Detection of Antibiotic Resistance Genes in Vibrio cholerae isolated from Human Fecal samples during a Diarrheal Outbreak in Peshawar, Pakistan

preprint OA: closed
Full text JSON View at publisher
Full text 116,350 characters · extracted from preprint-html · click to expand
Detection of Antibiotic Resistance Genes in Vibrio cholerae isolated from Human Fecal samples during a Diarrheal Outbreak in Peshawar, Pakistan | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Detection of Antibiotic Resistance Genes in Vibrio cholerae isolated from Human Fecal samples during a Diarrheal Outbreak in Peshawar, Pakistan Jawad Ahmad, Hafiza Misbah Ahmad, Muhammad Atif, Aiman Waheed This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7072088/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Vibrio cholerae , the etiological agent of cholera, remains a significant public health concern in several regions of Khyber Pakhtunkhwa, Pakistan. Cholera is characterized by acute watery diarrhea, which can lead to severe dehydration and death if left untreated. Contributing factors to outbreaks in Khyber Pakhtunkhwa include poor sanitation, limited access to clean drinking water, and overcrowded living conditions. This study aimed to determine the prevalence, antimicrobial susceptibility patterns, and molecular characterization of V. cholerae during a diarrheal outbreak in Peshawar, Pakistan, in July 2023. A total of 45 stool samples were collected from patients suffering from diarrhea. Samples were cultured on Thiosulfate-Citrate-Bile-Sucrose agar. Isolates were identified using standard biochemical tests, followed by molecular confirmation through PCR amplification of the 16S rRNA gene. Biochemical tests confirmed 34 (75.55%) isolates as V. cholerae . The highest infection rate was observed in the age group of ≤ 18 years (64.70%), with a higher frequency in male patients (79.41%). Antibiotic susceptibility test using the Kirby-Bauer disc diffusion method revealed multidrug resistance in 13 isolates, showing resistance to at least three distinct antibiotic classes. Sequencing and phylogenetic analysis of the 16S rRNA gene confirmed the multidrug resistant isolates as V. cholerae . The isolates exhibited high resistance to ERY (100%), LVX (100%), AZM (92.85%), TET (88.89%), SXT (80%), AMP (75%), and CRO (75%). Conversely, CIP (53.84%), AMK (61.53%), and MEM (81%) showed the highest susceptibility. Statistical analysis revealed no significant association between V. cholerae infection and age groups. The molecular analysis of Vibrio cholerae isolates revealed a significant prevalence of antibiotic resistance genes linked to various antibiotics classes, emphasizing the multi-drug resistant characteristics of Vibrio cholerae . PCR-based molecular characterization of multi-drug resistant isolates demonstrated higher prevalence of resistance genes including dfrA1 (92.3%), sul1 (92.3%), sul2 (76.9%), tetA (76.9%), blaTEM (84.6%), blaCTX-M (69.2%), blaOXA (61.5%), blaSHV (38.5%), and mcr-1 (53.8%). The identification of mcr-1 is especially alarming because of its correlation with COL resistance. The findings highlight the alarming pattern of multidrug resistance in V. cholerae isolates from Peshawar, emphasizing the need for effective surveillance and control measures to combat the spread of antibiotic resistant strains. Vibrio cholerae prevalence Antibiotic susceptibility test multi-drug resistant MEM Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction The causative agent of cholera, Vibrio cholerae ( V. cholerae ), remains a serious public health concern in many developing countries, particularly in areas lacking access to clean water, and proper sanitation. Cholera is an acute diarrheal infection caused by ingestion of food or water contaminated with specific serogroups of V. cholerae , namely O1 or O13 (Kaper et al., 2014 ). The illness is characterized by vomiting, watery diarrhea, and a rapid onset. If left untreated, severe dehydration can result in death (Kumar and Sharma, 2014 ). Due to the fecal-oral transmission of the bacterium V. cholerae , hygiene play a vital role in preventing the spread of the disease (Kanjilal et al., 2010 ). Water contamination, inadequate sewage disposal, and poor food handling practices often contribute to outbreaks. With its ability to persist in aquatic environments and the ability to form biofilms, V. cholerae contributes to its environmental resilience and poses ongoing transmission risks. According to the World Health Organization, improving access to safe drinking water, sanitation, and hygiene interventions is crucial for the effective control and prevention of cholera (Taylor et al., 2015 ). The threat of cholera persists despite advancements in medical treatment, especially in regions suffering from poverty, conflict, and natural disasters. Implementing effective control measures requires an understanding of the epidemiology of V. cholerae and its antimicrobial resistance profile (Zaman et al., 2020 ). It is estimated that cholera affects between 1.3 and 4.0 million people worldwide each year, causing 21,000 to 143,000 deaths (Asumah et al., 2023 ). A disproportionate number of cholera cases are reported in Sub-Saharan Africa and South-East Asia, highlighting the persistent challenges in these regions (Ali et al., 2015 ). Like many other developing nations, Pakistan faces ongoing challenges related to waterborne diseases, such as cholera which accounts for approximately 40% of all illnesses, and contribute to 20–40% of hospitalizations nationwide (Khan and Mohsin, 2021 ). There are several factors that contribute to the persistence and spread of V. cholerae , including climate change, urbanization, and inadequate facilities. Changing rainfall patterns and surface air temperatures may increase the risk of diarrheal diseases due to increased levels of waterborne pathogens. A serious concern for Pakistan is the frequency of tropical cyclone activity in the Arabian Sea, as much of the country's industrial infrastructure is located in Karachi, a coastal city that is highly vulnerable to tropical cyclones. The first case of V. cholerae in Pakistan was reported in 1994, but the number has now exceeded thousands. Studies have demonstrated that V. cholerae is prevalent in various regions of Pakistan, illustrating the need for continuous surveillance and monitoring. Furthermore, the effectiveness of treatment is significantly threatened by the emergence of antibiotic resistance in V. cholerae isolates (Kaper et al., 2014 ). As resistance increases, infections can become more difficult to treat, resulting in higher morbidity, mortality, and healthcare costs. Despite the fact that V. cholerae prevalence and molecular epidemiology have been the subject of numerous studies in Pakistan, a substantial gap remains about its origins and patterns of antimicrobial resistance (AMR) in the Khyber Pakhtunkhwa (KP) province. V. cholerae O1 strains have been frequently identified in coastal or flood-prone areas of Sindh and Punjab, especially in cities like Karachi and Lahore, where previous surveillance efforts have primarily focused. In contrast, despite growing reports of waterborne outbreaks associated with poor sanitation systems and contaminated drinking water, data from KP remains scarce. Unlike previous studies that highlighted the genetic variety of O1 and non-O1 strains mainly in the southern regions, the current study shows a concerning shift towards more resistant and possibly hyper virulent genotypes circulating in northern Pakistan (Hussain et al., 2024 ). Significantly, this study reveals substantial levels of resistance to widely used frontline antibiotics, such as AMP, ERY, and TET, which contrasts significantly with national trends where these drugs have historically maintained their therapeutic efficacy. These results highlight the critical need for region-specific research to guide empirical treatment plans and assist with public health initiatives aimed to KP's particular geographic, socioeconomic, and climatic circumstances. This study aimed to examine the prevalence of V. cholerae in stool samples collected from diarrheal patients in Peshawar, a district of KP, Pakistan during an outbreak in July 2023. Additionally, the study aimed to determine the AMR profile of the isolated V. cholerae , providing valuable insights into the current resistance conditions in the region. Data collected during this particular period provide useful insights into regional patterns in cholera cases. Findings of this study can be used to inform public health interventions and guide effective treatment strategies to address the problem of cholera by identifying the circulating V. cholerae strains and their susceptibility profiles. 2. Methodology 2.1 Sample Collection A total of 45 patients presenting with acute watery diarrhea were enrolled during the peak of the July 2023 outbreak in Peshawar. These patients represented the complete cohort of cases who visited the health facility and consented to participate during the outbreak period, providing a representative snapshot of the affected population. Inclusion criteria were: patients of all age groups presenting with symptoms of acute diarrhea within 48 hours of onset and no recent history of antibiotic use. Exclusion criteria included: prior antibiotic intake within the last 7 days, hospitalization for unrelated illnesses, or lack of informed consent. To collect samples, each participant received a screw-capped universal container with a wide mouth that was dry and clean. The labels were carefully attached, and each sample was assigned a unique laboratory number. Within one to three hours of being collected, the samples were taken to the laboratory for processing. This study was approved by the Institutional Research Ethics Committee of the Hayatabad Medical Complex, Peshawar. Written informed consent was obtained from all participants or their guardians in the case of minors. 2.2 Bacterial isolation and Identification Following three hours of incubation, the samples were cultured on Thiosulphate Citrate Bile Sucrose Agar (TCBS) media after being inoculated into an alkaline peptone water broth for enrichment. The culture plates were examined for the growth of V. cholerae after being incubated for 24 hours at 37°C. Biochemical assays such as Voges-Proskauer, Methyl Red, and Indole were conducted along with Gram staining (Zereen et al., 2019 ). 2.3 Antibiotic Susceptibility Test Antibiotic susceptibility of V. cholerae isolates was determined using the Kirby-Bauer disc diffusion method, following the guidelines of the Clinical Laboratory Standards Institute (CLSI, M100-S23, 2018). Bacterial cultures were harvested using a sterile loop and suspended in alkaline peptone water (APW), followed by incubation at 37°C for 2 hours. The resulting cultures were adjusted to match the 0.5 McFarland turbidity standard (approximately 1.5 × 10⁸ CFU/mL) to prepare the inoculum for testing. A sterile swab was used to uniformly lawn the bacterial suspension onto Mueller-Hinton agar (MHA) plates. Antibiotic-impregnated discs were placed on the surface of the agar, and the plates were incubated at 37°C for 18–24 hours. Following incubation, the diameters of the zones of inhibition were measured and interpreted according to CLSI standards (Raveendran et al., 2008 ), (Islam et al., 2008 ). The antibiotics included: COL; Colistin, CTZ; Ceftazidime, AMK; Amikacin, CFM; Cefixime, LVX; Levofloxacin, ERY; Erythromycin, SXT; Trimethoprim-Sulfamethoxazole, CIP; Ciprofloxacin, AZM; Azithromycin, TET; Tetracycline, AMP; Ampicillin, MEM; Meropenem, CRO; Ceftriaxone. MDR was defined as resistance to at least one agent in three or more antimicrobial categories, as per the criteria established by Magiorakos et al., ( 2012 ). 2.4 PCR and Sequencing of 16s rRNA gene The V. cholerae strains were cultured in the Tryptic soy broth (TSB) with 2% NaCl (pH 8.0) at 37°C until reached the mid logarithmic growth phase. Bacterial cells were harvested at 2700 g for 10 minutes at 4°C. Genomic DNA was extracted using the TIAN amp Bacteria DNA Kit (Tiangen Biochemical Technology Co., Ltd., Beijing, China) and subsequently examined. The 16S rRNA gene was amplified using universal primers 27F (5′-GGTTGGCCAATCTACTCCCAGG-3′) and 1492R (5′-TGGTCTCCTTAAACCTGTCTT-3′) (Kai et al., 2019 ). Each PCR reaction consisted of 5 µl of template DNA, 2.5 µl of each primer (forward and reverse), 25 µl of master mix, and 14 µl of PCR-grade water, making a total reaction volume of 49 µl. The PCR cycling conditions included an initial denaturation at 94°C for 1 minute, followed by 30 cycles of denaturation at 94°C for 1 minute, annealing at 54°C for 1 minute, and extension at 72°C for 3 minutes. A final extension was carried out at 72°C for 1 minute. The 16S rRNA gene of V. cholerae isolates was amplified individually by PCR, followed by purification and sequencing. Sequence data were analyzed using the Basic Local Alignment Search Tool (BLAST) available from the National Center for Biotechnology Information (NCBI) to identify homologous sequences. Multiple sequence alignment was performed using Clustal W in MEGA version 11, and The phylogenetic tree of 13 V. cholerae isolates was constructed using the maximum likelihood method to assess the genetic relationships of the V. cholerae isolates with reference strains (Dhillon et al., 2003 ; Sun et al., 2024 ). 