple fields under bright-field microscopy, and the total number of cells per group at 800. The percentage of SA-\u0026beta;-gal\u0026ndash;positive cells was calculated for each treatment condition. As shown in Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e and Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, the control group exhibited minimal basal senescence (1.5%), whereas 5-FU treatment induced a dose-dependent increase in SA-\u0026beta;-gal\u0026ndash;positive cells. Notably, the 1/20th IC₅₀ concentration (4.2 \u0026micro;mol) resulted in a pronounced elevation of senescent cells (59%), significantly higher than all other groups (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Intermediate doses (1/15th and 1/10th IC₅₀) induced moderate senescence (25% and 17.9%, respectively), while higher concentrations (IC₅₀ and 1/5th IC₅₀) showed only modest increases (8.4% and 10.1%, respectively), likely reflecting a shift toward apoptosis rather than senescence at cytotoxic levels. These findings confirm that 5-FU induces maximal senescence at the lowest sublethal dose (1/20th IC₅₀), consistent with the morphological observations described in previous section.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eQuantification of SA-\u0026beta;-gal-positive (blue-stained) cells in A549 populations following 5-FU treatment.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTreatment Group\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eConcentration of 5FU\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSA-\u0026beta;-gal\u0026thinsp;+\u0026thinsp;Cells (n)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e% Senescent Cells\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eControl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNo treatment\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.5%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eIC₅₀\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e86 \u0026micro;mol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e8.4%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1/5th of IC₅₀\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e17.2 \u0026micro;mol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e81\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e10.1%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1/10th of IC₅₀\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8.6 \u0026micro;mol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e143\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e17.9%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1/15th of IC₅₀\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.7 \u0026micro;mol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e200\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e25.0%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1/20th of IC₅₀\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.2 \u0026micro;mol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e472\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e59.0%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n \u003ch2\u003e3.5. Chemosensitization of A549 Cells by QCT and HDN\u003c/h2\u003e\n \u003cp\u003eTo investigate whether QCT and HDN could reverse SASP-CM\u0026ndash;induced chemoresistance, A549 cells were treated with increasing concentrations (20\u0026ndash;100 \u0026micro;mol) of QCT or HDN in the presence of SASP-CM, and cell viability was assessed using the MTT assay. As shown in Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, both compounds induced a concentration-dependent increase in cell death. At lower concentrations (20 and 40 \u0026micro;mol), cytotoxic effects were minimal. However, at higher concentrations (80 and 100 \u0026micro;mol), a significant increase in cell death was observed (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 to \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Across all concentrations, HDN exhibited a stronger cytotoxic effect compared to QCT, suggesting a more potent chemosensitizing capacity. These results indicate that both QCT and HDN can enhance the susceptibility of SASP-CM\u0026ndash;conditioned A549 cells to cytotoxic stress, with HDN demonstrating superior efficacy. This suggests their potential utility in overcoming senescence-associated drug resistance.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n \u003ch2\u003e3.7. Scratch (wound) healing assay\u003c/h2\u003e\n \u003cp\u003eTo assess the effect of HDN and QCT on cell migration, a scratch healing assay was performed in A549 cells under SASP-CM exposure. Cells were first cultured to form a confluent monolayer, scratched to generate a cell-free area, and then treated with 1/20th IC₅₀ of 5-FU in combination with increasing concentrations of HDN or QCT. As shown in Figs. