Adrenergic Ligands-Induced Transinhibition of EGFR by GPR27 and GPR173 Reveals a Novel GPCR Signaling Mechanism | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Biological Sciences - Article Adrenergic Ligands-Induced Transinhibition of EGFR by GPR27 and GPR173 Reveals a Novel GPCR Signaling Mechanism Sorin Tunaru, Sorina Anghel, Rodica Badea, Cosmin Trif, Teodora Stratulat, and 11 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7641991/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract G protein-coupled receptors 27 and 173 (GPR27 and GPR173) are part of the "Super Conserved Receptors Expressed in Brain" (SREB) family, alongside GPR85. While the endogenous ligands and functions of SREB receptors are still unknown, GPR27 has been implicated in insulin secretion and tumorigenesis, whereas GPR173 has been proposed to be a receptor mediating biological effects of phoenixin-20 amide. Here, we show that substituting GPR27’s C-terminal domain with that of the β1 adrenergic receptor (β1AR) yields a chimera with β1AR-like ligand selectivity and cellular functions. Interestingly, stimulation of GPR27 with isoproterenol and adrenergic ligands inhibited epidermal growth factor (EGF)-induced serum-responsive element (SRE) activation, independently of G proteins and β-arrestins, and induced GPR27 internalization.Surprisingly, GPR173 responded exclusively to noradrenaline, showing both inhibition of EGF-induced SRE activity and receptor internalisation, whereas GPR85 remained unresponsive to the tested adrenergic ligands. Taken together, these intriguing findings suggest that GPR27 and GPR173 respond to adrenergic ligands to transinhibit EGFR through a unique and atypical signaling mechanism, previously undescribed for any known GPCR. Moreover, we provide the first evidence of ligand-induced functional transinhibition of a receptor tyrosine kinase, such as EGFR, by a GPCR, opening new research lines with translational potential. Biological sciences/Cell biology/Cell signalling/Hormone receptors Health sciences/Diseases/Cancer Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction G protein-coupled receptors (GPCRs) represent one of the largest and most diverse families of membrane receptors in mammalian cells, playing pivotal roles in transducing extracellular signals into intracellular responses (1). Among the less explored members of this vast superfamily are the Super Conserved Receptors Expressed in Brain (SREB), which include SREB1 (GPR27), SREB2 (GPR85), and SREB3 (GPR173). These receptors, first identified through genomic analysis and named for their conserved sequences across species, are predominantly expressed in the central nervous system (CNS), hinting at their potential roles in neurophysiology and brain function (2, 3). Despite their evolutionary conservation and high expression in the CNS, the endogenous ligands and physiological functions of SREBs have remained elusive, classifying them as orphan GPCRs (4). Recent research, however, has begun to shed light on the potential roles of these receptors. GPR27, for example, has been implicated in modulating insulin secretion, suggesting a link between this receptor and metabolic regulation (5, 6). Moreover, the heterologous expression of GPR27 in HEK293T cells resulted in elevated inositol phosphate levels, pointing to a G q/11 protein-coupling of this receptor (7). On the other hand, a broader study involving the analysis of the transient expression of a large number of GPCRs on cAMP levels in Chinese hamster ovary (CHO) cells revealed that GPR27, but not GPR85 and GPR173, displays significant constitutive inhibitory activity on cAMP-driven gene expression, suggesting potential G i protein-coupling of GPR27 (8). In addition, several synthetic agonists of GPR27 have been recently proposed. These agonists display specificity for GPR27 over GPR85 and GPR173 and, interestingly, in the case of GPR27, induced the recruitment of β-arrestin 2 in a G protein-independent manner (9). Evidence of possible implications in pathological conditions was drawn from the analysis of The Cancer Genome Atlas Database, where lower expression levels of GPR27 were correlated with higher death rates in patients with glioma (10). On the other hand, GPR173 is considered to be the putative receptor for phoenixin mediating the enhanced gonadotropin-releasing hormone (GnRH) signaling in the hypothalamus and pituitary gland, and thus promoting luteinizing hormone (LH) secretion and supporting ovarian cycling (11) . The functional interaction between GPCRs and receptor tyrosine kinases (RTKs) has been the subject of intense research since the seminal work by Ulrich and colleagues describing tyrosine phosphorylation of the epidermal growth factor receptor (EGFR) in response to known GPCR agonists,a phenomenon termed “transactivation” (12).EGFR is not the only RTK family member subject to transactivation by GPCRs. Other RTKs, such as fibroblast growth factor receptors (FGFRs), platelet-derived growth factor receptors (PDGFRs), or the insulin receptor (IR), have been reported to be targets for GPCR transactivation (13). Thebiological consequences of transactivation are well described. For example, the activation of GPCRs by ligands such as lysophosphatidic acid (LPA), endothelin-1, and thrombin in Rat-1 fibroblasts promotes S phase entry and DNA synthesis through transactivation of the EGFR (14). The molecular mechanisms underlying this phenomenon are still not fully clear. Several lines of evidence demonstrate that the transactivation of RTKs by GPCRs involves metalloproteinases (MMPs) or a disintegrin and metalloproteinases (ADAMs). MMPs and ADAMs cleave pro-ligands of RTKs bound to extracellular matrix components, leading to the release of ligands that can bind to their cognate RTKs, triggering intracellular signaling events (15, 16).In contrast to the transactivation phenomenon, the inhibition of RTK signaling by GPCRs has not yet been widely reported. However, it was recently reported that CXCL12 stimulation of CXCR4-positive HeLa and 5637 cells induced the inhibition of EGFR phosphorylation involving protein kinase C (PKC) (17). Although the transactivation of RTKs by GPCRs has been associated with important biological functions, the putative roles of transinhibition have not yet been described. The present study shows that GPR27 and GPR173 are novel adrenergic receptors that function atypically to transinhibit RTKs such as EGFR without engaging G proteins and arrestins. 2. Materials and Methods 3.1 Chemicals The majority of chemicals were purchased from Cayman Chemicals, with a few exceptions. Pertussis toxin (PTX) was obtained from Invitrogen (Carlsbad, CA, USA), YM-254890 from Focus Biomolecules (Montgomery County, PA, USA), the GRK inhibitor, 4-Amino-5-(bromomethyl)-2-methyl pyrimidine dihydrobromide (CAS 5423-98-3) and sodium orthovanadate from Santa Cruz Biotechnology (Texas, USA), Tris-base, protease inhibitor cocktail from Thermo Fisher Scientific (Waltham, MA, USA), phenylmethylsulfonyl fluoride (PMSF, A0999), NP-40 from AppliChem (Darmstadt, Germany), sodium fluoride (NaF) from VWR (Seattle, WA, USA), polyethyleneimine (PEI), gallein, PP2 (4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4-d]pyramidine), iodoacetic acid, sodium dodecyl sulfate (SDS), sodium deoxycholate were from Sigma-Aldrich (St. Louis, MO, USA) and EGF was obtained from PeproTech Inc. (Rocky Hill, New Jersey, USA). The FDA-Approved Drug Library containing 1403 compounds was acquired from TargetMol (Boston, MA, USA). 3.2 Cell culture and transfection HEK293T cells (RRID: CVCL_0063) were grown in DMEM with 4.5 g/L glucose (Pan Biotech) supplemented with 10% foetal bovine serum (FBS) (Gibco) and 1% penicillin and streptomycin mix (Gibco) at 37°C and 5% CO 2 . Plasmid constructs were transfected into HEK-293T cells using polyethylenimine (PEI) or Lipofectamine 2000 (Thermo Scientific). 3.3 Plasmids The human GPR27 (SREB1) and GPR173 (SREB3) plasmids were cloned in a previous study (9). Human GPR85 (SREB2) was amplified by PCR using pcDNA3.1(+)-GPR85 (cDNA Resource Center, The Bloomsburg University Foundation, PA, USA) as template and the following primers: forward - 5’- CCTAGGTACCATGGCGAACTATAGCC - 3’ reverse - 5’ – GCTCGGATCCTCATATAACACAGTAAGG - 3’ The amplified fragment was inserted into pcDNA3.1-N-DYK vector between KpnI and BamHI restriction sites. pGloSensorTM-22F cAMP plasmid, pGL4.29[luc2P/CRE/Hygro], pGL4.33[luc2P/SRE/Hygro] were purchased from Promega Corporation (Madison, WI, USA). pOZITX-S1 was a gift from Jonathan Javitch (Addgene plasmid #184925; http://n2t.net/addgene:184925; RRID:Addgene_184925). N-terminally HA-tagged β1AR and the chimeric receptors cDNAs were synthesized and cloned into pcDNA3.1(+)(GenScript Biotech Corporation, Nanjing, China). The truncated form of GPR27 (GPR27ΔCterm) was generated by PCR cloning using pcDNA3.1-N-DYK-GPR27 as a template and the following primers: forward - 5’-AATGGATCCACCATGAAGACGATCATC-3’, reverse - 5’-TAGTCTAGATTAGCTCTGGCAGCAGGGGAAC - 3’. The amplicon product was then inserted into pcDNA3.1(+) vector between BamHI and XbaI restriction sites. PWPXLD-EGFR-WT was a gift from Chay Kuo (Addgene plasmid #133749; http://n2t.net/addgene:133749; RRID: Addgene_133749). All plasmids generated were validated by enzymatic digestion and sequencing (CeMIA, Larissa, Greece). All SREBs were sub-cloned in frame with Nanoluciferase (Nluc) into p-Nluc-N1. The membrane anchoring sequence derived from the myristoylation signal of the human Src family kinase (Lyn11) was cloned in frame into p-mVenus-N1, as previously described. 3.4 Determination of cell surface receptor expression by whole-cell ELISA HEK293T cells were transiently transfected with plasmids encoding receptor cDNAs in a 96-well plate format. The following day, cells were washed with HBSS and fixed with paraformaldehyde 1% for 5 min. The permeabilization of cells was performed using TritonX-100 0.1% treatment for 3 min to assess the total protein expression. Then, cells were washed three times with HBSS, blocked with 5% non-fat dry milk/HBSS for 1h, and probed with horseradish peroxidase-conjugated antibody directed against the FLAG epitope (1:1000, Sigma) for another hour. After the washing step, cells were incubated with TMB substrate (BD Biosciences, SanDiego, USA), and the reaction was stopped by adding 1M H 2 SO 4 , resulting in a yellow color solution with an absorbance at 450 nm that was measured on a microplate reader (Mithras LB 940, Berthold Technologies). 3.5 cAMP determination HEK293T cells were seeded in white clear-bottom 96-well plates and transiently co-transfected with a plasmid encoding a cytosolic localized cAMP-sensitive bioluminescent probe, pGlo-22F (Promega), and plasmids containing receptor cDNAs. After 24 h, cells were incubated at room temperature in HBSS containing 1 mM Luciferin EF (NanoLight) for 2 h, in the dark. Following ligand stimulation for 15 min, luminescence was recorded by a microplate reader (Mithras LB 940, Berthold Technologies). 3.6 GTPase assay HEK293T cells seeded in 55 cm 2 dishes were transiently transfected with the pcDNA3.1 empty plasmid and, respectively, with plasmids encoding GPR27 and β1AR cDNAs. 24 h later, cells were washed with cold PBS and lysed with hypotonic buffer (20 mM HEPES, pH 7.4, 1 mM EDTA supplemented with 1 mM DTT, protease inhibitor cocktail EDTA-free, 1 mM PMSF, 1 mM orthovanadate, 5 mM iodoacetic acid, 5 mM NaF) by passing them 15-20 times through a 26G syringe needle. Then, the lysate was centrifuged for 10 min at 9000xg, 4°C, and the nuclear fraction was discarded. The soluble fraction was further centrifuged for 40 min at 25000xg, 4°C, and the resulting pellet (membrane fraction) was resuspended in GTPase/GAP buffer (from GTPase-GloTM Assay kit), containing or not 2 nM isoprotenerol. GTPase activity was further determined using the GTPase-GloTM assay kit (Promega Corporation, WI, Madison, USA) following the protocol for intrinsic GTPase activity recommended by the manufacturer. After adding Detection Reagent, the reactions were incubated for 5-10 min at 25°C, and the luminescence was recorded on a microplate reader (Mithras LB 940, Berthold Technologies). Total protein of each sample was estimated using a Pierce BCA Protein Assay kit (Thermo Scientific, Rockfort, IL, USA). To determine the specific GTPase activity, the luminescence value obtained was normalized to the total protein for each sample. 3.7 CRE- and SRE-luciferase reporter gene assay HEK293T cells were seeded in white clear-bottom 96-well plates and transiently transfected with pGL4.29[luc2P/CRE/Hygro] or pGL4.33[luc2P/SRE/Hygro] (Promega) together with plasmid encoding receptor cDNAs. After 24h, cells were incubated for 4 h at 37°C, 5% CO 2 with different compounds in serum-free media and lysed with 0.25% Triton X-100 for 30 min at 4°C. Luciferase activity was measured using Firefly Luciferase Assay Reagent (NanoLight) on a microplate reader (Mithras LB 940, Berthold Technologies). For SRE and SRF-RE experiments, the media was replaced by DMEM containing 2% FBS before transfection, and 1% FBS was used during the assay. 3.8 Beta-arrestin 2 recruitment assay β-Arrestin 2 recruitment assay was performed by Firefly Luciferase Complementation Assay as previously described ( 9 ). Briefly, cells were transfected with plasmids encoding cDNAs for β-arrestin 2 fused with the N-terminal part of the firefly luciferase (β-arr2-FLuc) and GPR27 or β2AR fused with the C-terminal part of the firefly luciferase (GPR27-FLuc or β2AR-FLuc). Additionally, we employed chimeric receptors consisting of GPR27 or β2AR with the C-terminal domain replaced by the homologous domain of vasopressin 2 receptor (V2R) fused with the C-terminal part of the firefly luciferase (GPR27-V2RFluc or β2AR-V2RFluc). After 24h, the medium was replaced with HBSS, and cells were stimulated with compounds for 10 min at room temperature. Luminescence was recorded on a microplate reader (Mithras LB 940, Berthold Technologies) after luciferin EF (1 mM) addition. 3.9 Immunoblotting HEK293T cells seeded in 12-well plates were transiently transfected with plasmids containing receptor cDNAs. After 24h, cells were starved for 6h or overnight (16h) in DMEM without FBS and then treated with isoproterenol at the indicated concentrations for 10 min at 37°C. Then, the cells were lysed in ice-cold radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris, 150 mM NaCl,1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, pH 7.5) supplemented with protease inhibitors cocktail and the lysates were clarified by centrifugation for 45 min at 25000xg, 4°C. Equal amounts of total lysates were separated by SDS-PAGE and transferred to a PVDF membrane. Detection was performed with specific antibodies: rabbit monoclonal anti-pERK (1:1000), rabbit monoclonal anti-ERK (1:1000), rabbit monoclonal anti-pY416(c-Src) (1:1000), and anti-HA-HRP (1:1000) all from Cell Signaling Technology (Danvers, MA, USA), mouse monoclonal anti-c-Src (Merck-Millipore, Darmstadt, Germany), mouse monoclonal anti-FLAG-HRP (Sigma-Aldrich, Darmstadt, Germany), rabbit polyclonal anti-calnexin (1:6000) (kindly provided by Dr. Gabriela Chiritoiu, Institute of Biochemsitry, Bucharest, Romania). As secondary antibodies, we used goat anti-mouse-HRP (1:4000) and mouse anti-rabbit-HRP (1:4000). 3.10 Bioluminescence resonance energy transfer (BRET) assay BRET assays were performed 48 h after transfection. Therefore, cells were washed with HBSS/ HEPES and equilibrated with 32.5 µl HBSS/ HEPES for 60 min at room temperature. 12.5 µl of NanoBRET NanoGlo substrate, diluted 1:250 (final dilution 1:1000), were added, and ten consecutive baseline reads were taken using the EnVision Microplate reader. Luminescence was measured at 460 ± 80 nm (donor) and 535 ± 30 nm (acceptor), and the BRET ratio was calculated as the ratio between acceptor and donor emission. Stimulation was performed by adding 5 µl of 10x ligand solution, and reading was continued for another 30 cycles. The basal BRET ratio before ligand stimulation was defined as the average of the last four consecutive BRET values before ligand addition. To quantify ligand-induced changes, ΔBRET was calculated for each well as % over basal [(Ratiostim - Ratiobasal)/Ratiobasal] x 100. Subsequently, the average ΔBRET of vehicle control was subtracted. The net area under the curve (AUC) was calculated using Graphpad Prism 10.4. 3.11 Statistics The presented data are expressed as mean ± s.e.m. Statistical., and statistical analysis was performed by using GraphPad Prism 8 software. Unpaired Student’s t-tests were used to compare two groups. 3. Results 4.1 Heterologously expressed human GPR27 reduces intracellular cAMP levels in a G i/o/z protein-independent manner. To explore the cellular functions of SREBs, we examined whether the heterologous expression of human GPR27, GPR85, and GPR173 in HEK293T cells impacts various intracellular signaling pathways, including those modulating cAMP levels. As illustrated in Figure 1a,, expression of GPR27 and GPR173 significantly reduced forskolin-induced cAMP accumulation, with the most pronounced effect observed for GPR27, whereas GPR85 showed no impact on intracellular cAMP levels. Based on the observation that GPR27 severely affected basal- as well as forskolin-induced increase in cAMP, we next examined the possibility that GPR27 is a constitutively active receptor interacting with G i proteins as previously reported (8). To explore this hypothesis, we determined the effect of stimulation with 10 µM forskolin on cAMP levels in HEK293T cells expressing GPR27 in the absence and the presence of the G i/o protein inhibitor pertussis toxin (PTX). As presented in Figure 1b, pretreatment of cells with PTX did not result in the reversal of the inhibitory effect of GPR27 on cAMP levels following forskolin stimulation. However, the well-known inhibitory effects of nicotinic acid (niacin) on cAMP mediated by hydroxycarboxylic acid receptor 2 (HCA 2 ) (18) were fully reversed by PTX pretreatment, confirming the toxin's effectiveness. To further address the potential involvement of other types of G proteins, such as G z , we examined the effect of a recently described toxin, OZITX (Gα o , Gα z , and Gα i -inhibiting t o x in) (19), on the ability of GPR27 to decrease cAMP levels in cells stimulated with forskolin. As shown in Figure 1c, the expression of OZITX did not reverse the inhibitory effects of GPR27 on cAMP levels increased by forskolin. However, the quinpirole inhibition of forskolin-induced increase in cAMP levels through the dopamine D2 receptor was fully reversed by the presence of OZITX. Interestingly, the expression of OZITX induced a decrease in basal levels of cAMP in mock and D2R expressing cells. Although GPR27 showed significant cellular effects in the absence of ligand stimulation, which were not mediated by G i/o/z proteins, it localized at the plasma membrane as demonstrated by the detection of an anti-FLAG-HRP-conjugated antibody in non-permeabilized and permeabilized conditions of HEK293T cells expressing human N-terminally FLAG-tagged GPR27 (Figure 1d). These results demonstrate that GPR27 is not a G i/o/z protein-coupled constitutively active receptor as it strongly inhibits the accumulation of intracellular cAMP independently of these types of G proteins. 