The enhanced osteogenic differentiation of human periodontal ligament stem cells and M2 polarization of macrophages may be mediated by EphB4/ephrinB2 signaling pathway: a study of their direct co-culture

preprint OA: closed
Full text JSON View at publisher
Full text 181,044 characters · extracted from preprint-html · click to expand
The enhanced osteogenic differentiation of human periodontal ligament stem cells and M2 polarization of macrophages may be mediated by EphB4/ephrinB2 signaling pathway: a study of their direct co-culture | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The enhanced osteogenic differentiation of human periodontal ligament stem cells and M2 polarization of macrophages may be mediated by EphB4/ephrinB2 signaling pathway: a study of their direct co-culture Xiaoqian Yang, Yijun Luan, Jiling Qiu, Huaze Ren, Qiuyue Yin, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7457833/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 02 Mar, 2026 Read the published version in Stem Cell Research & Therapy → Version 1 posted 16 You are reading this latest preprint version Abstract Background Periodontal tissue regeneration can be achieved by periodontal ligament stem cells (PDLSCs) through its regulating the immune system. However, the specific signal or molecular mechanism remains unreported. The interaction between MSCs and macrophages (Mφ) has been the focus of the research in recent years. The objective of this study is to examine the effect of direct co-culture of human periodontal ligament stem cells (hPDLSCs) and macrophages on the osteogenic differentiation of hPDLSCs and the polarization of macrophages, and also to explore the role of the EphB4/ephrinB2 signaling pathway in the interaction of co-cultured hPDLSCs and macrophages. Methods hPDLSCs isolated from human periodontal ligament were co-cultured with non-activated M0 macrophages (M0-Mφ) induced from THP-1. Quantitative real-time polymerase chain reaction (qRT-PCR), alkaline phosphatase (ALP) staining and assay, as well as Alizarin red staining (ARS) were carried out to evaluate hPDLSCs osteogenic differentiation. qRT-PCR and Enzyme-Linked Immunosorbent Assay (ELISA) were employed to detect the expression of macrophage polarization-related factors. Western Blot was utilized to detect the expression of EphB4, ephrinB2, ERK1/2 and STAT3. Results When M0-Mφ was directly co-cultured with hPDLSCs at a ratio of 5:1, the co-culture system significantly promoted the osteogenic differentiation of hPDLSCs, as demonstrated by enhanced ALP staining/activity, ARS mineralization and upregulated mRNA expression of osteogenic markers (Runx2, ALP, OCN, and OPN). Meanwhile, the co-culture system markedly increased anti-inflammatory factor expression (TGF-β1 and IL-10) and decreased the pro-inflammatory factors (TNF-α and IL-1β), indicating enhanced polarization of alternatively activated macrophages (M2-Mφ). The mRNA and protein expression of EphB4 and ephrinB2 increased significantly with the time extension of the two cells’ co-culture. However, pharmacological interruption of EphB4/ephrinB2 signaling pathway resulted in the inhibition of hPDLSC osteogenic differentiation, M2 macrophage polarization, and p-STAT3 expression in the co-culture system. Conclusions The EphB4/ephrinB2 pathway may mediate the osteogenic differentiation of hPDLSCs and the polarization of M2-Mφ in the co-culture system. Its regulatory effect on the osteogenic differentiation of hPDLSCs may be achieved through the STAT3 signaling pathway. Human periodontal ligament stem cells Macrophages Direct co-culture Osteogenic differentiation Polarization EphB4 ephrinB2 STAT3 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Background Periodontitis, a chronic inflammatory disease initiated by microbial infection, has become a major public health problem due to its high incidence rate [ 1 ]. In addition to the widely applied initial periodontal therapy, immunomodulation has been regarded as a potential combination strategy. Mesenchymal stem cells (MSCs) have been widely used in the field of tissue regeneration due to not only their multi-directional differentiation potential [ 2 , 3 ], but also their immunomodulatory ability. Although MSCs per se are not part of the immune system, they can interact with immune cells to release anti-inflammatory or pro-inflammatory factors targeting effector cells for precise regulation in tissue repair in the wound area [ 4 ]. MSCs are therefore increasingly receiving wide attention as candidates for the treatment of inflammatory diseases. Periodontal ligament stem cells (PDLSCs), as the ideal seed cells for periodontal tissue engineering, possess strong self-renewal capacity and multipotent differentiation potential. Moreover, they participate in innate immune regulation, making them the most critical functional cells in periodontal regeneration [ 5 ]. Regulating the immune system to promote tissue regeneration is becoming a hot spot in the emerging research field of regenerative medicine [ 6 – 8 ]. Among them, the interaction between MSCs and macrophages (Mφ) has been the focus of the research in recent years [ 9 , 10 ]. Mφ is an important component of the innate immune system, playing a critical role in host defense against invading pathogens and maintaining immune homeostasis. Macrophages are capable of plasticity. Studies have shown that macrophages can switch between classically activated macrophages (M1) and alternatively activated macrophages (M2) under the influence of local microenvironmental signals, and thus exert pro-inflammatory and anti-inflammatory effects, respectively [ 11 ]. The polarization state of Mφ dominates the occurrence, the development and the regression of inflammation [ 11 ]. The ratio of M1/M2 increases with the progression of the inflammation [ 12 ]. Gene expression profile analysis showed that M1 can release high levels of pro-inflammatory cytokines, including tumor necrosis factor-α (TNF-α), monocyte chemoattractant protein-1 (MCP-1), and interleukin-1 (IL-1) [ 13 ]. In contrast, M2 highly expresses CD206, chemokine receptor (CCR2), C-X-C chemokine receptor 1 (CXCR1) [ 14 ], and produces a large amount of interleukin-10 (IL-10) and arginase-1 (Arg-1), which plays an important role in tissue repair [ 15 ]. Multiple studies have shown the importance of the cross-talk between MSCs and Mφ in tissue regeneration and repair [ 16 – 18 ]. The direct contact co-culture of Mφ and MSCs significantly enhanced the osteogenic differentiation and mineralization of MSCs [ 19 ]. At the same time, the immunosuppressive ability of MSCs was increased and the polarization of Mφ to M2 type was promoted [ 20 ]. Paracrine signal has been investigated as one of the important pathway of the coculture-driven modulatory effect [ 21 ]. However, more and more studies have proved that the direct cell-to-cell contact between MSCs and Mφ mediates the regulatory effect of the interaction. Nicolaidou et al [ 22 ]showed that the direct contact of MSCs and Mφ promoted the osteogenic differentiation of MSCs by the activation of STAT3 signaling pathway. Luo et al [ 23 ]found that direct contact had the stronger promoting effect on the osteogenic differentiation of MSCs than the paracrine pathway, suggesting that direct cell-to-cell contact be a more effective way to increase the communication between cells. Ephrins/Ephs pathway is a contact-dependent bidirectional signaling pathway [ 24 ], Ephrin receptors, the largest family of receptor tyrosine kinases in mammals, are widely studied in the cell-coculture research. Ephrin receptors can form bidirectional signals with transmembrane protein ephrins ligands. Generally, EphA receptors (EphA1-A8, A10) interact with ephrinA (ephrinA1-A5), and EphB receptors (EphB1-B6) interact with ephrinB ligands (ephrinB1-B3) [ 25 , 26 ]. The N-terminus of EphB4 has highly conserved characteristics. After binding to the extracellular domain structure of ephrinB2, the generated complex has the characteristic of enhancing the association between molecules [ 27 ]. The interaction between Eph receptors and ephrins ligands occurs with direct cell contact, by which a bidirectional signal transmission is promoted. Eph receptors initiate forward signal transmission into the cell, while ephrins ligands trigger reverse signal transmission inward [ 28 , 29 ]. In this signaling pathway, the forward Eph signal depends on the active expression of Eph kinase, while the reverse ephrin signal depends on Src family kinases and other effector molecules [ 30 ]. Some studies revealed that the interaction between the EphB4 receptor on the osteoblast membrane and the ephrinB2 ligand on the osteoclast membrane can trigger bidirectional signal transmission and then influence the differentiation balance between osteoclasts and osteoblasts, indicating that EphB4/ephrinB2 plays an important role in maintaining bone homeostasis [ 31 , 32 ]. Wang et al. [ 33 ] found EphB4/ephrinB2 signal pathway can effectively enhance the osteogenic differentiation of osteoblast precursor cells by activating EphB4 through exogenous ephrinB2-fc. These findings revealed the extensive biological activity of EphB4 and ephrinB2 in multiple cell types. Studies have shown that both PDLSCs and Mφ expressed EphB4 and ephrinB2 [ 34 – 36 ]. We therefore investigated if the EphB4/ephrinB2 signaling pathway play an important role in the interaction of co-cultured hPDLSCs and macrophages and the underlying possible mechnism. Methods Isolation and culture of hPDLSCs This study was conducted with approval from the Ethics Committee of Hospital of Stomatology Shandong University (No. 20200706). Healthy premolars (n = 8) were collected from orthodontic patients (16 to 24 years old) after obtaining informed consent. Periodontal ligament tissues were aseptically harvested from the middle third of the root, minced into 1-mm³ fragments, and cultured in alpha-modified Eagle’s medium (α-MEM; Biological Industries, Israel) containing 20% fetal bovine serum (FBS; Biological Industries, Israel), 2 mM glutamine and antibiotics (100 U/mL penicillin and 100 µg/mL streptomycin; Biosharp, China) at 37°C in 5% CO₂. Primary PDLSCs migrating from periodontal ligament explants were maintained in 10% FBS medium with biweekly medium changes. hPDLSCs were acquired by limiting dilution method. Cloning formation experiment of hPDLSCs When cells growing out from the periodontal ligament tissue block reached 80% in the culture dish, they were trypsinized and resuspended in α-MEM medium supplemented with 10% FBS to prepare single-cell suspensions. The cell concentration was adjusted to 100 cells per milliliter and inoculated into 10-centimeter diameter culture dishes. The medium was changed every 2 to 3 days during the 14-day culture period. Following culture, cells were fixed with 4% paraformaldehyde for 15 minutes and subsequently stained with crystal violet for 20 minutes. Excessive staining solution was removed by washing with phosphate-buffered saline (PBS; Biosharp, China) three times. After air-drying at room temperature, cell clones were observed under the inverted microscope (NEXCOPE, USA), with a clone defined as containing ≥ 50 cells. Multilineage differentiation of hPDLSCs hPDLSCs in P3 were harvested and cultured in osteogenic differentiation medium (α-MEM supplemented with 10% FBS, 10 mmol/L β-glycerophosphate, 0.1 µmol/L dexamethasone and 0.05 mmol/L vitamin C) or adipogenic differentiation medium (α-MEM supplemented with 10% FBS, 200 µmol/L indomethacin, 10 µmol/L dexamethasone and 0.5 mmol/L IBMX) for 21 days. Then, cells were fixed and stained with Alizarin Red S (Solarbio, China) for osteogenic differentiation or Oil Red O (Solarbio, China) for adipogenic differentiation respectively. After air-drying at room temperature, staining results were examined macroscopically and microscopically with representative images captured for documentation. Flow cytometry identification of hPDLSCs To further verify the stem cell characertistic of our acquired cells, the expression of stem cell surface markers on the isolated cells was analyzed by flow cytometry (BD Biosciences, USA) following standard protocols. Briefly, cells were washed twice with PBS and subsequently incubated with fluorescently conjugated monoclonal antibodies against human CD44-PE, CD73-APC, CD90-FITC, CD34-PE, and CD45-FITC (all from BD Biosciences, USA) for 30 min at 4°C in the dark. PBS-treated cells served as negative controls. After additional PBS washing, cell fluorescence was immediately analyzed using the flow cytometer. Immunofluorescence identification of hPDLSCs Isolated cells were seeded in 96-well plates and cultured to adherence. After PBS washing, cells were fixed with 4% paraformaldehyde for 20 minutes, permeabilized with 0.1% Triton X-100 (Solarbio, China) for 10 minutes, and blocked with 5% goat serum (Zhongshan Golden Bridge, China) for 20 minutes. Primary antibodies against Vimentin (Proteintech, China) and Cytokeratin 17 (Proteintech, China) were applied overnight at 4°C, followed by incubation with fluorescent goat anti-rabbit secondary antibody (Proteintech, China) for 1 hour. Nuclei were counterstained with DAPI (Solarbio, China) for 10 minutes before fluorescence microscopy imaging. All steps were interspersed with PBS washing and samples were air-dried prior to observation. Induction and identification of macrophages THP-1 cells (Procell, China) were plated in 6-well plates (1×10 6 cells/well) and induced to differentiated into macrophages by using 100 ng/mL phorbol-12-myristate-13-acetate (PMA; SIGMA, USA) in RPMI-1640 medium supplemented with 10% FBS for 48 hours. Then cells were washed with PBS to remove residual PMA and maintained in fresh complete medium (RPMI-1640 medium supplemented with 10% FBS). One plate was used for macrophage identification by flow cytometry analysis with anti-CD11b antibody (Thermo, USA). In brief, single-cell suspension (1×10 6 cells/tube) were stained with anti-CD11b antibody (Thermo, USA) for 40 minutes at 4℃ in the dark. After PBS washing to remove unbound fluorescent antibodies, cells were resuspended in 500 µL PBS and analyzed by flow cytometry to quantify CD11b surface expression. Co-culture of macrophages with hPDLSCs PMA induced THP-1 was named as M0-Mφ and they were inoculated into same one of the 6-well plates with hPDLSCs at three different ratios of 1:1 (1×10 6 M0-Mφ and 1×10 6 hPDLSCs), 5:1 (1×10 6 M0-Mφ and 2×10 5 hPDLSCs) and 10:1 (1×10 6 M0-Mφ and 1×10 5 hPDLSCs) respectively. The co-cultured cells were cultured in a 1:1 mixture of macrophage medium (RPMI-1640 with 10% FBS) and osteogenic induction medium (α-MEM with 10% FBS, 10 mmol/L β-glycerophosphate, 0.1 µmol/L dexamethasone, and 0.05 mmol/L vitamin C). The co-culture medium was refreshed every 72 hours throughout the experiment. Immunofluorescence staining M0 macrophages (3.3×10⁴ cells/well) and P3 hPDLSCs (1.3×10⁴ cells/well) were cultured in 96-well plates using RPMI-1640 (10% FBS) and α-MEM (10% FBS), respectively. Upon reaching 70–80% confluence, hPDLSCs were processed for immunofluorescence: after PBS washing, cells were fixed with 4% paraformaldehyde for 20 minutes., blocked with 5% goat serum (Zhongshan Golden Bridge, China) for 20 minutes., and incubated with primary antibodies against EphB4 (Proteintech, China) and ephrinB2 (Bioss, China) overnight at 4°C. Following secondary antibody incubation (goat anti-rabbit IgG, Proteintech, China) for 1 hour and DAPI counterstaining (Solarbio, China) for 10 minutes, samples were imaged using the Operetta CLS™ high-content analysis system (PerkinElmer, USA) after final PBS washes and air-drying. qRT-PCR analysis Total RNA was isolated from cells using the RNAfast200 Total RNA Extreme Extraction kit (Shanghai Feijie, China) and reverse transcribed into cDNA using the Evo M-MLV Reverse Transcription Premixed kit (AG, China). The primer information is shown in Table 1 and includes β-actin, ALP, RunX2, OCN, OPN, TNF-α, IL-1β, TGF-β1, IL-10, CD206, EphB4, and ephrinB2. qRT-PCR reactions were performed using SYBR Green Premix Pro Taq HS qPCR Kit (AG, China). Relative quantification was achieved using the comparative 2 −△△Cq method. Table 1 qRT-PCR Primer Sequence Primer name Sense primers(5’-3’) Antisense primers(5’-3’) β-actin GAAGAGCTACGAGCTGCCTGA CAGACAGCACTGTGTTGGCG ALP CGGACCATTCCCACGTCTTC CATTCTCTCGTTCACCGCCC RunX2 GGAGTGGACGAGGCAAGAGT AGGCGGTCAGAGAACAAACT OCN TCACACTCCTCGCCCTATTG CTCTTCACTACCTCGCTGCC OPN GCCGTGGGAAGGACAGTTAT ATCTGGACTGCTTGTGGCTG TNF-α GAGGCCAAGCCCTGGTATG CGGGCCGATTGATCTCAGC IL-1β CAACAAGTGGTGTTCTCCATGTC ACACGCAGGACAGGTACAGA TGF-β1 GCAACAATTCCTGGCGATACC ATTTCCCCTCCACGGCTCAA IL-10 CCAGACATCAAGGCGCATGT GATGCCTTTCTCTTGGAGCTTATT CD206 GATTGCAGGGGGCTTATGGG CGGACATTTGGGTTCGGGAG EphB4 GGTGACATTCCCTCAGGTGG TGCACGTCACACACTTCGTA ephrinB2 ACTGCTGGGGTGTTTTGATG GTTTTAGAGTCCACTTTGGGGC Cytokine measurements The supernatants of different groups were collected and centrifuged at 1000 g for 20 min to remove impurities and cell debris. Levels of TNF-α, IL-1β, TGF-β1, and IL-10 in the culture supernatants were quantified according to the instructions of the ELISA kits (Lianke Biotechnology, China). Western blot analysis Cells in 6-well plates were placed on ice and washed three times with ice-cold PBS. Lysis was performed using RIPA buffer (Solarbio, China) supplemented with 1 mM PMSF and 1 mM phosphatase inhibitor for 30 minutes, followed by ultrasonication. Protein concentrations were determined using a BCA assay. Equal amounts of protein were separated by SDS-PAGE (Epizyme Biotech, China) and transferred to 0.22 µm PVDF membranes (Biosharp, China). Membranes were blocked with 5% BSA (Solarbio, China) in TBST (0.05% Tween-20; Solarbio, China) for 1 hour at room temperature, then incubated overnight at 4°C with the following primary antibodies: polyclonal rabbit anti-EPHB4 antibody (1:1000; Proteintech, China), rabbit anti-ephrinB 2 antibody (1:1000; Bioss, China), polyclonal Rabbit anti-GAPDH antibody (1:1000000; HUABIO, China); phospho-ERK1/2 (Thr202/Tyr204) Recombinant antibody(1:1000; Proteintech, China); polyclonal rabbit anti-ERK1/2 antibody (1:1000; Proteintech, China); rabbit anti-STAT3 antibody (1:1000; CST, USA) and phospho-STAT3 (Tyr705) antibody(1:1000; CST, USA). After washing, membranes were incubated with horseradish peroxidase (HRP)conjugated goat antirabbit IgG (1:5000; ZSGB-BIO, China) for 1 hour at room temperature. Protein bands were visualized using ECL chemiluminescence (Biosharp, China) and quantified using ImageJ software (NIH, USA). Results Identification of hPDLSCs hPDLSCs were cultured using the periodontal ligament tissue block method, and obtained through clone purification. After crystal violet staining in the clone formation experiment, purple-blue spots scattered at the bottom of the culture dish could be visually identified (Fig. 1 A-a). Under an inverted microscope, the cell clone morphology could be seen, with the cells arranged in a vortex around the central point (Fig. 1 A-b). A single cell clone is defined as an aggregated group of ≥ 50 cells, and the clone formation rate is calculated to be 14.51% ± 0.95%. In comparison with the non-induced group, alizarin red staining of the osteogenic induction group revealed the formation of red mineralized nodules (Fig. 1 B). Likewise, after 21 days of adipogenic induction of hPDLSCs, a large