Garden cress oil attenuates methotrexate-induced hepatic damage by enhancing inflammation, apoptosis, and histological profile: in vivo and in silico studies

Garden cress oil attenuates methotrexate-induced hepatic damage by enhancing inflammation, apoptosis, and histological profile: in vivo and in silico studies | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Garden cress oil attenuates methotrexate-induced hepatic damage by enhancing inflammation, apoptosis, and histological profile: in vivo and in silico studies Dalia M. Mabrouk, Radwa H. El-Akad, Ahmed H. Afifi, Hafiza A. Sharaf, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4840230/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 20 Feb, 2025 Read the published version in Scientific Reports → Version 1 posted 11 You are reading this latest preprint version Abstract Methotrexate (MTX) has been used in high doses for cancer therapy and low doses for autoimmune diseases. It is proven that methotrexate-induced hepatotoxicity occurs even at relatively low doses. It is known that garden cress has anti-inflammatory, antioxidant, and hepatoprotective properties. This study investigates the potential alleviating effect of garden cress oil (GCO) against MTX-induced hepatotoxicity in rats. The chemical composition of GCO was assessed using GC/MS analysis. Liver damage was studied using molecular and histological analysis. Also, the effects of GCO on TNF-α and caspase-3 proteins were evaluated through molecular docking studies. MTX showed clear signs of apoptosis, such as increased mRNA expression levels of BAX, Caspase-3, and P53, and increased liver inflammation indicated by higher levels of TNF-α expression. MTX exhibited significant liver damage, as demonstrated by histological examination. Treatment with GCO effectively alleviated the apoptotic effects of MTX and provided protection against inflammation, as well as restoring histological alterations. Molecular docking revealed that linoleic acid and α-tocopherol are recognized as leading compounds for attenuating the inflammatory and apoptosis cascade reactions in the liver by inhibiting TNF-α and caspase-3 proteins, and in vivo and in silico studies demonstrated that GCO could potentially alleviate MTX hepatotoxicity. Biological sciences/Biochemistry Biological sciences/Cell biology Biological sciences/Genetics Methotrexate hepatotoxicity Garden cress In silico inflammation Apoptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Drug-induced liver injury is a significant issue that limits the duration of medication therapy and undermines its positive effects. These effects could potentially result from modifications in distinct pathways that trigger an immediate toxic effect, the production of active metabolites, or an immune response. Consequently, over the last decade, researchers, government agencies, medical professionals, and pharmaceutical companies have all paid close attention to the rise in drug-induced liver damage. Over a thousand medications have been linked to liver injury, which can lead to inflammation, hepatic death, and severe liver failure [ 1 ]. Methotrexate (MTX) is one of the most effective and widely used drugs in the management of autoimmune diseases [ 2 ]. Methotrexate is specified for a variety of medical conditions, including autoimmune rheumatic, psoriatic and juvenile idiopathic arthritis, inflammatory myopathies, sarcoidosis, rheumatic polymyalgia, arthritis related to secondary amyloidosis, and others. It is also used for other autoimmune conditions, such as Sjogren syndrome, inflammatory bowel disease, vasculitis, and some neoplasms [ 3 , 4 ]. It is an antifolic acid medication derived from aminopterin that can inhibit DNA synthesis and repair [5 ,6). One potential mechanism for MTX-induced liver damage is the prolonged presence of MTX in cells due to hepatocytes storing and metabolizing it in its polyglutamated form [ 7 , 8 ]. Disruption of the intestinal barrier function may lead to methotrexate-induced hepatotoxicity, allowing bacteria to translocate to the liver and cause damage. Furthermore, MTX has been shown to increase intestinal permeability, which is linked to elevated hepatic enzymes, fibrosis, cirrhosis, and hepatic inflammation [ 9 ]. Several studies have indicated that hepatotoxicity can result from an imbalance in the regulation of oxidative stress, inflammation, endothelial damage, and apoptosis [ 10 , 2 , 11 – 14 ]. Additionally, MTX may be used in lower dosages as a disease-modifying anti-rheumatic drug for autoimmune diseases, but this use can still result in liver damage as a side effect [ 15 ], indicating that MTX-induced hepatotoxicity may not be dose-dependent [ 16 ]. Apoptosis is essential for maintaining tissue homeostasis in the body and occurs under the control of different genes in multicellular and unicellular organisms. The pro-apoptotic Bcl-associated X (BAX) protein and anti-apoptotic B-cell lymphoma 2 (Bcl-2) protein play significant roles in forming mitochondrial apoptotic channels. Caspase protease enzymes, including caspase-3 and 7, are also involved in various apoptotic pathways. The TP53 gene is one of the most widely studied genes in human cells due to its multifaceted functions and complex dynamics. P53 can induce apoptosis in a genetically unstable cell by interacting with many pro-apoptotic and anti-apoptotic factors [ 17 , 18 ]. In addition, TNFα, mainly produced by activated macrophages during inflammation, has been implicated as an important pathogenic mediator in liver diseases [ 19 ]. It has been reported that plant-based medicines are a source of biologically active ingredients and are important in global healthcare, including alternative, conventional, and preventative medicine [ 20 ]. Lepidium sativum (LS) or Garden cress, a member of the Brassicaceae family, can be topically used to relieve rheumatism, inflammation, and sore muscles [ 21 ]. Additionally, it has hepatoprotective, anti-diarrheal, antioxidant, blood-purifying, hunger-stimulating, antispasmodic, and anticancer properties [ 22 , 23 ]. It also possesses anti-diabetic, laxative, cholesterol-lowering, fracture-healing, pain-relieving, procoagulant, and diuretic properties. According to Emhofer et al. [ 24 ], it contains proteins, vitamins, carbohydrates, omega-3 fatty acids, iron, phytochemicals, and flavonoids. The liver-protective properties of garden cress seeds have come to light due to their ability to promote liver function and protect it from injury. Therefore, many studies are investigating the bioactive compounds in garden cress seeds and their impact on liver function [ 25 ]. The purpose of this study was to explore three main objectives: 1) to examine the potential impact of garden cress oil on reducing hepatotoxicity caused by low-dose methotrexate in rats, 2) to analyze the chemical composition of GCO, and 3) to predict the binding modes and affinities of the major metabolites against potential biological targets using molecular docking tools. Results Lipid content determination in GCO via GC/MS analysis Total ion chromatograms of the analyzed unsaponifiable matter (unsap.) and FAME are shown in Figure 1. The area percentage of identified compounds is presented in Table 1 and Table 2. Analysis of unsaponifiable matter revealed the identification of 67 metabolites constituting 89.5%; the majority of which are alkane hydrocarbons (80.26 %) varying between branched and straight chain (Table 1). Herein, 36 alkane hydrocarbons were detected. Long chain unsaturated fatty alcohols docosenol (15.1%) and eicosenol (15.01%) were the major compounds in the analyzed sample (Table 1). Other detected compounds included alcohols, esters and aldehydes of saturated and unsaturated hydrocarbon chains varying from C-12 to C-31 (Table 1). Other identified compounds belong to diverse phytochemical classes including 19 mono-/sesqui-/di-/and tri-terpenes (4.75%), 2 phenyl propanoids (0.5%), 3 tocopherols (0.08%), 2 lignans (Sesamin (0.97%) and sesamolin (1.5%) and 6 sterols (1.59%) (Fig.2). Carotane sesquiterpenes, carotol (1.1%) and daucol (0.05%), are reported herein for the first time as well as bisabolene (0.73%), cuparene (0.027%) and cupranene (0.011%), Conversely, 6 fatty acids were identified as methyl esters (92.02%) that included oleic (33.1%) and linoleic acids (30.9%) followed by erucic, vaccenic, palmitic and stearic acids (Table 2). Molecular docking study Molecular docking study was employed to assess the binding affinities and binding poses of the identified phytoconstituents in garden cress oil against the active sites of TNF-α (pdb: 7JRA) and Caspase-3 (pdb: 3GJQ) with the aim to predict the underlying mechanism of the hepatoprotective effect of garden cress oil against MTX-induced hepatotoxicity. Table 3 displays the binding energy of the top-scoring phytoconstituents against the two targets. Validation of the docking protocol was assessed through redocking of the co-crystalized ligands against their corresponding proteins and calculating the RMSD value between the docked pose and the co-crystalized pose for both ligands. The validity of the docking parameters was donated by the excellent superposition and small RMSD value between docked and co-crystalized poses for both ligand (0.587 and 0.846 Å for TNF-α and Caspase-3, respectively). Among the identified phytoconstituents, α, β and γ-tocopherols along with erucic acid and Sesamolin exhibited the highest binding affinities toward TNF-α binding site with binding energies -9.55, -10.73, -9.52, -9.97 and -9.91 kcal/mol, respectively. Inspection of the best scoring pose of β-tocopherol in the active site of TNF-α homotrimer revealed the formation of one conventional hydrogen bond between the phenolic hydroxyl group of β-tocopherol and Gly197 residue in chain B of TNF-α. Moreover, several hydrophobic interactions have also contributed to anchor the compound in the hydrophobic binding cavity (Figure 3). On the other hand, the highest binding affinities to Caspase-3 active site were observed by linoleic acid, vaccenic acid, oleic acid, stearic acid and palmitic acid as they achieved binding energies of -10.05, -7.48, -7.45, -6.93 and -6.89 kcal/mol, respectively. Best scoring pose of linoleic acid displayed its binding to the active site at the interface between p17 (chain A) and p12 (chain B) subunits of caspase-3 heterodimer and the formation of three conventional hydrogen bonds by linoleic acid carboxylic group with the residues Arg64 (chain A), Gln161 (chain A) and Arg207 (chain B) in addition to one salt bridge with Arg64 (chain A). Also, several hydrophobic interactions with the active site residues were observed in (Figure 4). Table 1: Relative area percentage of unsaponifiable components detected in garden cress seed oil ( Lepidium sativum ) via GC/MS analysis Table 2: Relative area percentage of fatty acid methyl esters detected in garden cress seed oil ( Lepidium sativum ) via GC/MS analysis Peak Rt (min.) Identification Area % 33.1 Palmitic acid, methyl ester 6.85 36.5 Linoleic acid, methyl ester 30.97 36.7 Oleic acid, methyl ester 33.1 37.1 Stearic acid, methyl ester 4.19 37.38 Vaccenic acid, methyl ester 7 43.6 Erucic acid, methyl ester 9.9 Total 92.02 % Saturated fatty acids 11.04 % Unsaturated fatty acids 80.98 Table 3 Docking results scoring Garden cress oil identified phytoconstituents against TNF-α and Caspase-3 binding sites. TNF-α (PDB: 7JRA) Caspase-3 (PDB: 3GJQ) Ligand Binding energy D G (kcal/mol) Compound Binding energy D G (kcal/mol) Co-crystalized inhibitor -12.89 Co-crystalized inhibitor -11.01 β-Tocopherol -10.73 Linoleic acid -10.05 Erucic acid -9.97 Vaccenic acid -7.48 Sesamolin -9.91 Oleic acid -7.45 α-Tocopherol -9.55 Stearic acid -6.93 γ-Tocopherol -9.52 Palmitic acid -6.89 mRNA expression of inflammatory and apoptotic genes Injection with MTX induced a significant increase in the mRNA expression level of TNFα, a proinflammatory marker, compared to the control groups (P≤0.05). However, treatment with GCO (200 and 400 mg/kg) led to a significant downregulation (P≤0.05) of TNFα compared to the MTX-treated group. Nevertheless, TNFα expression remained significantly higher among rats treated with GCO/MTX compared to the control group (Figure 5A). Next, we analyzed the expression levels of the pro-apoptotic genes (Bax, P53, Caspase-3). The results showed that MTX caused a significant increase in Bax, P53, and Caspase-3 expression (P≤0.05). However, treatment with GCO (200 and 400 mg/kg) effectively reversed these effects (P≤0.05) (Figure 5B, C, D). Histological Results The microscopic examination of the liver section of control rats (Figure 6A) showed a normal structure of the hepatic lobule, with cords of hepatic cells radiating from the central vein separated by blood sinusoids. In contrast, the treated rats with Garden cress seed oil extraction showed hepatic lobules that were almost normal, except for some inflammatory cells infiltrating between the sinusoids (Figure 6B). Animals treated with methotrexate (MTX) exhibited marked cellular infiltration and septa of fibrosis around portal tracts, with shrinking hepatic cells containing pyknotic small nuclei and eosinophilic cytoplasm (Figure 6C). Various forms of nuclear damage were present, including apoptosis and polymorphism (uneven size of the nuclei), pyknosis, karyolysis, karyorrhexis, and necrotic areas (Figure 6D). The livers of animals treated with MTX and garden cress seed oil at a dose of 200mg/kg showed some improvement, such as a reduction in fibrosis around the portal area, infiltration of inflammatory cells, and dilation of sinusoids (Figure 6E). Hepatocyte vacuolization, fatty degeneration, and focal necrotic areas (Figure 6F) were also present. In the group treated with MTX plus garden cress oil at a dose of 400mg/kg, there was much improvement, with a reduction in connective tissue around the portal tract, proliferation of bile ducts, and cellular infiltration (Figure 6G). However, nuclear degeneration in the form of pyknosis, karyolysis, as well as marked vacuolar degeneration and fatty degeneration of hepatocytes, were still observed (Figure 6H). Van Gieson's stain is a simple method used for differential staining of collagen in connective tissue. It gives collagen a pink color, similar to what is seen in fibrosis. In control animals, the liver showed a normal distribution of fibrous tissue around the portal area (Figure 7A). However, livers treated with Garden cress