2.5 Detection of Antimicrobial Resistance Genes by PCR The polymerase chain reaction was performed for detecting significant antimicrobial resistance genes in V. cholerae isolates, targeting a set of genes associated with resistance towards the used antibiotic classes. The examined genes included tetA (TET resistance), dfrA1 (Trimethoprim resistance), sul1 and sul2 (Sulfonamide resistance), blaTEM , blaCTX-M , blaOXA , and blaSHV (β-lactam resistance), and mcr-1 , which confers resistance to COL. Gene-specific primers were used according to confirmed sequences reported in the literature (Table 1 ). Each 25 µl PCR reaction contained 12.5 µl of PCR master mix (including Taq DNA polymerase, dNTPs, and MgCl₂), 1 µl of forward primer, 1 µl of reverse primer (10 pmol/µl), 2 µl of extracted genomic DNA, and 8.5 µl of nuclease-free water. Thermal cycling conditions were defined as follows: an initial denaturation at 95°C for 5 minutes; 35 amplification cycles including denaturation at 95°C for 30 seconds, primer annealing at 55°C for 30 seconds, and extension at 72°C for 1 minute; followed by a final extension at 72°C for 5 minutes. Each PCR cycle used positive controls (DNA from previously verified resistant strains) and a negative control lacking of template DNA to ensure result precision and minimize contamination or false-positive results (Colom et al., 2003 ). 2.6 Statistical Analysis The data were analyzed using SPSS software (version 17.0, SPSS Inc., Chicago, IL, USA). A chi-square test of independence was performed to evaluate the association between V. cholerae positivity and age groups categorized as ≤ 18 years, 19–40 years, and > 40 years. To further investigate the distribution of observed frequencies, a post hoc analysis using standardized residuals was conducted to identify any significant deviations within specific age categories. Table 1 Primers used in the study. Target Genes Sequence (5’ 3’) Product size (bp) Reference tetA F GGCGGTCTTCTTCATCATGC R CGGCAGGCAGAGCAAGTAGA 210 (Aslam et al., 2012 ) dfrA1 F ATGATGAAAACGGCGGAAC R TTATTTCTCGGCGAACGCC 267 (Koo, 2003 ) sul1 F CGGCGTGGGCTACCTGAACG R GCCGATCGCGTGAAGTTCCG 432 (Hu et al., 2005 ) sul2 F TCCGGTGGAGGCCGGTATCTGG R CGGGAATGCCATCTGCCTTGAG 293 (Dean et al., 2003 ) blaTEM F ATGAGTATTCAACATTTCCG R CCAATGCTTAATCAGTGAGC 867 (Colom et al., 2003 ) blaCTX-M F SCSATGTGCAGYACCAGTAA R CCGCRATATGRTTGGTGGTG 550 (Dallenne et al., 2010 ) blaOXA F ACACAATACATATCAACTTCGC R AGTGTGTTTAGAATGGTGATC 813 (Colom et al., 2003 ) blaSHV F TCAGCGAAAAACACCTTG R CCCGCAGATAAATCACCAC 768 (Colom et al., 2003 ) mcr-1 F AGTCCGTTTGTTCTTGTGGC R AGATCCTTGGTCTCGGCTTG 309 (Liu et al., 2016 ) 3. Results 3.1 Occurrence of V. cholerae in Peshawar Out of 45 stool culture samples, 39 samples showed growth where 34 (75.55%) were reported as V. cholerae during the study. PCR amplification confirmed these isolates as V. cholerae . The study evaluated the prevalence of infection in the population according to age and gender. The age group of ≤ 18 years had the highest infection rate at 22 (64.70%). The age group of 19–40 years and the age group of over 40 years both had 6 (17.64%) positive cases. Moreover, frequency of male patients was higher 27 (79.41%) than female 7 (20.58%). The percentage was calculated in the total of 34 positive V. cholerae cases (Fig. 1 ). In order to evaluate the isolates' patterns of antibiotic resistance and investigate the association between V. cholerae infection and demographic characteristics, a thorough statistical analysis was conducted. A post-hoc residual analysis confirmed that no particular age group contributed disproportionately to the observed distribution, and a chi-square test of independence showed no significant correlation between infection status and age groups (χ² = 0.042, p = 0.979). However, the small subgroup sizes may have limited the statistical power of the test, and the non-significant associations should be interpreted with caution. 3.2 Antibiotic Susceptibility Test The antibiotic susceptibility showed that 13 isolates exhibited multidrug resistance, demonstrating resistance to at least three distinct classes of antibiotics. These MDR isolates were further characterized through 16S rRNA gene sequencing. Isolate 6, 8, 10, 13, 15, 17, 19, 20, 22, 25, 26, 29 and 32 were observed MDRs showing resistance to at least one agent in three or more antimicrobial categories (Fig. 2 ). 3.3 16S rRNA Gene Sequencing and phylogenetic identification The amplified PCR products were subjected to sequencing. After the construction of phylogenetic tree using MEGA 11 software, the selected MDR isolates were observed V. cholerae . Figure 3 illustrates the phylogenetic tree for the isolated strain, constructed with the BLAST search tool from the NCBI, based on the analysis of the 16S rRNA sequence and the homology among the 16S rRNA sequences of the registered strains. The accession numbers were given as (PV789514.1 - PV789526.1) 3.4 Antimicrobial Resistance Profile of V. cholerae isolates According to the 2018 Clinical and Laboratory Standards Institute (CLSI) standards, the Kirby-Bauer disc diffusion method was used to assess the antimicrobial susceptibility of V. cholerae isolates. A zone size between the two cut-offs was regarded as intermediate, a zone diameter of less than or equal to 16 mm as resistant, and a zone diameter of less than or equal to 12 mm as sensitive. A total of thirteen antibiotics were tested against V. cholerae isolates, revealing a concerning trend of extensive antimicrobial resistance. The isolates exhibited complete resistance (100%) to ERY and LVX, indicating no therapeutic efficacy of these agents. High resistance levels were also observed against AZM (92.85%), TET (88.89%), SXT (80%), AMP (75%), and CRO (75%). COL although not commonly used for V. cholerae , showed 66.67% resistance, highlighting its limited potential. CFM also demonstrated notable resistance at 33.33%. In contrast, MEM emerged as the most effective antibiotic, showing 81% susceptibility, followed by AMK (61.53%) and CIP (53.84%). Moderate susceptibility was noted for CTZ (33.33%). Overall, the isolates from Peshawar reflect a MDR profile, highlighting the urgency of ongoing surveillance and rational antibiotic stewardship to manage cholera infections effectively (Fig. 4 ). 3.5 PCR Detection of Antimicrobial Resistance Genes The molecular analysis of V. cholerae isolates revealed a significant prevalence of antibiotic resistance genes linked to various antibiotics classes, emphasizing the MDR characteristics of V. cholerae (Fig. 5 ). Of the 13 isolates examined, the dfrA1 gene, responsible for Trimethoprim resistance, was detected in 92.30% of the isolates, indicating significant resistance to folate pathway inhibitors. The Sulfonamide resistance genes sul1 and sul2 were detected in 92.30% and 76.92% of the isolates, respectively, exhibiting a broad distribution of alternative dihydropteroate synthase genes. The tetA gene, which confers TET resistance through efflux mechanisms, was detected in 76.92% of isolates, highlighting the persistent prevalence of plasmid-mediated TET resistance. Resistance to β-lactam antibiotics was evidenced by the identification of blaTEM (84.61%), blaCTX-M (69.23%), blaOXA (61.53%), and blaSHV (38.46%), showing numerous enzymatic pathways that inactivate Penicillin’s and extended-spectrum Cephalosporin. The identification of mcr-1 in 53.84% of the isolates is particularly alarming, as it is a plasmid-mediated COL resistance gene associated with the failure of last-resort antibiotics (Fig. 6 ). 4. Discussion In the present study, there was a significant prevalence of V. cholerae in stool samples from patients in Peshawar, with 75.55% of culture-positive samples being identified as V. cholerae . It is evident from the findings that cholera poses a continuing public health threat in this region. According to the age distribution of infected individuals, younger populations were more vulnerable, possibly because of factors such as hygiene practices, exposure to contaminated water, and immune status. Statistical analysis revealed no significant correlation between infection status and age groups. Although the highest number of cases was observed in the youngest age group, other age groups were also notably affected. These findings underscore the need for a comprehensive public health strategy targeting all age demographics. There were more male patients (79.41%) than female patients (20.58%), suggesting that there may be gender-related differences in exposure, health-seeking behavior, or susceptibility to infection. Comparing our findings with previous studies, several contextual similarities and differences emerged. According to studies, low socioeconomic groups are more likely to contract cholera. There may be a lack of access to clean water and sanitation facilities, as well as poor hygiene practices. Studies have demonstrated that cholera is an endemic and recurring issue in South Asian regions, where inadequate sanitation and limited access to clean drinking water remain major factors (Ramamurthy and Sharma, 2014 ). Recent studies from South Asia have reported similar findings. Mohanty et al., ( 2024 ) highlighted emerging resistance to macrolides and TETs in India, while Hussain et al., ( 2024 ) identified high prevalence of ESBL-producing V. cholerae in Baluchistan, Pakistan. These trends support our findings and further emphasize the urgency for regional antimicrobial stewardship programs. In addition to the remarkably high rate observed in this study, it is possible that localized outbreaks or environmental reservoirs facilitate continuous transmission. A distribution of cases based on age revealed that 64.70% of those infected were under the age of 18, highlighting the vulnerability of young people. The results of this study are consistent with previous reports showing that children and adolescents are disproportionately affected by cholera because of their increased exposure to unsafe water sources, insufficient hand hygiene, and weakened immunity (Deen et al., 2008 ; Qadri et al., 2005 ). A statistical analysis, however, indicated that no significant correlation exists between age group and infection status, suggesting that while young individuals are more susceptible to infection, susceptibility extends to individuals of all ages. Hence, in high-risk areas, public health interventions should be universal rather than age-specific. It is noteworthy that the study indicated a gender disparity, with 79.41% of cases involving male patients. According to some epidemiological studies (Nelson et al., 2009 ), males have higher infection rates due to occupational exposure or behavioral patterns. This finding also raises the question of possible underreporting or reduced health seeking behavior among females, a phenomenon commonly documented in conservative or resource-constrained settings. Further research is required to determine whether these patterns are the result of exposure differences or of systemic barriers to healthcare access. The antimicrobial susceptibility profile of V. cholerae isolates from human fecal samples in Peshawar demonstrated a concerning pattern of significant resistance to several routinely used antibiotics. The complete resistance to ERY (100%) and LVX (100%) observed in this study is particularly alarming, as both antibiotics are frequently used in the control of severe diarrheal infections and cholera outbreaks. Bhattacharya et al., ( 2012 ) reported similar findings in India, where V. cholerae isolates demonstrated significant resistance to macrolides and fluoroquinolones, highlighting the global increase of resistant V. cholerae isolates. The resistance to AZM (92.85%), another macrolide, further emphasizes this pattern. Despite AZM being recommended for cholera treatment due to its effectiveness and pharmacokinetic properties (Mohanraj and Mandal, 2022 ), the nearly total resistance reported currently indicates a possible alteration in regional susceptibility patterns, potentially resulting from the overuse or misuse of macrolides in medication. Significant resistance rates were observed against TET (88.89%) and SXT (80%), both of which have been included in the WHO's recommended treatments for cholera, particularly in regions with limited resources. The observed resistance to AMP (75%) and the third-generation cephalosporin CRO (75%) in this study relates to earlier research conducted in Bangladesh and Nigeria, where V. cholerae isolates possessed β-lactamase genes, such as blaCTX-M , blaSHV , and blaOXA , frequently located on plasmids or integrative conjugative elements (Mogessie et al., 2024 ). These genetic factors not only provide resistance to β-lactams but also promote horizontal gene transfer, contributing in the spread of multidrug resistance among enteric