quantity of red lipid droplets was observed following oil red O staining (Fig. 1 C). Cultured PDLSCs were positive for MSCs markers (CD44, CD73, and CD90), and were negative for leucocyte cell makers (CD45) and hematopoietic stem cells markers (CD34) (Fig. 1 D). Under an inverted fluorescence microscope, positive staining for vimentin in the cell cytoplasm was observed (Fig. 1 E-a), confirming that the cells are derived from the mesoderm. Negative staining for cytokeratin (Fig. 1 E-b) indicated that there was no contamination by cells of ectodermal origin. All the results indicated that hPDLSCs were successfully obtained from periodontal ligament tissues. Identification of macrophages Under an inverted microscope, it was observed that THP-1 cells grew in suspension, presenting a full cell morphology, being round, transparent, and of uniform size (Fig. 1 F). After induction with 100 ng/mL PMA for 48 hours, the cells were seen to grow in an adherent manner, with irregular cell contours, increased volume and varying sizes, and some cells extended short protrusions (Fig. 1 G). Flow cytometry examination showed that the positive rate of M0-Mφ-related surface marker CD11b was 99.0%, which was consistent with the phenotypic characteristics of M0-Mφ (Fig. 1 H). The co-culture of M0-Mφ and hPDLSCs promoted the osteogenic differentiation of hPDLSCs Using monocultured hPDLSCs as a control, the impacts of the co-culture system on the mRNA expression of osteogenesis-related factors of hPDLSCs were investigated. As shown in Fig. 2 A, the mRNA level of ALP, RunX2, OCN and OPN in the co-culture group on day 3 was all upregulated, compared with those in the monoculture group. Nevertheless, only the increase of the expression of ALP and OPN was statistically significant. On day 14, the mRNA level of osteogenesis-related factors in hPDLSCs in the co-culture group was all significantly elevated ( P < 0.05) (Fig. 2 A). The above findings indicated that the co-culture of M0-Mφ and hPDLSCs is conducive to the osteogenic differentiation of hPDLSCs. The results of ALP activity assay showed that the ALP activity in both the monoculture group and the co-culture group reached the peak on the 14th days. Compared with the monoculture group, the ALP activity in the co-culture group was significantly increased on the 3rd, 7th, and 14th days (P < 0.05) (Fig. 2 B). In alizarin red staining and calcium quantification assay, a small number of calcium nodules could be observed in both groups on the 14th day. After 21 days, both the number of calcium nodules and the amount of the calcium deposition in the co-culture group was significantly higher than those in the hPDLSCs monoculture group (P < 0.05) (Fig. 2 C). The co-culture of M0-Mφ and hPDLSCs promoted the polarization of Mφ towards the M2 type An increasing number of Mφ aggregated in one aggregation unit with time (Fig. 3 A), suggesting that hPDLSCs may have a chemotactic effect on Mφ. The impact of co-culture on the polarization state of Mφ was investigated. The results of RT-qPCR and ELISA experiments demonstrated that the expression levels of pro-inflammatory factors TNF-α and IL-1β significantly decreased, while the expression levels of anti-inflammatory factors TGF-β1, IL-10, and CD206 significantly increased after three days of co-culture (P < 0.05) (Fig. 3 B), indicating that co-culture system promoted the polarization of Mφ to M2 type and down-regulated the proportion of M1. We then tried to study the effect of different co-culture duration on the polarization of Mφ. Experiment showed that in comparison with the 3-day and 7-day co-culture groups, the mRNA expression of TNF-α and IL-1β were at their lowest, while the mRNA expression of TGF-β1, IL-10, and CD206 were at their highest (P < 0.05) after 14 days of coculture. The protein expression of TNF-α and IL-1β presented the same trend in the co-culture system. Interestingly, the ELISA results showed that the expression of TGF-β1 and IL-10 reached the peak on the 7th day rather than the 14th day (Fig. 3 C). While mRNA levels peak on the 14th day, translational repression via RNA-binding proteins or microRNA-mediated silencing (e.g., miR-98 for IL-10) could delay protein synthesis [ 37 , 38 ]. Additionally, accelerated protein degradation through ubiquitin-proteasome system activation (particularly E3 ligases like Smurf1 for TGF-β1) may explain the earlier (7-day) peak in secreted cytokines [ 39 , 40 ]. These findings suggested that the co-culture of M0-Mφ and hPDLSCs promoted the polarization of Mφ to the M2 type, and the effect was optimal when co-cultured for 7 days. The determination of optimal ratio for M0-Mφ and hPDLSCs co-culture In order to determine the optimal co-culture ratio of M0-Mφ and hPDLSCs, M0-Mφ and hPDLSCs were directly co-cultured in vitro at three distinct ratios of 1:1, 5:1 and 10:1, respectively. The results of RT-qPCR showed that the mRNA expression of ALP, OCN, and OPN at co-culture ratio of 5:1 was significantly higher than that at ratio of 1:1 or 10:1 after 7 days of co-culture (Fig. 4 A). The significant increase of ALP activity was also found at co-culture ratio of 5:1 (Fig. 4 B) (P < 0.05). Additionally, the mRNA expression of TGF-β1, IL-10, and CD206 was the highest, while the expression of TNF-α and IL-1β was the lowest (P < 0.05) at ratio of 5:1 (Fig. 4 C). ELISA experiments revealed that the increase of the expression of TGF-β1 and IL-10 at ratio of 5:1 was the most prominent, while the expression of TNF-α and IL-1β was the lowest (P < 0.05) (Fig. 4 D). The above findings demonstrated that the effects on promoting osteogenesis of hPDLSCs and M2-Mφ polarization were the most remarkable when M0-Mφ and hPDLSCs are co-cultured at a ratio of 5:1. M0-Mφ and hPDLSCs co-culture increased the expression of EphB4 and ephrinB2 The expression of EphB4 and ephrinB2 on hPDLSCs and M0-Mφ was detected by the immunofluorescence method. The results indicated that EphB4 and ephrinB2 were primarily expressed on the cell membranes of hPDLSCs and M0-Mφ (Fig. 5 A and 5 B) In the process of osteogenic differentiation of monocultured hPDLSCs, the mRNA and protein expression of EphB4 and ephrinB2 exhibited an upward tendency (Fig. 5 C, 5 D and 5 E) with time. In the co-culture system, the mRNA and protein expression of EphB4 and ephrinB2 increased gradually with the prolongation of the co-culture time (Fig. 5 F, 5 G and 5 H). Inhibition of the EphB4/ephrinB2/STAT3 pathway reduced the osteogenic differentiation of hPDLSCs in the co-culture system NVP-BHG712, a small-molecule inhibitor of EphB4, can effectively and specifically inhibit the EphB4 kinase among numerous kinases. To investigate the cytotoxicity of NVP-BHG712 on hPDLSCs and M0-Mφ, cells were incubated with NVP-BHG712 at concentration of 0, 0.05, 0.1, 0.2, 0.4, 0.8, 1.6 and 3.2 µM respectively. The CCK8 results indicated there was no significant effect on the viability of both cell types at concentrations of 0.05, 0.1, and 0.2 µM of NVP-BHG712 (Fig. 6 A). A concentration of 0.2 µM was employed for the subsequent experiments. The results of RT-qPCR experiments demonstrated that the application of NVP-BHG712 significantly decreased the mRNA expression of osteogenesis-related factor ALP, RunX2, OCN, and OPN after 7-day co-culture (P < 0.05) (Fig. 6 B). ALP activity and quantitative calcium quantification detection revealed that NVP-BHG712 also significantly decreased the ALP activity and calcium deposition (P < 0.05) (Fig. 6 C and 6 D). The above findings suggested that inhibition of EphB4 suppressed the osteogenic differentiation of hPDLSCs in the co-culture model. To further explore the impact of EphB4 inhibition on osteogenesis-related signaling pathways ERK1/2 and STAT3, the protein expression of ERK1/2 and STAT3 was detected in the presence or absence of NVP-BHG712 by Western Blot. The results showed that the protein expression of P-STAT3 in the presence of NVP-BHG712 was significantly decreased (P 0.05) (Fig. 6 G and 6 H). These findings demonstrated that the EphB4/ephrinB2 pathway mediated the osteogenic differentiation of hPDLSCs in the co-culture system, and its regulatory effect might be achieved through the STAT3 signaling pathway. Inhibition of the EphB4/ephrinB2 pathway significantly reduced the polarization of the M2-Mφ type in the co-culture system To further investigate the effect of EphB4 inhibition on the polarization of co-cultured Mφ, the mRNA expression of Mφ marker-related factors and the secretion of Mφ polarization-related factors were detected with NVP-BHG712 application after 7days of coculture. The results showed that NVP-BHG712 significantly increased IL-1β mRNA expression, but decreased mRNA expression levels of TGF-β1, IL-10, and CD206 (P < 0.05) (Fig. 6 I). The ELISA results showed that M1-Mφ type-associated TNF-α and IL-1β expression in the NVP-BHG712 group was significantly increased, while M2-Mφ type-associated TGF-β1 and IL-10 expression significantly decreased (Fig. 6 J) (P < 0.05). Based on the above data, it can be speculated that EphB4 inhibition suppressed the polarization of Mφ to the M2 type while promoted its polarization to the M1 type in the co-culture system. Discussion Periodontitis is a host immune response damage initiated by plaque microorganisms. During the occurrence and development of periodontitis, Monocytes/macrophages contribute great significance. As a type of immunocyte with heterogeneity and plasticity, macrophages can be specifically classified into M0, M1, and M2 macrophages based on their molecular phenotypes and functional characteristics [ 41 ]. M1 and M2 macrophages are at the two extremes of different polarization states. Among them, M1 macrophages can promote cell oxidation and inflammatory reactions by highly expressing inflammatory factors such as tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and interleukin-12 (IL-12) as well as reactive oxygen free radicals. They play the role of immune surveillance by recruiting adaptive immune cells [ 42 ]. M2 macrophages can not only balance the body's inflammatory response by secreting anti-inflammatory factors such as interleukin-10 (IL-10) and transforming growth factor-β (TGF-β) and other cytokines like protectins and resolvins, but also directly clear the surrounding apoptotic cells and tissue debris through "efferocytosis". Therefore, M2 macrophages have important functions in immune regulation and promoting tissue healing [ 43 ]. Analyzing and intervening in the polarization trend of M0 macrophages may become one of the effective approaches for the treatment of infectious diseases. Numerous studies have shown that M1-Mφ significantly augments in the environment of severe periodontitis [ 44 , 45 ]. Consequently, facilitating the polarization of M1-Mφ to M2-Mφ has emerged as an important strategy for controlling periodontal inflammation and promoting the wound healing of periodontal tissues [ 46 , 47 ]. Periodontal ligament stem cells (PDLSCs) are the most critical functional cells for periodontal regeneration. However, the periodontal inflammatory microenvironment not only impacts the osteogenic differentiation potential of PDLSCs but also diminishes the positive immunomodulatory ability of PDLSCs [ 48 ]. Emerging evidence reveals a reciprocal enhancement between Mφ and MSCs, where MSCs drive Mφ polarization toward anti-inflammatory M2 phenotype, while Mφ reciprocally augment MSC-mediated osteogenesis [ 11 ]. This bidirectional crosstalk is particularly relevant in periodontitis, where dense macrophage infiltration creates direct cell-cell contact opportunities with resident hPDLSCs. Our study specifically investigated this cellular dialogue using THP-1-derived macrophages and hPDLSCs, with three objectives: (1) to characterize their contact-dependent communication, (2) to identify the optimal co-culture ratio that maximizes therapeutic interactions, and (3) to elucidate the possible underlying molecular mechanisms. When cultured in vitro, cells need to reach a certain density for interaction. High-density culture promotes cell-to-cell contact, thereby more effectively facilitating signal transmission and functional regulation [ 4 ]. Our findings revealed that the Mφ:hPDLSCs ratio critically regulated their crosstalk, with a 5:1 ratio optimally enhancing hPDLSCs osteogenic differentiation and Mφ M2-polarization. This research result is in line with previous studies [ 19 , 49 ]. Moreover, different cell seeding ratios affect the interaction between cells. Lu et al. observed increased mineralization at higher Mφ densities (5:1 vs 1:1) [ 13 ]. Zhang et al. reported M1-Mφ-mediated mineralization enhancement at 1:1 ratio, while M2-Mφ showed density-dependent osteogenic promotion, contrasting with M0-Mφ's inhibitory effects [ 49 ]. The differences in research results may be attributed to the different cell types and sources, the methods of inducing Mφ polarization, and the types of culture media, underscoring the importance of standardized models. Based on the above experimental results, we established 5:1 as the optimal Mφ: hPDLSCs ratio for periodontal regeneration studies. Evidence indicates a reciprocal interaction between Mφ and MSCs, wherein MSCs promote M2 polarization of Mφ and Mφ enhance MSC-mediated osteogenesis [ 11 ] vice versa. This bidirectional crosstalk significantly augments both MSC osteogenic differentiation and Mφ M2 polarization. Our results demonstrated that co-culture group significantly upregulated osteogenic differentiation, as evidenced by the increased expression of ALP, RunX2, OCN, and OPN, and enhanced ALP activity and calcium deposition compared to hPDLSCs monoculture ( p < 0.05 ). These findings indicated that co-culture system promoted hPDLSCs osteogenic differentiation in a time-dependent manner, with optimal effects observed during 7–14 days of co-culture, coinciding with improved M2 polarization of macrophages which reached their peak at 14 days. Microscopic analysis revealed that co-culture with hPDLSCs reduced the proportion of elongated, pseudopod-extending M1-like Mφ compared to M0-Mφ monocultures, with increasing Mφ aggregation observed over time, suggesting hPDLSC-mediated chemotaxis. RT-qPCR and ELISA demonstrated significantly decreased pro-inflammatory cytokines (TNF-α, IL-1β) and increased anti-inflammatory factors (TGF-β1, IL-10) in co-culture, peaking at day 7 ( p < 0.05 ), consistent with M2 polarization. Our findings aligned with reports of hPDLSC-mediated immunomodulation [ 50 , 51 ], discrepancies existed regarding MSC-osteogenesis suppression by M1/M2-Mφ [ 52 , 53 ], which potentially attributed to variations in: (1) cell sources, (2) polarization protocols, (3) co-culture ratios, and (4) culture conditions [ 4 ]. While our direct contact co-culture model demonstrates significant effects on Mφ polarization and hPDLSCs osteogenesis, the concomitant paracrine interactions [ 50 , 54 , 55 ] necessitate future validation through indirect co-culture systems to precisely delineate cell-contact-dependent versus soluble factor-mediated mechanisms. Mechanistic investigations revealed that EphB4/ephrinB2 signaling mediates macrophage-PDLSC crosstalk, potentially regulating osteogenic differentiation through STAT3 pathway modulation. Cell co-culture, first developed by Lawrence in the 1980s [ 56 ], involves cultivating multiple cell types together to mimic in vivo microenvironments [ 57 ]. Current systems utilize either direct or indirect contact models [ 58 ]. Notably, Nicolaidou et al. indicated that direct MSC-macrophage contact activates STAT3 signaling to promote osteogenesis, an effect not replicated by paracrine factors alone [ 16 ], highlighting the critical role of cell-contact-dependent mechanisms in tissue repair processes. Both EphB4 and ephrinB2 are cell membrane proteins. Their interaction promotes a complex two-way signal transmission and regulates interacting cells. EphB4 and ephrinB2, mainly localized and expressed on the cell membrane, are able to activate a large number of ligand-receptor complexes at the direct contact points between cells, precisely controlling cell biological behaviors [ 59 ]. An increasing number of studies have shown that Eph/ephrin is involved in the regulation of bone homeostasis [ 60 , 61 ]. This experimental study showed that the expression levels of EphB4 and ephrinB2 gradually increased as osteogenic differentiation progress, which means that EphB4/ephrinB2 may have an important impact on the osteogenic process. Using NVP-BHG712, a highly specific EphB4 kinase inhibitor developed by Martiny-Baron et al. [ 62 ]. Pharmacological inhibition of EphB4 signaling with NVP-BHG712 in the co-culture system significantly downregulated the expression of osteogenic marker ALP, RunX2, OCN, and OPN, reduced ALP enzymatic activity, and decreased calcium deposition ( p < 0.05 ), demonstrating EphB4's critical role in mediating hPDLSC osteogenic differentiation during macrophage crosstalk. It has been found that Mφ can effectively induce the osteogenic differentiation of MSCs. The phosphorylation of STAT3 in MSCs up-regulates the expression of osteogenesis-related genes, and cause MSCs to differentiate into osteoblasts [ 16 ]. Some scholars have pointed out that in the co-culture of MSCs and Mφ, the STAT3 signaling pathway may be a mechanism for MSCs to promote the anti-inflammatory phenotype of Mφ [ 63 ]. In addition, ERK has also been reported in the ephrin and Eph signaling pathway [ 25 ]. Western blot analysis of the NVP-BHG712-treated co-culture system demonstrated significant downregulation of STAT3 protein expression ( p < 0.05 ) compared to untreated controls, while ERK1/2 levels remained unchanged, indicating selective inhibition of the STAT3 pathway during EphB4-mediated hPDLSC-Mφ crosstalk. qPCR and ELISA analyses revealed significantly elevated IL-1β, IL-10, and CD206 expression in treated groups versus controls ( p < 0.05 ), indicating EphB4 inhibition promotes M1 rather than M2 polarization. These findings collectively demonstrated that direct Mφ-hPDLSC contact enhanced osteogenic differentiation and immunomodulation, with EphB4/ephrinB2 signaling mediating these effects through STAT3 pathway activation (Fig. 7 ). As a bidirectional signaling pathway expressed on both cell types, the precise directional regulation of EphB4/ephrinB2 in Mφ-hPDLSC crosstalk remains to be elucidated. Future studies should employ lentiviral-mediated knockdown of EphB4 or ephrinB2 in each cell type to determine which ligand-receptor pair drives hPDLSC osteogenesis and M2 polarization. Additionally, in vivo validation is essential to confirm the translational relevance of these interactions. Conclusions In conclusion, our findings demonstrate that direct M0-Mφ/hPDLSC contact reciprocally enhances M2 polarization and osteogenic differentiation, thus revealing an intrinsic link between immunomodulation and bone formation. Mechanistically, the EphB4/ephrinB2 pathway mediates this crosstalk by activating STAT3-dependent osteogenic signaling. This work elucidates the dual role of EphB4/ephrinB2 in coordinating macrophage polarization and hPDLSC differentiation, providing a molecular framework for developing targeted periodontal regeneration strategies. Abbreviations hPDLSCs Human periodontal ligament stem cells THP-1 Human acute mononuclear leukemia cell Mφ Macrophage M1- Mφ Classically activated macrophages M2- Mφ Alternatively activated macrophage PMA Phorbol-12-myristate-13-acetate RPMI Roswell Park Memorial Institute α-MEM Alpha-modified Eagle’s medium FBS Fetal bovine serum PBS Phosphate buffer solution ALP Alkaline phosphatase RunX2 Runt-related transcription factor 2 OCN Osteocalcin OPN Osteopontin TNF-α Tumor necrosis factor-alpha IL-1β Interleukin-1β TGF-β1 Transforming growth factor-β IL-10 Interleukin-10 CD206 Cluster of differentiation 206 Eph Erythropoietin-producing hepatocyte receptor Ephrin Eph ligand ERK1/2 Etracellular regulated protein kinases STAT3 Signal transducer and activator of transcription 3 RT-qPCR Real-time quantitative polymerase chain reaction ELISA Enzyme linked immunosorbent assay Declarations Acknowledgements The authors wish to thank the staff and participants of the study. The authors declare that they have not use AI-generated work in this manuscript in this section. Author contributions Xiaoqian Yang contributed to the experimental design, performed the whole experiments, analyzed the data and wrote the original draft; Yijun Luan, Huaze Ren and Qiuyue Yin performed the hPDLSCs culture and identification experiments; Hongrui Liu and Jiling Qiu contributed to the experimental design; Hui Song and Aimei Song guided the research, reviewed and edited the manuscript. Aimei Song also served as the principal investigator of the funding project that supported this study. All authors have read and agreed to the published version of the manuscript. Funding This work was supported by Natural Science Foundation of Shandong Province (ZR2020MH184) and National Clinical Key Specialty (Periodontology) Construction Project. Data availability The datasets used and/or analyzed during the current study are included in this published article or available from the corresponding author upon reasonable request. Ethics approval and consent to participate All experiments were approved by the Shandong University Clinical Ethical Committee under this project “EphB4/EphrinB2 mediated interaction between periodontal ligament stem cells and macrophages and its application in periodontal inflammation control and tissue regeneration in experimental periodontitis model”. The approval number is NO.20191113. The approval date for these experiments is 2019-11-11. Consent for publication All authors have read and agreed to the published version of the manuscript. Competing interests The authors declare no competing interests. Author details 1 Department of Periodontology, School and Hospital of Stomatology, Cheeloo College of Medicine, Shandong University & Shandong Key Laboratory of Oral Tissue Regeneration & Shandong Engineering Research Center of Dental Materials and Oral Tissue Regeneration & Shandong Provincial Clinical Research Center for Oral Diseases, No.44-1 Wenhua Road West, Jinan 250012, Shandong, China. 