exhibited a slight increase in fibrosis around the portal tract (Figure 7B). The group treated with MTX showed a significant increase in fibrous tissues around the portal tract, along with bile duct proliferation, massive cellular infiltration, and severe dilation of the portal area (Figure 7C). Animals treated with MTX in combination with garden cress extract at a dose of 200 mg/kg showed some improvement, with a decrease in fibrous tissue, although dilation was still present (Figure 7D). The group treated with MTX and garden cress seed oil at a dose of 400 mg/kg showed even more improvement, with a reduction in connective tissue around the portal tract (Figure 7E). Discussion Methotrexate is the cornerstone of treatment for autoimmune diseases and a crucial part of managing inflammatory rheumatic disorders. Prescribers considering starting long-term methotrexate therapy for their patients have long been concerned about hepatotoxicity [ 26 , 27 ]. Lepidium sativum, or garden cress is an overlooked edible herb native to Egypt and commonly cultivated worldwide. The seed oil is reported to have beneficial health-promoting effects in metabolic disorders like diabetes and hyperlipidemia, as well as antioxidant, anti-inflammatory, and antirheumatic activities [ 28 ]. Other studies have reported in vitro and in vivo hepatoprotective effects, prevention of hepatocarcinogenesis, anticarcinogenic activity, and detoxification of carcinogens by the seed extracts/juice [ 28 , 29 ]. Garden cress (Lepidium sativum) seeds' nutritional, ethnopharmacological, and medicinal relevance might be owed to their content of bioactive compounds and antioxidant properties [ 30 ]. The phytochemical investigation of commercial GCO via GC/MS analysis revealed the presence of 67 unsaponifiable compounds [19 mono-/sesqui-/di-/and tri-terpenes (4.75%), 2 phenyl propanoids (0.5%), 3 tocopherols (0.08%), 2 lignans (2.47%), 6 sterols (1.59%), 35 alkane hydrocarbons (80.26%)]. These findings are consistent with previously reported literature [ 26 , 27 , 29 ]. The oil itself is odorless, but, its unsaponifiable fraction has a characteristic aromatic scent attributed to the detected mono- and sesqui-terpenes. Additionally, 6 fatty acids were identified, with oleic and linoleic acids being the major ones. Several metabolites (Carotane sesquiterpenes, carotol, daucol, bisabolene, cuparene and cupranene) were reported for the first time in this study. In this investigation, we are studying the role of garden cress in attenuating the hepatotoxicity of MTX through inflammatory and apoptotic gene pathways as well as histopathological observations. Most drugs are metabolized by the liver and kidneys, making the liver susceptible to Drug-Induced Liver Injury (DILI) [ 32 ]. In hepatocytes, methotrexate (MTX) is converted to MTX-polyglutamate (MTX-PGs) by folylpolyglutamate synthase (FPGS) leading to apoptosis, fibrosis, oxidative stress, inflammation, and steatosis. The up-regulation of TNF-α observed in our study is a relevant biomarker associated with the inflammation pathway in MTX-induced hepatotoxicity. This significant increase in hepatic TNF-α may be due to MTX-PG-induced intracellular ROS, which in turn activate transcription factors like NF-kB and Nrf-2. Their nuclear translocation causes pro-inflammatory responses through the release of several inflammatory cytokines, such as TNF-α [ 2 ]. Consistent with our findings, previous in vitro and in vivo studies have reported that the anti-inflammatory property of L. sativum was attributed to the lowering of TNF-α levels [ 33 – 36 ]. Notably, our research findings demonstrated that GCO inhibited MTX-induced hepatic inflammation by lowering TNF-α mRNA expression. The anti-inflammatory effect of GCO is likely attributed to the antioxidant and/or anti-inflammatory activities of the reported bioactive components such as phenyl propanoids, α-Linolenic acid, sterols, and triterpenes [ 37 ]. Forms of vitamin E such as γ-tocotrienol, γ-tocopherol, and δ-tocopherol are potent natural therapeutic antioxidants with anti-inflammatory properties that help prevent many illnesses [ 38 ]. Both lignans (sesamin and sesamolin) are reported to have antioxidant, immunomodulatory and anti-inflammatory activities as well as beneficial health promoting effect on decreasing hepatic lipogenic activity through increasing fatty acid oxidation enzymes [ 39 ]. Regarding apoptotic markers, MTX resulted in significantly higher expression levels of Bax, caspase-3, and P53 genes. Our results support previous studies that have shown increased expression levels of these genes in vivo in response to MTX [ 40 – 42 ]. During MTX-induced hepatotoxicity, an increase in oxidative stress leads to Bax translocation to the outer mitochondrial membrane, resulting in increased mitochondrial permeability and cytochrome c release into the cytosol. This activates downstream effector caspases, such as caspase-3 [ 43 ]. Conversely, our results indicated that GCO downregulated the elevation of Bax, Caspase-3, and P53 induced by MTX in rat liver tissue, explaining its antiapoptotic action. These findings are consistent with Raish et al. [ 44 ], who reported that Lepidium sativum ethanolic extract significantly down-regulated the expression levels of caspase-3 in a galactosamine/lipopolysaccharide-induced liver damage model. The in silico docking study of the identified metabolites into TNF-α (pdb: 7JRA) and Caspase-3 (pdb: 3GJQ) target proteins suggested that the observed anti-inflammatory activity of GCO through inhibition of TNF-α enzyme could be attributed to tocopherols (α-/β-/ and γ), sesamolin lignan, and erucic acid. These compounds showed the highest binding affinity, with docking scores ranging from 9.52 to 10.73 kcal/mol, compared to the co-crystalized ligand (12.89 kcal/mol). Tocopherols, especially vitamin E, and sesamolin were reported to attenuate TNF-α gene expression and improve the treatment of hepatotoxicity [ 45 ]. Linoleic acid showed the highest docking score against caspase-3 protein (10.05 kcal/mol) compared to its co-crystalized ligand (11.01 kcal/mol), followed by other fatty acids. Previous studies on different cells have shown that linoleic acid and other unsaturated fatty acids play a protective regulatory role by inhibiting apoptosis through blocking the caspase cascade signaling pathway in inflammatory reactions, or by activating apoptosis to induce cell death in cancer [ 46 ]. The histological analyses revealed significant liver damage in the MTX-treated group, including interface necrosis, apoptotic cells, and central zone lymphocyte infiltration. These alterations are corroborated by previous research [ 47 ]. Morsy et al. [ 13 ] demonstrated that rats receiving MTX showed high collagen deposition in their liver tissue, primarily leading to hepatic fibrosis. Taskin et al. [ 48 ] confirmed that MTX exhibited many pathological anomalies in the liver, including hepatocyte necrosis, fibrosis, and an increase in cellular infiltration. Meanwhile, the present study indicated that garden cress restores the histopathological alterations induced by MTX. According to Zamzami et al. [ 49 ], Lepidium sativum enhanced liver function in CCl4-treated New Zealand white rabbits by reversing the liver histopathologic alterations. Additionally, Ibrahim et al. [ 50 ] reported that a daily dose of 400 mg/kg b.w. of garden cress ethanolic extract has hepatoprotective, antioxidant, and anti-steatosis properties in rats. Garden cress has been found to have potential benefits for liver tissue regeneration, where bioactive compounds in the seeds are thought to promote the growth of new liver cells, aiding in the restoration of injured liver tissue [ 51 ]. On the other hand, administering both doses of 2% and 5% garden cress seeds revealed a significant degree of recovery in liver and pancreas histology in streptozotocin-induced diabetic rats [ 52 ]. Conclusion All of our data points to the fact that GCO protects the liver from MTX-induced damage. This is partially explained by its strong anti-inflammatory, anti-fibrotic, and anti-apoptotic properties. These properties is probably attributed to the identified compounds as linoleic acid and α-tocopherol that recognized from in silico study as leading compounds for attenuating the inflammatory and apoptosis reactions in the liver by inhibiting TNF-α and caspase-3, as proven by gene expression results. Materials and methods Chemicals Methotrexate was obtained from EIMC United Pharmaceuticals Company (Cairo-Egypt). Cold-pressed Garden cress oil was purchased from Haraz Co., Cairo, Egypt. All other chemicals were of analytical grade and acquired from standard marketable suppliers. GC/MS analysis of lipid content in garden cress seed oil Saponification of garden cress oil (GCO) (8 g) was performed by refluxing for 6–8 hours with alcoholic KOH, followed by extraction of unsaponifiable matter with ether, yielding 0.7 g upon evaporation to dryness. Fatty acids were methylated through reflux with a 2 M HCl solution in methanol for 3–4 hours, then extracted with ether and evaporated to dryness, yielding 4.8 gm as fatty acid methyl esters (FAME) [ 53 ]. Both fractions were then analyzed via a Shimadzu GCMS-QP2010 (Kyoto, Japan) equipped with an Rtx-5MS fused bonded column (30 m x 0.25 mm i.d. x 0.25 µm film thickness) (Restek, USA) with a split–spitless injector. The following guidelines were established: the initial temperature of the column was maintained at 50°C for three minutes (isothermal), then it was increased to 300°C at a rate of 5°C per minute and held there for ten minutes (isothermal). Even though the injector temperature was established at 280°C. The flow rate of the helium carrier gas was 1.37 ml/min. The following parameters were applied to all mass spectra recordings: Ion source temperature: 220°C; ionization voltage: 70 eV; filament emission current: 60 mA. Split mode injections were used with diluted samples (1% v/v; split ratio: 1:15). Identification of compounds was achieved by comparing their retention index (RI) and mass spectral data with NIST/Wiley, Pherobase, and other literature sources [ 54 ]. Molecular docking study of identified compounds The 3D coordinates of the detected phytoconstituents were obtained in SDF format from the PubChem database. After being energy-minimized to a gradient of 0.01 Kcal/mol Å in the gas phase using the MMFF94x Force Field, the data were saved in PDBQT format. Human TNF-α (PDB ID: 7JRA) and human caspase-3 (PDB ID: 3GJQ) co-crystal structures were obtained from the Protein Data Bank ( https://www.rcsb.org ). Using MGL Tools v1.5.7, all target receptors were prepared by deleting water molecules and other hetatoms, adding polar hydrogens, and assigning Kollman charges. The receptors were then saved in PDBQT format. Grid boxes measuring 25 x 25 x 25 Å were positioned at the co-crystallized ligands to encompass the entire binding sites of the target receptors. To perform all docking computations, AutoDock Vina, an open-source program, was utilized. The docking poses were ranked according to their docking scores, and the pose with the best energy was selected. Using Discovery Studio Visualizer v21.1.0.20298, the interactions between the selected compounds and the target proteins were examined [ 55 ]. In vivo experimental design Thirty adult male Sprague-Dawley albinos, weighing between 100 to 150g, were obtained from the animal facility at the National Research Center in Giza, Egypt. The rats were housed in a room with controlled environmental conditions, including a 12-hour light/12-hour dark cycle and a temperature of 22ºC. They were kept in clear plastic cages with stainless steel wire tops, and provided with rat feed pellets and unrestricted access to water. The study was approved by the Ethics Committee at the National Research Center (Approval No. 19032). The research methods were carried out following relevant guidelines and ARRIVE guidelines. The rats were randomly divided into five groups, each consisting of six animals. The animals were given a week to acclimate before the start of the study. The groups were as follows: Group I: rats received oral gavages of saline as a negative control. Group II: animals were orally administered Garden cress oil (400 mg/kg/day) for 28 days as a vehicle group. Group III: animals were intraperitoneally injected with methotrexate at a dose of 5 mg/kg/day for 7 days following the protocol of Demiryilmaz et al. [ 56 ]. Groups IV & V: animals were injected with methotrexate following the same protocol as Group III. On the eighth day, they were orally administered Garden cress oil at doses of 200 and 400 mg/kg once daily for 28 days, as described by Yogesh et al. [ 57 ]. RNA isolation, cDNA synthesis, and reverse transcription polymerase chain reaction (RT-PCR) analysis Isolated liver samples were homogenized in an Easy Red Total RNA Extraction Kit (Intronbio, Korea), and RNA was extracted following the manufacturer’s instructions. The yield and quality of isolated RNAs were assessed through gel electrophoresis and spectrophotometric measurement. The RNA was then treated with the RNase-free DNase kit (Thermo Scientific) and cDNA was synthesized via reverse-transcription as per the manufacturer’s instructions (Thermo Scientific, China). Gyceraldehyde-3-phosphate dehydrogenase (GADPH) was used as the internal control and the expression of four genes (Bcl-associated X protein (Bax), cysteine aspartic acid specific protease 3 (Caspase-3), tumor necrosis factor alpha (TNF-α) and tumor-suppressor protein (P53) was evaluated in the study. The primers used are GADPH, F: AACTTTGGCATTGTGGAAGG, R: ACACATTGGGGGTAGGAACA; Bax, F: ATTGACACAATACACGGGATCTGT, R: AAATTCAAGGGACGGGTCAT; Caspase-3, F: AGA GGA TGA TTG CTG ATG TGG, R: CCC AGT TGA AGT TGC CGT; TNF-α, F: CCACCACGCTCTTCTGTCTAC, R: ACCACCAGTTGGTTGTCTTTG; P53, F: GCA GAG TTG TTA GAA GGC, R: TTG AGA AGG GAC GGA AGA. RT-qPCR was conducted using the Stratagene Mx3000P Real-Time PCR System (Agilent Technologies, USA) and carried out in a 25 µL reaction containing cDNA, TOPreal™qPCR 2X PreMIX (SYBR Green with low ROX) (Enzynomics), forward and reverse primers (10 pmol/µl) (Macrogen), and free water nuclease. The gene expression levels were calculated using the 2-ΔΔCt method [ 58 ]. Histological methodology Hematoxylin and eosin stain The liver specimens were collected, fixed in a 10% buffered formalin (Thermo Fisher Scientific, Waltham, MA) at room temperature for