4.2 Critical role of the C-terminal domain of GPR27 and β1AR in signaling Given that heterologous expression of GPR27 induces cellular effects independently of ligand stimulation and without engaging G proteins, we investigated whether the intracellular C-terminal domain of GPR27 might be responsible for these effects. To explore this idea, we employed several strategies, including the construction of chimeric GPR27 receptors containing the C-terminal domains of receptors with known ligands. Functional studies were then conducted to evaluate the impact of these modifications on chimera signaling. Additionally, we created chimeras where the C-terminus of known GPCRs was replaced with that of GPR27 and assessed their functional properties (Fig. 2a, d, inside panel).Surprisingly, the chimera of GPR27 containing the β1-adrenergic receptor (β1AR) C-terminus (GPR27-Ctβ1) responded to increasing concentrations of isoproterenol in the cAMP accumulation assay, mimicking β1AR, while wild-type GPR27 remained unresponsive to isoproterenol concentrations up to 30 nM. Conversely, the chimera of β1AR containing the GPR27 C-terminus (β1AR-Ct27) was unresponsive to isoproterenol, similar to GPR27 (Fig. 2b). These functional differences were not due to altered expression levels, as both GPR27-Ctβ1 and β1AR-Ct27 showed comparable plasma membrane localization in HEK293T cells (Suppl. Fig. S1). Similar results were observed in the cAMP accumulation assay when both chimeras were exposed to increasing concentrations of the endogenous β1AR ligand, adrenaline (Fig. 2c). These findings prompted us to assess the impact of FDA-approved compounds on GPR27-Ctβ1 and β1AR. As shown in Table 1, adrenergic and dopaminergic ligands induced similar activation profiles on GPR27-Ctβ1 and β1AR. The observation that the β1AR C terminus confers GPR27 responsiveness to adrenergic ligands led us to investigate whether C termini from other adrenergic receptors, such as β2AR or α1AR, would impart similar functional properties to GPR27. As shown in Figure 2d, replacing the GPR27 C terminus with the corresponding domains of β2AR (GPR27-Ctβ2) or α1AR (GPR27-Ctα1) did not result in chimeras capable of mediating cAMP increases following stimulation with maximal concentrations of isoproterenol. These results indicate that the unique and intriguing combination of GPR27’s seven-transmembrane domain and the β1AR C terminus is necessary to create a chimeric receptor that mirrors β1AR’s ligand recognition and G s protein-mediated signaling. Given the responsiveness of the GPR27-Ctβ1 chimera to adrenergic ligands, we further examined whether wild-type GPR27 mediates isoproterenol effects by stimulating G s protein-induced intracellular cAMP increases or by inhibiting forskolin-induced cAMP elevation. Stimulation of HEK293T cells expressing GPR27 with a maximal concentration (1 nM) of isoproterenol did not lead to cAMP accumulation, unlike the robust cAMP increase observed in β1AR-expressing cells (Suppl. Fig. S2a). Additionally, isoproterenol stimulation of GPR27-expressing cells failed to inhibit forskolin-induced cAMP elevation (Suppl. Fig. S2b). These findings demonstrate that GPR27 does not engage G s or G i proteins to alter intracellular cAMP levels in response to isoproterenol stimulation. 4.3 GPR27 mediates the inhibitory effects of isoproterenol on transcription factor activity Based on the observation that the GPR27-Ctβ1 chimera can respond to isoproterenol similarly to β1AR, we hypothesized that GPR27 is able to bind adrenergic ligands such as isoproterenol. Unfortunately, no labeled adrenergic ligands are available on the market to directly demonstrate the binding of adrenergic ligands to GPR27. However, to indirectly test such an idea, we investigated whether GPR27 could affect cellular signaling pathway functions through a more integrative approach, by analyzing the activity of transcription factors in response to isoproterenol. Consistent with the lack of impact on G s protein-mediated signaling, stimulation of HEK293T cells expressing GPR27 with isoproterenol did not affect the activity of the cyclic AMP response element-luciferase (CRE-Luc) fusion protein (Fig. 3a). However, when cells were coexpressed with the serum-response element-luciferase (SRE-Luc) fusion protein reporter, isoproterenol stimulation resulted in a GPR27-dependent decrease in SRE-Luc activity. In contrast, β1AR-expressing cells showed the opposite response, with isoproterenol increasing SRE-Luc activity (Fig. 3b), while there was no effect of isoproterenol on SRE-Luc activity in GPR85- and GPR173-expressing cells. However, in the case of GPR173-expressing cells, there was a tendency for isoproterenol to inhibit SRE-Luc activity, although without reaching statistical significance. Since SRE activity is known to be modulated by RTKs, we hypothesized that GPR27 might alter SRE activity in response to adrenergic ligands, such as isoproterenol and noradrenaline. As shown in Figure 3c, isoproterenol stimulation of cells expressing GPR27 inhibited the EGF-stimulated increase in SRE-Luc activity in a GPR27 and concentration manner as cells expressing an empty vector (mock) showed the opposite effect when challenged with isoproterenol, namely an increase rather than a decrease in SRE-Luc activity. The inhibitory effect of isoproterenol on SRE-Luc activity via GPR27 was completely reversed by the β1AR antagonist metoprolol and the β1/β2AR antagonist propranolol (Fig. 3d), supporting the idea that GPR27 is a β1AR-like receptor but with opposite cellular functions. Similar to the isoproterenol-induced inhibition of the EGF-induced increase in SRE-Luc activity, the endogenous ligand, noradrenaline, is able to inhibit SRE-Luc activity with a similar potency as isoproterenol. To our surprise, noradrenaline stimulation of cells expressing GPR173 led to a similar effect on SRE-Luc activity as GPR27-expressing cells (Fig. 3e). These unexpected results prompted us to verify whether β1/β2AR antagonists have a similar effect on noradrenaline-induced inhibition of SRE-Luc activity as in GPR27-expressing cells. As presented in Figure 3f pretreatment, pretreatment of cells expressing GPR173 with a maximal concentration of metoprolol and propanolol reversed the inhibitory effects of noradrenaline on SRE-Luc activity. These observations demonstrate that GPR27 and GPR173 specifically inhibit SRE-Luc activity in response to noradrenaline (GPR27 and GPR173) and isoproterenol (GPR27 only), a distinct feature not observed in GPR85, emphasizing the unique cellular effects mediated by GPR27 and GPR173 within the SREB family. 4.4 GPR27-mediated inhibition of EGF signaling reveals a role of ICL3 and distinct internalization responses to adrenergic ligands. To prove that GPR27 and GPR173 directly mediate cellular effects of adrenergic ligands, such as isoproterenol and noradrenaline, we conducted internalization experiments in HEK293T cells expressing C-terminally Nluc-tagged SREB receptors and mVenus-tagged membrane anchoring sequence (mas). As shown in Figure 4a, isoproterenol stimulation of cells expressing GPR27 resulted in time-dependent internalization of GPR27, whereas GPR85 and GPR173 did not undergo such cellular effects. However, to our surprise, GPR173 internalized to the same extent as GPR27 when cells were exposed to a maximal concentration of noradrenaline, as presented in Figure 4b. Furthermore, to demonstrate the involvement of the EGFR in the effects of isoproterenol mediated by GPR27, cells expressing either GPR27 or the empty vector were exposed to 1 nM EGF and increasing concentrations of isoproterenol in the presence or absence of the EGFR antagonist, erlotinib. As illustrated in Figure 4c, isoproterenol strongly reduced the effect of EGF on SRE-Luc activity in a concentration-dependent manner only in cells expressing GPR27. Erlotinib treatment abolished the concentration-dependent inhibition of SRE-Luc activity by isoproterenol. Furthermore, in an attempt to determine the structural determinants of GPR27 involved in the inhibition of EGF signaling by isoproterenol, chimeric receptors between GPR27 and β1AR were expressed in HEK293T cells, and the effect of isoproterenol stimulation on EGF-induced SRE-Luc activity was determined. When stimulated with increasing concentrations of isoproterenol, the the GPR27-Ctβ1 chimera activated SRE-Luc activity with a similar profile as found for β1AR. On the other hand, β1AR-Ct27 responded to isoproterenol in an almost identical manner as GPR27, by concentration-dependent inhibition of EGF-induced SRE-Luc activation (Fig. 4d). These results correlate with those observed in the functional intracellular cAMP assay (Fig. 2b,c), suggesting that the combination of GPR27’s 7TM domain and the C terminus of β1AR is necessary to obtain a chimera that acquires G s protein-coupling and SRE-Luc-activating characteristics. These result point to a critical role of the C-terminal domain of GPR27 in signaling. To investigate this hypothesis, we generated a truncated version of GPR27 lacking the C terminus (amino acids P359 – L375, GPR27∆Cterm). When heterologously expressed in HEK293T, GPR27∆Cterm localized at the plasma membrane similarly to GPR27 (Suppl. Fig. S3a). However, contrary to our expectations, GPR27∆Cterm showed no coupling to G s or G i proteins in response to isoproterenol when tested in a functional cAMP assay (Suppl. Fig. S3b,c). Consistent with a lack of G s or G i protein-coupling, GPR27∆Cterm and β1AR-Ct27 responded to isoproterenol similarly to GPR27 by inhibiting EGF-induced SRE-Luc activation in a concentration-dependent manner (Fig. 4d). A recent study demonstrated an important role of the intracellular loop 3 (ICL3) for β1AR-coupling to G s proteins (20). To test the potential role of ICL3 of GPR27 and β1AR in receptor functionality, we generated chimeric receptors of β1AR having the ICL3 from GPR27 (β1ARicl 3 27) and of GPR27 with the ICL3 from β1AR (GPR27icl 3 β1). Interestingly, β1ARicl 3 27 showed an almost unaffected capacity to respond to isoproterenol in cAMP assays (Suppl. Fig. S4. On the other hand, isoproterenol stimulation of cells expressing GPR27icl3β1 or GPR27icl3β1∆Ct chimeras resulted in a significant reduction of the inhibitory effect of isoproterenol on the EGF-induced increase in SRE-Luc activity (Figure 4e). Interestingly, both chimeras also have a significantly reduced inhibitory effect on the basal intracellular cAMP levels compared to cells expressing GPR27 (Fig. 4f), although they showed plasma membrane localization levels similar to GPR27 (Suppl. Fig. S5. These results clearly indicate that the ICL3 of GPR27 appears to be critical for the observed inhibitory effects on SRE-Luc activity and cAMP levels in G protein-independent signaling whereas the receptor’s C terminus appears not to be important for these effects to occur. 4.5 Isoproterenol-induced inhibition of EGF signaling through GPR27 does not involve G proteins or arrestins. Based on the data showing that the ligand-induced inhibition of EGF signaling through GPR27 results in a reduced SRE-Luc activity, we wanted to address the question: What are the cellular components involved in this phenomenon? To test the potential involvement of G proteins, we assessed the result of GPR27 stimulation with isoproterenol on overall cellular GTPase activity. As illustrated in suppl. Fig. S6 isoproterenol stimulation of cells expressing β1AR resulted in a significant increase in cellular GTPase activity, as expected. In contrast, exposure to a maximal concentration (10 µM) of isoproterenol did not affect GTPase activity in cells expressing GPR27. To further analyze the potential involvement of specific G proteins in the observed effects of isoproterenol through GPR27, we employed selective inhibitors of G q/11 , G 12/13 , G i/o proteins, as well as the nonselective G protein inhibitor, suramin. As shown in Figure 5a, pretreatment of HEK293T cells expressing GPR27 with PTX (G i/o protein inhibitor), Y-27632 (an inhibitor that prevents G 12/13 protein-mediated ROCK-dependent downstream cellular effects) and YM-254890 (a G q/11 protein inhibitor) did not significantly reverse the inhibitory effect of isoproterenol on the EGF-induced increase in SRE-Luc activity. Furthermore, the pretreatment with gallein (an inhibitor of Gβγ protein subunit-dependent signaling) did not reverse the inhibitory effect of GPR27 stimulation with isoproterenol on EGF-induced SRE activation. These results demonstrate that GPR27 mediates the inhibitory effects of isoproterenol on EGF-induced SRE-Luc activation independent of G proteins, irrespective of their subtype. In response to agonist stimulation, GPCRs become substrates for the action of G protein receptor kinases (GRKs), which are serine-threonine kinases that phosphorylate serine and threonine residues mostly located especially within the ICL3 and C-terminal domain of the activated receptor (21). This phosphorylation event is part of the desensitization mechanism involving arrestin recruitment to the phosphorylated receptor and its internalization (22). It is now well established that G protein-independent signaling of GPCRs, especially through β-arrestins, plays a significant role in regulating cellular responses (23, 24). Since we did not observe any role of G proteins in the inhibition of SRE-Luc activity by GPR27, we wondered whether GRKs and arrestins could mediate these effects of GPR27 stimulation with isoproterenol on EGF-induced SRE-Luc activation. To test this idea, we first examined the impact of the pharmacological inhibition of GRKs on GPR27-induced inhibition of SRE-Luc activity after isoproterenol stimulation. As shown in Figure 5b, pretreatment of cells expressing GPR27 with the non-selective GRK inhibitor 4-Amino-5-(bromomethyl)-2-methylpyrimidine dihydrobromide (AB06102) could not reverse the inhibition of EGF-induced increase in SRE-Luc activity triggered by stimulation of GPR27 with a maximal concentration (1 µM) of isoproterenol. However, in cells expressing β1AR, pretreatment with AB06102 led to an enhanced SRE activity in response to isoproterenol, as expected, considering that GRKs inhibitor prevents the desensitization mechanism of β1AR is affected by the GRKs inhibitor. Furthermore, to explore the possibility that β-arrestin 2 might mediate the effects of isoproterenol stimulation of GPR27 on SRE activity, we employed a previously described complementation-based system (9), consisting of a chimeric GPR27 receptor in which the the C-terminus domain is replaced with the corresponding domain of the vasopressin 2 receptor (V2R) and fused to a C-terminal portion of the firefly luciferase (Fluc) separated by a linker (GPR27-V2R-Fluc). We also employed a chimeric GPR27 with its C-terminus fused to the C-terminal part of the Fluc (GPR27-Fluc). The β-arrestin 2 fused with the N-terminal part of the Fluc (β-arr-Fluc) was coexpressed with GPR27-V2R-Fluc and GPR27-Fluc to determine the potential arrestin recruitment to the receptors. As shown in Figure 5c, isoproterenol stimulation of HEK293T cells expressing β-arr-Fluc together with GPR27-V2R-Fluc or GPR27-FLuc did not increase luciferase activity compared to solvent stimulation. This indicates that the complementation of the two fragments of the luciferase was not achieved through isoproterenol-stimulated GPR27-V2R-Fluc. Thus, these results suggest that β-arrestin 2 was not recruited to the stimulated chimeric receptor. To verify that the chimeric receptors described above retained their functionality, GPR27-Fluc and GPR27-V2R-Fluc were tested for their responsiveness to isoproterenol challenge. As shown in Figure 5d, stimulation with a maximal concentration (1µM) of isoproterenol led to a strong inhibition of EGF-induced increase in SRE-Luc activity in cells expressing GPR27-Fluc and GPR27-V2R-Fluc. All these results indicate that GPR27-mediated inhibition of isoproterenol on the EGF-induced increase in SRE-Luc activity does not involve G proteins or β-arrestins. 