Loss of fatty acid-binding protein 7 enhances metastasis in B16F10 melanoma cells through phenotypic shift

preprint OA: closed
Full text JSON View at publisher
Full text 133,789 characters · extracted from preprint-html · click to expand
Loss of fatty acid-binding protein 7 enhances metastasis in B16F10 melanoma cells through phenotypic shift | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Loss of fatty acid-binding protein 7 enhances metastasis in B16F10 melanoma cells through phenotypic shift Tunyanat Wannakul, Hirofumi Miyazaki, Motoko Maekawa, Yoshiteru Kagawa, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4767873/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Mar, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Melanoma possesses the characteristic phenotypic plasticity, enhancing its metastatic formation and drug resistance. Lipid and fatty acid metabolism are usually altered to support melanoma progression and can be targeted for therapeutic development. Fatty acid binding protein 7 (FABP7) is highly expressed in melanomas and is shown to support its proliferation, migration, and invasion, but the mechanisms remain unclear. Our study aimed to link FABP7 to lipid metabolism and phenotypic shift in melanomas. We established the Fabp7 -knockout (KO) B16F10 melanoma cells, which showed an enhanced invasion through matrix-coated membrane, without significant change in proliferation. Similar outcomes were obtained when using RNA interference targeting FABP7. Fabp7 -KO cells injected into mice exhibited slower primary tumor growth, but formed higher metastatic foci count in the lungs. We also discovered a higher saturation in overall lipids, phosphatidylcholines, and triacylglycerols. We observed transcriptional shifts toward the invasive MITF Low /AXL High phenotype, with upregulation of transforming growth factor-beta (TGF-β) receptor mRNAs. In conclusion, FABP7 may help balancing lipid saturation and maintain the proliferative state of melanomas, mitigating invasiveness and metastatic formation. Biological sciences/Cancer/Skin cancer/Melanoma Biological sciences/Biochemistry/Lipids/Fatty acids Health sciences/Diseases/Cancer/Skin cancer/Melanoma Biological sciences/Cell biology/Mechanisms of disease Biological sciences/Cancer/Metastases Biological sciences/Biochemistry/Lipidomics Melanoma Fatty Acid-Binding Protein 7 Adaptation Physiological Neoplasm Metastasis Lipid Metabolism Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Melanoma is a highly aggressive skin cancer, characterized by its metastatic potential, immune response evasiveness, and resistance to current therapies 1 . Arisen from melanocytes, descendants of embryonic neural crest cells, melanomas acquire the phenotypic plasticity by potentially hijacking their embryonic genetic program 2 , allowing them to reversibly shift into various states in response to environmental cues under regulation of several transcription factors, similar to epithelial-to-mesenchymal transition (EMT) found in many epithelial tumor cells 3 – 8 . Among many candidates, the microphthalmia-associated transcription factor (MITF), and the tyrosine kinase receptor AXL are widely used to mark different states of melanomas 9 . MITF regulates multiple genes accounting for melanoma differentiation antigens, including TYRP1 and MLANA, which involve in melanin production, melanocyte differentiation and proliferation 10 , 11 . AXL is associated with aggressiveness and drug resistance by signaling through PI3K/AKT, MAPK/ERK and STAT3 pathways 12 . Melanomas with MITF High /AXL Low profile are often linked to the more differentiated and proliferative phenotypes, while MITF Low /AXL High melanomas are more mesenchymal-like, that is, de-differentiated, slow cycling but highly invasive 8 . Switching toward the invasive state is often contributed by stresses in the tumor microenvironment, such as hypoxic condition, nutrient deprivation, or inflammatory response. This invasive phenotype can also be induced by various cytokines, including tumor necrosis factor, and transforming growth factor-beta (TGF-β) 4 , 8 . Cancer cells usually rewire their metabolism to match their increased energy and macromolecules demand during rapid cell proliferation, to adapt to nutrient scarcity and promote metastasis 13 , 14 . Lipids are one of the most important nutrients, not only as the main component of the cellular membrane, but also serve as energy source and storage, and play significant roles in signaling pathways, many of which are related to tumor progression, such as the phosphatidylinositol in PI3K/AKT/mTOR pathway 15 , 16 . Fatty acids (FAs) are shown to play significant roles in supporting melanoma aggressiveness, as both FA de novo synthesis and exogenous uptake are shown to be upregulated and support melanoma metastasis formation 17 , 18 , or supporting survival during metastasis by certain FAs 19 . The degree of FA saturation partially determines melanoma phenotypes by inducing stress responses and altering membrane fluidity 20 , 21 . Fatty acid binding protein 7 (FABP7) is a fatty acid chaperon protein highly expressed in the brain and glial cells, which binds to long chain poly-unsaturated FAs (PUFAs), notably docosahexaenoic acid (DHA), regulates cell mobility during brain development via peroxisome proliferator-activated receptors (PPARs) activation 22 , 23 , and facilitates myelination 24 . Several cancers, including breast cancer, glioma, carcinomas, and melanomas, also express FABP7 with its expression associated with poor prognosis 25 – 28 . In melanoma, FABP7 expression is associated with tumor thickness, and enhances its proliferation, migration, and invasion 29 – 31 . But the aspects on melanoma’s unique phenotypic plasticity and altered lipid metabolism have not yet been thoroughly explored. Our study’s goal is to uncover how FABP7 promotes melanoma progression on the transcriptional and metabolic level, regarding fatty acids and lipid metabolism. Results FABP7 is highly expressed in B16F10 melanoma cells. FABP7 has been shown to be highly expressed in melanoma cells 30 , 32 . We confirmed a high Fabp7 mRNA (Fig. 1 a) and protein expression (Fig. 1 b, c, d) in highly metastatic murine melanoma cell line B16F10 in comparison with its lowly metastatic B16F1 counterpart 33 . Immunocytochemistry staining revealed a homogeneous FABP7 expression both in the cytosol and the nucleus (Fig. 1 d). Subcutaneous and intravenous B16F10 cells in vivo transplantation also expressed FABP7 (Fig. 1 e). Interestingly, we found that FABP7 expression of the tumor foci in the lungs from the intravenously transplanted mice was relatively higher than those of the subcutaneous transplants. Loss of FABP7 increases B16F10 invasiveness. A Fabp7 knockout (KO) B16F10 cell line was generated using CRISPR/Cas9 splicing system. The knockout mutation was detected in DNA sequence. The complete knockout was confirmed by quantitative real-time polymerase chain reaction (qRT-PCR), western blot, and immunofluorescent staining, showing a stable absence of FABP7 protein expression (Fig. 2 a, b, c). While loss of FABP7 did not affect the proliferation rate of these cells (Fig. 2 d), Fabp7 -KO cells showed an increase in both migration and invasion (Fig. 2 e, f), with 2-fold higher invaded cell number in the KO group (p = 0.002). Fabp7 knockdown by siRNA interference (Fig. 2 g, h) also showed a similar trend of enhanced invasion, (Fig. 2 j, k) with almost 6-fold higher invaded cells (p < 0.001). But the wound closure rate was slower in the knockdown cells (Fig. 2 i). Taken together, these results showed that loss of FABP7 promote B16F10 invasion without effects on proliferation in vitro . Loss of FABP7 decreases tumor growth but increases in vivo lung metastasis formation. Control (CT) and Fabp7 -KO B16F10 cells were implanted subcutaneously on C57BL/6 mice to evaluate in vivo effects. Tumor formation started to be visible at day 4–5 after injection and the KO groups were significantly smaller in size (Fig. 3 a, b), with less than half of the CT group at day 15 after injection (Fig. 3 c, p = 0.002). To evaluate the ability to form metastasis, the same cell lines were intravenously injected into the tail veins of C57BL/6 mice. The mice’s body weight and behavior were monitored daily, until 14 days after injection, when we sacrificed the animals and harvested the lungs to evaluate for metastatic formation. Multiple melanotic foci appeared on the lungs in both CT and KO groups. The foci count of KO group was significantly higher than CT, yet the size of each metastatic foci noticeably smaller (Fig. 3 d, e). Fabp7 knockout alters cellular lipid composition. Cellular lipid content of Fabp7 -KO B16F10 cells was evaluated with liquid chromatography–mass spectrometry (LC-MS/MS) lipidomics (Supplementary Data 1). Phosphatidylcholines, diacylglycerides, and phosphatidylethanolamines were the highest lipid composition in both groups (Fig. 4 a). We found an overall increase of glucosyl ceramide, lysophosphatidylethanolamine, and phosphatidic acid species in the KO group, while a decrease in monoglycerides, gangliosides, sphingosines, acylcarnitine lactosyl ceramides, and cardiolipins could be observed. Among free fatty acids (FA), arachidonic acid (C20:4, n-6) was the predominating FA, following by oleic acid (C18:1, n-9), dihomo-gamma-linolenic acid (C20:3, n-6), and stearic acid (C18:0) (Fig. 4 b). A significant decrease of stearic acid (log 2 FC = -1.663, p = 0.003), α-linolenic acid (C18:3, n-3, log 2 FC = -1.242, p = 0.003), arachidonic acid (log 2 FC = -1.700, p = 0.032), and docosapentaenoic acid (C22:5, n-3, log 2 FC = -2.580, p = 0.040)) can be observed in KO group. We found a significant correlation between the abundance of lipids and the number of double bonds. There was an overall decrease in lipid species with higher double bond number within the KO group (Fig. 4 c, d). This trend was also present when considering specific lipid groups, including phosphatidylcholines and glycerolipids, but not apparent for FAs (Fig. 4 e, f). In other words, the saturated to unsaturated ratio in structural and storage lipids was higher in the KO cells and may represent the altered fatty acid metabolism and transportation. Fabp7 knockout causes phenotypic shift toward invasive profiles. An increase in Axl mRNA expression in the KO cell line was observed, while Mitf expression did not significantly change but remained at the original low level, corresponding to the Mitf Low / Axl High invasive phenotype (Fig. 5 a). TGF-β signaling is related to the invasive phenotype of melanoma cells 8 , and we indeed found an increased mRNA expression of TGF-β receptors Tgfbr1 , Tgfbr2 , and Tgfbr3 in the KO cells (Fig. 5 b). It is known that TGF-β signaling induces invasiveness of epithelial cancers thorough epithelial-to-mesenchymal transition (EMT) 34 . We found that certain EMT marker mRNAs were upregulated in the KO cells, including Cdh2 and Zeb2 (Fig. 5 c). Changes in these genes suggest a transcriptional rewiring toward the more invasive, de-differentiated phenotype. Discussion Several studies have demonstrated the roles of FABP7 in promoting aggressiveness of cancers, including melanomas, by supporting tumor growth and metastatic process. We discovered for the first time, FABP7’s role in regulating melanoma phenotypic shift, using a combination of in vitro experiments, an animal model, and metabolomic analysis. FABP7 was originally found to be highly expressed in the brain, remarkably in astrocytes and other glial cells. Since melanomas originate from the neural crest cell-derived melanocytes, they may retain the high FABP7 expression from their origin. Goto, et al , demonstrated that FABP7 mRNA copies are higher in the primary melanoma, than the metastatic site 30 . While patient-acquired tissue immunohistochemistry by Slipicevic, et al . revealed highest FABP7 expression in benign nevi lesion, followed by primary and metastatic melanomas at similar levels 31 . These fluctuations hint that FABP7 may be downregulated during the malignant transformation and metastatic processes, either as metastasis initiator, or as a result from metastatic processes. We found relatively higher FABP7 expression in high-metastatic B16F10 murine melanoma cells compared to B16F1, the low-metastatic variant 35 , 36 . Our finding may appear contradictory to the results from patient tissue studies. However, FABP7 expression in cell lines was observed in vitro , in a stable state, therefore, it cannot represent in vivo fluctuations. Nonetheless, it is plausible that high FABP7 expression supports B16F10 invasiveness. Our in vivo models also showed a relatively higher FABP7 expression in the lungs, than at the primary tumor site, which may be due to a different metastatic process and could not represent the naturally occurred metastasis which involves multiple steps, since our method involved direct injection of tumor cells into the bloodstream. The strong FABP7 expressing metastatic foci in our model could be explained by ROS scavenging capacity. Direct exposure to blood stream can be stressful to melanoma cells and lead to reactive oxygen species-induced cell death 19 , which could be attenuated by lipid droplets 37 . Bansaad, et al , had shown that FABP3 and FABP7 protect glioblastoma cells from ROS during hypoxia-reoxygenation by enhancing lipid droplet formation 38 , it is reasonable that melanoma cells with higher FABP7 expression will similarly survive better in harmful environment then successfully form tumor foci at distant sites. In our study, Fabp7 -KO B16F10 cells had higher capability to invade through ECM-coated membrane without noticeable change in proliferation, contradicting to other studies which showed decreased melanoma proliferation, migration, and invasion in absence of FABP7 29,31 . Our results showed slower primary tumor growth in Fabp7 -KO group, suggesting its importance in cell proliferation in vivo. Presence of complex tumor microenvironment and available nutrients may account for the different findings from in vitro experiments. Higher tumor foci count in the lungs of Fabp7 -KO group corresponds to the increased invasiveness found in trans-well experiments, but the tumor sizes were smaller than the WT group. This, once again, supports its role in tumor proliferation, which might also be mitigated in KO group, leading to slower tumor growth despite successfully forming a metastatic focus. Still, a similar deterioration was not apparent in in vitro results. It is very likely that the TME can dramatically affect the outcome. Since melanoma is a solid tumor of cells forming in a spheroid mass, each tumor cells may be affected by the environment differently. For example, cells at the tumor core may be less exposed to nutrients or oxygen than those at the periphery, especially in rapidly growing tumor without sufficient vascularization. 