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e and \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e, untreated SASP-CM\u0026ndash;exposed cells exhibited enhanced wound closure, with near-complete migration into the scratch zone by 72 hours, indicating that paracrine factors from senescent cells promote migratory behaviour. In contrast, treatment with HDN or QCT significantly impaired wound closure in a concentration-dependent manner. Higher concentrations (80 and 100 \u0026micro;mol) of both compounds were particularly effective in inhibiting migration, resulting in visibly larger unhealed wound areas at 72 hours. This anti-migratory effect may be attributable to the pro-apoptotic or anti-proliferative actions of HDN and QCT under SASP-CM influence. Quantitative analysis of wound closure distances confirmed these observations. Treatment with HDN (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eA) and QCT (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eB) significantly reduced migration compared to SASP-CM control conditions. Notably, 100 \u0026micro;mol concentrations of both compounds exhibited the strongest inhibition (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), suggesting that HDN and QCT can effectively suppress SASP-mediated migratory responses in A549 cells. These findings indicate that while SASP-CM enhances A549 cell migration, treatment with flavonoids such as HDN and QCT can counteract this effect, thereby offering potential anti-metastatic benefits.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\n \u003ch2\u003e3.8 Induction of Apoptosis Assessed by AO/EB Staining\u003c/h2\u003e\n \u003cp\u003eTo determine the mode of cell death and evaluate the senolytic potential of HDN and QCT, A549 cells were subjected to AO/EB dual staining following a 5-day treatment with 5-FU, HDN, or QCT under SASP-CM exposure. Acridine orange penetrates all cells and stains nuclei green, whereas ethidium bromide only enters non-viable cells, emitting orange or red fluorescence that distinguishes early and late apoptotic/necrotic stages, respectively. Untreated control cells exhibited uniform green fluorescence and intact nuclear morphology, indicative of viable and healthy cells (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e). Conversely, cells treated with the IC₅₀ concentration of 5-FU demonstrated prominent orange to red fluorescence, with marked nuclear condensation and fragmentation\u0026mdash;hallmarks of late apoptosis and necrosis. Sublethal 5-FU (1/20th IC₅₀) alone or in combination with increasing concentrations of HDN or QCT revealed distinct apoptotic profiles. Quantitative analysis (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e) showed that HDN induced a dose-dependent increase in apoptotic/necrotic cell populations. At 20, 40, and 60 \u0026micro;M HDN, only minor increases in cell death were observed (8%, 10%, and 14%, respectively), whereas 80 \u0026micro;M and 100 \u0026micro;M treatments led to significant elevations in apoptosis, with 38% and 65% apoptotic/necrotic cells, respectively. Morphological changes were consistent with late apoptosis at these higher concentrations. In contrast, QCT-treated cells exhibited a more moderate apoptotic response. At 20\u0026ndash;60 \u0026micro;M, the majority of cells remained viable with predominantly green fluorescence, and apoptotic percentages remained low (6\u0026ndash;11%). At 80 \u0026micro;M and 100 \u0026micro;M, there was a mild increase in red fluorescence and nuclear condensation, with apoptotic/necrotic cell populations reaching 18% and 29%, respectively\u0026mdash;considerably lower than those observed in HDN-treated cells at equivalent concentrations. These findings confirm that HDN possesses a more potent pro-apoptotic and senolytic effect on A549 cells under SASP-CM conditions than QCT. The differential apoptotic induction suggests that HDN is more effective in overcoming SASP-mediated survival signals, making it a promising candidate for senescence-targeted therapy in chemoresistant lung cancer.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec23\" class=\"Section2\"\u003e\n \u003ch2\u003e3.9. X-Gal Staining to Assess Senolytic Activity\u003c/h2\u003e\n \u003cp\u003eTo evaluate the senolytic potential of QCT and HDN, A549 cells were first induced into a senescent state using 1/20th IC₅₀ concentration of 5-FU. Senescence was confirmed via SA-\u0026beta;-galactosidase (X-Gal) staining, and treatments with QCT and HDN were carried out at concentrations ranging from 20 to 100 \u0026micro;mol over 3, 5, and 7 days. X-Gal staining demonstrated a progressive increase in senescent cell burden over time in the 5-FU\u0026ndash;treated group, with minimal staining at day 3, moderate accumulation by day 5, and a peak in SA-\u0026beta;-gal positivity at day 7. Control cells remained negative for SA-\u0026beta;-gal staining throughout the observation period, confirming the specificity of 5-FU in inducing TIS. Treatment with HDN (Fig. \u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003e) and QCT (Fig. \u003cspan class=\"InternalRef\"\u003e11\u003c/span\u003e) resulted