Impact of CYP2A6 genetic polymorphism on letrozole efficacy in Iraqi women with polycystic ovary syndrome.

The research was a self-funded study.

NRK conducted all experimental and analytical work and wrote the manuscript. AMR conducted the statistical analyses. AUM provided supervision throughout the project and proofread the manuscript. All authors have critically reviewed and approved the final draft and are responsible for the content and similarity index of the manuscript.

This study was approved by the Ethics Committee of the College of Pharmacy/University of Karbala on August 2, 2023 (Ref No. 2023HU2). All patients provided informed consent before enrollment in the study. This study was performed in accordance with the principles of the Declaration of Helsinki.

The demographic data of the participants, including age, BMI, duration of marriage, number of abortions, and regulation of the menstrual cycle, were evaluated. There were no significant differences in demographic data between the study groups of women with PCOS with infertility ( P > 0.05), as shown in Table 2 . Table 2 Demographic characteristics of women with PCOS with infertility using the independent t -test, Mann–Whitney U test, and Chi-square test. Table 2 Variables Women with PCOS with infertility P value Response (No: 61) Non-response (No: 33) Age (y) (mean ± SEM) 28.57 ± 0.71 28 ± 0.94 0.632 BMI (kg/m 2 ) (mean ± SEM) 29.82 ± 0.6 29.75 ± 1.03 0.95 Duration of marriage (y) (mean ± SD) 5.92 ± 3.31 6.39 ± 3.8 0,667 Number of abortions (mean ± SD) 0.75 ± 1.29 0.39 ± 0.79 0238 Regular menstrual cycle (No (%)) No 19 (54.3 %) 16 (45.7 %) 0.097 Yes 42 (71.2 %) 17 (28.8 %) BMI: Body mass index; PCOS: Polycystic ovary syndrome; SD: Standard deviation; SEM: Standard error of the mean. Three primary outcomes emerged from our analysis. (1) Letrozole significantly improved ovulation rates (65 % overall), with comparable efficacy between the AA (68 %) and TT (63 %) genotypes ( P = 0.45). (2) Hormonal profiles showed consistent changes (LH↑, E2↑, T↓) across all genotypes (all P > 0.1). (3) Pregnancy rates (9/94) did not differ by genotype (AA 13.7 % vs. TT 12.2 %; P = 0.84). Demographic characteristics of women with PCOS with infertility using the independent t -test, Mann–Whitney U test, and Chi-square test. BMI: Body mass index; PCOS: Polycystic ovary syndrome; SD: Standard deviation; SEM: Standard error of the mean. Three primary outcomes emerged from our analysis. (1) Letrozole significantly improved ovulation rates (65 % overall), with comparable efficacy between the AA (68 %) and TT (63 %) genotypes ( P = 0.45). (2) Hormonal profiles showed consistent changes (LH↑, E2↑, T↓) across all genotypes (all P > 0.1). (3) Pregnancy rates (9/94) did not differ by genotype (AA 13.7 % vs. TT 12.2 %; P = 0.84). The plasma levels of LH and E2 were significantly elevated in women with PCOS with and infertility after letrozole administration compared to the same women before letrozole administration ( P < 0.05). The plasma levels of PRL and T were significantly lower in women with PCOS women with infertility after taking letrozole than in the same women before taking letrozole ( P 0.05; Table 2 ). The plasma level of E2 increased considerably in women with PCOS with infertility who took letrozole and subsequently became pregnant compared to those who remained infertile ( P 0.05; Table 3 ). Table 3 Plasma levels of sex hormones before and after letrozole administration. Table 3 Sex hormones Administration of letrozole P value Before (mean ± SD) After (mean ± SD) FSH (mlU/mL) 7.309 ± 2.74 7.313 ± 3.54 0.681 LH (mIU/mL) 6.339 ± 3.38 11.293 ± 8.55 0.00001 E2 (pg/mL) 41.919 ± 30.31 184.819 ± 252.53 0.00001 PRL (ng/mL) 17.746 ± 12.31 13.515 ± 11.77 0.002 T (ng/mL) 1.01 ± 0.4 0.41 ± 0.2 0.00001 E2: Estradiol; FSH: Follicle-stimulating hormone; LH: Luteinizing hormone; PRL: Prolactin; SD: Standard deviation; T: Testosterone. P -value indicates statistical significance level (Wilcoxon test). Plasma levels of sex hormones before and after letrozole administration. E2: Estradiol; FSH: Follicle-stimulating hormone; LH: Luteinizing hormone; PRL: Prolactin; SD: Standard deviation; T: Testosterone. P -value indicates statistical significance level (Wilcoxon test). The ovarian follicle size and endometrial tissue of women with PCOS with infertility were significantly elevated after taking letrozole compared to the same women before using letrozole ( P < 0.05; Figure 1 ). Follicle size increased considerably in women with PCOS with infertility who took letrozole and subsequently became pregnant compared to those who remained infertile ( P 0.05; Table 4 ). Figure 1 Ultrasonographic changes in endometrial thickness and follicle size before and after letrozole administration in women with PCOS with infertility . The figure illustrates the mean (± standard deviation) for endometrial thickness (mm) and follicle size (mm) in women with PCOS with infertility before and after letrozole treatment. Asterisks (∗) denote statistically significant differences (∗ P < 0.05) between pre-treatment (red bars) and post-treatment (green bars) measurements, as determined by the Wilcoxon signed-rank test. Error bars represent the standard deviation. The data demonstrate that letrozole significantly increased both endometrial thickness and follicle size, supporting its role in improving ovarian and endometrial responses in PCOS-related infertility. Figure 1 Figure 2 Agarose gel electrophoresis of CYP2A6∗2 (1799T>A, rs1801272) genotyping in women with PCOS with infertility . The gel image shows PCR products for the CYP2A6 2∗ variant (1799T>A, rs1801272) with a 342-bp band. Lanes 1 – 6: Representative samples of wild-type (AA), heterozygous (AT), and mutant (TT) genotypes. Lane M: 100-bp DNA ladder marker. Genotypes were determined by allele-specific PCR, with the wild-type allele (A) and mutant allele (T) distinguished by primer design ( Table 1 ). The clear banding pattern confirms successful amplification and genotyping. Ethidium bromide staining was visualized under UV transillumination. Primer sequences and PCR conditions are provided in Table 1 . Figure 2 Table 4 Plasma levels of sex hormones in women with PCOS with infertility who did or did not respond to letrozole. Table 4 Sex hormones Women with PCOS with infertility P value Response (mean ± SD) Non-response (mean ± SD) FSH (mlU/mL) 7.15 ± 3.42 7.62 ± 3.79 0.287 LH (mlU/mL) 12.05 ± 8.52 9.9 ± 8.55 0.144 E2 (pg/mL) 239.29 ± 293.14 84.14 ± 90 0,00004 PRL (ng/mL) 13.54 ± 10.34 13.46 ± 14.21 0.498 T (ng/mL) 0.39 ± 0.2 0.44 ± 0.2 0.937 AMH (pg/mL) 4.75 ± 3.19 4.64 ± 2.6 0.260 AMH: Anti-Müllerian hormone; E2: Estradiol; FSH: Follicle-stimulating hormone; LH: Luteinizing hormone; PCOS: Polycystic ovary syndrome; PRL: Prolactin; SD: Standard deviation; T: Testosterone. P -value indicates statistical significance level (Mann–Whitney U test). Ultrasonographic changes in endometrial thickness and follicle size before and after letrozole administration in women with PCOS with infertility . The figure illustrates the mean (± standard deviation) for endometrial thickness (mm) and follicle size (mm) in women with PCOS with infertility before and after letrozole treatment. Asterisks (∗) denote statistically significant differences (∗ P < 0.05) between pre-treatment (red bars) and post-treatment (green bars) measurements, as determined by the Wilcoxon signed-rank test. Error bars represent the standard deviation. The data demonstrate that letrozole significantly increased both endometrial thickness and follicle size, supporting its role in improving ovarian and endometrial responses in PCOS-related infertility. Agarose gel electrophoresis of CYP2A6∗2 (1799T>A, rs1801272) genotyping in women with PCOS with infertility . The gel image shows PCR products for the CYP2A6 2∗ variant (1799T>A, rs1801272) with a 342-bp band. Lanes 1 – 6: Representative samples of wild-type (AA), heterozygous (AT), and mutant (TT) genotypes. Lane M: 100-bp DNA ladder marker. Genotypes were determined by allele-specific PCR, with the wild-type allele (A) and mutant allele (T) distinguished by primer design ( Table 