4.6 Isoproterenol-induced inhibition of SRE activity through GPR27 does not involve ERK1/2 but implicates c-Src proteins. In an attempt to identify the intracellular mechanism responsible for SRE inhibition by isoproterenol through GPR27 and based on the observation that this inhibition does not involve G proteins, we analyzed the involvement of well-known intracellular proteins in the observed effects. Extracellular signal-regulated protein kinase (ERK) 1/2 proteins are well-known modulators of SRE activity (25, 26). Therefore, it was a natural question whether GPR27 might alter the phosphorylation status of ERK1/2 proteins in response to isoproterenol, which would then lead to SRE-Luc inhibition. As presented in Figure 6a stimulation of cells expressing GPR27 with a maximal concentration of isoproterenol did not change the phosphorylation levels of ERK1/2 proteins. However, in response to an equivalent concentration of isoproterenol, β1AR mediated a significant increase in the phosphorylated ERK1/2. Moreover, following isoproterenol stimulation, the GPR27-Ctβ1 chimera mediated a strong increase in the phosphorylation of ERK1/2 proteins, consistent with previously described effects on cAMP levels (Figures 6b, 2b). To our surprise, β1AR-Ct27 chimera stimulation with isoproterenol also led to significant phosphorylation of ERK1/2 (Fig. 6b), although it mediated inhibition of EGF-induced SRE activation, in a similar manner as GPR27 (Fig. 4d). These results indicate that the inhibition of SRE activity by GPR27 in response to isoproterenol does not occur through ERK1/2 proteins. Since the observed cellular effects of GPR27 in response to isoproterenol are the inhibition of EGF-induced SRE activation, we examined whether there is a direct interaction between GPR27 and EGFR. Although we could not see a ligand-induced interaction between GPR27 and EGFR, as revealed by immunoprecipitation studies (Suppl. Fig. S7), the role of c-Src proteins in phosphorylation of EGFR (27) as well as in EGFR transactivation by GPCRs has been previously demonstrated (28). Consistent with the role of Src in mediating trans-inhibition of EGFR by isoproterenol through GPR27, pretreatment of cells expressing GPR27 with the c-Src inhibitor PP2 led to a complete loss of the inhibitory effect of isoproterenol on EGF-induced SRE activation (Fig. 6c). Interestingly, in cells expressing β1AR, pretreatment with PP led to a potentiation effect of isoproterenol-induced SRE activation (Fig. 6d). Based on these results we concluded that GPR27 mediates the inhibition of EGF-dependent activation of SRE through a previously undescribed trans-inhibition mechanism, involving c-Src and EGFR. 4. Discussion In the present study, we promote the idea that GPR27 and GPR173 are novel atypical adrenergic receptors that trans-inhibit RTKs such as EGFR. Our starting point was the search for cellular effects induced by the heterologous expression of SREBs (GPR27, GPR85, and GPR173). Interestingly, GPR27 and to a lesser extent GPR173, but not GPR85 induced significant inhibition of the adenylyl-cyclase/cAMP pathway in a G i protein-independent manner. Our hypothesis that the C-terminal domain of GPR27 might play a role in the observed cellular effects of GPR27 led us to the generation of a series of chimeric receptors consisting of GPR27 lacking the C terminus, and with the C terminus replaced by the homologous domain of GPCRs with known ligands. Conversely, we generated chimeras consisting of known GPCRs with their C terminus replaced by the homologous domain of GPR27. All these chimeras were analyzed for expression and localization at the plasma membrane, followed by functional analyses. Surprisingly, among all the properly expressed chimeras, GPR27-Ctβ1 functioned similarly to β1AR in terms of G s protein-coupling and responsiveness to adrenergic agonists and antagonists. On the other hand, β1AR-Ct27 lost its ability to couple to G s proteins in response to agonists, suggesting that the C terminus of GPR27 severely impacts chimera signaling through G s proteins. These two important pieces of evidence prompted us to generate and test the functionality of GPR27∆Ct. Contrary to our expectations, the C-terminally truncated receptor did not regain G protein-coupling in response to adrenergic ligands, indicating that the C terminus might not be the only domain critically involved in the particular signaling characteristics of GPR27. Although GPR27-Ctβ1 functioned similarly to β1AR, GPR27 did not respond to adrenergic ligands by engaging canonical G protein-mediated signaling pathways. These results led us to interrogate more integrative signaling pathways, such as determining transcriptional factor activity after receptor stimulation. Among all the transcriptional factors tested, only the EGF-induced increase in SRE activity was strongly inhibited by GPR27 and GPR173 after stimulation with adrenergic ligands, including noradrenaline. Interestingly, the observed inhibitory effect of GPR27 was insensitive to G protein inhibitors, did not involve arrestin recruitment, and also did not alter the levels of the phosphorylated ERK1/2 proteins, suggesting a novel cellular signaling mechanism of GPR27. Importantly, GPR27-Ctβ1 functioned similarly to β1AR regarding SRE-Luc activation in response to isoproterenol, whereas β1AR-Ct27 was similar to GPR27, inducing an opposite effect on EGF signaling through SRE. These observations point to a critical role of the C-terminal domain of GPR27, especially when considering its severe impact on β1AR signaling. Unexpectedly to us, GPR27∆Ct still displayed full signaling characteristics of GPR27, including the effects on SRE activity. This is the reason we investigated the potential role of ICL3 of GPR27 and β1AR, by generating chimeras between both receptors, exchanging this domain. Notably, β1ARicl 3 27 functioned as β1AR in terms of G s protein-coupling and SRE-Luc activation. However, GPR27icl 3 β1AR had a significantly lower capacity to inhibit EGF signaling through SRE, illustrating the significance of ICL3 in the atypical signaling features of GPR27. This assertion was supported by the fact that expression of GPR27icl 3 β1AR strongly reduced the inhibition on isoproterenol-induced cAMP accumulation compared to GPR27 partially answering our starting question derived from the observation of the strong effects of GPR27 on cAMP levels (Fig. 1a). However, GPR27icl 3 β1AR did not regain G protein engagement capacity in response to isoproterenol and could still inhibit EGF signaling through SRE although with a significantly reduced efficacy. Interestingly, GPR27icl 3 β1∆Ct functioned similarly to GPR27icl 3 β1AR, pointing to a less critical role of the C terminus in the chimera’s functionality. In an attempt to identify the intracellular signaling pathways involved in the effects of GPR27 on EGF signaling, we examined the effect of GPR27 stimulation with isoproterenol on the phosphorylation status of ERK1/2 proteins. Thereby, we could clearly demonstrate that ERK1/2 proteins are not involved in the inhibition of SRE-Luc activity through GPR27. On the other hand, the involvement of c-Src in the transinhibition of EGFR by GPR27 was further supported by the effect of the c-Src family of tyrosine kinase inhibitor PP2, which completely abolished the concentration dependent inhibition of SRE-Luc activity induced by isoproterenol in cells expressing GPR27. Intriguingly, PP2 had a rather positive effect on β1AR-induced activation of SRE-Luc activity in response to isoproterenol stimulation, a fact that deserves future attention. Based on the results presented in this study, we propose that GPR27 and GPR173 sense extracellular adrenergic ligands, through an unknown mechanism, but likely independent of G proteins and β-arrestins. Notably, several intriguing pieces of evidence raise important questions that need to be further addressed. For example, the β1ARCt27 chimera, while mimicking GPR27 in terms of SRE inhibition and the lack of G protein engagement, increased the phosphorylation levels of ERK1/2 proteins in response to isoproterenol exposure in contrast to GPR27. Importantly, we could neither see a direct interaction between GPR27 and EGFR nor a ligand-induced one, supporting the idea that the trans-inhibition of EGFR by GPR27 occurs through the engagement of cellular effectors such as members of the c-Src family of tyrosine kinases. It would be important to clarify whether there is an interaction between GPR27 and the endogenously expressed β1AR that could lead to the formation of a heteromer with a completely different function than a classical Class A GPCR, also an exciting hypothesis since no example of such a heteromer has been reported so far. However, this hypothesis might have its weaknesses based on our data demonstrating the absence of β1- or β2-adrenergic receptors in HEK293T as they do not respond to dobutamine, at concentrations up to 30 µM (Suppl. Fig. S8. Moreover, the direct effect of adrenergic ligands on GPR27 and GPR173 was further supported by the observation that these receptors are internalized in response to isoproterenol (GPR27) and noradrenaline (GPR27 and GPR173). Although GPR27 belongs to the SREB family of receptors, together with GPR85 and GPR173, it distinguishes itself by sharing a similar β1AR-like ligand selectivity but with opposed functionality, features not shared with GPR85. Interestingly, GPR173 did not inhibit SRE-Luc activity in response to isoproterenol, but it did so when stimulated with noradrenaline, with a similar potency as GPR27. A previously published study proposed that phoenixin might be a ligand of GPR173, inducing cellular effects through G s proteins. However, in our system, we could not see any activation of cellular pathways downstream of G s proteins mediated by GPR173 in response to phoenixin (Suppl. Fig. S9). Ligand-dependent transinhibition of RTKs by GPCRs has not been described so far, and the cellular mechanism underlying this phenomenon might be complex, involving cellular effectors that still need to be characterized in further studies. However, published studies on the potential role of GPR27 reveal antitumor effects (10) that could be explained by our results on the trans-inhibition of RTKs by GPR27 described in this paper. In conclusion, we provide evidence for a new cellular phenomenon, trans-inhibition of EGFR by the orphan receptors GPR27 and GPR173 in response to adrenergic ligands. Declarations Acknowledgments We would like to thank Dr. Stefan Offermanns for critical reading of the manuscript and for his expert opinion that led to a clearer manuscript. Funding: This work was funded by an EEA-Romania-Norway research grant (2018-0535) entitled “New Generation of Drug Targets for Schizophrenia”, (NEXTDRUG). Competing Interests: The authors have no relevant financial or non-financial interests to disclose. References Liu S, Anderson PJ, Rajagopal S, Lefkowitz RJ, Rockman HA. G Protein-Coupled Receptors: A Century of Research and Discovery. Circulation research. 2024 Jun 21;135(1):174-97. PubMed PMID: 38900852. Pubmed Central PMCID: 11192237. Matsumoto M, Saito T, Takasaki J, Kamohara M, Sugimoto T, Kobayashi M, et al. An evolutionarily conserved G-protein coupled receptor family, SREB, expressed in the central nervous system. Biochemical and biophysical research communications. 2000 Jun 7;272(2):576-82. PubMed PMID: 10833454. Staubert C, Wozniak M, Dupuis N, Laschet C, Pillaiyar T, Hanson J. Superconserved receptors expressed in the brain: Expression, function, motifs and evolution of an orphan receptor family. Pharmacology & therapeutics. 2022 Dec;240:108217. PubMed PMID: 35644261. Alexander SPH, Christopoulos A, Davenport AP, Kelly E, Mathie AA, Peters JA, et al. The Concise Guide to PHARMACOLOGY 2023/24: G protein-coupled receptors. British journal of pharmacology. 2023 Oct;180 Suppl 2:S23-S144. PubMed PMID: 38123151. Nath AK, Ma J, Chen ZZ, Li Z, Vitery MDC, Kelley ML, et al. Genetic deletion of gpr27 alters acylcarnitine metabolism, insulin sensitivity, and glucose homeostasis in zebrafish. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 2020 Jan;34(1):1546-57. PubMed PMID: 31914600. Pubmed Central PMCID: 6956728. Chopra DG, Yiv N, Hennings TG, Zhang Y, Ku GM. Deletion of Gpr27 in vivo reduces insulin mRNA but does not result in diabetes. Scientific reports. 2020 Mar 27;10(1):5629. PubMed PMID: 32221326. Pubmed Central PMCID: 7101378. Ku GM, Pappalardo Z, Luo CC, German MS, McManus MT. An siRNA screen in pancreatic beta cells reveals a role for Gpr27 in insulin production. PLoS genetics. 2012 Jan;8(1):e1002449. PubMed PMID: 22253604. Pubmed Central PMCID: 3257298. Martin AL, Steurer MA, Aronstam RS. Constitutive Activity among Orphan Class-A G Protein Coupled Receptors. PloS one. 2015;10(9):e0138463. PubMed PMID: 26384023. Pubmed Central PMCID: 4575141. Dupuis N, Laschet C, Franssen D, Szpakowska M, Gilissen J, Geubelle P, et al. Activation of the Orphan G Protein-Coupled Receptor GPR27 by Surrogate Ligands Promotes beta-Arrestin 2 Recruitment. Molecular pharmacology. 2017 Jun;91(6):595-608. PubMed PMID: 28314853. Cai C, Hu L, Wu K, Liu Y. GPR27 expression correlates with prognosis and tumor progression in gliomas. PeerJ. 2024;12:e17024. PubMed PMID: 38638156. Pubmed Central PMCID: 11025540. Treen AK, Luo V, Belsham DD. Phoenixin Activates Immortalized GnRH and Kisspeptin Neurons Through the Novel Receptor GPR173. Molecular endocrinology. 2016 Aug;30(8):872-88. PubMed PMID: 27268078. Pubmed Central PMCID: 5414621. Daub H, Weiss FU, Wallasch C, Ullrich A. Role of transactivation of the EGF receptor in signalling by G-protein-coupled receptors. Nature. 1996 Feb 8;379(6565):557-60. PubMed PMID: 8596637. Crudden C, Shibano T, Song D, Suleymanova N, Girnita A, Girnita L. Blurring Boundaries: Receptor Tyrosine Kinases as functional G Protein-Coupled Receptors. International review of cell and molecular biology. 2018;339:1-40. PubMed PMID: 29776602. New DC, Wong YH. Molecular mechanisms mediating the G protein-coupled receptor regulation of cell cycle progression. Journal of molecular signaling. 2007 Feb 26;2:2. PubMed PMID: 17319972. Pubmed Central PMCID: 1808056. Cattaneo F, Guerra G, Parisi M, De Marinis M, Tafuri D, Cinelli M, et al. Cell-surface receptors transactivation mediated by g protein-coupled receptors. International journal of molecular sciences. 2014 Oct 29;15(11):19700-28. PubMed PMID: 25356505. Pubmed Central PMCID: 4264134. Kilpatrick LE, Hill SJ. Transactivation of G protein-coupled receptors (GPCRs) and receptor tyrosine kinases (RTKs): Recent insights using luminescence and fluorescence technologies. Current opinion in endocrine and metabolic research. 2021 Feb;16:102-12. PubMed PMID: 33748531. Pubmed Central PMCID: 7960640. Rigo A, Gottardi M, Damiani E, Bonifacio M, Ferrarini I, Mauri P, et al. CXCL12 and [N33A]CXCL12 in 5637 and HeLa cells: regulating HER1 phosphorylation via calmodulin/calcineurin. PloS one. 2012;7(4):e34432. PubMed PMID: 22529914. Pubmed Central PMCID: 3329496. Tunaru S, Kero J, Schaub A, Wufka C, Blaukat A, Pfeffer K, et al. PUMA-G and HM74 are receptors for nicotinic acid and mediate its anti-lipolytic effect. Nature medicine. 2003 Mar;9(3):352-5. PubMed PMID: 12563315. Keen AC, Pedersen MH, Lemel L, Scott DJ, Canals M, Littler DR, et al. OZITX, a pertussis toxin-like protein for occluding inhibitory G protein signalling including Galpha(z). Communications biology. 2022 Mar 23;5(1):256. PubMed PMID: 35322196. Pubmed Central PMCID: 8943041. Qiu X, Chao K, Song S, Wang YQ, Chen YA, Rouse SL, et al. Coupling and Activation of the beta1 Adrenergic Receptor - The Role of the Third Intracellular Loop. Journal of the American Chemical Society. 2024 Oct 3;146(41):28527-37. PubMed PMID: 39359104. Pubmed Central PMCID: 11487556 cofounder of and consultant at OMass Therapeutics. The remaining authors declare no competing interests. Yang Z, Yang F, Zhang D, Liu Z, Lin A, Liu C, et al. Phosphorylation of G Protein-Coupled Receptors: From the Barcode Hypothesis to the Flute Model. Molecular pharmacology. 2017 Sep;92(3):201-10. PubMed PMID: 28246190. Sun N, Kim KM. Mechanistic diversity involved in the desensitization of G protein-coupled receptors. Archives of pharmacal research. 2021 Apr;44(4):342-53. PubMed PMID: 33761113. Zhang M, Chen T, Lu X, Lan X, Chen Z, Lu S. G protein-coupled receptors (GPCRs): advances in structures, mechanisms, and drug discovery. Signal transduction and targeted therapy. 2024 Apr 10;9(1):88. PubMed PMID: 38594257. Pubmed Central PMCID: 11004190. Jean-Charles PY, Kaur S, Shenoy SK. G Protein-Coupled Receptor Signaling Through beta-Arrestin-Dependent Mechanisms. Journal of cardiovascular pharmacology. 2017 Sep;70(3):142-58. PubMed PMID: 28328745. Pubmed Central PMCID: 5591062. Chang SH, Poser S, Xia Z. A novel role for serum response factor in neuronal survival. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2004 Mar 3;24(9):2277-85. PubMed PMID: 14999078. Pubmed Central PMCID: 6730428. Mebratu Y, Tesfaigzi Y. How ERK1/2 activation controls cell proliferation and cell death: Is subcellular localization the answer? Cell cycle. 2009 Apr 15;8(8):1168-75. PubMed PMID: 19282669. Pubmed Central PMCID: 2728430. Biscardi JS, Maa MC, Tice DA, Cox ME, Leu TH, Parsons SJ. c-Src-mediated phosphorylation of the epidermal growth factor receptor on Tyr845 and Tyr1101 is associated with modulation of receptor function. The Journal of biological chemistry. 1999 Mar 19;274(12):8335-43. PubMed PMID: 10075741. Wang Z. Transactivation of Epidermal Growth Factor Receptor by G Protein-Coupled Receptors: Recent Progress, Challenges and Future Research. International journal of molecular sciences. 2016 Jan 12;17(1). PubMed PMID: 26771606. Pubmed Central PMCID: 4730337. Table Table 1 Effect of the shown ligands at 10 µM on intracellular cAMP levels in HEK293T cells expressing GPR27-Ctβ1 chimera and β1AR together with pGlo-22F cAMP sensor. Numbers represent the average of RLU recorded after compound stimulation of GPR27Ctβ1 expressing cells divided by the average of RLU determined after compound stimulation of mock transfected cells. Ligand Class Drug name Fold change (Av. RLU receptor/Av. RLU mock) (Mean ± SD) MoA[1]/Target[2] GPR27Ctβ1 β1AR Adrenergic agonists Isoproterenol 4.7 ± 1.1 4.5 ± 0.8 β1, β2, β3 Dobutamine 5.5 ± 0.3 4.6 ± 0.3 β1 Ritodrine 7.5 ± 0.1 6.2 ± 0.1 β2 Orciprenaline 2.6 ± 0.1 1.9 ± 0.2 Olodaterol 4.0 ± 0.3 3.1 ± 0.4 Indacaterol 4.6 ± 0.5 3.4 ± 0.3 Formoterol 2.5 ± 0.4 1.8 ± 0.1 Vilanterol 2.6 ± 0.0 2.1 ± 0.2 Salbutamol 3.9 ± 0.2 3.0 ± 0.2 Terbutaline 3.6 ± 0.1 2.6 ± 0.1 Isoetharine 2.5 ± 0.1 1.9 ± 0.1 Mirabegron 21.9 ± 1.9 17.3 ± 1.0 β3 Naphazoline 2.6 ± 0.1 1.1 ± 0.5 α1, α2 Metaraminol 11.0 ± 0.8 8.1 ± 0.6 α1 Phenylephrine 6.4 ± 1.0 5.8 ± 0.8 α1 Methyldopa 2.8 ± 0.1 1.6 ± 0.2 α2 Guanfacine 18.8 ± 1.5 14.4 ± 0.5 α2 Brimonidine 3.2 ± 0.2 1.9 ± 0.1 α2 Droxidopa 9.8 ± 0.6 8.5 ± 0.8 NA prodrug Dipivefrine 10.1 ± 0.8 6.8 ± 0.2 NA prodrug Adrenergic antagonists[3] ,[4] Propranolol 16.2 ± 13.5 13.5 ± 1.6 β1, β2, β3 Nadolol 6.6 ± 0.4 5.4 ± 0.2 β1, β2, β3 Timolol 10.5 ± 0.5 7.8 ± 0.0 β1, β2 Carvedilol 12.2 ± 0.8 10.7 ± 0.5 β1, β2 Labetalol 14.6 ± 1.2 13.0 ± 0.6 β1, β2, α1D Carteolol 16.1 ± 1.0 15.0 ± 1.0 β1, β2 Esmolol 8.9 ± 0.5 6.4 ± 0.2 β1 Acebutolol 12.6 ± 0.5 10.7 ± 0.2 β1 Cholinergic agonists Pilocarpine 2.7 ± 0.2 1.6 ± 0.0 MRs Dopaminergic agonists Dopamine 21.4 ± 2.0 23.4 ± 0.9 DRs Fenoldopam 6.5 ± 0.4 3.8 ± 0.1 D1, D4 Rotigotine 19.9 ± 0.9 10.6 ± 0.8 DRs Quinpirole 2.3 ± 0.3 1.6 ± 0.2 DRs and 5HT1A, 5HT2A,B,C Levodopa 5.0 ± 0.4 2.6 ± 0.1 DA precursor Dopaminergic antagonists Pimozide 21.6 ± 2.7 16 ± 2 DRs, 5HTRs Bendazol 3.5 ± 0.3 1.9 ± 0.1 DRs Serotoninergic Flibanserin 4.1 ± 0.2 2.2 ± 0.3 5-HT1A agonist and 5-HT2A antagonist Related to aminergic system Dihydroergotoxine 4.1 ± 0.2 2.2 ± 0.1 DRs, ADRs, 5HTRs[5] Milnacipran 21.8 ± 0.3 17.9 ± 0.4 ISRN Tranylcipromine 2.7 ± 0.4 1.4 ± 0.1 MAOI Others Amantadine 11.7 ± 0.4 8.9 ± 1.1 NMDA [1] MoA = mechanism of action [2] Verified using Iuphar/DrugBank/TargetMol [3] Some of them reported in literatured as partial agonists. !We tested them at 10 µM in transfected cells! [4] The library also contained metoprolol, betaxolol, nebivolol, levobetaxolol, atenolol, bisoprolol and no effect was recorded in their presence. Additional Declarations There is NO Competing Interest. Supplementary Files SupplementaryFigures.docx Suppl. Fig. S1 Whole-cell ELISA on HEK293T cells expressing the indicated receptors in non-permeabilized conditions (non-perm) to show plasma membrane localization or in permeabilized conditions (perm.) to determine the overall expression of the indicated receptors, using an anti-HA-HRP-conjugated antibody. Shown are mean values ± s.e.m., n = 3. Suppl. Fig. S2 (a-b) Determination of intracellular cAMP levels in HEK293T cells expressing the indicated receptors together with the cAMP-sensitive probe after stimulation with 1 nM isoproterenol in the absence (a) or presence of 10 µM isoproterenol (b). Shown are mean values ± s.e.m., n = 4. Suppl. Fig. S3 (a) Whole-cell ELISA on HEK293T cells expressing the indicated receptors to determine plasma membrane localization (non-perm.) and overall cellular expression (perm.). (b-c) Determination of intracellular levels of cAMP in HEK293T cells expressing the indicated receptors together with the cytosolic localized cAMP-sensitive probe after stimulation with 1 nM isoproterenol, in the presence (b) or absence (c) of forskolin (10 µM). Shown are mean values ± s.e.m., n = 3. Suppl. Fig. S4 Effect of increasing concentrations of isoproterenol on intracellular levels of cAMP in HEK293T cells expressing the indicated receptors together with the cytosolic localized cAMP-sensitive probe. Shown are mean values ± s.e.m., n = 4. Suppl. Fig. S5 Whole-cell ELISA on HEK293T cells expressing the indicated receptors to evaluate plasma membrane localization (non-perm) and total cellular expression (perm.) using anti-HA-HRP conjugated antibody. Shown are mean values ± s.e.m., n = 3. Suppl. Fig. S6 Total cellular GTPase activity assays in HEK293T cells expressing the indicated receptors were performed as described in Materials and Methods. For easier visualization, the raw results were divided by one hundred. Shown are mean values ± s.e.m., n = 3. **** P < 0.0001 (Student’s two-tailed t -test). Suppl. Fig. S7 Immunoprecipitation followed by Western Blotting of cellular lysates (input: 300 µg total protein) from cells expressing N-terminally FLAG-tagged GPR27 and C-terminally HA-tagged EGFR. Where indicated, cells were exposed for 10 min to 1 µM isoproterenol. IP-FLAG, immunoprecipitation of total cellular lysates using anti-FLAG antibody; IP-HA, immunoprecipitation of total cellular lysates using anti-HA antibody. The assay was performed as presented in the Materials and Methods. Suppl. Fig. S8 Effect of increasing concentrations of dobutamine on intracellular levels of cAMP in HEK293T cells expressing the indicated receptors together with the cytosolic localized cAMP-sensitive probe. Shown are mean values ± s.e.m., n = 4. Suppl. Fig. S9 Effect of pheonixin and forskolin on HEK293T expressing empty vector (mock) and GPR173 toghether with a probe consisting of the firefly luciferase gene under the control of six cAMP response elements (CREs), CRE-Luc. Shown are mean values ± s.e.m,., n = 6. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7641991","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Biological Sciences - Article","associatedPublications":[],"authors":[{"id":516640443,"identity":"5a04984e-2c86-4d16-b237-77597ac04adc","order_by":0,"name":"Sorin Tunaru","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwElEQVRIiWNgGAWjYLCCBBDB3sDATJRqHrgWngOkaAEDiQQitdjzHz724eEOhnx+yTeGnwsqbBj427sT8NsikZY8I/EMg+XM2TnG0jPOpDFInDm7gYAWHmOGxDYGA4PbOQbSvG2HGQwkcglo4T8D1XLzjPFv4rQw5EC13OAxI9KWG2nJYC2SPWll1jxn0ngI+oW9//Bhxp9ALfzshzff5qmwkeNv78WvBQr+AzGHAcSlJAD2B6SoHgWjYBSMghEEAHq0PF58HtuNAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-6005-1737","institution":"Institute of Biochemistry, Romanian Academy","correspondingAuthor":true,"prefix":"","firstName":"Sorin","middleName":"","lastName":"Tunaru","suffix":""},{"id":516640444,"identity":"9d07c282-314e-40b3-83ec-1af2fa34cf3f","order_by":1,"name":"Sorina Anghel","email":"","orcid":"","institution":"Institute of Biochemistry, Romanian Academy","correspondingAuthor":false,"prefix":"","firstName":"Sorina","middleName":"","lastName":"Anghel","suffix":""},{"id":516640445,"identity":"eff66622-67a3-4c06-8a29-49d16b2d0f38","order_by":2,"name":"Rodica Badea","email":"","orcid":"","institution":"Institute of Biochemistry, Romanian Academy","correspondingAuthor":false,"prefix":"","firstName":"Rodica","middleName":"","lastName":"Badea","suffix":""},{"id":516640446,"identity":"767a6fd6-89e8-47f7-bd1d-649f300fbf3e","order_by":3,"name":"Cosmin Trif","email":"","orcid":"","institution":"Institute of Biochemistry, Romanian Academy","correspondingAuthor":false,"prefix":"","firstName":"Cosmin","middleName":"","lastName":"Trif","suffix":""},{"id":516640447,"identity":"0631f1ce-a48e-427a-8790-748f98e636e0","order_by":4,"name":"Teodora Stratulat","email":"","orcid":"","institution":"Institute of Biochemistry, Romanian Academy","correspondingAuthor":false,"prefix":"","firstName":"Teodora","middleName":"","lastName":"Stratulat","suffix":""},{"id":516640448,"identity":"94b3534f-d813-4b69-942f-7221bc883fcd","order_by":5,"name":"Cristiana Trita","email":"","orcid":"","institution":"Institute of Biochemistry, Romanian Academy","correspondingAuthor":false,"prefix":"","firstName":"Cristiana","middleName":"","lastName":"Trita","suffix":""},{"id":516640449,"identity":"dcdb0751-34aa-4c57-a061-815ea209adf7","order_by":6,"name":"Diana Navligu","email":"","orcid":"","institution":"Institute of Biochemistry, Romanian Academy","correspondingAuthor":false,"prefix":"","firstName":"Diana","middleName":"","lastName":"Navligu","suffix":""},{"id":516640450,"identity":"8276333d-6175-406c-95c9-299cb2fcd0a4","order_by":7,"name":"Stefana Petrescu","email":"","orcid":"","institution":"Institute of Biochemistry, Romanian Academy","correspondingAuthor":false,"prefix":"","firstName":"Stefana","middleName":"","lastName":"Petrescu","suffix":""},{"id":516640451,"identity":"12482fc6-d841-4dad-9699-b1937f39faee","order_by":8,"name":"Alexandru Babes","email":"","orcid":"","institution":"Faculty of Biology, University of Bucharest","correspondingAuthor":false,"prefix":"","firstName":"Alexandru","middleName":"","lastName":"Babes","suffix":""},{"id":516640452,"identity":"f2089103-9f4d-47c7-b845-c0d71bff9c36","order_by":9,"name":"Costin Popescu","email":"","orcid":"","institution":"Institute of Biochemistry, Romanian Academy","correspondingAuthor":false,"prefix":"","firstName":"Costin","middleName":"","lastName":"Popescu","suffix":""},{"id":516640453,"identity":"8de9a58e-e9f9-40b4-b1e0-e9e2a8f44cf8","order_by":10,"name":"Aura Ionescu","email":"","orcid":"","institution":"Institue of Biochemistry, Romanian Academy","correspondingAuthor":false,"prefix":"","firstName":"Aura","middleName":"","lastName":"Ionescu","suffix":""},{"id":516640454,"identity":"8209dce0-2c68-4b27-9eb8-8cfeda77474c","order_by":11,"name":"Cristin Coman","email":"","orcid":"","institution":"Cantacuzino\" Medico-Military National Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Cristin","middleName":"","lastName":"Coman","suffix":""},{"id":516640455,"identity":"28754e44-022c-4abf-a90b-bd9fb01715d4","order_by":12,"name":"Aenne-Dorothea Liebing","email":"","orcid":"https://orcid.org/0009-0003-2882-4386","institution":"Leipzig University","correspondingAuthor":false,"prefix":"","firstName":"Aenne-Dorothea","middleName":"","lastName":"Liebing","suffix":""},{"id":516640456,"identity":"2cccf840-e479-41d8-8e54-024597da1e8a","order_by":13,"name":"Claudia Stäubert","email":"","orcid":"https://orcid.org/0000-0003-0721-8507","institution":"Rudolf Schönheimer Institute of Biochemistry, Faculty of Medicine, Leipzig University, Johannisallee 30, 04103, Leipzig, Germany","correspondingAuthor":false,"prefix":"","firstName":"Claudia","middleName":"","lastName":"Stäubert","suffix":""},{"id":516640457,"identity":"61f02951-5b11-42d7-abbd-b7b7eb1b1aee","order_by":14,"name":"Thanigaimalai Pillaiyar","email":"","orcid":"","institution":"Institute of Pharmacy, Pharmaceutical/Medicinal Chemistry and Tübingen Center for Academic Drug Discovery, Eberhard Karls University Tübingen","correspondingAuthor":false,"prefix":"","firstName":"Thanigaimalai","middleName":"","lastName":"Pillaiyar","suffix":""},{"id":516640458,"identity":"2095fbbb-e780-419a-96e2-92a85da3caa1","order_by":15,"name":"Julien Hanson","email":"","orcid":"https://orcid.org/0000-0001-7063-7590","institution":"University of Liège","correspondingAuthor":false,"prefix":"","firstName":"Julien","middleName":"","lastName":"Hanson","suffix":""}],"badges":[],"createdAt":"2025-09-17 15:50:44","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7641991/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7641991/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":92026679,"identity":"ea3cc5e9-a57a-4e27-a9c1-5bcf98e9372a","added_by":"auto","created_at":"2025-09-23 19:07:58","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":460232,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGPR27 inhibits forskolin-induced cAMP increases in a G\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003ei/o/z \u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003eprotein-independent manner.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Comparison between the effect of heterologous expression of GPR27, GPR85, GPR173, and empty vector (mock) on basal (solvent)- and 10 µM forskolin-induced cAMP increases in HEK293T cells. (b) Effect of pertussis toxin (PTX, 100 ng/ml) pretreatment of cells expressing GPR27, HCA\u003csub\u003e2\u003c/sub\u003e, and empty vector on forskolin-induced cAMP increase. Cells expressing the HCA\u003csub\u003e2\u003c/sub\u003e receptor were stimulated with 100 µM nicotinic acid (niacin) in the absence or presence of PTX pretreatment to ensure the toxin’s effectiveness. (c) Effect of OZITX expression in HEK293T cells with empty vector, GPR27, and D2R receptor on forskolin (10 µM)-induced cAMP increases. D2R agonist quinpirole (10 µM) stimulation of cells co-expressing OZITX or empty vector and D2R was employed to demonstrate the toxin’s effectiveness. (d) Plasma membrane and overall cellular expression of N-terminally FLAG-tagged GPR27 in comparison with a typical G\u003csub\u003ei\u003c/sub\u003e protein-coupled receptor, N-terminally FLAG-tagged HCA\u003csub\u003e2,\u003c/sub\u003e in HEK293T cells. Colorimetric reaction was initiated, and absorbance was recorded after exposure of cells to anti-FLAG-HRP-conjugated antibody, followed by preparative steps as described in Materials and Methods. Shown are mean values ± s.e.m., n = 5, **P ≤ 0.01 (compared to forskolin-induced cAMP increases in mock-transfected cells), ****P ≤ 0.0001 (Student’s two-tailed t-test).\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7641991/v1/5a3195d74c61ea179f228be3.jpg"},{"id":92026186,"identity":"ead040f3-c08c-4cb2-bc0a-2b3edb9bfb2f","added_by":"auto","created_at":"2025-09-23 18:59:58","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":747390,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe critical role of β1AR- and GPR27-C-termini in cellular signaling.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Picture illustrating the chimeras between β1AR and GPR27, after the C termini switch, resulting in GPR27 with the C terminus of β1AR (GPR27-Ctβ1) and β1AR with the C terminus of GPR27 (β1AR-Ct27). (b-c) Effect of increasing concentrations of isoproterenol (b) and adrenaline (c) on intracellular cAMP levels in HEK293T cells expressing the indicated receptors together with a cAMP-sensitive bioluminescence probe (as described in Materials and Methods). (d) (inset) Picture depicting the chimeras between GPR27, α1AR and β2AR, resulting in GPR27 with the C termini of α1AR (GPR27-Ctα1) and of β2AR (GPR27-Ctβ2). Effect of isoproterenol (0.1 nM) on cAMP levels in HEK293T expressing the indicated receptors. Shown are mean values ± s.e.m., n = 5.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7641991/v1/c0e9a86ad7ab2da6cdf45fac.jpg"},{"id":92026185,"identity":"d9f5d551-a4ff-4326-a07a-f2d9ae12debd","added_by":"auto","created_at":"2025-09-23 18:59:58","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":749452,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGPR27 mediates isoproterenol-induced inhibition of SRE activity.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Effect of isoproterenol (1 µM) on the cyclic AMP response element (CRE)-luciferase (CRE-Luc) fusion protein activity in cells expressing empty vector (mock), GPR27, and β1AR. (b) Effect of isoproterenol (1 µM) stimulation of HEK293T cells expressing empty vector (mock), GPR27, and β1AR together with the serum-response element (SRE)-luciferase (SRE-Luc) fusion protein reporter. Shown are mean values ± s.e.m., n = 4. (c) Effect of increasing concentrations of isoproterenol on SRE-Luc activity in HEK293T cells expressing empty vector (mock) or GPR27. Data are normalized to the solvent effect on each of the groups. (d) Effect of metoprolol and propranolol (10 µM each) on SRE activity in cells expressing empty vector or GPR27 and stimulated with 1 µM isoproterenol. Shown are mean values ± s.e.m., n = 6, *P ≤ 0.05, **P ≤ 0.001,****P \u0026lt; 0.0001, n.s., not significant (Student’s two-tailed t-test). Raw data were normalized to the solvent effect of each of the samples.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7641991/v1/fd8b653a8d5130a0b4affd50.jpg"},{"id":92026680,"identity":"89c1f98d-9fd9-42c9-a8ef-a40ae6806010","added_by":"auto","created_at":"2025-09-23 19:07:58","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1057550,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGPR27 mediates the inhibition of isoproterenol on EGF-induced activation of SRE-Luc activity.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Effect of 10 \u0026nbsp;µM isoproterenol (GPR27, GPR85, GPR173 and β2AR)) and 10 µM D-phenyllactic acid (HCA\u003csub\u003e3\u003c/sub\u003e) (10 ) and (b) 10 µM noradrenaline\u0026nbsp; (GPR27, GPR85, GPR173 and β2AR)) and 10 µM D-phenyllactic acid (HCA3) \u0026nbsp;on internalization of the indicated C-terminally Nluc-tagged receptors in HEK293T cells co-transfected with mas-mVenus. BRET ratios were defined as acceptor emission/donor emission. (c) Effect of EGFR antagonist erlotinib (10 µM) on the capacity of increasing concentrations of isoproterenol to inhibit EGF-induced activation of SRE-Luc. (d-e) Determination of SRE-Luc activity in cells expressing the indicated receptors and exposed to increasing concentrations of isoproterenol in the presence of 1 nM EGF. (f) Determination of intracellular cAMP levels in cells expressing the indicated receptors together with the intracellular cAMP-sensitive probe pGlo-22F (Promega) and exposed to 30 nM of isoproterenol. Shown are mean values ± s.e.m., n = 6, ****P \u0026lt; 0.0001 (compared with the effect of 30 nM isoproterenol on GPR27 expressing cells, Student’s two-tailed t-test). Raw data were normalized for the effect of the solvent on each of the samples.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7641991/v1/bf9c1b05fdb6abe2004d8e58.jpg"},{"id":92026187,"identity":"f1a30421-8a07-43e8-b235-7c6a9b8fbe15","added_by":"auto","created_at":"2025-09-23 18:59:58","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":501946,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGPR27 mediates the inhibition of isoproterenol on EGF-induced SRE-Luc activation independently of G proteins and β-arrestin 2.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Effects of PTX (100 ng/ml), suramin (300 µM), gallein (100 µM), Y-27632 (10 µM), and YM-254890 (100 nM) on isoproterenol-induced inhibition of SRE-Luc activity in the presence of 1 nM EGF in HEK293T cells expressing GPR27. (b) Determination of SRE-Luc activity in cells expressing the indicated receptors stimulated with 1 µM isoproterenol, exposed to the GRKs inhibitor \u0026nbsp;4-Amino-5-(bromomethyl)-2-methylpyrimidine dihydrobromide (AB06102) in the presence of 1 nM EGF. (c) Protein complementation assay in HEK293T cells expressing β-arrestin 2 fused with the N-terminal part of the firefly luciferase (β-arr-Fluc) together with receptors having their C-terminal domain fused to the C-terminal domain of the firefly luciferase (GPR27-Fluc) or replaced by the C-terminus of vasopressin 2 receptor (V2R) fused to the C-terminus of the firefly luciferase (GPR27-V2R-Fluc). The degree of the reconstitution of the luciferase was determined after stimulation of cells with 1 µM isoproterenol and expressed as relative luminescence units (RLU). (d) Effect of isoproterenol (1 µM) on EGF-induced SRE activation in HEK293T cells expressing the receptors described in (c). Shown are mean values ± s.e.m., n = 6, ****P \u0026lt; 0.0001 (Student’s two-tailed t-test). Raw data were normalized to the solvent effect of each sample.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7641991/v1/0f6fb19f2e39e517d3195fec.jpg"},{"id":92026189,"identity":"6eb7c6ed-611e-4bdc-a04e-9a995a9330cf","added_by":"auto","created_at":"2025-09-23 18:59:58","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":662040,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIsoproterenol inhibition of EGF-induced SRE activation through GPR27 involves c-Src, independently of the MAP kinase pathway component, ERK1/2.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a-b) Phosphorylation of ERK1/2 proteins in response to isoproterenol stimulation of HEK293T cells expressing the indicated receptors, as revealed by immunoblotting using anti-phospho-p44/42 MAPK (Erk1/2) antibody (pERK1/2, upper blot). Loading controls for each sample and expression of the indicated receptors were determined by immunoblotting the same membrane with ERK1/2 and \u0026nbsp;anti-FLAG and anti-HA(a) or anti-HA (b)antibodies.\u003c/p\u003e\n\u003cp\u003e(c-d) Effect of Src family inhibitor, PP2, on isoproterenol-induced inhibition of SRE activity in the presence of EGF (1 nM) in HEK293T cells expressing GPR27 (c) and β1-AR (d). Shown are mean values ± s.e.m., n = 6, ****P \u0026lt; 0.0001 (Student’s two-tailed t-test).\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7641991/v1/7cb365bc50d14cd6dde74229.jpg"},{"id":92188582,"identity":"b5c585f3-0516-416f-84d3-c9d35e9aa568","added_by":"auto","created_at":"2025-09-25 14:44:59","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5065955,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7641991/v1/4587f50b-22d9-4bd8-9d06-4d4ca93661e7.pdf"},{"id":92026183,"identity":"b35b31c3-0242-4407-8713-3d948b2beb97","added_by":"auto","created_at":"2025-09-23 18:59:58","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1363296,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSuppl. Fig. S1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWhole-cell ELISA on HEK293T cells expressing the indicated receptors in non-permeabilized conditions (non-perm) to show plasma membrane localization or in permeabilized conditions (perm.) to determine the overall expression of the indicated receptors, using an anti-HA-HRP-conjugated antibody. Shown are mean values ± s.e.m., n = 3.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSuppl. Fig. S2\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a-b) Determination of intracellular cAMP levels in HEK293T cells expressing the indicated receptors together with the cAMP-sensitive probe after stimulation with 1 nM isoproterenol in the absence (a) or presence of 10 µM isoproterenol (b). Shown are mean values ± s.e.m., n = 4.