2 Department of Stomatology, Zhongshan Hospital of Xiamen University, Xiamen University, No.201-209, Hubinnan Road, Siming District, Xiamen 361004, Fujian, China. 3 Department of Oral Medicine, Qilu Hospital of Shandong University, No.107 West Wenhua Road, Jinan 250012, Shandong, China. 4 Department of Stomatology, The First Affiliated Hospital of Shandong First Medical University & Shandong Provincial Qianfoshan Hospital, No.16766, Jingshi Road, Jinan 250014, Shandong, China 5 Weifang People’s Hospital, Shandong Second Medical University, No.151, Guangwen Street, Kuiwen District, Weifang 261000, Shandong, China 6 Department of Health Care (Department of General Dentistry Ⅱ), School and Hospital of Stomatology, Cheeloo College of Medicine, Shandong University & Shandong Key Laboratory of Oral Tissue Regeneration & Shandong Engineering Research Center of Dental Materials and Oral Tissue Regeneration & Shandong Provincial Clinical Research Center for Oral Diseases, No.44-1 Wenhua Road West, Jinan 250012, Shandong, China. References Herrera D, Sanz M, Shapira L, Jepsen S, Blanco J, Sanz M, et al. Association between periodontal diseases and cardiovascular diseases, diabetes and respiratory diseases: Consensus report of the Joint Workshop by the European Federation of Periodontology (EFP) and the European arm of the World Organization of Family Doctors (WONCA Europe). J Clin Periodontol. 2023;50(6):819–41. https://doi.org/10.1111/jcpe.13807 . Shariati A, Nemati R, Sadeghipour Y, Hazrati A, Hosseini S, Eslaminejad MB, et al. Mesenchymal stromal cells (MSCs) for neurodegenerative disease: A promising frontier. Eur J Cell Biol. 2020;99(6):151097. https://doi.org/10.1016/j.ejcb.2020.151097 . Maqsood M, Kang M, Wu X, Chen J, Teng L, Qiu L. Adult mesenchymal stem cells and their exosomes: Sources, characteristics, and application in regenerative medicine. Life Sci. 2020;256:118002. https://doi.org/10.1016/j.lfs.2020.118002 . Yang XQ, Song AM, Song H. Co-culture technology of mesenchymal stem cells and macrophages. Chin J Tissue Eng Res. 2024;28(31):5055–62. https://doi.org/10.12307/2024.706 . Tomokiyo A, Wada N, Maeda H. Periodontal ligament stem cells: regenerative potency in periodontium. Stem Cells Dev. 2019;28(15):974–85. https://doi.org/10.1089/scd.2019.0031 . Julier Z, Park AJ, Briquez PS, Martino MM. Promoting tissue regeneration by modulating the immune system. Acta Biomater. 2017;53:13–28. https://doi.org/10.1016/j.actbio.2017.01.056 . Abnave P, Ghigo E. Role of the immune system in regeneration and its dynamic interplay with adult stem cells. Semin Cell Dev Biol. 2019;87:160–8. https://doi.org/10.1016/j.semcdb.2018.04.002 . Yang N, Liu Y. The role of the immune microenvironment in bone regeneration. Int J Med Sci. 2021;18(16):3697–707. https://doi.org/10.7150/ijms.61080 . Wang M, Chen F, Wang J, Chen X, Zhang H, Cao W, et al. Calcium phosphate altered the cytokine secretion of macrophages and influenced the homing of mesenchymal stem cells. J Mater Chem B. 2018;6(29):4765–74. https://doi.org/10.1039/c8tb01201f . Teo KYW, Zhang S, Loh JT, Lai RC, Lim SK, Chen Q, et al. Mesenchymal stromal cell exosomes mediate M2-like macrophage polarization through CD73/ecto-5′-nucleotidase activity. Pharmaceutics. 2023;15(5):1489. https://doi.org/10.3390/pharmaceutics15051489 . Atri C, Guerfali FZ, Laouini D. Role of human macrophage polarization in inflammation during infectious diseases. Int J Mol Sci. 2018;19(6):1801. https://doi.org/10.3390/ijms19061801 . Murray PJ, Allen JE, Biswas SK, Fisher EA, Gilroy DW, Goerdt S, et al. Macrophage activation and polarization: nomenclature and experimental guidelines. Immunity. 2014;41(1):14–20. https://doi.org/10.1016/j.immuni.2014.06.008 . Sica A, Mantovani A. Macrophage plasticity and polarization: in vivo veritas. J Clin Invest. 2012;122(3):787–95. https://doi.org/10.1172/JCI59643 . Martinez FO, Helming L, Gordon S. Alternative activation of macrophages: an immunologic functional perspective. Annu Rev Immunol. 2009;27:451–83. https://doi.org/10.1146/annurev.immunol.021908.132532 . Galván-Peña S, O’Neill LAJ. Metabolic reprograming in macrophage polarization. Front Immunol. 2014;5:420. https://doi.org/10.3389/fimmu.2014.00420 . He X, Dong Z, Cao Y, Wang H, Liu S, Liao L, et al. MSC-derived exosome promotes M2 polarization and enhances cutaneous wound healing. Stem Cells Int. 2019;2019:7132708. https://doi.org/10.1155/2019/7132708 . Pajarinen J, Lin T, Gibon E, Kohno Y, Maruyama M, Nathan K, et al. Mesenchymal stem cell-macrophage crosstalk and bone healing. Biomaterials. 2019;196:80–9. https://doi.org/10.1016/j.biomaterials.2017.12.025 . Lu D, Xu Y, Liu Q, Zhang Q. Mesenchymal stem cell-macrophage crosstalk and maintenance of inflammatory microenvironment homeostasis. Front Cell Dev Biology. 2021;9:681171. https://doi.org/10.3389/fcell.2021.681171 . Lu LY, Loi F, Nathan K, Lin TH, Pajarinen J, Gibon E, et al. Pro-inflammatory M1 macrophages promote osteogenesis by mesenchymal stem cells via the COX-2-prostaglandin E2 pathway. J Orthop Res. 2017;35(11):2378–85. https://doi.org/10.1002/jor.23553 . Li Y, Zhang D, Xu L, Dong L, Zheng J, Lin Y, et al. Cell–cell contact with proinflammatory macrophages enhances the immunotherapeutic effect of mesenchymal stem cells in two abortion models. Cell Mol Immunol. 2019;16(12):908–20. https://doi.org/10.1038/s41423-019-0204-6 . Liu H, Yang R, Zhao S, Li J, Wang Y, Zhang X, et al. Collagen scaffolds derived from bovine skin loaded with MSC optimized M1 macrophages remodeling and chronic diabetic wounds healing. Bioeng Translational Med. 2023;8(3):e10467. https://doi.org/10.1002/btm2.10467 . Nicolaidou V, Wong MM, Redpath AN, Ersek A, Baban DF, Williams LM, et al. Monocytes induce STAT3 activation in human mesenchymal stem cells to promote osteoblast formation. PLoS ONE. 2012;7(7):e39871. https://doi.org/10.1371/journal.pone.0039871 . Luo M, Jiao Y, Gong W, Li J, Liu H, Chen X. Macrophages enhance mesenchymal stem cell osteogenesis via down-regulation of reactive oxygen species. J Dent. 2020;94:103297. https://doi.org/10.1016/j.jdent.2020.103297 . Salvucci O, Tosato G. Essential roles of EphB receptors and EphrinB ligands in endothelial cell function and angiogenesis. Adv Cancer Res. 2012;114:21–57. https://doi.org/10.1016/B978-0-12-386503-8.00002-8 . Pitulescu ME, Adams RH. Eph/ephrin molecules—a hub for signaling and endocytosis. Genes Dev. 2010;24(22):2480–92. https://doi.org/10.1101/gad.1973910 . Egea J, Klein R. Bidirectional Eph–ephrin signaling during axon guidance. Trends Cell Biol. 2007;17(5):230–8. https://doi.org/10.1016/j.tcb.2007.03.004 . Park I, Lee HS. EphB/ephrinB signaling in cell adhesion and migration. Mol Cells. 2015;38(1):14–9. https://doi.org/10.14348/molcells.2015.2116 . Chrencik JE, Brooun A, Recht MI, Kraus ML, Koolpe M, Kolatkar AR, et al. Structure and thermodynamic characterization of the EphB4/Ephrin-B2 antagonist peptide complex reveals the determinants for receptor specificity. Structure. 2006;14(2):321–30. https://doi.org/10.1016/j.str.2005.11.011 . Pasquale EB. Eph receptors and ephrins in cancer: bidirectional signalling and beyond. Nat Rev Cancer. 2010;10(3):165–80. https://doi.org/10.1038/nrc2806 . Cunningham F, Amode MR, Barrell D, Beal K, Billis K, Brent S, et al. Ensembl 2015. Nucleic Acids Res. 2015;43(D1):D662–9. https://doi.org/10.1093/nar/gku1010 . Zhao C, Irie N, Takada Y, Shimoda K, Miyamoto T, Nishiwaki T, et al. Bidirectional ephrinB2-EphB4 signaling controls bone homeostasis. Cell Metabol. 2006;4(2):111–21. https://doi.org/10.1016/j.cmet.2006.05.012 . Allan EH, Häusler KD, Wei T, Gooi JH, Quinn JM, Crimeen-Irwin B, et al. EphrinB2 regulation by PTH and PTHrP revealed by molecular profiling in differentiating osteoblasts. J Bone Miner Res. 2008;23(8):1170–81. https://doi.org/10.1359/jbmr.080324 . Wang L, Zhang J, Wang C, Qi Y, Du M, Liu W, et al. Low concentrations of TNF-α promote osteogenic differentiation via activation of the ephrinB2-EphB4 signalling pathway. Cell Prolif. 2017;50(1):e12311. https://doi.org/10.1111/cpr.12311 . Zhu SY, Wang PL, Liao CS, Huang GT, Lin YL, Yang YC, et al. Transgenic expression of ephrinB2 in periodontal ligament stem cells (PDLSCs) modulates osteogenic differentiation via signaling crosstalk between ephrinB2 and EphB4 in PDLSCs and between PDLSCs and pre-osteoblasts within co-culture. J Periodontal Res. 2017;52(3):562–73. https://doi.org/10.1111/jre.12424 . Sakamoto A, Sugamoto Y, Tokunaga Y, Yoshimuta T, Hayashi K, Konno T, et al. Expression profiling of the ephrin (EFN) and Eph receptor (EPH) family of genes in atherosclerosis-related human cells. J Int Med Res. 2011;39(2):522–7. https://doi.org/10.1177/147323001103900220 . Li C, Shi C, Kim J, Chen Y, Ni S, Jiang L, et al. Erythropoietin promotes bone formation through EphrinB2/EphB4 signaling. J Dent Res. 2015;94(3):455–63. https://doi.org/10.1177/0022034514566431 . Sheedy FJ, Palsson-McDermott E, Hennessy EJ, Martin C, O’Leary JJ, Ruan Q, et al. Negative regulation of TLR4 via targeting of the proinflammatory tumor suppressor PDCD4 by the microRNA miR-21. Nat Immunol. 2010;11(2):141–7. https://doi.org/10.1038/ni.1828 . Brooks SA, Blackshear PJ. Tristetraprolin (TTP): interactions with mRNA and proteins, and current thoughts on mechanisms of action. Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms. 2013;1829(6–7):666–79. https://doi.org/10.1016/j.bbagrm.2013.02.003 Lo RS, Massagué J. Ubiquitin-dependent degradation of TGF-beta-activated smad2. Nat Cell Biol. 1999;1(8):472–8. https://doi.org/10.1038/70258 . Glickman MH, Ciechanover A. The ubiquitin-proteasome proteolytic pathway: destruction for the sake of construction. Physiol Rev. 2002;82(2):373–428. https://doi.org/10.1152/physrev.00027.2001 . Fleetwood AJ, Dinh H, Cook AD, Hertzog PJ, Hamilton JA. GM-CSF- and M-CSF-dependent macrophage phenotypes display differential dependence on type I interferon signaling. J Leukoc Biol. 2009;86(2):411–21. https://doi.org/10.1189/jlb.1108702 . Martinez FO, Sica A, Mantovani A, Locati M. Macrophage activation and polarization. Front Bioscience-Landmark. 2008;13(2):453–61. https://doi.org/10.2741/2692 . Gordon S. Alternative activation of macrophages. Nat Rev Immunol. 2003;3(1):23–35. https://doi.org/10.1038/nri978 . Gonzalez OA, Novak MJ, Kirakodu S, Stromberg A, Nagarajan R, Huang CB, et al. Differential gene expression profiles reflecting macrophage polarization in aging and periodontitis gingival tissues. Immunol Investig. 2015;44(7):643–64. https://doi.org/10.3109/08820139.2015.1070269 . Liang H, Chen B, He S, Xie X, Yan F. Distribution and proportion of M1/M2 macrophages in periodontal tissues in rats with and without periodontitis. J Prev Treat Stomatological Dis. 2018;26(10):627–33. https://doi.org/10.12016/j.issn.2096-1456.2018.10.003 . Zhuang Z, Yoshizawa-Smith S, Glowacki A, Maltos K, Pacheco C, Shehabeldin M, et al. Induction of M2 macrophages prevents bone loss in murine periodontitis models. J Dent Res. 2019;98(2):200–8. https://doi.org/10.1177/0022034518805984 . Golub LM, Lee HM. Periodontal therapeutics: Current host-modulation agents and future directions. Periodontol 2000. 2020;82(1):186–204. https://doi.org/10.1111/prd.12315 . Liu D, Xu J, Liu O, Fan Z, Liu Y, Wang F, et al. Mesenchymal stem cells derived from inflamed periodontal ligaments exhibit impaired immunomodulation. J Clin Periodontol. 2012;39(12):1174–82. https://doi.org/10.1111/jcpe.12009 . Zhang Y, Böse T, Unger RE, Jansen JA, Kirkpatrick CJ, van den Beucken JJ. Macrophage type modulates osteogenic differentiation of adipose tissue MSCs. Cell Tissue Res. 2017;369(2):273–86. https://doi.org/10.1007/s00441-017-2598-8 . Gao H, Zhang Q, Chen L, Han X, Yang L, Zheng X, et al. The expression pattern of cytokines in mesenchymal stem cells and macrophages co-cultured system. Immunological J. 2017;33(11):930–6. https://link.oversea.cnki.net/doi/10.13431/j.cnki.immunol.j.20170163 . Romero-López M, Li Z, Rhee C, Maruyama M, Duldulao C, Westendorf JJ, et al. Macrophage effects on mesenchymal stem cell osteogenesis in a three-dimensional in vitro bone model. Tissue Eng Part A. 2020;26(19–20):1099–111. https://doi.org/10.1089/ten.TEA.2020.0041 . Tang H, Husch JFA, Zhang Y, Jansen JA, Beucken JJJP, Yang F. Coculture with monocytes/macrophages modulates osteogenic differentiation of adipose-derived mesenchymal stromal cells on poly(lactic-co-glycolic) acid/polycaprolactone scaffolds. J Tissue Eng Regen Med. 2019;13(5):785–98. https://doi.org/10.1002/term.2826 . Tang H, Zhang Y, Jansen JA, Beucken JJJP. Effect of monocytes/macrophages on the osteogenic differentiation of adipose-derived mesenchymal stromal cells in 3D co-culture spheroids. Tissue Cell. 2017;49(4):461–9. https://doi.org/10.1016/j.tice.2017.06.002 . Yuan Y, Ni S, Zhuge A, Li B, Li C. Adipose-derived mesenchymal stem cells reprogram M1 macrophage metabolism via PHD2/HIF-1α pathway in colitis mice. Front Immunol. 2022;13:859806. https://doi.org/10.3389/fimmu.2022.859806 . Yao H, Yuan X, Wu Z, Du M, Jin Y, Luo J, et al. Fabrication and performance evaluation of gelatin/sodium alginate hydrogel-based macrophage and MSC cell-encapsulated paracrine system with potential application in wound healing. Int J Mol Sci. 2023;24(2):1240. https://doi.org/10.3390/ijms24021240 . Lawrence TS, Beers WH, Gilula NB. Transmission of hormonal stimulation by cell-to-cell communication. Nature. 1978;272(5653):501–6. https://doi.org/10.1038/272501a0 . Xie L, Meng R, Shang P. Application of Cells Co-culture Technique in Bone Tissue Biology. Chin J Cell Biology. 2013;35(2):216–23. Zhang C, Zhang D, Xu W. Cell co-culture system of dental pulp regenerative tissue engineering. Chin J Tissue Eng Res. 2023;27(15):2379–84. https://doi.org/10.12307/2023.376 . Cao C, Huang Y, Tang Q, Zhang C, Li Z, Yang L, et al. Bidirectional juxtacrine ephrinB2/Ephs signaling promotes angiogenesis of ECs and maintains self-renewal of MSCs. Biomaterials. 2018;172:1–13. https://doi.org/10.1016/j.biomaterials.2018.04.042 . Arthur A, Zannettino A, Panagopoulos R, Koblar SA, Sims NA, Stylianou C, et al. EphB/ephrin-B interactions mediate human MSC attachment, migration and osteochondral differentiation. Bone. 2011;48(3):533–42. https://doi.org/10.1016/j.bone.2010.10.180 . Zuo C, Huang Y, Bajis R, Sahih M, Li YF, Altawil R, et al. Osteoblastogenesis regulation signals in bone remodeling. Osteoporos Int. 2012;23:1653–63. https://doi.org/10.1007/s00198-012-1909-x . Martiny-Baron G, Holzer P, Billy E, Schnell C, Brueggen J, Ferretti M, et al. The small molecule specific EphB4 kinase inhibitor NVP-BHG712 inhibits VEGF driven angiogenesis. Angiogenesis. 2010;13:259–67. https://doi.org/10.1007/s10456-010-9183-z . Gur-Wahnon D, Borovsky Z, Beyth S, Liebergall M, Rachmilewitz J. Contact-dependent induction of regulatory antigen-presenting cells by human mesenchymal stem cells is mediated via STAT3 signaling. Exp Hematol. 