39 With limited nutrients, tumor cells will have to switch to different modes of metabolism, such as using lipids as main source of energy, instead of glucose. 40 Therefore, Fabp7 -KO cells with impaired fatty acid transportation, would be susceptible to such metabolic stress, halting their proliferation or undergoing apoptosis, leading to an overall smaller tumor size. This locational nutrient availability is likely not present in monolayer cell culture format. Additionally, other TME components, including immune cells, fibroblasts, adipocytes, and various ECM molecules and cytokines, further complicate the tumor progression. 41 – 43 Since FABP7 prefers PUFAs as its ligand 23 , Fabp7 -KO cells presumably have impaired uptake and transportation of these fatty acids, leading to lower overall amount of unsaturated fatty acids and eventually, increasing the saturated to unsaturated lipid ratio. Imbalance between saturated (SFA) and unsaturated fatty acids can affect cell behaviors 20 , 44 . Cell membrane which incorporates unsaturated fatty acids has higher fluidity, enhancing cell motility during invasion, while excessive cellular SFAs can lead to ER stress, unfolded protein response, and ceramide formation 21 . These conditions can activate cellular stress signaling and eventually induce phenotypic shifting toward the invasive phenotype 45 . The evidence of lipid saturation change was only apparent in incorporated lipids, but not FFAs, suggests the role of FABP7 as FA transporter since FFAs may be regulated by other entities. Considering FABP7’s binding affinity toward specific FAs, the reduction of AA in Fabp7 -KO cells is not unexpected. As AA is the precursor of multiple inflammatory cytokines that benefit tumor growth, 46 a lower level of this FA could hinder tumor growth at primary site as well as at metastatic foci. We found evidence of phenotypic shifting in KO cells, characterized by an increase in Axl expression and various EMT markers. While there is no change in Mitf , its original expression is very low in the wild type cells and remains low in the KO cells, resulting in the invasive Mitf Low / Axl High signature. Among multiple factors that can influence the phenotypes, TGF-β signaling is a well-studied pathways known to induce invasion and de-differentiation 8 . KO cells have higher expression of TGF-β receptors, therefore, an increase in TGF-β signaling could be expected. Kagawa, et al 27 , 47 , showed that FABP7 regulates caveolin-1 (Cav-1) expression in gliomas and astrocytes. Apart from changes in membrane FA component that determine the lipid raft function, Cav-1 also plays a significant role in membrane lipid raft formation and can inhibit TGF-β/SMAD signaling via the TGF-β type I receptor 48 . As a result, these receptors may be disinhibited in Fabp7 -KO cells, leading to increased TGF-β signaling. In epithelial cancers, TGF-β signaling is also known to induce EMT by formation of SMAD complex that binds to DNA 34 . Different markers used in this study were expressed at different stages of the transition. In brief, epithelial tumor cells generally express CDH1 which codes for E-cadherin, the main component of cell-cell adhesion proteins in tight junctions, that maintain the integrity of epithelial tissue 49 . CDH2 , on the other hand, codes for N-cadherin, which is upregulated in mesenchymal stage, associated with cancer invasiveness 50 . Cdh2 was upregulated in Fabp7 -KO cells, hinting the mesenchymal-like transition. Meanwhile, upregulation of the epithelial gene Cdh1 was also observed, suggesting a partial EMT-like transformation, that may support the transition back to the proliferative phenotype after successful metastatic seeding 51 . ZEB1 and ZEB2 are transcription factors that repress E-cadherin expression, eventually promoting the mesenchymal transition 52 . Thereby, Zeb2 mRNA upregulation in Fabp7 -KO cells can also account for the enhanced invasiveness. Essentially, changes in these genes indicate that FABP7 can regulate melanoma aggressiveness by preventing it from shifting into the invasive phenotype. This regulation occurs both through direct alterations of structural FA components and indirectly through TGF-β and stress signaling, which lead to EMT-like transitioning alongside the phenotypic shift. In conclusion, this study explores the roles of FABP7 concerning melanoma phenotypic plasticity and lipid metabolism. FABP7 plays an important role in regulating the balance of lipid saturation by preserving UFA levels within the cell. In the absence of FABP7, SFA to UFA ratio increases, likely triggering stress responses and eventually the phenotypic shift toward the invasive phenotype. Through this mechanism, melanoma cells acquire higher metastatic capability, but with a reduction in primary tumor growth. These insights could be potential for finding candidates regarding lipid metabolism, and development of better melanoma therapies. Materials and Methods Reagents and antibodies Reagents and antibodies used in this experiment are as followed: Dulbecco’s modified Eagle’s medium (Sigma Aldrich, Co.), Fetal bovine serum (Sigma Aldrich, Co., Lot# BCBX4307) Penicillin-Streptomycin Mixed Solution (Nacalai Tesque, Kyoto, Japan), 2.5% Trypsin (Thermo Fisher Scientific Inc.), Normal goat serum (Jackson Immuno Research Labs), Bovine serum albumin (BSA) (Wako, Japan), DAPI nucleic acid stain (Invitrogen, Ltd.). Primary antibodies included anti-mouse FABP7 rabbit polyclonal IgG established by our laboratory 53 , and anti-alpha-tubulin rat monoclonal IgG (Santa Cruz Biotechnology Cat# sc-53029, RRID:AB_793541). Secondary antibodies used in this study were Alexa Fluor® 488 goat anti-rabbit IgG (H + L) (Thermo Fisher Scientific Cat# A-11070, RRID:AB_2534114), Alexa Fluor® 568 goat anti-rabbit IgG (H + L) (Thermo Fisher Scientific Cat# A-11011, RRID:AB_143157), horseradish peroxidase (HRP) conjugated goat anti-rabbit IgG H&L (Abcam Cat# ab6721, RRID:AB_955447), and HRP conjugated goat anti-rat IgG (Millipore Cat# AP136P, RRID:AB_11214444) Animals 8–12 weeks old wild type male and female C57BL/6J mice (RRID:IMSR_JAX:000664) were obtained from the Tohoku University Graduate School of Medicine Animal Center. All animal experiments were approved by the Ethics Committee for Animal Experimentation of Tohoku University Graduate School of Medicine and carried out according to the Guidelines for Animal Experimentation of the Tohoku University Graduate School of Medicine and under the law and notification requirements of the Japanese government. All animal experiments were conducted in accordance with the ARRIVE guidelines (Animal Research: Reporting of In Vivo Experiments). Cell cultures Murine melanoma cell lines B16F1 (NCI-DTP Cat# B16F1, RRID:CVCL_0158) and B16F10 (NCI-DTP Cat# B16F10, RRID:CVCL_0159) were obtained from Cell Resource Center for Biomedical Research, Tohoku University. All cell lines were maintained in DMEM supplemented with 10% (v/v) heat-inactivated FBS, 1% (v/v) penicillin/streptomycin, and 2 mM l-glutamine, at 37°C, 5% CO 2 unless specified otherwise. All cell culture experiments were performed under strict sterile condition. Generation of CRISPR/Cas9 Fabp7 knockout cell line CRISPR/Cas9 Fabp7 knockout B16F10 cells were generated as previously described 29 , 54 . Briefly, sgRNA expression plasmid, we selected target sites within exon 1 of murine Fabp7 gene using CHOPCHOP software ( https://chopchop.cbu.uib.no/ ). The following oligonucleotide was used: gRNA; 5’-TAGATGCTTTCTGCGCAACCTGGA-3’ sequence of exon 1. The double-stranded oligonucleotide was synthesized and inserted into pGuide-it-ZsGreen1 vector (Takara, Tokyo, Japan) following manufacturer’s protocol. The constructed vector was transfected into B16F10 cells using Lipofectamine® 2000 Reagent (Thermo Fisher Scientific Inc.). The culture medium was changes 6 hours after transfection. 48 hours after transfection, cells were collected and selected for green fluorescence expressing cells with flow cytometry using BD FACS Aria II (Becton Dickinson, Japan), and seeded as single cells per well in 96-well plates. Cell clones were cultured and propagated in DMEM with 10% FBS at 37°C, 5% CO 2 , passaged and stocked at appropriate time. Complete knockout of FABP7 was confirmed with DNA sequencing analysis, and absence of Fabp7 mRNA protein expression by qRT-PCR, western blotting, and immunofluorescent staining. siRNA gene silencing B16F10 cells were transfected with a stealth siRNA targeting Fabp7 (Cat# MSS202379, Thermo Fisher Scientific Inc.) and negative control siRNA (Cat# sc-37007, Santa Cruz Biotechnology, CA.), using Lipofectamine® RNAiMAX reagent (Thermo Fisher Scientific Inc.) following the manufacturer’s protocol. After optimization, knockdown of Fabp7 mRNA and FABP7 protein expression were confirmed with qRT-PCR and western blot analysis at 48 hours after transfection. Cell proliferation assay Cells were seeded at 5 × 10 3 cells/well in 24-well plates and cultured in DMEM with 10% FBS at 37°C, 5% CO 2 overnight. Cell proliferation was assessed using Cell Count Reagent SF (Nacalai Tesque, Kyoto, Japan) according to the company protocol, every 24 hours for at least 72 hours. The reagents were transferred into 96-well plates to be read at 450 nm wavelength with Multiskan FC microplate photometer (Thermo Fisher Scientific Inc.). Scratch wound healing assay Cells were seeded in 6-well plates and cultured in DMEM with 10% FBS at 37°C, 5% CO 2 until near confluency. Media were replaced with 0.5% FBS DMEM and cultured for another 24 hours to minimize cell proliferation. Scratch wounds were introduced with a 200 µL pipette tip directly onto the confluent cell monolayer. The wound sizes were imaged and measured every 12–24 hours until 72 hours or complete closure. Cell migration was assessed by the reduction percentage of the wound size over time. Boyden’s chamber invasion assay Cells were cultured in DMEM with 10% FBS overnight, then the media were replaced with DMEM with 1% FBS and cultured for another 6 hours. Serum-deprived cells were collected by trypsinization and plated into 24-well plates with 8.0 µm polyester membrane cell culture inserts pre-coated with Geltrex™ Basement Membrane Matrix (Thermo Fisher Inc.). The top chambers contained 2 × 10 5 cells in DMEM with 1% FBS, while the bottom chambers contained DMEM with 10% FBS as chemoattractant. The plates were incubated in 37°C, 5% CO 2 for 24 hours, then the inserts were fixed with 4% PFA and stained with 0.1% crystal violet. The invaded cells were counted under microscope and calculated as cells per image. RNA extraction and quantitative real-time PCR (qRT-PCR) RNA templates from cell culture were isolated using RNeasy Micro Kit (QIAGEN) following the manufacturer’s protocol. cDNA synthesis was performed with GeneAce cDNA Synthesis Kit (Nippon Gene, Tokyo, Japan). qRT-PCR was performed using Applied Biosystems 7500 Real-Time PCR System (RRID:SCR_018051) with THUNDERBIRD® Next SYBR® qPCR Mix (Toyobo Inc.). RNA expression was quantified by normalizing cycle threshold (C T ) values with 18s ribosomal RNA expression and analyzed by comparative ΔC T method. The primer sequences are shown in Table 1 . Table 1 Primers used for qRT-PCR Gene Strand Sequence 18srRNA Forward GTAACCCGTTGAACCCCATT Reverse CCATCCAATCGGTAGTAGCG Axl Forward GGAGGAGCCTGAGGACAAAGC Reverse TACAGCATCTTGAAGCCAGAGTAGG Cdh1 Forward CATCATTGAGAGGGAGACAG Reverse GACACGGCATGAGAATAGAG Cdh2 Forward CTGACTGAGGAGCCTATGAA Reverse CAGTCTCTCTTCTGCCTTTG Fabp7 Forward AAGTGGGAAACGTGACCAAAC Reverse CAACCGAACCACAGACTTACAG miR200c Forward GTCTTACCCAGCAGTGTTTG Reverse TACCCGGCAGTATTAGAGAC Mitf Forward AGATTTGAGATGCTCATCCCC Reverse GATGCGTGATGTCATACTGGA Snail Forward CAACTATAGCGAGCTGCAGGA Reverse GTACCAGGAGAGAGTCCCAGAT Tgfbr1 Forward TCTGCATTGCACTTATGCTGA Reverse AAAGGGCGATCTAGTGATGGA Tgfbr2 Forward CCGCTGCATATCGTCCTGTG Reverse AGTGGATGGATGGTCCTATTACA Tgfbr3 Forward GGTGTGAACTGTCACCGATCA Reverse GTTTAGGATGTGAACCTCCCTTG Zeb1 Forward CCAGCAGACCAGACAGTATT Reverse TCTGAGTCACACACTCGTTGTC Zeb2 Forward GCCACGAGAAGAATGAAGAG Reverse CTCCTTGGGTTAGCATTTGG --- End of the manuscript --- Western blotting Cells were lysed in Pierce™ RIPA buffer (Thermo Fisher Scientific Inc.) with cOmplete Mini protease and phosphatase inhibitor cocktails (Roche) for at least 30 minutes on ice with gentle agitation, ultrasonicated, and centrifuged. The supernatants were collected and measured for protein concentration using the BCA assay (Thermo Fisher Scientific Inc.). Western blot samples were mixed with Laemmli buffer to the final protein concentration of 1–2 g/mL, incubated at 95°C for 5 minutes, and stored at -20°C until gel electrophoresis. Protein samples were resolved in 10% or 12% TGX Stain-Free FastCast Acrylamide Kit (Bio-Rad), transferred onto Immobilon-P PVDF membrane (Sigma Aldrich, Co.), blocked with 5% BSA in 0.1% Tween-20 Tris-Buffered Saline, and incubated in primary antibody at 4°C overnight with gentle agitation. Then, membranes were incubated in HRP-conjugated secondary antibody of appropriate hosts at room temperature for 60 minutes. The chemiluminescent signals were activated with ECL reagents and imaged with BioRad ChemiDoc Touch Imaging System (RRID:SCR_021693). Alpha-tubulin was used as protein reference. Signals were measured and analyzed with Image Lab Software v6.1 ( http://www.bio-rad.com , RRID:SCR_014210). Immunocytochemistry Cells were seeded on poly-L-lysine coated 12mm glass cover slips in 24-well plates. Cells were fixed with 4% paraformaldehyde solution, permeabilized with 0.1% Triton X-100, blocked with 5% BSA, and incubated in primary antibodies at 4°C overnight. After that, cells were washed and incubated with fluorescent-labelled secondary antibodies at room temperature for 60 minutes, with DAPI for nuclear counterstain then mounted with Fluoromount (Sigma-Aldrich, Co.) and kept at 4°C in the dark until imaging with Zeiss LSM 800 with Airyscan Microscope (RRID:SCR_015963). Fluorescent signals were optimized and analyzed using Zeiss Zen Lite ( https://www.zeiss.com , RRID:SCR_023747) and ImageJ v1.53t ( https://imagej.net/ , RRID:SCR_003070). In vivo tumor models Control and Fabp7 -KO B16F10 cells were cultured in DMEM with 10% FBS and passaged at least two times before harvesting by trypsinization. 