Dietary Proanthocyanidins Ameliorate Age-Related Cognitive Decline and Neuroinflammation in Mice via the Gut Microbiota-SCFAs-5-HTP Axis

preprint OA: closed
Full text JSON View at publisher
Full text 155,757 characters · extracted from preprint-html · click to expand
Dietary Proanthocyanidins Ameliorate Age-Related Cognitive Decline and Neuroinflammation in Mice via the Gut Microbiota-SCFAs-5-HTP Axis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Dietary Proanthocyanidins Ameliorate Age-Related Cognitive Decline and Neuroinflammation in Mice via the Gut Microbiota-SCFAs-5-HTP Axis Chong Yuan, Na Wang, Kunmiao He, Tiantian Xu, Hanshuo Wang, Hongtao Ren, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8795494/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 12 You are reading this latest preprint version Abstract Age-related cognitive impairment represents a major global public health challenge closely linked to neuroinflammation and gut microbiota dysbiosis. Proanthocyanidins (PC), widely distributed dietary polyphenols, exhibit substantial potential for modulating gut-brain axis communication through their antioxidant and anti-inflammatory properties. This study elucidated the molecular mechanisms underlying PC-mediated amelioration of age-related cognitive impairment via the gut microbiota-SCFAs-5-HTP axis. Using an aging mouse model, we systematically evaluated PC's effects through behavioral tests, histopathology, molecular analyses, 16S rRNA gene sequencing, and targeted metabolomics. PC significantly improved spatial learning and memory in aging mice, as demonstrated by Morris water maze performance. Mechanistically, PC reshaped the disrupted gut microbiota by enriching SCFA-producing bacteria (e.g., Duncaniella and Ligilactobacillus ) and significantly increasing butyrate and propionate levels. Elevated SCFAs enhanced intestinal barrier integrity by upregulating tight junction proteins and promoting intestinal tryptophan hydroxylase 1 (TPH1) expression, thereby increasing 5-HTP biosynthesis. Circulating 5-HTP crossed the blood-brain barrier and was converted to serotonin (5-HT) in the hippocampus, where it activated 5-HT1A and 5-HT6 receptors, thereby inhibiting glial activation, reducing neuroinflammation, and improving cognitive function. This study systematically elucidated how proanthocyanidins exert neuroprotective effects via a microbiota-metabolite-neurotransmitter cascade, providing a mechanistic foundation for developing polyphenol-based precision nutrition strategies to prevent age-related cognitive decline. Health sciences/Diseases Biological sciences/Microbiology Biological sciences/Neuroscience Cognitive impairment Proanthocyanidins Gut-brain axis Gut microbiota Short-chain fatty acids Serotonin Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1 Introduction The global demographic structure is undergoing unprecedented transformation, with population aging accelerating worldwide. The global population aged ≥ 65 years is projected to rise from 10% (2022) to 16% by 2050 [ 1 ] . This demographic shift has precipitated a sharp rise in age-related cognitive decline (ARCD) prevalence. ARCD encompasses a continuum from subjective cognitive complaints to mild cognitive impairment, characterized by progressive deficits in memory, executive function, and processing speed, distinct from overt neurodegenerative diseases such as Alzheimer's disease [ 2 ] . Large-scale epidemiological studies show that > 30% of community-dwelling older adults without dementia exhibit significant cognitive decline [ 3 ] . ARCD represents a critical public health challenge [ 4 ] , impairing quality of life, functional independence, and social engagement while imposing substantial socioeconomic burdens on individuals and society. Consequently, developing effective interventions to prevent or ameliorate ARCD has become a global research priority in aging and public health. Research on cognitive aging has traditionally focused on neuronal degeneration. However, the past decade has witnessed a paradigm shift: neuroinflammation is now recognized as a central driver of cognitive decline [ 5 ] . During aging, central nervous system resident immune cells (microglia and astrocytes) shift from homeostatic "surveillance" to persistently activated "reactive" phenotypes. This shift drives chronic low-grade release of pro-inflammatory cytokines (e.g., IL-1β, IL-6, TNF-α), chemokines, and reactive oxygen species, creating an "inflammaging" microenvironment [ 6 ] . Chronic neuroinflammation impairs cognition through multiple mechanisms: degrading synaptic plasticity proteins and impairing long-term potentiation (LTP); disrupting neuronal metabolic homeostasis; promoting pathological protein accumulation (e.g., β-amyloid); and suppressing neurogenesis [ 7 ] . A critical question remains: what triggers central neuroinflammation? The gut-brain axis concept provides a revolutionary framework for addressing this question. This axis comprises bidirectional communication pathways between the gut and brain, including neural (vagus nerve), endocrine (hypothalamic-pituitary-adrenal axis), immune, and metabolic routes [ 8 ] . The gut microbiota serves as a central regulator, continuously signaling to the host via metabolite production. During aging, the gut microbiota undergoes dysbiosis, characterized by decreased α-diversity, depletion of beneficial bacteria (e.g., Bifidobacterium , Lactobacillus ), expansion of potentially pathogenic taxa, and reduced functional stability [ 9 ] . Gut dysbiosis impairs local intestinal homeostasis and, through multiple mechanisms, disrupts distant organ function, particularly in the brain. Among gut microbiota metabolites, short-chain fatty acids (SCFAs) play a central role. SCFAs are produced through dietary fiber fermentation by intestinal anaerobes, primarily acetate, propionate, and butyrate [ 10 ] . Beyond serving as the primary energy source for colonocytes, SCFAs function as signaling molecules, exerting diverse physiological effects via G protein-coupled receptors (GPR41/43/109a) and histone deacetylase (HDAC) inhibition [ 11 ] . During aging, gut dysbiosis reduces SCFA production [ 12 ] , contributing to multiple pathologies: impaired intestinal barrier integrity (reduced tight junction proteins, "leaky gut"), compromised regulatory T cell differentiation and immune tolerance, and disrupted hepatic glucose-lipid metabolism. Importantly, SCFAs cross the blood-brain barrier or indirectly modulate central nervous system function by influencing microglial maturation, suggesting their role as key gut-brain mediators. The serotonin (5-HT) system is central to learning, memory, and emotional regulation. Notably, ~ 90% of the body's 5-HT is synthesized by intestinal enterochromaffin cells, with tryptophan hydroxylase 1 (TPH1) as the rate-limiting enzyme [ 13 ] . Intestinal 5-HT synthesis is tightly regulated by gut microbiota and their metabolites. Although gut-derived 5-HT cannot cross the blood-brain barrier due to its polarity, its precursor 5-hydroxytryptophan (5-HTP) readily crosses via lipid solubility and is converted to brain 5-HT by aromatic L-amino acid decarboxylase (AADC) [ 14 ] . Therefore, intestinal 5-HTP synthesis may represent a critical peripheral node regulating central serotonergic function. Interestingly, SCFAs, particularly butyrate, upregulate intestinal TPH1 expression [ 15 ] , suggesting a coherent "microbiota-SCFAs-5-HTP" axis. Proanthocyanidins (PC) are polyphenolic polymers widely distributed in grape seeds, blueberries, cocoa, and other plant-based foods. PC has attracted interest for its antioxidant and anti-inflammatory properties [ 16 ] . Due to their high polymerization, PC are poorly absorbed in the upper gastrointestinal tract, reaching the colon largely intact where they interact extensively with gut microbiota, exhibiting prebiotic properties. Studies show that PC selectively enriches beneficial bacteria (e.g., Lactobacillus , Bifidobacterium ), inhibits pathogens, and increases SCFA production [ 17 ] . Furthermore, PC enhances intestinal barrier function and alleviates oxidative stress [ 18 ] . Based on these properties, PC may improve cognitive function via gut-brain axis modulation. However, existing studies have examined these effects in isolation, lacking systematic investigation of whether and how PC ameliorates age-related cognitive impairment through the complete "microbiota remodeling → metabolite alteration → neurotransmitter precursor synthesis → cognitive improvement" cascade. We hypothesized that dietary PC reshapes the disrupted gut microbiota in aging mice by enriching SCFA-producing bacteria and increasing butyrate production; these SCFAs repair the intestinal barrier and upregulate intestinal TPH1 expression, promoting 5-HTP synthesis; circulating 5-HTP crosses the blood-brain barrier, is converted to hippocampal 5-HT, activates serotonin receptors, and thereby alleviates neuroinflammation, enhances synaptic plasticity, and improves cognitive function. To test this hypothesis, we employed an aging mouse model and integrated behavioral, histopathological, molecular, microbiome, and metabolomic analyses to systematically elucidate the mechanisms underlying PC's amelioration of ARCD and provide a mechanistic foundation for developing precision nutrition strategies targeting the gut-brain axis. 2 Materials and Methods 2.1 Animals and Ethics Six-week-old female SPF-grade BALB/c mice were obtained from Henan Provincial Laboratory Animal Center (License No. SCXK(Yu)2022-0001). Mice were housed in a specific pathogen-free (SPF) facility at the Animal Immunology Laboratory, Henan Academy of Agricultural Sciences, under standard conditions (22 ± 2°C, 50 ± 10% humidity, 12-h light/dark cycle) with ad libitum access to food and water. All procedures were approved by the Animal Ethics Committee of Henan Agricultural University (Approval No. HNND2024031107) and conducted in accordance with the 3R principles. 2.2 Experimental Design After one week of acclimation, mice were randomly assigned to four groups (n = 9/group): Control group (NC) distilled water daily for 8 weeks; Aging model group (Model) thyroxine (Th, 320 mg/kg/day) for 8 weeks; PC prevention group (Prevent) PC (100 mg/kg/day) followed 8 h later by Th (320 mg/kg/day) for 8 weeks; PC intervention group (Treatment) Th (320 mg/kg/day) followed 8 h later by PC (100 mg/kg/day) for 8 weeks. PC (grape seed proanthocyanidins, ≥ 95% purity, Lot No. IYT7499) was obtained from Beijing Solarbio Science & Technology Co., Ltd., and Th was purchased from Renhe Pharmaceutical Co., Ltd. Dosages were determined based on preliminary experiments and literature [ 19 ] . All mice received oral gavage administration. The experimental timeline is shown in Fig. 2 C. 2.3 Morris Water Maze Test The Morris water maze test was conducted following the 8-week intervention to assess spatial learning and memory. The apparatus consisted of a circular pool (120 cm diameter, 40 cm height) divided into four quadrants, filled with water maintained at 25 ± 2°C. Place navigation training was conducted for 5 consecutive days (4 trials/day). In each trial, mice were placed into the water facing the pool wall from pseudo-random start locations in different quadrants. Escape latency (time to locate the hidden platform; maximum 60 s) was recorded. The platform (10 cm diameter) was submerged 1 cm below the water surface in the target quadrant. Mice that found the platform remained on it for 15 s; those failing to find it within 60 s were gently guided to the platform and allowed to remain for 15 s. On day 6, a spatial probe trial was conducted with the platform removed. Mice were released from the quadrant opposite the original platform location, and the following parameters were recorded during a 90-s test: number of platform crossings, time in the target quadrant, and total swimming distance. All behavioral data were recorded and analyzed using a video tracking system (DeepLabCut). 2.4 Sample Collection Following behavioral testing, mice were fasted for 4 h with ad libitum access to water. Mice were then anesthetized with sodium pentobarbital (50 mg/kg, 1% solution, intraperitoneal injection). Blood was collected via the orbital venous plexus, allowed to clot at room temperature for 30 min, and centrifuged at 3,000 × g for 15 min at 4°C. Serum was separated, aliquoted, and stored at -80°C. Brains were rapidly removed and bilateral hippocampi were dissected on ice. Half of each hippocampus was fixed in 4% paraformaldehyde for histological analysis; the other half was snap-frozen in liquid nitrogen and stored at -80°C for molecular analyses. Colon segments were collected; portions were fixed in 4% paraformaldehyde and portions were snap-frozen in liquid nitrogen and stored at -80°C. Fresh fecal samples were collected before euthanasia, immediately snap-frozen in liquid nitrogen, and stored at -80°C for microbiome and metabolomic analyses. 2.5 Immunofluorescence Fixed hippocampal and colonic tissues were paraffin-embedded and sectioned at 5 µm. Sections were deparaffinized, rehydrated, and antigen retrieval was performed in sodium citrate buffer (pH 6.0, 95°C, 15 min). Sections were blocked with 10% goat serum containing 0.3% Triton X-100 for 1 h at room temperature, then incubated overnight at 4°C with primary antibodies against IBA-1, GFAP, Occludin, ZO-1, and Claudin-1 (Wuhan Sanying Biotechnology Co., Ltd.). After PBS washes, sections were incubated with appropriate fluorescent secondary antibodies for 1 h at room temperature in darkness. Nuclei were counterstained with DAPI. After mounting with anti-fade medium, sections were visualized using a fluorescence microscope. For each section, three non-overlapping fields were randomly selected from the hippocampal CA1 region or colonic mucosa, and mean fluorescence intensity was quantified using ImageJ software (NIH, USA). 2.6 Quantitative Real-Time PCR (qRT-PCR) Total RNA was extracted from hippocampal and colonic tissues using TRIzol reagent (Invitrogen). RNA concentration and purity were assessed using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific); samples with A260/A280 ratios of 1.8–2.0 were used for downstream analysis. One microgram of total RNA was reverse-transcribed to cDNA using the PrimeScript RT Reagent Kit (Beijing Quanshijin Biotechnology Co., Ltd.). qRT-PCR was performed using a LightCycler 480 II system (Roche) with SYBR Premix Ex Taq II (Vazyme Biotech Co., Ltd.). The 20 µL reaction mixture contained 2 µL cDNA template, 0.4 µL each primer (10 µM), 10 µL SYBR Green Mix, and 7.2 µL nuclease-free water. Thermal cycling conditions were: 95°C for 30 s, followed by 35 cycles of 95°C for 5 s and 60°C for 30 s. β-actin served as the reference gene, and relative expression was calculated using the 2^(-ΔΔCt) method. Primer sequences are provided in Table 1 . Table 1 Primer sequences for qRT-PCR Gene Forward Primer (5’-3’) Reverse Primer (5’-3’) IL-1β TCGCAGCAGCACATCAACAAG TAGCCCTCCATTCCTGAAAGC IL-6 GAGAGGAGACTTCACAGAGGATACC TCATTTCCACGATTTCCCAGAGAAC TNF-α CACGCTCTTCTGTCTACTGAACTTC CTTGGTGGTTTGTGAGTGTGAGG MCP-1 CTACTATTCCTGATGGCACTTCTCTTG GAACCTCTGTCCGTGATGATCTTC AADC TCCTCTTCAGTTCGCAGAGC GATCAGGGGCCGAAGATAGC TPH1 AACAAAGACCATTCCTCCGAAAG TGTAACAGGCTCACATGATTCTC TPH2 GCAAGACAGCGGTAGTGTTCT CAGTCCACGAAGATTTCGACTT 5-HT1a TACGTGAACAAGAGGACGCC CACTCGATGCACCTCGATCA 5-HT6 TGGGCAAAGCTCGAACATCT CCACCTCCCACTCTTAGGGA β-actin TGGCATTGTTACCAACTGGGAC TCACGGTTGGCCTTAGGGTTC 2.7 Biochemical Assays and ELISA All assays were performed according to the manufacturers' protocols. The following parameters were determined: Oxidative stress markers : Serum levels of total antioxidant capacity (T-AOC), superoxide dismutase (SOD), malondialdehyde (MDA), and glutathione (GSH) were measured using commercial kits (Nanjing Jiancheng Bioengineering Institute). Inflammatory and barrier markers : Serum lipopolysaccharide (LPS) and C-reactive protein (CRP) were measured using ELISA kits (Shanghai Enzyme-linked Biotechnology Co., Ltd.). Neurotransmitters and precursors : Levels of 5-HT and 5-HTP in serum, hippocampal homogenates, and colonic homogenates were measured using ELISA kits (Shanghai Enzyme-linked Biotechnology Co., Ltd.). All samples were assayed in triplicate, and data are presented as mean values. 2.8 Intestinal Permeability Assay One week before the end of the intervention, 6 mice per group were randomly selected for this assay. After 4 h of fasting, mice were orally gavaged with FITC-dextran (4 kDa, 600 mg/kg body weight, dissolved in PBS; Sigma-Aldrich, USA). Four hours later, mice were anesthetized and blood was collected via cardiac puncture; serum was then separated by centrifugation. Serum fluorescence intensity was measured using a fluorescence microplate reader (excitation 485 nm, emission 528 nm), and FITC-dextran concentrations were calculated from a standard curve. 