2007;35(3):426–33. https://doi.org/10.1016/j.exphem.2006.11.001 . Additional Declarations No competing interests reported. Supplementary Files SupplementaryMaterial1.doc Cite Share Download PDF Status: Published Journal Publication published 02 Mar, 2026 Read the published version in Stem Cell Research & Therapy → Version 1 posted Editorial decision: Revision requested 10 Dec, 2025 Reviews received at journal 09 Dec, 2025 Reviews received at journal 06 Dec, 2025 Reviews received at journal 27 Nov, 2025 Reviewers agreed at journal 25 Nov, 2025 Reviews received at journal 21 Nov, 2025 Reviewers agreed at journal 19 Nov, 2025 Reviewers agreed at journal 19 Nov, 2025 Reviewers agreed at journal 17 Nov, 2025 Reviewers agreed at journal 17 Nov, 2025 Reviewers agreed at journal 17 Nov, 2025 Reviewers agreed at journal 13 Oct, 2025 Reviewers invited by journal 13 Oct, 2025 Editor assigned by journal 27 Aug, 2025 Submission checks completed at journal 27 Aug, 2025 First submitted to journal 25 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7457833","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":533944179,"identity":"2d5d4961-9161-4a45-8437-b92c7c7339d7","order_by":0,"name":"Xiaoqian Yang","email":"","orcid":"","institution":"Department of Periodontology, School and Hospital of Stomatology, Cheeloo College of Medicine, Shandong University \u0026 Shandong Key Laboratory of Oral Tissue Regeneration","correspondingAuthor":false,"prefix":"","firstName":"Xiaoqian","middleName":"","lastName":"Yang","suffix":""},{"id":533944180,"identity":"215fe295-0868-4dc0-aa32-a2a55bb508c2","order_by":1,"name":"Yijun Luan","email":"","orcid":"","institution":"Department of Periodontology, School and Hospital of Stomatology, Cheeloo College of Medicine, Shandong University \u0026 Shandong Key Laboratory of Oral Tissue Regeneration","correspondingAuthor":false,"prefix":"","firstName":"Yijun","middleName":"","lastName":"Luan","suffix":""},{"id":533944181,"identity":"9e59a026-4181-472e-ac9b-a3f54dbb41e3","order_by":2,"name":"Jiling Qiu","email":"","orcid":"","institution":"Department of Stomatology, The First Affiliated Hospital of Shandong First Medical University \u0026 Shandong Provincial Qianfoshan Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jiling","middleName":"","lastName":"Qiu","suffix":""},{"id":533944182,"identity":"02254134-9e95-4548-9619-095434c12fb3","order_by":3,"name":"Huaze Ren","email":"","orcid":"","institution":"Department of Periodontology, School and Hospital of Stomatology, Cheeloo College of Medicine, Shandong University \u0026 Shandong Key Laboratory of Oral Tissue Regeneration","correspondingAuthor":false,"prefix":"","firstName":"Huaze","middleName":"","lastName":"Ren","suffix":""},{"id":533944183,"identity":"bcc10fac-585e-4ec8-8de5-f7f907402ae2","order_by":4,"name":"Qiuyue Yin","email":"","orcid":"","institution":"Department of Periodontology, School and Hospital of Stomatology, Cheeloo College of Medicine, Shandong University \u0026 Shandong Key Laboratory of Oral Tissue Regeneration","correspondingAuthor":false,"prefix":"","firstName":"Qiuyue","middleName":"","lastName":"Yin","suffix":""},{"id":533944184,"identity":"636cb04b-38fd-43a6-bcca-2dec338139bd","order_by":5,"name":"Hongrui Liu","email":"","orcid":"","institution":"Department of Periodontology, School and Hospital of Stomatology, Cheeloo College of Medicine, Shandong University \u0026 Shandong Key Laboratory of Oral Tissue Regeneration","correspondingAuthor":false,"prefix":"","firstName":"Hongrui","middleName":"","lastName":"Liu","suffix":""},{"id":533944185,"identity":"31656081-9cd2-41ce-a142-5d5816f37565","order_by":6,"name":"Hui Song","email":"","orcid":"","institution":"Department of Health Care (Department of General Dentistry Ⅱ), School and Hospital of Stomatology, Cheeloo College of Medicine, Shandong University","correspondingAuthor":false,"prefix":"","firstName":"Hui","middleName":"","lastName":"Song","suffix":""},{"id":533944186,"identity":"a72e1149-ad7b-4b85-a2b8-5cee736c5a8d","order_by":7,"name":"Aimei Song","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA00lEQVRIie3OvQrCMBSG4VMKnSKumdpbiDjqxUQEuzTg1DmTXQTXioK3EPEGEjJaOndwcHJqod1c/Mnoom03hzwQyHBe+AAs60/J5jn1Aaj5et0KR6XeYtwrcTXy9Ix3ToLkTDVCbnhIIgJ1rGG4478TkjGh9thjIiuJk+Ya8EW2JMCELAliAkfEHaw0EExbhm0qIRHFYZCa5NElgcIMQ5JQKEzidElIUQm15XQksttSrfMQ4aJ1GDvVDX8FQTI/Xu/xxB+mbcM+SfNQj3vLsizrmze3dUlQhqx1vQAAAABJRU5ErkJggg==","orcid":"","institution":"Department of Periodontology, School and Hospital of Stomatology, Cheeloo College of Medicine, Shandong University \u0026 Shandong Key Laboratory of Oral Tissue Regeneration","correspondingAuthor":true,"prefix":"","firstName":"Aimei","middleName":"","lastName":"Song","suffix":""}],"badges":[],"createdAt":"2025-08-26 02:23:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7457833/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7457833/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13287-026-04946-1","type":"published","date":"2026-03-02T15:58:04+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":94490849,"identity":"0eef9286-a50f-40e6-9190-41eb069bb8c3","added_by":"auto","created_at":"2025-10-27 17:17:24","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":109319460,"visible":true,"origin":"","legend":"","description":"","filename":"TheenhancedosteogenicdifferentiationofhumanperiodontalligamentstemcellsandM2polarizationofmacrophagesmaybemediatedbyEphB4ephrinB2signalingpathwayastudyoftheirdirectcoculture.docx","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/f1063a300ab4f002367b3595.docx"},{"id":94452738,"identity":"d5b61f49-5499-4449-886b-cc3770ab0967","added_by":"auto","created_at":"2025-10-27 14:41:43","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9874,"visible":true,"origin":"","legend":"","description":"","filename":"a3b8cd64ae7443c09a6b622575a64e89.json","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/cbf8159ec89cf3f120d5f709.json"},{"id":94453619,"identity":"b1ee6dc1-37f9-4559-91ff-55adb819557b","added_by":"auto","created_at":"2025-10-27 14:42:44","extension":"doc","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2541568,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial1.doc","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/6ba2cfcb927f753759d9501a.doc"},{"id":94453602,"identity":"9a9b1fcb-137c-4830-8e54-0ffc2a437a14","added_by":"auto","created_at":"2025-10-27 14:42:42","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":164110,"visible":true,"origin":"","legend":"","description":"","filename":"a3b8cd64ae7443c09a6b622575a64e891enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/823e8fdf2fdf6eff3d37e651.xml"},{"id":94490910,"identity":"d97096ee-0176-4f7e-b8e6-5d84987bf033","added_by":"auto","created_at":"2025-10-27 17:18:23","extension":"emf","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10631256,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.emf","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/9952d1a66d41d2e7dda6348a.emf"},{"id":94453588,"identity":"08711fb6-d853-4386-92e8-877a588d117d","added_by":"auto","created_at":"2025-10-27 14:42:41","extension":"emf","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22934700,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.emf","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/0cdf682d149508cf1d2211cd.emf"},{"id":94490857,"identity":"f0dcfd19-e3b4-47c6-a918-45d6e2c2ab17","added_by":"auto","created_at":"2025-10-27 17:17:39","extension":"emf","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11698272,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.emf","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/f5b0bee4973ab6602e7d4793.emf"},{"id":94452847,"identity":"c5e71b0a-21f4-4930-bb4e-b8ee0d7e4a9c","added_by":"auto","created_at":"2025-10-27 14:42:00","extension":"emf","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":64976620,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.emf","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/d74018d5b66dfa25c70e0497.emf"},{"id":94452617,"identity":"e79fad87-152e-4fd4-8236-2f0c8cf0c46d","added_by":"auto","created_at":"2025-10-27 14:41:27","extension":"emf","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":47956360,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.emf","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/61142cccefaec15e089b90c5.emf"},{"id":94452809,"identity":"e54de9cf-fd20-4898-b587-7b9d3307640a","added_by":"auto","created_at":"2025-10-27 14:41:50","extension":"emf","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":28493760,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.emf","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/c6030956626630e1d6d06252.emf"},{"id":94452351,"identity":"9c4ab86b-3852-484c-9a09-91ffbeb427e4","added_by":"auto","created_at":"2025-10-27 14:41:01","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":92840,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/23744f3deabf0a1664e3f00d.jpeg"},{"id":94453295,"identity":"6891974d-c6bf-4e11-a7c6-d0388bf24cb7","added_by":"auto","created_at":"2025-10-27 14:42:26","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1614227,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/eea18750863a775ad25a152b.png"},{"id":94453721,"identity":"ee1df1a1-8275-4622-9223-c3d33b3fa11d","added_by":"auto","created_at":"2025-10-27 14:42:50","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1697649,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/2bb9e0a4ca5a59f003d55872.png"},{"id":94452742,"identity":"8474f047-5467-4632-873c-08cc69962998","added_by":"auto","created_at":"2025-10-27 14:41:43","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1737315,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/e8691683bb22156b968ccd0c.png"},{"id":94452849,"identity":"28ac0b2f-71d1-4f34-b109-07c9b2b151bf","added_by":"auto","created_at":"2025-10-27 14:42:00","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1292244,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/da47768569b495e5b3e630f3.png"},{"id":94453339,"identity":"7f606914-8fa3-43ee-b148-6c0f3a390b32","added_by":"auto","created_at":"2025-10-27 14:42:27","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":455844,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/364d8767a7868ff75b9ba503.png"},{"id":94453728,"identity":"2fb6d444-c8e2-414b-83a5-16e2e8b19889","added_by":"auto","created_at":"2025-10-27 14:42:51","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1829472,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/be734052498632f02a22c93e.png"},{"id":94453274,"identity":"b18203b5-55be-4ef7-a221-12a0ac33b047","added_by":"auto","created_at":"2025-10-27 14:42:23","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":32355,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/cc8680f5666a9856e03dfc91.png"},{"id":94453031,"identity":"86fabcc3-4b78-483e-8ead-c8618148bc6c","added_by":"auto","created_at":"2025-10-27 14:42:12","extension":"xml","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":165057,"visible":true,"origin":"","legend":"","description":"","filename":"a3b8cd64ae7443c09a6b622575a64e891structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/1c3f125eac4e656a2edcd560.xml"},{"id":94452343,"identity":"79705e70-5060-4870-b1fa-c3de98593fcb","added_by":"auto","created_at":"2025-10-27 14:41:00","extension":"html","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":175999,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/a8042b516505fb4d0b50ea04.html"},{"id":94452995,"identity":"bda1e3b6-1869-49ec-8cbe-cb0cd0716c9a","added_by":"auto","created_at":"2025-10-27 14:42:08","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":585843,"visible":true,"origin":"","legend":"\u003cp\u003eIdentification of hPDLSCs and macrophages. (A) hPDLSCs were acquired by the limited dilution method from periodontal ligament. (a) After crystal violet staining, cell clones scattered at the bottom of the large culture dish were visible to the naked eye after 14 days of culture. (b) Magnification of the cell clones in Fig.1A(a), one clone was present here; scale bar =200 μm. (B) hPDLSCs showed positive Alizarin Red staining; scale bar =100 μm. (C) hPDLSCs showed positive Oil Red O staining; scale bar =50 μm. (D) hPDLSCs positively expressed CD44 (98.6%), CD73 (99.2%), CD90 (97.0%), and negatively expressed CD34 (0.82%), CD45 (0.13%). (E) Vimentin staining for hPDLSCs was positive; scale bar =100 μm. However, cytokeratin staining was negative for hPDLSCs; scale bar =100 μm. (F) THP-1 grew in suspension manner; scale bar =100 μm. (G) THP-1 was induced by PMA into M0-type macrophages and the cells grew adherently; scale bar =100 μm. (H) The surface marker CD11b of M0-Mφ was identified.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/4cd635986b295260692d4159.png"},{"id":94452953,"identity":"9b5807ac-8aad-4b17-84f9-f50c4b50ce29","added_by":"auto","created_at":"2025-10-27 14:42:04","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":328804,"visible":true,"origin":"","legend":"\u003cp\u003eThe influence of co-culture on the osteogenic differentiation of hPDLSCs. (A) The effect of co-culture of M0-Mφ and hPDLSCs on the mRNA expression of osteogenesis-related factors of hPDLSCs. (B) BCIP/NBT staining and quantitative detection of ALP activity; scale bar =200 μm. (C) Alizarin red staining and calcium content detection; scale bar =200 μm. (n = 3; *: \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, the comparison between Monoculture and Co-culture; $: \u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05, comparison within the Monoculture group; #: \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05, comparison within the Co-culture group).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/b75e93d346ced22b921ea710.png"},{"id":94452735,"identity":"c3f8058a-d747-4bfb-b874-42ec415ec53f","added_by":"auto","created_at":"2025-10-27 14:41:42","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":534087,"visible":true,"origin":"","legend":"\u003cp\u003eThe influence of co-culture on the polarization of Mφ. (A) The growth state of Mφ. (B) The influence of direct co-culture for 3 days on the expression levels of Mφ polarization marker-related factors. (C) The influence of different co-culture times on the expression levels of Mφ polarization marker-related factors. (n = 3; *: \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/7554f9259a83097efcd38607.png"},{"id":94453138,"identity":"5edd4221-02de-4d06-95a9-aafa5da443dc","added_by":"auto","created_at":"2025-10-27 14:42:13","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":260058,"visible":true,"origin":"","legend":"\u003cp\u003eThe influence of different co-culture ratios on the osteogenic differentiation of hPDLSCs and the polarization of Mφ. (A) The influence of different co-culture ratios on the mRNA expression levels of osteogenesis-related factors of hPDLSCs. (B) BCIP/NBT staining and quantitative detection of ALP activity at different co-culture ratios; scale bar =200 μm. (C) The influence of different co-culture ratios on the mRNA expression levels of Mφ marker-related factors in direct co-culture for 7 days. (D) The influence of different co-culture ratios on the secretion of Mφ polarization-related cytokines in direct co-culture for 7 days. (n = 3; *: \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/31ed8d1cd504e3f33e4c9aaa.png"},{"id":94452838,"identity":"f6d7ffb2-4190-48f0-834c-cd0bef6ab2de","added_by":"auto","created_at":"2025-10-27 14:41:59","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":184390,"visible":true,"origin":"","legend":"\u003cp\u003eThe influence of co-culture of M0-Mφ and hPDLSCs on the expression of EphB4/ephrinB2. (A) Protein localization of EphB4/ephrinB2 in hPDLSCs in vitro; scale bar = 100 μm. (B) Protein localization of EphB4/ephrinB2 in M0-Mφ in vitro; scale bar = 50 μm. (C) mRNA expression of EphB4 and ephrinB2 during osteogenic differentiation of hPDLSCs. (D) Protein expression of EphB4 and ephrinB2 during osteogenic differentiation of hPDLSCs. (E) Quantitative results of protein expression of EphB4 and ephrinB2 during osteogenic differentiation of hPDLSCs. (F) mRNA expression of EphB4 and ephrinB2 in M0-Mφ and hPDLSCs at different direct co-culture times. (G) Protein expression of EphB4 and ephrinB2 in M0-Mφ and hPDLSCs at different direct co-culture times. (H) Quantitative results of protein expression of EphB4 and ephrinB2 in M0-Mφ and hPDLSCs at different direct co-culture times. (n = 3; *: \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/d35224f5b74b42b5fbdff7a2.png"},{"id":94453446,"identity":"4b440cca-2f8c-499a-bf59-71a5dfbe29ff","added_by":"auto","created_at":"2025-10-27 14:42:35","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":233047,"visible":true,"origin":"","legend":"\u003cp\u003eExperiment on the interaction between M0-Mφ and hPDLSCs mediated by EphB4/ephrinB2. (A) The effect of NVP-BHG712 on the cytotoxicity of hPDLSCs and M0 cells. (B) The influence of NVP-BHG712 on the mRNA expression levels of osteogenesis-related factors of hPDLSCs in direct co-culture for 3, 7, and 14 days. (C) BCIP/NBT staining and quantitative detection of ALP activity. (D) Alizarin red S staining and calcium content detection. (E) Protein expression of STAT3 in direct co-culture for 7 days with NVP-BHG712. (F) Quantitative results of protein expression of STAT3 in direct co-culture for 7 days with NVP-BHG712. (G) Protein expression of ERK1/2 in direct co-culture for 7 days with NVP-BHG712. (H) Quantitative results of protein expression of ERK1/2 in direct co-culture for 7 days with NVP-BHG712. (I) The influence of NVP-BHG712 on the mRNA expression levels of Mφ marker-related factors in direct co-culture for 7 days. (J) The influence of NVP-BHG712 on the secretion of Mφ polarization-related factors in direct co-culture for 7 days. (n = 3; *: \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, compared between NVP-BHG712(+) and NVP-BHG712(-); $: \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, comparison within the NVP-BHG712(-) group; #: P \u0026lt; 0.05, comparison within the NVP-BHG712(+) group).\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/c00e88f78668ccf02f605e54.png"},{"id":94453266,"identity":"85b9f661-6c6b-4f81-ac48-21aa288bc05f","added_by":"auto","created_at":"2025-10-27 14:42:22","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":178741,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic diagram of the mechanism of direct contact between macrophages and human periodontal ligament stem cells. Direct contact co-culture of M0-Mφ and hPDLSCs promotes the polarization of M2-Mφ and the osteogenic differentiation of hPDLSCs. The EphB4/ephrinB2 pathway may mediate the osteogenic differentiation of hPDLSCs via the STAT3 signaling pathway of osteogenic differentiation.