2 x 10 5 cells in 100 µL phosphate buffer solution (PBS) of control or Fabp7 -KO B16F10 cells were subcutaneously injected into the right flank of the mice. Tumor sizes were measured using a caliper every 3 days for at least two weeks or until the maximum size reached 20 mm. Tumor volume was calculated by the formula: Volume (mm 3 ) = 0.5 × Length (mm) × Width (mm) 2 . For the metastasis model, 2 x 10 5 cells in 100 µL PBS solution of control or Fabp7 -KO B16F10 cells were injected into the tail vein of the mice. Mice’s body weight and well-being were monitored closely for 14 days, until sacrificed. For tissue harvest, mice were adequately anesthetized with isoflurane inhalant, and maintained on the surgical plane of anesthesia throughout the whole sacrifice process. The mice’s chest cavity was opened perfused intraventricularly with normal saline solution then perfused with 4% (PFA) solution. Mice were confirmed death with cervical dislocation while under deep anesthesia. The tumor and the lungs were harvested and fixed in 4% PFA further at 4°C overnight, then processed for paraffinization. Tissue paraffinization and immunohistochemistry Fixed tissue samples were washed twice in PBS, then dehydrated through serial ethanol, cleared with xylene, and embedded in paraffin. Paraffin blocks were sectioned with a sliding microtome at the thickness of 4 µm. Tissue sections were deparaffinized and rehydrated. Heat-induced antigen retrieval was performed in Histofine® antigen retrieval solution (pH 9) (Nichirei, Tokyo, Japan) following manufacturer’s protocol. Tissue sections were blocked with 5% normal goat serum at room temperature for 1 hour, then incubated in primary antibody solution at 4°C overnight. After that, the sections were incubated in biotin-conjugated goat anti-rabbit IgG for 45 minutes, following by VECTASTAIN Elite ABC-HRP reagents per company’s protocol, and finally stained with DAB and hematoxylin nuclear counterstaining. Tissue sections were mounted using PathoMount (Wako, Japan), and observed under Keyence BZ-X800 Fluorescent Microscope (RRID:SCR_023617). Lipidomics analysis Cells were cultured in DMEM with 10% FBS for 24 hours, before collected by trypsinization and stored in PBS at -80°C until analysis. Lipidomics analysis was performed by Human Metabolome Technologies, Inc., using liquid chromatography-mass spectrophotometry (LC-MS/MS) technique. Statistical analysis All data represent the mean ± s.d., calculated from at least three independent experiments. Statistical comparisons were analyzed using Student’s unpaired t-test (two-tailed), multiple t-test with FDR correction, or two-way ANOVA test. Statistical significances were considered at p-value < 0.05. The analyses were performed using GraphPad Prism v10.0.2 ( http://www.graphpad.com/ , RRID:SCR_002798), and Microsoft Excel v16.78 ( https://www.microsoft.com/en-gb/ , RRID:SCR_016137). Declarations Competing interests We declare no competing interests on this study. Author Contribution T.W., H.M., and Y.O. contributed to conceptualization and experimental plans. T.W. and H.M. performed the experiments. T.W. analyzed the data. T.W. and H.M. wrote the manuscript. All others contributed to reviewing and editing the manuscript; Y.O. contributed to supervising and funding. Acknowledgements We would like to thank the Biomedical Research Core, Graduate School of Medicine, Tohoku university, Japan, for their equipment support. This project was funded by JSPS KAKENHI Grant Numbers 22K19724 and 22H03526 (to YO). Data Availability The additional datasets generated during and/or analyzed during the current study, that are not included in this published article, are available from the corresponding author on reasonable request. References Long, G. V., Swetter, S. M., Menzies, A. M., Gershenwald, J. E. & Scolyer, R. A. Cutaneous melanoma. The Lancet 402, 485–502 (2023). Diener, J. & Sommer, L. Reemergence of neural crest stem cell-like states in melanoma during disease progression and treatment. Stem Cells Transl Med 10, 522–533 (2021). Kim, I. S. et al. Microenvironment-derived factors driving metastatic plasticity in melanoma. Nat Commun 8, 14343 (2017). Diazzi, S., Tartare-Deckert, S. & Deckert, M. The mechanical phenotypic plasticity of melanoma cell: an emerging driver of therapy cross-resistance. Oncogenesis 12, 7 (2023). Pedri, D., Karras, P., Landeloos, E., Marine, J.-C. & Rambow, F. Epithelial-to-mesenchymal-like transition events in melanoma. FEBS J 289, 1352–1368 (2022). Hoek, K. S. et al. In vivo switching of human melanoma cells between proliferative and invasive states. Cancer Res 68, 650–656 (2008). Verfaillie, A. et al. Decoding the regulatory landscape of melanoma reveals TEADS as regulators of the invasive cell state. Nat Commun 6, (2015). Arozarena, I. & Wellbrock, C. Phenotype plasticity as enabler of melanoma progression and therapy resistance. Nat Rev Cancer 19, 377–391 (2019). Tirosh, I. et al. Dissecting the multicellular ecosystem of metastatic melanoma by single-cell RNA-seq. Science (1979) 352, 189–196 (2016). Wellbrock, C. & Arozarena, I. Microphthalmia-associated transcription factor in melanoma development and MAP-kinase pathway targeted therapy. Pigment Cell Melanoma Res 28, 390–406 (2015). Kawakami, A. & Fisher, D. E. The master role of microphthalmia-associated transcription factor in melanocyte and melanoma biology. Laboratory Investigation 97, 649–656 (2017). Nyakas, M. et al. AXL inhibition improves BRAF-targeted treatment in melanoma. Sci Rep 12, 5076 (2022). Martínez-Reyes, I. & Chandel, N. S. Cancer metabolism: looking forward. Nature Reviews Cancer 2021 21:10 21, 669–680 (2021). Martinez-Outschoorn, U. E., Peiris-Pagés, M., Pestell, R. G., Sotgia, F. & Lisanti, M. P. Cancer metabolism: a therapeutic perspective. Nature Reviews Clinical Oncology 2016 14:1 14, 11–31 (2016). Cantley, L. C. The phosphoinositide 3-kinase pathway. Science (1979) 296, 1655–1657 (2002). Tímár, J., Hegedüs, B. & Rásó, E. The role of lipid signaling in the progression of malignant melanoma. Cancer and Metastasis Reviews 37, 245–255 (2018). Pascual, G. et al. Targeting metastasis-initiating cells through the fatty acid receptor CD36. Nature 541, 41–45 (2017). Rambow, F. et al. Toward Minimal Residual Disease-Directed Therapy in Melanoma. Cell 174, 843–855.e19 (2018). Ubellacker, J. M. et al. Lymph protects metastasizing melanoma cells from ferroptosis. Nature 585, 113–118 (2020). Vivas-García, Y. et al. Lineage-Restricted Regulation of SCD and Fatty Acid Saturation by MITF Controls Melanoma Phenotypic Plasticity. Mol Cell 77, 120–137.e9 (2020). Du, J. et al. Raman-guided subcellular pharmaco-metabolomics for metastatic melanoma cells. Nat Commun 11, (2020). Maximin, E. et al. Fatty acid binding protein 7 and n-3 poly unsaturated fatty acid supply in early rat brain development. Dev Neurobiol 76, 287–297 (2016). Balendiran, G. K. et al. Crystal Structure and Thermodynamic Analysis of Human Brain Fatty Acid-binding Protein. Journal of Biological Chemistry 275, 27045–27054 (2000). Foerster, S. et al. The fatty acid binding protein FABP7 is required for optimal oligodendrocyte differentiation during myelination but not during remyelination. Glia 68, 1410–1420 (2020). Kagawa, Y. et al. Role of FABP7 in tumor cell signaling. Adv Biol Regul 71, 206–218 (2019). Umaru, B. A. et al. Oleic acid-bound FABP7 drives glioma cell proliferation through regulation of nuclear lipid droplet formation. FEBS J 290, 1798–1821 (2023). Kagawa, Y. et al. Nuclear FABP7 regulates cell proliferation of wild-type IDH1 glioma through caveolae formation. Mol Oncol 16, 289–306 (2022). Nagao, K. et al. Fatty acid binding protein 7 may be a marker and therapeutic targets in clear cell renal cell carcinoma. BMC Cancer 18, (2018). Umaru, B. A. et al. Ligand Bound Fatty Acid Binding Protein 7 (FABP7) Drives Melanoma Cell Proliferation Via Modulation of Wnt/β-Catenin Signaling. Pharm Res 38, 479–490 (2021). Goto, Y. et al. Aberrant Fatty Acid-Binding Protein-7 Gene Expression in Cutaneous Malignant Melanoma. Journal of Investigative Dermatology 130, 221–229 (2010). Slipicevic, A. et al. The fatty acid binding protein 7 (FABP7) is involved in proliferation and invasion of melanoma cells. BMC Cancer 8, 1–13 (2008). Goto, Y. et al. A New Melanoma Antigen Fatty Acid–Binding Protein 7, Involved in Proliferation and Invasion, Is a Potential Target for Immunotherapy and Molecular Target Therapy. Cancer Res 66, 4443–4449 (2006). Seliger, B., Wollscheid, U., Momburg, F., Blankenstein, T. & Huber, C. Characterization of the Major Histocompatibility Complex Class I Deficiencies in B16 Melanoma Cells1. Cancer Res 61, 1095–1099 (2001). Xu, J., Lamouille, S. & Derynck, R. TGF-β-induced epithelial to mesenchymal transition. Cell Research 2009 19:2 19, 156–172 (2009). Fidler, I. J. Selection of Successive Tumour Lines for Metastasis. Nature New Biology 1973 242:118 242, 148–149 (1973). Hill, R. P., Chambers, A. F., Ling, V. & Harris, J. F. Dynamic Heterogeneity: Rapid Generation of Metastatic Variants in Mouse B16 Melanoma Cells. Science (1979) 224, 998–1001 (1984). Zadoorian, A., Du, X. & Yang, H. Lipid droplet biogenesis and functions in health and disease. Nature Reviews Endocrinology 2023 19:8 19, 443–459 (2023). Bensaad, K. et al. Fatty Acid Uptake and Lipid Storage Induced by HIF-1α Contribute to Cell Growth and Survival after Hypoxia-Reoxygenation. Cell Rep 9, 349–365 (2014). Vaziri-Gohar, A. et al. Limited nutrient availability in the tumor microenvironment renders pancreatic tumors sensitive to allosteric IDH1 inhibitors. Nature Cancer 2022 3:7 3, 852–865 (2022). Munir, R., Lisec, J., Swinnen, J. V & Zaidi, N. Lipid metabolism in cancer cells under metabolic stress. Br J Cancer 120, 1090–1098 (2019). Quail, D. F. & Joyce, J. A. Microenvironmental regulation of tumor progression and metastasis. Nature Medicine 2013 19:11 19, 1423–1437 (2013). Avagliano, A. et al. Metabolic Plasticity of Melanoma Cells and Their Crosstalk With Tumor Microenvironment. Front Oncol 10, (2020). Marzagalli, M., Ebelt, N. D. & Manuel, E. R. Unraveling the crosstalk between melanoma and immune cells in the tumor microenvironment. Semin Cancer Biol 59, 236–250 (2019). Currie, E., Schulze, A., Zechner, R., Walther, T. C. & Farese, R. V. Cellular Fatty Acid Metabolism and Cancer. Cell Metab 18, 153–161 (2013). Falletta, P. et al. Translation reprogramming is an evolutionarily conserved driver of phenotypic plasticity and therapeutic resistance in melanoma. Genes Dev 31, 18–33 (2017). Wang, D. & Dubois, R. N. Eicosanoids and cancer. Nature Reviews Cancer 2010 10:3 10, 181–193 (2010). Kagawa, Y. et al. Fatty acid-binding protein 7 regulates function of caveolae in astrocytes through expression of caveolin-1. Glia 63, 780–794 (2015). Razani, B. et al. Caveolin-1 Regulates Transforming Growth Factor (TGF)-β/SMAD Signaling through an Interaction with the TGF-β Type I Receptor. Journal of Biological Chemistry 276, 6727–6738 (2001). Cano, A. et al. The transcription factor Snail controls epithelial–mesenchymal transitions by repressing E-cadherin expression. Nature Cell Biology 2000 2:2 2, 76–83 (2000). Yang, H. et al. TGF-β-activated SMAD3/4 complex transcriptionally upregulates N-cadherin expression in non-small cell lung cancer. Lung Cancer 87, 249–257 (2015). Yuan, S., Norgard, R. J. & Stanger, B. Z. Cellular plasticity in cancer. Cancer Discov 9, 837–851 (2019). Park, S. M., Gaur, A. B., Lengyel, E. & Peter, M. E. The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. Genes Dev 22, 894–907 (2008). Abdelwahab, S. A. et al. Localization of brain-type fatty acid-binding protein in Kupffer cells of mice and its transient decrease in response to lipopolysaccharide. Histochem Cell Biol 119, 469–475 (2003). Kagawa, Y. et al. Mitochondrial dysfunction in GnRH neurons impaired GnRH production. Biochem Biophys Res Commun 530, 329–335 (2020). Additional Declarations No competing interests reported. Supplementary Files SupplementDatasetFile.xlsx SupplementaryFigures.pdf Cite Share Download PDF Status: Published Journal Publication published 26 Mar, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 19 Oct, 2024 Reviews received at journal 17 Oct, 2024 Reviewers agreed at journal 06 Oct, 2024 Reviews received at journal 13 Aug, 2024 Reviewers agreed at journal 06 Aug, 2024 Reviewers invited by journal 06 Aug, 2024 Editor assigned by journal 06 Aug, 2024 Editor invited by journal 26 Jul, 2024 Submission checks completed at journal 23 Jul, 2024 First submitted to journal 19 Jul, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4767873","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":339991156,"identity":"7d8b5239-bd99-429b-9d8c-81b4b413a159","order_by":0,"name":"Tunyanat Wannakul","email":"","orcid":"","institution":"Tohoku University","correspondingAuthor":false,"prefix":"","firstName":"Tunyanat","middleName":"","lastName":"Wannakul","suffix":""},{"id":339991157,"identity":"6caef7c8-02db-41dd-a025-3795202052ed","order_by":1,"name":"Hirofumi Miyazaki","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABEElEQVRIiWNgGAWjYBACAwbGBjDNxg6kecAibBApiAQ+LTwHQFoMiNECoyUS0LTgAuZih9skfvyxM+aTfJ344A3DHzlz9rY0CYYaOwbm2ditsZyd2CbZw5Nsxiadu9lwDoOBsWXPsWMSDMeSGRjnHMDusNuJbRI8Esw2QC3bpIEOS9xwI71NgoHtAAPjjAScWiT/GNTbsEme3f4boeUffi3SPAmHzdgkeLcxQ7SkHZNgbMOrpdla5sBxYzae3M2ScwyMjQ3OHEu2SOxL5sHtl/SHN9/8qTac335244c3FXJyBsfbDG98+GYnZ4gjxICARQLJBCgNdBKP4QxcOhiYP2AXl5fALj4KRsEoGAUjDgAAHeJaev45378AAAAASUVORK5CYII=","orcid":"","institution":"Tohoku University","correspondingAuthor":true,"prefix":"","firstName":"Hirofumi","middleName":"","lastName":"Miyazaki","suffix":""},{"id":339991158,"identity":"7539bad1-23af-4cd9-865f-05edf88ed9ed","order_by":2,"name":"Motoko Maekawa","email":"","orcid":"","institution":"Tohoku University","correspondingAuthor":false,"prefix":"","firstName":"Motoko","middleName":"","lastName":"Maekawa","suffix":""},{"id":339991159,"identity":"b2107de7-b430-408d-bbaf-f129cfdc98f0","order_by":3,"name":"Yoshiteru Kagawa","email":"","orcid":"","institution":"Tohoku University","correspondingAuthor":false,"prefix":"","firstName":"Yoshiteru","middleName":"","lastName":"Kagawa","suffix":""},{"id":339991160,"identity":"7fa1e5ea-fdfe-4146-8c22-c818df1e400a","order_by":4,"name":"Yui Yamamoto","email":"","orcid":"","institution":"Tohoku Medical and Pharmaceutical University","correspondingAuthor":false,"prefix":"","firstName":"Yui","middleName":"","lastName":"Yamamoto","suffix":""},{"id":339991161,"identity":"97bf7cf3-224b-45e9-906d-8db9699abdb8","order_by":5,"name":"Yuji Owada","email":"","orcid":"","institution":"Tohoku University","correspondingAuthor":false,"prefix":"","firstName":"Yuji","middleName":"","lastName":"Owada","suffix":""}],"badges":[],"createdAt":"2024-07-19 12:23:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4767873/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4767873/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-024-80874-5","type":"published","date":"2025-03-26T15:57:37+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":62878026,"identity":"de3050bd-f9d9-41b0-bd23-7345327d3b33","added_by":"auto","created_at":"2024-08-20 14:18:12","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3069748,"visible":true,"origin":"","legend":"\u003cp\u003eFABP7 is highly expressed in B16F10 murine melanoma.