bacteria. Despite COL not being a conventional treatment for cholera, the reported resistance rate of 66.67% is significant. COL resistance in V. cholerae may result from chromosomal mutations or the transfer of mcr genes, as evidenced in environmental and clinical isolates from Asia (Lai et al., 2018 ). The moderate resistance to CFM (33.33%) and CTZ (66.67%) correlates with the widespread distribution of ESBLs among V. cholerae strains, as reported in areas such as Kenya and South India (Mohanty et al., 2024 ). Conversely, MEM exhibited the highest susceptibility (81%), highlighting that Carbapenem continue to be an effective last-resort treatment against MDR V. cholerae strains in this region. Noorian et al., ( 2023 ) demonstrated similar results, indicating that V. cholerae isolates retained Carbapenem sensitivity despite significant resistance to other antibiotics classes. Similarly, AMK (61.53%) and CIP (53.84%) showed significant efficacy; nevertheless, the decreasing susceptibility to CIP poses issues regarding the potential establishment of fluoroquinolone-resistant mutations in the gyrA and parC genes (Son et al., 2018 ). Compared to research conducted in other endemic regions, the findings of this study are similar. According to Lawrence Grant et al., ( 2023 ), individuals from low-income households are significantly more likely to contract cholera due to substandard living conditions. Ali et al., ( 2015 ) also found an association between socio-demographic factors such as income, education level, and gender, as well as household water treatment practices in cholera-endemic areas. It is likely that these socioeconomic factors play a role in the regional patterns observed in our study, where infrastructure deficiencies and inequalities in public health access contribute to the vulnerability of populations. The study provides significant insights on the prevalence, antibiotic resistance trends, and demographic distribution of V. cholerae during the 2023 outbreak in Peshawar; yet, several limitations must be acknowledged. Firstly, the sample size was restricted to 45 patients from a single healthcare institution during the outbreak's peak. This cohort offers a glimpse of the impacted community, but the results may not be applicable to the broader region or to cases handled outside formal hospital environments. Secondly, the study employed a cross-sectional design and lacked longitudinal follow-up, thereby limiting the assessment of clinical outcomes, reinfection rates, and the temporal evolution of resistance patterns. Furthermore, environmental samples (e.g., from water sources) were neither collected nor analyzed, which restricted the ability to identify specific sources of infection or evaluate the overall environmental risk factors contributing to transmission. 5. Conclusion According to the current investigation of V. cholerae outbreak in Peshawar, MDR strains are emerging in alarming numbers. An estimated 75.55% of diarrheal patients are affected, primarily children under the age of 18 years. Particularly high resistance rates were observed to ERY, AZM, TET, and AMP. A significant number of isolates, 13 having shown resistance to three or more antibiotic classes, were observed as MDR organisms, which poses a serious public health concern due to the organism's ability to rapidly spread and acquire resistance genes. MEM and AMK retained higher susceptibility rates, but their limited accessibility and high cost may limit routine use in low-resource settings. Molecular confirmation of these isolates by 16S rRNA gene sequencing and the phylogenetic relationship between them further highlight the genetic conservation and potential clonal spread of resistant V. cholerae in the region. To avoid future outbreaks, it is recommended to implement a continuous molecular surveillance program, update antimicrobial management procedures, and improve water and sanitation facilities. Public health officials have to respond instantly to address a number of concerning resistance patterns, which include assessing basic treatment strategies and establishing integrated cholera prevention measures. Declarations Human Ethics and Consent to Participate declarations: In accordance with the Declaration of Helsinki (2013) and the National Bioethics Committee (NBC) of Pakistan, the Institutional Research and Ethical Board (IREB) of Hayatabad Medical Complex, Peshawar, Pakistan, reviewed and approved this study. The approval had been granted on January 8, 2024, under reference number 2168. The need for informed consent was formally waived by the committee as the study involved anonymized, routine diagnostic samples collected as part of standard hospital procedures. In accordance with national ethical guidelines, no identifiable personal or patient information was used, and the data were handled in compliance with ethical standards for biomedical research on human subjects. Consent for publication: Not applicable. Availability of data and materials: The datasets analyzed and/or generated during the current study are not publicly accessible as a result of institutional policies and confidentiality agreements regarding the management of clinical samples. Access to the data will be permitted upon request for academic, non-commercial purposes and with prior approval from the Institutional Research and Ethical Board (IREB) of the Hayatabad Medical Complex in Peshawar. Competing interests: The authors declare that they have no competing interests. Funding: Not applicable. Authors' contributions: Jawad Ahmad supervised the work, conceived and designed the study. Jawad Ahmad and Hafiza Misbah Ahmad conducted the laboratory work and drafted the initial manuscript. Muhammad Atif and Aiman Waheed contributed to statistical analysis and data interpretations. Jawad Ahmad contributed to the final editing and approval of the manuscript. Acknowledgements : Authors are thankful to the Institute of Biotechnology and Genetic Engineering, University of Agriculture Peshawar for providing the research facilities. Clinical trial number: Not applicable. References Ali, M., Nelson, A. R., Lopez, A. L., and Sack, D. A. (2015). Updated Global Burden of Cholera in Endemic Countries. PLOS Neglected Tropical Diseases , 9 (6), e0003832. https://doi.org/10.1371/journal.pntd.0003832 Aslam, M., Checkley, S., Avery, B., Chalmers, G., Bohaychuk, V., Gensler, G., Reid-Smith, R., and Boerlin, P. (2012). Phenotypic and genetic characterization of antimicrobial resistance in Salmonella serovars isolated from retail meats in Alberta, Canada. Food Microbiology , 32 (1), 110–117. https://doi.org/10.1016/j.fm.2012.04.017 Asumah, M. N., Padhi, B. K., and Sinha, A. (2023). Rising cases of cholera in Ethiopia: A need for sustainable wash practices? International Journal of Surgery , 109 (3), 608–609. https://doi.org/10.1097/JS9.0000000000000196 Bhattacharya, D., Sayi, D. S., Thamizhmani, R., Bhattacharjee, H., Bharadwaj, A. P., Roy, A., and Sugunan, A. P. (2012). Emergence of Multidrug-Resistant Vibrio cholerae O1 Biotype El Tor in Port Blair, India. The American Society of Tropical Medicine and Hygiene , 86 (6), 1015–1017. https://doi.org/10.4269/ajtmh.2012.11-0327 Colom, K., Pérez, J., Alonso, R., Fernández-Aranguiz, A., Lariño, E., and Cisterna, R. (2003). Simple and reliable multiplex PCR assay for detection of blaTEM, blaSHV and blaOXA-1 genes in Enterobacteriaceae. FEMS Microbiology Letters , 223 (2), 147–151. https://doi.org/10.1016/S0378-1097(03)00306-9 Dallenne, C., Da Costa, A., Decré, D., Favier, C., and Arlet, G. (2010). Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. Journal of Antimicrobial Chemotherapy , 65 (3), 490–495. https://doi.org/10.1093/jac/dkp498 Dean, C. R., Visalli, M. A., Projan, S. J., Sum, P.-E., and Bradford, P. A. (2003). Efflux-mediated resistance to tigecycline (GAR-936) in Pseudomonas aeruginosa PAO1. Antimicrobial Agents and Chemotherapy , 47 (3), 972–978. https://doi.org/10.1128/AAC.47.3.972-978.2003 Deen, J. L., Von Seidlein, L., Sur, D., Agtini, M., Lucas, M. E. S., Lopez, A. L., Kim, D. R., Ali, M., and Clemens, J. D. (2008). The High Burden of Cholera in Children: Comparison of Incidence from Endemic Areas in Asia and Africa. PLoS Neglected Tropical Diseases , 2 (2), e173. https://doi.org/10.1371/journal.pntd.0000173 Dhillon, A., Teske, A., Dillon, J., Stahl, D. A., and Sogin, M. L. (2003). Molecular Characterization of Sulfate-Reducing Bacteria in the Guaymas Basin. Applied and Environmental Microbiology , 69 (5), 2765–2772. https://doi.org/10.1128/AEM.69.5.2765-2772.2003 Hu, K.-F., Regner, M., Siegrist, C.-A., Lambert, P., Chen, M., Bengtsson, K. L., and Morein, B. (2005). The immunomodulating properties of human respiratory syncytial virus and immunostimulating complexes containing Quillaja saponin components QH-A, QH-C and ISCOPREP TM 703. FEMS Immunology and Medical Microbiology , 43 (2), 269–276. https://doi.org/10.1016/j.femsim.2004.08.010 Hussain, A., Lashari, Y., Mazhar, M., and Department of Pathology, Loralai Medical College Loralai. (2024). Survey of Cholera Outbreak and its Resistant Pattern in Baluchistan, Pakistan. Journal of HBS MandDC , 3 (2), 63–65. https://doi.org/10.70394/jhbsmdc.v3i2.61 Islam, M. J., Sharmin, N., Hasan, Dr. Md. N., and Azad, A. K. (2008). Antimicrobial susceptibility of salmonella serovars isolated from blood. Journal of Innovation and Development Strategy , 2 , 22–27. Kai, S., Matsuo, Y., Nakagawa, S., Kryukov, K., Matsukawa, S., Tanaka, H., Iwai, T., Imanishi, T., and Hirota, K. (2019). Rapid bacterial identification by direct PCR amplification of 16S rRNA genes using the MinION TM nanopore sequencer. FEBS Open Bio , 9 (3), 548–557. https://doi.org/10.1002/2211-5463.12590 Kanjilal, S., Citorik, R., LaRocque, R. C., Ramoni, M. F., and Calderwood, S. B. (2010). A Systems Biology Approach To Modeling Vibrio cholerae Gene Expression under Virulence-Inducing Conditions. Journal of Bacteriology , 192 (17), 4300–4310. https://doi.org/10.1128/JB.00182-10 Kaper, J. B., Fasano, A., and Trucksis, M. (2014). Toxins of Vibrio cholerae . In I. Kaye Wachsmuth, P. A. Blake, and Ø. Olsvik (Eds.), Vibrio cholerae and Cholera (pp. 143–176). ASM Press. https://doi.org/10.1128/9781555818364.ch11 Khan, I., and Mohsin, S. (2021). Microbiological Analysis of Drinking Water from Different Areas of Lahore. International Journal of Economic and Environmental Geology , 12 (3), 44–47. https://doi.org/10.46660/ijeeg.Vol12.Iss3.2021.620 Koo, H. (2003). Inhibition of Streptococcus mutans biofilm accumulation and polysaccharide production by apigenin and tt-farnesol. Journal of Antimicrobial Chemotherapy , 52 (5), 782–789. https://doi.org/10.1093/jac/dkg449 Kumar, M., and Sharma, V. L. (2014). Outbreak Investigation of Cholera in a Slum of Northern India. Open Journal of Epidemiology , 04 (04), 243–247. https://doi.org/10.4236/ojepi.2014.44031 Lai, C.-C., Lin, Y.-T., Lin, Y.-T., Lu, M.-C., Shi, Z.-Y., Chen, Y.-S., Wang, L.-S., Tseng, S.-H., Lin, C.-N., Chen, Y.-H., Ko, W.-C., Wang, F.-D., and Hsueh, P.-R. (2018). Clinical characteristics of patients with bacteraemia due to the emergence of mcr-1-harbouring Enterobacteriaceae in humans and pigs in Taiwan. International Journal of Antimicrobial Agents , 52 (5), 651–657. https://doi.org/10.1016/j.ijantimicag.2018.08.015 Lawrence Grant, S., Lange, S., Almeida, S., Hoque, B., and Kjær Mackie Jensen, P. (2023). Influence of Seasonal Hazards on Water, Sanitation, and Hygiene–Related Behavior and Implications for Cholera Transmission in Bangladesh. The American Journal of Tropical Medicine and Hygiene , 108 (3), 518–523. https://doi.org/10.4269/ajtmh.21-0708 Liu, Y.-Y., Wang, Y., Walsh, T. R., Yi, L.-X., Zhang, R., Spencer, J., Doi, Y., Tian, G., Dong, B., Huang, X., Yu, L.-F., Gu, D., Ren, H., Chen, X., Lv, L., He, D., Zhou, H., Liang, Z., Liu, J.-H., and Shen, J. (2016). Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: A microbiological and molecular biological study. The Lancet Infectious Diseases , 16 (2), 161–168. https://doi.org/10.1016/S1473-3099(15)00424-7 Magiorakos, A.-P., Srinivasan, A., Carey, R. B., Carmeli, Y., Falagas, M. E., Giske, C. G., Harbarth, S., Hindler, J. F., Kahlmeter, G., Olsson-Liljequist, B., Paterson, D. L., Rice, L. B., Stelling, J., Struelens, M. J., Vatopoulos, A., Weber, J. T., and Monnet, D. L. (2012). Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clinical Microbiology and Infection , 18 (3), 268–281. https://doi.org/10.1111/j.1469-0691.2011.03570.x Mogessie, H., Legesse, M., Hailu, A. F., Teklehaymanot, T., Alemayehu, H., Abubeker, R., and Ashenafi, M. (2024). Vibrio cholerae O1 and Escherichia coli O157:H7 from drinking water and wastewater in Addis Ababa, Ethiopia. BMC Microbiology , 24 (1), 219. https://doi.org/10.1186/s12866-024-03302-8 Mohanraj, R. S., and Mandal, J. (2022). Azithromycin can induce SOS response and horizontal gene transfer of SXT element in Vibrio cholerae. Molecular Biology Reports , 49 (6), 4737–4748. https://doi.org/10.1007/s11033-022-07323-2 Mohanty, A., Lakra, N., and Mandal, J. (2024). Trends and antibiotic susceptibility patterns of diarrhoeal pathogens—An experience of fourteen years in Southern India . https://doi.org/10.1099/acmi.0.000818.v1 Nelson, E. J., Harris, J. B., Glenn Morris, J., Calderwood, S. B., and Camilli, A. (2009). Cholera transmission: The host, pathogen and bacteriophage dynamic. Nature Reviews Microbiology , 7 (10), 693–702. https://doi.org/10.1038/nrmicro2204 Noorian, P., Hoque, M. M., Espinoza-Vergara, G., and McDougald, D. (2023). Environmental Reservoirs of Pathogenic Vibrio spp. and Their Role in Disease: The List Keeps Expanding. In S. Almagro-Moreno and S. Pukatzki (Eds.), Vibrio spp. Infections (Vol. 1404, pp. 99–126). Springer International Publishing. https://doi.org/10.1007/978-3-031-22997-8_6 Qadri, F., Khan, A. I., Faruque, A. S. G., Begum, Y. A., Chowdhury, F., Nair, G. B., Salam, M. A., Sack, D. A., and Svennerholm, A.-M. (2005). Enterotoxigenic Escherichia coli and Vibrio cholerae Diarrhea, Bangladesh, 2004. Emerging Infectious Diseases , 11 (7), 1104–1107. https://doi.org/10.3201/eid1107.041266 Ramamurthy, T., and Sharma, N. C. (2014). Cholera Outbreaks in India. In G. B. Nair and Y. Takeda (Eds.), Cholera Outbreaks (Vol. 379, pp. 49–85). Springer Berlin Heidelberg. https://doi.org/10.1007/82_2014_368 Raveendran, R., Wattal, C., Sharma, A., Oberoi, J. K., Prasad, K. J., and Datta, S. (2008). High level ciprofloxacin resistance in Salmonella enterica isolated from blood. Indian Journal of Medical Microbiology , 26 (1), Article 1. https://doi.org/10.4103/0255-0857.38858 Son, K. C., Chung, H. S., Jung, S. I., Kim, M. S., Hwang, E. C., Kim, J. W., and Kwon, D. D. (2018). Trial Comparing a Combined Regimen of Amikacin and Ciprofloxacin to Ciprofloxacin Alone as Transrectal Prostate Biopsy Prophylaxis in the Era of High Fluoroquinolone-Resistant Rectal Flora. Journal of Korean Medical Science , 33 (15), e113. https://doi.org/10.3346/jkms.2018.33.e113 Sun, S., Gu, T., Ou, Y., Wang, Y., Xie, L., and Chen, L. (2024). Environmental Compatibility and Genome Flexibility of Klebsiella oxytoca Isolated from Eight Species of Aquatic Animals. Diversity , 16 (1), 30. https://doi.org/10.3390/d16010030 Taylor, D. L., Kahawita, T. M., Cairncross, S., and Ensink, J. H. J. (2015). The Impact of Water, Sanitation and Hygiene Interventions to Control Cholera: A Systematic Review. PLOS ONE , 10 (8), e0135676. https://doi.org/10.1371/journal.pone.0135676 Zaman, K., Ryun Kim, D., Ali, M., Ahmmed, F., Im, J., Islam, M. T., Khan, A. I., Yunus, M., Khan, M. A., Marks, F., Qadri, F., Kim, J., and Clemens, J. D. (2020). Can cholera ‘hotspots’ be converted to cholera ‘coldspots’ in cholera endemic countries? The Matlab, Bangladesh experience. International Journal of Infectious Diseases , 95 , 28–31. https://doi.org/10.1016/j.ijid.2020.02.055 Zereen, F., Akter, S., Sobur, M., Hossain, M., and Rahman, M. (2019). Molecular detection of Vibrio cholerae from human stool collected from SK Hospital, Mymensingh, and their antibiogram. Journal of Advanced Veterinary and Animal Research , 6 (4), 451. https://doi.org/10.5455/javar.2019.f367 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7072088","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":503216293,"identity":"5ff922fe-7da3-4855-8dd4-f5725e4e6eb1","order_by":0,"name":"Jawad Ahmad","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDklEQVRIiWNgGAWjYBACxgYgwcNwAMKT/GMDEms8QIKWhjSwGF4tYADXwthwGEzj1cLcfsbww5s/d+TMZzc/fGC547zd2vbDQFtqbKJxOqwnx1hybtszY5k7x4wNJM/cTt52JhGo5VhabgNOv+RukOZtOJw4QyLBTEKC7Xay2QGgFqALcWvpf7v5N8+fw/UzJNK/AbWcSzY7/5CAlhm526R52A4nSEjkmElIth2wM7tByJYZ779Zzm07bDhD5kyxgcSZ5ASzG0BbEvD4xbA/LfnGmz+H5SWk2zc+lqiwszc7n/7wwYcaG9xa4BISwBAH4kSwQAIO5SAgD2cBlTN+YGCwx6N4FIyCUTAKRigAAFquaamhQ5J4AAAAAElFTkSuQmCC","orcid":"","institution":"University of Agriculture Peshawar","correspondingAuthor":true,"prefix":"","firstName":"Jawad","middleName":"","lastName":"Ahmad","suffix":""},{"id":503216294,"identity":"fe64b013-e2c7-4048-b126-3f68510cf5f6","order_by":1,"name":"Hafiza Misbah Ahmad","email":"","orcid":"","institution":"University of Agriculture Peshawar","correspondingAuthor":false,"prefix":"","firstName":"Hafiza","middleName":"Misbah","lastName":"Ahmad","suffix":""},{"id":503216295,"identity":"be223a1c-ee2e-4d98-af6d-41a1a954f703","order_by":2,"name":"Muhammad Atif","email":"","orcid":"","institution":"University of the Punjab Lahore","correspondingAuthor":false,"prefix":"","firstName":"Muhammad","middleName":"","lastName":"Atif","suffix":""},{"id":503216296,"identity":"3389d619-9b17-4d11-842c-54bc6217dc33","order_by":3,"name":"Aiman Waheed","email":"","orcid":"","institution":"University of Peshawar","correspondingAuthor":false,"prefix":"","firstName":"Aiman","middleName":"","lastName":"Waheed","suffix":""}],"badges":[],"createdAt":"2025-07-08 07:53:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7072088/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7072088/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":89561109,"identity":"ba12c8c1-2841-439b-b1bf-8b4c8baadfc0","added_by":"auto","created_at":"2025-08-21 10:22:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":38800,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePositivity rate of Vibrio cholerae in the Peshawar district of Khyber Pakhtunkhwa. \u003c/strong\u003eX-axis represent age groups; Y-axis represent the number of confirmed positive cases.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7072088/v1/3b1e5750ca8d7c8a4b22e0eb.png"},{"id":89561110,"identity":"1b841d57-d80c-46da-8384-8f23d48a6f70","added_by":"auto","created_at":"2025-08-21 10:22:57","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":58985,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe antibiogram profiles of Vibrio cholerae (n = 34) isolated from faecal samples. \u003c/strong\u003eEach row represents an individual isolate, and each column corresponds to a specific antibiotic evaluated. Antimicrobial susceptibility patterns are color-coded for clarity: red indicates resistance, yellow represents intermediate, and green represents susceptibility.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7072088/v1/8694ce49a15837b7580c99e8.png"},{"id":89563525,"identity":"9527c7ba-58e2-419f-ade2-8b536ccd8bb9","added_by":"auto","created_at":"2025-08-21 10:30:38","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":202443,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhylogenetic tree based on 16S rRNA gene sequences of 13 multidrug-resistant Vibrio cholerae isolates. \u003c/strong\u003eThe tree was constructed using the Maximum Likelihood method in MEGA 11 software. Each isolate is labeled with its corresponding identifier (AUP; Agriculture University Peshawar). All screened bacterial isolates have NCBI accession codes given (PV789514.1-PV789526.1).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7072088/v1/beacdf543c3f01e359b84269.png"},{"id":89561076,"identity":"9448a03e-d13b-44ed-9557-737635f3cb63","added_by":"auto","created_at":"2025-08-21 10:22:38","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":25190,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAntimicrobial resistance profile of Vibrio cholerae isolates against 13 antibiotics in Peshawar district of Khyber Pakhtunkhwa, Pakistan. \u003c/strong\u003eX-axis shows antibiotics used, Y-axis shows percent activity of antibiotics. The black bars display the percentage of isolates exhibiting susceptibility, and red bars display the percentage of isolates exhibiting resistance to each antibiotic tested.\u003c/p\u003e\n\u003cp\u003eCOL; Colistin, CTZ; Ceftazidime, AMK; Amikacin, CFM; Cefixime, LVX; Levofloxacin, ERY; Erythromycin, SXT; Trimethoprim-Sulfamethoxazole, CIP; Ciprofloxacin, AZM; Azithromycin, TET; Tetracycline, AMP; Ampicillin, MEM; Meropenem, CRO; Ceftriaxone.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7072088/v1/607d5bad9dfa341100cfc963.png"},{"id":89561083,"identity":"51d1d305-f695-4796-92a6-1269bb95be17","added_by":"auto","created_at":"2025-08-21 10:22:38","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":656719,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePCR amplification of antibiotic resistance genes in Vibrio cholerae isolates. \u003c/strong\u003e(A) dfrA1(92.30%), (B) sul1(92.30%), (C) sul2(76.92%), (D) tetA(76.92%), (E) blaTEM (84.61%), (F) blaCTX-M (69.23%), (G) blaOXA (61.53%), (H) blaSHV (38.46%), and (I) mcr-1 (53.84%) genes were detected in V. choleraeisolates. PCR products were resolved on 1.5% agarose gel stained with ethidium bromide and visualized under UV light. First Lane: 100 bp DNA ladder; 1-13 lanes represent individual isolates positive for the respective genes, 14; Positive control, 15; Negative control.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7072088/v1/99fe4904a46ad1aede95c991.png"},{"id":89561081,"identity":"d373482b-f58e-416a-9c3f-29a90249d981","added_by":"auto","created_at":"2025-08-21 10:22:38","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":19851,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe prevalence of key antibiotic resistance genes detected by PCR among clinical Vibrio cholerae isolates. \u003c/strong\u003eX-axis represents the antibiotic resistance genes; Y-axis shows the proportion (%) of isolates harboring each gene.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7072088/v1/30adff9767974e263ed932ba.png"},{"id":94646810,"identity":"096d0c08-85c8-4c2e-8bfd-37fd16e4648f","added_by":"auto","created_at":"2025-10-29 08:53:54","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2196152,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7072088/v1/745f364c-fb9a-43b4-8b3b-b74c4f3cb548.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Detection of Antibiotic Resistance Genes in Vibrio cholerae isolated from Human Fecal samples during a Diarrheal Outbreak in Peshawar, Pakistan","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eThe causative agent of cholera, \u003cem\u003eVibrio cholerae\u003c/em\u003e (\u003cem\u003eV. cholerae\u003c/em\u003e), remains a serious public health concern in many developing countries, particularly in areas lacking access to clean water, and proper sanitation. Cholera is an acute diarrheal infection caused by ingestion of food or water contaminated with specific serogroups of \u003cem\u003eV. cholerae\u003c/em\u003e, namely O1 or O13 (Kaper et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The illness is characterized by vomiting, watery diarrhea, and a rapid onset. If left untreated, severe dehydration can result in death (Kumar and Sharma, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Due to the fecal-oral transmission of the bacterium \u003cem\u003eV. cholerae\u003c/em\u003e, hygiene play a vital role in preventing the spread of the disease (Kanjilal et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Water contamination, inadequate sewage disposal, and poor food handling practices often contribute to outbreaks. With its ability to persist in aquatic environments and the ability to form biofilms, \u003cem\u003eV. cholerae\u003c/em\u003e contributes to its environmental resilience and poses ongoing transmission risks. According to the World Health Organization, improving access to safe drinking water, sanitation, and hygiene interventions is crucial for the effective control and prevention of cholera (Taylor et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The threat of cholera persists despite advancements in medical treatment, especially in regions suffering from poverty, conflict, and natural disasters.\u003c/p\u003e\u003cp\u003eImplementing effective control measures requires an understanding of the epidemiology of \u003cem\u003eV. cholerae\u003c/em\u003e and its antimicrobial resistance profile (Zaman et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). It is estimated that cholera affects between 1.3 and 4.0\u0026nbsp;million people worldwide each year, causing 21,000 to 143,000 deaths (Asumah et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). A disproportionate number of cholera cases are reported in Sub-Saharan Africa and South-East Asia, highlighting the persistent challenges in these regions (Ali et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Like many other developing nations, Pakistan faces ongoing challenges related to waterborne diseases, such as cholera which accounts for approximately 40% of all illnesses, and contribute to 20\u0026ndash;40% of hospitalizations nationwide (Khan and Mohsin, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThere are several factors that contribute to the persistence and spread of \u003cem\u003eV. cholerae\u003c/em\u003e, including climate change, urbanization, and inadequate facilities. Changing rainfall patterns and surface air temperatures may increase the risk of diarrheal diseases due to increased levels of waterborne pathogens. A serious concern for Pakistan is the frequency of tropical cyclone activity in the Arabian Sea, as much of the country's industrial infrastructure is located in Karachi, a coastal city that is highly vulnerable to tropical cyclones. The first case of \u003cem\u003eV. cholerae\u003c/em\u003e in Pakistan was reported in 1994, but the number has now exceeded thousands. Studies have demonstrated that \u003cem\u003eV. cholerae\u003c/em\u003e is prevalent in various regions of Pakistan, illustrating the need for continuous surveillance and monitoring. Furthermore, the effectiveness of treatment is significantly threatened by the emergence of antibiotic resistance in \u003cem\u003eV. cholerae\u003c/em\u003e isolates (Kaper et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). As resistance increases, infections can become more difficult to treat, resulting in higher morbidity, mortality, and healthcare costs.