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/ac6f81d26fe29c34be3cfbd8.png"},{"id":104250837,"identity":"2a15a5cf-6e52-49f8-9939-7bf06e54ba5c","added_by":"auto","created_at":"2026-03-09 16:09:40","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3277075,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/4f5c1a21-4cf4-40a6-8cd8-0cd02a9e293e.pdf"},{"id":94452739,"identity":"39e5efde-2639-42ef-ba6b-610032dddb18","added_by":"auto","created_at":"2025-10-27 14:41:43","extension":"doc","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":2541568,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial1.doc","url":"https://assets-eu.researchsquare.com/files/rs-7457833/v1/e6ecb79142b1cdb828b7ab2e.doc"}],"financialInterests":"No competing interests reported.","formattedTitle":"The enhanced osteogenic differentiation of human periodontal ligament stem cells and M2 polarization of macrophages may be mediated by EphB4/ephrinB2 signaling pathway: a study of their direct co-culture","fulltext":[{"header":"Background","content":"\u003cp\u003ePeriodontitis, a chronic inflammatory disease initiated by microbial infection, has become a major public health problem due to its high incidence rate [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In addition to the widely applied initial periodontal therapy, immunomodulation has been regarded as a potential combination strategy. Mesenchymal stem cells (MSCs) have been widely used in the field of tissue regeneration due to not only their multi-directional differentiation potential [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], but also their immunomodulatory ability. Although MSCs \u003cem\u003eper se\u003c/em\u003e are not part of the immune system, they can interact with immune cells to release anti-inflammatory or pro-inflammatory factors targeting effector cells for precise regulation in tissue repair in the wound area [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. MSCs are therefore increasingly receiving wide attention as candidates for the treatment of inflammatory diseases. Periodontal ligament stem cells (PDLSCs), as the ideal seed cells for periodontal tissue engineering, possess strong self-renewal capacity and multipotent differentiation potential. Moreover, they participate in innate immune regulation, making them the most critical functional cells in periodontal regeneration [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eRegulating the immune system to promote tissue regeneration is becoming a hot spot in the emerging research field of regenerative medicine [\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Among them, the interaction between MSCs and macrophages (Mφ) has been the focus of the research in recent years [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Mφ is an important component of the innate immune system, playing a critical role in host defense against invading pathogens and maintaining immune homeostasis. Macrophages are capable of plasticity. Studies have shown that macrophages can switch between classically activated macrophages (M1) and alternatively activated macrophages (M2) under the influence of local microenvironmental signals, and thus exert pro-inflammatory and anti-inflammatory effects, respectively [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The polarization state of Mφ dominates the occurrence, the development and the regression of inflammation [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The ratio of M1/M2 increases with the progression of the inflammation [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Gene expression profile analysis showed that M1 can release high levels of pro-inflammatory cytokines, including tumor necrosis factor-α (TNF-α), monocyte chemoattractant protein-1 (MCP-1), and interleukin-1 (IL-1) [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In contrast, M2 highly expresses CD206, chemokine receptor (CCR2), C-X-C chemokine receptor 1 (CXCR1) [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], and produces a large amount of interleukin-10 (IL-10) and arginase-1 (Arg-1), which plays an important role in tissue repair [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eMultiple studies have shown the importance of the cross-talk between MSCs and Mφ in tissue regeneration and repair [\u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The direct contact co-culture of Mφ and MSCs significantly enhanced the osteogenic differentiation and mineralization of MSCs [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. At the same time, the immunosuppressive ability of MSCs was increased and the polarization of Mφ to M2 type was promoted [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Paracrine signal has been investigated as one of the important pathway of the coculture-driven modulatory effect [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. However, more and more studies have proved that the direct cell-to-cell contact between MSCs and Mφ mediates the regulatory effect of the interaction. Nicolaidou et al [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]showed that the direct contact of MSCs and Mφ promoted the osteogenic differentiation of MSCs by the activation of STAT3 signaling pathway. Luo et al [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]found that direct contact had the stronger promoting effect on the osteogenic differentiation of MSCs than the paracrine pathway, suggesting that direct cell-to-cell contact be a more effective way to increase the communication between cells.\u003c/p\u003e\u003cp\u003eEphrins/Ephs pathway is a contact-dependent bidirectional signaling pathway [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], Ephrin receptors, the largest family of receptor tyrosine kinases in mammals, are widely studied in the cell-coculture research. Ephrin receptors can form bidirectional signals with transmembrane protein ephrins ligands. Generally, EphA receptors (EphA1-A8, A10) interact with ephrinA (ephrinA1-A5), and EphB receptors (EphB1-B6) interact with ephrinB ligands (ephrinB1-B3) [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The N-terminus of EphB4 has highly conserved characteristics. After binding to the extracellular domain structure of ephrinB2, the generated complex has the characteristic of enhancing the association between molecules [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The interaction between Eph receptors and ephrins ligands occurs with direct cell contact, by which a bidirectional signal transmission is promoted. Eph receptors initiate forward signal transmission into the cell, while ephrins ligands trigger reverse signal transmission inward [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. In this signaling pathway, the forward Eph signal depends on the active expression of Eph kinase, while the reverse ephrin signal depends on Src family kinases and other effector molecules [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSome studies revealed that the interaction between the EphB4 receptor on the osteoblast membrane and the ephrinB2 ligand on the osteoclast membrane can trigger bidirectional signal transmission and then influence the differentiation balance between osteoclasts and osteoblasts, indicating that EphB4/ephrinB2 plays an important role in maintaining bone homeostasis [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Wang et al. [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] found EphB4/ephrinB2 signal pathway can effectively enhance the osteogenic differentiation of osteoblast precursor cells by activating EphB4 through exogenous ephrinB2-fc. These findings revealed the extensive biological activity of EphB4 and ephrinB2 in multiple cell types. Studies have shown that both PDLSCs and Mφ expressed EphB4 and ephrinB2 [\u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. We therefore investigated if the EphB4/ephrinB2 signaling pathway play an important role in the interaction of co-cultured hPDLSCs and macrophages and the underlying possible mechnism.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eIsolation and culture of hPDLSCs\u003c/h2\u003e\u003cp\u003e This study was conducted with approval from the Ethics Committee of Hospital of Stomatology Shandong University (No. 20200706). Healthy premolars (n\u0026thinsp;=\u0026thinsp;8) were collected from orthodontic patients (16 to 24 years old) after obtaining informed consent. Periodontal ligament tissues were aseptically harvested from the middle third of the root, minced into 1-mm\u0026sup3; fragments, and cultured in alpha-modified Eagle\u0026rsquo;s medium (α-MEM; Biological Industries, Israel) containing 20% fetal bovine serum (FBS; Biological Industries, Israel), 2 mM glutamine and antibiotics (100 U/mL penicillin and 100 \u0026micro;g/mL streptomycin; Biosharp, China) at 37\u0026deg;C in 5% CO₂. Primary PDLSCs migrating from periodontal ligament explants were maintained in 10% FBS medium with biweekly medium changes. hPDLSCs were acquired by limiting dilution method.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eCloning formation experiment of hPDLSCs\u003c/h3\u003e\n\u003cp\u003eWhen cells growing out from the periodontal ligament tissue block reached 80% in the culture dish, they were trypsinized and resuspended in α-MEM medium supplemented with 10% FBS to prepare single-cell suspensions. The cell concentration was adjusted to 100 cells per milliliter and inoculated into 10-centimeter diameter culture dishes. The medium was changed every 2 to 3 days during the 14-day culture period. Following culture, cells were fixed with 4% paraformaldehyde for 15 minutes and subsequently stained with crystal violet for 20 minutes. Excessive staining solution was removed by washing with phosphate-buffered saline (PBS; Biosharp, China) three times. After air-drying at room temperature, cell clones were observed under the inverted microscope (NEXCOPE, USA), with a clone defined as containing\u0026thinsp;\u0026ge;\u0026thinsp;50 cells.\u003c/p\u003e\n\u003ch3\u003eMultilineage differentiation of hPDLSCs\u003c/h3\u003e\n\u003cp\u003ehPDLSCs in P3 were harvested and cultured in osteogenic differentiation medium (α-MEM supplemented with 10% FBS, 10 mmol/L β-glycerophosphate, 0.1 \u0026micro;mol/L dexamethasone and 0.05 mmol/L vitamin C) or adipogenic differentiation medium (α-MEM supplemented with 10% FBS, 200 \u0026micro;mol/L indomethacin, 10 \u0026micro;mol/L dexamethasone and 0.5 mmol/L IBMX) for 21 days. Then, cells were fixed and stained with Alizarin Red S (Solarbio, China) for osteogenic differentiation or Oil Red O (Solarbio, China) for adipogenic differentiation respectively. After air-drying at room temperature, staining results were examined macroscopically and microscopically with representative images captured for documentation.\u003c/p\u003e\n\u003ch3\u003eFlow cytometry identification of hPDLSCs\u003c/h3\u003e\n\u003cp\u003eTo further verify the stem cell characertistic of our acquired cells, the expression of stem cell surface markers on the isolated cells was analyzed by flow cytometry (BD Biosciences, USA) following standard protocols. Briefly, cells were washed twice with PBS and subsequently incubated with fluorescently conjugated monoclonal antibodies against human CD44-PE, CD73-APC, CD90-FITC, CD34-PE, and CD45-FITC (all from BD Biosciences, USA) for 30 min at 4\u0026deg;C in the dark. PBS-treated cells served as negative controls. After additional PBS washing, cell fluorescence was immediately analyzed using the flow cytometer.\u003c/p\u003e\n\u003ch3\u003eImmunofluorescence identification of hPDLSCs\u003c/h3\u003e\n\u003cp\u003eIsolated cells were seeded in 96-well plates and cultured to adherence. After PBS washing, cells were fixed with 4% paraformaldehyde for 20 minutes, permeabilized with 0.1% Triton X-100 (Solarbio, China) for 10 minutes, and blocked with 5% goat serum (Zhongshan Golden Bridge, China) for 20 minutes. Primary antibodies against Vimentin (Proteintech, China) and Cytokeratin 17 (Proteintech, China) were applied overnight at 4\u0026deg;C, followed by incubation with fluorescent goat anti-rabbit secondary antibody (Proteintech, China) for 1 hour. Nuclei were counterstained with DAPI (Solarbio, China) for 10 minutes before fluorescence microscopy imaging. All steps were interspersed with PBS washing and samples were air-dried prior to observation.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eInduction and identification of macrophages\u003c/h2\u003e\u003cp\u003eTHP-1 cells (Procell, China) were plated in 6-well plates (1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells/well) and induced to differentiated into macrophages by using 100 ng/mL phorbol-12-myristate-13-acetate (PMA; SIGMA, USA) in RPMI-1640 medium supplemented with 10% FBS for 48 hours. Then cells were washed with PBS to remove residual PMA and maintained in fresh complete medium (RPMI-1640 medium supplemented with 10% FBS). One plate was used for macrophage identification by flow cytometry analysis with anti-CD11b antibody (Thermo, USA). In brief, single-cell suspension (1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells/tube) were stained with anti-CD11b antibody (Thermo, USA) for 40 minutes at 4℃ in the dark. After PBS washing to remove unbound fluorescent antibodies, cells were resuspended in 500 \u0026micro;L PBS and analyzed by flow cytometry to quantify CD11b surface expression.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eCo-culture of macrophages with hPDLSCs\u003c/h3\u003e\n\u003cp\u003ePMA induced THP-1 was named as M0-Mφ and they were inoculated into same one of the 6-well plates with hPDLSCs at three different ratios of 1:1 (1\u0026times;10\u003csup\u003e6\u003c/sup\u003e M0-Mφ and 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e hPDLSCs), 5:1 (1\u0026times;10\u003csup\u003e6\u003c/sup\u003e M0-Mφ and 2\u0026times;10\u003csup\u003e5\u003c/sup\u003e hPDLSCs) and 10:1 (1\u0026times;10\u003csup\u003e6\u003c/sup\u003e M0-Mφ and 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e hPDLSCs) respectively. The co-cultured cells were cultured in a 1:1 mixture of macrophage medium (RPMI-1640 with 10% FBS) and osteogenic induction medium (α-MEM with 10% FBS, 10 mmol/L β-glycerophosphate, 0.1 \u0026micro;mol/L dexamethasone, and 0.05 mmol/L vitamin C). The co-culture medium was refreshed every 72 hours throughout the experiment.\u003c/p\u003e\n\u003ch3\u003eImmunofluorescence staining\u003c/h3\u003e\n\u003cp\u003eM0 macrophages (3.3\u0026times;10⁴ cells/well) and P3 hPDLSCs (1.3\u0026times;10⁴ cells/well) were cultured in 96-well plates using RPMI-1640 (10% FBS) and α-MEM (10% FBS), respectively. Upon reaching 70\u0026ndash;80% confluence, hPDLSCs were processed for immunofluorescence: after PBS washing, cells were fixed with 4% paraformaldehyde for 20 minutes., blocked with 5% goat serum (Zhongshan Golden Bridge, China) for 20 minutes., and incubated with primary antibodies against EphB4 (Proteintech, China) and ephrinB2 (Bioss, China) overnight at 4\u0026deg;C. Following secondary antibody incubation (goat anti-rabbit IgG, Proteintech, China) for 1 hour and DAPI counterstaining (Solarbio, China) for 10 minutes, samples were imaged using the Operetta CLS\u0026trade; high-content analysis system (PerkinElmer, USA) after final PBS washes and air-drying.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eqRT-PCR analysis\u003c/h2\u003e\u003cp\u003eTotal RNA was isolated from cells using the RNAfast200 Total RNA Extreme Extraction kit (Shanghai Feijie, China) and reverse transcribed into cDNA using the Evo M-MLV Reverse Transcription Premixed kit (AG, China). The primer information is shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and includes β-actin, ALP, RunX2, OCN, OPN, TNF-α, IL-1β, TGF-β1, IL-10, CD206, EphB4, and ephrinB2. qRT-PCR reactions were performed using SYBR Green Premix Pro Taq HS qPCR Kit (AG, China). Relative quantification was achieved using the comparative 2\u003csup\u003e\u0026minus;△△Cq\u003c/sup\u003e method.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eqRT-PCR Primer Sequence\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimer name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSense primers(5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAntisense primers(5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eβ-actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGAAGAGCTACGAGCTGCCTGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCAGACAGCACTGTGTTGGCG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eALP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGGACCATTCCCACGTCTTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCATTCTCTCGTTCACCGCCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRunX2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGAGTGGACGAGGCAAGAGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGGCGGTCAGAGAACAAACT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eOCN\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCACACTCCTCGCCCTATTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTCTTCACTACCTCGCTGCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eOPN\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCCGTGGGAAGGACAGTTAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATCTGGACTGCTTGTGGCTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTNF-α\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGAGGCCAAGCCCTGGTATG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGGGCCGATTGATCTCAGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIL-1β\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAACAAGTGGTGTTCTCCATGTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACACGCAGGACAGGTACAGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTGF-β1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCAACAATTCCTGGCGATACC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATTTCCCCTCCACGGCTCAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIL-10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCAGACATCAAGGCGCATGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGATGCCTTTCTCTTGGAGCTTATT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCD206\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGATTGCAGGGGGCTTATGGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGGACATTTGGGTTCGGGAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eEphB4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGTGACATTCCCTCAGGTGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGCACGTCACACACTTCGTA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eephrinB2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eACTGCTGGGGTGTTTTGATG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGTTTTAGAGTCCACTTTGGGGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eCytokine measurements\u003c/h2\u003e\u003cp\u003eThe supernatants of different groups were collected and centrifuged at 1000 g for 20 min to remove impurities and cell debris. Levels of TNF-α, IL-1β, TGF-β1, and IL-10 in the culture supernatants were quantified according to the instructions of the ELISA kits (Lianke Biotechnology, China).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eWestern blot analysis\u003c/h2\u003e\u003cp\u003eCells in 6-well plates were placed on ice and washed three times with ice-cold PBS. Lysis was performed using RIPA buffer (Solarbio, China) supplemented with 1 mM PMSF and 1 mM phosphatase inhibitor for 30 minutes, followed by ultrasonication. Protein concentrations were determined using a BCA assay. Equal amounts of protein were separated by SDS-PAGE (Epizyme Biotech, China) and transferred to 0.22 \u0026micro;m PVDF membranes (Biosharp, China). Membranes were blocked with 5% BSA (Solarbio, China) in TBST (0.05% Tween-20; Solarbio, China) for 1 hour at room temperature, then incubated overnight at 4\u0026deg;C with the following primary antibodies: polyclonal rabbit anti-EPHB4 antibody (1:1000; Proteintech, China), rabbit anti-ephrinB 2 antibody (1:1000; Bioss, China), polyclonal Rabbit anti-GAPDH antibody (1:1000000; HUABIO, China); phospho-ERK1/2 (Thr202/Tyr204) Recombinant antibody(1:1000; Proteintech, China); polyclonal rabbit anti-ERK1/2 antibody (1:1000; Proteintech, China); rabbit anti-STAT3 antibody (1:1000; CST, USA) and phospho-STAT3 (Tyr705) antibody(1:1000; CST, USA). After washing, membranes were incubated with horseradish peroxidase (HRP)conjugated goat antirabbit IgG (1:5000; ZSGB-BIO, China) for 1 hour at room temperature. Protein bands were visualized using ECL chemiluminescence (Biosharp, China) and quantified using ImageJ software (NIH, USA).\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eIdentification of hPDLSCs\u003c/h2\u003e\u003cp\u003ehPDLSCs were cultured using the periodontal ligament tissue block method, and obtained through clone purification. After crystal violet staining in the clone formation experiment, purple-blue spots scattered at the bottom of the culture dish could be visually identified (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-a). Under an inverted microscope, the cell clone morphology could be seen, with the cells arranged in a vortex around the central point (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-b). A single cell clone is defined as an aggregated group of \u0026ge;\u0026thinsp;50 cells, and the clone formation rate is calculated to be 14.51% \u0026plusmn; 0.95%. In comparison with the non-induced group, alizarin red staining of the osteogenic induction group revealed the formation of red mineralized nodules (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Likewise, after 21 days of adipogenic induction of hPDLSCs, a large quantity of red lipid droplets was observed following oil red O staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Cultured PDLSCs were positive for MSCs markers (CD44, CD73, and CD90), and were negative for leucocyte cell makers (CD45) and hematopoietic stem cells markers (CD34) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Under an inverted fluorescence microscope, positive staining for vimentin in the cell cytoplasm was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE-a), confirming that the cells are derived from the mesoderm. Negative staining for cytokeratin (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE-b) indicated that there was no contamination by cells of ectodermal origin. All the results indicated that hPDLSCs were successfully obtained from periodontal ligament tissues.