one to three days, and embedded in paraffin. Subsequently, 5µm thick paraffin tissue sections were subjected to standard procedures, including deparaffining, hematoxylin and eosin staining, dehydration, and mounting. were prepared and stained with H&E stain following the method of Drury and Wallington [ 59 ]. Using an optical microscope (Olympus, IX53, Tokyo, Japan), the stained slides were inspected and captured on camera. Van Gieson stain Van Gieson stain was used to evaluate liver fibrosis, following the protocol outlined by Chen et al. [ 60 ]. Briefly, paraffin-embedded liver sections were deparaffinized and hydrated in distilled water. They were then stained with Wright’s Working Hematoxylin for 10 minutes and washed in distilled water. The slides were further stained with Van Gieson solution for 3 minutes, followed by gradient dehydration in 95% alcohol, absolute alcohol, and 2 changes in xylene before mounting with DPX for investigation. Statistical analysis The data obtained were presented as means ± standard error of the means (SEM) ( n = 3) and analysis was performed using the SPSS 16.0 program (SPSS Inc., Chicago, IL, USA). One way analysis of variance method was used to evaluate the statistical differences. Differences among groups were considered statistically significant at p values ≤ 0.05. Declarations Author contribution A.I.E. and H.A.S. conceived of the presented idea and designed the manuscript plan, R.H.E. and A.H.A. performed the oil analysis and molecular docking, D.M.M. carried out the genetic analysis; H.A.S. & S.L.E. performed the histological analysis, A. I.E. and D.M.M. wrote the manuscript with input from all authors. Additional information Competing interests The authors declare that they have no competing interests. Data availability Data is provided within the manuscript file. Ethics declarations The animal experiments were approved by the Ethics Committee of the National Research Centre (Approval No. 19032). Consent to participate/Consent to publish N/A References Kalantari, E., Zolbanin, N. M., & Ghasemnejad-Berenji, M. Protective effects of empagliflozin on methotrexate induced hepatotoxicity in rats. Biomedicine & pharmacotherapy. 170, 115953. https://doi.org/10.1016/j.biopha.2023.115953 (2024). Ezhilarasan, D. Hepatotoxic potentials of methotrexate: Understanding the possible toxicological molecular mechanisms. Toxicology 458, 152840. https://doi.org/10.1016/j.tox.2021.152840 (2021). Valerio, V., et al., Systematic review of recommendations on the use of methotrexate in rheumatoid arthritis. Clin .Rheumatol. 40, 1259–1271 https://doi.org/10.1007/s10067-020-05363-2 (2021). Ikponmwosa, O. B. & Usunomena, U. Aqueous Leaf Extract of Chromolaena odorata Attenuates Methotrexate-Induced Hepatotoxicity in Wistar Rats. Journal of Fundamental and Applied Pharmaceutical Science 3(1), 16-29 (2022). AbdelKader, G . et al. Protective Effects of Crocin against Methotrexate-Induced Hepatotoxicity in Adult Male Albino Rats: Histological, Immunohistochemical, and Biochemical Study. Cureus 15, e34468. https://doi.org/10.7759/cureus.34468 (2023). Aboubakr, M. et al. Allicin and lycopene possesses a protective effect against methotrexate induced testicular toxicity in rats. Pak. Vet. J . 43, 559–566. https://doi.org/10.29261/pakvetj/2023.057 (2023). Bath, R. K., Brar, N. K., Forouhar, F. A. & Wu, G.Y. A review of methotrexate-associated hepatotoxicity. J. Dig. Dis. 15, 517–524. https://doi.org/10.1111/1751-2980.12184 (2014). Tag, H.M. Hepatoprotective effect of mulberry (Morus nigra) leaves extract against methotrexate induced hepatotoxicity in male albino rat. BMC Complement Altern. Med .15, 252. https://doi.org/10.1186/s12906-015-0744-y (2015). Cao, Y. et al . Protective Effects of Magnesium Glycyrrhizinate on Methotrexate-Induced Hepatotoxicity and Intestinal Toxicity May Be by Reducing COX-2. Frontiers in pharmacology 1, 119. https://doi.org/10.3389/fphar.2019.00119 (2019). Abdelaziz, R. M., Abdelazem, A. Z., Hashem, K. S., & Attia, Y. A. Protective effects of hesperidin against MTX-induced hepatotoxicity in male albino rats. Naunyn-Schmiedeberg's archives of pharmacology , 393 (8), 1405–1417. https://doi.org/10.1007/s00210-020-01843-z (2020). Abd El-Ghafar, O. A. M. et al. Hepatoprotective effect of acetovanillone against methotrexate hepatotoxicity: Role of Keap-1/Nrf2/ARE, IL6/STAT-3, and NF-κB/AP-1 signaling pathways. Phytotherapy research : PTR , 36 (1), 488–505. https://doi.org/10.1002/ptr.7355 (2022). Alfwuaires, M.A. Galangin mitigates oxidative stress, inflammation, and apoptosis in a rat model of methotrexate hepatotoxicity. Environ. Sci. Pollut. Res. 29, 20279–20288. https://doi.org/10.1007/s11356-021-16804-z (2022). Morsy, M. A., Abdel-Latif, R., Hafez, S. M. N. A., Kandeel, M., & Abdel-Gaber, S. A.. Paeonol Protects against Methotrexate Hepatotoxicity by Repressing Oxidative Stress, Inflammation, and Apoptosis-The Role of Drug Efflux Transporters. Pharmaceuticals (Basel, Switzerland) 15 (10), 1296. https://doi.org/10.3390/ph15101296 (2022). Wang, S. C.et al. Melatonin protects against methotrexate hepatotoxicity in young rats: Impact of PI3K/Akt/mTOR signaling. Journal of biochemical and molecular toxicology 37(5), e23323. https://doi.org/10.1002/jbt.23323 (2023). Clary, D. D., Reid, A. T., Kiani, R. & Fanciullo, J. Methotrexate Hepatotoxicity Monitoring Guidelines in Psoriasis and Rheumatoid Arthritis: Is There a Consensus?. South Dakota medicine : the journal of the South Dakota State Medical Association 74 (8), 363–366(2021). Azzam A., Jiyad, Z. & O’Beirne, J. Is methotrexate hepatotoxicity associated with cumulative dose? A systematic review and meta-analysis. Austral J. Dermatol . 62 (2), 130–140 https://onlinelibrary.wiley.com/doi/10.1111/ajd.13546〉(2021). Feroz, W.& Sheikh, A.M.A. Exploring the multiple roles of guardian of the genome: P53. Egypt J. Med. Hum. Genet. 21, 49 https://doi.org/10.1186/s43042-020-00089-x (2020). Vahid, N. K., Nameni, F., & Chaharmahali, B. Y. Effect of Interval Training and Curcumin on BAX, Bcl-2, and Caspase-3 Enzyme Activity in Rats. Gene, Cell and Tissue 9(4), e112792 (2022). Faletti, L. et al. TNFα sensitizes hepatocytes to FasL-induced apoptosis by NFκB-mediated Fas upregulation. Cell death & disease (9):909 (2018). El-Makawy, A. I . et al. Efficiency of turnip bioactive lipids in treating osteoporosis through activation of Osterix and suppression of Cathepsin K and TNF-α signaling in rats. Environmental science and pollution research international , 27 (17), 20950–20961. https://doi.org/10.1007/s11356-020-08540-7 (2020). El-Makawy, A. I., Mabrouk, D.M.; Ibrahim, F.M.; Abdel-Aziem, S.H. and Sharaf, H.A. Therapeutic and Prophylactic Efficacy of Garden cress Seed Oil against Osteoporosis in Rats. Jordan Journal of Biological Sciences 13(2), 237-245 (2020). Kanabur, V. & Sharavathi, V. Nutritional Significance and Usage of Garden cress Seeds (Lepidium sativum L)–A Review. American Journal of Food Science and Technology 1(1), 50-55 (2022). Lahiri, B. & Rani, R. Garden cress Seeds: chemistry, medicinal properties, application in dairy and food industry: A Review. Emergent Life Sciences Research 6,1-4 (2020). Emhofer, L., Himmelsbach, M., Buchberger, W., & Klampfl, C. W. High-performance liquid chromatography drift-tube ion-mobility quadrupole time-of-flight/mass spectrometry for the identity confirmation and characterization of metabolites from three statins (lipid-lowering drugs) in the model plant cress (Lepidium sativum) after uptake from water. Journal of Chromatography A 1592, 122-132 (2019). Jagdale, Y.D. et al . Nutritional profile and potential health benefits of super foods: A review. Sustainability 13(16), 9240 (2021). Di Martino, V. et al . Busting the myth of methotrexate chronic hepatotoxicity. Nature reviews. Rheumatology , 19 (2), 96–110. https://doi.org/10.1038/s41584-022-00883-4 (2023). Pradhan, A., Sengupta, S., Sengupta, R., & Chatterjee, M. Attenuation of methotrexate induced hepatotoxicity by epigallocatechin 3-gallate. Drug and Chemical Toxicology 46(4), 717–725. https://doi.org/10.1080/01480545.2022.2085738 (2023). Rezig, L., et al., Profile characterization and biological activities of cold pressed Garden cress (Lepidium sativum) seed oil. Arabian Journal of Chemistry . 15(8),103958 (2022). Nazir, S.et al. Lepidium sativum Secondary Metabolites (Essential Oils): In Vitro and In Silico Studies on Human Hepatocellular Carcinoma Cell Lines. Plants (Basel, Switzerland), 10(9), 1863. https://doi.org/10.3390/plants10091863 (2021). Bhatia, K. & Bhasin, A. Exploring the versatile potential of garden cress seeds: Therapeutic applications and industrial utilization: A comprehensive review. Pharma Innovation 12(9),101-108. DOI: 10.22271/tpi.2023.v12.i9b.22647 (2023). Ismael, I.A. & Khorsheed, A.C. Quantitative and qualitative detection of metabolic compounds in the seeds of cress plant (Lepidium sativum. L) using chromatography technique. Journal of Kerbala for Agricultural Sciences 8 (1), 8–16. https://doi.org/10.59658/jkas.v8i1.867 (2021). Hosack, T., Damry, D., & Biswas, S. Drug-induced liver injury: a comprehensive review. Therapeutic advances in gastroenterology . 16 : 17562848231163410. https://doi.org/10.1177/17562848231163410 (2023). Turkoglu, M., Kılıc, S., Pekmezci, E., & Kartal, M. Evaluating antiinflammatory and antiandrogenic effects of garden cress (Lepidium sativum L.) in HaCaT cells. Records of Natural Products, 12(6), 595-601(2018). Alqahtani, F. Y. et al Chemical composition and antimicrobial, antioxidant, and anti-inflammatory activities of Lepidium sativum seed oil. Saudi journal of biological sciences , 26 (5), 1089–1092. https://doi.org/10.1016/j.sjbs.2018.05.007 (2019). Ahmad, A. et al . Inhibitory effects of Lepidium sativum polysaccharide extracts on TNF-α production in Escherichia coli -stimulated mouse. Biotech , 8 (6), 286 https://doi.org/10.1007/s13205-018-1309-9 (2018). Abdulmalek, S. A., Fessal, M., & El-Sayed, M. Effective amelioration of hepatic inflammation and insulin response in high fat diet-fed rats via regulating AKT/mTOR signaling: Role of Lepidium sativum seed extracts. Journal of ethnopharmacology , 266, 113439. https://doi.org/10.1016/j.jep.2020.113439 (2021). Vazifeh, S., Kananpour, P., Khalilpour, M., Eisalou, S.V. & Hamblin, M.R. Anti-inflammatory and Immunomodulatory Properties of Lepidium sativum. Biomed. Res. Int. 2022, 12 https://doi.org/10.1155/2022/3645038 (2022). Ciarcià, G. et al. Vitamin E and non-communicable diseases: a review. Biomedicines, 10, 2473(2022). Pathak, N., Bhaduri, A., & Rai, A. K.. Sesame: Bioactive compounds and health benefits. Bioactive molecules in food , 5, 181-200 (2019). Almalki, R.S. The Protective Effect of Roflumilast against Acute Hepatotoxicity Caused by Methotrexate in Wistar Rats: In vivo Evaluation. Drug Des. Devel. Ther. 18: 453-462. http://doi:10.2147/DDDT.S438703 (2024). Kabakcı, A.G. & Bozkır, M.G. Protective Effect of Linoleic Acid on Liver Toxicity Induced By Methotrexate. Int. J. Morphol. 41, 237-245. http://dx.doi.org/10.4067/S0717-95022023000100237 (2023). Kızıl, H.E. et al .. Morin ameliorates methotrexate-induced hepatotoxicity via targeting Nrf2/HO-1 and Bax/Bcl2/Caspase-3 signaling pathways . Mol. Biol. Rep . 50,3479-3488. https://doi: 10.1007/s11033-023-08286-8 (2023). Mahmoud, A.M. et al . Ferulic acid prevents oxidative stress, inflammation, and liver injury via upregulation of Nrf2/HO-1 signaling in methotrexate-induced rats. Environ. Sci. Pollut. Res 27, 7910–7921 https://doi.org/10.1007/s11356-019-07532-6 (2020). Raish, M. et al. Hepatoprotective activity of Lepidium sativum seeds against D-galactosamine/lipopolysaccharide induced hepatotoxicity in animal model. BMC Complement Altern Med. 16,501. https://doi: 10.1186/s12906-016-1483-4 (2016). Hadipour, E., & Emami, S. A. Effects of sesame (Sesamum indicum L.) and bioactive compounds (sesamin and sesamolin) on inflammation and atherosclerosis: A review. Food Science & Nutrition, 11, 3729-3757. https://doi.org/10.1002/fsn3.3407 (2023). Montecillo-Aguado, M., Tirado-Rodriguez, B. & Huerta-Yepez, S. The Involvement of Polyunsaturated Fatty Acids in Apoptosis Mechanisms and Their Implications in Cancer. Int. J. Mol. Sci . 24, 11691. https://doi.org/10.3390/ijms241411691 (2023). Kalantari, H., Asadmasjedi, N., reza Abyaz, M., Mahdavinia, M., & Mohammadtaghvaei, N. Protective effect of inulin on methotrexate-induced liver toxicity in mice. Biomedicine & Pharmacotherapy , 110, 943-950 (2019). Taskin, B., Erdogan, A. M., Yigitturk, G., Gunenç, D. & Erbas O Antifibrotic Effect of Lactulose on a Methotrexate-Induced Liver Injury Model. Gastroenterology Research and Practice 2017, 7942531. https://doi.org/10.1155/2017/7942531 (2017). Zamzami A. M., O. A. Baothman, F. Samy, & M. K. Abo-Golayel, “Amelioration of CCl4-induced hepatotoxicity in rabbits by Lepidium sativum seeds,” Evidence-Based Complementary and Alternative Medicine . 2019, 17 (2019). Ibrahim, I.A., Shalaby, A.A., Abdallah, H.M.L., El-Zohairy, N.F.& Bahr, H.I . Ameliorative effect of garden cress ( Lepidium sativum L.) seeds ethanolic extract on high fat diet-prompted non-alcoholic fatty liver disease in the rat model: Impact on 3-hydroxy-3-methylglutaryl-coenzyme a reductase and vascular endothelial growth factor. Adv. Anim. Vet. Sci. 8, 1-10. http://dx.doi.org/10.17582/journal.aavs/2020/8.s1.1.10 (2020). Mohamed, H.S., Kholief, T., Mohamed, R.W., Abd El-Rhman, A. The modulatory effects of black chia (Salvia hispanica) and garden cress ( Lepidium sativum ) seeds on Nε-CML formation in streptozotocin-injected rats. Journal of Herbmed Pharmacology . 12, 250-261 (2023). Doghmane, A., Aouacheri, O., Laouaichia, R. & Saka, S. The investigation of the efficacy ratio of cress seeds supplementation to moderate hyperglycemia and hepatotoxicity in streptozotocin‐induced diabetic rats. Journal of Diabetes & Metabolic Disorders 20, 447-459 (2021). El-Akad, R.H., et al Fruit metabolome profiling via HR-UPLC/MS and it’s in vitro antiarthritic activity. South African Journal of Botany 151,649-654 (2022). Adams, R.P., Identification of essential oil components by gas chromatography/mass spectrometry. 5 online ed. Gruver, TX USA: Texensis Publishing, 2017. Sayed, D. et al. Metabolic Profiling of Mimusops elengi Linn. Leaves extract and in silico anti-inflammatory assessment targeting NLRP3 inflammasome. Arabian Journal of Chemistry 16 (6), 104753 (2023).. Demiryilmaz, I. et al . Biochemically and histopathologically comparative review of thiamine’s and thiamine pyrophosphate’s oxidative stress effects generated with methotrexate in rat liver. Med. Sci. Monit. 