\u003c/p\u003e\u003cp\u003eDespite the fact that \u003cem\u003eV. cholerae\u003c/em\u003e prevalence and molecular epidemiology have been the subject of numerous studies in Pakistan, a substantial gap remains about its origins and patterns of antimicrobial resistance (AMR) in the Khyber Pakhtunkhwa (KP) province. \u003cem\u003eV. cholerae\u003c/em\u003e O1 strains have been frequently identified in coastal or flood-prone areas of Sindh and Punjab, especially in cities like Karachi and Lahore, where previous surveillance efforts have primarily focused. In contrast, despite growing reports of waterborne outbreaks associated with poor sanitation systems and contaminated drinking water, data from KP remains scarce. Unlike previous studies that highlighted the genetic variety of O1 and non-O1 strains mainly in the southern regions, the current study shows a concerning shift towards more resistant and possibly hyper virulent genotypes circulating in northern Pakistan (Hussain et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Significantly, this study reveals substantial levels of resistance to widely used frontline antibiotics, such as AMP, ERY, and TET, which contrasts significantly with national trends where these drugs have historically maintained their therapeutic efficacy. These results highlight the critical need for region-specific research to guide empirical treatment plans and assist with public health initiatives aimed to KP's particular geographic, socioeconomic, and climatic circumstances.\u003c/p\u003e\u003cp\u003eThis study aimed to examine the prevalence of \u003cem\u003eV. cholerae\u003c/em\u003e in stool samples collected from diarrheal patients in Peshawar, a district of KP, Pakistan during an outbreak in July 2023. Additionally, the study aimed to determine the AMR profile of the isolated \u003cem\u003eV. cholerae\u003c/em\u003e, providing valuable insights into the current resistance conditions in the region. Data collected during this particular period provide useful insights into regional patterns in cholera cases. Findings of this study can be used to inform public health interventions and guide effective treatment strategies to address the problem of cholera by identifying the circulating \u003cem\u003eV. cholerae\u003c/em\u003e strains and their susceptibility profiles.\u003c/p\u003e"},{"header":"2. Methodology","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Sample Collection\u003c/h2\u003e\u003cp\u003eA total of 45 patients presenting with acute watery diarrhea were enrolled during the peak of the July 2023 outbreak in Peshawar. These patients represented the complete cohort of cases who visited the health facility and consented to participate during the outbreak period, providing a representative snapshot of the affected population. Inclusion criteria were: patients of all age groups presenting with symptoms of acute diarrhea within 48 hours of onset and no recent history of antibiotic use. Exclusion criteria included: prior antibiotic intake within the last 7 days, hospitalization for unrelated illnesses, or lack of informed consent. To collect samples, each participant received a screw-capped universal container with a wide mouth that was dry and clean. The labels were carefully attached, and each sample was assigned a unique laboratory number. Within one to three hours of being collected, the samples were taken to the laboratory for processing. This study was approved by the Institutional Research Ethics Committee of the Hayatabad Medical Complex, Peshawar. Written informed consent was obtained from all participants or their guardians in the case of minors.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 Bacterial isolation and Identification\u003c/h2\u003e\u003cp\u003eFollowing three hours of incubation, the samples were cultured on Thiosulphate Citrate Bile Sucrose Agar (TCBS) media after being inoculated into an alkaline peptone water broth for enrichment. The culture plates were examined for the growth of \u003cem\u003eV. cholerae\u003c/em\u003e after being incubated for 24 hours at 37\u0026deg;C. Biochemical assays such as Voges-Proskauer, Methyl Red, and Indole were conducted along with Gram staining (Zereen et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3 Antibiotic Susceptibility Test\u003c/h2\u003e\u003cp\u003eAntibiotic susceptibility of \u003cem\u003eV. cholerae\u003c/em\u003e isolates was determined using the Kirby-Bauer disc diffusion method, following the guidelines of the Clinical Laboratory Standards Institute (CLSI, M100-S23, 2018). Bacterial cultures were harvested using a sterile loop and suspended in alkaline peptone water (APW), followed by incubation at 37\u0026deg;C for 2 hours. The resulting cultures were adjusted to match the 0.5 McFarland turbidity standard (approximately 1.5 \u0026times; 10⁸ CFU/mL) to prepare the inoculum for testing. A sterile swab was used to uniformly lawn the bacterial suspension onto Mueller-Hinton agar (MHA) plates. Antibiotic-impregnated discs were placed on the surface of the agar, and the plates were incubated at 37\u0026deg;C for 18\u0026ndash;24 hours. Following incubation, the diameters of the zones of inhibition were measured and interpreted according to CLSI standards (Raveendran et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2008\u003c/span\u003e), (Islam et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). The antibiotics included: COL; Colistin, CTZ; Ceftazidime, AMK; Amikacin, CFM; Cefixime, LVX; Levofloxacin, ERY; Erythromycin, SXT; Trimethoprim-Sulfamethoxazole, CIP; Ciprofloxacin, AZM; Azithromycin, TET; Tetracycline, AMP; Ampicillin, MEM; Meropenem, CRO; Ceftriaxone. MDR was defined as resistance to at least one agent in three or more antimicrobial categories, as per the criteria established by Magiorakos et al., (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4 PCR and Sequencing of 16s rRNA gene\u003c/h2\u003e\u003cp\u003eThe \u003cem\u003eV. cholerae\u003c/em\u003e strains were cultured in the Tryptic soy broth (TSB) with 2% NaCl (pH 8.0) at 37\u0026deg;C until reached the mid logarithmic growth phase. Bacterial cells were harvested at 2700 g for 10 minutes at 4\u0026deg;C. Genomic DNA was extracted using the TIAN amp Bacteria DNA Kit (Tiangen Biochemical Technology Co., Ltd., Beijing, China) and subsequently examined. The 16S rRNA gene was amplified using universal primers 27F (5\u0026prime;-GGTTGGCCAATCTACTCCCAGG-3\u0026prime;) and 1492R (5\u0026prime;-TGGTCTCCTTAAACCTGTCTT-3\u0026prime;) (Kai et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Each PCR reaction consisted of 5 \u0026micro;l of template DNA, 2.5 \u0026micro;l of each primer (forward and reverse), 25 \u0026micro;l of master mix, and 14 \u0026micro;l of PCR-grade water, making a total reaction volume of 49 \u0026micro;l. The PCR cycling conditions included an initial denaturation at 94\u0026deg;C for 1 minute, followed by 30 cycles of denaturation at 94\u0026deg;C for 1 minute, annealing at 54\u0026deg;C for 1 minute, and extension at 72\u0026deg;C for 3 minutes. A final extension was carried out at 72\u0026deg;C for 1 minute. The 16S rRNA gene of \u003cem\u003eV. cholerae\u003c/em\u003e isolates was amplified individually by PCR, followed by purification and sequencing. Sequence data were analyzed using the Basic Local Alignment Search Tool (BLAST) available from the National Center for Biotechnology Information (NCBI) to identify homologous sequences. Multiple sequence alignment was performed using Clustal W in MEGA version 11, and The phylogenetic tree of 13 \u003cem\u003eV. cholerae\u003c/em\u003e isolates was constructed using the maximum likelihood method to assess the genetic relationships of the \u003cem\u003eV. cholerae\u003c/em\u003e isolates with reference strains (Dhillon et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Sun et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5 Detection of Antimicrobial Resistance Genes by PCR\u003c/h2\u003e\u003cp\u003eThe polymerase chain reaction was performed for detecting significant antimicrobial resistance genes in \u003cem\u003eV. cholerae\u003c/em\u003e isolates, targeting a set of genes associated with resistance towards the used antibiotic classes. The examined genes included \u003cem\u003etetA\u003c/em\u003e (TET resistance), \u003cem\u003edfrA1\u003c/em\u003e (Trimethoprim resistance), \u003cem\u003esul1\u003c/em\u003e and \u003cem\u003esul2\u003c/em\u003e (Sulfonamide resistance), \u003cem\u003eblaTEM\u003c/em\u003e, \u003cem\u003eblaCTX-M\u003c/em\u003e, \u003cem\u003eblaOXA\u003c/em\u003e, and \u003cem\u003eblaSHV\u003c/em\u003e (β-lactam resistance), and \u003cem\u003emcr-1\u003c/em\u003e, which confers resistance to COL. Gene-specific primers were used according to confirmed sequences reported in the literature (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Each 25 \u0026micro;l PCR reaction contained 12.5 \u0026micro;l of PCR master mix (including Taq DNA polymerase, dNTPs, and MgCl₂), 1 \u0026micro;l of forward primer, 1 \u0026micro;l of reverse primer (10 pmol/\u0026micro;l), 2 \u0026micro;l of extracted genomic DNA, and 8.5 \u0026micro;l of nuclease-free water. Thermal cycling conditions were defined as follows: an initial denaturation at 95\u0026deg;C for 5 minutes; 35 amplification cycles including denaturation at 95\u0026deg;C for 30 seconds, primer annealing at 55\u0026deg;C for 30 seconds, and extension at 72\u0026deg;C for 1 minute; followed by a final extension at 72\u0026deg;C for 5 minutes. Each PCR cycle used positive controls (DNA from previously verified resistant strains) and a negative control lacking of template DNA to ensure result precision and minimize contamination or false-positive results (Colom et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2003\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6 Statistical Analysis\u003c/h2\u003e\u003cp\u003eThe data were analyzed using SPSS software (version 17.0, SPSS Inc., Chicago, IL, USA). A chi-square test of independence was performed to evaluate the association between \u003cem\u003eV. cholerae\u003c/em\u003e positivity and age groups categorized as \u0026le;\u0026thinsp;18 years, 19\u0026ndash;40 years, and \u0026gt;\u0026thinsp;40 years. To further investigate the distribution of observed frequencies, a post hoc analysis using standardized residuals was conducted to identify any significant deviations within specific age categories.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimers used in the study.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTarget Genes\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSequence (5\u0026rsquo; 3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eProduct size (bp)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eReference\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003etetA\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e GGCGGTCTTCTTCATCATGC\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e CGGCAGGCAGAGCAAGTAGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e210\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e(Aslam et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2012\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003edfrA1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e ATGATGAAAACGGCGGAAC\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e TTATTTCTCGGCGAACGCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e267\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e(Koo, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2003\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003esul1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e CGGCGTGGGCTACCTGAACG\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e GCCGATCGCGTGAAGTTCCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e432\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e(Hu et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2005\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003esul2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e TCCGGTGGAGGCCGGTATCTGG\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e CGGGAATGCCATCTGCCTTGAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e293\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e(Dean et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2003\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eblaTEM\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e ATGAGTATTCAACATTTCCG\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e CCAATGCTTAATCAGTGAGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e867\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e(Colom et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2003\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eblaCTX-M\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e SCSATGTGCAGYACCAGTAA\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e CCGCRATATGRTTGGTGGTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e550\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e(Dallenne et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2010\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eblaOXA\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e ACACAATACATATCAACTTCGC\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e AGTGTGTTTAGAATGGTGATC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e813\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e(Colom et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2003\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eblaSHV\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e TCAGCGAAAAACACCTTG\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e CCCGCAGATAAATCACCAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e768\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e(Colom et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2003\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003emcr-1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e AGTCCGTTTGTTCTTGTGGC\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e AGATCCTTGGTCTCGGCTTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e309\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e(Liu et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2016\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003e\u003cstrong\u003e3.1 Occurrence of\u003c/strong\u003e \u003cstrong\u003eV. cholerae\u003c/strong\u003e \u003cstrong\u003ein Peshawar\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eOut of 45 stool culture samples, 39 samples showed growth where 34 (75.55%) were reported as \u003cem\u003eV. cholerae\u003c/em\u003e during the study. PCR amplification confirmed these isolates as \u003cem\u003eV. cholerae\u003c/em\u003e. The study evaluated the prevalence of infection in the population according to age and gender. The age group of \u0026le;\u0026thinsp;18 years had the highest infection rate at 22 (64.70%). The age group of 19\u0026ndash;40 years and the age group of over 40 years both had 6 (17.64%) positive cases. Moreover, frequency of male patients was higher 27 (79.41%) than female 7 (20.58%). The percentage was calculated in the total of 34 positive \u003cem\u003eV. cholerae\u003c/em\u003e cases (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eIn order to evaluate the isolates\u0026apos; patterns of antibiotic resistance and investigate the association between \u003cem\u003eV. cholerae\u003c/em\u003e infection and demographic characteristics, a thorough statistical analysis was conducted. A post-hoc residual analysis confirmed that no particular age group contributed disproportionately to the observed distribution, and a chi-square test of independence showed no significant correlation between infection status and age groups (\u0026chi;\u0026sup2; = 0.042, p\u0026thinsp;=\u0026thinsp;0.979). However, the small subgroup sizes may have limited the statistical power of the test, and the non-significant associations should be interpreted with caution.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003e3.2 Antibiotic Susceptibility Test\u003c/h2\u003e\n \u003cp\u003eThe antibiotic susceptibility showed that 13 isolates exhibited multidrug resistance, demonstrating resistance to at least three distinct classes of antibiotics. These MDR isolates were further characterized through 16S rRNA gene sequencing. Isolate 6, 8, 10, 13, 15, 17, 19, 20, 22, 25, 26, 29 and 32 were observed MDRs showing resistance to at least one agent in three or more antimicrobial categories (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003e3.3 16S rRNA Gene Sequencing and phylogenetic identification\u003c/h2\u003e\n \u003cp\u003eThe amplified PCR products were subjected to sequencing. After the construction of phylogenetic tree using MEGA 11 software, the selected MDR isolates were observed \u003cem\u003eV. cholerae\u003c/em\u003e. Figure \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e illustrates the phylogenetic tree for the isolated strain, constructed with the BLAST search tool from the NCBI, based on the analysis of the 16S rRNA sequence and the homology among the 16S rRNA sequences of the registered strains. The accession numbers were given as (PV789514.1 - PV789526.1)\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003e\u003cstrong\u003e3.4 Antimicrobial Resistance Profile of\u003c/strong\u003e \u003cstrong\u003eV. cholerae\u003c/strong\u003e \u003cstrong\u003eisolates\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eAccording to the 2018 Clinical and Laboratory Standards Institute (CLSI) standards, the Kirby-Bauer disc diffusion method was used to assess the antimicrobial susceptibility of \u003cem\u003eV. cholerae\u003c/em\u003e isolates. A zone size between the two cut-offs was regarded as intermediate, a zone diameter of less than or equal to 16 mm as resistant, and a zone diameter of less than or equal to 12 mm as sensitive.\u003c/p\u003e\n \u003cp\u003eA total of thirteen antibiotics were tested against \u003cem\u003eV. cholerae\u003c/em\u003e isolates, revealing a concerning trend of extensive antimicrobial resistance. The isolates exhibited complete resistance (100%) to ERY and LVX, indicating no therapeutic efficacy of these agents. High resistance levels were also observed against AZM (92.85%), TET (88.89%), SXT (80%), AMP (75%), and CRO (75%). COL although not commonly used for \u003cem\u003eV. cholerae\u003c/em\u003e, showed 66.67% resistance, highlighting its limited potential. CFM also demonstrated notable resistance at 33.33%. In contrast, MEM emerged as the most effective antibiotic, showing 81% susceptibility, followed by AMK (61.53%) and CIP (53.84%). Moderate susceptibility was noted for CTZ (33.33%). Overall, the isolates from Peshawar reflect a MDR profile, highlighting the urgency of ongoing surveillance and rational antibiotic stewardship to manage cholera infections effectively (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003e3.5 PCR Detection of Antimicrobial Resistance Genes\u003c/h2\u003e\n \u003cp\u003eThe molecular analysis of \u003cem\u003eV. cholerae\u003c/em\u003e isolates revealed a significant prevalence of antibiotic resistance genes linked to various antibiotics classes, emphasizing the MDR characteristics of \u003cem\u003eV. cholerae\u003c/em\u003e (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). Of the 13 isolates examined, the \u003cem\u003edfrA1\u003c/em\u003e gene, responsible for Trimethoprim resistance, was detected in 92.30% of the isolates, indicating significant resistance to folate pathway inhibitors. The Sulfonamide resistance genes \u003cem\u003esul1\u003c/em\u003e and \u003cem\u003esul2\u003c/em\u003e were detected in 92.30% and 76.92% of the isolates, respectively, exhibiting a broad distribution of alternative dihydropteroate synthase genes. The \u003cem\u003etetA\u003c/em\u003e gene, which confers TET resistance through efflux mechanisms, was detected in 76.92% of isolates, highlighting the persistent prevalence of plasmid-mediated TET resistance. Resistance to \u0026beta;-lactam antibiotics was evidenced by the identification of \u003cem\u003eblaTEM\u003c/em\u003e (84.61%), \u003cem\u003eblaCTX-M\u003c/em\u003e (69.23%), \u003cem\u003eblaOXA\u003c/em\u003e (61.53%), and \u003cem\u003eblaSHV\u003c/em\u003e (38.46%), showing numerous enzymatic pathways that inactivate Penicillin\u0026rsquo;s and extended-spectrum Cephalosporin. The identification of \u003cem\u003emcr-1\u003c/em\u003e in 53.84% of the isolates is particularly alarming, as it is a plasmid-mediated COL resistance gene associated with the failure of last-resort antibiotics (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn the present study, there was a significant prevalence of \u003cem\u003eV. cholerae\u003c/em\u003e in stool samples from patients in Peshawar, with 75.55% of culture-positive samples being identified as \u003cem\u003eV. cholerae\u003c/em\u003e. It is evident from the findings that cholera poses a continuing public health threat in this region. According to the age distribution of infected individuals, younger populations were more vulnerable, possibly because of factors such as hygiene practices, exposure to contaminated water, and immune status. Statistical analysis revealed no significant correlation between infection status and age groups. Although the highest number of cases was observed in the youngest age group, other age groups were also notably affected. These findings underscore the need for a comprehensive public health strategy targeting all age demographics. There were more male patients (79.41%) than female patients (20.58%), suggesting that there may be gender-related differences in exposure, health-seeking behavior, or susceptibility to infection.\u003c/p\u003e\u003cp\u003eComparing our findings with previous studies, several contextual similarities and differences emerged. According to studies, low socioeconomic groups are more likely to contract cholera. There may be a lack of access to clean water and sanitation facilities, as well as poor hygiene practices. Studies have demonstrated that cholera is an endemic and recurring issue in South Asian regions, where inadequate sanitation and limited access to clean drinking water remain major factors (Ramamurthy and Sharma, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Recent studies from South Asia have reported similar findings. Mohanty et al., (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) highlighted emerging resistance to macrolides and TETs in India, while Hussain et al., (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) identified high prevalence of ESBL-producing \u003cem\u003eV. cholerae\u003c/em\u003e in Baluchistan, Pakistan. These trends support our findings and further emphasize the urgency for regional antimicrobial stewardship programs. In addition to the remarkably high rate observed in this study, it is possible that localized outbreaks or environmental reservoirs facilitate continuous transmission.\u003c/p\u003e\u003cp\u003eA distribution of cases based on age revealed that 64.70% of those infected were under the age of 18, highlighting the vulnerability of young people. The results of this study are consistent with previous reports showing that children and adolescents are disproportionately affected by cholera because of their increased exposure to unsafe water sources, insufficient hand hygiene, and weakened immunity (Deen et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Qadri et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). A statistical analysis, however, indicated that no significant correlation exists between age group and infection status, suggesting that while young individuals are more susceptible to infection, susceptibility extends to individuals of all ages. Hence, in high-risk areas, public health interventions should be universal rather than age-specific.\u003c/p\u003e\u003cp\u003eIt is noteworthy that the study indicated a gender disparity, with 79.41% of cases involving male patients. According to some epidemiological studies (Nelson et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2009\u003c/span\u003e), males have higher infection rates due to occupational exposure or behavioral patterns. This finding also raises the question of possible underreporting or reduced health seeking behavior among females, a phenomenon commonly documented in conservative or resource-constrained settings. Further research is required to determine whether these patterns are the result of exposure differences or of systemic barriers to healthcare access.\u003c/p\u003e\u003cp\u003eThe antimicrobial susceptibility profile of \u003cem\u003eV. cholerae\u003c/em\u003e isolates from human fecal samples in Peshawar demonstrated a concerning pattern of significant resistance to several routinely used antibiotics. The complete resistance to ERY (100%) and LVX (100%) observed in this study is particularly alarming, as both antibiotics are frequently used in the control of severe diarrheal infections and cholera outbreaks. Bhattacharya et al., (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) reported similar findings in India, where \u003cem\u003eV. cholerae\u003c/em\u003e isolates demonstrated significant resistance to macrolides and fluoroquinolones, highlighting the global increase of resistant \u003cem\u003eV. cholerae\u003c/em\u003e isolates.\u003c/p\u003e\u003cp\u003eThe resistance to AZM (92.85%), another macrolide, further emphasizes this pattern. Despite AZM being recommended for cholera treatment due to its effectiveness and pharmacokinetic properties (Mohanraj and Mandal, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), the nearly total resistance reported currently indicates a possible alteration in regional susceptibility patterns, potentially resulting from the overuse or misuse of macrolides in medication.