in a clear reduction in the number of blue-stained, senescent cells. This effect was concentration-dependent and was more prominent at day 5, suggesting effective senolytic activity. Notably, the highest concentrations of both compounds (80 and 100 \u0026micro;mol) led to substantial clearance of SA-\u0026beta;-gal\u0026ndash;positive cells by day 5. Interestingly, the senolytic effect was somewhat attenuated by day 7, potentially due to either recovery of remaining viable senescent cells or adaptive resistance mechanisms. Overall, both QCT and HDN demonstrated significant senolytic activity in the TIS model. HDN appeared slightly more potent at higher concentrations, while QCT showed broader efficacy across mid-range doses. These results suggest that both flavonoids hold promise as senolytic agents capable of targeting therapy-induced senescent cells in lung cancer models.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\n \u003ch2\u003e\u003cstrong\u003e3.10. Colony Formation Assay\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eTo further evaluate the senolytic efficacy of QCT and HDN, a crystal violet colony formation assay was performed following senescence induction. A549 cells were initially rendered senescent via treatment with 1/20th IC₅₀ 5-FU. Post-senescence, cells were exposed to increasing concentrations (20\u0026ndash;100 \u0026micro;mol) of QCT and HDN for 48 hours. Cell viability was assessed by 0.5% crystal violet staining, which marks adherent and viable cells. As shown in Fig. \u003cspan class=\"InternalRef\"\u003e12\u003c/span\u003eA, senescent A549 cells treated with QCT or HDN exhibited a dose-dependent reduction in crystal violet staining, indicative of decreased viability and cell number. This cytotoxic effect was specific to senescent cells, as control (non-senescent) cells treated with the same concentrations of QCT and HDN displayed minimal change in colony density or staining intensity. Notably, higher concentrations (80 and 100 \u0026micro;mol) of both compounds induced a pronounced decrease in viable senescent colonies, consistent with senolytic activity. Quantitative analysis was performed by solubilizing the stained cells in 100% methanol and measuring absorbance at 570 nm (Fig. \u003cspan class=\"InternalRef\"\u003e12\u003c/span\u003eB). Senescent cells maintained in SASP-CM and treated only with 5-FU (1/20th IC₅₀) exhibited enhanced survival and proliferation relative to untreated controls, as evidenced by elevated absorbance values. However, treatment with QCT or HDN significantly decreased absorbance in a concentration-dependent manner, confirming their senolytic potency. These findings further validate that both QCT and HDN selectively eliminate senescent cells while sparing non-senescent populations, reinforcing their therapeutic potential in senescence-targeted strategies.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec25\" class=\"Section2\"\u003e\n \u003ch2\u003e3.11. Gene expression analysis of SASP markers\u003c/h2\u003e\n \u003cp\u003eTo investigate the transcriptional changes associated with TIS and the senolytic potential of HDN and QCT, RT-PCR was performed to assess the expression of key SASP factors and senescence-associated genes in A549 cells (Figs. 13 \u0026amp; \u003cspan class=\"InternalRef\"\u003e14\u003c/span\u003e). Cells were treated with 1/20th IC₅₀ 5-FU alone or in combination with 100 \u0026micro;M HDN (H100) or quercetin (Q100) for 5 days. The expression of IL-6, IL-8, MMP3, E-cadherin, p21, p16, and p53 was evaluated. Treatment with 5-FU alone significantly upregulated SASP-related inflammatory cytokines (IL-6, IL-8) and canonical senescence markers (p21, p16, MMP3, and E-cadherin), confirming successful induction of the senescent phenotype. Co-treatment with HDN (H100) resulted in a marked downregulation of all SASP markers, including a pronounced suppression of p21, p16, and MMP3, alongside a strong\u0026thinsp;~\u0026thinsp;5-fold increase in p53 expression. This suggests HDN promotes apoptosis while attenuating the inflammatory and pro-invasive features of SASP. Interestingly, E-cadherin expression was also significantly reduced in the HDN group, potentially indicating loss of epithelial integrity or reduced cell-cell adhesion in the remaining cell population. In comparison, QCT (Q100) co-treatment also reduced SASP gene expression but to a lesser extent. While moderate decreases in p21, p16, and MMP3 were observed, p53 expression remained largely unchanged, suggesting a comparatively weaker pro-apoptotic and senolytic effect. These results indicate that both flavonoids modulate the SASP transcriptional program induced by sublethal 5-FU treatment, with HDN demonstrating a superior capacity to suppress SASP markers and promote apoptotic gene signatures.