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e qRT-PCR analysis of \u003cem\u003eFabp7\u003c/em\u003eexpression in B16F1 and B16F10 cell line, normalized to \u003cem\u003e18srRNA\u003c/em\u003e. \u003cstrong\u003eb\u003c/strong\u003eWestern blot analysis of FABP7 of B16F1 and B16F10 cell lines. \u003cstrong\u003ec\u003c/strong\u003e FABP7 protein expression of B16F1 and B16F10 cell lines from western blot analysis, normalized to alpha-tubulin. Original blots are presented in Supplementary Figure 1 \u003cstrong\u003ed\u003c/strong\u003e Immunofluorescent analysis of FABP7 protein expression in B16F10 cells with or without DAPI nuclear counterstain. \u003cstrong\u003ee\u003c/strong\u003e DAB staining of FABP7 in mice tissue transplanted with B16F10 cells. The top row is from the primary tumor at the subcutaneous injection site with arrows show the border between the primary tumor (P), and subcutaneous tissue (S). The bottom row shows metastatic tumor foci (M) within normal lung tissue (L) from intravenous tumor injection. Right panels are magnification from the dotted square regions. Scale bar represents 500mm and 100mm for left and right panels respectively. Graphs show mean ± s.d. from at least three independent experiments. Unpaired t-test.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4767873/v1/90af18c5d1e9598749352dd2.png"},{"id":62878020,"identity":"d1849845-fa6a-44a9-9867-62a3904d7d52","added_by":"auto","created_at":"2024-08-20 14:18:12","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1440263,"visible":true,"origin":"","legend":"\u003cp\u003eLoss of FABP7 increases B16F10 invasiveness in vitro.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea \u003c/strong\u003eqRT-PCR analysis of \u003cem\u003eFabp7\u003c/em\u003emRNA expression in CRSPR/Cas9 \u003cem\u003eFABP7\u003c/em\u003e knockout B16F10 cell line in comparison with control cell line, normalized to \u003cem\u003e18srRNA\u003c/em\u003e. \u003cstrong\u003eb\u003c/strong\u003eWestern blot analysis of \u003cem\u003eFabp7\u003c/em\u003e-KO B16F10 cell line (KO), in comparison with control cell line (CT). Original blots are presented in Supplementary Figure 2 \u003cstrong\u003ec\u003c/strong\u003e Immunofluorescent analysis of FABP7 protein expression in\u003cem\u003e Fabp7\u003c/em\u003e-KO B16F10 cell line (KO), in comparison with control cell line (CT), with or without DAPI nuclear counterstain. \u003cstrong\u003ed\u003c/strong\u003e Proliferation assay of \u003cem\u003eFabp7\u003c/em\u003e-KO B16F10 cell line (KO), cultured in complete medium with 10%FBS, in comparison with control cell line (CT). \u003cstrong\u003ee\u003c/strong\u003e Scratch wound healing assay of \u003cem\u003eFabp7\u003c/em\u003e-KO B16F10 cell line (KO), in comparison with control cell line (CT). Graph shows the wound area relative to the time of the scratch. \u003cstrong\u003ef\u003c/strong\u003e Invasion assay of \u003cem\u003eFabp7\u003c/em\u003e-KO B16F10 cell line (KO), in comparison with control cell line (CT), through the GelTrex® precoated Boyden chamber, using 10%FBS as chemoattractant. Scale bar = 100mm. \u003cstrong\u003eg \u003c/strong\u003eqRT-PCR analysis of \u003cem\u003eFabp7\u003c/em\u003e mRNA expression in \u003cem\u003eFabp7\u003c/em\u003e knockdown B16F10 cells using siRNA (si\u003cem\u003eFabp7\u003c/em\u003e), in comparison with control cells (siCtrl), normalized to \u003cem\u003e18srrna\u003c/em\u003e, at 24 and 48 hours after transfection. \u003cstrong\u003eh\u003c/strong\u003eWestern blot analysis of si\u003cem\u003eFabp7\u003c/em\u003e knockdown B16F10 cells in comparison with control cells (siCtrl) at 24, 48, and 72 hours after transfection. Original blots are presented in Supplementary Figure 3. \u003cstrong\u003ei \u003c/strong\u003eProliferation assay of si\u003cem\u003eFabp7\u003c/em\u003e knockdown B16F10 cells in comparison with control cells (siCtrl). \u003cstrong\u003ej \u003c/strong\u003eScratch wound healing assay of si\u003cem\u003eFabp7\u003c/em\u003e knockdown B16F10 cells in comparison with control cells (siCtrl). \u003cstrong\u003ek\u003c/strong\u003e Invasion assay of si\u003cem\u003eFabp7\u003c/em\u003e knockdown B16F10 cells in comparison with control cells (siCtrl) through the GelTrex® pre-coated Boyden chamber, using 10% FBS as chemoattractant. Scale bar = 100mm. Graphs show mean ±s.d. from at least three independent experiments. Unpaired t-test and multiple t-test corrected for 1% FDR.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4767873/v1/ba910b05c886ec596b3e2d01.png"},{"id":62878022,"identity":"2bbe8c1a-a188-4d2c-a34c-e0621abfbff4","added_by":"auto","created_at":"2024-08-20 14:18:12","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":686996,"visible":true,"origin":"","legend":"\u003cp\u003eLoss of FABP7 decreases primary tumor growth but increases in vivo lung metastasis formation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e Primary tumor dissected from the subcutaneous injection site at day 16 after transplantation. Top row is the control group (CT), and bottom row is the knockout group (KO). \u003cstrong\u003eb\u003c/strong\u003eEstimated tumor volume over time of the subcutaneous injection with CT and KO cells. Connecting dots represent individual mice. Thick lines represent the exponential curve fit for each group. \u003cstrong\u003ec\u003c/strong\u003e Comparison of tumor volume at day 15 after subcutaneous injection with CT and KO cells. \u003cstrong\u003ed\u003c/strong\u003e Lungs harvested from the intravenous injection model, showing black spots of tumor metastatic foci. Top row is the CT group, and bottom row is the KO group. \u003cstrong\u003ee\u003c/strong\u003eCount of lung metastatic tumor foci from the intravenous injection model. Graphs show mean ±s.d. from at least three independent experiments. Unpaired t-test.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4767873/v1/3ee716ab6c9490c2feddfafc.png"},{"id":62878818,"identity":"b67b2756-663b-470b-9437-aefc13976af1","added_by":"auto","created_at":"2024-08-20 14:26:12","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1023922,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eFabp7\u003c/em\u003e knockout alters cellular lipid composition.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e Lipidomics analysis of \u003cem\u003eFabp7\u003c/em\u003e-KO (KO) and control (CT) B16F10 cells, showing ratio of each of the top 20 most abundant lipid species in mol-percent of total lipid. \u003cstrong\u003eb\u003c/strong\u003e Ratio of each free fatty acids to total lipid of KO and CT cells, with scaled up graph in the box. \u003cstrong\u003ec\u003c/strong\u003e Volcano plot of lipidomics analysis result, considering the relationship between number of double bonds in each lipid species, and overall fold change of \u003cem\u003eFabp7\u003c/em\u003e-KO over CT B16F10 cells. Each dot represents a specific lipid species with color indicating the total number of double bonds from no double bond in dark purple, to highest number of double bonds in light yellow. X-axis represents the log\u003csub\u003e2 \u003c/sub\u003efold change (FC) of KO over CT. Y-axis represents the statistical significance for each pair, showing in -log(p-value). Horizontal dashed line represents the cut point of p-value = 0.05. \u003cstrong\u003ed\u003c/strong\u003e XY correlation graph from Fig. 4c, showing a negative correlation between the fold change from KO to CT (x-axis) and the double bond number (y-axis). Blue line represents simple linear curve fit. P-value represents significant deviation from zero. \u003cstrong\u003ee\u003c/strong\u003e Volcano plots of lipidomics analysis result, considering the relationship between number of double bonds and fold change of \u003cem\u003eFabp7\u003c/em\u003e-KO over CT B16F10 cells in specific groups of lipids. X-axis represents the log\u003csub\u003e2 \u003c/sub\u003efold change (FC) of KO over CT. Y-axis represents the statistical significance for each pair. Horizontal dashed line represents the cut point of p-value = 0.05. \u003cstrong\u003e(F)\u003c/strong\u003e XY correlation graph from Fig. 4e. Bar graphs show mean ± s.d. from three separate samples. PC, phosphatidylcholine, DG, diglyceride, PE, phosphatidylethanolamine, SM, sphingomyelin, Hex1Cer, glucosyl ceramide, galactosyl ceramide, PI, phosphatidylinositol, LPE, lysophosphatidylethanolamine, TG, triglyceride, PS, phosphatidylserine, Cer, ceramide, PG, phosphatigylglycerol, ChE, cholesteryl ester, LBPA, bis(monooleoylglycero)phosphate, Co, coenzyme Q, MG, monoglyceride, GM3, gangliosides, LPC, lysophosphatidylcholine, FA, free fatty acid, SPH, sphingosine, AcCa, acyl carnitine, LPI, lysophosphatidylinositol, LPG, lysophosphatidylglycerol, Hex2Cer, lactosyl ceramide, Ch, cholesterol, CL, cardiolipin, PA, phosphatidic acid, LPS, lysophosphatidylserine, ZyE, zymosterol ester. Unpaired t-test was used to compare each lipid species.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4767873/v1/943ae5ffddb4e395366210a7.png"},{"id":62878023,"identity":"297ae1c1-ee98-4aff-80da-9a1b7547df03","added_by":"auto","created_at":"2024-08-20 14:18:12","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":453497,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eFabp7\u003c/em\u003e knockout causes phenotypic shift toward invasive profiles.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e qRT-PCR analysis of \u003cem\u003eMitf\u003c/em\u003eand \u003cem\u003eAxl\u003c/em\u003e mRNA expression in \u003cem\u003eFabp7\u003c/em\u003e-KO B16F10 cell line (KO) in comparison with control cell line (CT), normalized to \u003cem\u003e18srRNA\u003c/em\u003e. \u003cstrong\u003eb\u003c/strong\u003eqRT-PCR analysis of TGF-breceptors mRNA expression in \u003cem\u003eFabp7\u003c/em\u003e-KO B16F10 cell line (KO) in comparison with control cell line (CT), normalized to \u003cem\u003e18srRNA\u003c/em\u003e. \u003cstrong\u003ec\u003c/strong\u003eqRT-PCR analysis of convention epithelial-to-mesenchymal transition genes in \u003cem\u003eFabp7\u003c/em\u003e-KO cell line (KO) in comparison with control cell line (CT), normalized to \u003cem\u003e18srRNA\u003c/em\u003e. Graphs show mean ±s.d. from at least three independent experiments. Unpaired t-test. N.D., not detected.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4767873/v1/94fd0bb5b49dd36d2dabd21e.png"},{"id":79605914,"identity":"22d42fa2-98bc-46bf-8226-7e6b4b853cc5","added_by":"auto","created_at":"2025-03-31 16:11:40","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8664286,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4767873/v1/658c71d0-1a82-4ef6-8a00-dba7178cbfb6.pdf"},{"id":62878819,"identity":"042c410f-1574-4b56-a2c6-a4bccefda2f7","added_by":"auto","created_at":"2024-08-20 14:26:12","extension":"xlsx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":136255,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementDatasetFile.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4767873/v1/a7dc1695accc2470a8e03662.xlsx"},{"id":62878025,"identity":"415dc539-7d79-4b1c-9713-1bdaebb0a3b3","added_by":"auto","created_at":"2024-08-20 14:18:12","extension":"pdf","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":2030065,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigures.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4767873/v1/1d881bae703ff2f199c0e9cf.