18,BR475–BR481 https://doi.org/10.12659/msm.883591 (2012). Yogesh Chand, Y., Srivastav, D.N & Seth, A.K. Invivo antioxidant potential of Lepidium sativum L. seeds in albino rats using cisplatin induced nephrotoxicity. Inter. J. Phytomed . 2, 292-298 (2010). Livak, K.J.& Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods . 25,402-408 (2001). Drury, R.A.B. & Wallington, E.A., Carleton’s histological technique Ed. 5 Oxford University Press, Oxford, UK (1980). Chen, Y. Y. et al . Intrahepatic macrophage populations in the pathophysiology of primary sclerosing cholangitis. J.H.E.P. Reports 1, 369-376 (2019). ‏ Table Table 1 is available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files Tables1.docx Cite Share Download PDF Status: Published Journal Publication published 20 Feb, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 07 Nov, 2024 Reviews received at journal 06 Nov, 2024 Reviewers agreed at journal 02 Nov, 2024 Reviews received at journal 25 Oct, 2024 Reviewers agreed at journal 11 Oct, 2024 Reviewers agreed at journal 09 Oct, 2024 Reviewers invited by journal 08 Oct, 2024 Editor assigned by journal 08 Oct, 2024 Editor invited by journal 29 Aug, 2024 Submission checks completed at journal 29 Aug, 2024 First submitted to journal 01 Aug, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4840230","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":358489613,"identity":"748e3892-d5dc-4842-bc9f-ffd6d01da45d","order_by":0,"name":"Dalia M. Mabrouk","email":"","orcid":"","institution":"National Research Centre","correspondingAuthor":false,"prefix":"","firstName":"Dalia","middleName":"M.","lastName":"Mabrouk","suffix":""},{"id":358489614,"identity":"31002d10-fc90-4957-8036-3d64f9e84138","order_by":1,"name":"Radwa H. El-Akad","email":"","orcid":"","institution":"National Research Centre","correspondingAuthor":false,"prefix":"","firstName":"Radwa","middleName":"H.","lastName":"El-Akad","suffix":""},{"id":358489615,"identity":"3fc41362-9fc8-407b-a793-4202f4d3bf7c","order_by":2,"name":"Ahmed H. Afifi","email":"","orcid":"","institution":"National Research Centre","correspondingAuthor":false,"prefix":"","firstName":"Ahmed","middleName":"H.","lastName":"Afifi","suffix":""},{"id":358489616,"identity":"3394c4a1-196e-4007-bdeb-f3bef8cdb2f6","order_by":3,"name":"Hafiza A. Sharaf","email":"","orcid":"","institution":"National Research Centre","correspondingAuthor":false,"prefix":"","firstName":"Hafiza","middleName":"A.","lastName":"Sharaf","suffix":""},{"id":358489617,"identity":"6f292cc0-631c-44ca-b284-a0462a65b09e","order_by":4,"name":"Sonia L. Elsharkawy","email":"","orcid":"","institution":"National Research Centre","correspondingAuthor":false,"prefix":"","firstName":"Sonia","middleName":"L.","lastName":"Elsharkawy","suffix":""},{"id":358489618,"identity":"c0bbddcd-9388-4147-b86b-8d97dc2346be","order_by":5,"name":"Aida I. El makawy","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2klEQVRIiWNgGAWjYFAC5gYGhgNAmr2BgZlILYxQLTwHSNYikUCkFv72xtYNP87YJW64+cbwc0GFDVCkOwGvFokzB9tu9txITtxwO8dYesaZNKDI2Q34rbmR2HaD5wNzLlCLgTRv22EGA4lc/Frk7z9su/nnQ33uhptnjH8TpcXgBmPbbZ4bh3M33OAxI84WwzOJbbdlzhyvn3kmrcya50waD0G/yB0/fOzmm2PVxnzHD2++zVNhI8ff3kvA+zCgcIDDAETzEKccBOQb2B8Qr3oUjIJRMApGFAAA/TdT0czQSzcAAAAASUVORK5CYII=","orcid":"","institution":"National Research Centre","correspondingAuthor":true,"prefix":"","firstName":"Aida","middleName":"I. El","lastName":"makawy","suffix":""}],"badges":[],"createdAt":"2024-08-01 07:44:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4840230/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4840230/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-89550-8","type":"published","date":"2025-02-20T15:57:11+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":65458253,"identity":"60b96393-8d8b-4d2d-995c-90c480f0070a","added_by":"auto","created_at":"2024-09-27 16:54:27","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":252922,"visible":true,"origin":"","legend":"\u003cp\u003eTotal ion chromatograms of unsaponifiable matter (A) and fatty acid methyl esters (B) detected in garden cress seed oil (Lepidium sativum) via GC/MS analyses. Peaks follow the numbering of identified compounds in Table 1 and Table 2.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4840230/v1/0d78ea103b770dc579733274.png"},{"id":65458255,"identity":"9597b130-c1b5-4d91-8d7b-ef0263130b6a","added_by":"auto","created_at":"2024-09-27 16:54:27","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":202573,"visible":true,"origin":"","legend":"\u003cp\u003eStructures of selected compounds identified in garden cress seed oil \u003cem\u003evia \u003c/em\u003eGC/MS analysis of unsaponifiable matter and fatty acids (as methyl esters).\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4840230/v1/eb7ceaa81b79894ff7bb3c95.png"},{"id":65458595,"identity":"8f0fe6b6-e976-4976-8159-c2950a067fe9","added_by":"auto","created_at":"2024-09-27 17:02:27","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":526250,"visible":true,"origin":"","legend":"\u003cp\u003e3D and 2D illustration of the docking pose and binding interactions of β-tocopherol (ball and sticks) in the active site of TNF-α homotrimer (pdb: 7JRA)\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4840230/v1/6606cd78c71ee85520d4d2fe.png"},{"id":65459220,"identity":"f55cf759-5644-4e48-86ee-6a3ace18c07e","added_by":"auto","created_at":"2024-09-27 17:10:27","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":475930,"visible":true,"origin":"","legend":"\u003cp\u003e3D and 2D illustration of the docking pose and binding interactions of linoleic acid (ball and sticks) in the active site of caspase-3 heterodimer (pdb: 3GJQ)\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4840230/v1/3896f7457dca0397166ed004.png"},{"id":65458596,"identity":"28de90d6-aed6-4578-b0c9-02f2e257b6a9","added_by":"auto","created_at":"2024-09-27 17:02:27","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":217300,"visible":true,"origin":"","legend":"\u003cp\u003eThe mRNA expression of inflammatory and apoptotic genes in rat liver of all experimental groups, A) TNF-α; B) Bax; C) Caspase; D) P53.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4840230/v1/2e92ad6c039141cfc89b3f8c.png"},{"id":65458260,"identity":"445186b4-0ec0-4114-a714-129c8a1b9c47","added_by":"auto","created_at":"2024-09-27 16:54:27","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3246644,"visible":true,"origin":"","legend":"\u003cp\u003eSection of rat liver (A) control showing normal structure of hepatic lobule, hepatic cells radiated from central vain (CV) and sinusoids in between, (B) treated with garden cress showing hepatic lobule almost normal, while some inflammatory cells infiltration in between sinusoids were noticed. (C) methotrexate showing marked cellular infiltration and septa of fibrosis around portal tracts, shrinked hepatic cells with pyknotic small nuclei and eosinophilic cytoplasm. (D) High power of liver section treated with methotrexate showing apoptotic cells (arrow) and different form of nuclear damage represented in polymorphism (uneven size of the nuclei), pyknosis, karyolitic, karyorrhexis as well as necrotic areas(star). (E) methotrexate plus (200mg/Kg) garden cress extract showing some improvement represented in reduction in fibrosis around portal area, while the thickening of the portal tract with infiltration of inflammatory cells as well as dilation of sinusoid is present. (F) High power of liver section treated with methotrexate along with garden cress at dose (200mg/kg) showing hepatocyte vacuolization, fatty degeneration(F) and focal necrotic areas (N). (G): methotrexate plus garden cress extract at dose (400mg/Kg) showing much improvement manifested by reduction of connective tissue around portal tract, proliferation of bile ducts and cellular infiltration. Meanwhile the damage of hepatic cells and necrotic areas still present. (H): high power of section of liver treated with methotrexate plus garden cress extract at dose (400mg/Kg) showing of nuclear degeneration in the form of (pyknosis, karyolitic (curved arrow), as well as, marked vacuolar degeneration (arrow) and fatty degeneration (thick arrow) of hepatocytes still found.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4840230/v1/ec072f3a90aeb689d05ff847.png"},{"id":65458258,"identity":"6bdb26fa-f8b5-45d1-9456-2fec3e4f204c","added_by":"auto","created_at":"2024-09-27 16:54:27","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1596799,"visible":true,"origin":"","legend":"\u003cp\u003eImage\u003cstrong\u003e (\u003c/strong\u003eA): Liver section of control rat showing normal distribution of fibrous tissue around portal area (arrow). (B) liver section of rat treated with Garden cress showing minimal amount of fibrous tissue and slights dilation in portal area.\u003cstrong\u003e \u003c/strong\u003e(C) liver treated with methotrexate showing sever dilation of portal area and increase in fibrous tissues around portal tract, proliferation of bile ducts and massive cellular infiltration. (D) Liver treated with methotrexate pulse Garden cress extraction at dose (200 mg/kg) showing some improvement represented in decrease in fibrous tissue while the dilation still present (E) liver treated with methotrexate pulse Garden cress extraction at dose (400 mg/kg) showing much improvements represented in reduction in fibrous tissues around portal tract.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4840230/v1/bdee6d2c3bda727bee3d1b7c.png"},{"id":77053760,"identity":"4287f602-f32d-4418-ace1-4c744c3a9168","added_by":"auto","created_at":"2025-02-24 16:30:14","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8827988,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4840230/v1/ecb5d566-bd09-46da-b4dc-5f6161d670fc.pdf"},{"id":65458252,"identity":"ff88471c-a0bf-4c01-9c04-93441b87b702","added_by":"auto","created_at":"2024-09-27 16:54:27","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":31502,"visible":true,"origin":"","legend":"","description":"","filename":"Tables1.docx","url":"https://assets-eu.researchsquare.com/files/rs-4840230/v1/da19002803b44323601a3152.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Garden cress oil attenuates methotrexate-induced hepatic damage by enhancing inflammation, apoptosis, and histological profile: in vivo and in silico studies","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDrug-induced liver injury is a significant issue that limits the duration of medication therapy and undermines its positive effects. These effects could potentially result from modifications in distinct pathways that trigger an immediate toxic effect, the production of active metabolites, or an immune response. Consequently, over the last decade, researchers, government agencies, medical professionals, and pharmaceutical companies have all paid close attention to the rise in drug-induced liver damage. Over a thousand medications have been linked to liver injury, which can lead to inflammation, hepatic death, and severe liver failure [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMethotrexate (MTX) is one of the most effective and widely used drugs in the management of autoimmune diseases [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Methotrexate is specified for a variety of medical conditions, including autoimmune rheumatic, psoriatic and juvenile idiopathic arthritis, inflammatory myopathies, sarcoidosis, rheumatic polymyalgia, arthritis related to secondary amyloidosis, and others. It is also used for other autoimmune conditions, such as Sjogren syndrome, inflammatory bowel disease, vasculitis, and some neoplasms [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. It is an antifolic acid medication derived from aminopterin that can inhibit DNA synthesis and repair [5 ,6). One potential mechanism for MTX-induced liver damage is the prolonged presence of MTX in cells due to hepatocytes storing and metabolizing it in its polyglutamated form [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Disruption of the intestinal barrier function may lead to methotrexate-induced hepatotoxicity, allowing bacteria to translocate to the liver and cause damage. Furthermore, MTX has been shown to increase intestinal permeability, which is linked to elevated hepatic enzymes, fibrosis, cirrhosis, and hepatic inflammation [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Several studies have indicated that hepatotoxicity can result from an imbalance in the regulation of oxidative stress, inflammation, endothelial damage, and apoptosis [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan additionalcitationids=\"CR12 CR13\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Additionally, MTX may be used in lower dosages as a disease-modifying anti-rheumatic drug for autoimmune diseases, but this use can still result in liver damage as a side effect [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], indicating that MTX-induced hepatotoxicity may not be dose-dependent [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eApoptosis is essential for maintaining tissue homeostasis in the body and occurs under the control of different genes in multicellular and unicellular organisms. The pro-apoptotic Bcl-associated X (BAX) protein and anti-apoptotic B-cell lymphoma 2 (Bcl-2) protein play significant roles in forming mitochondrial apoptotic channels. Caspase protease enzymes, including caspase-3 and 7, are also involved in various apoptotic pathways. The TP53 gene is one of the most widely studied genes in human cells due to its multifaceted functions and complex dynamics. P53 can induce apoptosis in a genetically unstable cell by interacting with many pro-apoptotic and anti-apoptotic factors [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In addition, TNFα, mainly produced by activated macrophages during inflammation, has been implicated as an important pathogenic mediator in liver diseases [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIt has been reported that plant-based medicines are a source of biologically active ingredients and are important in global healthcare, including alternative, conventional, and preventative medicine [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. \u003cem\u003eLepidium sativum\u003c/em\u003e (LS) or Garden cress, a member of the Brassicaceae family, can be topically used to relieve rheumatism, inflammation, and sore muscles [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Additionally, it has hepatoprotective, anti-diarrheal, antioxidant, blood-purifying, hunger-stimulating, antispasmodic, and anticancer properties [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. It also possesses anti-diabetic, laxative, cholesterol-lowering, fracture-healing, pain-relieving, procoagulant, and diuretic properties. According to Emhofer et al. [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], it contains proteins, vitamins, carbohydrates, omega-3 fatty acids, iron, phytochemicals, and flavonoids. The liver-protective properties of garden cress seeds have come to light due to their ability to promote liver function and protect it from injury. Therefore, many studies are investigating the bioactive compounds in garden cress seeds and their impact on liver function [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe purpose of this study was to explore three main objectives: 1) to examine the potential impact of garden cress oil on reducing hepatotoxicity caused by low-dose methotrexate in rats, 2) to analyze the chemical composition of GCO, and 3) to predict the binding modes and affinities of the major metabolites against potential biological targets using molecular docking tools.