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eTIS is a key cellular response following chemotherapeutic stress, characterized by cell cycle arrest, morphological changes, and secretion of pro-inflammatory cytokines, collectively known as the SASP. The activation of cellular senescence can play dual roles\u0026mdash;offering advantages such as tissue repair and remodelling, while also contributing to negative outcomes like cancer progression when senescent cells persist (Hernandez-Segura et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Rodier et al, 2011). The persistence of TIS cells following cancer treatment has been increasingly recognized as a contributor to tumour relapse and chemoresistance. Consequently, selectively eliminating these senescent cells has emerged as a promising approach to enhance treatment efficacy and prevent cancer progression.\u003c/p\u003e \u003cp\u003eAmong natural agents, QCT, a dietary flavonol, was one of the first senolytics shown to act on senescent endothelial and bone marrow-derived mesenchymal stem cells. However, its efficacy is significantly enhanced when combined with the tyrosine kinase inhibitor dasatinib, giving a synergistic disruption of anti-apoptotic pathways and caspase activation (Zhu et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Despite its therapeutic potential, QCT suffers from poor solubility and low bioavailability, which have been improved by using advanced delivery systems like lipid carriers and nanoparticles. In a study by Lewińska et al (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), three structurally modified QCT derivatives (QD1\u0026ndash;QD3) were synthesized, with QD3\u0026mdash;bearing full acetylation\u0026mdash;exhibiting the most potent senolytic effect in etoposide-induced senescent HMEC and MDA-MB-231 cells by promoting apoptosis and suppressing SASP and HSP70 expression.\u003c/p\u003e \u003cp\u003eIn the present study, we utilised HDN, a citrus flavanone glycoside and QCT, a well-established senolytic. HDN is widely studied for its antioxidant, anti-inflammatory, and cytoprotective properties. Structurally, HDN consists of the aglycone hesperetin linked to a disaccharide rutinose moiety, which significantly influences its solubility and biological activity (Erlund, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Despite these pharmacokinetic limitations, HDN itself has demonstrated significant therapeutic potential. Notably, emerging evidence suggests that HDN may modulate DNA damage response pathways. It has been shown to sensitize various cancer cell lines to genotoxic agents by interfering with key DDR regulators such as ATM, ATR, and Chk1/Chk2 kinases, thereby impairing repair of DNA double-strand breaks and promoting apoptosis (Aggarwal et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Such findings point to HDN not only as a systemic antioxidant but also as a promising adjuvant for cancer therapy by targeting DNA repair mechanisms. Moreover, its ability to suppress oxidative stress-related pathways may synergize with DDR inhibition to enhance anti-tumour efficacy.\u003c/p\u003e \u003cp\u003eThis study demonstrates the senolytic capabilities of HDN and QCT in countering TIS\u0026ndash;associated 5-FU chemoresistance in A549 lung carcinoma cells. We induced senescence using a sublethal dose of 5‑FU at 1/20th IC₅₀ (4.2 \u0026micro;M), resulting in classic senescence hallmarks, including increased SA‑β‑gal activity, flattened morphology, and enlarged nuclei. Notably, higher 5‑FU concentrations triggered apoptosis\u0026mdash;evidenced by nuclear condensation and decreased SA‑β‑gal staining\u0026mdash;confirming a dose-dependent divergence between apoptosis and senescence (Demaria et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Kumar \u0026amp; Diekman, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Approximately 60% of cells displayed SA‑β‑gal positivity at 4.2 \u0026micro;M 5‑FU, validating the reliability of this concentration for modelling TIS. Similar findings have been reported by De Angelis et al. (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2006\u003c/span\u003e), Focaceti et al. (2015), and Bai et al. (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), where treatment with 5-FU at varying concentrations and durations\u0026mdash;770 \u0026micro;M for 24 hours, 10\u0026ndash;1000 \u0026micro;M for 72 hours, and 1 \u0026micro;M for 4 days, respectively\u0026mdash;successfully induced TIS in HCT116 cells. Consistent with prior reports, we observed that low-dose 5-FU (1/20th IC₅₀) preferentially induced senescence, as evidenced by elevated SA-β-gal activity, characteristic morphological alterations, and upregulation of canonical senescence markers (p21, p16, MMP3, and IL-6) (Vousden \u0026amp; Prives, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Kuilman \u0026amp; Peeper, 2009). The pro-senescent effect of low-dose chemotherapy has been highlighted as a double-edged sword: while initially cytostatic, TIS may promote tumor progression through SASP-driven inflammation and remodelling (Copp\u0026eacute; et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Milanovic et al., 2018).