2.9 16S rRNA Gene Sequencing and Microbiome Analysis Fecal microbial DNA was extracted using the QIAamp DNA Stool Mini Kit (QIAGEN, Germany). The V3-V4 hypervariable region of the 16S rRNA gene was amplified using universal primers 338F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3'). After purification, PCR amplicons were sequenced on an Illumina MiSeq platform (2 × 300 bp paired-end; Shanghai Personalbio Biotechnology Co., Ltd.). Raw sequencing data were processed using QIIME2 (v2020.6). Quality filtering and denoising were performed with DADA2 to generate amplicon sequence variants (ASVs). Taxonomic classification was performed against the SILVA 138 database. Alpha diversity was assessed using Chao1 richness and Shannon diversity indices. β-diversity was assessed by principal coordinates analysis (PCoA) based on Bray-Curtis dissimilarity, with significance tested using PERMANOVA. Differentially abundant taxa were identified using linear discriminant analysis effect size (LEfSe) with an LDA score threshold of 2.0 and P < 0.05. 2.10 Short-Chain Fatty Acid Quantification Fecal samples (~ 100 mg) were homogenized in 1 mL of 50% acetonitrile containing internal standard (2-ethylbutyric acid-d9, 10 µg/mL), vortexed for 2 min, and sonicated in an ice bath for 30 min. Samples were then centrifuged at 13,000 × g for 15 min at 4°C, and supernatants were collected. Supernatants were mixed with derivatization reagents [3-nitrophenylhydrazine (50 mg/mL) and EDC (120 mg/mL), both in 50% acetonitrile] at a 1:1:1 volume ratio and incubated at 40°C for 30 min. Derivatized samples were filtered through 0.22 µm membranes prior to LC-MS/MS analysis. SCFA analysis was performed using a UHPLC-QTRAP 6500 + system (AB Sciex). Chromatographic separation was achieved on a Phenomenex Kinetex C18 column (2.1 × 100 mm, 1.7 µm) at 40°C with a mobile phase of (A) 0.1% formic acid in water and (B) 0.1% formic acid in acetonitrile. The gradient elution was: 0–2 min, 5% B; 2–8 min, 5–50% B; 8–12 min, 95% B; 12–14 min, 5% B. The flow rate was 0.35 mL/min, and the injection volume was 5 µL. Mass spectrometry was performed in negative electrospray ionization (ESI-) mode with multiple reaction monitoring (MRM). The MRM transitions were: acetate ( m/z 176 → 132), propionate (190 → 146), butyrate (204 → 160), valerate (218 → 174), and hexanoate (232 → 188). SCFAs were quantified using the internal standard method with calibration curves prepared from authentic standards. 2.11 Statistical Analysis Data are presented as mean ± SEM. Statistical analyses and data visualization were performed using GraphPad Prism 8.0, Graphical abstract and experimental flow charts were drawn via Biorender.com. For comparisons among multiple groups, one-way ANOVA followed by Tukey's honestly significant difference (HSD) post hoc test was used. Escape latency was analyzed using two-way repeated measures ANOVA with group and time as factors. Between-group differences in gut microbiota β-diversity were assessed using permutational multivariate analysis of variance (PERMANOVA). Correlations were assessed using Pearson's correlation for normally distributed data and Spearman's rank correlation for non-normally distributed data. Multiple testing was corrected using the Benjamini-Hochberg false discovery rate (FDR) method. Statistical significance was set at P < 0.05, with P < 0.01 indicating high significance. 3 Results 3.1 PC Improves Spatial Learning and Memory in Aging Mice To assess the effects of PC on age-related cognitive decline, we performed behavioral, histological, and molecular evaluations. In the Morris water maze test, Model mice exhibited significant spatial memory impairment compared to NC mice, characterized by disorganized exploration trajectories, reduced time in the target quadrant, and decreased swimming distance ( P < 0.01) (Fig. 1 A, C). Both PC treatment groups (Treatment and Prevent) significantly reversed this impairment, with behavioral parameters approaching NC levels ( P < 0.05), indicating that PC improves spatial learning and memory in aging mice. Immunofluorescence staining of the hippocampal dentate gyrus (DG) revealed significantly elevated GFAP (astrocyte marker) and IBA-1 (microglia marker) expression in Model mice ( P < 0.01), indicating excessive glial activation (Fig. 1 B, D). PC treatment (both Treatment and Prevent groups) significantly reduced GFAP and IBA-1 expression ( P < 0.05), indicating that PC attenuates glial activation and preserves neuronal homeostasis. Excessive glial cell activation is a critical driver of neuroinflammation. Molecular-level analysis (Fig. 1 E) demonstrated that the mRNA expression levels of pro-inflammatory cytokines IL-1β, IL-6, TNF-α, and MCP-1 in the hippocampus were significantly upregulated in the Model group compared with the NC group ( P < 0.01). Following PC intervention, the expression of IL-1β, IL-6, and MCP-1 was significantly suppressed ( P < 0.01), and TNF-α also showed a downward trend, indicating that PC can effectively alleviate neuroinflammatory responses in the aging brain. In summary, PC supplementation can ameliorate neuroinflammation by inhibiting abnormal activation of hippocampal astrocytes and microglia and downregulating the expression of key pro-inflammatory cytokines, thereby ultimately improving spatial learning and memory functions in aging mice. These findings suggest that PC may serve as a potential dietary intervention strategy for delaying age-related cognitive decline. (A) Representative heat maps of swimming trajectories during the Morris water maze probe trial. (B) Representative immunofluorescence images of the hippocampal dentate gyrus showing GFAP (green, astrocyte marker) and IBA-1 (red, microglia marker) expression. Nuclei were counterstained with DAPI (blue). Scale bar, 50 µm. (C) Quantification of swimming distance and time in the target quadrant during the probe trial. (D) Quantification of GFAP and IBA-1 expression in hippocampal tissues. (E) Hippocampal mRNA expression of pro-inflammatory cytokines (IL-1β, IL-6, TNF-α, and MCP-1). Data are presented as mean ± SEM (n = 3/group). *, P < 0.05; **, P < 0.01 vs NC; #, P < 0.05; ##, P < 0.01 vs Model; +, P < 0.05; ++, P < 0.01, Prevent vs Treatment; ns, not significant. 3.2 PC Attenuates Oxidative Stress and Intestinal Inflammation in Aging Mice To assess PC's effects on systemic oxidative stress and intestinal inflammation, we measured serum antioxidant markers and intestinal inflammatory parameters. Model mice exhibited significantly decreased serum T-AOC, SOD activity, and GSH levels, with elevated MDA content ( P < 0.01) (Fig. 2 A). These findings indicate impaired antioxidant defenses and oxidative stress in aging mice. Both PC treatment groups significantly increased serum T-AOC, SOD, and GSH levels and reduced MDA content ( P < 0.01), with parameters approaching NC levels. Notably, the Prevent group showed significantly higher T-AOC and GSH levels than the Treatment group ( P < 0.01), suggesting that early PC intervention may be more effective in preserving redox homeostasis. Colonic mRNA expression of pro-inflammatory cytokines (IL-1β, IL-6, TNF-α, and MCP-1) was significantly upregulated in Model mice compared to NC ( P < 0.01) (Fig. 2 B), indicating intestinal inflammation in aging mice. Both PC treatment groups significantly reduced colonic expression of these cytokines ( P < 0.01), indicating that PC attenuates age-related intestinal inflammation. In summary, aging led to systemic oxidative stress and intestinal inflammation in mice. PC supplementation ameliorated these conditions by enhancing antioxidant defenses (increased T-AOC, SOD, and GSH; reduced MDA) and reducing colonic pro-inflammatory cytokine expression. Notably, the Prevent group showed superior effects in improving oxidative stress markers compared to the Treatment group, suggesting that early PC intervention may be more beneficial for preventing age-related oxidative damage and inflammation. (A) Serum levels of oxidative stress markers: total antioxidant capacity (T-AOC), superoxide dismutase (SOD) activity, malondialdehyde (MDA), and reduced glutathione (GSH). (B) Colonic mRNA expression of pro-inflammatory cytokines (IL-1β, IL-6, TNF-α, and MCP-1) determined by qRT-PCR. (C) Schematic of experimental design and workflow. Data are presented as mean ± SEM (n = 3/group). *, P < 0.05; **, P < 0.01 vs NC; #, P < 0.05; ##, P < 0.01 vs Model; +, P < 0.05; ++, P < 0.01, Prevent vs Treatment; ns, not significant. 3.3 PC Restores Intestinal Barrier Integrity in Aging Mice To assess PC's effects on intestinal barrier function, we evaluated colonic tight junction proteins, tissue morphology, and barrier permeability. PC treatment effectively restored tight junction protein expression and barrier function in aging mice. Immunofluorescence analysis revealed that expression of tight junction proteins (Claudin-1, ZO-1, and Occludin) in colonic epithelium was significantly reduced in Model mice compared to NC ( P < 0.01), with disrupted characteristic reticular distribution (Fig. 3A-B), indicating impaired tight junction integrity. Both PC treatment groups significantly increased expression of all three proteins ( P < 0.01), with restored continuous and orderly reticular distribution, indicating that PC preserves tight junction structure. Notably, the Prevent group showed a trend toward superior performance compared to the Treatment group in most indicators, suggesting that early PC intervention may be more effective in maintaining tight junction homeostasis. Histological analysis revealed significant villus atrophy and reduced crypt depth in the colon of Model mice compared to NC ( P < 0.01), indicating mucosal atrophy (Fig. 3C). Both PC treatment groups significantly increased villus length and crypt depth ( P < 0.01), indicating that PC not only restores tight junction structures but also promotes overall intestinal epithelial integrity. To assess barrier function, we measured serum LPS and CRP levels, as well as FITC-dextran permeability. Model mice exhibited significantly elevated serum LPS and CRP levels ( P < 0.01), with increased FITC-dextran permeability ( P < 0.01), indicating impaired barrier function and "leaky gut" (Fig. 3D). Both PC treatment groups significantly reduced serum LPS, CRP, and FITC-dextran permeability ( P < 0.01), demonstrating that PC restores barrier function and reduces endotoxin translocation. In summary, PC ameliorated age-related intestinal barrier damage through multiple mechanisms: upregulating tight junction protein (Claudin-1, ZO-1, Occludin) expression, improving villus and crypt morphology, and reducing intestinal permeability. These findings provide experimental evidence that PC may serve as a dietary strategy to maintain intestinal barrier integrity and alleviate systemic inflammation in aging. Figure 3. PC restores intestinal barrier integrity in aging mice (A) Representative immunofluorescence images of tight junction proteins (Occludin, Claudin-1, and ZO-1) in colonic epithelium from NC, Model, Prevent, and Treatment groups. Nuclei were counterstained with DAPI (blue). Merge shows multi-channel overlay. (B) Quantification of Claudin-1, Occludin, and ZO-1 expression in colonic epithelium. (C) Quantification of colonic crypt depth and villus length. (D) Serum barrier dysfunction markers: C-reactive protein (CRP), lipopolysaccharide (LPS), and FITC-dextran permeability. Data are presented as mean ± SEM (n = 3/group).*, P < 0.05; **, P < 0.01 vs NC; #, P < 0.05; ##, P < 0.01 vs Model; +, P < 0.05; ++, P < 0.01, Prevent vs Treatment; ns, not significant. 3.4 PC Modulates Gut Microbiota and Short-Chain Fatty Acid Production To assess PC's effects on gut microbial metabolites and microbiota composition, we measured fecal short-chain fatty acids (SCFAs) and performed 16S rRNA gene sequencing. SCFAs, as primary products of gut microbial fermentation, are key regulators of intestinal barrier integrity and immune homeostasis [ 20 ] . Principal component analysis (PCA) of SCFA profiles revealed distinct separation between Model and NC groups, indicating age-related metabolic alterations (Fig. 4 A). The metabolic profiles of both PC treatment groups (Prevent and Treatment) shifted toward NC, suggesting that PC partially reverses age-related metabolic dysregulation. Model mice exhibited significantly reduced fecal levels of multiple short-chain fatty acids (SCFAs), including acetate, propionate, butyrate, valerate, and hexanoate, compared to NC ( P < 0.01) (Fig. 4 B-E), indicating impaired intestinal SCFA biosynthesis. Both PC treatment groups significantly increased fecal SCFA levels (all P < 0.01). Notably, the Prevent group showed significantly higher butyrate and propionate levels compared to the Treatment group ( P < 0.01), suggesting that early PC intervention is more effective in restoring these crucial metabolites. In summary, aging led to systemic decline in intestinal SCFA production, while PC intervention effectively enhanced SCFA abundance, particularly butyrate and propionate. These findings suggest that PC may improve intestinal barrier function through enhancing SCFA production, thereby providing energy for epithelial cells, strengthening tight junctions, and suppressing inflammation. The restoration of SCFA levels represents a key mechanistic link between PC intervention and intestinal barrier improvement. (A) Principal component analysis (PCA) of fecal SCFA profiles. (B) Heatmap showing relative abundance of seven SCFAs across groups. (C) Volcano plots of differential SCFAs in Model vs NC, Prevent vs Model, and Treatment vs Model comparisons. (D) Radar chart of SCFA expression patterns. (E) Quantification of fecal acetate, propionate, butyrate, valerate, and hexanoate levels. Data are presented as mean ± SEM (n = 3/group).*, P < 0.05; **, P < 0.01 vs NC; #, P < 0.05; ##, P < 0.01 vs Model; +, P < 0.05; ++, P < 0.01, Prevent vs Treatment; ns, not significant. 3.5 PC Modulates Gut Microbiota Composition To assess PC's effects on gut microbiota composition and diversity, we performed 16S rRNA gene sequencing. Alpha diversity analysis revealed that Model mice exhibited significantly reduced microbiota richness compared to NC, while both PC treatment groups (Prevent and Treatment) showed partial restoration of diversity (Fig. 5 A). Principal coordinate analysis (PCoA) demonstrated distinct separation of microbiota structure between Model and NC groups, with PC intervention shifting the overall microbiota composition toward NC, indicating that PC can reverse age-related gut microbiota dysbiosis (Fig. 5 B). At the phylum level, Model mice showed significantly decreased Firmicutes and increased Bacteroidota relative abundance, resulting in a reduced Firmicutes/Bacteroidota (F/B) ratio ( P < 0.01) (Fig. 5 C, E). Both PC treatment groups significantly elevated the F/B ratio ( P < 0.01), indicating restoration of microbial ecological balance. At the genus level, PC treatment specifically promoted the proliferation of SCFA-producing bacteria. The abundance of key butyrate-producing genera, including Ligilactobacillus and Duncaniella , was significantly decreased in Model mice compared to NC. Following PC supplementation, the abundance of both genera was significantly restored ( P < 0.01) (Fig. 5 C, F). Correlation analysis further revealed that the abundance of Ligilactobacillus and Duncaniella exhibited significant positive correlations with fecal levels of acetate, propionate, and particularly butyrate (Fig. 5 D). In summary, PC reshaped the age-disrupted gut microbiota composition, with its core action lying in the specific enrichment of beneficial SCFA-producing bacteria such as Ligilactobacillus and Duncaniella . The restoration of these functional bacteria directly contributed to increased intestinal SCFA biosynthesis, particularly butyrate, providing a microbiological explanation for the observed improvements in SCFA levels and intestinal barrier function. (A) Rarefaction curves showing alpha diversity (Shannon index) across groups. (B) Principal coordinate analysis (PCoA) based on Bray-Curtis dissimilarity showing beta diversity. (C) Relative abundance of gut microbiota at phylum (upper) and genus (lower) levels. (D) Correlation network between bacterial genera and fecal SCFAs. Green lines, positive correlations; red lines, negative correlations. Color intensity indicates Pearson correlation coefficient magnitude. (E) Relative abundance of Firmicutes and Bacteroidota, and Firmicutes/Bacteroidota (F/B) ratio. (F) Relative abundance of Ligilactobacillus and Duncaniella . Data are presented as mean ± SEM (n = 3/group).*, P < 0.05; **, P < 0.01 vs NC; #, P < 0.05; ##, P < 0.01 vs Model; +, P < 0.05; ++, P < 0.01, Prevent vs Treatment; ns, not significant. 