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eIdentification of macrophages\u003c/h2\u003e\u003cp\u003eUnder an inverted microscope, it was observed that THP-1 cells grew in suspension, presenting a full cell morphology, being round, transparent, and of uniform size (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). After induction with 100 ng/mL PMA for 48 hours, the cells were seen to grow in an adherent manner, with irregular cell contours, increased volume and varying sizes, and some cells extended short protrusions (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). Flow cytometry examination showed that the positive rate of M0-Mφ-related surface marker CD11b was 99.0%, which was consistent with the phenotypic characteristics of M0-Mφ (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eThe co-culture of M0-Mφ and hPDLSCs promoted the osteogenic differentiation of hPDLSCs\u003c/h2\u003e\u003cp\u003eUsing monocultured hPDLSCs as a control, the impacts of the co-culture system on the mRNA expression of osteogenesis-related factors of hPDLSCs were investigated. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, the mRNA level of ALP, RunX2, OCN and OPN in the co-culture group on day 3 was all upregulated, compared with those in the monoculture group. Nevertheless, only the increase of the expression of ALP and OPN was statistically significant. On day 14, the mRNA level of osteogenesis-related factors in hPDLSCs in the co-culture group was all significantly elevated (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). The above findings indicated that the co-culture of M0-Mφ and hPDLSCs is conducive to the osteogenic differentiation of hPDLSCs.\u003c/p\u003e\u003cp\u003eThe results of ALP activity assay showed that the ALP activity in both the monoculture group and the co-culture group reached the peak on the 14th days. Compared with the monoculture group, the ALP activity in the co-culture group was significantly increased on the 3rd, 7th, and 14th days \u003cem\u003e(P\u0026thinsp;\u0026lt;\u0026thinsp;0.05)\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003eIn alizarin red staining and calcium quantification assay, a small number of calcium nodules could be observed in both groups on the 14th day. After 21 days, both the number of calcium nodules and the amount of the calcium deposition in the co-culture group was significantly higher than those in the hPDLSCs monoculture group \u003cem\u003e(P\u0026thinsp;\u0026lt;\u0026thinsp;0.05)\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eThe co-culture of M0-Mφ and hPDLSCs promoted the polarization of Mφ towards the M2 type\u003c/h2\u003e\u003cp\u003eAn increasing number of Mφ aggregated in one aggregation unit with time (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA), suggesting that hPDLSCs may have a chemotactic effect on Mφ. The impact of co-culture on the polarization state of Mφ was investigated. The results of RT-qPCR and ELISA experiments demonstrated that the expression levels of pro-inflammatory factors TNF-α and IL-1β significantly decreased, while the expression levels of anti-inflammatory factors TGF-β1, IL-10, and CD206 significantly increased after three days of co-culture \u003cem\u003e(P\u0026thinsp;\u0026lt;\u0026thinsp;0.05)\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB), indicating that co-culture system promoted the polarization of Mφ to M2 type and down-regulated the proportion of M1.\u003c/p\u003e\u003cp\u003eWe then tried to study the effect of different co-culture duration on the polarization of Mφ. Experiment showed that in comparison with the 3-day and 7-day co-culture groups, the mRNA expression of TNF-α and IL-1β were at their lowest, while the mRNA expression of TGF-β1, IL-10, and CD206 were at their highest \u003cem\u003e(P\u0026thinsp;\u0026lt;\u0026thinsp;0.05)\u003c/em\u003e after 14 days of coculture. The protein expression of TNF-α and IL-1β presented the same trend in the co-culture system. Interestingly, the ELISA results showed that the expression of TGF-β1 and IL-10 reached the peak on the 7th day rather than the 14th day (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). While mRNA levels peak on the 14th day, translational repression via RNA-binding proteins or microRNA-mediated silencing (e.g., miR-98 for IL-10) could delay protein synthesis [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Additionally, accelerated protein degradation through ubiquitin-proteasome system activation (particularly E3 ligases like Smurf1 for TGF-β1) may explain the earlier (7-day) peak in secreted cytokines [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. These findings suggested that the co-culture of M0-Mφ and hPDLSCs promoted the polarization of Mφ to the M2 type, and the effect was optimal when co-cultured for 7 days.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eThe determination of optimal ratio for M0-Mφ and hPDLSCs co-culture\u003c/h2\u003e\u003cp\u003eIn order to determine the optimal co-culture ratio of M0-Mφ and hPDLSCs, M0-Mφ and hPDLSCs were directly co-cultured \u003cem\u003ein vitro\u003c/em\u003e at three distinct ratios of 1:1, 5:1 and 10:1, respectively. The results of RT-qPCR showed that the mRNA expression of ALP, OCN, and OPN at co-culture ratio of 5:1 was significantly higher than that at ratio of 1:1 or 10:1 after 7 days of co-culture (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). The significant increase of ALP activity was also found at co-culture ratio of 5:1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB) \u003cem\u003e(P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/em\u003e Additionally, the mRNA expression of TGF-β1, IL-10, and CD206 was the highest, while the expression of TNF-α and IL-1β was the lowest \u003cem\u003e(P\u0026thinsp;\u0026lt;\u0026thinsp;0.05)\u003c/em\u003e at ratio of 5:1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). ELISA experiments revealed that the increase of the expression of TGF-β1 and IL-10 at ratio of 5:1 was the most prominent, while the expression of TNF-α and IL-1β was the lowest \u003cem\u003e(P\u0026thinsp;\u0026lt;\u0026thinsp;0.05)\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). The above findings demonstrated that the effects on promoting osteogenesis of hPDLSCs and M2-Mφ polarization were the most remarkable when M0-Mφ and hPDLSCs are co-cultured at a ratio of 5:1.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eM0-Mφ and hPDLSCs co-culture increased the expression of EphB4 and ephrinB2\u003c/h2\u003e\u003cp\u003eThe expression of EphB4 and ephrinB2 on hPDLSCs and M0-Mφ was detected by the immunofluorescence method. The results indicated that EphB4 and ephrinB2 were primarily expressed on the cell membranes of hPDLSCs and M0-Mφ (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB)\u003c/p\u003e\u003cp\u003eIn the process of osteogenic differentiation of monocultured hPDLSCs, the mRNA and protein expression of EphB4 and ephrinB2 exhibited an upward tendency (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE) with time. In the co-culture system, the mRNA and protein expression of EphB4 and ephrinB2 increased gradually with the prolongation of the co-culture time (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eInhibition of the EphB4/ephrinB2/STAT3 pathway reduced the osteogenic differentiation of hPDLSCs in the co-culture system\u003c/h2\u003e\u003cp\u003eNVP-BHG712, a small-molecule inhibitor of EphB4, can effectively and specifically inhibit the EphB4 kinase among numerous kinases. To investigate the cytotoxicity of NVP-BHG712 on hPDLSCs and M0-Mφ, cells were incubated with NVP-BHG712 at concentration of 0, 0.05, 0.1, 0.2, 0.4, 0.8, 1.6 and 3.2 \u0026micro;M respectively. The CCK8 results indicated there was no significant effect on the viability of both cell types at concentrations of 0.05, 0.1, and 0.2 \u0026micro;M of NVP-BHG712 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). A concentration of 0.2 \u0026micro;M was employed for the subsequent experiments.\u003c/p\u003e\u003cp\u003eThe results of RT-qPCR experiments demonstrated that the application of NVP-BHG712 significantly decreased the mRNA expression of osteogenesis-related factor ALP, RunX2, OCN, and OPN after 7-day co-culture \u003cem\u003e(P\u0026thinsp;\u0026lt;\u0026thinsp;0.05)\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). ALP activity and quantitative calcium quantification detection revealed that NVP-BHG712 also significantly decreased the ALP activity and calcium deposition \u003cem\u003e(P\u0026thinsp;\u0026lt;\u0026thinsp;0.05)\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). The above findings suggested that inhibition of EphB4 suppressed the osteogenic differentiation of hPDLSCs in the co-culture model.\u003c/p\u003e\u003cp\u003eTo further explore the impact of EphB4 inhibition on osteogenesis-related signaling pathways ERK1/2 and STAT3, the protein expression of ERK1/2 and STAT3 was detected in the presence or absence of NVP-BHG712 by Western Blot. The results showed that the protein expression of P-STAT3 in the presence of NVP-BHG712 was significantly decreased \u003cem\u003e(P\u0026thinsp;\u0026lt;\u0026thinsp;0.05)\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF). Although the protein expression of P-ERK1/2 also decreased, there was no statistical significance \u003cem\u003e(P\u0026thinsp;\u0026gt;\u0026thinsp;0.05)\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eH). These findings demonstrated that the EphB4/ephrinB2 pathway mediated the osteogenic differentiation of hPDLSCs in the co-culture system, and its regulatory effect might be achieved through the STAT3 signaling pathway.\u003c/p\u003e\u003cp\u003e\u003cb\u003eInhibition of the EphB4/ephrinB2 pathway significantly reduced the polarization of the M2-Mφ type in the co-culture system\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo further investigate the effect of EphB4 inhibition on the polarization of co-cultured Mφ, the mRNA expression of Mφ marker-related factors and the secretion of Mφ polarization-related factors were detected with NVP-BHG712 application after 7days of coculture. The results showed that NVP-BHG712 significantly increased IL-1β mRNA expression, but decreased mRNA expression levels of TGF-β1, IL-10, and CD206 \u003cem\u003e(P\u0026thinsp;\u0026lt;\u0026thinsp;0.05)\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eI). The ELISA results showed that M1-Mφ type-associated TNF-α and IL-1β expression in the NVP-BHG712 group was significantly increased, while M2-Mφ type-associated TGF-β1 and IL-10 expression significantly decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eJ) \u003cem\u003e(P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/em\u003e Based on the above data, it can be speculated that EphB4 inhibition suppressed the polarization of Mφ to the M2 type while promoted its polarization to the M1 type in the co-culture system.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003ePeriodontitis is a host immune response damage initiated by plaque microorganisms. During the occurrence and development of periodontitis, Monocytes/macrophages contribute great significance. As a type of immunocyte with heterogeneity and plasticity, macrophages can be specifically classified into M0, M1, and M2 macrophages based on their molecular phenotypes and functional characteristics [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. M1 and M2 macrophages are at the two extremes of different polarization states. Among them, M1 macrophages can promote cell oxidation and inflammatory reactions by highly expressing inflammatory factors such as tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and interleukin-12 (IL-12) as well as reactive oxygen free radicals. They play the role of immune surveillance by recruiting adaptive immune cells [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. M2 macrophages can not only balance the body's inflammatory response by secreting anti-inflammatory factors such as interleukin-10 (IL-10) and transforming growth factor-β (TGF-β) and other cytokines like protectins and resolvins, but also directly clear the surrounding apoptotic cells and tissue debris through \"efferocytosis\". Therefore, M2 macrophages have important functions in immune regulation and promoting tissue healing [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Analyzing and intervening in the polarization trend of M0 macrophages may become one of the effective approaches for the treatment of infectious diseases.\u003c/p\u003e\u003cp\u003eNumerous studies have shown that M1-Mφ significantly augments in the environment of severe periodontitis [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Consequently, facilitating the polarization of M1-Mφ to M2-Mφ has emerged as an important strategy for controlling periodontal inflammation and promoting the wound healing of periodontal tissues [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Periodontal ligament stem cells (PDLSCs) are the most critical functional cells for periodontal regeneration. However, the periodontal inflammatory microenvironment not only impacts the osteogenic differentiation potential of PDLSCs but also diminishes the positive immunomodulatory ability of PDLSCs [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eEmerging evidence reveals a reciprocal enhancement between Mφ and MSCs, where MSCs drive Mφ polarization toward anti-inflammatory M2 phenotype, while Mφ reciprocally augment MSC-mediated osteogenesis [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. This bidirectional crosstalk is particularly relevant in periodontitis, where dense macrophage infiltration creates direct cell-cell contact opportunities with resident hPDLSCs. Our study specifically investigated this cellular dialogue using THP-1-derived macrophages and hPDLSCs, with three objectives: (1) to characterize their contact-dependent communication, (2) to identify the optimal co-culture ratio that maximizes therapeutic interactions, and (3) to elucidate the possible underlying molecular mechanisms.\u003c/p\u003e\u003cp\u003eWhen cultured in vitro, cells need to reach a certain density for interaction. High-density culture promotes cell-to-cell contact, thereby more effectively facilitating signal transmission and functional regulation [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Our findings revealed that the Mφ:hPDLSCs ratio critically regulated their crosstalk, with a 5:1 ratio optimally enhancing hPDLSCs osteogenic differentiation and Mφ M2-polarization. This research result is in line with previous studies [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Moreover, different cell seeding ratios affect the interaction between cells. Lu et al. observed increased mineralization at higher Mφ densities (5:1 vs 1:1) [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Zhang et al. reported M1-Mφ-mediated mineralization enhancement at 1:1 ratio, while M2-Mφ showed density-dependent osteogenic promotion, contrasting with M0-Mφ's inhibitory effects [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. The differences in research results may be attributed to the different cell types and sources, the methods of inducing Mφ polarization, and the types of culture media, underscoring the importance of standardized models. Based on the above experimental results, we established 5:1 as the optimal Mφ: hPDLSCs ratio for periodontal regeneration studies.\u003c/p\u003e\u003cp\u003eEvidence indicates a reciprocal interaction between Mφ and MSCs, wherein MSCs promote M2 polarization of Mφ and Mφ enhance MSC-mediated osteogenesis [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] vice versa. This bidirectional crosstalk significantly augments both MSC osteogenic differentiation and Mφ M2 polarization.\u003c/p\u003e\u003cp\u003eOur results demonstrated that co-culture group significantly upregulated osteogenic differentiation, as evidenced by the increased expression of ALP, RunX2, OCN, and OPN, and enhanced ALP activity and calcium deposition compared to hPDLSCs monoculture (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). These findings indicated that co-culture system promoted hPDLSCs osteogenic differentiation in a time-dependent manner, with optimal effects observed during 7\u0026ndash;14 days of co-culture, coinciding with improved M2 polarization of macrophages which reached their peak at 14 days.\u003c/p\u003e\u003cp\u003eMicroscopic analysis revealed that co-culture with hPDLSCs reduced the proportion of elongated, pseudopod-extending M1-like Mφ compared to M0-Mφ monocultures, with increasing Mφ aggregation observed over time, suggesting hPDLSC-mediated chemotaxis. RT-qPCR and ELISA demonstrated significantly decreased pro-inflammatory cytokines (TNF-α, IL-1β) and increased anti-inflammatory factors (TGF-β1, IL-10) in co-culture, peaking at day 7 (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), consistent with M2 polarization. Our findings aligned with reports of hPDLSC-mediated immunomodulation [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e], discrepancies existed regarding MSC-osteogenesis suppression by M1/M2-Mφ [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e], which potentially attributed to variations in: (1) cell sources, (2) polarization protocols, (3) co-culture ratios, and (4) culture conditions [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eWhile our direct contact co-culture model demonstrates significant effects on Mφ polarization and hPDLSCs osteogenesis, the concomitant paracrine interactions [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e] necessitate future validation through indirect co-culture systems to precisely delineate cell-contact-dependent versus soluble factor-mediated mechanisms.\u003c/p\u003e\u003cp\u003eMechanistic investigations revealed that EphB4/ephrinB2 signaling mediates macrophage-PDLSC crosstalk, potentially regulating osteogenic differentiation through STAT3 pathway modulation.\u003c/p\u003e\u003cp\u003eCell co-culture, first developed by Lawrence in the 1980s [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e], involves cultivating multiple cell types together to mimic in vivo microenvironments [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. Current systems utilize either direct or indirect contact models [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. Notably, Nicolaidou et al. indicated that direct MSC-macrophage contact activates STAT3 signaling to promote osteogenesis, an effect not replicated by paracrine factors alone [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], highlighting the critical role of cell-contact-dependent mechanisms in tissue repair processes.