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Loss of fatty acid-binding protein 7 enhances metastasis in B16F10 melanoma cells through phenotypic shift","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMelanoma is a highly aggressive skin cancer, characterized by its metastatic potential, immune response evasiveness, and resistance to current therapies\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Arisen from melanocytes, descendants of embryonic neural crest cells, melanomas acquire the phenotypic plasticity by potentially hijacking their embryonic genetic program\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e, allowing them to reversibly shift into various states in response to environmental cues under regulation of several transcription factors, similar to epithelial-to-mesenchymal transition (EMT) found in many epithelial tumor cells\u003csup\u003e\u003cspan additionalcitationids=\"CR4 CR5 CR6 CR7\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAmong many candidates, the microphthalmia-associated transcription factor (MITF), and the tyrosine kinase receptor AXL are widely used to mark different states of melanomas\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. MITF regulates multiple genes accounting for melanoma differentiation antigens, including TYRP1 and MLANA, which involve in melanin production, melanocyte differentiation and proliferation\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. AXL is associated with aggressiveness and drug resistance by signaling through PI3K/AKT, MAPK/ERK and STAT3 pathways\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Melanomas with MITF\u003csup\u003eHigh\u003c/sup\u003e/AXL\u003csup\u003eLow\u003c/sup\u003e profile are often linked to the more differentiated and proliferative phenotypes, while MITF\u003csup\u003eLow\u003c/sup\u003e/AXL\u003csup\u003eHigh\u003c/sup\u003e melanomas are more mesenchymal-like, that is, de-differentiated, slow cycling but highly invasive\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Switching toward the invasive state is often contributed by stresses in the tumor microenvironment, such as hypoxic condition, nutrient deprivation, or inflammatory response. This invasive phenotype can also be induced by various cytokines, including tumor necrosis factor, and transforming growth factor-beta (TGF-β)\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eCancer cells usually rewire their metabolism to match their increased energy and macromolecules demand during rapid cell proliferation, to adapt to nutrient scarcity and promote metastasis\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e,\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Lipids are one of the most important nutrients, not only as the main component of the cellular membrane, but also serve as energy source and storage, and play significant roles in signaling pathways, many of which are related to tumor progression, such as the phosphatidylinositol in PI3K/AKT/mTOR pathway\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Fatty acids (FAs) are shown to play significant roles in supporting melanoma aggressiveness, as both FA de novo synthesis and exogenous uptake are shown to be upregulated and support melanoma metastasis formation\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e, or supporting survival during metastasis by certain FAs\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. The degree of FA saturation partially determines melanoma phenotypes by inducing stress responses and altering membrane fluidity\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eFatty acid binding protein 7 (FABP7) is a fatty acid chaperon protein highly expressed in the brain and glial cells, which binds to long chain poly-unsaturated FAs (PUFAs), notably docosahexaenoic acid (DHA), regulates cell mobility during brain development via peroxisome proliferator-activated receptors (PPARs) activation\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e, and facilitates myelination\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. Several cancers, including breast cancer, glioma, carcinomas, and melanomas, also express FABP7 with its expression associated with poor prognosis\u003csup\u003e\u003cspan additionalcitationids=\"CR26 CR27\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. In melanoma, FABP7 expression is associated with tumor thickness, and enhances its proliferation, migration, and invasion\u003csup\u003e\u003cspan additionalcitationids=\"CR30\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eBut the aspects on melanoma\u0026rsquo;s unique phenotypic plasticity and altered lipid metabolism have not yet been thoroughly explored. Our study\u0026rsquo;s goal is to uncover how FABP7 promotes melanoma progression on the transcriptional and metabolic level, regarding fatty acids and lipid metabolism.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eFABP7 is highly expressed in B16F10 melanoma cells.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eFABP7 has been shown to be highly expressed in melanoma cells\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e,\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. We confirmed a high \u003cem\u003eFabp7\u003c/em\u003e mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea) and protein expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb, c, d) in highly metastatic murine melanoma cell line B16F10 in comparison with its lowly metastatic B16F1 counterpart\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. Immunocytochemistry staining revealed a homogeneous FABP7 expression both in the cytosol and the nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed). Subcutaneous and intravenous B16F10 cells in vivo transplantation also expressed FABP7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee). Interestingly, we found that FABP7 expression of the tumor foci in the lungs from the intravenously transplanted mice was relatively higher than those of the subcutaneous transplants.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eLoss of FABP7 increases B16F10 invasiveness.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eA \u003cem\u003eFabp7\u003c/em\u003e knockout (KO) B16F10 cell line was generated using CRISPR/Cas9 splicing system. The knockout mutation was detected in DNA sequence. The complete knockout was confirmed by quantitative real-time polymerase chain reaction (qRT-PCR), western blot, and immunofluorescent staining, showing a stable absence of FABP7 protein expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea, b, c).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWhile loss of FABP7 did not affect the proliferation rate of these cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed), \u003cem\u003eFabp7\u003c/em\u003e-KO cells showed an increase in both migration and invasion (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee, f), with 2-fold higher invaded cell number in the KO group (p\u0026thinsp;=\u0026thinsp;0.002). \u003cem\u003eFabp7\u003c/em\u003e knockdown by siRNA interference (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eg, h) also showed a similar trend of enhanced invasion, (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ej, k) with almost 6-fold higher invaded cells (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). But the wound closure rate was slower in the knockdown cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ei). Taken together, these results showed that loss of FABP7 promote B16F10 invasion without effects on proliferation \u003cem\u003ein vitro\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eLoss of FABP7 decreases tumor growth but increases in vivo lung metastasis formation.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eControl (CT) and \u003cem\u003eFabp7\u003c/em\u003e-KO B16F10 cells were implanted subcutaneously on C57BL/6 mice to evaluate in vivo effects. Tumor formation started to be visible at day 4\u0026ndash;5 after injection and the KO groups were significantly smaller in size (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, b), with less than half of the CT group at day 15 after injection (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec, p\u0026thinsp;=\u0026thinsp;0.002).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo evaluate the ability to form metastasis, the same cell lines were intravenously injected into the tail veins of C57BL/6 mice. The mice\u0026rsquo;s body weight and behavior were monitored daily, until 14 days after injection, when we sacrificed the animals and harvested the lungs to evaluate for metastatic formation.\u003c/p\u003e \u003cp\u003eMultiple melanotic foci appeared on the lungs in both CT and KO groups. The foci count of KO group was significantly higher than CT, yet the size of each metastatic foci noticeably smaller (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed, e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eFabp7 knockout alters cellular lipid composition.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCellular lipid content of \u003cem\u003eFabp7\u003c/em\u003e-KO B16F10 cells was evaluated with liquid chromatography\u0026ndash;mass spectrometry (LC-MS/MS) lipidomics (Supplementary Data 1). Phosphatidylcholines, diacylglycerides, and phosphatidylethanolamines were the highest lipid composition in both groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). We found an overall increase of glucosyl ceramide, lysophosphatidylethanolamine, and phosphatidic acid species in the KO group, while a decrease in monoglycerides, gangliosides, sphingosines, acylcarnitine lactosyl ceramides, and cardiolipins could be observed. Among free fatty acids (FA), arachidonic acid (C20:4, n-6) was the predominating FA, following by oleic acid (C18:1, n-9), dihomo-gamma-linolenic acid (C20:3, n-6), and stearic acid (C18:0) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). A significant decrease of stearic acid (log\u003csub\u003e2\u003c/sub\u003eFC = -1.663, p\u0026thinsp;=\u0026thinsp;0.003), α-linolenic acid (C18:3, n-3, log\u003csub\u003e2\u003c/sub\u003eFC = -1.242, p\u0026thinsp;=\u0026thinsp;0.003), arachidonic acid (log\u003csub\u003e2\u003c/sub\u003eFC = -1.700, p\u0026thinsp;=\u0026thinsp;0.032), and docosapentaenoic acid (C22:5, n-3, log\u003csub\u003e2\u003c/sub\u003eFC = -2.580, p\u0026thinsp;=\u0026thinsp;0.040)) can be observed in KO group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe found a significant correlation between the abundance of lipids and the number of double bonds. There was an overall decrease in lipid species with higher double bond number within the KO group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec, d). This trend was also present when considering specific lipid groups, including phosphatidylcholines and glycerolipids, but not apparent for FAs (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee, f). In other words, the saturated to unsaturated ratio in structural and storage lipids was higher in the KO cells and may represent the altered fatty acid metabolism and transportation.\u003c/p\u003e \u003cp\u003e \u003cb\u003eFabp7 knockout causes phenotypic shift toward invasive profiles.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAn increase in \u003cem\u003eAxl\u003c/em\u003e mRNA expression in the KO cell line was observed, while \u003cem\u003eMitf\u003c/em\u003e expression did not significantly change but remained at the original low level, corresponding to the \u003cem\u003eMitf\u003c/em\u003e\u003csup\u003eLow\u003c/sup\u003e/\u003cem\u003eAxl\u003c/em\u003e\u003csup\u003eHigh\u003c/sup\u003e invasive phenotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). TGF-β signaling is related to the invasive phenotype of melanoma cells\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e, and we indeed found an increased mRNA expression of TGF-β receptors \u003cem\u003eTgfbr1\u003c/em\u003e, \u003cem\u003eTgfbr2\u003c/em\u003e, and \u003cem\u003eTgfbr3\u003c/em\u003e in the KO cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). It is known that TGF-β signaling induces invasiveness of epithelial cancers thorough epithelial-to-mesenchymal transition (EMT)\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. We found that certain EMT marker mRNAs were upregulated in the KO cells, including \u003cem\u003eCdh2\u003c/em\u003e and \u003cem\u003eZeb2\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). Changes in these genes suggest a transcriptional rewiring toward the more invasive, de-differentiated phenotype.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eSeveral studies have demonstrated the roles of FABP7 in promoting aggressiveness of cancers, including melanomas, by supporting tumor growth and metastatic process. We discovered for the first time, FABP7\u0026rsquo;s role in regulating melanoma phenotypic shift, using a combination of \u003cem\u003ein vitro\u003c/em\u003e experiments, an animal model, and metabolomic analysis.\u003c/p\u003e \u003cp\u003eFABP7 was originally found to be highly expressed in the brain, remarkably in astrocytes and other glial cells. Since melanomas originate from the neural crest cell-derived melanocytes, they may retain the high FABP7 expression from their origin. Goto, \u003cem\u003eet al\u003c/em\u003e, demonstrated that \u003cem\u003eFABP7\u003c/em\u003e mRNA copies are higher in the primary melanoma, than the metastatic site\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. While patient-acquired tissue immunohistochemistry by Slipicevic, \u003cem\u003eet al\u003c/em\u003e. revealed highest FABP7 expression in benign nevi lesion, followed by primary and metastatic melanomas at similar levels\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. These fluctuations hint that FABP7 may be downregulated during the malignant transformation and metastatic processes, either as metastasis initiator, or as a result from metastatic processes.\u003c/p\u003e \u003cp\u003eWe found relatively higher FABP7 expression in high-metastatic B16F10 murine melanoma cells compared to B16F1, the low-metastatic variant\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e,\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Our finding may appear contradictory to the results from patient tissue studies. However, FABP7 expression in cell lines was observed \u003cem\u003ein vitro\u003c/em\u003e, in a stable state, therefore, it cannot represent \u003cem\u003ein vivo\u003c/em\u003e fluctuations. Nonetheless, it is plausible that high FABP7 expression supports B16F10 invasiveness. Our \u003cem\u003ein vivo\u003c/em\u003e models also showed a relatively higher FABP7 expression in the lungs, than at the primary tumor site, which may be due to a different metastatic process and could not represent the naturally occurred metastasis which involves multiple steps, since our method involved direct injection of tumor cells into the bloodstream. The strong FABP7 expressing metastatic foci in our model could be explained by ROS scavenging capacity. Direct exposure to blood stream can be stressful to melanoma cells and lead to reactive oxygen species-induced cell death\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e, which could be attenuated by lipid droplets\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Bansaad, \u003cem\u003eet al\u003c/em\u003e, had shown that FABP3 and FABP7 protect glioblastoma cells from ROS during hypoxia-reoxygenation by enhancing lipid droplet formation\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e, it is reasonable that melanoma cells with higher FABP7 expression will similarly survive better in harmful environment then successfully form tumor foci at distant sites.