\u003c/p\u003e \u003cp\u003eNotably, A549 cells exposed to SASP-CM derived from 5-FU\u0026ndash;induced senescent cells showed enhanced resistance to 5-FU, with the IC₅₀ increasing from 86 \u0026micro;M to 152 \u0026micro;M. This observation reinforces the role of SASP factors\u0026mdash;such as IL-6 and IL-8\u0026mdash;in driving chemoresistance, promoting proliferation of adjacent tumor cells, and inducing EMT (Boccardi \u0026amp; Mecocci., 2021). Supporting the paracrine influence of SASP, Altieri et al. (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) demonstrated that 5-FU or sera from capecitabine-treated (a prodrug of 5-FU) patients could induce senescence in EA.hy926 endothelial cells, suggesting that 5-FU\u0026ndash;induced SASP may contribute to systemic and tumour microenvironment\u0026ndash;mediated resistance. Though cellular senescence prevents malignancy during early tumorigenesis, cell cycle arrest and metabolic reprogramming activates the SASP.\u003c/p\u003e \u003cp\u003eSASP components can either support immune surveillance or, in later tumour stages, promote malignancy through EMT induction, angiogenesis, and immune evasion (Yuan et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). \u003cem\u003eIn vivo\u003c/em\u003e models show that senescent cells contribute to tissue repair and developmental remodelling, with key markers such as p16 and p21 elevated in the tissues. Upon treatment with QCT and HDN in the presence of SASP-CM, we observed concentration-dependent reductions in cell viability, with HDN showing greater potency. In scratch assay, both flavonoids significantly impaired A549 cell migration under SASP conditions, especially at higher doses (80\u0026ndash;100 \u0026micro;M), suggesting inhibition of SASP-driven EMT and metastatic behaviour (Valenzuela et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). These findings are consistent with evidence that senotherapeutic agents can disrupt SASP-mediated migration pathways (Xu et al., 2016; Boccardi \u0026amp; Mecocci., 2021). Additionally, AO/EB staining revealed elevated apoptosis and necrosis after flavonoid treatment, with HDN producing strong late-apoptotic signals\u0026mdash;supporting its senolytic efficacy. The superior efficacy of HDN over QCT in inducing apoptosis, as reflected by AO/EB staining and increased p53 expression, points toward its stronger senolytic potential. p53 activation is a known mediator of apoptosis in senescent and stressed cells (Vousden \u0026amp; Prives, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). The observed downregulation of SASP factors by HDN, particularly IL-6, IL-8, and MMP3, further supports its dual anti-inflammatory and senolytic action, potentially limiting the tumor-promoting effects of SASP (Faget et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe colony formation and X-Gal staining assays confirm the capacity of both flavonoids to selectively eliminate senescent cells, sparing non-senescent populations. QCT and HDN both significantly reduced SA‑β‑gal positivity\u0026mdash;particularly by day 5\u0026mdash;while crystal violet staining demonstrated decreased colony density in treated cultures, indicating successful clearance of senescent cells. This is based on the concept of a senescence \u0026rarr; senolysis or \u0026ldquo;the one\u0026ndash;two punch\u0026rdquo; strategy for robust tumour cell elimination (Escriche-Navarro et al., 2025). Similar results have been observed in a study by Saleh et al., (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) where exposure of senescent A549 cells to ABT-263 led to a marked reduction in SA-β-gal-positive populations, confirming its targeted action against senescent phenotypes. Notably, ABT-263 induced significant apoptotic cell death\u0026mdash;as evidenced by increased Annexin-V/PI staining, and the cleavage of PARP and caspase-3\u0026mdash;in cells rendered senescent by etoposide, doxorubicin, or ionizing radiation, but not in untreated controls. Also this selective cytotoxicity aligns with the growing interest in senolytic therapies as adjuncts to standard cancer treatment (Kirkland \u0026amp; Tchkonia, 2017; Short et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). But the attenuation of senolytic effects by day 7 may reflect adaptive resistance mechanisms or survival of a more resistant senescent subpopulation, warranting further investigation.\u003c/p\u003e \u003cp\u003eRT‑PCR analysis showed that 5‑FU\u0026ndash;induced senescence elevated SASP components (IL‑6, IL‑8, MMP3) and senescence biomarkers p21 and p16\u0026mdash;consistent with activation of the p53/p21 and p16/Rb pathways (Coppe et al., 2008). Notably, co‑treatment with HDN suppressed these SASP markers and markedly increased p53 expression, indicating a shift towards apoptosis and senescence escape. While QCT also reduced SASP gene expression, its impact was less pronounced and lacked significant p53 activation. These results position HDN as a highly effective anticancer senolytic agent.