\u003c/p\u003e\u003cp\u003eSignificant resistance rates were observed against TET (88.89%) and SXT (80%), both of which have been included in the WHO's recommended treatments for cholera, particularly in regions with limited resources. The observed resistance to AMP (75%) and the third-generation cephalosporin CRO (75%) in this study relates to earlier research conducted in Bangladesh and Nigeria, where \u003cem\u003eV. cholerae\u003c/em\u003e isolates possessed β-lactamase genes, such as \u003cem\u003eblaCTX-M\u003c/em\u003e, \u003cem\u003eblaSHV\u003c/em\u003e, and \u003cem\u003eblaOXA\u003c/em\u003e, frequently located on plasmids or integrative conjugative elements (Mogessie et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). These genetic factors not only provide resistance to β-lactams but also promote horizontal gene transfer, contributing in the spread of multidrug resistance among enteric bacteria.\u003c/p\u003e\u003cp\u003eDespite COL not being a conventional treatment for cholera, the reported resistance rate of 66.67% is significant. COL resistance in \u003cem\u003eV. cholerae\u003c/em\u003e may result from chromosomal mutations or the transfer of \u003cem\u003emcr\u003c/em\u003e genes, as evidenced in environmental and clinical isolates from Asia (Lai et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The moderate resistance to CFM (33.33%) and CTZ (66.67%) correlates with the widespread distribution of ESBLs among \u003cem\u003eV. cholerae\u003c/em\u003e strains, as reported in areas such as Kenya and South India (Mohanty et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eConversely, MEM exhibited the highest susceptibility (81%), highlighting that Carbapenem continue to be an effective last-resort treatment against MDR \u003cem\u003eV. cholerae\u003c/em\u003e strains in this region. Noorian et al., (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) demonstrated similar results, indicating that \u003cem\u003eV. cholerae\u003c/em\u003e isolates retained Carbapenem sensitivity despite significant resistance to other antibiotics classes. Similarly, AMK (61.53%) and CIP (53.84%) showed significant efficacy; nevertheless, the decreasing susceptibility to CIP poses issues regarding the potential establishment of fluoroquinolone-resistant mutations in the \u003cem\u003egyrA\u003c/em\u003e and \u003cem\u003eparC\u003c/em\u003e genes (Son et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eCompared to research conducted in other endemic regions, the findings of this study are similar. According to Lawrence Grant et al., (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), individuals from low-income households are significantly more likely to contract cholera due to substandard living conditions. Ali et al., (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) also found an association between socio-demographic factors such as income, education level, and gender, as well as household water treatment practices in cholera-endemic areas. It is likely that these socioeconomic factors play a role in the regional patterns observed in our study, where infrastructure deficiencies and inequalities in public health access contribute to the vulnerability of populations.\u003c/p\u003e\u003cp\u003eThe study provides significant insights on the prevalence, antibiotic resistance trends, and demographic distribution of \u003cem\u003eV. cholerae\u003c/em\u003e during the 2023 outbreak in Peshawar; yet, several limitations must be acknowledged. Firstly, the sample size was restricted to 45 patients from a single healthcare institution during the outbreak's peak. This cohort offers a glimpse of the impacted community, but the results may not be applicable to the broader region or to cases handled outside formal hospital environments.\u003c/p\u003e\u003cp\u003eSecondly, the study employed a cross-sectional design and lacked longitudinal follow-up, thereby limiting the assessment of clinical outcomes, reinfection rates, and the temporal evolution of resistance patterns. Furthermore, environmental samples (e.g., from water sources) were neither collected nor analyzed, which restricted the ability to identify specific sources of infection or evaluate the overall environmental risk factors contributing to transmission.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eAccording to the current investigation of \u003cem\u003eV. cholerae\u003c/em\u003e outbreak in Peshawar, MDR strains are emerging in alarming numbers. An estimated 75.55% of diarrheal patients are affected, primarily children under the age of 18 years. Particularly high resistance rates were observed to ERY, AZM, TET, and AMP. A significant number of isolates, 13 having shown resistance to three or more antibiotic classes, were observed as MDR organisms, which poses a serious public health concern due to the organism's ability to rapidly spread and acquire resistance genes. MEM and AMK retained higher susceptibility rates, but their limited accessibility and high cost may limit routine use in low-resource settings. Molecular confirmation of these isolates by 16S rRNA gene sequencing and the phylogenetic relationship between them further highlight the genetic conservation and potential clonal spread of resistant \u003cem\u003eV. cholerae\u003c/em\u003e in the region.\u003c/p\u003e\u003cp\u003eTo avoid future outbreaks, it is recommended to implement a continuous molecular surveillance program, update antimicrobial management procedures, and improve water and sanitation facilities. Public health officials have to respond instantly to address a number of concerning resistance patterns, which include assessing basic treatment strategies and establishing integrated cholera prevention measures.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003e Human Ethics and Consent to Participate declarations:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn accordance with the Declaration of Helsinki (2013) and the National Bioethics Committee (NBC) of Pakistan, the Institutional Research and Ethical Board (IREB) of Hayatabad Medical Complex, Peshawar, Pakistan, reviewed and approved this study. The approval had been granted on January 8, 2024, under reference number 2168. The need for informed consent was formally waived by the committee as the study involved anonymized, routine diagnostic samples collected as part of standard hospital procedures. In accordance with national ethical guidelines, no identifiable personal or patient information was used, and the data were handled in compliance with ethical standards for biomedical research on human subjects.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Consent for publication:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Availability of data and materials:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets analyzed and/or generated during the current study are not publicly accessible as a result of institutional policies and confidentiality agreements regarding the management of clinical samples. Access to the data will be permitted upon request for academic, non-commercial purposes and with prior approval from the Institutional Research and Ethical Board (IREB) of the Hayatabad Medical Complex in Peshawar.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Competing interests:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Funding:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Authors\u0026apos; contributions:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJawad Ahmad supervised the work, conceived and designed the study. Jawad Ahmad and Hafiza Misbah Ahmad conducted the laboratory work and drafted the initial manuscript. Muhammad Atif and Aiman Waheed contributed to statistical analysis and data interpretations. Jawad Ahmad contributed to the final editing and approval of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Acknowledgements\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAuthors are thankful to the Institute of Biotechnology and Genetic Engineering, University of Agriculture Peshawar for providing the research facilities.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Clinical trial number:\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAli, M., Nelson, A. R., Lopez, A. L., and Sack, D. A. (2015). Updated Global Burden of Cholera in Endemic Countries. \u003cem\u003ePLOS Neglected Tropical Diseases\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(6), e0003832. https://doi.org/10.1371/journal.pntd.0003832\u003c/li\u003e\n\u003cli\u003eAslam, M., Checkley, S., Avery, B., Chalmers, G., Bohaychuk, V., Gensler, G., Reid-Smith, R., and Boerlin, P. (2012). Phenotypic and genetic characterization of antimicrobial resistance in Salmonella serovars isolated from retail meats in Alberta, Canada. \u003cem\u003eFood Microbiology\u003c/em\u003e, \u003cem\u003e32\u003c/em\u003e(1), 110\u0026ndash;117. https://doi.org/10.1016/j.fm.2012.04.017\u003c/li\u003e\n\u003cli\u003eAsumah, M. N., Padhi, B. K., and Sinha, A. (2023). Rising cases of cholera in Ethiopia: A need for sustainable wash practices? \u003cem\u003eInternational Journal of Surgery\u003c/em\u003e, \u003cem\u003e109\u003c/em\u003e(3), 608\u0026ndash;609. https://doi.org/10.1097/JS9.0000000000000196\u003c/li\u003e\n\u003cli\u003eBhattacharya, D., Sayi, D. S., Thamizhmani, R., Bhattacharjee, H., Bharadwaj, A. P., Roy, A., and Sugunan, A. P. (2012). Emergence of Multidrug-Resistant Vibrio cholerae O1 Biotype El Tor in Port Blair, India. \u003cem\u003eThe American Society of Tropical Medicine and Hygiene\u003c/em\u003e, \u003cem\u003e86\u003c/em\u003e(6), 1015\u0026ndash;1017. https://doi.org/10.4269/ajtmh.2012.11-0327\u003c/li\u003e\n\u003cli\u003eColom, K., P\u0026Atilde;\u0026copy;rez, J., Alonso, R., Fern\u0026Atilde;\u0026iexcl;ndez-Aranguiz, A., Lari\u0026Atilde;\u0026plusmn;o, E., and Cisterna, R. (2003). Simple and reliable multiplex PCR assay for detection of blaTEM, blaSHV and blaOXA-1 genes in Enterobacteriaceae. \u003cem\u003eFEMS Microbiology Letters\u003c/em\u003e, \u003cem\u003e223\u003c/em\u003e(2), 147\u0026ndash;151. https://doi.org/10.1016/S0378-1097(03)00306-9\u003c/li\u003e\n\u003cli\u003eDallenne, C., Da Costa, A., Decr\u0026eacute;, D., Favier, C., and Arlet, G. (2010). Development of a set of multiplex PCR assays for the detection of genes encoding important \u0026beta;-lactamases in Enterobacteriaceae. \u003cem\u003eJournal of Antimicrobial Chemotherapy\u003c/em\u003e, \u003cem\u003e65\u003c/em\u003e(3), 490\u0026ndash;495. https://doi.org/10.1093/jac/dkp498\u003c/li\u003e\n\u003cli\u003eDean, C. R., Visalli, M. A., Projan, S. J., Sum, P.-E., and Bradford, P. A. (2003). Efflux-mediated resistance to tigecycline (GAR-936) in Pseudomonas aeruginosa PAO1. \u003cem\u003eAntimicrobial Agents and Chemotherapy\u003c/em\u003e, \u003cem\u003e47\u003c/em\u003e(3), 972\u0026ndash;978. https://doi.org/10.1128/AAC.47.3.972-978.2003\u003c/li\u003e\n\u003cli\u003eDeen, J. L., Von Seidlein, L., Sur, D., Agtini, M., Lucas, M. E. S., Lopez, A. L., Kim, D. R., Ali, M., and Clemens, J. D. (2008). The High Burden of Cholera in Children: Comparison of Incidence from Endemic Areas in Asia and Africa. \u003cem\u003ePLoS Neglected Tropical Diseases\u003c/em\u003e, \u003cem\u003e2\u003c/em\u003e(2), e173. https://doi.org/10.1371/journal.pntd.0000173\u003c/li\u003e\n\u003cli\u003eDhillon, A., Teske, A., Dillon, J., Stahl, D. A., and Sogin, M. L. (2003). Molecular Characterization of Sulfate-Reducing Bacteria in the Guaymas Basin. \u003cem\u003eApplied and Environmental Microbiology\u003c/em\u003e, \u003cem\u003e69\u003c/em\u003e(5), 2765\u0026ndash;2772. https://doi.org/10.1128/AEM.69.5.2765-2772.2003\u003c/li\u003e\n\u003cli\u003eHu, K.-F., Regner, M., Siegrist, C.-A., Lambert, P., Chen, M., Bengtsson, K. L., and Morein, B. (2005). The immunomodulating properties of human respiratory syncytial virus and immunostimulating complexes containing \u003cem\u003eQuillaja\u003c/em\u003e saponin components QH-A, QH-C and ISCOPREP\u003csup\u003eTM\u003c/sup\u003e 703. \u003cem\u003eFEMS Immunology and Medical Microbiology\u003c/em\u003e, \u003cem\u003e43\u003c/em\u003e(2), 269\u0026ndash;276. https://doi.org/10.1016/j.femsim.2004.08.010\u003c/li\u003e\n\u003cli\u003eHussain, A., Lashari, Y., Mazhar, M., and Department of Pathology, Loralai Medical College Loralai. (2024). Survey of Cholera Outbreak and its Resistant Pattern in Baluchistan, Pakistan. \u003cem\u003eJournal of HBS MandDC\u003c/em\u003e, \u003cem\u003e3\u003c/em\u003e(2), 63\u0026ndash;65. https://doi.org/10.70394/jhbsmdc.v3i2.61\u003c/li\u003e\n\u003cli\u003eIslam, M. J., Sharmin, N., Hasan, Dr. Md. N., and Azad, A. K. (2008). Antimicrobial susceptibility of salmonella serovars isolated from blood. \u003cem\u003eJournal of Innovation and Development Strategy\u003c/em\u003e, \u003cem\u003e2\u003c/em\u003e, 22\u0026ndash;27.