3.6 PC Increases Intestinal and Hippocampal 5-HTP Synthesis To assess PC's effects on the serotonin (5-HT) synthesis pathway, we measured colonic and hippocampal expression of 5-HT synthesis enzymes and levels of 5-HT and its precursor 5-hydroxytryptophan (5-HTP). Colonic 5-HT synthesis that Model mice showed significantly reduced colonic mRNA expression of tryptophan hydroxylase 1 (TPH1) and aromatic L-amino acid decarboxylase (AADC), with decreased colonic 5-HTP and 5-HT levels ( P < 0.01) (Fig. 6 A–D). Both PC treatment groups significantly increased TPH1 and AADC expression and restored colonic 5-HTP and 5-HT levels ( P < 0.01), with the Prevent group showing higher 5-HTP levels than the Treatment group ( P < 0.01). In serum, Model mice exhibited significantly reduced serum 5-HT and 5-HTP levels ( P < 0.01). Both PC treatment groups significantly increased serum 5-HT and 5-HTP concentrations ( P < 0.01) (Fig. 6 A–C). Hippocampal 5-HT synthesis that Model mice showed reduced hippocampal expression of TPH2 and AADC, decreased 5-HTP and 5-HT levels, and reduced expression of 5-HT receptors (5-HT1A and 5-HT6) ( P < 0.01) (Fig. 6 A–C, E, F). Both PC treatment groups significantly increased hippocampal TPH2, AADC, 5-HT1A, and 5-HT6 expression, and elevated hippocampal 5-HTP and 5-HT levels ( P < 0.01). Spearman correlation analysis revealed that the abundance of Duncaniella and fecal butyrate levels positively correlated with serum and hippocampal 5-HTP levels ( P < 0.01) (Fig. 6 G). Collectively, PC increased intestinal 5-HT synthesis and serum 5-HTP availability, leading to enhanced hippocampal 5-HT synthesis and receptor expression. Correlation analysis suggests that gut microbiota modulation, particularly increased SCFA-producing bacteria, may contribute to enhanced 5-HT synthesis. (A) Serotonin (5-HT) levels in colon, hippocampus, and serum. (B) 5-hydroxytryptophan (5-HTP) levels in colon, hippocampus, and serum. (C) Colonic and hippocampal mRNA expression of aromatic L-amino acid decarboxylase (AADC). (D) Colonic mRNA expression of tryptophan hydroxylase 1 (TPH1). (E) Hippocampal mRNA expression of tryptophan hydroxylase 2 (TPH2). (F) Hippocampal mRNA expression of serotonin receptors 5-HT1A and 5-HT6. (G) Spearman correlation analysis between gut microbiota abundance, fecal SCFA levels, and serum/hippocampal 5-HTP levels. Data are presented as mean ± SEM (n = 3/group).*, P < 0.05; **, P < 0.01 vs NC; #, P < 0.05; ##, P < 0.01 vs Model; +, P < 0.05; ++, P < 0.01, Prevent vs Treatment; ns, not significant. 4 Discussion This study demonstrates that dietary phosphatidylcholine (PC) improves age-related cognitive decline through modulation of the gut microbiota-short-chain fatty acid (SCFA)-serotonin axis. Our findings reveal a multi-step pathway: PC supplementation enriches intestinal SCFA-producing bacteria ( Ligilactobacillus and Duncaniella ), increases fecal butyrate and propionate levels, and enhances intestinal synthesis of 5-hydroxytryptophan (5-HTP). Elevated peripheral 5-HTP crosses the blood-brain barrier, leading to increased hippocampal serotonin synthesis and upregulation of serotonin receptors (5-HT1A and 5-HT6). These neurochemical changes are accompanied by reduced hippocampal neuroinflammation, improved intestinal barrier integrity, and enhanced spatial learning and memory. These results suggest that PC may represent a dietary strategy to maintain cognitive function in aging by targeting the gut-brain axis, though causal relationships require further validation. 4.1 PC Improves Cognitive Function and Reduces Neuroinflammation PC supplementation significantly improved spatial learning and memory in aging mice, as demonstrated by enhanced performance in the Morris water maze. These findings are consistent with prior studies showing cognitive benefits of polyphenol-rich extracts, including grape seed proanthocyanidins in D-galactose-induced aging models [ 21 ] and blueberry polyphenols in individuals with mild cognitive impairment [ 22 ] Beyond behavioral improvements, our study reveals underlying neurobiological changes, including reduced hippocampal neuroinflammation and oxidative stress. PC treatment reduced microglial activation and decreased expression of pro-inflammatory cytokines (IL-1β, IL-6, TNF-α, MCP-1) in the hippocampus. Chronic low-grade neuroinflammation, or "inflammaging," is a hallmark of brain aging that impairs synaptic plasticity and cognitive reserve [ 23 ] . PC may exert direct anti-inflammatory effects through inhibition of NF-κB signaling and activation of the Nrf2/HO-1 antioxidant pathway [ 24 ] . However, the strong correlation between PC's effects on intestinal barrier integrity and hippocampal inflammation suggests that gut-brain axis modulation may be a primary mechanism underlying PC's neuroprotective effects. 4.2 PC Restores Intestinal Barrier Integrity and Reduces Systemic Inflammation Intestinal barrier dysfunction, or "leaky gut," is a hallmark of aging characterized by compromised tight junction integrity and increased intestinal permeability [ 25 ] . In aging mice, we observed elevated serum LPS and CRP levels, decreased colonic expression of tight junction proteins (Claudin-1, Occludin, ZO-1), and increased intestinal permeability, confirming age-related barrier dysfunction. Increased gut permeability allows bacterial products such as LPS to enter systemic circulation, triggering inflammation through Toll-like receptor 4 (TLR4) activation. These peripheral inflammatory signals can reach the brain via multiple routes, including cytokine passage across the blood-brain barrier and vagal afferent pathways, potentially exacerbating hippocampal neuroinflammation [ 26 , 27 ] . PC treatment significantly improved all markers of barrier dysfunction, including tight junction protein expression, serum LPS and CRP levels, and intestinal permeability. These findings are consistent with prior studies showing that prebiotics and bioactive compounds can enhance intestinal barrier function through AMPK activation or microbiota modulation and NF-κB inhibition [ 28 , 29 ] . However, whether PC acts directly on intestinal epithelial cells or indirectly through modulation of the gut microbiota remains to be determined. Our data suggest that microbiota modulation may be a primary mechanism, as PC enriched SCFA-producing bacteria and increased fecal butyrate levels, both of which are known to enhance barrier integrity. 4.3 PC Exerts Prebiotic-Like Functions to Reshape Microbiota and Drive SCFA Metabolism Gut microbiota dysbiosis is a hallmark of aging and has been linked to cognitive decline [ 30 ] . Using 16S rRNA gene sequencing, we found that PC treatment enriched SCFA-producing genera, including Duncaniella and Ligilactobacillus . Duncaniella belongs to the Muribaculaceae family, which degrades complex polysaccharides and produces SCFAs [ 31 ] . Consistent with enrichment of SCFA-producing bacteria, PC treatment increased fecal levels of acetate, propionate, and butyrate. Butyrate is particularly important in this context, as it serves as the primary energy source for colonocytes and exhibits anti-inflammatory and barrier-protective effects through histone deacetylase (HDAC) inhibition and other signaling pathways [ 32 ] . Prior studies have shown that butyrate enhances tight junction protein expression and inhibits NF-κB signaling, thereby improving intestinal barrier function and reducing inflammation [ 33 ] . The strong correlation between increased SCFA levels and improved barrier function observed in our study supports this proposed mechanism. However, causal validation through direct SCFA supplementation or microbiota depletion studies is needed to confirm this pathway. 4.4 PC Increases Intestinal 5-HTP Production and Hippocampal Serotonin Synthesis While SCFAs are known to regulate intestinal barrier function and immunity, their effects on brain function and cognition are less well understood. SCFAs have limited blood-brain barrier permeability. Our findings suggest that SCFAs, particularly butyrate, may indirectly influence brain serotonin levels by stimulating intestinal 5-HTP synthesis. Following PC treatment, colonic TPH1 and AADC expression increased along with elevated fecal SCFA levels, resulting in higher colonic 5-HTP and 5-HT levels. These findings are consistent with prior studies showing that gut microbiota and SCFAs regulate intestinal serotonin synthesis [ 34 ][ 35 ] . Butyrate may enhance TPH1 expression through HDAC inhibition or receptor-mediated signaling pathways [ 36 ] , thereby converting microbial metabolites into a blood-brain barrier-permeable precursor (5-HTP). Importantly, 5-HTP, unlike serotonin (5-HT), can readily cross the blood-brain barrier. PC treatment increased serum 5-HTP levels, consistent with prior studies showing that 5-HTP supplementation elevates brain serotonin and improves cognitive functionr [ 37 ] . Additionally, we observed increased hippocampal 5-HTP and serotonin levels, along with upregulated expression of serotonin receptors (5-HT1A and 5-HT6), which are implicated in learning and memory. Our findings support a pathway whereby PC enriches SCFA-producing bacteria, leading to increased intestinal 5-HTP synthesis and elevated serum 5-HTP levels, which may contribute to enhanced hippocampal serotonin synthesis. However, further studies are needed to confirm the causal relationships in this proposed pathway. 4.5 Enhanced Hippocampal Serotonin Signaling May Contribute to Cognitive Improvement Following PC treatment, hippocampal 5-HTP and serotonin levels increased, along with upregulated expression of TPH2 and AADC, the enzymes responsible for central serotonin synthesis. This may reflect enhanced local serotonin synthesis capacity in response to increased substrate availability. Additionally, PC treatment increased hippocampal expression of serotonin receptors 5-HT1A and 5-HT6, which are implicated in learning and memory. 5-HT1A receptors modulate hippocampal synaptic plasticity and neurogenesis [ 38 ] , while 5-HT6 receptors influence cognitive processing and memory [ 39 ] . Together, increased hippocampal serotonin levels and upregulated receptor expression may enhance serotonergic neurotransmission, potentially contributing to improved synaptic plasticity and cognitive function. Correlation analysis revealed positive associations between gut bacterial abundance ( Duncaniella , Ligilactobacillus ), fecal SCFA levels, serum 5-HTP, and hippocampal serotonin levels, supporting the proposed gut-brain axis pathway. However, these correlations do not establish causation, and mechanistic validation studies are needed. 5 Conclusion This study demonstrates that dietary phosphatidylcholine (PC) improves age-related cognitive decline through modulation of the gut microbiota-SCFA-serotonin axis. PC treatment reduced hippocampal neuroinflammation and oxidative stress, restored intestinal barrier integrity, and enriched SCFA-producing bacteria. Specifically, PC enriched Duncaniella and Ligilactobacillus , leading to increased fecal butyrate and propionate levels, which correlated with improved barrier function. Furthermore, increased fecal SCFAs correlated with elevated intestinal and serum 5-HTP levels, and hippocampal 5-HTP and serotonin levels. PC also upregulated hippocampal expression of serotonin receptors (5-HT1A and 5-HT6), which may contribute to enhanced serotonergic neurotransmission and improved cognitive performance. Preventive PC supplementation showed greater efficacy than therapeutic treatment in several outcomes, suggesting potential benefits of early intervention. These findings support PC as a potential dietary strategy for maintaining cognitive function in aging by targeting the gut-brain axis. However, the correlational nature of these findings necessitates further mechanistic validation studies to confirm causal relationships and evaluate translational potential. Declarations Conflicts of interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Author Contribution Chong Yuan: writing-original draft, visualization, validation, and methodology. Na Wang: writing-review & editing, project administration. Kunmiao He: software and formal analysis. Tiantian Xu: writing-review & editing and methodology. Hanshuo Wang: methodology, data curation. Hongtao Ren: methodology and investigation. Shuangjuan Xue: data curation. Qiuying Yu: software, and methodology. Linlin Chen: writing-review & editing, resources, data curation, methodology, and funding acquisition. Gaiping Zhang: project administration. Acknowledgements This research was funded by the Innovation and Ecological Support Special Project of Henan Province (HARS-22-05-Z1) and the Key Scientific and Technological Project of Henan Province (242102320264). Data Availability Data for this article are available at Science Date Bank at https://doi.org/10.57760/sciencedb.12131. References Zarocostas J. The UN reports global asymmetries in population growth[J]. Lancet, 2022, 400(10347): 148–148. Shen K Y, Shi Y, Wang X, et al. Cellular Components of the Blood-Brain Barrier and Their Involvement in Aging-Associated Cognitive Impairment[J]. Aging and Disease, 2025, 16(3): 1513–1534. Petersen R C, Caracciolo B, Brayne C, et al. Mild cognitive impairment: a concept in evolution[J]. Journal of Internal Medicine, 2014, 275(3): 214–228. Han Y, Quan X P, Chuang Y C, et al. A multi-omics analysis for the prediction of neurocognitive disorders risk among the elderly in Macao[J]. Clinical and Translational Medicine, 2022, 12(6): 18. Boche D, Perry V H, Nicoll J A R. Review: Activation patterns of microglia and their identification in the human brain[J]. Neuropathology and Applied Neurobiology, 2013, 39(1): 3–18. Heneka M T, Kummer M P, Latz E. Innate immune activation in neurodegenerative disease[J]. Nature Reviews Immunology, 2014, 14(7): 463–477. Franceschi C, Garagnani P, Parini P, et al. Inflammaging: a new immune-metabolic viewpoint for age-related diseases[J]. Nature Reviews Endocrinology, 2018, 14(10): 576–590. Erny D, de Angelis A L H, Jaitin D, et al. Host microbiota constantly control maturation and function of microglia in the CNS[J]. Nature Neuroscience, 2015, 18(7): 965-+. Agirman G, Hsiao E Y. SnapShot: The microbiota-gut-brain axis[J]. Cell, 2021, 184(9): 2524–2525. Koh A, De Vadder F, Kovatcheva-Datchary P, et al. From Dietary Fiber to Host Physiology: Short-Chain Fatty Acids as Key Bacterial Metabolites[J]. Cell, 2016, 165(6): 1332–1345. Brown A J, Goldsworthy S M, Barnes A A, et al. The orphan G protein-coupled receptors GPR41 and GPR43 are activated by propionate and other short chain carboxylic acids[J]. Journal of Biological Chemistry, 2003, 278(13): 11312–11319. Smith P M, Howitt M R, Panikov N, et al. The Microbial Metabolites, Short-Chain Fatty Acids, Regulate Colonic Treg Cell Homeostasis[J]. Science, 2013, 341(6145): 569–573. Gershon M D, Tack J. The serotonin signaling system: From basic understanding to drug development-for functional GI disorders[J]. Gastroenterology, 2007, 132(1): 397–414. Wall R, Cryan J F, Ross R P, et al. Bacterial Neuroactive Compounds Produced by Psychobiotics[M]. Lyte M, Cryan J F. Microbial Endocrinology: The Microbiota-Gut-Brain Axis in Health and Disease. New York: Springer, 2014: 221–239. Yano J M, Yu K, Donaldson G P, et al. Indigenous Bacteria from the Gut Microbiota Regulate Host Serotonin Biosynthesis[J]. Cell, 2015, 161(2): 264–276. Qi Q Q, Chu M J, Yu X T, et al. Anthocyanins and Proanthocyanidins: Chemical Structures, Food Sources, Bioactivities, and Product Development[J]. Food Reviews International, 2023, 39(7): 4581–4609. Chen X Y, Liu S, Song H, et al. Evaluation of biological activity and prebiotic properties of proanthocyanidins with different degrees of polymerization through simulated digestion and in vitro fermentation by human fecal microbiota[J]. Food Chemistry, 2024, 447: 11. Zhu W, Oteiza P. Proanthocyanidins at the gastrointestinal tract: mechanisms involved in their capacity to mitigate obesity-associated metabolic disorders[J]. Critical Reviews in Food Science and Nutrition, 2024, 64(2): 220–240. Feng Q, Xia W K, Dai G X, et al. The Aging Features of Thyrotoxicosis Mice: Malnutrition, Immunosenescence and Lipotoxicity[J]. Frontiers in Immunology, 2022, 13: 23. Archana, Gupta A K, Noumani A, et al. Gut microbiota derived short-chain fatty acids in physiology and pathology: An update[J]. Cell Biochemistry and Function, 2024, 42(7): 17. Sheng K L, Yang J, Xu Y F, et al. Alleviation effects of grape seed proanthocyanidin extract on inflammation and oxidative stress in a d-galactose-induced aging mouse model by modulating the gut microbiota[J]. Food & Function, 2022, 13(3): 1348–1359. Cheng N Y, Barfoot K L, Le Cozannet R, et al. Wild Blueberry Extract Intervention in Healthy Older Adults: A Multi-Study, Randomised, Controlled Investigation of Acute Cognitive and Cardiovascular Effects[J]. Nutrients, 2024, 16(8): 19. Jiang X, Liu J, Lin Q, et al. Proanthocyanidin prevents lipopolysaccharide-induced depressive-like behavior in mice via neuroinflammatory pathway[J]. Brain Research Bulletin, 2017, 135: 40–46. Bashir N, Manoharan V, Miltonprabu S. Grape seed proanthocyanidins protects against cadmium induced oxidative pancreatitis in rats by attenuating oxidative stress, inflammation and apoptosis via Nrf-2/HO-1 signaling[J]. Journal of Nutritional Biochemistry, 2016, 32: 128–141. Gou H Z, Zhang Y L, Ren L F, et al. How do intestinal probiotics restore the intestinal barrier?