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSuppl. Fig. S3\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Whole-cell ELISA on HEK293T cells expressing the indicated receptors to determine plasma membrane localization (non-perm.) and overall cellular expression (perm.). (b-c) Determination of intracellular levels of cAMP in HEK293T cells expressing the indicated receptors together with the cytosolic localized cAMP-sensitive probe after stimulation with 1 nM isoproterenol, in the presence (b) or absence (c) of forskolin (10 µM). Shown are mean values ± s.e.m., n = 3.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSuppl. Fig. S4\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEffect of increasing concentrations of isoproterenol on intracellular levels of cAMP in HEK293T cells expressing the indicated receptors together with the cytosolic localized cAMP-sensitive probe. Shown are mean values ± s.e.m., n = 4.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSuppl. Fig. S5\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWhole-cell ELISA on HEK293T cells expressing the indicated receptors to evaluate plasma membrane localization (non-perm) and total cellular expression (perm.) using anti-HA-HRP conjugated antibody. Shown are mean values ± s.e.m., n = 3.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSuppl. Fig. S6\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal cellular GTPase activity assays in HEK293T cells expressing the indicated receptors were performed as described in Materials and Methods. For easier visualization, the raw results were divided by one hundred. Shown are mean values ± s.e.m., n = 3. ****\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001 (Student’s two-tailed \u003cem\u003et\u003c/em\u003e-test).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSuppl. Fig. S7\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eImmunoprecipitation followed by Western Blotting of cellular lysates (input: 300 µg total protein) from cells expressing N-terminally FLAG-tagged GPR27 and C-terminally HA-tagged EGFR. Where indicated, cells were exposed for 10 min to 1 µM isoproterenol. IP-FLAG, immunoprecipitation of total cellular lysates using anti-FLAG antibody; IP-HA, immunoprecipitation of total cellular lysates using anti-HA antibody. The assay was performed as presented in the Materials and Methods.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSuppl. Fig. S8\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEffect of increasing concentrations of dobutamine on intracellular levels of cAMP in HEK293T cells expressing the indicated receptors together with the cytosolic localized cAMP-sensitive probe. Shown are mean values ± s.e.m., n = 4.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSuppl. Fig. S9 \u003c/strong\u003eEffect of pheonixin and forskolin on HEK293T expressing empty vector (mock) and GPR173 toghether with a probe consisting of the firefly luciferase gene under the control of six cAMP response elements (CREs), CRE-Luc. Shown are mean values ± s.e.m,., n = 6.\u003c/p\u003e","description":"","filename":"SupplementaryFigures.docx","url":"https://assets-eu.researchsquare.com/files/rs-7641991/v1/c2cc763e8a29f01e25f63784.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eAdrenergic Ligands-Induced Transinhibition of EGFR by GPR27 and GPR173 Reveals a Novel GPCR Signaling Mechanism\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eG protein-coupled receptors (GPCRs) represent one of the largest and most diverse families of membrane receptors in mammalian cells, playing pivotal roles in transducing extracellular signals into intracellular responses (1). Among the less explored members of this vast superfamily are the Super Conserved Receptors Expressed in Brain (SREB), which include SREB1 (GPR27), SREB2 (GPR85), and SREB3 (GPR173). These receptors, first identified through genomic analysis and named for their conserved sequences across species, are predominantly expressed in the central nervous system (CNS), hinting at their potential roles in neurophysiology and brain function (2, 3). Despite their evolutionary conservation and high expression in the CNS, the endogenous ligands and physiological functions of SREBs have remained elusive, classifying them as orphan GPCRs (4). Recent research, however, has begun to shed light on the potential roles of these receptors. GPR27, for example, has been implicated in modulating insulin secretion, suggesting a link between this receptor and metabolic regulation (5, 6). Moreover, the heterologous expression of GPR27 in HEK293T cells resulted in elevated inositol phosphate levels, pointing to a G\u003csub\u003eq/11\u003c/sub\u003e protein-coupling of this receptor (7). On the other hand, a broader study involving the analysis of the transient expression of a large number of GPCRs on cAMP levels in Chinese hamster ovary (CHO) cells revealed that GPR27, but not GPR85 and GPR173, displays significant constitutive inhibitory activity on cAMP-driven gene expression, suggesting potential G\u003csub\u003ei\u003c/sub\u003e protein-coupling of GPR27 (8). In addition, several synthetic agonists of GPR27 have been recently proposed. These agonists display specificity for GPR27 over GPR85 and GPR173 and, interestingly, in the case of GPR27, induced the recruitment of β-arrestin 2 in a G protein-independent manner (9). Evidence of possible implications in pathological conditions was drawn from the analysis of The Cancer Genome Atlas Database, where lower expression levels of GPR27 were correlated with higher death rates in patients with glioma (10). On the other hand, GPR173 is considered to be the putative receptor for phoenixin mediating the enhanced gonadotropin-releasing hormone (GnRH) signaling in the hypothalamus and pituitary gland, and thus promoting luteinizing hormone (LH) secretion and supporting ovarian cycling (11)\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe functional interaction between GPCRs and receptor tyrosine kinases (RTKs) has been the subject of intense research since the seminal work by Ulrich and colleagues describing tyrosine phosphorylation of the epidermal growth factor receptor (EGFR) in response to known GPCR agonists,a phenomenon termed “transactivation” (12).EGFR is not the only RTK family member subject to transactivation by GPCRs. Other RTKs, such as fibroblast growth factor receptors (FGFRs), platelet-derived growth factor receptors (PDGFRs), or the insulin receptor (IR), have been reported to be targets for GPCR transactivation (13). Thebiological consequences of transactivation are well described. For example, the activation of GPCRs by ligands such as lysophosphatidic acid (LPA), endothelin-1, and thrombin in Rat-1 fibroblasts promotes S phase entry and DNA synthesis through transactivation of the EGFR (14). The molecular mechanisms underlying this phenomenon are still not fully clear. Several lines of evidence demonstrate that the transactivation of RTKs by GPCRs involves metalloproteinases (MMPs) or a disintegrin and metalloproteinases (ADAMs). MMPs and ADAMs cleave pro-ligands of RTKs bound to extracellular matrix components, leading to the release of ligands that can bind to their cognate RTKs, triggering intracellular signaling events (15, 16).In contrast to the transactivation phenomenon, the inhibition of RTK signaling by GPCRs has not yet been widely reported. However, it was recently reported that CXCL12 stimulation of CXCR4-positive HeLa and 5637 cells induced the inhibition of EGFR phosphorylation involving protein kinase C (PKC) (17). Although the transactivation of RTKs by GPCRs has been associated with important biological functions, the putative roles of transinhibition have not yet been described. The present study shows that GPR27 and GPR173 are novel adrenergic receptors that function atypically to transinhibit RTKs such as EGFR without engaging G proteins and arrestins.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cp\u003e\u003cem\u003e3.1 Chemicals\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe majority of chemicals were purchased from Cayman Chemicals, with a few exceptions. Pertussis toxin (PTX) was obtained from Invitrogen (Carlsbad, CA, USA), YM-254890 from Focus Biomolecules (Montgomery County, PA, USA), the GRK inhibitor, 4-Amino-5-(bromomethyl)-2-methyl pyrimidine dihydrobromide (CAS 5423-98-3) and \u0026nbsp;sodium orthovanadate from Santa Cruz Biotechnology (Texas, USA), Tris-base, protease inhibitor cocktail from Thermo Fisher Scientific (Waltham, MA, USA), phenylmethylsulfonyl fluoride (PMSF, A0999), NP-40 from AppliChem (Darmstadt, Germany), sodium fluoride (NaF) from VWR (Seattle, WA, USA), polyethyleneimine (PEI), gallein, PP2 (4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4-d]pyramidine), iodoacetic acid, sodium dodecyl sulfate (SDS), sodium deoxycholate were from Sigma-Aldrich (St. Louis, MO, USA) and EGF was obtained from PeproTech Inc. (Rocky Hill, New Jersey, USA). The FDA-Approved Drug Library containing 1403 compounds was acquired from TargetMol (Boston, MA, USA).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e3.2 Cell culture and transfection\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eHEK293T cells (RRID: CVCL_0063) were grown in DMEM with 4.5 g/L glucose (Pan Biotech) supplemented with 10% foetal bovine serum (FBS) (Gibco) and 1% penicillin and streptomycin mix (Gibco) at 37°C and 5% CO\u003csub\u003e2\u003c/sub\u003e. Plasmid constructs were transfected into HEK-293T cells using polyethylenimine (PEI) or Lipofectamine 2000 (Thermo Scientific).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e3.3 Plasmids\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe human GPR27 (SREB1) and GPR173 (SREB3) plasmids were cloned in a previous study (9). Human GPR85 (SREB2) was amplified by PCR using pcDNA3.1(+)-GPR85 (cDNA Resource Center, The Bloomsburg University Foundation, PA, USA) as template and the following primers:\u003c/p\u003e\n\u003cp\u003eforward - 5’- CCTAGGTACCATGGCGAACTATAGCC - 3’\u003c/p\u003e\n\u003cp\u003ereverse - 5’ – GCTCGGATCCTCATATAACACAGTAAGG - 3’\u003c/p\u003e\n\u003cp\u003eThe amplified fragment was inserted into pcDNA3.1-N-DYK vector between KpnI and BamHI restriction sites. pGloSensorTM-22F cAMP plasmid, pGL4.29[luc2P/CRE/Hygro], pGL4.33[luc2P/SRE/Hygro] were purchased from Promega Corporation (Madison, WI, USA). pOZITX-S1 was a gift from Jonathan Javitch (Addgene plasmid #184925; http://n2t.net/addgene:184925; RRID:Addgene_184925). N-terminally HA-tagged β1AR and the chimeric receptors cDNAs were synthesized and cloned into pcDNA3.1(+)(GenScript Biotech Corporation, Nanjing, China). The truncated form of GPR27 (GPR27ΔCterm) was generated by PCR cloning using pcDNA3.1-N-DYK-GPR27 as a template and the following primers:\u003c/p\u003e\n\u003cp\u003eforward - 5’-AATGGATCCACCATGAAGACGATCATC-3’,\u003c/p\u003e\n\u003cp\u003ereverse - 5’-TAGTCTAGATTAGCTCTGGCAGCAGGGGAAC - 3’.\u003c/p\u003e\n\u003cp\u003eThe amplicon product was then inserted into pcDNA3.1(+) vector between BamHI and XbaI restriction sites. PWPXLD-EGFR-WT was a gift from Chay Kuo (Addgene plasmid #133749; http://n2t.net/addgene:133749; RRID: Addgene_133749). All plasmids generated were validated by enzymatic digestion and sequencing (CeMIA, Larissa, Greece). All SREBs were sub-cloned in frame with Nanoluciferase (Nluc) into p-Nluc-N1. The membrane anchoring sequence derived from the myristoylation signal of the human Src family kinase (Lyn11) was cloned in frame into p-mVenus-N1, as previously described.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e3.4 Determination of cell surface receptor expression by whole-cell ELISA\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eHEK293T cells were transiently transfected with plasmids encoding receptor cDNAs in a 96-well plate format. The following day, cells were washed with HBSS and fixed with paraformaldehyde 1% for 5 min. The permeabilization of cells was performed using TritonX-100 0.1% treatment for 3 min to assess the total protein expression. Then, cells were washed three times with HBSS, blocked with 5% non-fat dry milk/HBSS for 1h, and probed with horseradish peroxidase-conjugated antibody directed against the FLAG epitope (1:1000, Sigma) for another hour. After the washing step, cells were incubated with TMB substrate (BD Biosciences, SanDiego, USA), and the reaction was stopped by adding 1M H\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e, resulting in a yellow color solution with an absorbance at 450 nm that was measured on a microplate reader (Mithras LB 940, Berthold Technologies).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e3.5 cAMP determination\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eHEK293T cells were seeded in white clear-bottom 96-well plates and transiently co-transfected with a plasmid encoding a cytosolic localized cAMP-sensitive bioluminescent probe, pGlo-22F (Promega), and plasmids containing receptor cDNAs. After 24 h, cells were incubated at room temperature in HBSS containing 1 mM Luciferin EF (NanoLight) for 2 h, in the dark. Following ligand stimulation for 15 min, luminescence was recorded by a microplate reader (Mithras LB 940, Berthold Technologies).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e3.6 GTPase assay\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eHEK293T cells seeded in 55 cm\u003csup\u003e2\u003c/sup\u003e dishes were transiently transfected with the pcDNA3.1 empty plasmid and, respectively, with plasmids encoding GPR27 and β1AR cDNAs. 24 h later, cells were washed with cold PBS and lysed with hypotonic buffer (20 mM HEPES, pH 7.4, 1 mM EDTA supplemented with 1 mM DTT, protease inhibitor cocktail EDTA-free, 1 mM PMSF, 1 mM orthovanadate, 5 mM iodoacetic acid, 5 mM NaF) by passing them 15-20 times through a 26G syringe needle. Then, the lysate was centrifuged for 10 min at 9000xg, 4°C, and the nuclear fraction was discarded. The soluble fraction was further centrifuged for 40 min at 25000xg, 4°C, and the resulting pellet (membrane fraction) was resuspended in GTPase/GAP buffer (from GTPase-GloTM Assay kit), containing or not 2 nM isoprotenerol. GTPase activity was further determined using the GTPase-GloTM assay kit (Promega Corporation, WI, Madison, USA) following the protocol for intrinsic GTPase activity recommended by the manufacturer. After adding Detection Reagent, the reactions were incubated for 5-10 min at 25°C, and the luminescence was recorded on a microplate reader (Mithras LB 940, Berthold Technologies). Total protein of each sample was estimated using a Pierce BCA Protein Assay kit (Thermo Scientific, Rockfort, IL, USA). To determine the specific GTPase activity, the luminescence value obtained was normalized to the total protein for each sample.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e3.7 CRE- and SRE-luciferase reporter gene assay\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eHEK293T cells were seeded in white clear-bottom 96-well plates and transiently transfected with pGL4.29[luc2P/CRE/Hygro] or pGL4.33[luc2P/SRE/Hygro] (Promega) together with plasmid encoding receptor cDNAs. After 24h, cells were incubated for 4 h at 37°C, 5% CO\u003csub\u003e2\u003c/sub\u003e with different compounds in serum-free media and lysed with 0.25% Triton X-100 for 30 min at 4°C. Luciferase activity was measured using Firefly Luciferase Assay Reagent (NanoLight) on a microplate reader (Mithras LB 940, Berthold Technologies). For SRE and SRF-RE experiments, the media was replaced by DMEM containing 2% FBS before transfection, and 1% FBS was used during the assay.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e3.8 Beta-arrestin 2 recruitment assay\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eβ-Arrestin 2 recruitment assay was performed by Firefly Luciferase Complementation Assay as previously described (\u003ca href=\"#_ENREF_9\" title=\"Dupuis, 2017 #9\"\u003e9\u003c/a\u003e). Briefly, cells were transfected with plasmids encoding cDNAs for β-arrestin 2 fused with the N-terminal part of the firefly luciferase (β-arr2-FLuc) and GPR27 or β2AR fused with the C-terminal part of the firefly luciferase (GPR27-FLuc or β2AR-FLuc). Additionally, we employed chimeric receptors consisting of GPR27 or β2AR with the C-terminal domain replaced by the homologous domain of vasopressin 2 receptor (V2R) fused with the C-terminal part of the firefly luciferase (GPR27-V2RFluc or β2AR-V2RFluc). After 24h, the medium was replaced with HBSS, and cells were stimulated with compounds for 10 min at room temperature. Luminescence was recorded on a microplate reader (Mithras LB 940, Berthold Technologies) after luciferin EF (1 mM) addition.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e3.9 Immunoblotting\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eHEK293T cells seeded in 12-well plates were transiently transfected with plasmids containing receptor cDNAs. After 24h, cells were starved for 6h or overnight (16h) in DMEM without FBS and then treated with isoproterenol at the indicated concentrations for 10 min at 37°C. Then, the cells were lysed in ice-cold radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris, 150 mM NaCl,1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, pH 7.5) supplemented with protease inhibitors cocktail \u0026nbsp;and the lysates were clarified by centrifugation for 45 min at 25000xg, 4°C. Equal amounts of total lysates were separated by SDS-PAGE and transferred to a PVDF membrane. Detection was performed with specific antibodies: rabbit monoclonal anti-pERK (1:1000), rabbit monoclonal anti-ERK (1:1000), rabbit monoclonal anti-pY416(c-Src) (1:1000), and anti-HA-HRP (1:1000) all from Cell Signaling Technology (Danvers, MA, USA), mouse monoclonal anti-c-Src (Merck-Millipore, Darmstadt, Germany), mouse monoclonal anti-FLAG-HRP (Sigma-Aldrich, Darmstadt, Germany), rabbit polyclonal anti-calnexin (1:6000) (kindly provided by Dr. Gabriela Chiritoiu, Institute of Biochemsitry, Bucharest, Romania). As secondary antibodies, we used goat anti-mouse-HRP (1:4000) and mouse anti-rabbit-HRP (1:4000).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e3.10 Bioluminescence resonance energy transfer (BRET) assay\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eBRET assays were performed 48 h after transfection. Therefore, cells were washed with HBSS/ HEPES and equilibrated with 32.5 µl HBSS/ HEPES for 60 min at room temperature. 