\u003c/p\u003e \u003cp\u003eIn summary, HDN significantly outperformed QCT in overcoming SASP-mediated chemoresistance, inhibiting migration, and selectively eliminating senescent tumor cells. This flavonoid holds considerable promise for refining chemotherapeutic approaches by neutralizing the tumorigenic effects of TIS-induced SASP. Future investigations should validate these findings \u003cem\u003ein vivo\u003c/em\u003e, explore synergy with established senolytics, and further dissect the mechanistic roles of NF‑κB, TGF‑β, and Nrf2 pathways in HDN\u0026ndash;mediated senolysis. Overall, these results underscore the therapeutic potential of HDN in enhancing treatment outcomes by targeting the hidden burden of senescent cancer cells.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThis study demonstrates that HDN and QCT possess notable senolytic activity capable of mitigating TIS and associated chemoresistance in A549 lung cancer cells. By using a sublethal dose of 5-FU to induce senescence, we established a functional \u003cem\u003ein vitro\u003c/em\u003e model that mimicked SASP-mediated paracrine signalling and tumour-promoting effects. Our findings reveal that HDN, more effectively than QCT, attenuates SASP markers, restores drug sensitivity, reduces cell migration, and promotes apoptosis, as evidenced by increased p53 activation and loss of SA-β-gal activity. The ability of HDN to selectively eliminate senescent cells and suppress SASP-driven phenotypes underscores its promise as a senotherapeutic adjuvant in cancer treatment. These results support a \u0026ldquo;one\u0026ndash;two punch\u0026rdquo; strategy wherein chemotherapy is followed by senolytics to eliminate residual senescent cells and prevent relapse. Future in vivo studies and mechanistic analyses involving HDN\u0026rsquo;s interaction with key signalling pathways such as NF-κB and Nrf2 are warranted to further establish its clinical utility in overcoming TIS-associated tumour progression.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cul type=\"disc\"\u003e\n \u003cli\u003eThe authors declare no conflict of interest.\u003c/li\u003e\n \u003cli\u003eClinical trial number: not applicable.\u003c/li\u003e\n \u003cli\u003eEthics, Consent to Participate, and Consent to Publish declarations: not applicable.\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was carried out as part of the partial fulfillment of the requirements for the Master\u0026rsquo;s degree in Biomedical Sciences at the Department of Biomedical Sciences, SRIHER. The authors thank the department for providing the necessary laboratory infrastructure and support.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Funding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was self-funded by the authors. No external funding was received for the conduct of this study.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAggarwal V, Tuli HS, Thakral F, et al. Molecular mechanisms of action of hesperidin in cancer: recent trends and advancements. Exp Biol Med (Maywood). 2020;245(5):486\u0026ndash;497. doi:10.1177/1535370220903671\u003c/li\u003e\n \u003cli\u003eAltieri P, Murialdo R, Barisione C, et al. 5‑fluorouracil causes endothelial cell senescence: potential protective role of glucagon-like peptide 1. Br J Pharmacol. 2017;174(21):3713\u0026ndash;3726. doi:10.1111/bph.13725\u003c/li\u003e\n \u003cli\u003eBai SR, Zhao BX, Zhao Q, et al. Oleanolic acid improves 5‑fluorouracil‑induced intestinal damage and inflammation by alleviating intestinal senescence. Sci Rep. 2024;14:21852. doi:10.1038/s41598-024-72536-3\u003c/li\u003e\n \u003cli\u003eBoccardi V, Mecocci P. Senotherapeutics: targeting senescent cells for the main age-related diseases. Mech Ageing Dev. 2021;197:111526. doi:10.1016/j.mad.2021.111526\u003c/li\u003e\n \u003cli\u003eCopp\u0026eacute; JP, Patil CK, Rodier F, et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 2008;6(12):2853\u0026ndash;2868. doi:10.1371/journal.pbio.0060301\u003c/li\u003e\n \u003cli\u003eCopp\u0026eacute; JP, Desprez PY, Krtolica A, Campisi J. The senescence-associated secretory phenotype: the dark side of tumor suppression. Annu Rev Pathol. 2010;5:99\u0026ndash;118. doi:10.1146/annurev-pathol-121808-102144\u003c/li\u003e\n \u003cli\u003eCuollo L, Antonangeli F, Santoni A, Soriani A. The senescence-associated secretory phenotype (SASP) in the challenging future of cancer therapy and age-related diseases. Biology (Basel). 2020;9(12):485. doi:10.3390/biology9120485\u003c/li\u003e\n \u003cli\u003eDella Vedova L, Baron G, Morazzoni P, Aldini G, Gado F. The potential of polyphenols in modulating the cellular senescence process: implications and mechanism of action. Pharmaceuticals. 2025;18(2):138.