[J]. Frontiers in Microbiology, 2022, 13: 11. D'Amato A, Mannelli L D, Lucarini E, et al. Faecal microbiota transplant from aged donor mice affects spatial learning and memory via modulating hippocampal synaptic plasticity- and neurotransmission-related proteins in young recipients[J]. Microbiome, 2020, 8(1): 19. Hosoi T, Okuma Y, Matsuda T, et al. Novel pathway for LPS-induced afferent vagus nerve activation: Possible role of nodose ganglion[J]. Autonomic Neuroscience-Basic & Clinical, 2005, 120(1–2): 104–107. Liu W X, Xie J W, Jiang H L, et al. Mannose attenuates intestinal epithelial tight junction damage in experimental colitis mice by activating the AXIN-AMPK pathway[J]. International Immunopharmacology, 2024, 127: 10. Chen X X, Wu J L, Fu X, et al. Fructus mori polysaccharide alleviates diabetic symptoms by regulating intestinal microbiota and intestinal barrier against TLR4/NF-κB pathway[J]. International Journal of Biological Macromolecules, 2023, 249: 14. Mehta M, Louissaint J, Parikh N S, et al. Cognitive Function, Sarcopenia, and Inflammation Are Strongly Associated with Frailty: A Framingham Cohort Study[J]. American Journal of Medicine, 2021, 134(12): 1530–1538. Zhu Y Q, Chen B R, Zhang X Y, et al. Exploration of the Muribaculaceae Family in the Gut Microbiota: Diversity, Metabolism, and Function[J]. Nutrients, 2024, 16(16): 14. Wang Z F, Wang C, Yuan B Y, et al. Akkermansia muciniphila and its metabolite propionic acid maintains neuronal mitochondrial division and autophagy homeostasis during Alzheimer's disease pathologic process via GPR41 and GPR43[J]. Microbiome, 2025, 13(1). Liu P, Zhang M R, Liu T Y, et al. Avenanthramide Improves Colonic Damage Induced by Food Allergies in Mice through Altering Gut Microbiota and Regulating Hsp70-NF-κB Signaling[J]. Nutrients, 2023, 15(4): 18. Kwon Y H, Wang H Q, Denou E, et al. Modulation of Gut Microbiota Composition by Serotonin Signaling Influences Intestinal Immune Response and Susceptibility to Colitis[J]. Cellular and Molecular Gastroenterology and Hepatology, 2019, 7(4): 709–728. Engevik M A, Luck B, Visuthranukul C, et al. Human-Derived Bifidobacterium dentium Modulates the Mammalian Serotonergic System and Gut-Brain Axis[J]. Cellular and Molecular Gastroenterology and Hepatology, 2021, 11(1): 221–248. Grifka-Walk H M, Jenkins B R, Kominsky D J. Amino Acid Trp: The Far Out Impacts of Host and Commensal Tryptophan Metabolism[J]. Frontiers in Immunology, 2021, 12: 14. Chang P, Ma J W, Li K, et al. 5-Hydroxytryptophan artificial synaptic vesicles across the blood-brain barrier for the rapid-acting treatment of depressive disorder[J]. Materials Today Bio, 2024, 29: 14. Levitt E S, Hunnicutt B J, Knopp S J, et al. A selective 5-HT1a receptor agonist improves respiration in a mouse model of Rett syndrome[J]. Journal of Applied Physiology, 2013, 115(11): 1626–1633. Woods S, Clarke N N, Layfield R, et al. 5-HT6 receptor agonists and antagonists enhance learning and memory in a conditioned emotion response paradigm by modulation of cholinergic and glutamatergic mechanisms[J]. British Journal of Pharmacology, 2012, 167(2): 436–449. Additional Declarations No competing interests reported. Supplementary Files floatimage1.png Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 20 Feb, 2026 Reviews received at journal 19 Feb, 2026 Reviews received at journal 18 Feb, 2026 Reviews received at journal 17 Feb, 2026 Reviewers agreed at journal 13 Feb, 2026 Reviewers agreed at journal 10 Feb, 2026 Reviewers agreed at journal 09 Feb, 2026 Reviewers agreed at journal 08 Feb, 2026 Reviewers invited by journal 08 Feb, 2026 Editor assigned by journal 07 Feb, 2026 Submission checks completed at journal 07 Feb, 2026 First submitted to journal 05 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8795494","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":589777155,"identity":"801960af-f460-49a8-9ec9-f3fb6ed35d48","order_by":0,"name":"Chong Yuan","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Chong","middleName":"","lastName":"Yuan","suffix":""},{"id":589777156,"identity":"21767d99-cce7-4434-bd1e-62b011b15560","order_by":1,"name":"Na Wang","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Na","middleName":"","lastName":"Wang","suffix":""},{"id":589777157,"identity":"453f3814-dd79-45fb-8316-e70a0ad340c2","order_by":2,"name":"Kunmiao He","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Kunmiao","middleName":"","lastName":"He","suffix":""},{"id":589777158,"identity":"07c8da50-e287-4321-82f0-9fcf68a2a2a7","order_by":3,"name":"Tiantian Xu","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Tiantian","middleName":"","lastName":"Xu","suffix":""},{"id":589777159,"identity":"b49fc38a-0e36-495c-a08e-2988eb22a04e","order_by":4,"name":"Hanshuo Wang","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Hanshuo","middleName":"","lastName":"Wang","suffix":""},{"id":589777166,"identity":"5f44f5de-0226-42d6-924c-5b55559d0dc6","order_by":5,"name":"Hongtao Ren","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Hongtao","middleName":"","lastName":"Ren","suffix":""},{"id":589777167,"identity":"3f92289f-0d06-4dfd-aec3-21bb279adfa2","order_by":6,"name":"Shuangjuan Xue","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Shuangjuan","middleName":"","lastName":"Xue","suffix":""},{"id":589777169,"identity":"f0f7c273-ec76-4055-91e5-0b79c74d0b94","order_by":7,"name":"Qiuying Yu","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Qiuying","middleName":"","lastName":"Yu","suffix":""},{"id":589777174,"identity":"71cdc238-f888-4fd4-90a9-38b7de8f2b4a","order_by":8,"name":"Linlin Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7ElEQVRIie3PMUvDUBDA8QuBN1196wuG9ivcpAhFv8pJIC6Bduz4IODkB4j4PZwvBDoVXYV2iEvnZCkUSmkEC0Lta90c3h/edj/eHYDP9x8z3asJYgWBFZ4MUWt7BmECVBCWUs/SOCrkHAKAACopPx+rIVl2C/2ST2seL/Di8omE1TsSSNC0meOTxfSBmJao4llHcI7XoQ2j59fjhEx2ZZgqVCbriJnjjRUV9pxktPpB6A2/1jtBMvVNUhZmOU3MR7pfLBFhSTAqytx5iy6SpWk2VX9Q3Oftent7p3VeNq2D/FZg/zbv8/l8voN2beVSggZ+Gl8AAAAASUVORK5CYII=","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Linlin","middleName":"","lastName":"Chen","suffix":""},{"id":589777176,"identity":"5965d68c-4f55-4e2e-8872-959a230031c5","order_by":9,"name":"Gaiping Zhang","email":"","orcid":"","institution":"Peking University","correspondingAuthor":false,"prefix":"","firstName":"Gaiping","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2026-02-05 10:12:31","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8795494/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8795494/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":102489482,"identity":"6d94431b-aff7-4ebf-9eec-2f19696c5716","added_by":"auto","created_at":"2026-02-12 08:26:35","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1488798,"visible":true,"origin":"","legend":"\u003cp\u003ePC improves cognition and attenuates hippocampal neuroinflammation in aging mice\u003cbr\u003e\n \u003cstrong\u003e(A)\u003c/strong\u003e Representative heat maps of swimming trajectories during the Morris water maze probe trial. \u003cstrong\u003e(B)\u003c/strong\u003e Representative immunofluorescence images of the hippocampal dentate gyrus showing GFAP (green, astrocyte marker) and IBA-1 (red, microglia marker) expression. Nuclei were counterstained with DAPI (blue). Scale bar, 50 μm. \u003cstrong\u003e(C)\u003c/strong\u003e Quantification of swimming distance and time in the target quadrant during the probe trial. \u003cstrong\u003e(D)\u003c/strong\u003e Quantification of GFAP and IBA-1 expression in hippocampal tissues. \u003cstrong\u003e(E)\u003c/strong\u003e Hippocampal mRNA expression of pro-inflammatory cytokines (IL-1β, IL-6, TNF-α, and MCP-1). Data are presented as mean ± SEM (n = 3/group). *, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs NC; #, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; ##, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs Model; +, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; ++, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, Prevent vs Treatment; ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8795494/v1/9406dc646b64168a99676708.png"},{"id":102489632,"identity":"a94dba5a-839a-468d-b160-fc81f1613acb","added_by":"auto","created_at":"2026-02-12 08:27:06","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":835805,"visible":true,"origin":"","legend":"\u003cp\u003ePC attenuates oxidative stress and intestinal inflammation in aging mice\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Serum levels of oxidative stress markers: total antioxidant capacity (T-AOC), superoxide dismutase (SOD) activity, malondialdehyde (MDA), and reduced glutathione (GSH). \u003cstrong\u003e(B)\u003c/strong\u003e Colonic mRNA expression of pro-inflammatory cytokines (IL-1β, IL-6, TNF-α, and MCP-1) determined by qRT-PCR. \u003cstrong\u003e(C)\u003c/strong\u003e Schematic of experimental design and workflow. Data are presented as mean ± SEM (n = 3/group). *, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs NC; #, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; ##, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs Model; +, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; ++, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, Prevent vs Treatment; ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8795494/v1/35c2a0ac359e6d956c7c6343.png"},{"id":102489584,"identity":"42edb52d-7ad7-4f9b-b408-9b3985d6f59c","added_by":"auto","created_at":"2026-02-12 08:26:59","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1801757,"visible":true,"origin":"","legend":"\u003cp\u003ePC restores intestinal barrier integrity in aging mice\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Representative immunofluorescence images of tight junction proteins (Occludin, Claudin-1, and ZO-1) in colonic epithelium from NC, Model, Prevent, and Treatment groups. Nuclei were counterstained with DAPI (blue). Merge shows multi-channel overlay. \u003cstrong\u003e(B)\u003c/strong\u003e Quantification of Claudin-1, Occludin, and ZO-1 expression in colonic epithelium. \u003cstrong\u003e(C)\u003c/strong\u003e Quantification of colonic crypt depth and villus length. \u003cstrong\u003e(D)\u003c/strong\u003e Serum barrier dysfunction markers: C-reactive protein (CRP), lipopolysaccharide (LPS), and FITC-dextran permeability. Data are presented as mean ± SEM (n = 3/group).*, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01 vs NC; #, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; ##, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs Model; +, \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05; ++, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, Prevent vs Treatment; ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8795494/v1/b688aa6081ecf0ac23312f32.png"},{"id":102489544,"identity":"1131d669-0d21-463e-9320-ef55efe03fd2","added_by":"auto","created_at":"2026-02-12 08:26:48","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":405344,"visible":true,"origin":"","legend":"\u003cp\u003ePC increases fecal short-chain fatty acid production in aging mice\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Principal component analysis (PCA) of fecal SCFA profiles. \u003cstrong\u003e(B)\u003c/strong\u003e Heatmap showing relative abundance of seven SCFAs across groups. \u003cstrong\u003e(C)\u003c/strong\u003e Volcano plots of differential SCFAs in Model vs NC, Prevent vs Model, and Treatment vs Model comparisons. \u003cstrong\u003e(D)\u003c/strong\u003e Radar chart of SCFA expression patterns. \u003cstrong\u003e(E)\u003c/strong\u003eQuantification of fecal acetate, propionate, butyrate, valerate, and hexanoate levels. Data are presented as mean ± SEM (n = 3/group).*, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs NC; #, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; ##, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs Model; +, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; ++, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, Prevent vs Treatment; ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8795494/v1/03f8b6ddb16df4bd7a18df60.png"},{"id":102489662,"identity":"faa7799f-1d71-4781-91e2-4962feed4bbe","added_by":"auto","created_at":"2026-02-12 08:27:11","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":767601,"visible":true,"origin":"","legend":"\u003cp\u003ePC modulates gut microbiota composition in aging mice\u003cbr\u003e\n \u003cstrong\u003e(A)\u003c/strong\u003e Rarefaction curves showing alpha diversity (Shannon index) across groups. \u003cstrong\u003e(B)\u003c/strong\u003e Principal coordinate analysis (PCoA) based on Bray-Curtis dissimilarity showing beta diversity. \u003cstrong\u003e(C)\u003c/strong\u003e Relative abundance of gut microbiota at phylum (upper) and genus (lower) levels. \u003cstrong\u003e(D)\u003c/strong\u003e Correlation network between bacterial genera and fecal SCFAs. Green lines, positive correlations; red lines, negative correlations. Color intensity indicates Pearson correlation coefficient magnitude. \u003cstrong\u003e(E)\u003c/strong\u003e Relative abundance of Firmicutes and Bacteroidota, and Firmicutes/Bacteroidota (F/B) ratio. \u003cstrong\u003e(F)\u003c/strong\u003eRelative abundance of \u003cem\u003eLigilactobacillus\u003c/em\u003e and \u003cem\u003eDuncaniella\u003c/em\u003e. Data are presented as mean ± SEM (n = 3/group).*, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs NC; #, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; ##, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs Model; +, \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05; ++, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, Prevent vs Treatment; ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8795494/v1/72e35a1b4602a1a88d8fb0d9.png"},{"id":102489539,"identity":"2b8a088a-631a-46cd-ae42-6adaca3fbc7e","added_by":"auto","created_at":"2026-02-12 08:26:46","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":361983,"visible":true,"origin":"","legend":"\u003cp\u003ePC increases intestinal and hippocampal serotonin synthesis in aging mice\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Serotonin (5-HT) levels in colon, hippocampus, and serum.\u003cstrong\u003e(B)\u003c/strong\u003e 5-hydroxytryptophan (5-HTP) levels in colon, hippocampus, and serum. \u003cstrong\u003e(C)\u003c/strong\u003e Colonic and hippocampal mRNA expression of aromatic L-amino acid decarboxylase (AADC). \u003cstrong\u003e(D)\u003c/strong\u003e Colonic mRNA expression of tryptophan hydroxylase 1 (TPH1). \u003cstrong\u003e(E)\u003c/strong\u003e Hippocampal mRNA expression of tryptophan hydroxylase 2 (TPH2). \u003cstrong\u003e(F)\u003c/strong\u003eHippocampal mRNA expression of serotonin receptors 5-HT1A and 5-HT6. \u003cstrong\u003e(G)\u003c/strong\u003eSpearman correlation analysis between gut microbiota abundance, fecal SCFA levels, and serum/hippocampal 5-HTP levels. Data are presented as mean ± SEM (n = 3/group).*, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs NC; #, \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05; ##, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs Model; +, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; ++, \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01, Prevent vs Treatment; ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8795494/v1/bbfd7fda80c7e6687738d6f2.png"},{"id":102489991,"identity":"feec16ec-666a-4e22-8e2c-510bb183eaa4","added_by":"auto","created_at":"2026-02-12 08:28:13","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6659378,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8795494/v1/64bffdb2-8498-4862-a651-2c6c528afeb3.pdf"},{"id":102489459,"identity":"c360a5c9-aed1-4ccf-b9c8-ab4eec78e4c3","added_by":"auto","created_at":"2026-02-12 08:26:24","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3673039,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8795494/v1/2479676d9180472640dd8a14.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Dietary Proanthocyanidins Ameliorate Age-Related Cognitive Decline and Neuroinflammation in Mice via the Gut Microbiota-SCFAs-5-HTP Axis","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe global demographic structure is undergoing unprecedented transformation, with population aging accelerating worldwide. The global population aged\u0026thinsp;\u0026ge;\u0026thinsp;65 years is projected to rise from 10% (2022) to 16% by 2050\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. This demographic shift has precipitated a sharp rise in age-related cognitive decline (ARCD) prevalence. ARCD encompasses a continuum from subjective cognitive complaints to mild cognitive impairment, characterized by progressive deficits in memory, executive function, and processing speed, distinct from overt neurodegenerative diseases such as Alzheimer's disease\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. Large-scale epidemiological studies show that \u0026gt;\u0026thinsp;30% of community-dwelling older adults without dementia exhibit significant cognitive decline\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. ARCD represents a critical public health challenge\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e, impairing quality of life, functional independence, and social engagement while imposing substantial socioeconomic burdens on individuals and society. Consequently, developing effective interventions to prevent or ameliorate ARCD has become a global research priority in aging and public health.\u003c/p\u003e \u003cp\u003eResearch on cognitive aging has traditionally focused on neuronal degeneration. However, the past decade has witnessed a paradigm shift: neuroinflammation is now recognized as a central driver of cognitive decline\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. During aging, central nervous system resident immune cells (microglia and astrocytes) shift from homeostatic \"surveillance\" to persistently activated \"reactive\" phenotypes. This shift drives chronic low-grade release of pro-inflammatory cytokines (e.g., IL-1β, IL-6, TNF-α), chemokines, and reactive oxygen species, creating an \"inflammaging\" microenvironment\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. Chronic neuroinflammation impairs cognition through multiple mechanisms: degrading synaptic plasticity proteins and impairing long-term potentiation (LTP); disrupting neuronal metabolic homeostasis; promoting pathological protein accumulation (e.g., β-amyloid); and suppressing neurogenesis\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. A critical question remains: what triggers central neuroinflammation?