\u003c/p\u003e\u003cp\u003eBoth EphB4 and ephrinB2 are cell membrane proteins. Their interaction promotes a complex two-way signal transmission and regulates interacting cells. EphB4 and ephrinB2, mainly localized and expressed on the cell membrane, are able to activate a large number of ligand-receptor complexes at the direct contact points between cells, precisely controlling cell biological behaviors [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. An increasing number of studies have shown that Eph/ephrin is involved in the regulation of bone homeostasis [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e, \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. This experimental study showed that the expression levels of EphB4 and ephrinB2 gradually increased as osteogenic differentiation progress, which means that EphB4/ephrinB2 may have an important impact on the osteogenic process.\u003c/p\u003e\u003cp\u003eUsing NVP-BHG712, a highly specific EphB4 kinase inhibitor developed by Martiny-Baron et al. [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. Pharmacological inhibition of EphB4 signaling with NVP-BHG712 in the co-culture system significantly downregulated the expression of osteogenic marker ALP, RunX2, OCN, and OPN, reduced ALP enzymatic activity, and decreased calcium deposition (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), demonstrating EphB4's critical role in mediating hPDLSC osteogenic differentiation during macrophage crosstalk.\u003c/p\u003e\u003cp\u003eIt has been found that Mφ can effectively induce the osteogenic differentiation of MSCs. The phosphorylation of STAT3 in MSCs up-regulates the expression of osteogenesis-related genes, and cause MSCs to differentiate into osteoblasts [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Some scholars have pointed out that in the co-culture of MSCs and Mφ, the STAT3 signaling pathway may be a mechanism for MSCs to promote the anti-inflammatory phenotype of Mφ [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. In addition, ERK has also been reported in the ephrin and Eph signaling pathway [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eWestern blot analysis of the NVP-BHG712-treated co-culture system demonstrated significant downregulation of STAT3 protein expression (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) compared to untreated controls, while ERK1/2 levels remained unchanged, indicating selective inhibition of the STAT3 pathway during EphB4-mediated hPDLSC-Mφ crosstalk.\u003c/p\u003e\u003cp\u003eqPCR and ELISA analyses revealed significantly elevated IL-1β, IL-10, and CD206 expression in treated groups versus controls (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), indicating EphB4 inhibition promotes M1 rather than M2 polarization. These findings collectively demonstrated that direct Mφ-hPDLSC contact enhanced osteogenic differentiation and immunomodulation, with EphB4/ephrinB2 signaling mediating these effects through STAT3 pathway activation (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eAs a bidirectional signaling pathway expressed on both cell types, the precise directional regulation of EphB4/ephrinB2 in Mφ-hPDLSC crosstalk remains to be elucidated. Future studies should employ lentiviral-mediated knockdown of EphB4 or ephrinB2 in each cell type to determine which ligand-receptor pair drives hPDLSC osteogenesis and M2 polarization. Additionally, in vivo validation is essential to confirm the translational relevance of these interactions.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn conclusion, our findings demonstrate that direct M0-Mφ/hPDLSC contact reciprocally enhances M2 polarization and osteogenic differentiation, thus revealing an intrinsic link between immunomodulation and bone formation. Mechanistically, the EphB4/ephrinB2 pathway mediates this crosstalk by activating STAT3-dependent osteogenic signaling. This work elucidates the dual role of EphB4/ephrinB2 in coordinating macrophage polarization and hPDLSC differentiation, providing a molecular framework for developing targeted periodontal regeneration strategies.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003ehPDLSCs Human periodontal ligament stem cells\u003c/p\u003e\u003cp\u003eTHP-1 Human acute mononuclear leukemia cell\u003c/p\u003e\u003cp\u003eMφ Macrophage\u003c/p\u003e\u003cp\u003eM1- Mφ Classically activated macrophages\u003c/p\u003e\u003cp\u003eM2- Mφ Alternatively activated macrophage\u003c/p\u003e\u003cp\u003ePMA Phorbol-12-myristate-13-acetate\u003c/p\u003e\u003cp\u003eRPMI Roswell Park Memorial Institute\u003c/p\u003e\u003cp\u003eα-MEM Alpha-modified Eagle\u0026rsquo;s medium\u003c/p\u003e\u003cp\u003eFBS Fetal bovine serum\u003c/p\u003e\u003cp\u003ePBS Phosphate buffer solution\u003c/p\u003e\u003cp\u003eALP Alkaline phosphatase\u003c/p\u003e\u003cp\u003eRunX2 Runt-related transcription factor 2\u003c/p\u003e\u003cp\u003eOCN Osteocalcin\u003c/p\u003e\u003cp\u003eOPN Osteopontin\u003c/p\u003e\u003cp\u003eTNF-α Tumor necrosis factor-alpha\u003c/p\u003e\u003cp\u003eIL-1β Interleukin-1β\u003c/p\u003e\u003cp\u003eTGF-β1 Transforming growth factor-β\u003c/p\u003e\u003cp\u003eIL-10 Interleukin-10\u003c/p\u003e\u003cp\u003eCD206 Cluster of differentiation 206\u003c/p\u003e\u003cp\u003eEph Erythropoietin-producing hepatocyte receptor\u003c/p\u003e\u003cp\u003eEphrin Eph ligand\u003c/p\u003e\u003cp\u003eERK1/2 Etracellular regulated protein kinases\u003c/p\u003e\u003cp\u003eSTAT3 Signal transducer and activator of transcription 3\u003c/p\u003e\u003cp\u003eRT-qPCR Real-time quantitative polymerase chain reaction\u003c/p\u003e\u003cp\u003eELISA Enzyme linked immunosorbent assay\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors wish to thank the staff and participants of the study. The authors declare that they have not use AI-generated work in this manuscript in this section.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXiaoqian Yang contributed to the experimental design, performed the whole experiments, analyzed the data and wrote the original draft; Yijun Luan, Huaze Ren and Qiuyue Yin performed the hPDLSCs culture and identification experiments; Hongrui Liu and Jiling Qiu contributed to the experimental design; Hui Song and Aimei Song guided the research,\u0026nbsp;reviewed and edited the manuscript. Aimei Song also served as the principal investigator of the funding project that supported this study. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Natural Science Foundation of Shandong Province (ZR2020MH184) and National Clinical Key Specialty (Periodontology) Construction Project.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are included in this published article or available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments were approved by the Shandong University Clinical Ethical Committee under this project \u0026ldquo;EphB4/EphrinB2 mediated interaction between periodontal ligament stem cells and macrophages and its application in periodontal inflammation control and tissue regeneration in experimental periodontitis model\u0026rdquo;. The approval number is NO.20191113. The approval date for these experiments is 2019-11-11.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003eDepartment of Periodontology, School and Hospital of Stomatology, Cheeloo College of Medicine, Shandong University \u0026amp; Shandong Key Laboratory of Oral Tissue Regeneration \u0026amp; Shandong Engineering Research Center of Dental Materials and Oral Tissue Regeneration \u0026amp; Shandong Provincial Clinical Research Center for Oral Diseases, No.44-1 Wenhua Road West, Jinan 250012, Shandong, China.\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e2\u003c/sup\u003eDepartment of Stomatology, Zhongshan Hospital of Xiamen University, Xiamen University, No.201-209, Hubinnan Road, Siming District, Xiamen 361004, Fujian, China.\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e3\u003c/sup\u003eDepartment of Oral Medicine, Qilu Hospital of Shandong University, No.107 West Wenhua Road, Jinan 250012, Shandong, China.\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e4\u003c/sup\u003eDepartment of Stomatology, The First Affiliated Hospital of Shandong First Medical University \u0026amp; Shandong Provincial Qianfoshan Hospital, No.16766, Jingshi Road, Jinan 250014, Shandong, China\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e5\u003c/sup\u003eWeifang People\u0026rsquo;s Hospital, Shandong Second Medical University, No.151, Guangwen Street, Kuiwen District, Weifang 261000, Shandong, China\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e6\u003c/sup\u003eDepartment of Health Care (Department of General Dentistry Ⅱ), School and Hospital of Stomatology, Cheeloo College of Medicine, Shandong University \u0026amp; Shandong Key Laboratory of Oral Tissue Regeneration \u0026amp; Shandong Engineering Research Center of Dental Materials and Oral Tissue Regeneration \u0026amp; Shandong Provincial Clinical Research Center for Oral Diseases, No.44-1 Wenhua Road West, Jinan 250012, Shandong, China.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eHerrera D, Sanz M, Shapira L, Jepsen S, Blanco J, Sanz M, et al. Association between periodontal diseases and cardiovascular diseases, diabetes and respiratory diseases: Consensus report of the Joint Workshop by the European Federation of Periodontology (EFP) and the European arm of the World Organization of Family Doctors (WONCA Europe). J Clin Periodontol. 2023;50(6):819\u0026ndash;41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jcpe.13807\u003c/span\u003e\u003cspan address=\"10.1111/jcpe.13807\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShariati A, Nemati R, Sadeghipour Y, Hazrati A, Hosseini S, Eslaminejad MB, et al. Mesenchymal stromal cells (MSCs) for neurodegenerative disease: A promising frontier. Eur J Cell Biol. 2020;99(6):151097. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ejcb.2020.151097\u003c/span\u003e\u003cspan address=\"10.1016/j.ejcb.2020.151097\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMaqsood M, Kang M, Wu X, Chen J, Teng L, Qiu L. Adult mesenchymal stem cells and their exosomes: Sources, characteristics, and application in regenerative medicine. Life Sci. 2020;256:118002. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.lfs.2020.118002\u003c/span\u003e\u003cspan address=\"10.1016/j.lfs.2020.118002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang XQ, Song AM, Song H. Co-culture technology of mesenchymal stem cells and macrophages. Chin J Tissue Eng Res. 2024;28(31):5055\u0026ndash;62. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.12307/2024.706\u003c/span\u003e\u003cspan address=\"10.12307/2024.706\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTomokiyo A, Wada N, Maeda H. Periodontal ligament stem cells: regenerative potency in periodontium. Stem Cells Dev. 2019;28(15):974\u0026ndash;85. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1089/scd.2019.0031\u003c/span\u003e\u003cspan address=\"10.1089/scd.2019.0031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJulier Z, Park AJ, Briquez PS, Martino MM. Promoting tissue regeneration by modulating the immune system. Acta Biomater. 2017;53:13\u0026ndash;28. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.actbio.2017.01.056\u003c/span\u003e\u003cspan address=\"10.1016/j.actbio.2017.01.056\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbnave P, Ghigo E. Role of the immune system in regeneration and its dynamic interplay with adult stem cells. Semin Cell Dev Biol. 2019;87:160\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.semcdb.2018.04.002\u003c/span\u003e\u003cspan address=\"10.1016/j.semcdb.2018.04.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang N, Liu Y. The role of the immune microenvironment in bone regeneration. Int J Med Sci. 2021;18(16):3697\u0026ndash;707. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7150/ijms.61080\u003c/span\u003e\u003cspan address=\"10.7150/ijms.61080\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang M, Chen F, Wang J, Chen X, Zhang H, Cao W, et al. Calcium phosphate altered the cytokine secretion of macrophages and influenced the homing of mesenchymal stem cells. J Mater Chem B. 2018;6(29):4765\u0026ndash;74. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1039/c8tb01201f\u003c/span\u003e\u003cspan address=\"10.1039/c8tb01201f\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTeo KYW, Zhang S, Loh JT, Lai RC, Lim SK, Chen Q, et al. Mesenchymal stromal cell exosomes mediate M2-like macrophage polarization through CD73/ecto-5\u0026prime;-nucleotidase activity. Pharmaceutics. 2023;15(5):1489. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/pharmaceutics15051489\u003c/span\u003e\u003cspan address=\"10.3390/pharmaceutics15051489\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAtri C, Guerfali FZ, Laouini D. Role of human macrophage polarization in inflammation during infectious diseases. Int J Mol Sci. 2018;19(6):1801. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms19061801\u003c/span\u003e\u003cspan address=\"10.3390/ijms19061801\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMurray PJ, Allen JE, Biswas SK, Fisher EA, Gilroy DW, Goerdt S, et al. Macrophage activation and polarization: nomenclature and experimental guidelines. Immunity. 2014;41(1):14\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.immuni.2014.06.008\u003c/span\u003e\u003cspan address=\"10.1016/j.immuni.2014.06.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSica A, Mantovani A. Macrophage plasticity and polarization: in vivo veritas. J Clin Invest. 2012;122(3):787\u0026ndash;95. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1172/JCI59643\u003c/span\u003e\u003cspan address=\"10.1172/JCI59643\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMartinez FO, Helming L, Gordon S. Alternative activation of macrophages: an immunologic functional perspective. Annu Rev Immunol. 2009;27:451\u0026ndash;83. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev.immunol.021908.132532\u003c/span\u003e\u003cspan address=\"10.1146/annurev.immunol.021908.132532\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGalv\u0026aacute;n-Pe\u0026ntilde;a S, O\u0026rsquo;Neill LAJ. Metabolic reprograming in macrophage polarization. Front Immunol. 2014;5:420. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2014.00420\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2014.00420\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHe X, Dong Z, Cao Y, Wang H, Liu S, Liao L, et al. MSC-derived exosome promotes M2 polarization and enhances cutaneous wound healing. Stem Cells Int. 2019;2019:7132708. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2019/7132708\u003c/span\u003e\u003cspan address=\"10.1155/2019/7132708\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePajarinen J, Lin T, Gibon E, Kohno Y, Maruyama M, Nathan K, et al. Mesenchymal stem cell-macrophage crosstalk and bone healing. Biomaterials. 2019;196:80\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biomaterials.2017.12.025\u003c/span\u003e\u003cspan address=\"10.1016/j.biomaterials.2017.12.025\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLu D, Xu Y, Liu Q, Zhang Q. Mesenchymal stem cell-macrophage crosstalk and maintenance of inflammatory microenvironment homeostasis. Front Cell Dev Biology. 2021;9:681171. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fcell.2021.681171\u003c/span\u003e\u003cspan address=\"10.3389/fcell.2021.681171\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLu LY, Loi F, Nathan K, Lin TH, Pajarinen J, Gibon E, et al. Pro-inflammatory M1 macrophages promote osteogenesis by mesenchymal stem cells via the COX-2-prostaglandin E2 pathway. J Orthop Res. 2017;35(11):2378\u0026ndash;85. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jor.23553\u003c/span\u003e\u003cspan address=\"10.1002/jor.23553\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi Y, Zhang D, Xu L, Dong L, Zheng J, Lin Y, et al. Cell\u0026ndash;cell contact with proinflammatory macrophages enhances the immunotherapeutic effect of mesenchymal stem cells in two abortion models. Cell Mol Immunol. 2019;16(12):908\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41423-019-0204-6\u003c/span\u003e\u003cspan address=\"10.1038/s41423-019-0204-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu H, Yang R, Zhao S, Li J, Wang Y, Zhang X, et al. Collagen scaffolds derived from bovine skin loaded with MSC optimized M1 macrophages remodeling and chronic diabetic wounds healing. Bioeng Translational Med. 2023;8(3):e10467. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/btm2.10467\u003c/span\u003e\u003cspan address=\"10.1002/btm2.10467\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNicolaidou V, Wong MM, Redpath AN, Ersek A, Baban DF, Williams LM, et al. Monocytes induce STAT3 activation in human mesenchymal stem cells to promote osteoblast formation. PLoS ONE. 2012;7(7):e39871. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0039871\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0039871\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLuo M, Jiao Y, Gong W, Li J, Liu H, Chen X. Macrophages enhance mesenchymal stem cell osteogenesis via down-regulation of reactive oxygen species. J Dent. 2020;94:103297. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jdent.2020.103297\u003c/span\u003e\u003cspan address=\"10.1016/j.jdent.2020.103297\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSalvucci O, Tosato G. Essential roles of EphB receptors and EphrinB ligands in endothelial cell function and angiogenesis. Adv Cancer Res. 2012;114:21\u0026ndash;57. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/B978-0-12-386503-8.00002-8\u003c/span\u003e\u003cspan address=\"10.1016/B978-0-12-386503-8.00002-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePitulescu ME, Adams RH. Eph/ephrin molecules\u0026mdash;a hub for signaling and endocytosis. Genes Dev. 2010;24(22):2480\u0026ndash;92. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/gad.1973910\u003c/span\u003e\u003cspan address=\"10.1101/gad.1973910\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEgea J, Klein R. Bidirectional Eph\u0026ndash;ephrin signaling during axon guidance. Trends Cell Biol. 2007;17(5):230\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tcb.2007.03.004\u003c/span\u003e\u003cspan address=\"10.1016/j.tcb.2007.03.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePark I, Lee HS. EphB/ephrinB signaling in cell adhesion and migration. Mol Cells. 2015;38(1):14\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.14348/molcells.2015.2116\u003c/span\u003e\u003cspan address=\"10.14348/molcells.2015.2116\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChrencik JE, Brooun A, Recht MI, Kraus ML, Koolpe M, Kolatkar AR, et al. Structure and thermodynamic characterization of the EphB4/Ephrin-B2 antagonist peptide complex reveals the determinants for receptor specificity. Structure. 2006;14(2):321\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.str.2005.11.011\u003c/span\u003e\u003cspan address=\"10.1016/j.str.2005.11.