\u003c/li\u003e\n \u003cli\u003eDemaria M, O\u0026rsquo;Leary MN, Chang J, et al. Cellular senescence promotes adverse effects of chemotherapy and cancer relapse. Nat Med. 2017;23(8):967\u0026ndash;975. doi:10.1038/nm.4368\u003c/li\u003e\n \u003cli\u003eDe Angelis PM, Svendsrud DH, Kravik KL, Stokke T. Cellular response to 5‑fluorouracil (5‑FU) in 5‑FU-resistant colon cancer cell lines during treatment and recovery. Mol Cancer. 2006;5:20. doi:10.1186/1476-4598-5-20\u003c/li\u003e\n \u003cli\u003eDimri GP, Lee X, Basile G, et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 1995;92(20):9363\u0026ndash;9367. doi:10.1073/pnas.92.20.9363\u003c/li\u003e\n \u003cli\u003eErlund I. Review of the flavonoids quercetin, hesperetin, and naringenin: dietary sources, bioactivities, bioavailability, and epidemiology. Nutr Res. 2004;24(10):851\u0026ndash;874.\u003c/li\u003e\n \u003cli\u003eEscriche-Navarro B, Garrido E, Escudero A, et al. Targeting the senescent surfaceome through DPP4 antibody-functionalized nanoparticles: an application to cancer therapy. Biomaterials. 2025;[Epub Jun 4]. doi:10.1016/j.biomaterials.2025.123461\u003c/li\u003e\n \u003cli\u003eFaget DV, Ren Q, Stewart SA. Unmasking senescence: context-dependent effects of SASP in cancer. Nat Rev Cancer. 2019;19(8):439\u0026ndash;453. doi:10.1038/s41568-019-0156-2\u003c/li\u003e\n \u003cli\u003eFocaccetti C, Bruno A, Magnani E, et al. Effects of 5‑fluorouracil on morphology, cell cycle, proliferation, apoptosis, autophagy and ROS production in endothelial cells and cardiomyocytes. PLoS One. 2015;10(2):e0115686. doi:10.1371/journal.pone.0115686\u003c/li\u003e\n \u003cli\u003eHernandez-Segura A, Nehme J, Demaria M. Hallmarks of cellular senescence. Trends Cell Biol. 2018;28(6):436\u0026ndash;453. doi:10.1016/j.tcb.2018.02.001\u003c/li\u003e\n \u003cli\u003eKrtolica A, Parrinello S, Lockett S, Desprez PY, Campisi J. Senescent fibroblasts promote epithelial cell growth and tumorigenesis: a link between cancer and aging. Proc Natl Acad Sci U S A. 2001;98(21):12072\u0026ndash;12077. doi:10.1073/pnas.211053698\u003c/li\u003e\n \u003cli\u003eKumar S, Diekman BO. The emergence of senolytic targeting for cancer therapy. Nat Rev Cancer. 2022;22(6):314\u0026ndash;328. doi:10.1038/s41568-022-00466-8\u003c/li\u003e\n \u003cli\u003eLewińska A, Przybylski P, Adamczyk-Grochala J, et al. Senolysis-based elimination of chemotherapy-induced senescent breast cancer cells by quercetin derivative with blocked hydroxy groups. Cancers (Basel). 2022;14(3):605. doi:10.3390/cancers14030605\u003c/li\u003e\n \u003cli\u003eMilanović M, Fan DNY, Belenki D, et al. Senescence-associated reprogramming promotes cancer stemness. Nature. 2018;553(7686):96\u0026ndash;100. doi:10.1038/nature25167\u003c/li\u003e\n \u003cli\u003eOhtani N, Zebedee Z, Huot TJ, et al. Opposing effects of Ets and Id proteins on p16INK4a expression during cellular senescence. Nature. 2001;409(6823):1067\u0026ndash;1070. doi:10.1038/35059131\u003c/li\u003e\n \u003cli\u003eOrjalo AV, Bhaumik D, Gengler BK, Scott GK, Campisi J. Cell surface-bound IL-1\u0026alpha; is an upstream regulator of the senescence-associated IL-6/IL-8 cytokine network. Proc Natl Acad Sci U S A. 2009;106(40):17031\u0026ndash;17036. doi:10.1073/pnas.0905299106\u003c/li\u003e\n \u003cli\u003eSalama R, Sadaie M, Hoare M, Narita M. Cellular senescence and its effector programs. Genes Dev. 2014;28(2):99\u0026ndash;114. doi:10.1101/gad.235184.113\u003c/li\u003e\n \u003cli\u003eSaleh T, Carpenter VJ, Tyutyunyk-Massey L, et al. Clearance of therapy-induced senescent tumor cells by the senolytic ABT‑263 via interference with BCL‑XL\u0026ndash;BAX interaction. Mol Oncol. 2020;14(10):2504\u0026ndash;2519. doi:10.1002/1878-0261.12756\u003c/li\u003e\n \u003cli\u003eS\u0026aacute;nchez-D\u0026iacute;ez M, Romero-Jim\u0026eacute;nez P, Alegr\u0026iacute;a-Aravena N, et al. Assessment of cell viability in drug therapy: IC50 and other new time-independent indices for evaluating chemotherapy efficacy. Pharmaceutics. 2025;17(2):247. doi:10.3390/pharmaceutics17020247\u003c/li\u003e\n \u003cli\u003eSharpless NE, Sherr CJ. Forging a signature of in vivo senescence. Nat Rev Cancer. 2015;15(7):397\u0026ndash;408. doi:10.1038/nrc3960\u003c/li\u003e\n \u003cli\u003eShort S, Fielder E, Miwa S, von Zglinicki T. Senolytics and senostatics as adjuvant tumour therapy. EBioMedicine. 2019;41:683\u0026ndash;692. doi:10.1016/j.ebiom.2019.01.056\u003c/li\u003e\n \u003cli\u003ete Poele RH, Okorokov AL, Jardine L, Cummings J, Joel SP. DNA damage is able to induce senescence in tumor cells in vitro and in vivo. Cancer Res. 2002;62(6):1876\u0026ndash;1883. PMID:11912168\u003c/li\u003e\n \u003cli\u003eRodier F, Campisi J. Four faces of cellular senescence. J Cell Biol. 2011;192(4):547\u0026ndash;556. doi:10.1083/jcb.201009094\u003c/li\u003e\n \u003cli\u003eValenzuela CA, Quintanilla R, Olate-Briones A, et al. SASP-dependent interactions between senescent cells and platelets modulate migration and invasion of cancer cells. Int J Mol Sci. 2019;20(21):5292. doi:10.3390/ijms20215292\u003c/li\u003e\n \u003cli\u003eVousden KH, Lane DP. p53 in health and disease. Nat