\u003c/p\u003e \u003cp\u003eThe gut-brain axis concept provides a revolutionary framework for addressing this question. This axis comprises bidirectional communication pathways between the gut and brain, including neural (vagus nerve), endocrine (hypothalamic-pituitary-adrenal axis), immune, and metabolic routes\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. The gut microbiota serves as a central regulator, continuously signaling to the host via metabolite production. During aging, the gut microbiota undergoes dysbiosis, characterized by decreased α-diversity, depletion of beneficial bacteria (e.g., \u003cem\u003eBifidobacterium\u003c/em\u003e, \u003cem\u003eLactobacillus\u003c/em\u003e), expansion of potentially pathogenic taxa, and reduced functional stability\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. Gut dysbiosis impairs local intestinal homeostasis and, through multiple mechanisms, disrupts distant organ function, particularly in the brain.\u003c/p\u003e \u003cp\u003eAmong gut microbiota metabolites, short-chain fatty acids (SCFAs) play a central role. SCFAs are produced through dietary fiber fermentation by intestinal anaerobes, primarily acetate, propionate, and butyrate\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. Beyond serving as the primary energy source for colonocytes, SCFAs function as signaling molecules, exerting diverse physiological effects via G protein-coupled receptors (GPR41/43/109a) and histone deacetylase (HDAC) inhibition\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. During aging, gut dysbiosis reduces SCFA production\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e, contributing to multiple pathologies: impaired intestinal barrier integrity (reduced tight junction proteins, \"leaky gut\"), compromised regulatory T cell differentiation and immune tolerance, and disrupted hepatic glucose-lipid metabolism. Importantly, SCFAs cross the blood-brain barrier or indirectly modulate central nervous system function by influencing microglial maturation, suggesting their role as key gut-brain mediators.\u003c/p\u003e \u003cp\u003eThe serotonin (5-HT) system is central to learning, memory, and emotional regulation. Notably, ~\u0026thinsp;90% of the body's 5-HT is synthesized by intestinal enterochromaffin cells, with tryptophan hydroxylase 1 (TPH1) as the rate-limiting enzyme\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. Intestinal 5-HT synthesis is tightly regulated by gut microbiota and their metabolites. Although gut-derived 5-HT cannot cross the blood-brain barrier due to its polarity, its precursor 5-hydroxytryptophan (5-HTP) readily crosses via lipid solubility and is converted to brain 5-HT by aromatic L-amino acid decarboxylase (AADC)\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. Therefore, intestinal 5-HTP synthesis may represent a critical peripheral node regulating central serotonergic function. Interestingly, SCFAs, particularly butyrate, upregulate intestinal TPH1 expression\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e, suggesting a coherent \"microbiota-SCFAs-5-HTP\" axis.\u003c/p\u003e \u003cp\u003eProanthocyanidins (PC) are polyphenolic polymers widely distributed in grape seeds, blueberries, cocoa, and other plant-based foods. PC has attracted interest for its antioxidant and anti-inflammatory properties\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. Due to their high polymerization, PC are poorly absorbed in the upper gastrointestinal tract, reaching the colon largely intact where they interact extensively with gut microbiota, exhibiting prebiotic properties. Studies show that PC selectively enriches beneficial bacteria (e.g., \u003cem\u003eLactobacillus\u003c/em\u003e, \u003cem\u003eBifidobacterium\u003c/em\u003e), inhibits pathogens, and increases SCFA production\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. Furthermore, PC enhances intestinal barrier function and alleviates oxidative stress\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. Based on these properties, PC may improve cognitive function via gut-brain axis modulation. However, existing studies have examined these effects in isolation, lacking systematic investigation of whether and how PC ameliorates age-related cognitive impairment through the complete \"microbiota remodeling \u0026rarr; metabolite alteration \u0026rarr; neurotransmitter precursor synthesis \u0026rarr; cognitive improvement\" cascade.\u003c/p\u003e \u003cp\u003eWe hypothesized that dietary PC reshapes the disrupted gut microbiota in aging mice by enriching SCFA-producing bacteria and increasing butyrate production; these SCFAs repair the intestinal barrier and upregulate intestinal TPH1 expression, promoting 5-HTP synthesis; circulating 5-HTP crosses the blood-brain barrier, is converted to hippocampal 5-HT, activates serotonin receptors, and thereby alleviates neuroinflammation, enhances synaptic plasticity, and improves cognitive function. To test this hypothesis, we employed an aging mouse model and integrated behavioral, histopathological, molecular, microbiome, and metabolomic analyses to systematically elucidate the mechanisms underlying PC's amelioration of ARCD and provide a mechanistic foundation for developing precision nutrition strategies targeting the gut-brain axis.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"2 Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Animals and Ethics\u003c/h2\u003e \u003cp\u003eSix-week-old female SPF-grade BALB/c mice were obtained from Henan Provincial Laboratory Animal Center (License No. SCXK(Yu)2022-0001). Mice were housed in a specific pathogen-free (SPF) facility at the Animal Immunology Laboratory, Henan Academy of Agricultural Sciences, under standard conditions (22\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C, 50\u0026thinsp;\u0026plusmn;\u0026thinsp;10% humidity, 12-h light/dark cycle) with \u003cem\u003ead libitum\u003c/em\u003e access to food and water. All procedures were approved by the Animal Ethics Committee of Henan Agricultural University (Approval No. HNND2024031107) and conducted in accordance with the 3R principles.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Experimental Design\u003c/h2\u003e \u003cp\u003eAfter one week of acclimation, mice were randomly assigned to four groups (n\u0026thinsp;=\u0026thinsp;9/group):\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eControl group (NC)\u003c/strong\u003e \u003cp\u003edistilled water daily for 8 weeks;\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eAging model group (Model)\u003c/strong\u003e \u003cp\u003ethyroxine (Th, 320 mg/kg/day) for 8 weeks;\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003ePC prevention group (Prevent)\u003c/strong\u003e \u003cp\u003ePC (100 mg/kg/day) followed 8 h later by Th (320 mg/kg/day) for 8 weeks;\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003ePC intervention group (Treatment)\u003c/strong\u003e \u003cp\u003eTh (320 mg/kg/day) followed 8 h later by PC (100 mg/kg/day) for 8 weeks.\u003c/p\u003e \u003c/p\u003e \u003cp\u003ePC (grape seed proanthocyanidins, \u0026ge;\u0026thinsp;95% purity, Lot No. IYT7499) was obtained from Beijing Solarbio Science \u0026amp; Technology Co., Ltd., and Th was purchased from Renhe Pharmaceutical Co., Ltd. Dosages were determined based on preliminary experiments and literature\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. All mice received oral gavage administration. The experimental timeline is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Morris Water Maze Test\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe Morris water maze test was conducted following the 8-week intervention to assess spatial learning and memory. The apparatus consisted of a circular pool (120 cm diameter, 40 cm height) divided into four quadrants, filled with water maintained at 25\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C. Place navigation training was conducted for 5 consecutive days (4 trials/day). In each trial, mice were placed into the water facing the pool wall from pseudo-random start locations in different quadrants. Escape latency (time to locate the hidden platform; maximum 60 s) was recorded. The platform (10 cm diameter) was submerged 1 cm below the water surface in the target quadrant. Mice that found the platform remained on it for 15 s; those failing to find it within 60 s were gently guided to the platform and allowed to remain for 15 s. On day 6, a spatial probe trial was conducted with the platform removed. Mice were released from the quadrant opposite the original platform location, and the following parameters were recorded during a 90-s test: number of platform crossings, time in the target quadrant, and total swimming distance. All behavioral data were recorded and analyzed using a video tracking system (DeepLabCut).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Sample Collection\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eFollowing behavioral testing, mice were fasted for 4 h with \u003cem\u003ead libitum\u003c/em\u003e access to water. Mice were then anesthetized with sodium pentobarbital (50 mg/kg, 1% solution, intraperitoneal injection). Blood was collected via the orbital venous plexus, allowed to clot at room temperature for 30 min, and centrifuged at 3,000 \u0026times; \u003cem\u003eg\u003c/em\u003e for 15 min at 4\u0026deg;C. Serum was separated, aliquoted, and stored at -80\u0026deg;C. Brains were rapidly removed and bilateral hippocampi were dissected on ice. Half of each hippocampus was fixed in 4% paraformaldehyde for histological analysis; the other half was snap-frozen in liquid nitrogen and stored at -80\u0026deg;C for molecular analyses. Colon segments were collected; portions were fixed in 4% paraformaldehyde and portions were snap-frozen in liquid nitrogen and stored at -80\u0026deg;C. Fresh fecal samples were collected before euthanasia, immediately snap-frozen in liquid nitrogen, and stored at -80\u0026deg;C for microbiome and metabolomic analyses.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Immunofluorescence\u003c/h2\u003e \u003cp\u003eFixed hippocampal and colonic tissues were paraffin-embedded and sectioned at 5 \u0026micro;m. Sections were deparaffinized, rehydrated, and antigen retrieval was performed in sodium citrate buffer (pH 6.0, 95\u0026deg;C, 15 min). Sections were blocked with 10% goat serum containing 0.3% Triton X-100 for 1 h at room temperature, then incubated overnight at 4\u0026deg;C with primary antibodies against IBA-1, GFAP, Occludin, ZO-1, and Claudin-1 (Wuhan Sanying Biotechnology Co., Ltd.). After PBS washes, sections were incubated with appropriate fluorescent secondary antibodies for 1 h at room temperature in darkness. Nuclei were counterstained with DAPI. After mounting with anti-fade medium, sections were visualized using a fluorescence microscope. For each section, three non-overlapping fields were randomly selected from the hippocampal CA1 region or colonic mucosa, and mean fluorescence intensity was quantified using ImageJ software (NIH, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Quantitative Real-Time PCR (qRT-PCR)\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from hippocampal and colonic tissues using TRIzol reagent (Invitrogen). RNA concentration and purity were assessed using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific); samples with A260/A280 ratios of 1.8\u0026ndash;2.0 were used for downstream analysis. One microgram of total RNA was reverse-transcribed to cDNA using the PrimeScript RT Reagent Kit (Beijing Quanshijin Biotechnology Co., Ltd.). qRT-PCR was performed using a LightCycler 480 II system (Roche) with SYBR Premix Ex Taq II (Vazyme Biotech Co., Ltd.). The 20 \u0026micro;L reaction mixture contained 2 \u0026micro;L cDNA template, 0.4 \u0026micro;L each primer (10 \u0026micro;M), 10 \u0026micro;L SYBR Green Mix, and 7.2 \u0026micro;L nuclease-free water. Thermal cycling conditions were: 95\u0026deg;C for 30 s, followed by 35 cycles of 95\u0026deg;C for 5 s and 60\u0026deg;C for 30 s. β-actin served as the reference gene, and relative expression was calculated using the 2^(-ΔΔCt) method. Primer sequences are provided in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for qRT-PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Primer (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIL-1β\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCGCAGCAGCACATCAACAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAGCCCTCCATTCCTGAAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIL-6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGAGGAGACTTCACAGAGGATACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCATTTCCACGATTTCCCAGAGAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTNF-α\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACGCTCTTCTGTCTACTGAACTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTGGTGGTTTGTGAGTGTGAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMCP-1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTACTATTCCTGATGGCACTTCTCTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAACCTCTGTCCGTGATGATCTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAADC\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCTCTTCAGTTCGCAGAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATCAGGGGCCGAAGATAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTPH1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACAAAGACCATTCCTCCGAAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTAACAGGCTCACATGATTCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTPH2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCAAGACAGCGGTAGTGTTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGTCCACGAAGATTTCGACTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003e5-HT1a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTACGTGAACAAGAGGACGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACTCGATGCACCTCGATCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003e5-HT6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGGCAAAGCTCGAACATCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCACCTCCCACTCTTAGGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eβ-actin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGCATTGTTACCAACTGGGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCACGGTTGGCCTTAGGGTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Biochemical Assays and ELISA\u003c/h2\u003e \u003cp\u003eAll assays were performed according to the manufacturers' protocols. The following parameters were determined: \u003cb\u003eOxidative stress markers\u003c/b\u003e: Serum levels of total antioxidant capacity (T-AOC), superoxide dismutase (SOD), malondialdehyde (MDA), and glutathione (GSH) were measured using commercial kits (Nanjing Jiancheng Bioengineering Institute). \u003cb\u003eInflammatory and barrier markers\u003c/b\u003e: Serum lipopolysaccharide (LPS) and C-reactive protein (CRP) were measured using ELISA kits (Shanghai Enzyme-linked Biotechnology Co., Ltd.). \u003cb\u003eNeurotransmitters and precursors\u003c/b\u003e: Levels of 5-HT and 5-HTP in serum, hippocampal homogenates, and colonic homogenates were measured using ELISA kits (Shanghai Enzyme-linked Biotechnology Co., Ltd.). All samples were assayed in triplicate, and data are presented as mean values.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Intestinal Permeability Assay\u003c/h2\u003e \u003cp\u003eOne week before the end of the intervention, 6 mice per group were randomly selected for this assay. After 4 h of fasting, mice were orally gavaged with FITC-dextran (4 kDa, 600 mg/kg body weight, dissolved in PBS; Sigma-Aldrich, USA). Four hours later, mice were anesthetized and blood was collected via cardiac puncture; serum was then separated by centrifugation. Serum fluorescence intensity was measured using a fluorescence microplate reader (excitation 485 nm, emission 528 nm), and FITC-dextran concentrations were calculated from a standard curve.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 16S rRNA Gene Sequencing and Microbiome Analysis\u003c/h2\u003e \u003cp\u003eFecal microbial DNA was extracted using the QIAamp DNA Stool Mini Kit (QIAGEN, Germany). The V3-V4 hypervariable region of the 16S rRNA gene was amplified using universal primers 338F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3'). After purification, PCR amplicons were sequenced on an Illumina MiSeq platform (2 \u0026times; 300 bp paired-end; Shanghai Personalbio Biotechnology Co., Ltd.).