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eLipid content determination in GCO via GC/MS analysis\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTotal ion chromatograms of the analyzed unsaponifiable matter (unsap.) and FAME are shown in Figure 1. The area percentage of identified compounds is presented in Table 1 and Table 2. \u0026nbsp;Analysis of unsaponifiable matter revealed the identification of 67 metabolites constituting 89.5%; the majority of which are alkane hydrocarbons (80.26 %) varying between branched and straight chain (Table 1). Herein, 36 alkane hydrocarbons were detected. Long chain unsaturated fatty alcohols docosenol (15.1%) and eicosenol (15.01%) were the major compounds in the analyzed sample (Table 1). \u0026nbsp;Other detected compounds included alcohols, esters and aldehydes of saturated and unsaturated hydrocarbon chains varying from C-12 to C-31 (Table 1).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Other identified compounds belong to diverse phytochemical classes including 19 mono-/sesqui-/di-/and tri-terpenes (4.75%), 2 phenyl propanoids (0.5%), 3 tocopherols (0.08%), 2 lignans (Sesamin (0.97%) and sesamolin (1.5%) and 6 sterols (1.59%) (Fig.2). \u0026nbsp;Carotane sesquiterpenes, carotol (1.1%) and daucol (0.05%), are reported herein for the first time as well as bisabolene (0.73%), cuparene (0.027%) and cupranene (0.011%), Conversely, 6 fatty acids were identified as methyl esters (92.02%) that included oleic (33.1%) and linoleic acids (30.9%) followed by erucic, vaccenic, palmitic and stearic acids (Table 2). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular docking study \u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMolecular docking study was employed to assess the binding affinities and binding poses of the identified phytoconstituents in garden cress oil against the active sites of TNF-\u0026alpha; (pdb: 7JRA) and Caspase-3 (pdb: 3GJQ) with the aim to predict the underlying mechanism of the hepatoprotective effect of garden cress oil against MTX-induced hepatotoxicity. Table 3 displays the binding energy of the top-scoring phytoconstituents against the two targets.\u003c/p\u003e\n\u003cp\u003eValidation of the docking protocol was assessed through redocking of the co-crystalized ligands against their corresponding proteins and calculating the RMSD value between the docked pose and the co-crystalized pose for both ligands. The validity of the docking parameters was donated by the excellent superposition and small RMSD value between docked and co-crystalized poses for both ligand (0.587 and 0.846 \u0026Aring; for TNF-\u0026alpha; and Caspase-3, respectively).\u003c/p\u003e\n\u003cp\u003eAmong the identified phytoconstituents, \u0026alpha;, \u0026beta; and \u0026gamma;-tocopherols along with erucic acid and Sesamolin exhibited the highest binding affinities toward TNF-\u0026alpha; binding site with binding energies -9.55, -10.73, -9.52, -9.97 and -9.91 kcal/mol, respectively. Inspection of the best scoring pose of \u0026beta;-tocopherol in the active site of TNF-\u0026alpha; homotrimer revealed the formation of one conventional hydrogen bond between the phenolic hydroxyl group of \u0026beta;-tocopherol and Gly197 residue in chain B of TNF-\u0026alpha;. Moreover, several hydrophobic interactions have also contributed to anchor the compound in the hydrophobic binding cavity (Figure 3). On the other hand, the highest binding affinities to Caspase-3 active site were observed by linoleic acid, vaccenic acid, oleic acid, stearic acid and palmitic acid as they achieved binding energies of -10.05, -7.48, -7.45, -6.93 and -6.89 kcal/mol, respectively. Best scoring pose of linoleic acid displayed its binding to the active site at the interface between p17 (chain A) and p12 (chain B) subunits of caspase-3 heterodimer and the formation of three conventional hydrogen bonds by linoleic acid carboxylic group with the residues Arg64 (chain A), Gln161 (chain A) and Arg207 (chain B) in addition to one salt bridge with Arg64 (chain A). Also, several hydrophobic interactions with the active site residues were observed in (Figure 4).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1: Relative area percentage of unsaponifiable components detected in garden cress seed oil (\u003cem\u003eLepidium sativum\u003c/em\u003e) \u003cem\u003evia\u0026nbsp;\u003c/em\u003eGC/MS analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2:\u0026nbsp;\u003c/strong\u003eRelative area percentage of fatty acid methyl esters detected in garden cress seed oil (\u003cem\u003eLepidium sativum\u003c/em\u003e) \u003cem\u003evia\u0026nbsp;\u003c/em\u003eGC/MS analysis\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 10.5769%;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePeak\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14.4231%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRt (min.)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 51.9231%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eIdentification\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 23.0769%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eArea %\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 10.5769%;\"\u003e\n \u003col\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14.4231%;\"\u003e\n \u003cp\u003e33.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 51.9231%;\"\u003e\n \u003cp\u003ePalmitic acid, methyl ester\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 23.0769%;\"\u003e\n \u003cp\u003e6.85\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 10.5769%;\"\u003e\n \u003col start=\"2\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14.4231%;\"\u003e\n \u003cp\u003e36.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 51.9231%;\"\u003e\n \u003cp\u003eLinoleic acid, methyl ester\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 23.0769%;\"\u003e\n \u003cp\u003e30.97\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 10.5769%;\"\u003e\n \u003col start=\"3\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14.4231%;\"\u003e\n \u003cp\u003e36.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 51.9231%;\"\u003e\n \u003cp\u003eOleic acid, methyl ester\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 23.0769%;\"\u003e\n \u003cp\u003e33.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 10.5769%;\"\u003e\n \u003col start=\"4\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14.4231%;\"\u003e\n \u003cp\u003e37.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 51.9231%;\"\u003e\n \u003cp\u003eStearic acid, methyl ester\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 23.0769%;\"\u003e\n \u003cp\u003e4.19\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 10.5769%;\"\u003e\n \u003col start=\"5\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14.4231%;\"\u003e\n \u003cp\u003e37.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 51.9231%;\"\u003e\n \u003cp\u003eVaccenic acid, methyl ester\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 23.0769%;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 10.5769%;\"\u003e\n \u003col start=\"6\"\u003e\n \u003cli\u003e\u0026nbsp;\u003c/li\u003e\n \u003c/ol\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14.4231%;\"\u003e\n \u003cp\u003e43.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 51.9231%;\"\u003e\n \u003cp\u003eErucic acid, methyl ester\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 23.0769%;\"\u003e\n \u003cp\u003e9.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" style=\"width: 76.9231%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 23.0769%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e92.02 %\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" style=\"width: 76.9231%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSaturated fatty acids\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 23.0769%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e11.04 %\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" style=\"width: 76.9231%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eUnsaturated fatty acids\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 23.0769%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e80.98\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3 Docking results scoring Garden cress oil identified phytoconstituents against TNF-\u0026alpha; and Caspase-3 binding sites.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"622\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 49.8392%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTNF-\u0026alpha; (PDB: 7JRA)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 50.1608%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCaspase-3 (PDB: 3GJQ)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27.6527%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eLigand\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 22.1865%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBinding energy\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eD\u003c/strong\u003e\u003cstrong\u003eG (kcal/mol)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 27.0096%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCompound\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.1511%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBinding energy\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eD\u003c/strong\u003e\u003cstrong\u003eG (kcal/mol)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27.6527%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCo-crystalized inhibitor\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 22.1865%;\"\u003e\n \u003cp\u003e-12.89\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 27.0096%;\"\u003e\n \u003cp\u003eCo-crystalized inhibitor\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.1511%;\"\u003e\n \u003cp\u003e-11.01\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27.6527%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026beta;-Tocopherol\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 22.1865%;\"\u003e\n \u003cp\u003e-10.73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 27.0096%;\"\u003e\n \u003cp\u003eLinoleic acid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.1511%;\"\u003e\n \u003cp\u003e-10.05\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27.6527%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eErucic acid\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 22.1865%;\"\u003e\n \u003cp\u003e-9.97\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 27.0096%;\"\u003e\n \u003cp\u003eVaccenic acid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.1511%;\"\u003e\n \u003cp\u003e-7.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27.6527%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSesamolin\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 22.1865%;\"\u003e\n \u003cp\u003e-9.91\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 27.0096%;\"\u003e\n \u003cp\u003eOleic acid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.1511%;\"\u003e\n \u003cp\u003e-7.45\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27.6527%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026alpha;-Tocopherol\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 22.1865%;\"\u003e\n \u003cp\u003e-9.55\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 27.0096%;\"\u003e\n \u003cp\u003eStearic acid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.1511%;\"\u003e\n \u003cp\u003e-6.93\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27.6527%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026gamma;-Tocopherol\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 22.1865%;\"\u003e\n \u003cp\u003e-9.52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 27.0096%;\"\u003e\n \u003cp\u003ePalmitic acid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.1511%;\"\u003e\n \u003cp\u003e-6.89\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003emRNA expression of inflammatory and apoptotic genes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInjection with MTX induced a significant increase in the mRNA expression level of TNF\u0026alpha;, a proinflammatory marker, compared to the control groups (P\u0026le;0.05). However, treatment with GCO (200 and 400 mg/kg) led to a significant downregulation (P\u0026le;0.05) of TNF\u0026alpha; compared to the MTX-treated group. Nevertheless, TNF\u0026alpha; expression remained significantly higher among rats treated with GCO/MTX compared to the control group (Figure 5A). Next, we analyzed the expression levels of the pro-apoptotic genes (Bax, P53, Caspase-3). The results showed that MTX caused a significant increase in Bax, P53, and Caspase-3 expression (P\u0026le;0.05). However, treatment with GCO (200 and 400 mg/kg) effectively reversed these effects (P\u0026le;0.05) (Figure 5B, C, D).