12.5 µl of NanoBRET NanoGlo substrate, diluted 1:250 (final dilution 1:1000), were added, and ten consecutive baseline reads were taken using the EnVision Microplate reader. Luminescence was measured at 460 ± 80 nm (donor) and 535 ± 30 nm (acceptor), and the BRET ratio was calculated as the ratio between acceptor and donor emission. Stimulation was performed by adding 5 µl of 10x ligand solution, and reading was continued for another 30 cycles. The basal BRET ratio before ligand stimulation was defined as the average of the last four consecutive BRET values before ligand addition. To quantify ligand-induced changes, ΔBRET was calculated for each well as % over basal [(Ratiostim - Ratiobasal)/Ratiobasal] x 100. Subsequently, the average ΔBRET of vehicle control was subtracted. The net area under the curve (AUC) was calculated using Graphpad Prism 10.4.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e3.11 Statistics\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe presented data are expressed as mean ± s.e.m. Statistical., and statistical analysis was performed by using GraphPad Prism 8 software. Unpaired Student’s t-tests were used to compare two groups.\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e\u003cem\u003e4.1 Heterologously expressed human GPR27 reduces intracellular cAMP levels in a G\u003csub\u003ei/o/z\u003c/sub\u003e protein-independent manner. \u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTo explore the cellular functions of SREBs, we examined whether the heterologous expression of human GPR27, GPR85, and GPR173 in HEK293T cells impacts various intracellular signaling pathways, including those modulating cAMP levels. As illustrated in Figure 1a,, expression of GPR27 and GPR173 significantly reduced forskolin-induced cAMP accumulation, with the most pronounced effect observed for GPR27, whereas GPR85 showed no impact on intracellular cAMP levels. Based on the observation that GPR27 severely affected basal- as well as forskolin-induced increase in cAMP, we next examined the possibility that GPR27 is a constitutively active receptor interacting with G\u003csub\u003ei\u003c/sub\u003e proteins as previously reported (8). To explore this hypothesis, we determined the effect of stimulation with 10 µM forskolin on cAMP levels in HEK293T cells expressing GPR27 in the absence and the presence of the G\u003csub\u003ei/o\u003c/sub\u003e protein inhibitor pertussis toxin (PTX). As presented in Figure 1b, pretreatment of cells with PTX did not result in the reversal of the inhibitory effect of GPR27 on cAMP levels following forskolin stimulation. However, the well-known inhibitory effects of nicotinic acid (niacin) on cAMP mediated by hydroxycarboxylic acid receptor 2 (HCA\u003csub\u003e2\u003c/sub\u003e) (18) were fully reversed by PTX pretreatment, confirming the toxin's effectiveness. To further address the potential involvement of other types of G proteins, such as G\u003csub\u003ez\u003c/sub\u003e, we examined the effect of a recently described toxin, OZITX (Gα\u003cu\u003e\u003csub\u003eo\u003c/sub\u003e\u003c/u\u003e, Gα\u003cu\u003e\u003csub\u003ez\u003c/sub\u003e,\u003c/u\u003e and Gα\u003cu\u003e\u003csub\u003ei\u003c/sub\u003e\u003c/u\u003e-inhibiting \u003cu\u003et\u003c/u\u003eo\u003cu\u003ex\u003c/u\u003ein) (19), on the ability of GPR27 to decrease cAMP levels in cells stimulated with forskolin. As shown in Figure 1c, the expression of OZITX did not reverse the inhibitory effects of GPR27 on cAMP levels increased by forskolin. However, the quinpirole inhibition of forskolin-induced increase in cAMP levels through the dopamine D2 receptor was fully reversed by the presence of OZITX. Interestingly, the expression of OZITX induced a decrease in basal levels of cAMP in mock and D2R expressing cells. Although GPR27 showed significant cellular effects in the absence of ligand stimulation, which were not mediated by G\u003csub\u003ei/o/z\u003c/sub\u003e proteins, it localized at the plasma membrane as demonstrated by the detection of an anti-FLAG-HRP-conjugated antibody in non-permeabilized and permeabilized conditions of HEK293T cells expressing human N-terminally FLAG-tagged GPR27 (Figure 1d). These results demonstrate that GPR27 is not a G\u003csub\u003ei/o/z\u003c/sub\u003e protein-coupled constitutively active receptor as it strongly inhibits the accumulation of intracellular cAMP independently of these types of G proteins.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e4.2 Critical role of the C-terminal domain of GPR27 and β1AR in signaling\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eGiven that heterologous expression of GPR27 induces cellular effects independently of ligand stimulation and without engaging G proteins, we investigated whether the intracellular C-terminal domain of GPR27 might be responsible for these effects. To explore this idea, we employed several strategies, including the construction of chimeric GPR27 receptors containing the C-terminal domains of receptors with known ligands. Functional studies were then conducted to evaluate the impact of these modifications on chimera signaling. Additionally, we created chimeras where the C-terminus of known GPCRs was replaced with that of GPR27 and assessed their functional properties (Fig. 2a, d, inside panel).Surprisingly, the chimera of GPR27 containing the β1-adrenergic receptor (β1AR) C-terminus (GPR27-Ctβ1) responded to increasing concentrations of isoproterenol in the cAMP accumulation assay, mimicking β1AR, while wild-type GPR27 remained unresponsive to isoproterenol concentrations up to 30 nM. Conversely, the chimera of β1AR containing the GPR27 C-terminus (β1AR-Ct27) was unresponsive to isoproterenol, similar to GPR27 (Fig. 2b). These functional differences were not due to altered expression levels, as both GPR27-Ctβ1 and β1AR-Ct27 showed comparable plasma membrane localization in HEK293T cells (Suppl. Fig. S1). Similar results were observed in the cAMP accumulation assay when both chimeras were exposed to increasing concentrations of the endogenous β1AR ligand, adrenaline (Fig. 2c). These findings prompted us to assess the impact of FDA-approved compounds on GPR27-Ctβ1 and β1AR. As shown in Table 1, adrenergic and dopaminergic ligands induced similar activation profiles on GPR27-Ctβ1 and β1AR. The observation that the β1AR C terminus confers GPR27 responsiveness to adrenergic ligands led us to investigate whether C termini from other adrenergic receptors, such as β2AR or α1AR, would impart similar functional properties to GPR27. As shown in Figure 2d, replacing the GPR27 C terminus with the corresponding domains of β2AR (GPR27-Ctβ2) or α1AR (GPR27-Ctα1) did not result in chimeras capable of mediating cAMP increases following stimulation with maximal concentrations of isoproterenol. These results indicate that the unique and intriguing combination of GPR27’s seven-transmembrane domain and the β1AR C terminus is necessary to create a chimeric receptor that mirrors β1AR’s ligand recognition and G\u003csub\u003es\u003c/sub\u003e protein-mediated signaling. Given the responsiveness of the GPR27-Ctβ1 chimera to adrenergic ligands, we further examined whether wild-type GPR27 mediates isoproterenol effects by stimulating G\u003csub\u003es\u003c/sub\u003e protein-induced intracellular cAMP increases or by inhibiting forskolin-induced cAMP elevation. Stimulation of HEK293T cells expressing GPR27 with a maximal concentration (1 nM) of isoproterenol did not lead to cAMP accumulation, unlike the robust cAMP increase observed in β1AR-expressing cells (Suppl. Fig. S2a). Additionally, isoproterenol stimulation of GPR27-expressing cells failed to inhibit forskolin-induced cAMP elevation (Suppl. Fig. S2b). These findings demonstrate that GPR27 does not engage G\u003csub\u003es\u003c/sub\u003e or G\u003csub\u003ei\u003c/sub\u003e proteins to alter intracellular cAMP levels in response to isoproterenol stimulation.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e4.3 GPR27 mediates the inhibitory effects of isoproterenol on transcription factor activity\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eBased on the observation that the GPR27-Ctβ1 chimera can respond to isoproterenol similarly to β1AR, we hypothesized that GPR27 is able to bind adrenergic ligands such as isoproterenol. Unfortunately, no labeled adrenergic ligands are available on the market to directly demonstrate the binding of adrenergic ligands to GPR27. However, to indirectly test such an idea, we investigated whether GPR27 could affect cellular signaling pathway functions through a more integrative approach, by analyzing the activity of transcription factors in response to isoproterenol. Consistent with the lack of impact on G\u003csub\u003es\u003c/sub\u003e protein-mediated signaling, stimulation of HEK293T cells expressing GPR27 with isoproterenol did not affect the activity of the cyclic AMP response element-luciferase (CRE-Luc) fusion protein (Fig. 3a). However, when cells were coexpressed with the serum-response element-luciferase (SRE-Luc) fusion protein reporter, isoproterenol stimulation resulted in a GPR27-dependent decrease in SRE-Luc activity. In contrast, β1AR-expressing cells showed the opposite response, with isoproterenol increasing SRE-Luc activity (Fig. 3b), while there was no effect of isoproterenol on SRE-Luc activity in GPR85- and GPR173-expressing cells. However, in the case of GPR173-expressing cells, there was a tendency for isoproterenol to inhibit SRE-Luc activity, although without reaching statistical significance. Since SRE activity is known to be modulated by RTKs, we hypothesized that GPR27 might alter SRE activity in response to adrenergic ligands, such as isoproterenol and noradrenaline. As shown in Figure 3c, isoproterenol stimulation of cells expressing GPR27 inhibited the EGF-stimulated increase in SRE-Luc activity in a GPR27 and concentration manner as cells expressing an empty vector (mock) showed the opposite effect when challenged with isoproterenol, namely an increase rather than a decrease in SRE-Luc activity.\u003c/p\u003e\n\u003cp\u003eThe inhibitory effect of isoproterenol on SRE-Luc activity via GPR27 was completely reversed by the β1AR antagonist metoprolol and the β1/β2AR antagonist propranolol (Fig. 3d), supporting the idea that GPR27 is a β1AR-like receptor but with opposite cellular functions.\u003c/p\u003e\n\u003cp\u003eSimilar to the isoproterenol-induced inhibition of the EGF-induced increase in SRE-Luc activity, the endogenous ligand, noradrenaline, is able to inhibit SRE-Luc activity with a similar potency as isoproterenol. To our surprise, noradrenaline stimulation of cells expressing GPR173 led to a similar effect on SRE-Luc activity as GPR27-expressing cells (Fig. 3e). These unexpected results prompted us to verify whether β1/β2AR antagonists have a similar effect on noradrenaline-induced inhibition of SRE-Luc activity as in GPR27-expressing cells. As presented in Figure 3f pretreatment, pretreatment of cells expressing GPR173 with a maximal concentration of metoprolol and propanolol reversed the inhibitory effects of noradrenaline on SRE-Luc activity. These observations demonstrate that GPR27 and GPR173 specifically inhibit SRE-Luc activity in response to noradrenaline (GPR27 and GPR173) and isoproterenol (GPR27 only), a distinct feature not observed in GPR85, emphasizing the unique cellular effects mediated by GPR27 and GPR173 within the SREB family.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e4.4 \u003c/em\u003e\u003cem\u003eGPR27-mediated inhibition of EGF signaling reveals a role of ICL3 and distinct internalization responses to adrenergic ligands.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTo prove that GPR27 and GPR173 directly mediate cellular effects of adrenergic ligands, such as isoproterenol and noradrenaline, we conducted internalization experiments in HEK293T cells expressing C-terminally Nluc-tagged SREB receptors and mVenus-tagged membrane anchoring sequence (mas). As shown in Figure 4a, isoproterenol stimulation of cells expressing GPR27 resulted in time-dependent internalization of GPR27, whereas GPR85 and GPR173 did not undergo such cellular effects. However, to our surprise, GPR173 internalized to the same extent as GPR27 when cells were exposed to a maximal concentration of noradrenaline, as presented in Figure 4b.\u003c/p\u003e\n\u003cp\u003eFurthermore, to demonstrate the involvement of the EGFR in the effects of isoproterenol mediated by GPR27, cells expressing either GPR27 or the empty vector were exposed to 1 nM EGF and increasing concentrations of isoproterenol in the presence or absence of the EGFR antagonist, erlotinib. As illustrated in Figure 4c, isoproterenol strongly reduced the effect of EGF on SRE-Luc activity in a concentration-dependent manner only in cells expressing GPR27. Erlotinib treatment abolished the concentration-dependent inhibition of SRE-Luc activity by isoproterenol. Furthermore, in an attempt to determine the structural determinants of GPR27 involved in the inhibition of EGF signaling by isoproterenol, chimeric receptors between GPR27 and β1AR were expressed in HEK293T cells, and the effect of isoproterenol stimulation on EGF-induced SRE-Luc activity was determined. When stimulated with increasing concentrations of isoproterenol, the the GPR27-Ctβ1 chimera activated SRE-Luc activity with a similar profile as found for β1AR. On the other hand, β1AR-Ct27 responded to isoproterenol in an almost identical manner as GPR27, by concentration-dependent inhibition of EGF-induced SRE-Luc activation (Fig. 4d). These results correlate with those observed in the functional intracellular cAMP assay (Fig. 2b,c), suggesting that the combination of GPR27’s 7TM domain and the C terminus of β1AR is necessary to obtain a chimera that acquires G\u003csub\u003es\u003c/sub\u003e protein-coupling and SRE-Luc-activating characteristics. These result point to a critical role of the C-terminal domain of GPR27 in signaling. To investigate this hypothesis, we generated a truncated version of GPR27 lacking the C terminus (amino acids P359 – L375, GPR27∆Cterm). When heterologously expressed in HEK293T, GPR27∆Cterm localized at the plasma membrane similarly to GPR27 (Suppl. Fig. S3a). However, contrary to our expectations, GPR27∆Cterm showed no coupling to G\u003csub\u003es\u003c/sub\u003e or G\u003csub\u003ei\u003c/sub\u003e proteins in response to isoproterenol when tested in a functional cAMP assay (Suppl. Fig. S3b,c). Consistent with a lack of G\u003csub\u003es\u003c/sub\u003e or G\u003csub\u003ei\u003c/sub\u003e protein-coupling, GPR27∆Cterm and β1AR-Ct27 responded to isoproterenol similarly to GPR27 by inhibiting EGF-induced SRE-Luc activation in a concentration-dependent manner (Fig. 4d). A recent study demonstrated an important role of the intracellular loop 3 (ICL3) for β1AR-coupling to G\u003csub\u003es\u003c/sub\u003e proteins (20). To test the potential role of ICL3 of GPR27 and β1AR in receptor functionality, we generated chimeric receptors of β1AR having the ICL3 from GPR27 (β1ARicl\u003csub\u003e3\u003c/sub\u003e27) and of GPR27 with the ICL3 from β1AR (GPR27icl\u003csub\u003e3\u003c/sub\u003eβ1). Interestingly, β1ARicl\u003csub\u003e3\u003c/sub\u003e27 showed an almost unaffected capacity to respond to isoproterenol in cAMP assays (Suppl. Fig. S4. On the other hand, isoproterenol stimulation of cells expressing GPR27icl3β1 or GPR27icl3β1∆Ct chimeras resulted in a significant reduction of the inhibitory effect of isoproterenol on the EGF-induced increase in SRE-Luc activity (Figure 4e). Interestingly, both chimeras also have a significantly reduced inhibitory effect on the basal intracellular cAMP levels compared to cells expressing GPR27 (Fig. 4f), although they showed plasma membrane localization levels similar to GPR27 (Suppl. Fig. S5. These results clearly indicate that the ICL3 of GPR27 appears to be critical for the observed inhibitory effects on SRE-Luc activity and cAMP levels in G protein-independent signaling whereas the receptor’s C terminus appears not to be important for these effects to occur.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e4.5 Isoproterenol-induced inhibition of EGF signaling through GPR27 does not involve G proteins or arrestins. \u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eBased on the data showing that the ligand-induced inhibition of EGF signaling through GPR27 results in a reduced SRE-Luc activity, we wanted to address the question: What are the cellular components involved in this phenomenon? To test the potential involvement of G proteins, we assessed the result of GPR27 stimulation with isoproterenol on overall cellular GTPase activity. As illustrated in suppl. Fig. S6 isoproterenol stimulation of cells expressing β1AR resulted in a significant increase in cellular GTPase activity, as expected. In contrast, exposure to a maximal concentration (10 µM) of isoproterenol did not affect GTPase activity in cells expressing GPR27. To further analyze the potential involvement of specific G proteins in the observed effects of isoproterenol through GPR27, we employed selective inhibitors of G\u003csub\u003eq/11\u003c/sub\u003e, G\u003csub\u003e12/13\u003c/sub\u003e, G\u003csub\u003ei/o\u003c/sub\u003e proteins, as well as the nonselective G protein inhibitor, suramin. As shown in Figure 5a, pretreatment of HEK293T cells expressing GPR27 with PTX (G\u003csub\u003ei/o\u003c/sub\u003e protein inhibitor), Y-27632 (an inhibitor that prevents G\u003csub\u003e12/13\u003c/sub\u003e protein-mediated ROCK-dependent downstream cellular effects) and YM-254890 (a G\u003csub\u003eq/11\u003c/sub\u003e protein inhibitor) did not significantly reverse the inhibitory effect of isoproterenol on the EGF-induced increase in SRE-Luc activity. Furthermore, the pretreatment with gallein (an inhibitor of Gβγ protein subunit-dependent signaling) did not reverse the inhibitory effect of GPR27 stimulation with isoproterenol on EGF-induced SRE activation. These results demonstrate that GPR27 mediates the inhibitory effects of isoproterenol on EGF-induced SRE-Luc activation independent of G proteins, irrespective of their subtype. In response to agonist stimulation, GPCRs become substrates for the action of G protein receptor kinases (GRKs), which are serine-threonine kinases that phosphorylate serine and threonine residues mostly located especially within the ICL3 and C-terminal domain of the activated receptor (21). This phosphorylation event is part of the desensitization mechanism involving arrestin recruitment to the phosphorylated receptor and its internalization (22). It is now well established that G protein-independent signaling of GPCRs, especially through β-arrestins, plays a significant role in regulating cellular responses (23, 24). Since we did not observe any role of G proteins in the inhibition of SRE-Luc activity by GPR27, we wondered whether GRKs and arrestins could mediate these effects of GPR27 stimulation with isoproterenol on EGF-induced SRE-Luc activation. To test this idea, we first examined the impact of the pharmacological inhibition of GRKs on GPR27-induced inhibition of SRE-Luc activity after isoproterenol stimulation. As shown in Figure 5b, pretreatment of cells expressing GPR27 with the non-selective GRK inhibitor 4-Amino-5-(bromomethyl)-2-methylpyrimidine dihydrobromide (AB06102) could not reverse the inhibition of EGF-induced increase in SRE-Luc activity triggered by stimulation of GPR27 with a maximal concentration (1 µM) of isoproterenol. However, in cells expressing β1AR, pretreatment with AB06102 led to an enhanced SRE activity in response to isoproterenol, as expected, considering that GRKs inhibitor prevents the desensitization mechanism of β1AR is affected by the GRKs inhibitor. Furthermore, to explore the possibility that β-arrestin 2 might mediate the effects of isoproterenol stimulation of GPR27 on SRE activity, we employed a previously described complementation-based system (9), consisting of a chimeric GPR27 receptor in which the the C-terminus domain is replaced with the corresponding domain of the vasopressin 2 receptor (V2R) and fused to a C-terminal portion of the firefly luciferase (Fluc) separated by a linker (GPR27-V2R-Fluc). We also employed a chimeric GPR27 with its C-terminus fused to the C-terminal part of the Fluc (GPR27-Fluc). The β-arrestin 2 fused with the N-terminal part of the Fluc (β-arr-Fluc) was coexpressed with GPR27-V2R-Fluc and GPR27-Fluc to determine the potential arrestin recruitment to the receptors. As shown in Figure 5c, isoproterenol stimulation of HEK293T cells expressing β-arr-Fluc together with GPR27-V2R-Fluc or GPR27-FLuc did not increase luciferase activity compared to solvent stimulation. This indicates that the complementation of the two fragments of the luciferase was not achieved through isoproterenol-stimulated GPR27-V2R-Fluc. Thus, these results suggest that β-arrestin 2 was not recruited to the stimulated chimeric receptor. To verify that the chimeric receptors described above retained their functionality, GPR27-Fluc and GPR27-V2R-Fluc were tested for their responsiveness to isoproterenol challenge. As shown in Figure 5d, stimulation with a maximal concentration (1µM) of isoproterenol led to a strong inhibition of EGF-induced increase in SRE-Luc activity in cells expressing GPR27-Fluc and GPR27-V2R-Fluc. All these results indicate that GPR27-mediated inhibition of isoproterenol on the EGF-induced increase in SRE-Luc activity does not involve G proteins or β-arrestins.