\u003c/p\u003e \u003cp\u003eRaw sequencing data were processed using QIIME2 (v2020.6). Quality filtering and denoising were performed with DADA2 to generate amplicon sequence variants (ASVs). Taxonomic classification was performed against the SILVA 138 database. Alpha diversity was assessed using Chao1 richness and Shannon diversity indices. β-diversity was assessed by principal coordinates analysis (PCoA) based on Bray-Curtis dissimilarity, with significance tested using PERMANOVA. Differentially abundant taxa were identified using linear discriminant analysis effect size (LEfSe) with an LDA score threshold of 2.0 and P\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Short-Chain Fatty Acid Quantification\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eFecal samples (~\u0026thinsp;100 mg) were homogenized in 1 mL of 50% acetonitrile containing internal standard (2-ethylbutyric acid-d9, 10 \u0026micro;g/mL), vortexed for 2 min, and sonicated in an ice bath for 30 min. Samples were then centrifuged at 13,000 \u0026times; \u003cem\u003eg\u003c/em\u003e for 15 min at 4\u0026deg;C, and supernatants were collected. Supernatants were mixed with derivatization reagents [3-nitrophenylhydrazine (50 mg/mL) and EDC (120 mg/mL), both in 50% acetonitrile] at a 1:1:1 volume ratio and incubated at 40\u0026deg;C for 30 min. Derivatized samples were filtered through 0.22 \u0026micro;m membranes prior to LC-MS/MS analysis.\u003c/p\u003e \u003cp\u003eSCFA analysis was performed using a UHPLC-QTRAP 6500\u0026thinsp;+\u0026thinsp;system (AB Sciex). \u003cb\u003eChromatographic separation\u003c/b\u003e was achieved on a Phenomenex Kinetex C18 column (2.1 \u0026times; 100 mm, 1.7 \u0026micro;m) at 40\u0026deg;C with a mobile phase of (A) 0.1% formic acid in water and (B) 0.1% formic acid in acetonitrile. The gradient elution was: 0\u0026ndash;2 min, 5% B; 2\u0026ndash;8 min, 5\u0026ndash;50% B; 8\u0026ndash;12 min, 95% B; 12\u0026ndash;14 min, 5% B. The flow rate was 0.35 mL/min, and the injection volume was 5 \u0026micro;L. \u003cb\u003eMass spectrometry\u003c/b\u003e was performed in negative electrospray ionization (ESI-) mode with multiple reaction monitoring (MRM). The MRM transitions were: acetate (\u003cem\u003em/z\u003c/em\u003e 176 \u0026rarr; 132), propionate (190 \u0026rarr; 146), butyrate (204 \u0026rarr; 160), valerate (218 \u0026rarr; 174), and hexanoate (232 \u0026rarr; 188). SCFAs were quantified using the internal standard method with calibration curves prepared from authentic standards.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Statistical Analysis\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eData are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. Statistical analyses and data visualization were performed using GraphPad Prism 8.0, Graphical abstract and experimental flow charts were drawn via Biorender.com. For comparisons among multiple groups, one-way ANOVA followed by Tukey's honestly significant difference (HSD) post hoc test was used. Escape latency was analyzed using two-way repeated measures ANOVA with group and time as factors. Between-group differences in gut microbiota β-diversity were assessed using permutational multivariate analysis of variance (PERMANOVA). Correlations were assessed using Pearson's correlation for normally distributed data and Spearman's rank correlation for non-normally distributed data. Multiple testing was corrected using the Benjamini-Hochberg false discovery rate (FDR) method. Statistical significance was set at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, with P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 indicating high significance.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"3 Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.1 PC Improves Spatial Learning and Memory in Aging Mice\u003c/h2\u003e \u003cp\u003eTo assess the effects of PC on age-related cognitive decline, we performed behavioral, histological, and molecular evaluations. In the Morris water maze test, Model mice exhibited significant spatial memory impairment compared to NC mice, characterized by disorganized exploration trajectories, reduced time in the target quadrant, and decreased swimming distance (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, C). Both PC treatment groups (Treatment and Prevent) significantly reversed this impairment, with behavioral parameters approaching NC levels (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), indicating that PC improves spatial learning and memory in aging mice.\u003c/p\u003e \u003cp\u003eImmunofluorescence staining of the hippocampal dentate gyrus (DG) revealed significantly elevated GFAP (astrocyte marker) and IBA-1 (microglia marker) expression in Model mice (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), indicating excessive glial activation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, D). PC treatment (both Treatment and Prevent groups) significantly reduced GFAP and IBA-1 expression (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), indicating that PC attenuates glial activation and preserves neuronal homeostasis.\u003c/p\u003e \u003cp\u003eExcessive glial cell activation is a critical driver of neuroinflammation. Molecular-level analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE) demonstrated that the mRNA expression levels of pro-inflammatory cytokines IL-1β, IL-6, TNF-α, and MCP-1 in the hippocampus were significantly upregulated in the Model group compared with the NC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Following PC intervention, the expression of IL-1β, IL-6, and MCP-1 was significantly suppressed (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and TNF-α also showed a downward trend, indicating that PC can effectively alleviate neuroinflammatory responses in the aging brain.\u003c/p\u003e \u003cp\u003eIn summary, PC supplementation can ameliorate neuroinflammation by inhibiting abnormal activation of hippocampal astrocytes and microglia and downregulating the expression of key pro-inflammatory cytokines, thereby ultimately improving spatial learning and memory functions in aging mice. These findings suggest that PC may serve as a potential dietary intervention strategy for delaying age-related cognitive decline.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003e(A)\u003c/b\u003e Representative heat maps of swimming trajectories during the Morris water maze probe trial. \u003cb\u003e(B)\u003c/b\u003e Representative immunofluorescence images of the hippocampal dentate gyrus showing GFAP (green, astrocyte marker) and IBA-1 (red, microglia marker) expression. Nuclei were counterstained with DAPI (blue). Scale bar, 50 \u0026micro;m. \u003cb\u003e(C)\u003c/b\u003e Quantification of swimming distance and time in the target quadrant during the probe trial. \u003cb\u003e(D)\u003c/b\u003e Quantification of GFAP and IBA-1 expression in hippocampal tissues. \u003cb\u003e(E)\u003c/b\u003e Hippocampal mRNA expression of pro-inflammatory cytokines (IL-1β, IL-6, TNF-α, and MCP-1). Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM (n\u0026thinsp;=\u0026thinsp;3/group). *, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; **, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs NC; #, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; ##, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs Model; +, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; ++, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Prevent vs Treatment; ns, not significant.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.2 PC Attenuates Oxidative Stress and Intestinal Inflammation in Aging Mice\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eTo assess PC's effects on systemic oxidative stress and intestinal inflammation, we measured serum antioxidant markers and intestinal inflammatory parameters. Model mice exhibited significantly decreased serum T-AOC, SOD activity, and GSH levels, with elevated MDA content (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). These findings indicate impaired antioxidant defenses and oxidative stress in aging mice. Both PC treatment groups significantly increased serum T-AOC, SOD, and GSH levels and reduced MDA content (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), with parameters approaching NC levels. Notably, the Prevent group showed significantly higher T-AOC and GSH levels than the Treatment group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), suggesting that early PC intervention may be more effective in preserving redox homeostasis.\u003c/p\u003e \u003cp\u003eColonic mRNA expression of pro-inflammatory cytokines (IL-1β, IL-6, TNF-α, and MCP-1) was significantly upregulated in Model mice compared to NC (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), indicating intestinal inflammation in aging mice. Both PC treatment groups significantly reduced colonic expression of these cytokines (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), indicating that PC attenuates age-related intestinal inflammation.\u003c/p\u003e \u003cp\u003eIn summary, aging led to systemic oxidative stress and intestinal inflammation in mice. PC supplementation ameliorated these conditions by enhancing antioxidant defenses (increased T-AOC, SOD, and GSH; reduced MDA) and reducing colonic pro-inflammatory cytokine expression. Notably, the Prevent group showed superior effects in improving oxidative stress markers compared to the Treatment group, suggesting that early PC intervention may be more beneficial for preventing age-related oxidative damage and inflammation.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003e(A)\u003c/b\u003e Serum levels of oxidative stress markers: total antioxidant capacity (T-AOC), superoxide dismutase (SOD) activity, malondialdehyde (MDA), and reduced glutathione (GSH). \u003cb\u003e(B)\u003c/b\u003e Colonic mRNA expression of pro-inflammatory cytokines (IL-1β, IL-6, TNF-α, and MCP-1) determined by qRT-PCR. \u003cb\u003e(C)\u003c/b\u003e Schematic of experimental design and workflow. Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM (n\u0026thinsp;=\u0026thinsp;3/group). *, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; **, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs NC; #, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; ##, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs Model; +, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; ++, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Prevent vs Treatment; ns, not significant.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.3 PC Restores Intestinal Barrier Integrity in Aging Mice\u003c/h2\u003e \u003cp\u003eTo assess PC's effects on intestinal barrier function, we evaluated colonic tight junction proteins, tissue morphology, and barrier permeability. PC treatment effectively restored tight junction protein expression and barrier function in aging mice.\u003c/p\u003e \u003cp\u003eImmunofluorescence analysis revealed that expression of tight junction proteins (Claudin-1, ZO-1, and Occludin) in colonic epithelium was significantly reduced in Model mice compared to NC (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), with disrupted characteristic reticular distribution (Fig.\u0026nbsp;3A-B), indicating impaired tight junction integrity. Both PC treatment groups significantly increased expression of all three proteins (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), with restored continuous and orderly reticular distribution, indicating that PC preserves tight junction structure. Notably, the Prevent group showed a trend toward superior performance compared to the Treatment group in most indicators, suggesting that early PC intervention may be more effective in maintaining tight junction homeostasis.\u003c/p\u003e \u003cp\u003eHistological analysis revealed significant villus atrophy and reduced crypt depth in the colon of Model mice compared to NC (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), indicating mucosal atrophy (Fig.\u0026nbsp;3C). Both PC treatment groups significantly increased villus length and crypt depth (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), indicating that PC not only restores tight junction structures but also promotes overall intestinal epithelial integrity.\u003c/p\u003e \u003cp\u003eTo assess barrier function, we measured serum LPS and CRP levels, as well as FITC-dextran permeability. Model mice exhibited significantly elevated serum LPS and CRP levels (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), with increased FITC-dextran permeability (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), indicating impaired barrier function and \"leaky gut\" (Fig.\u0026nbsp;3D). Both PC treatment groups significantly reduced serum LPS, CRP, and FITC-dextran permeability (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), demonstrating that PC restores barrier function and reduces endotoxin translocation.\u003c/p\u003e \u003cp\u003eIn summary, PC ameliorated age-related intestinal barrier damage through multiple mechanisms: upregulating tight junction protein (Claudin-1, ZO-1, Occludin) expression, improving villus and crypt morphology, and reducing intestinal permeability. These findings provide experimental evidence that PC may serve as a dietary strategy to maintain intestinal barrier integrity and alleviate systemic inflammation in aging.\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eFigure 3. PC restores intestinal barrier integrity in aging mice\u003c/p\u003e\u003cp\u003e \u003cb\u003e(A)\u003c/b\u003e Representative immunofluorescence images of tight junction proteins (Occludin, Claudin-1, and ZO-1) in colonic epithelium from NC, Model, Prevent, and Treatment groups. Nuclei were counterstained with DAPI (blue). Merge shows multi-channel overlay. \u003cb\u003e(B)\u003c/b\u003e Quantification of Claudin-1, Occludin, and ZO-1 expression in colonic epithelium. \u003cb\u003e(C)\u003c/b\u003e Quantification of colonic crypt depth and villus length. \u003cb\u003e(D)\u003c/b\u003e Serum barrier dysfunction markers: C-reactive protein (CRP), lipopolysaccharide (LPS), and FITC-dextran permeability. Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM (n\u0026thinsp;=\u0026thinsp;3/group).*, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; **, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs NC; #, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; ##, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs Model; +, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; ++, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Prevent vs Treatment; ns, not significant.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.4 PC Modulates Gut Microbiota and Short-Chain Fatty Acid Production\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eTo assess PC's effects on gut microbial metabolites and microbiota composition, we measured fecal short-chain fatty acids (SCFAs) and performed 16S rRNA gene sequencing. SCFAs, as primary products of gut microbial fermentation, are key regulators of intestinal barrier integrity and immune homeostasis\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePrincipal component analysis (PCA) of SCFA profiles revealed distinct separation between Model and NC groups, indicating age-related metabolic alterations (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). The metabolic profiles of both PC treatment groups (Prevent and Treatment) shifted toward NC, suggesting that PC partially reverses age-related metabolic dysregulation.\u003c/p\u003e \u003cp\u003eModel mice exhibited significantly reduced fecal levels of multiple short-chain fatty acids (SCFAs), including acetate, propionate, butyrate, valerate, and hexanoate, compared to NC (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003eB-E), indicating impaired intestinal SCFA biosynthesis. Both PC treatment groups significantly increased fecal SCFA levels (all \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Notably, the Prevent group showed significantly higher butyrate and propionate levels compared to the Treatment group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), suggesting that early PC intervention is more effective in restoring these crucial metabolites.\u003c/p\u003e \u003cp\u003eIn summary, aging led to systemic decline in intestinal SCFA production, while PC intervention effectively enhanced SCFA abundance, particularly butyrate and propionate. These findings suggest that PC may improve intestinal barrier function through enhancing SCFA production, thereby providing energy for epithelial cells, strengthening tight junctions, and suppressing inflammation. The restoration of SCFA levels represents a key mechanistic link between PC intervention and intestinal barrier improvement.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003e(A)\u003c/b\u003e Principal component analysis (PCA) of fecal SCFA profiles. \u003cb\u003e(B)\u003c/b\u003e Heatmap showing relative abundance of seven SCFAs across groups. \u003cb\u003e(C)\u003c/b\u003e Volcano plots of differential SCFAs in Model vs NC, Prevent vs Model, and Treatment vs Model comparisons. \u003cb\u003e(D)\u003c/b\u003e Radar chart of SCFA expression patterns. \u003cb\u003e(E)\u003c/b\u003e Quantification of fecal acetate, propionate, butyrate, valerate, and hexanoate levels. Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM (n\u0026thinsp;=\u0026thinsp;3/group).*, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; **, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs NC; #, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; ##, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs Model; +, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; ++, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Prevent vs Treatment; ns, not significant.