\u003c/p\u003e \u003cp\u003eIn our study, \u003cem\u003eFabp7\u003c/em\u003e-KO B16F10 cells had higher capability to invade through ECM-coated membrane without noticeable change in proliferation, contradicting to other studies which showed decreased melanoma proliferation, migration, and invasion in absence of FABP7 \u003csup\u003e29,31\u003c/sup\u003e. Our results showed slower primary tumor growth in \u003cem\u003eFabp7\u003c/em\u003e-KO group, suggesting its importance in cell proliferation in vivo. Presence of complex tumor microenvironment and available nutrients may account for the different findings from in vitro experiments. Higher tumor foci count in the lungs of \u003cem\u003eFabp7\u003c/em\u003e-KO group corresponds to the increased invasiveness found in trans-well experiments, but the tumor sizes were smaller than the WT group. This, once again, supports its role in tumor proliferation, which might also be mitigated in KO group, leading to slower tumor growth despite successfully forming a metastatic focus. Still, a similar deterioration was not apparent in \u003cem\u003ein vitro\u003c/em\u003e results. It is very likely that the TME can dramatically affect the outcome. Since melanoma is a solid tumor of cells forming in a spheroid mass, each tumor cells may be affected by the environment differently. For example, cells at the tumor core may be less exposed to nutrients or oxygen than those at the periphery, especially in rapidly growing tumor without sufficient vascularization.\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e With limited nutrients, tumor cells will have to switch to different modes of metabolism, such as using lipids as main source of energy, instead of glucose.\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e Therefore, \u003cem\u003eFabp7\u003c/em\u003e-KO cells with impaired fatty acid transportation, would be susceptible to such metabolic stress, halting their proliferation or undergoing apoptosis, leading to an overall smaller tumor size. This locational nutrient availability is likely not present in monolayer cell culture format. Additionally, other TME components, including immune cells, fibroblasts, adipocytes, and various ECM molecules and cytokines, further complicate the tumor progression.\u003csup\u003e\u003cspan additionalcitationids=\"CR42\" citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eSince FABP7 prefers PUFAs as its ligand\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e, \u003cem\u003eFabp7\u003c/em\u003e-KO cells presumably have impaired uptake and transportation of these fatty acids, leading to lower overall amount of unsaturated fatty acids and eventually, increasing the saturated to unsaturated lipid ratio. Imbalance between saturated (SFA) and unsaturated fatty acids can affect cell behaviors\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. Cell membrane which incorporates unsaturated fatty acids has higher fluidity, enhancing cell motility during invasion, while excessive cellular SFAs can lead to ER stress, unfolded protein response, and ceramide formation\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. These conditions can activate cellular stress signaling and eventually induce phenotypic shifting toward the invasive phenotype\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. The evidence of lipid saturation change was only apparent in incorporated lipids, but not FFAs, suggests the role of FABP7 as FA transporter since FFAs may be regulated by other entities. Considering FABP7\u0026rsquo;s binding affinity toward specific FAs, the reduction of AA in \u003cem\u003eFabp7\u003c/em\u003e-KO cells is not unexpected. As AA is the precursor of multiple inflammatory cytokines that benefit tumor growth,\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e a lower level of this FA could hinder tumor growth at primary site as well as at metastatic foci.\u003c/p\u003e \u003cp\u003eWe found evidence of phenotypic shifting in KO cells, characterized by an increase in \u003cem\u003eAxl\u003c/em\u003e expression and various EMT markers. While there is no change in \u003cem\u003eMitf\u003c/em\u003e, its original expression is very low in the wild type cells and remains low in the KO cells, resulting in the invasive \u003cem\u003eMitf\u003c/em\u003e\u003csup\u003eLow\u003c/sup\u003e/\u003cem\u003eAxl\u003c/em\u003e\u003csup\u003eHigh\u003c/sup\u003e signature.\u003c/p\u003e \u003cp\u003eAmong multiple factors that can influence the phenotypes, TGF-β signaling is a well-studied pathways known to induce invasion and de-differentiation\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. KO cells have higher expression of TGF-β receptors, therefore, an increase in TGF-β signaling could be expected. Kagawa, \u003cem\u003eet al\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e,\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e, showed that FABP7 regulates caveolin-1 (Cav-1) expression in gliomas and astrocytes. Apart from changes in membrane FA component that determine the lipid raft function, Cav-1 also plays a significant role in membrane lipid raft formation and can inhibit TGF-β/SMAD signaling via the TGF-β type I receptor\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. As a result, these receptors may be disinhibited in \u003cem\u003eFabp7\u003c/em\u003e-KO cells, leading to increased TGF-β signaling.\u003c/p\u003e \u003cp\u003eIn epithelial cancers, TGF-β signaling is also known to induce EMT by formation of SMAD complex that binds to DNA\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. Different markers used in this study were expressed at different stages of the transition. In brief, epithelial tumor cells generally express \u003cem\u003eCDH1\u003c/em\u003e which codes for E-cadherin, the main component of cell-cell adhesion proteins in tight junctions, that maintain the integrity of epithelial tissue\u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003eCDH2\u003c/em\u003e, on the other hand, codes for N-cadherin, which is upregulated in mesenchymal stage, associated with cancer invasiveness\u003csup\u003e\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cem\u003eCdh2\u003c/em\u003e was upregulated in \u003cem\u003eFabp7\u003c/em\u003e-KO cells, hinting the mesenchymal-like transition. Meanwhile, upregulation of the epithelial gene \u003cem\u003eCdh1\u003c/em\u003e was also observed, suggesting a partial EMT-like transformation, that may support the transition back to the proliferative phenotype after successful metastatic seeding\u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e. ZEB1 and ZEB2 are transcription factors that repress E-cadherin expression, eventually promoting the mesenchymal transition\u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. Thereby, \u003cem\u003eZeb2\u003c/em\u003e mRNA upregulation in \u003cem\u003eFabp7\u003c/em\u003e-KO cells can also account for the enhanced invasiveness.\u003c/p\u003e \u003cp\u003eEssentially, changes in these genes indicate that FABP7 can regulate melanoma aggressiveness by preventing it from shifting into the invasive phenotype. This regulation occurs both through direct alterations of structural FA components and indirectly through TGF-β and stress signaling, which lead to EMT-like transitioning alongside the phenotypic shift.\u003c/p\u003e \u003cp\u003eIn conclusion, this study explores the roles of FABP7 concerning melanoma phenotypic plasticity and lipid metabolism. FABP7 plays an important role in regulating the balance of lipid saturation by preserving UFA levels within the cell. In the absence of FABP7, SFA to UFA ratio increases, likely triggering stress responses and eventually the phenotypic shift toward the invasive phenotype. Through this mechanism, melanoma cells acquire higher metastatic capability, but with a reduction in primary tumor growth. These insights could be potential for finding candidates regarding lipid metabolism, and development of better melanoma therapies.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eReagents and antibodies\u003c/h2\u003e \u003cp\u003e Reagents and antibodies used in this experiment are as followed: Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (Sigma Aldrich, Co.), Fetal bovine serum (Sigma Aldrich, Co., Lot# BCBX4307) Penicillin-Streptomycin Mixed Solution (Nacalai Tesque, Kyoto, Japan), 2.5% Trypsin (Thermo Fisher Scientific Inc.), Normal goat serum (Jackson Immuno Research Labs), Bovine serum albumin (BSA) (Wako, Japan), DAPI nucleic acid stain (Invitrogen, Ltd.). Primary antibodies included anti-mouse FABP7 rabbit polyclonal IgG established by our laboratory\u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e, and anti-alpha-tubulin rat monoclonal IgG (Santa Cruz Biotechnology Cat# sc-53029, RRID:AB_793541). Secondary antibodies used in this study were Alexa Fluor\u0026reg; 488 goat anti-rabbit IgG (H\u0026thinsp;+\u0026thinsp;L) (Thermo Fisher Scientific Cat# A-11070, RRID:AB_2534114), Alexa Fluor\u0026reg; 568 goat anti-rabbit IgG (H\u0026thinsp;+\u0026thinsp;L) (Thermo Fisher Scientific Cat# A-11011, RRID:AB_143157), horseradish peroxidase (HRP) conjugated goat anti-rabbit IgG H\u0026amp;L (Abcam Cat# ab6721, RRID:AB_955447), and HRP conjugated goat anti-rat IgG (Millipore Cat# AP136P, RRID:AB_11214444)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003e8\u0026ndash;12 weeks old wild type male and female C57BL/6J mice (RRID:IMSR_JAX:000664) were obtained from the Tohoku University Graduate School of Medicine Animal Center. All animal experiments were approved by the Ethics Committee for Animal Experimentation of Tohoku University Graduate School of Medicine and carried out according to the Guidelines for Animal Experimentation of the Tohoku University Graduate School of Medicine and under the law and notification requirements of the Japanese government. All animal experiments were conducted in accordance with the ARRIVE guidelines (Animal Research: Reporting of In Vivo Experiments).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eCell cultures\u003c/h2\u003e \u003cp\u003eMurine melanoma cell lines B16F1 (NCI-DTP Cat# B16F1, RRID:CVCL_0158) and B16F10 (NCI-DTP Cat# B16F10, RRID:CVCL_0159) were obtained from Cell Resource Center for Biomedical Research, Tohoku University. All cell lines were maintained in DMEM supplemented with 10% (v/v) heat-inactivated FBS, 1% (v/v) penicillin/streptomycin, and 2 mM l-glutamine, at 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e unless specified otherwise. All cell culture experiments were performed under strict sterile condition.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eGeneration of CRISPR/Cas9 Fabp7 knockout cell line\u003c/h2\u003e \u003cp\u003eCRISPR/Cas9 \u003cem\u003eFabp7\u003c/em\u003e knockout B16F10 cells were generated as previously described \u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e,\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u003c/sup\u003e. Briefly, sgRNA expression plasmid, we selected target sites within exon 1 of murine \u003cem\u003eFabp7\u003c/em\u003e gene using CHOPCHOP software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://chopchop.cbu.uib.no/\u003c/span\u003e\u003cspan address=\"https://chopchop.cbu.uib.no/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The following oligonucleotide was used: gRNA; 5\u0026rsquo;-TAGATGCTTTCTGCGCAACCTGGA-3\u0026rsquo; sequence of exon 1. The double-stranded oligonucleotide was synthesized and inserted into pGuide-it-ZsGreen1 vector (Takara, Tokyo, Japan) following manufacturer\u0026rsquo;s protocol. The constructed vector was transfected into B16F10 cells using Lipofectamine\u0026reg; 2000 Reagent (Thermo Fisher Scientific Inc.). The culture medium was changes 6 hours after transfection. 48 hours after transfection, cells were collected and selected for green fluorescence expressing cells with flow cytometry using BD FACS Aria II (Becton Dickinson, Japan), and seeded as single cells per well in 96-well plates. Cell clones were cultured and propagated in DMEM with 10% FBS at 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e, passaged and stocked at appropriate time. Complete knockout of FABP7 was confirmed with DNA sequencing analysis, and absence of \u003cem\u003eFabp7\u003c/em\u003e mRNA protein expression by qRT-PCR, western blotting, and immunofluorescent staining.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003esiRNA gene silencing\u003c/h2\u003e \u003cp\u003eB16F10 cells were transfected with a stealth siRNA targeting Fabp7 (Cat# MSS202379, Thermo Fisher Scientific Inc.) and negative control siRNA (Cat# sc-37007, Santa Cruz Biotechnology, CA.), using Lipofectamine\u0026reg; RNAiMAX reagent (Thermo Fisher Scientific Inc.) following the manufacturer\u0026rsquo;s protocol. After optimization, knockdown of Fabp7 mRNA and FABP7 protein expression were confirmed with qRT-PCR and western blot analysis at 48 hours after transfection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eCell proliferation assay\u003c/h2\u003e \u003cp\u003eCells were seeded at 5 \u0026times; 10\u003csup\u003e3\u003c/sup\u003e cells/well in 24-well plates and cultured in DMEM with 10% FBS at 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e overnight. Cell proliferation was assessed using Cell Count Reagent SF (Nacalai Tesque, Kyoto, Japan) according to the company protocol, every 24 hours for at least 72 hours. The reagents were transferred into 96-well plates to be read at 450 nm wavelength with Multiskan FC microplate photometer (Thermo Fisher Scientific Inc.).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eScratch wound healing assay\u003c/h2\u003e \u003cp\u003eCells were seeded in 6-well plates and cultured in DMEM with 10% FBS at 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e until near confluency. Media were replaced with 0.5% FBS DMEM and cultured for another 24 hours to minimize cell proliferation. Scratch wounds were introduced with a 200 \u0026micro;L pipette tip directly onto the confluent cell monolayer. The wound sizes were imaged and measured every 12\u0026ndash;24 hours until 72 hours or complete closure. Cell migration was assessed by the reduction percentage of the wound size over time.