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e4.6 Isoproterenol-induced inhibition of SRE activity through GPR27 does not involve ERK1/2 but implicates c-Src proteins.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eIn an attempt to identify the intracellular mechanism responsible for SRE inhibition by isoproterenol through GPR27 and based on the observation that this inhibition does not involve G proteins, we analyzed the involvement of well-known intracellular proteins in the observed effects. Extracellular signal-regulated protein kinase (ERK) 1/2 proteins are well-known modulators of SRE activity (25, 26). Therefore, it was a natural question whether GPR27 might alter the phosphorylation status of ERK1/2 proteins in response to isoproterenol, which would then lead to SRE-Luc inhibition. As presented in Figure 6a stimulation of cells expressing GPR27 with a maximal concentration of isoproterenol did not change the phosphorylation levels of ERK1/2 proteins. However, in response to an equivalent concentration of isoproterenol, β1AR mediated a significant increase in the phosphorylated ERK1/2. Moreover, following isoproterenol stimulation, the GPR27-Ctβ1 chimera mediated a strong increase in the phosphorylation of ERK1/2 proteins, consistent with previously described effects on cAMP levels (Figures 6b, 2b). To our surprise, β1AR-Ct27 chimera stimulation with isoproterenol also led to significant phosphorylation of ERK1/2 (Fig. 6b), although it mediated inhibition of EGF-induced SRE activation, in a similar manner as GPR27 (Fig. 4d). These results indicate that the inhibition of SRE activity by GPR27 in response to isoproterenol does not occur through ERK1/2 proteins. Since the observed cellular effects of GPR27 in response to isoproterenol are the inhibition of EGF-induced SRE activation, we examined whether there is a direct interaction between GPR27 and EGFR. Although we could not see a ligand-induced interaction between GPR27 and EGFR, as revealed by immunoprecipitation studies (Suppl. Fig. S7), the role of c-Src proteins in phosphorylation of EGFR (27) as well as in EGFR transactivation by GPCRs has been previously demonstrated (28). Consistent with the role of Src in mediating trans-inhibition of EGFR by isoproterenol through GPR27, pretreatment of cells expressing GPR27 with the c-Src inhibitor PP2 led to a complete loss of the inhibitory effect of isoproterenol on EGF-induced SRE activation (Fig. 6c). Interestingly, in cells expressing β1AR, pretreatment with PP led to a potentiation effect of isoproterenol-induced SRE activation (Fig. 6d). Based on these results we concluded that GPR27 mediates the inhibition of EGF-dependent activation of SRE through a previously undescribed trans-inhibition mechanism, involving c-Src and EGFR.\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn the present study, we promote the idea that GPR27 and GPR173 are novel atypical adrenergic receptors that trans-inhibit RTKs such as EGFR. Our starting point was the search for cellular effects induced by the heterologous expression of SREBs (GPR27, GPR85, and GPR173). Interestingly, GPR27 and to a lesser extent GPR173, but not GPR85 induced significant inhibition of the adenylyl-cyclase/cAMP pathway in a G\u003csub\u003ei\u003c/sub\u003e protein-independent manner. Our hypothesis that the C-terminal domain of GPR27 might play a role in the observed cellular effects of GPR27 led us to the generation of a series of chimeric receptors consisting of GPR27 lacking the C terminus, and with the C terminus replaced by the homologous domain of GPCRs with known ligands. Conversely, we generated chimeras consisting of known GPCRs with their C terminus replaced by the homologous domain of GPR27. All these chimeras were analyzed for expression and localization at the plasma membrane, followed by functional analyses. Surprisingly, among all the properly expressed chimeras, GPR27-Ct\u0026beta;1 functioned similarly to \u0026beta;1AR in terms of G\u003csub\u003es\u003c/sub\u003e protein-coupling and responsiveness to adrenergic agonists and antagonists. On the other hand, \u0026beta;1AR-Ct27 lost its ability to couple to G\u003csub\u003es\u003c/sub\u003e proteins in response to agonists, suggesting that the C terminus of GPR27 severely impacts chimera signaling through G\u003csub\u003es\u003c/sub\u003e proteins. These two important pieces of evidence prompted us to generate and test the functionality of GPR27∆Ct. Contrary to our expectations, the C-terminally truncated receptor did not regain G protein-coupling in response to adrenergic ligands, indicating that the C terminus might not be the only domain critically involved in the particular signaling characteristics of GPR27. Although GPR27-Ct\u0026beta;1 functioned similarly to \u0026beta;1AR, GPR27 did not respond to adrenergic ligands by engaging canonical G protein-mediated signaling pathways. These results led us to interrogate more integrative signaling pathways, such as determining transcriptional factor activity after receptor stimulation. Among all the transcriptional factors tested, only the EGF-induced increase in SRE activity was strongly inhibited by GPR27 and GPR173 after stimulation with adrenergic ligands, including noradrenaline. Interestingly, the observed inhibitory effect of GPR27 was insensitive to G protein inhibitors, did not involve arrestin recruitment, and also did not alter the levels of the phosphorylated ERK1/2 proteins, suggesting a novel cellular signaling mechanism of GPR27. Importantly, GPR27-Ct\u0026beta;1 functioned similarly to \u0026beta;1AR regarding SRE-Luc activation in response to isoproterenol, whereas \u0026beta;1AR-Ct27 was similar to GPR27, inducing an opposite effect on EGF signaling through SRE. These observations point to a critical role of the C-terminal domain of GPR27, especially when considering its severe impact on \u0026beta;1AR signaling. Unexpectedly to us, GPR27∆Ct still displayed full signaling characteristics of GPR27, including the effects on SRE activity. This is the reason we investigated the potential role of ICL3 of GPR27 and \u0026beta;1AR, by generating chimeras between both receptors, exchanging this domain. Notably, \u0026beta;1ARicl\u003csub\u003e3\u003c/sub\u003e27 functioned as \u0026beta;1AR in terms of G\u003csub\u003es\u003c/sub\u003e protein-coupling and SRE-Luc activation. However, GPR27icl\u003csub\u003e3\u003c/sub\u003e\u0026beta;1AR had a significantly lower capacity to inhibit EGF signaling through SRE, illustrating the significance of ICL3 in the atypical signaling features of GPR27. This assertion was supported by the fact that expression of GPR27icl\u003csub\u003e3\u003c/sub\u003e\u0026beta;1AR strongly reduced the inhibition on isoproterenol-induced cAMP accumulation compared to GPR27 partially answering our starting question derived from the observation of the strong effects of GPR27 on cAMP levels (Fig. 1a). However, GPR27icl\u003csub\u003e3\u003c/sub\u003e\u0026beta;1AR did not regain G protein engagement capacity in response to isoproterenol and could still inhibit EGF signaling through SRE although with a significantly reduced efficacy. Interestingly, GPR27icl\u003csub\u003e3\u003c/sub\u003e\u0026beta;1∆Ct functioned similarly to GPR27icl\u003csub\u003e3\u003c/sub\u003e\u0026beta;1AR, pointing to a less critical role of the C terminus in the chimera\u0026rsquo;s functionality. In an attempt to identify the intracellular signaling pathways involved in the effects of GPR27 on EGF signaling, we examined the effect of GPR27 stimulation with isoproterenol on the phosphorylation status of ERK1/2 proteins. Thereby, we could clearly demonstrate that ERK1/2 proteins are not involved in the inhibition of SRE-Luc activity through GPR27. On the other hand, the involvement of c-Src in the transinhibition of EGFR by GPR27 was further supported by the effect of the c-Src family of tyrosine kinase inhibitor PP2, which completely abolished the concentration dependent inhibition of SRE-Luc activity induced by isoproterenol in cells expressing GPR27. Intriguingly, PP2 had a rather positive effect on \u0026beta;1AR-induced activation of SRE-Luc activity in response to isoproterenol stimulation, a fact that deserves future attention.\u003c/p\u003e\n\u003cp\u003eBased on the results presented in this study, we propose that GPR27 and GPR173 sense extracellular adrenergic ligands, through an unknown mechanism, but likely independent of G proteins and \u0026beta;-arrestins. Notably, several intriguing pieces of evidence raise important questions that need to be further addressed. For example, the \u0026beta;1ARCt27 chimera, while mimicking GPR27 in terms of SRE inhibition and the lack of G protein engagement, \u0026nbsp;increased the phosphorylation levels of ERK1/2 proteins in response to isoproterenol exposure in contrast to GPR27. Importantly, we could neither see a direct interaction between GPR27 and EGFR nor a ligand-induced one, supporting the idea that the trans-inhibition of EGFR by GPR27 occurs through the engagement of cellular effectors such as members of the c-Src family of tyrosine kinases. It would be important to clarify whether there is an interaction between GPR27 and the endogenously expressed \u0026beta;1AR that could lead to the formation of a heteromer with a completely different function than a classical Class A GPCR, also an exciting hypothesis since no example of such a heteromer has been reported so far. However, this hypothesis might have its weaknesses based on our data demonstrating the absence of \u0026beta;1- or \u0026beta;2-adrenergic receptors in HEK293T as they do not respond to dobutamine, at concentrations up to 30 \u0026micro;M (Suppl. Fig. S8. Moreover, the direct effect of adrenergic ligands on GPR27 and GPR173 was further supported by the observation that these receptors are internalized in response to isoproterenol (GPR27) and noradrenaline (GPR27 and GPR173).\u003c/p\u003e\n\u003cp\u003eAlthough GPR27 belongs to the SREB family of receptors, together with GPR85 and GPR173, it distinguishes itself by sharing a similar \u0026beta;1AR-like ligand selectivity but with opposed functionality, features not shared with GPR85. Interestingly, GPR173 did not inhibit SRE-Luc activity in response to isoproterenol, but it did so when stimulated with noradrenaline, with a similar potency as GPR27. A previously published study proposed that phoenixin \u0026nbsp;might be a ligand of GPR173, inducing cellular effects through G\u003csub\u003es\u003c/sub\u003e proteins.\u0026nbsp;However, in our system, we could not see any activation of cellular pathways downstream of G\u003csub\u003es\u003c/sub\u003e proteins mediated by GPR173 in response to phoenixin (Suppl. Fig. S9). Ligand-dependent transinhibition of RTKs by GPCRs has not been described so far, and the cellular mechanism underlying this phenomenon might be complex, involving cellular effectors that still need to be characterized in further studies. However, published studies on the potential role of GPR27 reveal antitumor effects (10) that could be explained by our results on the trans-inhibition of RTKs by GPR27 described in this paper. In conclusion, we provide evidence for a new cellular phenomenon, trans-inhibition of EGFR by the orphan receptors GPR27 and GPR173 in response to adrenergic ligands.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank Dr. Stefan Offermanns for critical reading of the manuscript and for his expert opinion that led to a clearer manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e This work was funded by an EEA-Romania-Norway research grant (2018-0535) entitled “New Generation of Drug Targets for Schizophrenia”, (NEXTDRUG).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests:\u003c/strong\u003e The authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLiu S, Anderson PJ, Rajagopal S, Lefkowitz RJ, Rockman HA. G Protein-Coupled Receptors: A Century of Research and Discovery. Circulation research. 2024 Jun 21;135(1):174-97. PubMed PMID: 38900852. Pubmed Central PMCID: 11192237.\u003c/li\u003e\n\u003cli\u003eMatsumoto M, Saito T, Takasaki J, Kamohara M, Sugimoto T, Kobayashi M, et al. An evolutionarily conserved G-protein coupled receptor family, SREB, expressed in the central nervous system. Biochemical and biophysical research communications. 2000 Jun 7;272(2):576-82. PubMed PMID: 10833454.\u003c/li\u003e\n\u003cli\u003eStaubert C, Wozniak M, Dupuis N, Laschet C, Pillaiyar T, Hanson J. Superconserved receptors expressed in the brain: Expression, function, motifs and evolution of an orphan receptor family. Pharmacology \u0026amp; therapeutics. 2022 Dec;240:108217. PubMed PMID: 35644261.\u003c/li\u003e\n\u003cli\u003eAlexander SPH, Christopoulos A, Davenport AP, Kelly E, Mathie AA, Peters JA, et al. The Concise Guide to PHARMACOLOGY 2023/24: G protein-coupled receptors. British journal of pharmacology. 2023 Oct;180 Suppl 2:S23-S144. PubMed PMID: 38123151.\u003c/li\u003e\n\u003cli\u003eNath AK, Ma J, Chen ZZ, Li Z, Vitery MDC, Kelley ML, et al. Genetic deletion of gpr27 alters acylcarnitine metabolism, insulin sensitivity, and glucose homeostasis in zebrafish. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 2020 Jan;34(1):1546-57. PubMed PMID: 31914600. Pubmed Central PMCID: 6956728.\u003c/li\u003e\n\u003cli\u003eChopra DG, Yiv N, Hennings TG, Zhang Y, Ku GM. Deletion of Gpr27 in vivo reduces insulin mRNA but does not result in diabetes. Scientific reports. 2020 Mar 27;10(1):5629. PubMed PMID: 32221326. Pubmed Central PMCID: 7101378.\u003c/li\u003e\n\u003cli\u003eKu GM, Pappalardo Z, Luo CC, German MS, McManus MT. An siRNA screen in pancreatic beta cells reveals a role for Gpr27 in insulin production. PLoS genetics. 2012 Jan;8(1):e1002449. PubMed PMID: 22253604. Pubmed Central PMCID: 3257298.\u003c/li\u003e\n\u003cli\u003eMartin AL, Steurer MA, Aronstam RS. Constitutive Activity among Orphan Class-A G Protein Coupled Receptors. PloS one. 2015;10(9):e0138463. PubMed PMID: 26384023. Pubmed Central PMCID: 4575141.\u003c/li\u003e\n\u003cli\u003eDupuis N, Laschet C, Franssen D, Szpakowska M, Gilissen J, Geubelle P, et al. Activation of the Orphan G Protein-Coupled Receptor GPR27 by Surrogate Ligands Promotes beta-Arrestin 2 Recruitment. Molecular pharmacology. 2017 Jun;91(6):595-608. PubMed PMID: 28314853.\u003c/li\u003e\n\u003cli\u003eCai C, Hu L, Wu K, Liu Y. GPR27 expression correlates with prognosis and tumor progression in gliomas. PeerJ. 2024;12:e17024. PubMed PMID: 38638156. Pubmed Central PMCID: 11025540.\u003c/li\u003e\n\u003cli\u003eTreen AK, Luo V, Belsham DD. Phoenixin Activates Immortalized GnRH and Kisspeptin Neurons Through the Novel Receptor GPR173. Molecular endocrinology. 2016 Aug;30(8):872-88. PubMed PMID: 27268078. Pubmed Central PMCID: 5414621.\u003c/li\u003e\n\u003cli\u003eDaub H, Weiss FU, Wallasch C, Ullrich A. Role of transactivation of the EGF receptor in signalling by G-protein-coupled receptors. Nature. 1996 Feb 8;379(6565):557-60. PubMed PMID: 8596637.\u003c/li\u003e\n\u003cli\u003eCrudden C, Shibano T, Song D, Suleymanova N, Girnita A, Girnita L. Blurring Boundaries: Receptor Tyrosine Kinases as functional G Protein-Coupled Receptors. International review of cell and molecular biology. 2018;339:1-40. PubMed PMID: 29776602.\u003c/li\u003e\n\u003cli\u003eNew DC, Wong YH. Molecular mechanisms mediating the G protein-coupled receptor regulation of cell cycle progression. Journal of molecular signaling. 2007 Feb 26;2:2. PubMed PMID: 17319972. Pubmed Central PMCID: 1808056.\u003c/li\u003e\n\u003cli\u003eCattaneo F, Guerra G, Parisi M, De Marinis M, Tafuri D, Cinelli M, et al. Cell-surface receptors transactivation mediated by g protein-coupled receptors. International journal of molecular sciences. 2014 Oct 29;15(11):19700-28. PubMed PMID: 25356505. Pubmed Central PMCID: 4264134.\u003c/li\u003e\n\u003cli\u003eKilpatrick LE, Hill SJ. Transactivation of G protein-coupled receptors (GPCRs) and receptor tyrosine kinases (RTKs): Recent insights using luminescence and fluorescence technologies. Current opinion in endocrine and metabolic research. 2021 Feb;16:102-12. PubMed PMID: 33748531. Pubmed Central PMCID: 7960640.