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.5 PC Modulates Gut Microbiota Composition\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eTo assess PC's effects on gut microbiota composition and diversity, we performed 16S rRNA gene sequencing. Alpha diversity analysis revealed that Model mice exhibited significantly reduced microbiota richness compared to NC, while both PC treatment groups (Prevent and Treatment) showed partial restoration of diversity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Principal coordinate analysis (PCoA) demonstrated distinct separation of microbiota structure between Model and NC groups, with PC intervention shifting the overall microbiota composition toward NC, indicating that PC can reverse age-related gut microbiota dysbiosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eAt the phylum level, Model mice showed significantly decreased Firmicutes and increased Bacteroidota relative abundance, resulting in a reduced Firmicutes/Bacteroidota (F/B) ratio (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, E). Both PC treatment groups significantly elevated the F/B ratio (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), indicating restoration of microbial ecological balance.\u003c/p\u003e \u003cp\u003eAt the genus level, PC treatment specifically promoted the proliferation of SCFA-producing bacteria. The abundance of key butyrate-producing genera, including \u003cem\u003eLigilactobacillus\u003c/em\u003e and \u003cem\u003eDuncaniella\u003c/em\u003e, was significantly decreased in Model mice compared to NC. Following PC supplementation, the abundance of both genera was significantly restored (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, F). Correlation analysis further revealed that the abundance of \u003cem\u003eLigilactobacillus\u003c/em\u003e and \u003cem\u003eDuncaniella\u003c/em\u003e exhibited significant positive correlations with fecal levels of acetate, propionate, and particularly butyrate (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eIn summary, PC reshaped the age-disrupted gut microbiota composition, with its core action lying in the specific enrichment of beneficial SCFA-producing bacteria such as \u003cem\u003eLigilactobacillus\u003c/em\u003e and \u003cem\u003eDuncaniella\u003c/em\u003e. The restoration of these functional bacteria directly contributed to increased intestinal SCFA biosynthesis, particularly butyrate, providing a microbiological explanation for the observed improvements in SCFA levels and intestinal barrier function.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003e(A)\u003c/b\u003e Rarefaction curves showing alpha diversity (Shannon index) across groups. \u003cb\u003e(B)\u003c/b\u003e Principal coordinate analysis (PCoA) based on Bray-Curtis dissimilarity showing beta diversity. \u003cb\u003e(C)\u003c/b\u003e Relative abundance of gut microbiota at phylum (upper) and genus (lower) levels. \u003cb\u003e(D)\u003c/b\u003e Correlation network between bacterial genera and fecal SCFAs. Green lines, positive correlations; red lines, negative correlations. Color intensity indicates Pearson correlation coefficient magnitude. \u003cb\u003e(E)\u003c/b\u003e Relative abundance of Firmicutes and Bacteroidota, and Firmicutes/Bacteroidota (F/B) ratio. \u003cb\u003e(F)\u003c/b\u003e Relative abundance of \u003cem\u003eLigilactobacillus\u003c/em\u003e and \u003cem\u003eDuncaniella\u003c/em\u003e. Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM (n\u0026thinsp;=\u0026thinsp;3/group).*, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; **, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs NC; #, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; ##, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs Model; +, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; ++, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Prevent vs Treatment; ns, not significant.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.6 PC Increases Intestinal and Hippocampal 5-HTP Synthesis\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eTo assess PC's effects on the serotonin (5-HT) synthesis pathway, we measured colonic and hippocampal expression of 5-HT synthesis enzymes and levels of 5-HT and its precursor 5-hydroxytryptophan (5-HTP).\u003c/p\u003e \u003cp\u003eColonic 5-HT synthesis that Model mice showed significantly reduced colonic mRNA expression of tryptophan hydroxylase 1 (TPH1) and aromatic L-amino acid decarboxylase (AADC), with decreased colonic 5-HTP and 5-HT levels (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eA\u0026ndash;D). Both PC treatment groups significantly increased TPH1 and AADC expression and restored colonic 5-HTP and 5-HT levels (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), with the Prevent group showing higher 5-HTP levels than the Treatment group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). In serum, Model mice exhibited significantly reduced serum 5-HT and 5-HTP levels (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Both PC treatment groups significantly increased serum 5-HT and 5-HTP concentrations (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eA\u0026ndash;C).\u003c/p\u003e \u003cp\u003eHippocampal 5-HT synthesis that Model mice showed reduced hippocampal expression of TPH2 and AADC, decreased 5-HTP and 5-HT levels, and reduced expression of 5-HT receptors (5-HT1A and 5-HT6) (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eA\u0026ndash;C, E, F). Both PC treatment groups significantly increased hippocampal TPH2, AADC, 5-HT1A, and 5-HT6 expression, and elevated hippocampal 5-HTP and 5-HT levels (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Spearman correlation analysis revealed that the abundance of \u003cem\u003eDuncaniella\u003c/em\u003e and fecal butyrate levels positively correlated with serum and hippocampal 5-HTP levels (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eG).\u003c/p\u003e \u003cp\u003eCollectively, PC increased intestinal 5-HT synthesis and serum 5-HTP availability, leading to enhanced hippocampal 5-HT synthesis and receptor expression. Correlation analysis suggests that gut microbiota modulation, particularly increased SCFA-producing bacteria, may contribute to enhanced 5-HT synthesis.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003e(A)\u003c/b\u003e Serotonin (5-HT) levels in colon, hippocampus, and serum.\u003cb\u003e(B)\u003c/b\u003e 5-hydroxytryptophan (5-HTP) levels in colon, hippocampus, and serum. \u003cb\u003e(C)\u003c/b\u003e Colonic and hippocampal mRNA expression of aromatic L-amino acid decarboxylase (AADC). \u003cb\u003e(D)\u003c/b\u003e Colonic mRNA expression of tryptophan hydroxylase 1 (TPH1). \u003cb\u003e(E)\u003c/b\u003e Hippocampal mRNA expression of tryptophan hydroxylase 2 (TPH2). \u003cb\u003e(F)\u003c/b\u003e Hippocampal mRNA expression of serotonin receptors 5-HT1A and 5-HT6. \u003cb\u003e(G)\u003c/b\u003e Spearman correlation analysis between gut microbiota abundance, fecal SCFA levels, and serum/hippocampal 5-HTP levels. Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM (n\u0026thinsp;=\u0026thinsp;3/group).*, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; **, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs NC; #, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; ##, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs Model; +, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; ++, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Prevent vs Treatment; ns, not significant.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThis study demonstrates that dietary phosphatidylcholine (PC) improves age-related cognitive decline through modulation of the gut microbiota-short-chain fatty acid (SCFA)-serotonin axis. Our findings reveal a multi-step pathway: PC supplementation enriches intestinal SCFA-producing bacteria (\u003cem\u003eLigilactobacillus\u003c/em\u003e and \u003cem\u003eDuncaniella\u003c/em\u003e), increases fecal butyrate and propionate levels, and enhances intestinal synthesis of 5-hydroxytryptophan (5-HTP). Elevated peripheral 5-HTP crosses the blood-brain barrier, leading to increased hippocampal serotonin synthesis and upregulation of serotonin receptors (5-HT1A and 5-HT6). These neurochemical changes are accompanied by reduced hippocampal neuroinflammation, improved intestinal barrier integrity, and enhanced spatial learning and memory. These results suggest that PC may represent a dietary strategy to maintain cognitive function in aging by targeting the gut-brain axis, though causal relationships require further validation.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e4.1 PC Improves Cognitive Function and Reduces Neuroinflammation\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003ePC supplementation significantly improved spatial learning and memory in aging mice, as demonstrated by enhanced performance in the Morris water maze. These findings are consistent with prior studies showing cognitive benefits of polyphenol-rich extracts, including grape seed proanthocyanidins in D-galactose-induced aging models\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e and blueberry polyphenols in individuals with mild cognitive impairment\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e Beyond behavioral improvements, our study reveals underlying neurobiological changes, including reduced hippocampal neuroinflammation and oxidative stress. PC treatment reduced microglial activation and decreased expression of pro-inflammatory cytokines (IL-1β, IL-6, TNF-α, MCP-1) in the hippocampus. Chronic low-grade neuroinflammation, or \"inflammaging,\" is a hallmark of brain aging that impairs synaptic plasticity and cognitive reserve\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. PC may exert direct anti-inflammatory effects through inhibition of NF-κB signaling and activation of the Nrf2/HO-1 antioxidant pathway\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. However, the strong correlation between PC's effects on intestinal barrier integrity and hippocampal inflammation suggests that gut-brain axis modulation may be a primary mechanism underlying PC's neuroprotective effects.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e4.2 PC Restores Intestinal Barrier Integrity and Reduces Systemic Inflammation\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eIntestinal barrier dysfunction, or \"leaky gut,\" is a hallmark of aging characterized by compromised tight junction integrity and increased intestinal permeability\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. In aging mice, we observed elevated serum LPS and CRP levels, decreased colonic expression of tight junction proteins (Claudin-1, Occludin, ZO-1), and increased intestinal permeability, confirming age-related barrier dysfunction. Increased gut permeability allows bacterial products such as LPS to enter systemic circulation, triggering inflammation through Toll-like receptor 4 (TLR4) activation. These peripheral inflammatory signals can reach the brain via multiple routes, including cytokine passage across the blood-brain barrier and vagal afferent pathways, potentially exacerbating hippocampal neuroinflammation\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. PC treatment significantly improved all markers of barrier dysfunction, including tight junction protein expression, serum LPS and CRP levels, and intestinal permeability. These findings are consistent with prior studies showing that prebiotics and bioactive compounds can enhance intestinal barrier function through AMPK activation or microbiota modulation and NF-κB inhibition\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. However, whether PC acts directly on intestinal epithelial cells or indirectly through modulation of the gut microbiota remains to be determined. Our data suggest that microbiota modulation may be a primary mechanism, as PC enriched SCFA-producing bacteria and increased fecal butyrate levels, both of which are known to enhance barrier integrity.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e4.3 PC Exerts Prebiotic-Like Functions to Reshape Microbiota and Drive SCFA Metabolism\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eGut microbiota dysbiosis is a hallmark of aging and has been linked to cognitive decline\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. Using 16S rRNA gene sequencing, we found that PC treatment enriched SCFA-producing genera, including \u003cem\u003eDuncaniella\u003c/em\u003e and \u003cem\u003eLigilactobacillus\u003c/em\u003e. \u003cem\u003eDuncaniella\u003c/em\u003e belongs to the Muribaculaceae family, which degrades complex polysaccharides and produces SCFAs\u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. Consistent with enrichment of SCFA-producing bacteria, PC treatment increased fecal levels of acetate, propionate, and butyrate. Butyrate is particularly important in this context, as it serves as the primary energy source for colonocytes and exhibits anti-inflammatory and barrier-protective effects through histone deacetylase (HDAC) inhibition and other signaling pathways\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. Prior studies have shown that butyrate enhances tight junction protein expression and inhibits NF-κB signaling, thereby improving intestinal barrier function and reducing inflammation\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. The strong correlation between increased SCFA levels and improved barrier function observed in our study supports this proposed mechanism. However, causal validation through direct SCFA supplementation or microbiota depletion studies is needed to confirm this pathway.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003e4.4 PC Increases Intestinal 5-HTP Production and Hippocampal Serotonin Synthesis\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eWhile SCFAs are known to regulate intestinal barrier function and immunity, their effects on brain function and cognition are less well understood. SCFAs have limited blood-brain barrier permeability. Our findings suggest that SCFAs, particularly butyrate, may indirectly influence brain serotonin levels by stimulating intestinal 5-HTP synthesis.\u003c/p\u003e \u003cp\u003eFollowing PC treatment, colonic TPH1 and AADC expression increased along with elevated fecal SCFA levels, resulting in higher colonic 5-HTP and 5-HT levels. These findings are consistent with prior studies showing that gut microbiota and SCFAs regulate intestinal serotonin synthesis\u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e][\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. Butyrate may enhance TPH1 expression through HDAC inhibition or receptor-mediated signaling pathways\u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e, thereby converting microbial metabolites into a blood-brain barrier-permeable precursor (5-HTP).\u003c/p\u003e \u003cp\u003eImportantly, 5-HTP, unlike serotonin (5-HT), can readily cross the blood-brain barrier. PC treatment increased serum 5-HTP levels, consistent with prior studies showing that 5-HTP supplementation elevates brain serotonin and improves cognitive functionr\u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e. Additionally, we observed increased hippocampal 5-HTP and serotonin levels, along with upregulated expression of serotonin receptors (5-HT1A and 5-HT6), which are implicated in learning and memory.\u003c/p\u003e \u003cp\u003eOur findings support a pathway whereby PC enriches SCFA-producing bacteria, leading to increased intestinal 5-HTP synthesis and elevated serum 5-HTP levels, which may contribute to enhanced hippocampal serotonin synthesis. However, further studies are needed to confirm the causal relationships in this proposed pathway.\u003cb\u003e4.5 Enhanced Hippocampal Serotonin Signaling May Contribute to Cognitive Improvement\u003c/b\u003e\u003c/p\u003e \u003cp\u003eFollowing PC treatment, hippocampal 5-HTP and serotonin levels increased, along with upregulated expression of TPH2 and AADC, the enzymes responsible for central serotonin synthesis. This may reflect enhanced local serotonin synthesis capacity in response to increased substrate availability. Additionally, PC treatment increased hippocampal expression of serotonin receptors 5-HT1A and 5-HT6, which are implicated in learning and memory. 5-HT1A receptors modulate hippocampal synaptic plasticity and neurogenesis\u003csup\u003e[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e, while 5-HT6 receptors influence cognitive processing and memory\u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eTogether, increased hippocampal serotonin levels and upregulated receptor expression may enhance serotonergic neurotransmission, potentially contributing to improved synaptic plasticity and cognitive function. Correlation analysis revealed positive associations between gut bacterial abundance (\u003cem\u003eDuncaniella\u003c/em\u003e, \u003cem\u003eLigilactobacillus\u003c/em\u003e), fecal SCFA levels, serum 5-HTP, and hippocampal serotonin levels, supporting the proposed gut-brain axis pathway. However, these correlations do not establish causation, and mechanistic validation studies are needed.