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eBoyden\u0026rsquo;s chamber invasion assay\u003c/h2\u003e \u003cp\u003eCells were cultured in DMEM with 10% FBS overnight, then the media were replaced with DMEM with 1% FBS and cultured for another 6 hours. Serum-deprived cells were collected by trypsinization and plated into 24-well plates with 8.0 \u0026micro;m polyester membrane cell culture inserts pre-coated with Geltrex\u0026trade; Basement Membrane Matrix (Thermo Fisher Inc.). The top chambers contained 2 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells in DMEM with 1% FBS, while the bottom chambers contained DMEM with 10% FBS as chemoattractant. The plates were incubated in 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e for 24 hours, then the inserts were fixed with 4% PFA and stained with 0.1% crystal violet. The invaded cells were counted under microscope and calculated as cells per image.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction and quantitative real-time PCR (qRT-PCR)\u003c/h2\u003e \u003cp\u003eRNA templates from cell culture were isolated using RNeasy Micro Kit (QIAGEN) following the manufacturer\u0026rsquo;s protocol. cDNA synthesis was performed with GeneAce cDNA Synthesis Kit (Nippon Gene, Tokyo, Japan). qRT-PCR was performed using Applied Biosystems 7500 Real-Time PCR System (RRID:SCR_018051) with THUNDERBIRD\u0026reg; Next SYBR\u0026reg; qPCR Mix (Toyobo Inc.). RNA expression was quantified by normalizing cycle threshold (C\u003csub\u003eT\u003c/sub\u003e) values with 18s ribosomal RNA expression and analyzed by comparative ΔC\u003csub\u003eT\u003c/sub\u003e method. The primer sequences are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for qRT-PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eStrand\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003e18srRNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTAACCCGTTGAACCCCATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCATCCAATCGGTAGTAGCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eAxl\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGGAGCCTGAGGACAAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTACAGCATCTTGAAGCCAGAGTAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCdh1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCATCATTGAGAGGGAGACAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACACGGCATGAGAATAGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCdh2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGACTGAGGAGCCTATGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGTCTCTCTTCTGCCTTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eFabp7\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGTGGGAAACGTGACCAAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAACCGAACCACAGACTTACAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003emiR200c\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCTTACCCAGCAGTGTTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTACCCGGCAGTATTAGAGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eMitf\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGATTTGAGATGCTCATCCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATGCGTGATGTCATACTGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eSnail\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAACTATAGCGAGCTGCAGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTACCAGGAGAGAGTCCCAGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eTgfbr1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTGCATTGCACTTATGCTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAAGGGCGATCTAGTGATGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eTgfbr2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCGCTGCATATCGTCCTGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGTGGATGGATGGTCCTATTACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eTgfbr3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTGTGAACTGTCACCGATCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTTTAGGATGTGAACCTCCCTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eZeb1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAGCAGACCAGACAGTATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTGAGTCACACACTCGTTGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eZeb2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCACGAGAAGAATGAAGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCCTTGGGTTAGCATTTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003e\u003cem\u003e--- End of the manuscript ---\u003c/em\u003e\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eCells were lysed in Pierce\u0026trade; RIPA buffer (Thermo Fisher Scientific Inc.) with cOmplete Mini protease and phosphatase inhibitor cocktails (Roche) for at least 30 minutes on ice with gentle agitation, ultrasonicated, and centrifuged. The supernatants were collected and measured for protein concentration using the BCA assay (Thermo Fisher Scientific Inc.). Western blot samples were mixed with Laemmli buffer to the final protein concentration of 1\u0026ndash;2 g/mL, incubated at 95\u0026deg;C for 5 minutes, and stored at -20\u0026deg;C until gel electrophoresis.\u003c/p\u003e \u003cp\u003eProtein samples were resolved in 10% or 12% TGX Stain-Free FastCast Acrylamide Kit (Bio-Rad), transferred onto Immobilon-P PVDF membrane (Sigma Aldrich, Co.), blocked with 5% BSA in 0.1% Tween-20 Tris-Buffered Saline, and incubated in primary antibody at 4\u0026deg;C overnight with gentle agitation. Then, membranes were incubated in HRP-conjugated secondary antibody of appropriate hosts at room temperature for 60 minutes. The chemiluminescent signals were activated with ECL reagents and imaged with BioRad ChemiDoc Touch Imaging System (RRID:SCR_021693). Alpha-tubulin was used as protein reference. Signals were measured and analyzed with Image Lab Software v6.1 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.bio-rad.com\u003c/span\u003e\u003cspan address=\"http://www.bio-rad.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e, RRID:SCR_014210).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eImmunocytochemistry\u003c/h2\u003e \u003cp\u003eCells were seeded on poly-L-lysine coated 12mm glass cover slips in 24-well plates. Cells were fixed with 4% paraformaldehyde solution, permeabilized with 0.1% Triton X-100, blocked with 5% BSA, and incubated in primary antibodies at 4\u0026deg;C overnight. After that, cells were washed and incubated with fluorescent-labelled secondary antibodies at room temperature for 60 minutes, with DAPI for nuclear counterstain then mounted with Fluoromount (Sigma-Aldrich, Co.) and kept at 4\u0026deg;C in the dark until imaging with Zeiss LSM 800 with Airyscan Microscope (RRID:SCR_015963). Fluorescent signals were optimized and analyzed using Zeiss Zen Lite (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.zeiss.com\u003c/span\u003e\u003cspan address=\"https://www.zeiss.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e, RRID:SCR_023747) and ImageJ v1.53t (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://imagej.net/\u003c/span\u003e\u003cspan address=\"https://imagej.net/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e, RRID:SCR_003070).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eIn vivo tumor models\u003c/h2\u003e \u003cp\u003eControl and \u003cem\u003eFabp7\u003c/em\u003e-KO B16F10 cells were cultured in DMEM with 10% FBS and passaged at least two times before harvesting by trypsinization. 2 x 10\u003csup\u003e5\u003c/sup\u003e cells in 100 \u0026micro;L phosphate buffer solution (PBS) of control or \u003cem\u003eFabp7\u003c/em\u003e-KO B16F10 cells were subcutaneously injected into the right flank of the mice. Tumor sizes were measured using a caliper every 3 days for at least two weeks or until the maximum size reached 20 mm. Tumor volume was calculated by the formula: Volume (mm\u003csup\u003e3\u003c/sup\u003e)\u0026thinsp;=\u0026thinsp;0.5 \u0026times; Length (mm) \u0026times; Width (mm)\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. For the metastasis model, 2 x 10\u003csup\u003e5\u003c/sup\u003e cells in 100 \u0026micro;L PBS solution of control or \u003cem\u003eFabp7\u003c/em\u003e-KO B16F10 cells were injected into the tail vein of the mice. Mice\u0026rsquo;s body weight and well-being were monitored closely for 14 days, until sacrificed. For tissue harvest, mice were adequately anesthetized with isoflurane inhalant, and maintained on the surgical plane of anesthesia throughout the whole sacrifice process. The mice\u0026rsquo;s chest cavity was opened perfused intraventricularly with normal saline solution then perfused with 4% (PFA) solution. Mice were confirmed death with cervical dislocation while under deep anesthesia. The tumor and the lungs were harvested and fixed in 4% PFA further at 4\u0026deg;C overnight, then processed for paraffinization.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eTissue paraffinization and immunohistochemistry\u003c/h2\u003e \u003cp\u003eFixed tissue samples were washed twice in PBS, then dehydrated through serial ethanol, cleared with xylene, and embedded in paraffin. Paraffin blocks were sectioned with a sliding microtome at the thickness of 4 \u0026micro;m. Tissue sections were deparaffinized and rehydrated. Heat-induced antigen retrieval was performed in Histofine\u0026reg; antigen retrieval solution (pH 9) (Nichirei, Tokyo, Japan) following manufacturer\u0026rsquo;s protocol. Tissue sections were blocked with 5% normal goat serum at room temperature for 1 hour, then incubated in primary antibody solution at 4\u0026deg;C overnight. After that, the sections were incubated in biotin-conjugated goat anti-rabbit IgG for 45 minutes, following by VECTASTAIN Elite ABC-HRP reagents per company\u0026rsquo;s protocol, and finally stained with DAB and hematoxylin nuclear counterstaining. Tissue sections were mounted using PathoMount (Wako, Japan), and observed under Keyence BZ-X800 Fluorescent Microscope (RRID:SCR_023617).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eLipidomics analysis\u003c/h2\u003e \u003cp\u003eCells were cultured in DMEM with 10% FBS for 24 hours, before collected by trypsinization and stored in PBS at -80\u0026deg;C until analysis. Lipidomics analysis was performed by Human Metabolome Technologies, Inc., using liquid chromatography-mass spectrophotometry (LC-MS/MS) technique.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll data represent the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;s.d., calculated from at least three independent experiments. Statistical comparisons were analyzed using Student\u0026rsquo;s unpaired t-test (two-tailed), multiple t-test with FDR correction, or two-way ANOVA test. Statistical significances were considered at p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05. The analyses were performed using GraphPad Prism v10.0.2 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.graphpad.com/\u003c/span\u003e\u003cspan address=\"http://www.graphpad.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e, RRID:SCR_002798), and Microsoft Excel v16.78 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.microsoft.com/en-gb/\u003c/span\u003e\u003cspan address=\"https://www.microsoft.com/en-gb/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e, RRID:SCR_016137).\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eWe declare no competing interests on this study.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eT.W., H.M., and Y.O. contributed to conceptualization and experimental plans. T.W. and H.M. performed the experiments. T.W. analyzed the data. T.W. and H.M. wrote the manuscript. All others contributed to reviewing and editing the manuscript; Y.O. contributed to supervising and funding.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eWe would like to thank the Biomedical Research Core, Graduate School of Medicine, Tohoku university, Japan, for their equipment support. This project was funded by JSPS KAKENHI Grant Numbers 22K19724 and 22H03526 (to YO).\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe additional datasets generated during and/or analyzed during the current study, that are not included in this published article, are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLong, G. V., Swetter, S. M., Menzies, A. M., Gershenwald, J. E. \u0026amp; Scolyer, R. A. Cutaneous melanoma. The Lancet 402, 485\u0026ndash;502 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDiener, J. \u0026amp; Sommer, L. Reemergence of neural crest stem cell-like states in melanoma during disease progression and treatment. Stem Cells Transl Med 10, 522\u0026ndash;533 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim, I. S. \u003cem\u003eet al.\u003c/em\u003e Microenvironment-derived factors driving metastatic plasticity in melanoma. Nat Commun 8, 14343 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDiazzi, S., Tartare-Deckert, S. \u0026amp; Deckert, M. The mechanical phenotypic plasticity of melanoma cell: an emerging driver of therapy cross-resistance. Oncogenesis 12, 7 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePedri, D., Karras, P., Landeloos, E., Marine, J.-C. \u0026amp; Rambow, F. Epithelial-to-mesenchymal-like transition events in melanoma. FEBS J 289, 1352\u0026ndash;1368 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoek, K. S. \u003cem\u003eet al.\u003c/em\u003e In vivo switching of human melanoma cells between proliferative and invasive states. Cancer Res 68, 650\u0026ndash;656 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerfaillie, A. \u003cem\u003eet al.\u003c/em\u003e Decoding the regulatory landscape of melanoma reveals TEADS as regulators of the invasive cell state. Nat Commun 6, (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArozarena, I. \u0026amp; Wellbrock, C. Phenotype plasticity as enabler of melanoma progression and therapy resistance. Nat Rev Cancer 19, 377\u0026ndash;391 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTirosh, I. \u003cem\u003eet al.\u003c/em\u003e Dissecting the multicellular ecosystem of metastatic melanoma by single-cell RNA-seq. Science (1979) 352, 189\u0026ndash;196 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWellbrock, C. \u0026amp; Arozarena, I. Microphthalmia-associated transcription factor in melanoma development and MAP-kinase pathway targeted therapy. Pigment Cell Melanoma Res 28, 390\u0026ndash;406 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKawakami, A. \u0026amp; Fisher, D. E. The master role of microphthalmia-associated transcription factor in melanocyte and melanoma biology. Laboratory Investigation 97, 649\u0026ndash;656 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNyakas, M. \u003cem\u003eet al.