Rev Mol Cell Biol. 2007;8(4):275\u0026ndash;283. doi:10.1038/nrm2147\u003c/li\u003e\n \u003cli\u003eVousden KH, Prives C. Blinded by the light: the growing complexity of p53. Cell. 2009;137(3):413\u0026ndash;431. doi:10.1016/j.cell.2009.04.037\u003c/li\u003e\n \u003cli\u003eWiley CD, Campisi J. The metabolic roots of cellular senescence. Nat Rev Mol Cell Biol. 2021;22(8):411\u0026ndash;420. doi:10.1038/s41580-021-00347-2\u003c/li\u003e\n \u003cli\u003eYuan L, Alexander PB, Wang XF. Cellular senescence: from anti‑cancer weapon to anti‑aging target. Sci China Life Sci. 2020;63:332\u0026ndash;342. doi:10.1007/s11427-019-9594-8\u003c/li\u003e\n \u003cli\u003eZhu Y, Tchkonia T, Pirtskhalava T, et al. The Achilles\u0026rsquo; heel of senescent cells: from transcriptome to senolytic drugs. Aging Cell. 2015;14(4):644\u0026ndash;658. doi:10.1111/acel.12344\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"SASP, A549, therapy-induced senescence, 5-fluorouracil, cancer chemoresistance","lastPublishedDoi":"10.21203/rs.3.rs-7011853/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7011853/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cb\u003ePurpose\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTherapy-induced senescence (TIS) is a double-edged outcome of chemotherapeutic stress, leading to durable cell cycle arrest and the secretion of pro-inflammatory SASP factors that may promote tumour progression and relapse. This study aimed to investigate the senolytic potential of quercetin (QCT) and hesperidin (HDN)\u0026mdash;two flavonoids with known anticancer properties\u0026mdash;in reversing 5-fluorouracil (5-FU)-induced senescence and SASP-mediated paracrine resistance in A549 lung adenocarcinoma cells.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMethods\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA549 cells were treated with sublethal doses of 5-FU to induce senescence, confirmed by SA-β-gal staining and senescence marker expression (p16, p21). SASP-conditioned media (SASP-CM) were collected from senescent cultures and used to assess chemoresistance, migration, and gene expression profiles. The senolytic efficacy of QCT and HDN was evaluated using MTT assays, scratch assays, AO/EB staining, colony formation assays, X-Gal staining, and RT-PCR.\u003c/p\u003e\u003cp\u003e\u003cb\u003eResults\u003c/b\u003e\u003c/p\u003e \u003cp\u003eSublethal 5-FU induced robust senescence and increased resistance to subsequent 5-FU exposure in SASP-CM\u0026ndash;treated A549 cells. Both QCT and HDN significantly reversed SASP-mediated chemoresistance and inhibited cell migration. HDN exhibited greater pro-apoptotic and senolytic activity than QCT, as evidenced by higher apoptosis rates, enhanced p53 expression, and reduced SASP marker expression. X-Gal and colony formation assays confirmed selective clearance of senescent cells.\u003c/p\u003e\u003cp\u003e\u003cb\u003eConclusion\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThis study demonstrates that HDN and QCT, particularly HDN, possess strong senolytic and SASP-suppressing effects, thereby restoring chemosensitivity in TIS-affected lung cancer cells. These findings support the use of flavonoid-based senotherapeutics as adjunct strategies to overcome therapy-induced resistance and tumour recurrence.\u003c/p\u003e","manuscriptTitle":"Modulating SASP-Driven Paracrine Effects to Overcome Therapy-Induced Senescence: Senolytic Role of Hesperidin and Quercetin in A549 Lung Cancer Cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-07 10:09:28","doi":"10.21203/rs.3.rs-7011853/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-07-18T12:35:42+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-07-13T07:44:22+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"194521525544680188522282660599465505956","date":"2025-07-03T11:32:04+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-07-03T09:50:34+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-02T06:21:01+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-07-02T06:19:43+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Biology Reports","date":"2025-06-30T14:42:32+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"bc26f38b-faa9-4577-8c66-0433044a1f18","owner":[],"postedDate":"July 7th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-08-11T16:03:57+00:00","versionOfRecord":{"articleIdentity":"rs-7011853","link":"https://doi.org/10.1007/s11033-025-10904-6","journal":{"identity":"molecular-biology-reports","isVorOnly":false,"title":"Molecular Biology Reports"},"publishedOn":"2025-08-06 15:58:03","publishedOnDateReadable":"August 6th, 2025"},"versionCreatedAt":"2025-07-07 10:09:28","video":"","vorDoi":"10.1007/s11033-025-10904-6","vorDoiUrl":"https://doi.org/10.1007/s11033-025-10904-6","workflowStages":[]},"version":"v1","identity":"rs-7011853","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7011853","identity":"rs-7011853","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}