\u003c/p\u003e\n\u003cp\u003eHistological Results\u003c/p\u003e\n\u003cp\u003eThe microscopic examination of the liver section of control rats (Figure 6A) showed a normal structure of the hepatic lobule, with cords of hepatic cells radiating from the central vein separated by blood sinusoids. In contrast, the treated rats with Garden cress seed oil extraction showed hepatic lobules that were almost normal, except for some inflammatory cells infiltrating between the sinusoids (Figure 6B). Animals treated with methotrexate (MTX) exhibited marked cellular infiltration and septa of fibrosis around portal tracts, with shrinking hepatic cells containing pyknotic small nuclei and eosinophilic cytoplasm (Figure 6C). Various forms of nuclear damage were present, including apoptosis and polymorphism (uneven size of the nuclei), pyknosis, karyolysis, karyorrhexis, and necrotic areas (Figure 6D).\u003c/p\u003e\n\u003cp\u003eThe livers of animals treated with MTX and garden cress seed oil at a dose of 200mg/kg showed some improvement, such as a reduction in fibrosis around the portal area, infiltration of inflammatory cells, and dilation of sinusoids (Figure 6E). Hepatocyte vacuolization, fatty degeneration, and focal necrotic areas (Figure 6F) were also present. In the group treated with MTX plus garden cress oil at a dose of 400mg/kg, there was much improvement, with a reduction in connective tissue around the portal tract, proliferation of bile ducts, and cellular infiltration (Figure 6G). However, nuclear degeneration in the form of pyknosis, karyolysis, as well as marked vacuolar degeneration and fatty degeneration of hepatocytes, were still observed (Figure 6H).\u003c/p\u003e\n\u003cp\u003eVan Gieson\u0026apos;s stain is a simple method used for differential staining of collagen in connective tissue. It gives collagen a pink color, similar to what is seen in fibrosis. In control animals, the liver showed a normal distribution of fibrous tissue around the portal area (Figure 7A). However, livers treated with Garden cress exhibited a slight increase in fibrosis around the portal tract (Figure 7B). The group treated with MTX showed a significant increase in fibrous tissues around the portal tract, along with bile duct proliferation, massive cellular infiltration, and severe dilation of the portal area (Figure 7C). Animals treated with MTX in combination with garden cress extract at a dose of 200 mg/kg showed some improvement, with a decrease in fibrous tissue, although dilation was still present (Figure 7D). The group treated with MTX and garden cress seed oil at a dose of 400 mg/kg showed even more improvement, with a reduction in connective tissue around the portal tract (Figure 7E).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eMethotrexate is the cornerstone of treatment for autoimmune diseases and a crucial part of managing inflammatory rheumatic disorders. Prescribers considering starting long-term methotrexate therapy for their patients have long been concerned about hepatotoxicity [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Lepidium sativum, or garden cress is an overlooked edible herb native to Egypt and commonly cultivated worldwide. The seed oil is reported to have beneficial health-promoting effects in metabolic disorders like diabetes and hyperlipidemia, as well as antioxidant, anti-inflammatory, and antirheumatic activities [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Other studies have reported in vitro and in vivo hepatoprotective effects, prevention of hepatocarcinogenesis, anticarcinogenic activity, and detoxification of carcinogens by the seed extracts/juice [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Garden cress (Lepidium sativum) seeds' nutritional, ethnopharmacological, and medicinal relevance might be owed to their content of bioactive compounds and antioxidant properties [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe phytochemical investigation of commercial GCO via GC/MS analysis revealed the presence of 67 unsaponifiable compounds [19 mono-/sesqui-/di-/and tri-terpenes (4.75%), 2 phenyl propanoids (0.5%), 3 tocopherols (0.08%), 2 lignans (2.47%), 6 sterols (1.59%), 35 alkane hydrocarbons (80.26%)]. These findings are consistent with previously reported literature [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The oil itself is odorless, but, its unsaponifiable fraction has a characteristic aromatic scent attributed to the detected mono- and sesqui-terpenes. Additionally, 6 fatty acids were identified, with oleic and linoleic acids being the major ones. Several metabolites (Carotane sesquiterpenes, carotol, daucol, bisabolene, cuparene and cupranene) were reported for the first time in this study.\u003c/p\u003e \u003cp\u003eIn this investigation, we are studying the role of garden cress in attenuating the hepatotoxicity of MTX through inflammatory and apoptotic gene pathways as well as histopathological observations. Most drugs are metabolized by the liver and kidneys, making the liver susceptible to Drug-Induced Liver Injury (DILI) [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. In hepatocytes, methotrexate (MTX) is converted to MTX-polyglutamate (MTX-PGs) by folylpolyglutamate synthase (FPGS) leading to apoptosis, fibrosis, oxidative stress, inflammation, and steatosis. The up-regulation of TNF-α observed in our study is a relevant biomarker associated with the inflammation pathway in MTX-induced hepatotoxicity. This significant increase in hepatic TNF-α may be due to MTX-PG-induced intracellular ROS, which in turn activate transcription factors like NF-kB and Nrf-2. Their nuclear translocation causes pro-inflammatory responses through the release of several inflammatory cytokines, such as TNF-α [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Consistent with our findings, previous \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e studies have reported that the anti-inflammatory property of L. sativum was attributed to the lowering of TNF-α levels [\u003cspan additionalcitationids=\"CR34 CR35\" citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Notably, our research findings demonstrated that GCO inhibited MTX-induced hepatic inflammation by lowering TNF-α mRNA expression. The anti-inflammatory effect of GCO is likely attributed to the antioxidant and/or anti-inflammatory activities of the reported bioactive components such as phenyl propanoids, α-Linolenic acid, sterols, and triterpenes [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Forms of vitamin E such as γ-tocotrienol, γ-tocopherol, and δ-tocopherol are potent natural therapeutic antioxidants with anti-inflammatory properties that help prevent many illnesses [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Both lignans (sesamin and sesamolin) are reported to have antioxidant, immunomodulatory and anti-inflammatory activities as well as beneficial health promoting effect on decreasing hepatic lipogenic activity through increasing fatty acid oxidation enzymes [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eRegarding apoptotic markers, MTX resulted in significantly higher expression levels of Bax, caspase-3, and P53 genes. Our results support previous studies that have shown increased expression levels of these genes \u003cem\u003ein vivo\u003c/em\u003e in response to MTX [\u003cspan additionalcitationids=\"CR41\" citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. During MTX-induced hepatotoxicity, an increase in oxidative stress leads to Bax translocation to the outer mitochondrial membrane, resulting in increased mitochondrial permeability and cytochrome c release into the cytosol. This activates downstream effector caspases, such as caspase-3 [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Conversely, our results indicated that GCO downregulated the elevation of Bax, Caspase-3, and P53 induced by MTX in rat liver tissue, explaining its antiapoptotic action. These findings are consistent with Raish et al. [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e], who reported that \u003cem\u003eLepidium sativum\u003c/em\u003e ethanolic extract significantly down-regulated the expression levels of caspase-3 in a galactosamine/lipopolysaccharide-induced liver damage model.\u003c/p\u003e \u003cp\u003eThe in silico docking study of the identified metabolites into TNF-α (pdb: 7JRA) and Caspase-3 (pdb: 3GJQ) target proteins suggested that the observed anti-inflammatory activity of GCO through inhibition of TNF-α enzyme could be attributed to tocopherols (α-/β-/ and γ), sesamolin lignan, and erucic acid. These compounds showed the highest binding affinity, with docking scores ranging from 9.52 to 10.73 kcal/mol, compared to the co-crystalized ligand (12.89 kcal/mol). Tocopherols, especially vitamin E, and sesamolin were reported to attenuate TNF-α gene expression and improve the treatment of hepatotoxicity [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Linoleic acid showed the highest docking score against caspase-3 protein (10.05 kcal/mol) compared to its co-crystalized ligand (11.01 kcal/mol), followed by other fatty acids. Previous studies on different cells have shown that linoleic acid and other unsaturated fatty acids play a protective regulatory role by inhibiting apoptosis through blocking the caspase cascade signaling pathway in inflammatory reactions, or by activating apoptosis to induce cell death in cancer [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe histological analyses revealed significant liver damage in the MTX-treated group, including interface necrosis, apoptotic cells, and central zone lymphocyte infiltration. These alterations are corroborated by previous research [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Morsy et al. [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] demonstrated that rats receiving MTX showed high collagen deposition in their liver tissue, primarily leading to hepatic fibrosis. Taskin et al. [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e] confirmed that MTX exhibited many pathological anomalies in the liver, including hepatocyte necrosis, fibrosis, and an increase in cellular infiltration. Meanwhile, the present study indicated that garden cress restores the histopathological alterations induced by MTX. According to Zamzami et al. [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e], \u003cem\u003eLepidium sativum\u003c/em\u003e enhanced liver function in CCl4-treated New Zealand white rabbits by reversing the liver histopathologic alterations. Additionally, Ibrahim et al. [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e] reported that a daily dose of 400 mg/kg b.w. of garden cress ethanolic extract has hepatoprotective, antioxidant, and anti-steatosis properties in rats. Garden cress has been found to have potential benefits for liver tissue regeneration, where bioactive compounds in the seeds are thought to promote the growth of new liver cells, aiding in the restoration of injured liver tissue [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. On the other hand, administering both doses of 2% and 5% garden cress seeds revealed a significant degree of recovery in liver and pancreas histology in streptozotocin-induced diabetic rats [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e].\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eAll of our data points to the fact that GCO protects the liver from MTX-induced damage. This is partially explained by its strong anti-inflammatory, anti-fibrotic, and anti-apoptotic properties. These properties is probably attributed to the identified compounds as linoleic acid and α-tocopherol that recognized from in silico study as leading compounds for attenuating the inflammatory and apoptosis reactions in the liver by inhibiting TNF-α and caspase-3, as proven by gene expression results.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eChemicals\u003c/p\u003e \u003cp\u003eMethotrexate was obtained from EIMC United Pharmaceuticals Company (Cairo-Egypt). Cold-pressed Garden cress oil was purchased from Haraz Co., Cairo, Egypt. All other chemicals were of analytical grade and acquired from standard marketable suppliers.\u003c/p\u003e \u003cp\u003eGC/MS analysis of lipid content in garden cress seed oil\u003c/p\u003e \u003cp\u003eSaponification of garden cress oil (GCO) (8 g) was performed by refluxing for 6\u0026ndash;8 hours with alcoholic KOH, followed by extraction of unsaponifiable matter with ether, yielding 0.7 g upon evaporation to dryness. Fatty acids were methylated through reflux with a 2 M HCl solution in methanol for 3\u0026ndash;4 hours, then extracted with ether and evaporated to dryness, yielding 4.8 gm as fatty acid methyl esters (FAME) [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBoth fractions were then analyzed via a Shimadzu GCMS-QP2010 (Kyoto, Japan) equipped with an Rtx-5MS fused bonded column (30 m x 0.25 mm i.d. x 0.25 \u0026micro;m film thickness) (Restek, USA) with a split\u0026ndash;spitless injector. The following guidelines were established: the initial temperature of the column was maintained at 50\u0026deg;C for three minutes (isothermal), then it was increased to 300\u0026deg;C at a rate of 5\u0026deg;C per minute and held there for ten minutes (isothermal). Even though the injector temperature was established at 280\u0026deg;C. The flow rate of the helium carrier gas was 1.37 ml/min. The following parameters were applied to all mass spectra recordings: Ion source temperature: 220\u0026deg;C; ionization voltage: 70 eV; filament emission current: 60 mA. Split mode injections were used with diluted samples (1% v/v; split ratio: 1:15). Identification of compounds was achieved by comparing their retention index (RI) and mass spectral data with NIST/Wiley, Pherobase, and other literature sources [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMolecular docking study of identified compounds\u003c/p\u003e \u003cp\u003eThe 3D coordinates of the detected phytoconstituents were obtained in SDF format from the PubChem database. After being energy-minimized to a gradient of 0.01 Kcal/mol \u0026Aring; in the gas phase using the MMFF94x Force Field, the data were saved in PDBQT format. Human TNF-α (PDB ID: 7JRA) and human caspase-3 (PDB ID: 3GJQ) co-crystal structures were obtained from the Protein Data Bank (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.rcsb.org\u003c/span\u003e\u003cspan address=\"https://www.rcsb.