\u003c/em\u003e AXL inhibition improves BRAF-targeted treatment in melanoma. Sci Rep 12, 5076 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMart\u0026iacute;nez-Reyes, I. \u0026amp; Chandel, N. S. Cancer metabolism: looking forward. \u003cem\u003eNature Reviews Cancer 2021 21:10\u003c/em\u003e 21, 669\u0026ndash;680 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartinez-Outschoorn, U. E., Peiris-Pag\u0026eacute;s, M., Pestell, R. G., Sotgia, F. \u0026amp; Lisanti, M. P. Cancer metabolism: a therapeutic perspective. \u003cem\u003eNature Reviews Clinical Oncology\u003c/em\u003e 2016 \u003cem\u003e14:1\u003c/em\u003e 14, 11\u0026ndash;31 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCantley, L. C. The phosphoinositide 3-kinase pathway. Science (1979) 296, 1655\u0026ndash;1657 (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eT\u0026iacute;m\u0026aacute;r, J., Heged\u0026uuml;s, B. \u0026amp; R\u0026aacute;s\u0026oacute;, E. The role of lipid signaling in the progression of malignant melanoma. Cancer and Metastasis Reviews 37, 245\u0026ndash;255 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePascual, G. \u003cem\u003eet al.\u003c/em\u003e Targeting metastasis-initiating cells through the fatty acid receptor CD36. Nature 541, 41\u0026ndash;45 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRambow, F. \u003cem\u003eet al.\u003c/em\u003e Toward Minimal Residual Disease-Directed Therapy in Melanoma. Cell 174, 843\u0026ndash;855.e19 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUbellacker, J. M. \u003cem\u003eet al.\u003c/em\u003e Lymph protects metastasizing melanoma cells from ferroptosis. Nature 585, 113\u0026ndash;118 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVivas-Garc\u0026iacute;a, Y. \u003cem\u003eet al.\u003c/em\u003e Lineage-Restricted Regulation of SCD and Fatty Acid Saturation by MITF Controls Melanoma Phenotypic Plasticity. Mol Cell 77, 120\u0026ndash;137.e9 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu, J. \u003cem\u003eet al.\u003c/em\u003e Raman-guided subcellular pharmaco-metabolomics for metastatic melanoma cells. Nat Commun 11, (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaximin, E. \u003cem\u003eet al.\u003c/em\u003e Fatty acid binding protein 7 and n-3 poly unsaturated fatty acid supply in early rat brain development. Dev Neurobiol 76, 287\u0026ndash;297 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBalendiran, G. K. \u003cem\u003eet al.\u003c/em\u003e Crystal Structure and Thermodynamic Analysis of Human Brain Fatty Acid-binding Protein. Journal of Biological Chemistry 275, 27045\u0026ndash;27054 (2000).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFoerster, S. \u003cem\u003eet al.\u003c/em\u003e The fatty acid binding protein FABP7 is required for optimal oligodendrocyte differentiation during myelination but not during remyelination. Glia 68, 1410\u0026ndash;1420 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKagawa, Y. \u003cem\u003eet al.\u003c/em\u003e Role of FABP7 in tumor cell signaling. Adv Biol Regul 71, 206\u0026ndash;218 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUmaru, B. A. \u003cem\u003eet al.\u003c/em\u003e Oleic acid-bound FABP7 drives glioma cell proliferation through regulation of nuclear lipid droplet formation. FEBS J 290, 1798\u0026ndash;1821 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKagawa, Y. \u003cem\u003eet al.\u003c/em\u003e Nuclear FABP7 regulates cell proliferation of wild-type IDH1 glioma through caveolae formation. Mol Oncol 16, 289\u0026ndash;306 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNagao, K. \u003cem\u003eet al.\u003c/em\u003e Fatty acid binding protein 7 may be a marker and therapeutic targets in clear cell renal cell carcinoma. BMC Cancer 18, (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUmaru, B. A. \u003cem\u003eet al.\u003c/em\u003e Ligand Bound Fatty Acid Binding Protein 7 (FABP7) Drives Melanoma Cell Proliferation Via Modulation of Wnt/β-Catenin Signaling. Pharm Res 38, 479\u0026ndash;490 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoto, Y. \u003cem\u003eet al.\u003c/em\u003e Aberrant Fatty Acid-Binding Protein-7 Gene Expression in Cutaneous Malignant Melanoma. Journal of Investigative Dermatology 130, 221\u0026ndash;229 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSlipicevic, A. \u003cem\u003eet al.\u003c/em\u003e The fatty acid binding protein 7 (FABP7) is involved in proliferation and invasion of melanoma cells. BMC Cancer 8, 1\u0026ndash;13 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoto, Y. \u003cem\u003eet al.\u003c/em\u003e A New Melanoma Antigen Fatty Acid\u0026ndash;Binding Protein 7, Involved in Proliferation and Invasion, Is a Potential Target for Immunotherapy and Molecular Target Therapy. Cancer Res 66, 4443\u0026ndash;4449 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeliger, B., Wollscheid, U., Momburg, F., Blankenstein, T. \u0026amp; Huber, C. Characterization of the Major Histocompatibility Complex Class I Deficiencies in B16 Melanoma Cells1. Cancer Res 61, 1095\u0026ndash;1099 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu, J., Lamouille, S. \u0026amp; Derynck, R. TGF-β-induced epithelial to mesenchymal transition. Cell Research 2009 \u003cem\u003e19:2\u003c/em\u003e 19, 156\u0026ndash;172 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFidler, I. J. Selection of Successive Tumour Lines for Metastasis. \u003cem\u003eNature New Biology 1973 242:118\u003c/em\u003e 242, 148\u0026ndash;149 (1973).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHill, R. P., Chambers, A. F., Ling, V. \u0026amp; Harris, J. F. Dynamic Heterogeneity: Rapid Generation of Metastatic Variants in Mouse B16 Melanoma Cells. Science (1979) 224, 998\u0026ndash;1001 (1984).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZadoorian, A., Du, X. \u0026amp; Yang, H. Lipid droplet biogenesis and functions in health and disease. \u003cem\u003eNature Reviews Endocrinology 2023 19:8\u003c/em\u003e 19, 443\u0026ndash;459 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBensaad, K. \u003cem\u003eet al.\u003c/em\u003e Fatty Acid Uptake and Lipid Storage Induced by HIF-1α Contribute to Cell Growth and Survival after Hypoxia-Reoxygenation. Cell Rep 9, 349\u0026ndash;365 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVaziri-Gohar, A. \u003cem\u003eet al.\u003c/em\u003e Limited nutrient availability in the tumor microenvironment renders pancreatic tumors sensitive to allosteric IDH1 inhibitors. \u003cem\u003eNature Cancer 2022 3:7\u003c/em\u003e 3, 852\u0026ndash;865 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMunir, R., Lisec, J., Swinnen, J. V \u0026amp; Zaidi, N. Lipid metabolism in cancer cells under metabolic stress. Br J Cancer 120, 1090\u0026ndash;1098 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQuail, D. F. \u0026amp; Joyce, J. A. Microenvironmental regulation of tumor progression and metastasis. \u003cem\u003eNature Medicine 2013 19:11\u003c/em\u003e 19, 1423\u0026ndash;1437 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAvagliano, A. \u003cem\u003eet al.\u003c/em\u003e Metabolic Plasticity of Melanoma Cells and Their Crosstalk With Tumor Microenvironment. Front Oncol 10, (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarzagalli, M., Ebelt, N. D. \u0026amp; Manuel, E. R. Unraveling the crosstalk between melanoma and immune cells in the tumor microenvironment. Semin Cancer Biol 59, 236\u0026ndash;250 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCurrie, E., Schulze, A., Zechner, R., Walther, T. C. \u0026amp; Farese, R. V. Cellular Fatty Acid Metabolism and Cancer. Cell Metab 18, 153\u0026ndash;161 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFalletta, P. \u003cem\u003eet al.\u003c/em\u003e Translation reprogramming is an evolutionarily conserved driver of phenotypic plasticity and therapeutic resistance in melanoma. Genes Dev 31, 18\u0026ndash;33 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, D. \u0026amp; Dubois, R. N. Eicosanoids and cancer. \u003cem\u003eNature Reviews Cancer 2010 10:3\u003c/em\u003e 10, 181\u0026ndash;193 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKagawa, Y. \u003cem\u003eet al.\u003c/em\u003e Fatty acid-binding protein 7 regulates function of caveolae in astrocytes through expression of caveolin-1. Glia 63, 780\u0026ndash;794 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRazani, B. \u003cem\u003eet al.\u003c/em\u003e Caveolin-1 Regulates Transforming Growth Factor (TGF)-β/SMAD Signaling through an Interaction with the TGF-β Type I Receptor. Journal of Biological Chemistry 276, 6727\u0026ndash;6738 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCano, A. \u003cem\u003eet al.\u003c/em\u003e The transcription factor Snail controls epithelial\u0026ndash;mesenchymal transitions by repressing E-cadherin expression. \u003cem\u003eNature Cell Biology 2000 2:2\u003c/em\u003e 2, 76\u0026ndash;83 (2000).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, H. \u003cem\u003eet al.\u003c/em\u003e TGF-β-activated SMAD3/4 complex transcriptionally upregulates N-cadherin expression in non-small cell lung cancer. Lung Cancer 87, 249\u0026ndash;257 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan, S., Norgard, R. J. \u0026amp; Stanger, B. Z. Cellular plasticity in cancer. Cancer Discov 9, 837\u0026ndash;851 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark, S. M., Gaur, A. B., Lengyel, E. \u0026amp; Peter, M. E. The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. Genes Dev 22, 894\u0026ndash;907 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdelwahab, S. A. \u003cem\u003eet al.\u003c/em\u003e Localization of brain-type fatty acid-binding protein in Kupffer cells of mice and its transient decrease in response to lipopolysaccharide. Histochem Cell Biol 119, 469\u0026ndash;475 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKagawa, Y. \u003cem\u003eet al.\u003c/em\u003e Mitochondrial dysfunction in GnRH neurons impaired GnRH production. Biochem Biophys Res Commun 530, 329\u0026ndash;335 (2020).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Melanoma, Fatty Acid-Binding Protein 7, Adaptation, Physiological, Neoplasm Metastasis, Lipid Metabolism","lastPublishedDoi":"10.21203/rs.3.rs-4767873/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4767873/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMelanoma possesses the characteristic phenotypic plasticity, enhancing its metastatic formation and drug resistance. Lipid and fatty acid metabolism are usually altered to support melanoma progression and can be targeted for therapeutic development. Fatty acid binding protein 7 (FABP7) is highly expressed in melanomas and is shown to support its proliferation, migration, and invasion, but the mechanisms remain unclear. Our study aimed to link FABP7 to lipid metabolism and phenotypic shift in melanomas. We established the \u003cem\u003eFabp7\u003c/em\u003e-knockout (KO) B16F10 melanoma cells, which showed an enhanced invasion through matrix-coated membrane, without significant change in proliferation. Similar outcomes were obtained when using RNA interference targeting FABP7. \u003cem\u003eFabp7\u003c/em\u003e-KO cells injected into mice exhibited slower primary tumor growth, but formed higher metastatic foci count in the lungs. We also discovered a higher saturation in overall lipids, phosphatidylcholines, and triacylglycerols. We observed transcriptional shifts toward the invasive MITF\u003csup\u003eLow\u003c/sup\u003e/AXL\u003csup\u003eHigh\u003c/sup\u003e phenotype, with upregulation of transforming growth factor-beta (TGF-β) receptor mRNAs. In conclusion, FABP7 may help balancing lipid saturation and maintain the proliferative state of melanomas, mitigating invasiveness and metastatic formation.\u003c/p\u003e","manuscriptTitle":"Loss of fatty acid-binding protein 7 enhances metastasis in B16F10 melanoma cells through phenotypic shift","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-20 14:18:07","doi":"10.21203/rs.3.rs-4767873/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-10-19T11:03:33+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-17T11:00:28+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"144138297236941476156001109749132373107","date":"2024-10-06T06:31:55+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-08-14T03:43:01+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"74648188141402479596644754171104469944","date":"2024-08-06T19:48:14+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-08-06T07:29:25+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-08-06T07:17:21+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-07-26T17:47:20+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-07-23T14:50:33+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-07-19T12:18:56+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8cb4fda9-8f67-4bbe-920d-05fd6f818c29","owner":[],"postedDate":"August 20th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":36018333,"name":"Biological sciences/Cancer/Skin cancer/Melanoma"},{"id":36018334,"name":"Biological sciences/Biochemistry/Lipids/Fatty acids"},{"id":36018335,"name":"Health sciences/Diseases/Cancer/Skin cancer/Melanoma"},{"id":36018336,"name":"Biological sciences/Cell biology/Mechanisms of disease"},{"id":36018337,"name":"Biological sciences/Cancer/Metastases"},{"id":36018338,"name":"Biological sciences/Biochemistry/Lipidomics"}],"tags":[],"updatedAt":"2025-03-31T16:10:17+00:00","versionOfRecord":{"articleIdentity":"rs-4767873","link":"https://doi.org/10.1038/s41598-024-80874-5","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-03-26 15:57:37","publishedOnDateReadable":"March 26th, 2025"},"versionCreatedAt":"2024-08-20 14:18:07","video":"","vorDoi":"10.1038/s41598-024-80874-5","vorDoiUrl":"https://doi.org/10.1038/s41598-024-80874-5","workflowStages":[]},"version":"v1","identity":"rs-4767873","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4767873","identity":"rs-4767873","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00