\u003c/li\u003e\n\u003cli\u003eKai, S., Matsuo, Y., Nakagawa, S., Kryukov, K., Matsukawa, S., Tanaka, H., Iwai, T., Imanishi, T., and Hirota, K. (2019). Rapid bacterial identification by direct PCR amplification of 16S rRNA genes using the MinION\u003csup\u003eTM\u003c/sup\u003e nanopore sequencer. \u003cem\u003eFEBS Open Bio\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(3), 548\u0026ndash;557. https://doi.org/10.1002/2211-5463.12590\u003c/li\u003e\n\u003cli\u003eKanjilal, S., Citorik, R., LaRocque, R. C., Ramoni, M. F., and Calderwood, S. B. (2010). A Systems Biology Approach To Modeling \u003cem\u003eVibrio cholerae\u003c/em\u003e Gene Expression under Virulence-Inducing Conditions. \u003cem\u003eJournal of Bacteriology\u003c/em\u003e, \u003cem\u003e192\u003c/em\u003e(17), 4300\u0026ndash;4310. https://doi.org/10.1128/JB.00182-10\u003c/li\u003e\n\u003cli\u003eKaper, J. B., Fasano, A., and Trucksis, M. (2014). Toxins of \u003cem\u003eVibrio cholerae\u003c/em\u003e. In I. Kaye Wachsmuth, P. A. Blake, and \u0026Oslash;. Olsvik (Eds.), \u003cem\u003eVibrio cholerae and Cholera\u003c/em\u003e (pp. 143\u0026ndash;176). ASM Press. https://doi.org/10.1128/9781555818364.ch11\u003c/li\u003e\n\u003cli\u003eKhan, I., and Mohsin, S. (2021). Microbiological Analysis of Drinking Water from Different Areas of Lahore. \u003cem\u003eInternational Journal of Economic and Environmental Geology\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e(3), 44\u0026ndash;47. https://doi.org/10.46660/ijeeg.Vol12.Iss3.2021.620\u003c/li\u003e\n\u003cli\u003eKoo, H. (2003). Inhibition of Streptococcus mutans biofilm accumulation and polysaccharide production by apigenin and tt-farnesol. \u003cem\u003eJournal of Antimicrobial Chemotherapy\u003c/em\u003e, \u003cem\u003e52\u003c/em\u003e(5), 782\u0026ndash;789. https://doi.org/10.1093/jac/dkg449\u003c/li\u003e\n\u003cli\u003eKumar, M., and Sharma, V. L. (2014). Outbreak Investigation of Cholera in a Slum of Northern India. \u003cem\u003eOpen Journal of Epidemiology\u003c/em\u003e, \u003cem\u003e04\u003c/em\u003e(04), 243\u0026ndash;247. https://doi.org/10.4236/ojepi.2014.44031\u003c/li\u003e\n\u003cli\u003eLai, C.-C., Lin, Y.-T., Lin, Y.-T., Lu, M.-C., Shi, Z.-Y., Chen, Y.-S., Wang, L.-S., Tseng, S.-H., Lin, C.-N., Chen, Y.-H., Ko, W.-C., Wang, F.-D., and Hsueh, P.-R. (2018). Clinical characteristics of patients with bacteraemia due to the emergence of mcr-1-harbouring Enterobacteriaceae in humans and pigs in Taiwan. \u003cem\u003eInternational Journal of Antimicrobial Agents\u003c/em\u003e, \u003cem\u003e52\u003c/em\u003e(5), 651\u0026ndash;657. https://doi.org/10.1016/j.ijantimicag.2018.08.015\u003c/li\u003e\n\u003cli\u003eLawrence Grant, S., Lange, S., Almeida, S., Hoque, B., and Kj\u0026aelig;r Mackie Jensen, P. (2023). Influence of Seasonal Hazards on Water, Sanitation, and Hygiene\u0026ndash;Related Behavior and Implications for Cholera Transmission in Bangladesh. \u003cem\u003eThe American Journal of Tropical Medicine and Hygiene\u003c/em\u003e, \u003cem\u003e108\u003c/em\u003e(3), 518\u0026ndash;523. https://doi.org/10.4269/ajtmh.21-0708\u003c/li\u003e\n\u003cli\u003eLiu, Y.-Y., Wang, Y., Walsh, T. R., Yi, L.-X., Zhang, R., Spencer, J., Doi, Y., Tian, G., Dong, B., Huang, X., Yu, L.-F., Gu, D., Ren, H., Chen, X., Lv, L., He, D., Zhou, H., Liang, Z., Liu, J.-H., and Shen, J. (2016). Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: A microbiological and molecular biological study. \u003cem\u003eThe Lancet Infectious Diseases\u003c/em\u003e, \u003cem\u003e16\u003c/em\u003e(2), 161\u0026ndash;168. https://doi.org/10.1016/S1473-3099(15)00424-7\u003c/li\u003e\n\u003cli\u003eMagiorakos, A.-P., Srinivasan, A., Carey, R. B., Carmeli, Y., Falagas, M. E., Giske, C. G., Harbarth, S., Hindler, J. F., Kahlmeter, G., Olsson-Liljequist, B., Paterson, D. L., Rice, L. B., Stelling, J., Struelens, M. J., Vatopoulos, A., Weber, J. T., and Monnet, D. L. (2012). Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. \u003cem\u003eClinical Microbiology and Infection\u003c/em\u003e, \u003cem\u003e18\u003c/em\u003e(3), 268\u0026ndash;281. https://doi.org/10.1111/j.1469-0691.2011.03570.x\u003c/li\u003e\n\u003cli\u003eMogessie, H., Legesse, M., Hailu, A. F., Teklehaymanot, T., Alemayehu, H., Abubeker, R., and Ashenafi, M. (2024). Vibrio cholerae O1 and Escherichia coli O157:H7 from drinking water and wastewater in Addis Ababa, Ethiopia. \u003cem\u003eBMC Microbiology\u003c/em\u003e, \u003cem\u003e24\u003c/em\u003e(1), 219. https://doi.org/10.1186/s12866-024-03302-8\u003c/li\u003e\n\u003cli\u003eMohanraj, R. S., and Mandal, J. (2022). Azithromycin can induce SOS response and horizontal gene transfer of SXT element in Vibrio cholerae. \u003cem\u003eMolecular Biology Reports\u003c/em\u003e, \u003cem\u003e49\u003c/em\u003e(6), 4737\u0026ndash;4748. https://doi.org/10.1007/s11033-022-07323-2\u003c/li\u003e\n\u003cli\u003eMohanty, A., Lakra, N., and Mandal, J. (2024). \u003cem\u003eTrends and antibiotic susceptibility patterns of diarrhoeal pathogens\u0026mdash;An experience of fourteen years in Southern India\u003c/em\u003e. https://doi.org/10.1099/acmi.0.000818.v1\u003c/li\u003e\n\u003cli\u003eNelson, E. J., Harris, J. B., Glenn Morris, J., Calderwood, S. B., and Camilli, A. (2009). Cholera transmission: The host, pathogen and bacteriophage dynamic. \u003cem\u003eNature Reviews Microbiology\u003c/em\u003e, \u003cem\u003e7\u003c/em\u003e(10), 693\u0026ndash;702. https://doi.org/10.1038/nrmicro2204\u003c/li\u003e\n\u003cli\u003eNoorian, P., Hoque, M. M., Espinoza-Vergara, G., and McDougald, D. (2023). Environmental Reservoirs of Pathogenic Vibrio spp. and Their Role in Disease: The List Keeps Expanding. In S. Almagro-Moreno and S. Pukatzki (Eds.), \u003cem\u003eVibrio spp. Infections\u003c/em\u003e (Vol. 1404, pp. 99\u0026ndash;126). Springer International Publishing. https://doi.org/10.1007/978-3-031-22997-8_6\u003c/li\u003e\n\u003cli\u003eQadri, F., Khan, A. I., Faruque, A. S. G., Begum, Y. A., Chowdhury, F., Nair, G. B., Salam, M. A., Sack, D. A., and Svennerholm, A.-M. (2005). Enterotoxigenic \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eVibrio cholerae\u003c/em\u003e Diarrhea, Bangladesh, 2004. \u003cem\u003eEmerging Infectious Diseases\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(7), 1104\u0026ndash;1107. https://doi.org/10.3201/eid1107.041266\u003c/li\u003e\n\u003cli\u003eRamamurthy, T., and Sharma, N. C. (2014). Cholera Outbreaks in India. In G. B. Nair and Y. Takeda (Eds.), \u003cem\u003eCholera Outbreaks\u003c/em\u003e (Vol. 379, pp. 49\u0026ndash;85). Springer Berlin Heidelberg. https://doi.org/10.1007/82_2014_368\u003c/li\u003e\n\u003cli\u003eRaveendran, R., Wattal, C., Sharma, A., Oberoi, J. K., Prasad, K. J., and Datta, S. (2008). High level ciprofloxacin resistance in Salmonella enterica isolated from blood. \u003cem\u003eIndian Journal of Medical Microbiology\u003c/em\u003e, \u003cem\u003e26\u003c/em\u003e(1), Article 1. https://doi.org/10.4103/0255-0857.38858\u003c/li\u003e\n\u003cli\u003eSon, K. C., Chung, H. S., Jung, S. I., Kim, M. S., Hwang, E. C., Kim, J. W., and Kwon, D. D. (2018). Trial Comparing a Combined Regimen of Amikacin and Ciprofloxacin to Ciprofloxacin Alone as Transrectal Prostate Biopsy Prophylaxis in the Era of High Fluoroquinolone-Resistant Rectal Flora. \u003cem\u003eJournal of Korean Medical Science\u003c/em\u003e, \u003cem\u003e33\u003c/em\u003e(15), e113. https://doi.org/10.3346/jkms.2018.33.e113\u003c/li\u003e\n\u003cli\u003eSun, S., Gu, T., Ou, Y., Wang, Y., Xie, L., and Chen, L. (2024). Environmental Compatibility and Genome Flexibility of Klebsiella oxytoca Isolated from Eight Species of Aquatic Animals. \u003cem\u003eDiversity\u003c/em\u003e, \u003cem\u003e16\u003c/em\u003e(1), 30. https://doi.org/10.3390/d16010030\u003c/li\u003e\n\u003cli\u003eTaylor, D. L., Kahawita, T. M., Cairncross, S., and Ensink, J. H. J. (2015). The Impact of Water, Sanitation and Hygiene Interventions to Control Cholera: A Systematic Review. \u003cem\u003ePLOS ONE\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(8), e0135676. https://doi.org/10.1371/journal.pone.0135676\u003c/li\u003e\n\u003cli\u003eZaman, K., Ryun Kim, D., Ali, M., Ahmmed, F., Im, J., Islam, M. T., Khan, A. I., Yunus, M., Khan, M. A., Marks, F., Qadri, F., Kim, J., and Clemens, J. D. (2020). Can cholera \u0026lsquo;hotspots\u0026rsquo; be converted to cholera \u0026lsquo;coldspots\u0026rsquo; in cholera endemic countries? The Matlab, Bangladesh experience. \u003cem\u003eInternational Journal of Infectious Diseases\u003c/em\u003e, \u003cem\u003e95\u003c/em\u003e, 28\u0026ndash;31. https://doi.org/10.1016/j.ijid.2020.02.055\u003c/li\u003e\n\u003cli\u003eZereen, F., Akter, S., Sobur, M., Hossain, M., and Rahman, M. (2019). Molecular detection of Vibrio cholerae from human stool collected from SK Hospital, Mymensingh, and their antibiogram. \u003cem\u003eJournal of Advanced Veterinary and Animal Research\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e(4), 451. https://doi.org/10.5455/javar.2019.f367\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Vibrio cholerae, prevalence, Antibiotic susceptibility test, multi-drug resistant, MEM","lastPublishedDoi":"10.21203/rs.3.rs-7072088/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7072088/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003eVibrio cholerae\u003c/em\u003e, the etiological agent of cholera, remains a significant public health concern in several regions of Khyber Pakhtunkhwa, Pakistan. Cholera is characterized by acute watery diarrhea, which can lead to severe dehydration and death if left untreated. Contributing factors to outbreaks in Khyber Pakhtunkhwa include poor sanitation, limited access to clean drinking water, and overcrowded living conditions. This study aimed to determine the prevalence, antimicrobial susceptibility patterns, and molecular characterization of \u003cem\u003eV. cholerae\u003c/em\u003e during a diarrheal outbreak in Peshawar, Pakistan, in July 2023. A total of 45 stool samples were collected from patients suffering from diarrhea. Samples were cultured on Thiosulfate-Citrate-Bile-Sucrose agar. Isolates were identified using standard biochemical tests, followed by molecular confirmation through PCR amplification of the 16S rRNA gene. Biochemical tests confirmed 34 (75.55%) isolates as \u003cem\u003eV. cholerae\u003c/em\u003e. The highest infection rate was observed in the age group of \u0026le;\u0026thinsp;18 years (64.70%), with a higher frequency in male patients (79.41%). Antibiotic susceptibility test using the Kirby-Bauer disc diffusion method revealed multidrug resistance in 13 isolates, showing resistance to at least three distinct antibiotic classes. Sequencing and phylogenetic analysis of the 16S rRNA gene confirmed the multidrug resistant isolates as \u003cem\u003eV. cholerae\u003c/em\u003e. The isolates exhibited high resistance to ERY (100%), LVX (100%), AZM (92.85%), TET (88.89%), SXT (80%), AMP (75%), and CRO (75%). Conversely, CIP (53.84%), AMK (61.53%), and MEM (81%) showed the highest susceptibility. Statistical analysis revealed no significant association between \u003cem\u003eV. cholerae\u003c/em\u003e infection and age groups. The molecular analysis of \u003cem\u003eVibrio cholerae\u003c/em\u003e isolates revealed a significant prevalence of antibiotic resistance genes linked to various antibiotics classes, emphasizing the multi-drug resistant characteristics of \u003cem\u003eVibrio cholerae\u003c/em\u003e. PCR-based molecular characterization of multi-drug resistant isolates demonstrated higher prevalence of resistance genes including \u003cem\u003edfrA1\u003c/em\u003e (92.3%), \u003cem\u003esul1\u003c/em\u003e (92.3%), \u003cem\u003esul2\u003c/em\u003e (76.9%), \u003cem\u003etetA\u003c/em\u003e (76.9%), \u003cem\u003eblaTEM\u003c/em\u003e (84.6%), \u003cem\u003eblaCTX-M\u003c/em\u003e (69.2%), \u003cem\u003eblaOXA\u003c/em\u003e (61.5%), \u003cem\u003eblaSHV\u003c/em\u003e (38.5%), and \u003cem\u003emcr-1\u003c/em\u003e (53.8%). The identification of \u003cem\u003emcr-1\u003c/em\u003e is especially alarming because of its correlation with COL resistance. The findings highlight the alarming pattern of multidrug resistance in \u003cem\u003eV. cholerae\u003c/em\u003e isolates from Peshawar, emphasizing the need for effective surveillance and control measures to combat the spread of antibiotic resistant strains.\u003c/p\u003e","manuscriptTitle":"Detection of Antibiotic Resistance Genes in Vibrio cholerae isolated from Human Fecal samples during a Diarrheal Outbreak in Peshawar, Pakistan","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-21 10:22:33","doi":"10.21203/rs.3.rs-7072088/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f3c53240-1b70-40c1-b547-409e9f336db3","owner":[],"postedDate":"August 21st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-29T08:53:19+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-21 10:22:33","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7072088","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7072088","identity":"rs-7072088","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00