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"5 Conclusion","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThis study demonstrates that dietary phosphatidylcholine (PC) improves age-related cognitive decline through modulation of the gut microbiota-SCFA-serotonin axis. PC treatment reduced hippocampal neuroinflammation and oxidative stress, restored intestinal barrier integrity, and enriched SCFA-producing bacteria. Specifically, PC enriched \u003cem\u003eDuncaniella\u003c/em\u003e and \u003cem\u003eLigilactobacillus\u003c/em\u003e, leading to increased fecal butyrate and propionate levels, which correlated with improved barrier function. Furthermore, increased fecal SCFAs correlated with elevated intestinal and serum 5-HTP levels, and hippocampal 5-HTP and serotonin levels. PC also upregulated hippocampal expression of serotonin receptors (5-HT1A and 5-HT6), which may contribute to enhanced serotonergic neurotransmission and improved cognitive performance.\u003c/p\u003e \u003cp\u003ePreventive PC supplementation showed greater efficacy than therapeutic treatment in several outcomes, suggesting potential benefits of early intervention. These findings support PC as a potential dietary strategy for maintaining cognitive function in aging by targeting the gut-brain axis. However, the correlational nature of these findings necessitates further mechanistic validation studies to confirm causal relationships and evaluate translational potential.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eConflicts of interest\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eChong Yuan: writing-original draft, visualization, validation, and methodology. Na Wang: writing-review \u0026amp;amp; editing, project administration. Kunmiao He: software and formal analysis. Tiantian Xu: writing-review \u0026amp;amp; editing and methodology. Hanshuo Wang: methodology, data curation. Hongtao Ren: methodology and investigation. Shuangjuan Xue: data curation. Qiuying Yu: software, and methodology. Linlin Chen: writing-review \u0026amp;amp; editing, resources, data curation, methodology, and funding acquisition. Gaiping Zhang: project administration.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eThis research was funded by the Innovation and Ecological Support Special Project of Henan Province (HARS-22-05-Z1) and the Key Scientific and Technological Project of Henan Province (242102320264).\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eData for this article are available at Science Date Bank at https://doi.org/10.57760/sciencedb.12131.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eZarocostas J. The UN reports global asymmetries in population growth[J]. Lancet, 2022, 400(10347): 148\u0026ndash;148.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen K Y, Shi Y, Wang X, et al. Cellular Components of the Blood-Brain Barrier and Their Involvement in Aging-Associated Cognitive Impairment[J]. Aging and Disease, 2025, 16(3): 1513\u0026ndash;1534.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePetersen R C, Caracciolo B, Brayne C, et al. Mild cognitive impairment: a concept in evolution[J]. Journal of Internal Medicine, 2014, 275(3): 214\u0026ndash;228.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan Y, Quan X P, Chuang Y C, et al. A multi-omics analysis for the prediction of neurocognitive disorders risk among the elderly in Macao[J]. Clinical and Translational Medicine, 2022, 12(6): 18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoche D, Perry V H, Nicoll J A R. Review: Activation patterns of microglia and their identification in the human brain[J]. Neuropathology and Applied Neurobiology, 2013, 39(1): 3\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeneka M T, Kummer M P, Latz E. Innate immune activation in neurodegenerative disease[J]. Nature Reviews Immunology, 2014, 14(7): 463\u0026ndash;477.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFranceschi C, Garagnani P, Parini P, et al. Inflammaging: a new immune-metabolic viewpoint for age-related diseases[J]. Nature Reviews Endocrinology, 2018, 14(10): 576\u0026ndash;590.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eErny D, de Angelis A L H, Jaitin D, et al. Host microbiota constantly control maturation and function of microglia in the CNS[J]. Nature Neuroscience, 2015, 18(7): 965-+.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgirman G, Hsiao E Y. SnapShot: The microbiota-gut-brain axis[J]. Cell, 2021, 184(9): 2524\u0026ndash;2525.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoh A, De Vadder F, Kovatcheva-Datchary P, et al. From Dietary Fiber to Host Physiology: Short-Chain Fatty Acids as Key Bacterial Metabolites[J]. Cell, 2016, 165(6): 1332\u0026ndash;1345.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrown A J, Goldsworthy S M, Barnes A A, et al. The orphan G protein-coupled receptors GPR41 and GPR43 are activated by propionate and other short chain carboxylic acids[J]. Journal of Biological Chemistry, 2003, 278(13): 11312\u0026ndash;11319.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmith P M, Howitt M R, Panikov N, et al. The Microbial Metabolites, Short-Chain Fatty Acids, Regulate Colonic Treg Cell Homeostasis[J]. Science, 2013, 341(6145): 569\u0026ndash;573.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGershon M D, Tack J. The serotonin signaling system: From basic understanding to drug development-for functional GI disorders[J]. Gastroenterology, 2007, 132(1): 397\u0026ndash;414.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWall R, Cryan J F, Ross R P, et al. Bacterial Neuroactive Compounds Produced by Psychobiotics[M]. Lyte M, Cryan J F. Microbial Endocrinology: The Microbiota-Gut-Brain Axis in Health and Disease. New York: Springer, 2014: 221\u0026ndash;239.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYano J M, Yu K, Donaldson G P, et al. Indigenous Bacteria from the Gut Microbiota Regulate Host Serotonin Biosynthesis[J]. Cell, 2015, 161(2): 264\u0026ndash;276.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQi Q Q, Chu M J, Yu X T, et al. Anthocyanins and Proanthocyanidins: Chemical Structures, Food Sources, Bioactivities, and Product Development[J]. Food Reviews International, 2023, 39(7): 4581\u0026ndash;4609.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen X Y, Liu S, Song H, et al. Evaluation of biological activity and prebiotic properties of proanthocyanidins with different degrees of polymerization through simulated digestion and in vitro fermentation by human fecal microbiota[J]. Food Chemistry, 2024, 447: 11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu W, Oteiza P. Proanthocyanidins at the gastrointestinal tract: mechanisms involved in their capacity to mitigate obesity-associated metabolic disorders[J]. Critical Reviews in Food Science and Nutrition, 2024, 64(2): 220\u0026ndash;240.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng Q, Xia W K, Dai G X, et al. The Aging Features of Thyrotoxicosis Mice: Malnutrition, Immunosenescence and Lipotoxicity[J]. Frontiers in Immunology, 2022, 13: 23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArchana, Gupta A K, Noumani A, et al. Gut microbiota derived short-chain fatty acids in physiology and pathology: An update[J]. Cell Biochemistry and Function, 2024, 42(7): 17.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSheng K L, Yang J, Xu Y F, et al. Alleviation effects of grape seed proanthocyanidin extract on inflammation and oxidative stress in a d-galactose-induced aging mouse model by modulating the gut microbiota[J]. Food \u0026amp; Function, 2022, 13(3): 1348\u0026ndash;1359.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng N Y, Barfoot K L, Le Cozannet R, et al. Wild Blueberry Extract Intervention in Healthy Older Adults: A Multi-Study, Randomised, Controlled Investigation of Acute Cognitive and Cardiovascular Effects[J]. Nutrients, 2024, 16(8): 19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang X, Liu J, Lin Q, et al. Proanthocyanidin prevents lipopolysaccharide-induced depressive-like behavior in mice via neuroinflammatory pathway[J]. Brain Research Bulletin, 2017, 135: 40\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBashir N, Manoharan V, Miltonprabu S. Grape seed proanthocyanidins protects against cadmium induced oxidative pancreatitis in rats by attenuating oxidative stress, inflammation and apoptosis via Nrf-2/HO-1 signaling[J]. Journal of Nutritional Biochemistry, 2016, 32: 128\u0026ndash;141.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGou H Z, Zhang Y L, Ren L F, et al. How do intestinal probiotics restore the intestinal barrier?[J]. Frontiers in Microbiology, 2022, 13: 11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD'Amato A, Mannelli L D, Lucarini E, et al. Faecal microbiota transplant from aged donor mice affects spatial learning and memory via modulating hippocampal synaptic plasticity- and neurotransmission-related proteins in young recipients[J]. Microbiome, 2020, 8(1): 19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHosoi T, Okuma Y, Matsuda T, et al. Novel pathway for LPS-induced afferent vagus nerve activation: Possible role of nodose ganglion[J]. Autonomic Neuroscience-Basic \u0026amp; Clinical, 2005, 120(1\u0026ndash;2): 104\u0026ndash;107.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu W X, Xie J W, Jiang H L, et al. Mannose attenuates intestinal epithelial tight junction damage in experimental colitis mice by activating the AXIN-AMPK pathway[J]. International Immunopharmacology, 2024, 127: 10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen X X, Wu J L, Fu X, et al. Fructus mori polysaccharide alleviates diabetic symptoms by regulating intestinal microbiota and intestinal barrier against TLR4/NF-κB pathway[J]. International Journal of Biological Macromolecules, 2023, 249: 14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMehta M, Louissaint J, Parikh N S, et al. Cognitive Function, Sarcopenia, and Inflammation Are Strongly Associated with Frailty: A Framingham Cohort Study[J]. American Journal of Medicine, 2021, 134(12): 1530\u0026ndash;1538.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu Y Q, Chen B R, Zhang X Y, et al. Exploration of the Muribaculaceae Family in the Gut Microbiota: Diversity, Metabolism, and Function[J]. Nutrients, 2024, 16(16): 14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Z F, Wang C, Yuan B Y, et al. Akkermansia muciniphila and its metabolite propionic acid maintains neuronal mitochondrial division and autophagy homeostasis during Alzheimer's disease pathologic process via GPR41 and GPR43[J]. Microbiome, 2025, 13(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu P, Zhang M R, Liu T Y, et al. Avenanthramide Improves Colonic Damage Induced by Food Allergies in Mice through Altering Gut Microbiota and Regulating Hsp70-NF-κB Signaling[J]. Nutrients, 2023, 15(4): 18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKwon Y H, Wang H Q, Denou E, et al. Modulation of Gut Microbiota Composition by Serotonin Signaling Influences Intestinal Immune Response and Susceptibility to Colitis[J]. Cellular and Molecular Gastroenterology and Hepatology, 2019, 7(4): 709\u0026ndash;728.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEngevik M A, Luck B, Visuthranukul C, et al. Human-Derived Bifidobacterium dentium Modulates the Mammalian Serotonergic System and Gut-Brain Axis[J]. Cellular and Molecular Gastroenterology and Hepatology, 2021, 11(1): 221\u0026ndash;248.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrifka-Walk H M, Jenkins B R, Kominsky D J. Amino Acid Trp: The Far Out Impacts of Host and Commensal Tryptophan Metabolism[J]. Frontiers in Immunology, 2021, 12: 14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang P, Ma J W, Li K, et al. 5-Hydroxytryptophan artificial synaptic vesicles across the blood-brain barrier for the rapid-acting treatment of depressive disorder[J]. Materials Today Bio, 2024, 29: 14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLevitt E S, Hunnicutt B J, Knopp S J, et al. A selective 5-HT1a receptor agonist improves respiration in a mouse model of Rett syndrome[J]. Journal of Applied Physiology, 2013, 115(11): 1626\u0026ndash;1633.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWoods S, Clarke N N, Layfield R, et al. 5-HT6 receptor agonists and antagonists enhance learning and memory in a conditioned emotion response paradigm by modulation of cholinergic and glutamatergic mechanisms[J]. British Journal of Pharmacology, 2012, 167(2): 436\u0026ndash;449.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"npj-science-of-food","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"npjscifood","sideBox":"Learn more about [npj Science of Food](http://www.nature.com/npjscifood/)","snPcode":"41538","submissionUrl":"https://submission.springernature.com/new-submission/41538/3","title":"npj Science of Food","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Cognitive impairment, Proanthocyanidins, Gut-brain axis, Gut microbiota, Short-chain fatty acids, Serotonin","lastPublishedDoi":"10.21203/rs.3.rs-8795494/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8795494/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAge-related cognitive impairment represents a major global public health challenge closely linked to neuroinflammation and gut microbiota dysbiosis. Proanthocyanidins (PC), widely distributed dietary polyphenols, exhibit substantial potential for modulating gut-brain axis communication through their antioxidant and anti-inflammatory properties. This study elucidated the molecular mechanisms underlying PC-mediated amelioration of age-related cognitive impairment via the gut microbiota-SCFAs-5-HTP axis. Using an aging mouse model, we systematically evaluated PC's effects through behavioral tests, histopathology, molecular analyses, 16S rRNA gene sequencing, and targeted metabolomics. PC significantly improved spatial learning and memory in aging mice, as demonstrated by Morris water maze performance. Mechanistically, PC reshaped the disrupted gut microbiota by enriching SCFA-producing bacteria (e.g., \u003cem\u003eDuncaniella\u003c/em\u003eand \u003cem\u003eLigilactobacillus\u003c/em\u003e) and significantly increasing butyrate and propionate levels. Elevated SCFAs enhanced intestinal barrier integrity by upregulating tight junction proteins and promoting intestinal tryptophan hydroxylase 1 (TPH1) expression, thereby increasing 5-HTP biosynthesis. Circulating 5-HTP crossed the blood-brain barrier and was converted to serotonin (5-HT) in the hippocampus, where it activated 5-HT1A and 5-HT6 receptors, thereby inhibiting glial activation, reducing neuroinflammation, and improving cognitive function. This study systematically elucidated how proanthocyanidins exert neuroprotective effects via a microbiota-metabolite-neurotransmitter cascade, providing a mechanistic foundation for developing polyphenol-based precision nutrition strategies to prevent age-related cognitive decline.\u003c/p\u003e","manuscriptTitle":"Dietary Proanthocyanidins Ameliorate Age-Related Cognitive Decline and Neuroinflammation in Mice via the Gut Microbiota-SCFAs-5-HTP Axis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-12 08:24:00","doi":"10.21203/rs.3.rs-8795494/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-02-20T16:21:52+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-19T13:43:50+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-19T03:55:00+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-17T09:31:54+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"196764391260066826155383047271926910633","date":"2026-02-13T10:34:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"155497033003562372187024648836623307154","date":"2026-02-10T20:55:44+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"82059268772399044717428079099272780596","date":"2026-02-09T18:00:13+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"117120350127145960475617146514041166506","date":"2026-02-09T02:26:26+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-02-08T14:26:45+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-02-07T18:45:19+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-07T13:12:16+00:00","index":"","fulltext":""},{"type":"submitted","content":"npj Science of Food","date":"2026-02-05T09:24:36+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"npj-science-of-food","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"npjscifood","sideBox":"Learn more about [npj Science of Food](http://www.nature.com/npjscifood/)","snPcode":"41538","submissionUrl":"https://submission.springernature.com/new-submission/41538/3","title":"npj Science of Food","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d7e0a499-a27e-4fa7-bf9f-4b0b741c44bc","owner":[],"postedDate":"February 12th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":62758466,"name":"Health sciences/Diseases"},{"id":62758467,"name":"Biological sciences/Microbiology"},{"id":62758468,"name":"Biological sciences/Neuroscience"}],"tags":[],"updatedAt":"2026-05-16T02:53:34+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-12 08:24:00","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8795494","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8795494","identity":"rs-8795494","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00