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Using MGL Tools v1.5.7, all target receptors were prepared by deleting water molecules and other hetatoms, adding polar hydrogens, and assigning Kollman charges. The receptors were then saved in PDBQT format. Grid boxes measuring 25 x 25 x 25 \u0026Aring; were positioned at the co-crystallized ligands to encompass the entire binding sites of the target receptors. To perform all docking computations, AutoDock Vina, an open-source program, was utilized. The docking poses were ranked according to their docking scores, and the pose with the best energy was selected. Using Discovery Studio Visualizer v21.1.0.20298, the interactions between the selected compounds and the target proteins were examined [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn vivo experimental design\u003c/p\u003e \u003cp\u003eThirty adult male Sprague-Dawley albinos, weighing between 100 to 150g, were obtained from the animal facility at the National Research Center in Giza, Egypt. The rats were housed in a room with controlled environmental conditions, including a 12-hour light/12-hour dark cycle and a temperature of 22\u0026ordm;C. They were kept in clear plastic cages with stainless steel wire tops, and provided with rat feed pellets and unrestricted access to water. The study was approved by the Ethics Committee at the National Research Center (Approval No. 19032). The research methods were carried out following relevant guidelines and ARRIVE guidelines.\u003c/p\u003e \u003cp\u003eThe rats were randomly divided into five groups, each consisting of six animals. The animals were given a week to acclimate before the start of the study. The groups were as follows: Group I: rats received oral gavages of saline as a negative control. Group II: animals were orally administered Garden cress oil (400 mg/kg/day) for 28 days as a vehicle group. Group III: animals were intraperitoneally injected with methotrexate at a dose of 5 mg/kg/day for 7 days following the protocol of Demiryilmaz et al. [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Groups IV \u0026amp; V: animals were injected with methotrexate following the same protocol as Group III. On the eighth day, they were orally administered Garden cress oil at doses of 200 and 400 mg/kg once daily for 28 days, as described by Yogesh et al. [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eRNA isolation, cDNA synthesis, and reverse transcription polymerase chain reaction (RT-PCR) analysis\u003c/p\u003e \u003cp\u003eIsolated liver samples were homogenized in an Easy Red Total RNA Extraction Kit (Intronbio, Korea), and RNA was extracted following the manufacturer\u0026rsquo;s instructions. The yield and quality of isolated RNAs were assessed through gel electrophoresis and spectrophotometric measurement. The RNA was then treated with the RNase-free DNase kit (Thermo Scientific) and cDNA was synthesized via reverse-transcription as per the manufacturer\u0026rsquo;s instructions (Thermo Scientific, China). Gyceraldehyde-3-phosphate dehydrogenase (GADPH) was used as the internal control and the expression of four genes (Bcl-associated X protein (Bax), cysteine aspartic acid specific protease 3 (Caspase-3), tumor necrosis factor alpha (TNF-α) and tumor-suppressor protein (P53) was evaluated in the study. The primers used are GADPH, F: AACTTTGGCATTGTGGAAGG, R: ACACATTGGGGGTAGGAACA; Bax, F: ATTGACACAATACACGGGATCTGT, R: AAATTCAAGGGACGGGTCAT; Caspase-3, F: AGA GGA TGA TTG CTG ATG TGG, R: CCC AGT TGA AGT TGC CGT; TNF-α, F: CCACCACGCTCTTCTGTCTAC, R: ACCACCAGTTGGTTGTCTTTG; P53, F: GCA GAG TTG TTA GAA GGC, R: TTG AGA AGG GAC GGA AGA. RT-qPCR was conducted using the Stratagene Mx3000P Real-Time PCR System (Agilent Technologies, USA) and carried out in a 25 \u0026micro;L reaction containing cDNA, TOPreal\u0026trade;qPCR 2X PreMIX (SYBR Green with low ROX) (Enzynomics), forward and reverse primers (10 pmol/\u0026micro;l) (Macrogen), and free water nuclease. The gene expression levels were calculated using the 2-ΔΔCt method [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e].\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eHistological methodology\u003c/h2\u003e \u003cp\u003eHematoxylin and eosin stain\u003c/p\u003e \u003cp\u003eThe liver specimens were collected, fixed in a 10% buffered formalin (Thermo Fisher Scientific, Waltham, MA) at room temperature for one to three days, and embedded in paraffin. Subsequently, 5\u0026micro;m thick paraffin tissue sections were subjected to standard procedures, including deparaffining, hematoxylin and eosin staining, dehydration, and mounting. were prepared and stained with H\u0026amp;E stain following the method of Drury and Wallington [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. Using an optical microscope (Olympus, IX53, Tokyo, Japan), the stained slides were inspected and captured on camera.\u003c/p\u003e \u003cp\u003eVan Gieson stain\u003c/p\u003e \u003cp\u003eVan Gieson stain was used to evaluate liver fibrosis, following the protocol outlined by Chen et al. [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. Briefly, paraffin-embedded liver sections were deparaffinized and hydrated in distilled water. They were then stained with Wright\u0026rsquo;s Working Hematoxylin for 10 minutes and washed in distilled water. The slides were further stained with Van Gieson solution for 3 minutes, followed by gradient dehydration in 95% alcohol, absolute alcohol, and 2 changes in xylene before mounting with DPX for investigation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe data obtained were presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the means (SEM) (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;3) and analysis was performed using the SPSS 16.0 program (SPSS Inc., Chicago, IL, USA). One way analysis of variance method was used to evaluate the statistical differences. Differences among groups were considered statistically significant at \u003cem\u003ep\u003c/em\u003e values\u0026thinsp;\u0026le;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA.I.E. and H.A.S. conceived of the presented idea and designed the manuscript plan,\u0026nbsp;R.H.E.\u0026nbsp;and\u0026nbsp;A.H.A.\u0026nbsp;performed the oil analysis and molecular docking, D.M.M. carried out the genetic analysis; H.A.S. \u0026amp; S.L.E. performed the histological analysis, A. I.E. and D.M.M. wrote the manuscript with input from all authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData is provided within the manuscript file.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal experiments were approved by the Ethics Committee of the National Research Centre (Approval No. 19032).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate/Consent to publish\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eN/A\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKalantari, E., Zolbanin, N. M., \u0026amp; Ghasemnejad-Berenji, M. Protective effects of empagliflozin on methotrexate induced hepatotoxicity in rats. \u003cem\u003eBiomedicine \u0026amp; pharmacotherapy.\u003c/em\u003e 170, 115953. https://doi.org/10.1016/j.biopha.2023.115953 (2024).\u003c/li\u003e\n\u003cli\u003eEzhilarasan, D. Hepatotoxic potentials of methotrexate: Understanding the possible toxicological molecular mechanisms. \u003cem\u003eToxicology\u003c/em\u003e 458, 152840. https://doi.org/10.1016/j.tox.2021.152840 (2021).\u003c/li\u003e\n\u003cli\u003eValerio, V., et al., Systematic review of recommendations on the use of methotrexate in rheumatoid arthritis. \u003cem\u003eClin .Rheumatol.\u003c/em\u003e 40, 1259\u0026ndash;1271 https://doi.org/10.1007/s10067-020-05363-2 (2021). \u003c/li\u003e\n\u003cli\u003eIkponmwosa, O. B. \u0026amp; Usunomena, U. Aqueous Leaf Extract of Chromolaena odorata Attenuates Methotrexate-Induced Hepatotoxicity in Wistar Rats. \u003cem\u003eJournal of Fundamental and Applied Pharmaceutical Science\u003c/em\u003e 3(1), 16-29 (2022). \u003c/li\u003e\n\u003cli\u003eAbdelKader, G\u003cem\u003e. et al.\u003c/em\u003e Protective Effects of Crocin against Methotrexate-Induced Hepatotoxicity in Adult Male Albino Rats: Histological, Immunohistochemical, and Biochemical Study. \u003cem\u003eCureus\u003c/em\u003e 15, e34468. https://doi.org/10.7759/cureus.34468 (2023).\u003c/li\u003e\n\u003cli\u003eAboubakr, M. \u003cem\u003eet al.\u003c/em\u003e Allicin and lycopene possesses a protective effect against methotrexate induced testicular toxicity in rats. \u003cem\u003ePak. Vet. J\u003c/em\u003e. 43, 559\u0026ndash;566. https://doi.org/10.29261/pakvetj/2023.057 (2023).\u003c/li\u003e\n\u003cli\u003eBath, R. K., Brar, N. K., Forouhar, F. A. \u0026amp; Wu, G.Y. A review of methotrexate-associated hepatotoxicity. \u003cem\u003eJ. Dig. Dis.\u003c/em\u003e 15, 517\u0026ndash;524. https://doi.org/10.1111/1751-2980.12184 (2014).\u003c/li\u003e\n\u003cli\u003eTag, H.M. Hepatoprotective effect of mulberry (Morus nigra) leaves extract against methotrexate induced hepatotoxicity in male albino rat. BMC \u003cem\u003eComplement Altern. Med\u003c/em\u003e .15, 252. https://doi.org/10.1186/s12906-015-0744-y (2015).\u003c/li\u003e\n\u003cli\u003eCao, Y. \u003cem\u003eet al\u003c/em\u003e. Protective Effects of Magnesium Glycyrrhizinate on Methotrexate-Induced Hepatotoxicity and Intestinal Toxicity May Be by Reducing COX-2. \u003cem\u003eFrontiers in pharmacology \u003c/em\u003e\u003cem\u003e1,\u003c/em\u003e 119. https://doi.org/10.3389/fphar.2019.00119 (2019).\u003c/li\u003e\n\u003cli\u003eAbdelaziz, R. M., Abdelazem, A. Z., Hashem, K. S., \u0026amp; Attia, Y. A. Protective effects of hesperidin against MTX-induced hepatotoxicity in male albino rats. \u003cem\u003eNaunyn-Schmiedeberg\u0026apos;s archives of pharmacology\u003c/em\u003e, \u003cem\u003e393\u003c/em\u003e(8), 1405\u0026ndash;1417. https://doi.org/10.1007/s00210-020-01843-z (2020).\u003c/li\u003e\n\u003cli\u003eAbd El-Ghafar, O. A. M. \u003cem\u003eet al.\u003c/em\u003e Hepatoprotective effect of acetovanillone against methotrexate hepatotoxicity: Role of Keap-1/Nrf2/ARE, IL6/STAT-3, and NF-\u0026kappa;B/AP-1 signaling pathways. \u003cem\u003ePhytotherapy research : PTR\u003c/em\u003e, \u003cem\u003e36\u003c/em\u003e(1), 488\u0026ndash;505. https://doi.org/10.1002/ptr.7355 (2022).\u003c/li\u003e\n\u003cli\u003eAlfwuaires, M.A. Galangin mitigates oxidative stress, inflammation, and apoptosis in a rat model of methotrexate hepatotoxicity. \u003cem\u003eEnviron. Sci. Pollut. Res.\u003c/em\u003e 29, 20279\u0026ndash;20288. https://doi.org/10.1007/s11356-021-16804-z (2022).\u003c/li\u003e\n\u003cli\u003eMorsy, M. A., Abdel-Latif, R., Hafez, S. M. N. A., Kandeel, M., \u0026amp; Abdel-Gaber, S. A.. Paeonol Protects against Methotrexate Hepatotoxicity by Repressing Oxidative Stress, Inflammation, and Apoptosis-The Role of Drug Efflux Transporters. \u003cem\u003ePharmaceuticals (Basel, Switzerland)\u003c/em\u003e\u003cem\u003e15\u003c/em\u003e(10), 1296. https://doi.org/10.3390/ph15101296 (2022).\u003c/li\u003e\n\u003cli\u003eWang, S. C.et al. Melatonin protects against methotrexate hepatotoxicity in young rats: Impact of PI3K/Akt/mTOR signaling. \u003cem\u003eJournal of biochemical and molecular toxicology\u003c/em\u003e 37(5), e23323. https://doi.org/10.1002/jbt.23323 (2023).\u003c/li\u003e\n\u003cli\u003eClary, D. D., Reid, A. T., Kiani, R. \u0026amp; Fanciullo, J. Methotrexate Hepatotoxicity Monitoring Guidelines in Psoriasis and Rheumatoid Arthritis: Is There a Consensus?. \u003cem\u003eSouth Dakota medicine : the journal of the South Dakota State Medical Association\u003c/em\u003e\u003cem\u003e74\u003c/em\u003e(8), 363\u0026ndash;366(2021). \u003c/li\u003e\n\u003cli\u003eAzzam A., Jiyad, Z. \u0026amp; O\u0026rsquo;Beirne, J. Is methotrexate hepatotoxicity associated with cumulative dose? A systematic review and meta-analysis. \u003cem\u003eAustral J. Dermatol\u003c/em\u003e. 62 (2), 130\u0026ndash;140 https://onlinelibrary.wiley.com/doi/10.1111/ajd.13546〉(2021).\u003c/li\u003e\n\u003cli\u003eFeroz, W.\u0026amp; Sheikh, A.M.A. Exploring the multiple roles of guardian of the genome: P53. \u003cem\u003eEgypt J. Med. Hum. Genet.\u003c/em\u003e 21, 49 https://doi.org/10.1186/s43042-020-00089-x (2020).\u003c/li\u003e\n\u003cli\u003eVahid, N. K., Nameni, F., \u0026amp; Chaharmahali, B. Y. Effect of Interval Training and Curcumin on BAX, Bcl-2, and Caspase-3 Enzyme Activity in Rats. \u003cem\u003eGene, Cell and Tissue\u003c/em\u003e 9(4), e112792 (2022).\u003c/li\u003e\n\u003cli\u003eFaletti, L. \u003cem\u003eet al.\u003c/em\u003e TNF\u0026alpha; sensitizes hepatocytes to FasL-induced apoptosis by NF\u0026kappa;B-mediated Fas upregulation. \u003cem\u003eCell death \u0026amp; disease \u003c/em\u003e(9):909 (2018). \u003c/li\u003e\n\u003cli\u003eEl-Makawy, A. I\u003cem\u003e. et al.\u003c/em\u003e Efficiency of turnip bioactive lipids in treating osteoporosis through activation of Osterix and suppression of Cathepsin K and TNF-\u0026alpha; signaling in rats. \u003cem\u003eEnvironmental science and pollution research international\u003c/em\u003e, \u003cem\u003e27\u003c/em\u003e(17), 20950\u0026ndash;20961. https://doi.org/10.1007/s11356-020-08540-7 (2020).\u003c/li\u003e\n\u003cli\u003eEl-Makawy, A. I., Mabrouk, D.M.; Ibrahim, F.M.; Abdel-Aziem, S.H. and Sharaf, H.A. Therapeutic and Prophylactic Efficacy of Garden cress Seed Oil against Osteoporosis in Rats. \u003cem\u003eJordan Journal of Biological Sciences\u003c/em\u003e 13(2), 237-245 (2020).\u003c/li\u003e\n\u003cli\u003eKanabur, V. \u0026amp; Sharavathi, V. Nutritional Significance and Usage of Garden cress Seeds (Lepidium sativum L)\u0026ndash;A Review. \u003cem\u003eAmerican Journal of Food Science and Technology\u003c/em\u003e 1(1), 50-55 (2022).\u003c/li\u003e\n\u003cli\u003eLahiri, B. \u0026amp; Rani, R. Garden cress Seeds: chemistry, medicinal properties, application in dairy and food industry: A Review. \u003cem\u003eEmergent Life Sciences Research\u003c/em\u003e 6,1-4 (2020).\u003c/li\u003e\n\u003cli\u003eEmhofer, L., Himmelsbach, M., Buchberger, W., \u0026amp; Klampfl, C. W. High-performance liquid chromatography drift-tube ion-mobility quadrupole time-of-flight/mass spectrometry for the identity confirmation and characterization of metabolites from three statins (lipid-lowering drugs) in the model plant cress (Lepidium sativum) after uptake from water. \u003cem\u003eJournal of Chromatography A \u003c/em\u003e 1592, 122-132 (2019).\u003c/li\u003e\n\u003cli\u003eJagdale, Y.D. \u003cem\u003eet al\u003c/em\u003e. Nutritional profile and potential health benefits of super foods: A review. \u003cem\u003eSustainability\u003c/em\u003e 13(16), 9240 (2021).