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePasquale EB. Eph receptors and ephrins in cancer: bidirectional signalling and beyond. Nat Rev Cancer. 2010;10(3):165\u0026ndash;80. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrc2806\u003c/span\u003e\u003cspan address=\"10.1038/nrc2806\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCunningham F, Amode MR, Barrell D, Beal K, Billis K, Brent S, et al. Ensembl 2015. Nucleic Acids Res. 2015;43(D1):D662\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/nar/gku1010\u003c/span\u003e\u003cspan address=\"10.1093/nar/gku1010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao C, Irie N, Takada Y, Shimoda K, Miyamoto T, Nishiwaki T, et al. Bidirectional ephrinB2-EphB4 signaling controls bone homeostasis. Cell Metabol. 2006;4(2):111\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cmet.2006.05.012\u003c/span\u003e\u003cspan address=\"10.1016/j.cmet.2006.05.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAllan EH, H\u0026auml;usler KD, Wei T, Gooi JH, Quinn JM, Crimeen-Irwin B, et al. EphrinB2 regulation by PTH and PTHrP revealed by molecular profiling in differentiating osteoblasts. J Bone Miner Res. 2008;23(8):1170\u0026ndash;81. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1359/jbmr.080324\u003c/span\u003e\u003cspan address=\"10.1359/jbmr.080324\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang L, Zhang J, Wang C, Qi Y, Du M, Liu W, et al. Low concentrations of TNF-α promote osteogenic differentiation via activation of the ephrinB2-EphB4 signalling pathway. Cell Prolif. 2017;50(1):e12311. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/cpr.12311\u003c/span\u003e\u003cspan address=\"10.1111/cpr.12311\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhu SY, Wang PL, Liao CS, Huang GT, Lin YL, Yang YC, et al. Transgenic expression of ephrinB2 in periodontal ligament stem cells (PDLSCs) modulates osteogenic differentiation via signaling crosstalk between ephrinB2 and EphB4 in PDLSCs and between PDLSCs and pre-osteoblasts within co-culture. J Periodontal Res. 2017;52(3):562\u0026ndash;73. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jre.12424\u003c/span\u003e\u003cspan address=\"10.1111/jre.12424\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSakamoto A, Sugamoto Y, Tokunaga Y, Yoshimuta T, Hayashi K, Konno T, et al. Expression profiling of the ephrin (EFN) and Eph receptor (EPH) family of genes in atherosclerosis-related human cells. J Int Med Res. 2011;39(2):522\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/147323001103900220\u003c/span\u003e\u003cspan address=\"10.1177/147323001103900220\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi C, Shi C, Kim J, Chen Y, Ni S, Jiang L, et al. Erythropoietin promotes bone formation through EphrinB2/EphB4 signaling. J Dent Res. 2015;94(3):455\u0026ndash;63. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/0022034514566431\u003c/span\u003e\u003cspan address=\"10.1177/0022034514566431\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSheedy FJ, Palsson-McDermott E, Hennessy EJ, Martin C, O\u0026rsquo;Leary JJ, Ruan Q, et al. Negative regulation of TLR4 via targeting of the proinflammatory tumor suppressor PDCD4 by the microRNA miR-21. Nat Immunol. 2010;11(2):141\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ni.1828\u003c/span\u003e\u003cspan address=\"10.1038/ni.1828\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBrooks SA, Blackshear PJ. Tristetraprolin (TTP): interactions with mRNA and proteins, and current thoughts on mechanisms of action. Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms. 2013;1829(6\u0026ndash;7):666\u0026ndash;79. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbagrm.2013.02.003\u003c/span\u003e\u003cspan address=\"10.1016/j.bbagrm.2013.02.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLo RS, Massagu\u0026eacute; J. Ubiquitin-dependent degradation of TGF-beta-activated smad2. Nat Cell Biol. 1999;1(8):472\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/70258\u003c/span\u003e\u003cspan address=\"10.1038/70258\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGlickman MH, Ciechanover A. The ubiquitin-proteasome proteolytic pathway: destruction for the sake of construction. Physiol Rev. 2002;82(2):373\u0026ndash;428. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/physrev.00027.2001\u003c/span\u003e\u003cspan address=\"10.1152/physrev.00027.2001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFleetwood AJ, Dinh H, Cook AD, Hertzog PJ, Hamilton JA. GM-CSF- and M-CSF-dependent macrophage phenotypes display differential dependence on type I interferon signaling. J Leukoc Biol. 2009;86(2):411\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1189/jlb.1108702\u003c/span\u003e\u003cspan address=\"10.1189/jlb.1108702\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMartinez FO, Sica A, Mantovani A, Locati M. Macrophage activation and polarization. Front Bioscience-Landmark. 2008;13(2):453\u0026ndash;61. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2741/2692\u003c/span\u003e\u003cspan address=\"10.2741/2692\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGordon S. Alternative activation of macrophages. Nat Rev Immunol. 2003;3(1):23\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nri978\u003c/span\u003e\u003cspan address=\"10.1038/nri978\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGonzalez OA, Novak MJ, Kirakodu S, Stromberg A, Nagarajan R, Huang CB, et al. Differential gene expression profiles reflecting macrophage polarization in aging and periodontitis gingival tissues. Immunol Investig. 2015;44(7):643\u0026ndash;64. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3109/08820139.2015.1070269\u003c/span\u003e\u003cspan address=\"10.3109/08820139.2015.1070269\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiang H, Chen B, He S, Xie X, Yan F. Distribution and proportion of M1/M2 macrophages in periodontal tissues in rats with and without periodontitis. J Prev Treat Stomatological Dis. 2018;26(10):627\u0026ndash;33. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.12016/j.issn.2096-1456.2018.10.003\u003c/span\u003e\u003cspan address=\"10.12016/j.issn.2096-1456.2018.10.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhuang Z, Yoshizawa-Smith S, Glowacki A, Maltos K, Pacheco C, Shehabeldin M, et al. Induction of M2 macrophages prevents bone loss in murine periodontitis models. J Dent Res. 2019;98(2):200\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/0022034518805984\u003c/span\u003e\u003cspan address=\"10.1177/0022034518805984\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGolub LM, Lee HM. Periodontal therapeutics: Current host-modulation agents and future directions. Periodontol 2000. 2020;82(1):186\u0026ndash;204. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/prd.12315\u003c/span\u003e\u003cspan address=\"10.1111/prd.12315\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu D, Xu J, Liu O, Fan Z, Liu Y, Wang F, et al. Mesenchymal stem cells derived from inflamed periodontal ligaments exhibit impaired immunomodulation. J Clin Periodontol. 2012;39(12):1174\u0026ndash;82. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jcpe.12009\u003c/span\u003e\u003cspan address=\"10.1111/jcpe.12009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Y, B\u0026ouml;se T, Unger RE, Jansen JA, Kirkpatrick CJ, van den Beucken JJ. Macrophage type modulates osteogenic differentiation of adipose tissue MSCs. Cell Tissue Res. 2017;369(2):273\u0026ndash;86. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00441-017-2598-8\u003c/span\u003e\u003cspan address=\"10.1007/s00441-017-2598-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGao H, Zhang Q, Chen L, Han X, Yang L, Zheng X, et al. The expression pattern of cytokines in mesenchymal stem cells and macrophages co-cultured system. Immunological J. 2017;33(11):930\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://link.oversea.cnki.net/doi/10.13431/j.cnki.immunol.j.20170163\u003c/span\u003e\u003cspan address=\"https://link.oversea.cnki.net/doi/10.13431/j.cnki.immunol.j.20170163\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRomero-L\u0026oacute;pez M, Li Z, Rhee C, Maruyama M, Duldulao C, Westendorf JJ, et al. Macrophage effects on mesenchymal stem cell osteogenesis in a three-dimensional in vitro bone model. Tissue Eng Part A. 2020;26(19\u0026ndash;20):1099\u0026ndash;111. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1089/ten.TEA.2020.0041\u003c/span\u003e\u003cspan address=\"10.1089/ten.TEA.2020.0041\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTang H, Husch JFA, Zhang Y, Jansen JA, Beucken JJJP, Yang F. Coculture with monocytes/macrophages modulates osteogenic differentiation of adipose-derived mesenchymal stromal cells on poly(lactic-co-glycolic) acid/polycaprolactone scaffolds. J Tissue Eng Regen Med. 2019;13(5):785\u0026ndash;98. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/term.2826\u003c/span\u003e\u003cspan address=\"10.1002/term.2826\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTang H, Zhang Y, Jansen JA, Beucken JJJP. Effect of monocytes/macrophages on the osteogenic differentiation of adipose-derived mesenchymal stromal cells in 3D co-culture spheroids. Tissue Cell. 2017;49(4):461\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tice.2017.06.002\u003c/span\u003e\u003cspan address=\"10.1016/j.tice.2017.06.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYuan Y, Ni S, Zhuge A, Li B, Li C. Adipose-derived mesenchymal stem cells reprogram M1 macrophage metabolism via PHD2/HIF-1α pathway in colitis mice. Front Immunol. 2022;13:859806. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2022.859806\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2022.859806\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYao H, Yuan X, Wu Z, Du M, Jin Y, Luo J, et al. Fabrication and performance evaluation of gelatin/sodium alginate hydrogel-based macrophage and MSC cell-encapsulated paracrine system with potential application in wound healing. Int J Mol Sci. 2023;24(2):1240. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms24021240\u003c/span\u003e\u003cspan address=\"10.3390/ijms24021240\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLawrence TS, Beers WH, Gilula NB. Transmission of hormonal stimulation by cell-to-cell communication. Nature. 1978;272(5653):501\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/272501a0\u003c/span\u003e\u003cspan address=\"10.1038/272501a0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXie L, Meng R, Shang P. Application of Cells Co-culture Technique in Bone Tissue Biology. Chin J Cell Biology. 2013;35(2):216\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang C, Zhang D, Xu W. Cell co-culture system of dental pulp regenerative tissue engineering. Chin J Tissue Eng Res. 2023;27(15):2379\u0026ndash;84. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.12307/2023.376\u003c/span\u003e\u003cspan address=\"10.12307/2023.376\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCao C, Huang Y, Tang Q, Zhang C, Li Z, Yang L, et al. Bidirectional juxtacrine ephrinB2/Ephs signaling promotes angiogenesis of ECs and maintains self-renewal of MSCs. Biomaterials. 2018;172:1\u0026ndash;13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biomaterials.2018.04.042\u003c/span\u003e\u003cspan address=\"10.1016/j.biomaterials.2018.04.042\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eArthur A, Zannettino A, Panagopoulos R, Koblar SA, Sims NA, Stylianou C, et al. EphB/ephrin-B interactions mediate human MSC attachment, migration and osteochondral differentiation. Bone. 2011;48(3):533\u0026ndash;42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bone.2010.10.180\u003c/span\u003e\u003cspan address=\"10.1016/j.bone.2010.10.180\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZuo C, Huang Y, Bajis R, Sahih M, Li YF, Altawil R, et al. Osteoblastogenesis regulation signals in bone remodeling. Osteoporos Int. 2012;23:1653\u0026ndash;63. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00198-012-1909-x\u003c/span\u003e\u003cspan address=\"10.1007/s00198-012-1909-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMartiny-Baron G, Holzer P, Billy E, Schnell C, Brueggen J, Ferretti M, et al. The small molecule specific EphB4 kinase inhibitor NVP-BHG712 inhibits VEGF driven angiogenesis. Angiogenesis. 2010;13:259\u0026ndash;67. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10456-010-9183-z\u003c/span\u003e\u003cspan address=\"10.1007/s10456-010-9183-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGur-Wahnon D, Borovsky Z, Beyth S, Liebergall M, Rachmilewitz J. Contact-dependent induction of regulatory antigen-presenting cells by human mesenchymal stem cells is mediated via STAT3 signaling. Exp Hematol. 2007;35(3):426\u0026ndash;33. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.exphem.2006.11.001\u003c/span\u003e\u003cspan address=\"10.1016/j.exphem.2006.11.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"stem-cell-research-and-therapy","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scrt","sideBox":"Learn more about [Stem Cell Research \u0026 Therapy](http://stemcellres.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/scrt/default.aspx","title":"Stem Cell Research \u0026 Therapy","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Human periodontal ligament stem cells, Macrophages, Direct co-culture, Osteogenic differentiation, Polarization, EphB4, ephrinB2, STAT3","lastPublishedDoi":"10.21203/rs.3.rs-7457833/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7457833/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground \u003c/strong\u003ePeriodontal tissue regeneration can be achieved by periodontal ligament stem cells (PDLSCs) through its regulating the immune system. However, the specific signal or molecular mechanism remains unreported. The interaction between MSCs and macrophages (Mφ) has been the focus of the research in recent years. The objective of this study is to examine the effect of direct co-culture of human periodontal ligament stem cells (hPDLSCs) and macrophages on the osteogenic differentiation of hPDLSCs and the polarization of macrophages, and also to explore the role of the EphB4/ephrinB2 signaling pathway in the interaction of co-cultured hPDLSCs and macrophages.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods \u003c/strong\u003ehPDLSCs isolated from human periodontal ligament were co-cultured with non-activated M0 macrophages (M0-Mφ) induced from THP-1. Quantitative real-time polymerase chain reaction (qRT-PCR), alkaline phosphatase (ALP) staining and assay, as well as Alizarin red staining (ARS) were carried out to evaluate hPDLSCs osteogenic differentiation. qRT-PCR and Enzyme-Linked Immunosorbent Assay (ELISA) were employed to detect the expression of macrophage polarization-related factors. Western Blot was utilized to detect the expression of EphB4, ephrinB2, ERK1/2 and STAT3.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults \u003c/strong\u003eWhen\u003cstrong\u003e \u003c/strong\u003eM0-Mφ was directly co-cultured with hPDLSCs at a ratio of 5:1, the co-culture system significantly promoted the osteogenic differentiation of hPDLSCs, as demonstrated by enhanced ALP staining/activity, ARS mineralization and upregulated mRNA expression of osteogenic markers (Runx2, ALP, OCN, and OPN). Meanwhile, the co-culture system markedly increased anti-inflammatory factor expression (TGF-β1 and IL-10) and decreased the pro-inflammatory factors (TNF-α and IL-1β), indicating enhanced polarization of alternatively activated macrophages (M2-Mφ). The mRNA and protein expression of EphB4 and ephrinB2 increased significantly with the time extension of the two cells’ co-culture. However, pharmacological interruption of EphB4/ephrinB2 signaling pathway resulted in the inhibition of hPDLSC osteogenic differentiation, M2 macrophage polarization, and p-STAT3 expression in the co-culture system.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions \u003c/strong\u003eThe EphB4/ephrinB2 pathway may mediate the osteogenic differentiation of hPDLSCs and the polarization of M2-Mφ in the co-culture system. Its regulatory effect on the osteogenic differentiation of hPDLSCs may be achieved through the STAT3 signaling pathway.\u003c/p\u003e","manuscriptTitle":"The enhanced osteogenic differentiation of human periodontal ligament stem cells and M2 polarization of macrophages may be mediated by EphB4/ephrinB2 signaling pathway: a study of their direct co-culture","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-27 11:35:46","doi":"10.21203/rs.3.rs-7457833/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-12-10T18:11:14+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-09T13:44:06+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-06T12:29:28+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-27T09:58:12+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"8448584352607559093095648639839084623","date":"2025-11-25T09:53:40+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-21T18:26:03+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"23024415658576779091623682462007871210","date":"2025-11-19T23:39:24+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"290376369100750158316569816260364677409","date":"2025-11-19T12:25:11+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"193838656581386554660861450861969187259","date":"2025-11-17T16:34:19+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"3685370834650574523289402755559100585","date":"2025-11-17T09:32:14+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"228868633756768513771902091794241175596","date":"2025-11-17T08:56:01+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"139177640156036906530225270443887161412","date":"2025-10-14T02:09:54+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-10-13T11:59:03+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-28T01:41:34+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-28T01:40:33+00:00","index":"","fulltext":""},{"type":"submitted","content":"Stem Cell Research \u0026 Therapy","date":"2025-08-26T02:12:46+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"stem-cell-research-and-therapy","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scrt","sideBox":"Learn more about [Stem Cell Research \u0026 Therapy](http://stemcellres.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/scrt/default.aspx","title":"Stem Cell Research \u0026 Therapy","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7e65ffaf-82e9-40dd-8877-4fdeab5a04c8","owner":[],"postedDate":"October 27th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-09T16:05:54+00:00","versionOfRecord":{"articleIdentity":"rs-7457833","link":"https://doi.org/10.1186/s13287-026-04946-1","journal":{"identity":"stem-cell-research-and-therapy","isVorOnly":false,"title":"Stem Cell Research \u0026 Therapy"},"publishedOn":"2026-03-02 15:58:04","publishedOnDateReadable":"March 2nd, 2026"},"versionCreatedAt":"2025-10-27 11:35:46","video":"","vorDoi":"10.1186/s13287-026-04946-1","vorDoiUrl":"https://doi.org/10.1186/s13287-026-04946-1","workflowStages":[]},"version":"v1","identity":"rs-7457833","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7457833","identity":"rs-7457833","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00