\u003c/li\u003e\n\u003cli\u003eRigo A, Gottardi M, Damiani E, Bonifacio M, Ferrarini I, Mauri P, et al. CXCL12 and [N33A]CXCL12 in 5637 and HeLa cells: regulating HER1 phosphorylation via calmodulin/calcineurin. PloS one. 2012;7(4):e34432. PubMed PMID: 22529914. Pubmed Central PMCID: 3329496.\u003c/li\u003e\n\u003cli\u003eTunaru S, Kero J, Schaub A, Wufka C, Blaukat A, Pfeffer K, et al. PUMA-G and HM74 are receptors for nicotinic acid and mediate its anti-lipolytic effect. Nature medicine. 2003 Mar;9(3):352-5. PubMed PMID: 12563315.\u003c/li\u003e\n\u003cli\u003eKeen AC, Pedersen MH, Lemel L, Scott DJ, Canals M, Littler DR, et al. OZITX, a pertussis toxin-like protein for occluding inhibitory G protein signalling including Galpha(z). Communications biology. 2022 Mar 23;5(1):256. PubMed PMID: 35322196. Pubmed Central PMCID: 8943041.\u003c/li\u003e\n\u003cli\u003eQiu X, Chao K, Song S, Wang YQ, Chen YA, Rouse SL, et al. Coupling and Activation of the beta1 Adrenergic Receptor - The Role of the Third Intracellular Loop. Journal of the American Chemical Society. 2024 Oct 3;146(41):28527-37. PubMed PMID: 39359104. Pubmed Central PMCID: 11487556 cofounder of and consultant at OMass Therapeutics. The remaining authors declare no competing interests.\u003c/li\u003e\n\u003cli\u003eYang Z, Yang F, Zhang D, Liu Z, Lin A, Liu C, et al. Phosphorylation of G Protein-Coupled Receptors: From the Barcode Hypothesis to the Flute Model. Molecular pharmacology. 2017 Sep;92(3):201-10. PubMed PMID: 28246190.\u003c/li\u003e\n\u003cli\u003eSun N, Kim KM. Mechanistic diversity involved in the desensitization of G protein-coupled receptors. Archives of pharmacal research. 2021 Apr;44(4):342-53. PubMed PMID: 33761113.\u003c/li\u003e\n\u003cli\u003eZhang M, Chen T, Lu X, Lan X, Chen Z, Lu S. G protein-coupled receptors (GPCRs): advances in structures, mechanisms, and drug discovery. Signal transduction and targeted therapy. 2024 Apr 10;9(1):88. PubMed PMID: 38594257. Pubmed Central PMCID: 11004190.\u003c/li\u003e\n\u003cli\u003eJean-Charles PY, Kaur S, Shenoy SK. G Protein-Coupled Receptor Signaling Through beta-Arrestin-Dependent Mechanisms. Journal of cardiovascular pharmacology. 2017 Sep;70(3):142-58. PubMed PMID: 28328745. Pubmed Central PMCID: 5591062.\u003c/li\u003e\n\u003cli\u003eChang SH, Poser S, Xia Z. A novel role for serum response factor in neuronal survival. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2004 Mar 3;24(9):2277-85. PubMed PMID: 14999078. Pubmed Central PMCID: 6730428.\u003c/li\u003e\n\u003cli\u003eMebratu Y, Tesfaigzi Y. How ERK1/2 activation controls cell proliferation and cell death: Is subcellular localization the answer? Cell cycle. 2009 Apr 15;8(8):1168-75. PubMed PMID: 19282669. Pubmed Central PMCID: 2728430.\u003c/li\u003e\n\u003cli\u003eBiscardi JS, Maa MC, Tice DA, Cox ME, Leu TH, Parsons SJ. c-Src-mediated phosphorylation of the epidermal growth factor receptor on Tyr845 and Tyr1101 is associated with modulation of receptor function. The Journal of biological chemistry. 1999 Mar 19;274(12):8335-43. PubMed PMID: 10075741.\u003c/li\u003e\n\u003cli\u003eWang Z. Transactivation of Epidermal Growth Factor Receptor by G Protein-Coupled Receptors: Recent Progress, Challenges and Future Research. International journal of molecular sciences. 2016 Jan 12;17(1). PubMed PMID: 26771606. Pubmed Central PMCID: 4730337.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003cp\u003e\u003cstrong\u003eTable 1\u003c/strong\u003e Effect of the shown ligands at 10 \u0026micro;M on intracellular cAMP levels in HEK293T cells expressing GPR27-Ct\u0026beta;1 chimera and \u0026beta;1AR together with pGlo-22F cAMP sensor. Numbers represent the average of RLU recorded after compound stimulation of GPR27Ct\u0026beta;1 expressing cells divided by the average of RLU determined after compound stimulation of mock transfected cells.\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"658\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eLigand Class\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eDrug name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 246px;\"\u003e\n \u003cp\u003eFold change\u003c/p\u003e\n \u003cp\u003e(Av. RLU receptor/Av. RLU mock)\u003c/p\u003e\n \u003cp\u003e(Mean \u0026plusmn; SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eMoA[1]/Target[2]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003eGPR27Ct\u0026beta;1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e\u0026beta;1AR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"20\" valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eAdrenergic\u003c/p\u003e\n \u003cp\u003eagonists\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eIsoproterenol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e4.7 \u0026plusmn; 1.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e4.5 \u0026plusmn; 0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026beta;1, \u0026beta;2, \u0026beta;3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eDobutamine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e5.5 \u0026plusmn; 0.3\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e4.6 \u0026plusmn; 0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026beta;1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eRitodrine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e7.5 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e6.2 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"9\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026beta;2\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eOrciprenaline\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e2.6 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e1.9 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eOlodaterol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e4.0 \u0026plusmn; 0.3\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e3.1 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eIndacaterol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e4.6 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e3.4 \u0026plusmn; 0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eFormoterol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e2.5 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e1.8 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eVilanterol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e2.6 \u0026plusmn; 0.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e2.1 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eSalbutamol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e3.9 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e3.0 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eTerbutaline\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e3.6 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e2.6 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eIsoetharine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e2.5 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e1.9 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eMirabegron\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e21.9 \u0026plusmn; 1.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e17.3 \u0026plusmn; 1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026beta;3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eNaphazoline\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e2.6 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e1.1 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026alpha;1, \u0026alpha;2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eMetaraminol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e11.0 \u0026plusmn; 0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e8.1 \u0026plusmn; 0.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026alpha;1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003ePhenylephrine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e6.4 \u0026plusmn; 1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e5.8 \u0026plusmn; 0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026alpha;1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eMethyldopa\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e2.8 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e1.6 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026alpha;2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eGuanfacine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e18.8 \u0026plusmn; 1.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e14.4 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026alpha;2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eBrimonidine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e3.2 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e1.9 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026alpha;2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eDroxidopa\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e9.8 \u0026plusmn; 0.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e8.5 \u0026plusmn; 0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eNA prodrug\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eDipivefrine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e10.1 \u0026plusmn; 0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e6.8 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eNA prodrug\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"8\" valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eAdrenergic antagonists[3]\u003csup\u003e,[4]\u003c/sup\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003ePropranolol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e16.2 \u0026plusmn; 13.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e13.5 \u0026plusmn; 1.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026beta;1, \u0026beta;2, \u0026beta;3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eNadolol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e6.6 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e5.4 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026beta;1, \u0026beta;2, \u0026beta;3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eTimolol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e10.5 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e7.8 \u0026plusmn; 0.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026beta;1, \u0026beta;2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eCarvedilol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e12.2 \u0026plusmn; 0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e10.7 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026beta;1, \u0026beta;2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eLabetalol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e14.6 \u0026plusmn; 1.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e13.0 \u0026plusmn; 0.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026beta;1, \u0026beta;2, \u0026alpha;1D\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eCarteolol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e16.1 \u0026plusmn; 1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e15.0 \u0026plusmn; 1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026beta;1, \u0026beta;2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eEsmolol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e8.9 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e6.4 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026beta;1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eAcebutolol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e12.6 \u0026plusmn; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e10.7 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026beta;1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eCholinergic\u003c/p\u003e\n \u003cp\u003eagonists\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003ePilocarpine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e2.7 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e1.6 \u0026plusmn; 0.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eMRs\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"5\" valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eDopaminergic\u003c/p\u003e\n \u003cp\u003eagonists\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eDopamine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e21.4 \u0026plusmn; 2.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e23.4 \u0026plusmn; 0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eDRs\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eFenoldopam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e6.5 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e3.8 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eD1, D4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eRotigotine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e19.9 \u0026plusmn; 0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e10.6 \u0026plusmn; 0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eDRs\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eQuinpirole\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e2.3 \u0026plusmn; 0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e1.6 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eDRs and 5HT1A, 5HT2A,B,C\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eLevodopa\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e5.0 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e2.6 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eDA precursor\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eDopaminergic antagonists\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003ePimozide\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e21.6 \u0026plusmn; 2.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e16 \u0026plusmn; 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eDRs, 5HTRs\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eBendazol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e3.5 \u0026plusmn; 0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e1.9 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eDRs\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eSerotoninergic\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eFlibanserin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e4.1 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e2.2 \u0026plusmn; 0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e5-HT1A agonist and 5-HT2A antagonist\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"3\" valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eRelated to aminergic system\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eDihydroergotoxine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e4.1 \u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e2.2 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eDRs, ADRs, 5HTRs[5]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eMilnacipran\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e21.8 \u0026plusmn; 0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e17.9 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eISRN\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eTranylcipromine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e2.7 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e1.4 \u0026plusmn; 0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eMAOI\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eOthers\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eAmantadine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e11.7 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e8.9 \u0026plusmn; 1.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eNMDA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e[1] MoA = mechanism of action\u003c/p\u003e\n\u003cp\u003e[2] Verified using Iuphar/DrugBank/TargetMol\u003c/p\u003e\n\u003cp\u003e[3] Some of them reported in literatured as partial agonists. !We tested them at 10 \u0026micro;M in transfected cells!\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e[4] The library also contained metoprolol, betaxolol, nebivolol, levobetaxolol, atenolol, bisoprolol and no effect was recorded in their presence.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7641991/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7641991/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eG protein-coupled receptors 27 and 173 (GPR27 and GPR173) are part of the \"Super Conserved Receptors Expressed in Brain\" (SREB) family, alongside GPR85. While the endogenous ligands and functions of SREB receptors are still unknown, GPR27 has been implicated in insulin secretion and tumorigenesis, whereas GPR173 has been proposed to be a receptor mediating biological effects of phoenixin-20 amide. Here, we show that substituting GPR27’s C-terminal domain with that of the β1 adrenergic receptor (β1AR) yields a chimera with β1AR-like ligand selectivity and cellular functions. Interestingly, stimulation of GPR27 with isoproterenol and adrenergic ligands inhibited epidermal growth factor (EGF)-induced serum-responsive element (SRE) activation, independently of G proteins and β-arrestins, and induced GPR27 internalization.Surprisingly, GPR173 responded exclusively to noradrenaline, showing both inhibition of EGF-induced SRE activity and receptor internalisation, whereas GPR85 remained unresponsive to the tested adrenergic ligands. \u0026nbsp;\u0026nbsp;Taken together, these intriguing findings suggest that GPR27 and GPR173 respond to adrenergic ligands to transinhibit EGFR through a unique and atypical signaling mechanism, previously undescribed for any known GPCR. Moreover, we provide the first evidence of ligand-induced functional transinhibition of a receptor tyrosine kinase, such as EGFR, by a GPCR, opening new research lines with translational potential.\u003c/p\u003e","manuscriptTitle":"Adrenergic Ligands-Induced Transinhibition of EGFR by GPR27 and GPR173 Reveals a Novel GPCR Signaling Mechanism","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-23 18:59:53","doi":"10.21203/rs.3.rs-7641991/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7989a04b-6b96-4318-8b46-4f88d28cfa85","owner":[],"postedDate":"September 23rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":55189536,"name":"Biological sciences/Cell biology/Cell signalling/Hormone receptors"},{"id":55189537,"name":"Health sciences/Diseases/Cancer"}],"tags":[],"updatedAt":"2025-10-03T16:40:23+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-23 18:59:53","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7641991","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7641991","identity":"rs-7641991","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.