\u003c/li\u003e\n\u003cli\u003eDi Martino, V. \u003cem\u003eet al\u003c/em\u003e. Busting the myth of methotrexate chronic hepatotoxicity. \u003cem\u003eNature reviews. Rheumatology\u003c/em\u003e, \u003cem\u003e19\u003c/em\u003e(2), 96\u0026ndash;110. https://doi.org/10.1038/s41584-022-00883-4 (2023).\u003c/li\u003e\n\u003cli\u003ePradhan, A., Sengupta, S., Sengupta, R., \u0026amp; Chatterjee, M. Attenuation of methotrexate induced hepatotoxicity by epigallocatechin 3-gallate. \u003cem\u003eDrug and Chemical Toxicology\u003c/em\u003e 46(4), 717\u0026ndash;725. https://doi.org/10.1080/01480545.2022.2085738 (2023).\u003c/li\u003e\n\u003cli\u003eRezig, L., et al., Profile characterization and biological activities of cold pressed Garden cress (Lepidium sativum) seed oil. \u003cem\u003eArabian Journal of Chemistry\u003c/em\u003e. 15(8),103958 (2022).\u003c/li\u003e\n\u003cli\u003eNazir, S.et al. Lepidium sativum Secondary Metabolites (Essential Oils): In Vitro and In Silico Studies on Human Hepatocellular Carcinoma Cell Lines. \u003cem\u003ePlants\u003c/em\u003e (Basel, Switzerland), 10(9), 1863. https://doi.org/10.3390/plants10091863 (2021).\u003c/li\u003e\n\u003cli\u003eBhatia, K. \u0026amp; Bhasin, A. Exploring the versatile potential of garden cress seeds: Therapeutic applications and industrial utilization: A comprehensive review. \u003cem\u003ePharma Innovation \u003c/em\u003e12(9),101-108. DOI: 10.22271/tpi.2023.v12.i9b.22647 (2023).\u003c/li\u003e\n\u003cli\u003eIsmael, I.A. \u0026amp; Khorsheed, A.C. Quantitative and qualitative detection of metabolic compounds in the seeds of cress plant (Lepidium sativum. L) using chromatography technique. \u003cem\u003eJournal of\u003c/em\u003e\u003cem\u003eKerbala for Agricultural Sciences\u003c/em\u003e\u003cem\u003e8\u003c/em\u003e(1), 8\u0026ndash;16. https://doi.org/10.59658/jkas.v8i1.867 (2021).\u003c/li\u003e\n\u003cli\u003eHosack, T., Damry, D., \u0026amp; Biswas, S. Drug-induced liver injury: a comprehensive review. \u003cem\u003eTherapeutic advances in gastroenterology\u003c/em\u003e. \u003cem\u003e16\u003c/em\u003e: 17562848231163410. https://doi.org/10.1177/17562848231163410 (2023).\u003c/li\u003e\n\u003cli\u003eTurkoglu, M., Kılıc, S., Pekmezci, E., \u0026amp; Kartal, M. Evaluating antiinflammatory and antiandrogenic effects of garden cress (Lepidium sativum L.) in HaCaT cells. \u003cem\u003eRecords of Natural Products,\u003c/em\u003e 12(6), 595-601(2018).\u003c/li\u003e\n\u003cli\u003eAlqahtani, F. Y. \u003cem\u003eet al \u003c/em\u003eChemical composition and antimicrobial, antioxidant, and anti-inflammatory activities of \u003cem\u003eLepidium sativum\u003c/em\u003e seed oil. \u003cem\u003eSaudi journal of biological sciences\u003c/em\u003e, \u003cem\u003e26\u003c/em\u003e(5), 1089\u0026ndash;1092. https://doi.org/10.1016/j.sjbs.2018.05.007 (2019).\u003c/li\u003e\n\u003cli\u003eAhmad, A. \u003cem\u003eet al\u003c/em\u003e. Inhibitory effects of \u003cem\u003eLepidium sativum\u003c/em\u003e polysaccharide extracts on TNF-\u0026alpha; production in \u003cem\u003eEscherichia coli\u003c/em\u003e-stimulated mouse. \u003cem\u003eBiotech\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(6), 286 https://doi.org/10.1007/s13205-018-1309-9 (2018).\u003c/li\u003e\n\u003cli\u003eAbdulmalek, S. A., Fessal, M., \u0026amp; El-Sayed, M. Effective amelioration of hepatic inflammation and insulin response in high fat diet-fed rats via regulating AKT/mTOR signaling: Role of Lepidium sativum seed extracts. \u003cem\u003eJournal of ethnopharmacology\u003c/em\u003e, 266, 113439. https://doi.org/10.1016/j.jep.2020.113439 (2021).\u003c/li\u003e\n\u003cli\u003eVazifeh, S., Kananpour, P., Khalilpour, M., Eisalou, S.V. \u0026amp; Hamblin, M.R. Anti-inflammatory and Immunomodulatory Properties of Lepidium sativum. \u003cem\u003eBiomed. Res. Int.\u003c/em\u003e 2022, 12 https://doi.org/10.1155/2022/3645038 (2022).\u003c/li\u003e\n\u003cli\u003eCiarci\u0026agrave;, G.\u003cem\u003e et al. \u003c/em\u003eVitamin E and non-communicable diseases: a review. Biomedicines, 10, 2473(2022).\u003c/li\u003e\n\u003cli\u003ePathak, N., Bhaduri, A., \u0026amp; Rai, A. K.. Sesame: Bioactive compounds and health benefits. \u003cem\u003eBioactive molecules in food\u003c/em\u003e, 5, 181-200 (2019).\u003c/li\u003e\n\u003cli\u003eAlmalki, R.S. The Protective Effect of Roflumilast against Acute Hepatotoxicity Caused by Methotrexate in Wistar Rats: In vivo Evaluation. \u003cem\u003eDrug Des. Devel. Ther.\u003c/em\u003e18: 453-462. http://doi:10.2147/DDDT.S438703 (2024). \u003c/li\u003e\n\u003cli\u003eKabakcı, A.G. \u0026amp; Bozkır, M.G. Protective Effect of Linoleic Acid on Liver Toxicity Induced By Methotrexate. \u003cem\u003eInt. J. Morphol.\u003c/em\u003e 41, 237-245. http://dx.doi.org/10.4067/S0717-95022023000100237 (2023).\u003c/li\u003e\n\u003cli\u003eKızıl, H.E. \u003cem\u003eet al\u003c/em\u003e.. Morin ameliorates methotrexate-induced hepatotoxicity via targeting Nrf2/HO-1 and Bax/Bcl2/Caspase-3 signaling pathways\u003cem\u003e. Mol. Biol. Rep\u003c/em\u003e. 50,3479-3488. https://doi: 10.1007/s11033-023-08286-8 (2023).\u003c/li\u003e\n\u003cli\u003eMahmoud, A.M. \u003cem\u003eet al\u003c/em\u003e. Ferulic acid prevents oxidative stress, inflammation, and liver injury via upregulation of Nrf2/HO-1 signaling in methotrexate-induced rats. \u003cem\u003eEnviron. Sci. Pollut. Res\u003c/em\u003e 27, 7910\u0026ndash;7921 https://doi.org/10.1007/s11356-019-07532-6 (2020).\u003c/li\u003e\n\u003cli\u003eRaish, M. \u003cem\u003eet al.\u003c/em\u003e Hepatoprotective activity of Lepidium sativum seeds against D-galactosamine/lipopolysaccharide induced hepatotoxicity in animal model. \u003cem\u003eBMC Complement Altern Med.\u003c/em\u003e 16,501. https://doi: 10.1186/s12906-016-1483-4 (2016). \u003c/li\u003e\n\u003cli\u003eHadipour, E., \u0026amp; Emami, S. A. Effects of sesame (Sesamum indicum L.) and bioactive compounds (sesamin and sesamolin) on inflammation and atherosclerosis: A review. \u003cem\u003eFood Science \u0026amp; Nutrition, \u003c/em\u003e11, 3729-3757. https://doi.org/10.1002/fsn3.3407 (2023).\u003c/li\u003e\n\u003cli\u003eMontecillo-Aguado, M., Tirado-Rodriguez, B. \u0026amp; Huerta-Yepez, S. The Involvement of Polyunsaturated Fatty Acids in Apoptosis Mechanisms and Their Implications in Cancer. \u003cem\u003eInt. J. Mol. Sci\u003c/em\u003e. 24, 11691. https://doi.org/10.3390/ijms241411691 (2023).\u003c/li\u003e\n\u003cli\u003eKalantari, H., Asadmasjedi, N., reza Abyaz, M., Mahdavinia, M., \u0026amp; Mohammadtaghvaei, N. Protective effect of inulin on methotrexate-induced liver toxicity in mice. \u003cem\u003eBiomedicine \u0026amp; Pharmacotherapy\u003c/em\u003e, 110, 943-950 (2019).\u003c/li\u003e\n\u003cli\u003eTaskin, B., Erdogan, A. M., Yigitturk, G., Gunen\u0026ccedil;, D. \u0026amp; Erbas O Antifibrotic Effect of Lactulose on a Methotrexate-Induced Liver Injury Model. \u003cem\u003eGastroenterology Research and Practice\u003c/em\u003e 2017, 7942531. https://doi.org/10.1155/2017/7942531 (2017).\u003c/li\u003e\n\u003cli\u003eZamzami A. M., O. A. Baothman, F. Samy, \u0026amp; M. K. Abo-Golayel, \u0026ldquo;Amelioration of CCl4-induced hepatotoxicity in rabbits\u003cspan dir=\"RTL\"\u003e \u003c/span\u003eby Lepidium sativum seeds,\u0026rdquo; Evidence-Based \u003cem\u003eComplementary and Alternative Medicine\u003c/em\u003e. 2019, 17 (2019).\u003c/li\u003e\n\u003cli\u003eIbrahim, I.A., Shalaby, A.A., Abdallah, H.M.L., El-Zohairy, N.F.\u0026amp; Bahr, H.I . Ameliorative effect of garden cress (\u003cem\u003eLepidium sativum\u003c/em\u003e L.) seeds ethanolic extract on high fat diet-prompted non-alcoholic fatty liver disease in the rat model: Impact on 3-hydroxy-3-methylglutaryl-coenzyme a reductase and vascular endothelial growth factor. \u003cem\u003eAdv. Anim. Vet. Sci. \u003c/em\u003e8, 1-10. http://dx.doi.org/10.17582/journal.aavs/2020/8.s1.1.10 (2020).\u003c/li\u003e\n\u003cli\u003eMohamed, H.S., Kholief, T., Mohamed, R.W., Abd El-Rhman, A. The modulatory effects of black chia (Salvia hispanica) and garden cress (\u003cem\u003eLepidium sativum\u003c/em\u003e) seeds on N\u0026epsilon;-CML formation in streptozotocin-injected rats. \u003cem\u003eJournal of Herbmed Pharmacology\u003c/em\u003e. 12, 250-261 (2023).\u003c/li\u003e\n\u003cli\u003eDoghmane, A., Aouacheri, O., Laouaichia, R. \u0026amp; Saka, S. The investigation of the efficacy ratio of cress seeds supplementation to moderate hyperglycemia and hepatotoxicity in streptozotocin‐induced diabetic rats. \u003cem\u003eJournal of Diabetes \u0026amp; Metabolic Disorders\u003c/em\u003e 20, 447-459 (2021).\u003c/li\u003e\n\u003cli\u003eEl-Akad, R.H., et al Fruit metabolome profiling via HR-UPLC/MS and it\u0026rsquo;s in vitro antiarthritic activity. \u003cem\u003eSouth African Journal of Botany\u003c/em\u003e 151,649-654 (2022).\u003c/li\u003e\n\u003cli\u003eAdams, R.P., Identification of essential oil components by gas chromatography/mass spectrometry. 5 online ed. Gruver, TX USA: Texensis Publishing, 2017.\u003c/li\u003e\n\u003cli\u003eSayed, D. \u003cem\u003eet al.\u003c/em\u003e\u003cem\u003eMetabolic Profiling of Mimusops elengi Linn. Leaves extract and in silico anti-inflammatory assessment targeting NLRP3 inflammasome.\u003c/em\u003e\u003cem\u003eArabian Journal of Chemistry\u003c/em\u003e\u003cstrong\u003e16\u003c/strong\u003e(6), 104753 (2023).. \u003c/li\u003e\n\u003cli\u003eDemiryilmaz, I.\u003cem\u003e et al\u003c/em\u003e. Biochemically and histopathologically comparative review of thiamine\u0026rsquo;s and thiamine pyrophosphate\u0026rsquo;s oxidative stress effects generated with methotrexate in rat liver. \u003cem\u003eMed. Sci. Monit.\u003c/em\u003e 18,BR475\u0026ndash;BR481 https://doi.org/10.12659/msm.883591 (2012). \u003c/li\u003e\n\u003cli\u003eYogesh Chand, Y., Srivastav, D.N \u0026amp; Seth, A.K. Invivo antioxidant potential of Lepidium sativum L. seeds in albino rats using cisplatin induced nephrotoxicity. \u003cem\u003eInter. J. Phytomed\u003c/em\u003e. 2, 292-298 (2010). \u003c/li\u003e\n\u003cli\u003eLivak, K.J.\u0026amp; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. \u003cem\u003eMethods\u003c/em\u003e. 25,402-408 (2001). \u003c/li\u003e\n\u003cli\u003eDrury, R.A.B. \u0026amp; Wallington, E.A., Carleton\u0026rsquo;s histological technique Ed. 5 Oxford University Press, Oxford, UK (1980).\u003c/li\u003e\n\u003cli\u003eChen, Y. Y.\u003cem\u003e et al\u003c/em\u003e. Intrahepatic macrophage populations in the pathophysiology of primary sclerosing cholangitis. \u003cem\u003eJ.H.E.P. Reports\u003c/em\u003e 1, 369-376 (2019).\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003cp\u003eTable 1 is available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Methotrexate, hepatotoxicity, Garden cress, In silico, inflammation, Apoptosis","lastPublishedDoi":"10.21203/rs.3.rs-4840230/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4840230/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMethotrexate (MTX) has been used in high doses for cancer therapy and low doses for autoimmune diseases. It is proven that methotrexate-induced hepatotoxicity occurs even at relatively low doses. It is known that garden cress has anti-inflammatory, antioxidant, and hepatoprotective properties. This study investigates the potential alleviating effect of garden cress oil (GCO) against MTX-induced hepatotoxicity in rats. The chemical composition of GCO was assessed using GC/MS analysis. Liver damage was studied using molecular and histological analysis. Also, the effects of GCO on TNF-α and caspase-3 proteins were evaluated through molecular docking studies. MTX showed clear signs of apoptosis, such as increased mRNA expression levels of BAX, Caspase-3, and P53, and increased liver inflammation indicated by higher levels of TNF-α expression. MTX exhibited significant liver damage, as demonstrated by histological examination. Treatment with GCO effectively alleviated the apoptotic effects of MTX and provided protection against inflammation, as well as restoring histological alterations. Molecular docking revealed that linoleic acid and α-tocopherol are recognized as leading compounds for attenuating the inflammatory and apoptosis cascade reactions in the liver by inhibiting TNF-α and caspase-3 proteins, and in vivo and in silico studies demonstrated that GCO could potentially alleviate MTX hepatotoxicity.\u003c/p\u003e","manuscriptTitle":"Garden cress oil attenuates methotrexate-induced hepatic damage by enhancing inflammation, apoptosis, and histological profile: in vivo and in silico studies","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-27 16:54:22","doi":"10.21203/rs.3.rs-4840230/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-11-08T04:14:49+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-06T11:14:38+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"256780436787906227812960451566688556813","date":"2024-11-02T15:39:42+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-26T02:41:51+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"105486399455302855944213392305225315036","date":"2024-10-11T07:18:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"64165750551807754114848263008239798326","date":"2024-10-09T12:08:46+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-10-09T01:34:29+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-10-09T01:30:43+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-08-29T08:00:57+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-08-29T07:57:59+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-08-01T07:42:43+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6101aa1c-2d6e-4086-a7d5-a484eb822e7c","owner":[],"postedDate":"September 27th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":38140907,"name":"Biological sciences/Biochemistry"},{"id":38140908,"name":"Biological sciences/Cell biology"},{"id":38140909,"name":"Biological sciences/Genetics"}],"tags":[],"updatedAt":"2025-02-24T16:23:38+00:00","versionOfRecord":{"articleIdentity":"rs-4840230","link":"https://doi.org/10.1038/s41598-025-89550-8","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-02-20 15:57:11","publishedOnDateReadable":"February 20th, 2025"},"versionCreatedAt":"2024-09-27 16:54:22","video":"","vorDoi":"10.1038/s41598-025-89550-8","vorDoiUrl":"https://doi.org/10.1038/s41598-025-89550-8","workflowStages":[]},"version":"v1","identity":"rs-4840230","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4840230","identity":"rs-4840230","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}