1 ). The clear banding pattern confirms successful amplification and genotyping. Ethidium bromide staining was visualized under UV transillumination. Primer sequences and PCR conditions are provided in Table 1 . Plasma levels of sex hormones in women with PCOS with infertility who did or did not respond to letrozole. AMH: Anti-Müllerian hormone; E2: Estradiol; FSH: Follicle-stimulating hormone; LH: Luteinizing hormone; PCOS: Polycystic ovary syndrome; PRL: Prolactin; SD: Standard deviation; T: Testosterone. P -value indicates statistical significance level (Mann–Whitney U test). ∗: Significant effect ( P T (rs1801272) were clear, with a molecular size of 342 bp, as shown in Figure 1 . Wild-type alleles (AA) were widely distributed in approximately 51 (54.26 %) women with PCOS. Heterozygous (AT) and mutant (TT) alleles were present in 2 (2.13 %) and 41 (43.61 %) women with PCOS, respectively, as shown in Figure 3 . Figure 3 Prevalence of CYP2A6∗2 (1799T > A, rs1801272) genotypes in Iraqi women with PCOS-induced infertility . The pie chart illustrates the distribution of CYP2A6 2∗ (1799T > A) genotypes among 94 Iraqi women with PCOS: wild-type (AA) (54.26 %, n = 51, blue ), heterozygous (AT) (2.13 %, n = 2, yellow ), and mutant (TT) (43.61 %, n = 41, red ). Genotyping was performed via allele-specific PCR ( Figure 2 ). Figure 3 Prevalence of CYP2A6∗2 (1799T > A, rs1801272) genotypes in Iraqi women with PCOS-induced infertility . The pie chart illustrates the distribution of CYP2A6 2∗ (1799T > A) genotypes among 94 Iraqi women with PCOS: wild-type (AA) (54.26 %, n = 51, blue ), heterozygous (AT) (2.13 %, n = 2, yellow ), and mutant (TT) (43.61 %, n = 41, red ). Genotyping was performed via allele-specific PCR ( Figure 2 ). There was no significant difference between infertile women who took letrozole and those who carried different genotypes (wild-type AA, heterozygous AT, and mutant TT genotypes) of CYP2A6 (1799T>A) with respect to sex hormone, follicle size, endometrial thickness, and incidence of gestation at P > 0.05 ( Table 5 , Table 6 ). The heterozygous AT genotype in infertile women who did or did not respond to letrozole was considered statistically invalid because only one woman in each classified group carried this genotype. The plasma level of FSH was significantly lower in infertile women who did not respond to letrozole and carried the mutant TT genotype than in women with infertility who did not respond to letrozole and carried the wild AA genotype ( P < 0.05). The plasma levels of AMH and endometrial thickness were significantly elevated in infertile women who did not respond to letrozole and carried the mutant TT genotype compared to infertile women who did not respond to letrozole and carried the wild-type AA genotype ( P A) regarding LH, E2, PRL, T follicle size, and incidence of gestation ( P > 0.05). There was also no significant difference between infertile women who responded to letrozole and those who carried different genotypes (wild-type AA, heterozygous AT, and mutant TT genotypes) of CYP2A6 (1799T>A) regarding sex hormones, follicle size, endometrial thickness, and incidence of gestation ( P > 0.05; Figures 3 , 4 and 5 ). Table 5 Response of women with PCOS with infertility to letrozole. Table 5 Variables Women with PCOS with infertility P value Response (No: 61) Non-response (No: 33) Follicle size (mean ± SD) 20.3 ± 1.57 13.73 ± 3.05 0.00001 Endometrial thickness (mean ± SD) 3.88 ± 0.75 3.91 ± 0.81 0.85 Incidence of gestation No 52 (61.9 %) 32 (38.1 %) 0.078 Yes 9 (90 %) 1 (10 %) PCOS: Polycystic ovary syndrome; SD: Standard deviation. P -value indicates the statistical significance level; Gestation incidence was categorized as Yes (pregnant) or No (not pregnant); Follicle size and endometrial thickness were measured in mm. Table 6 Plasma level of sex hormones in women with PCOS with infertility who took letrozole and carried different genotypes of CYP 2A6 (1799T>A). Table 6 Sex hormones Genotyping of CYP 2A6 (1799T>A) P – value AA (No: 51) (mean ± SD) AT (No: 2) (mean ± SD) TT (No: 41) (mean ± SD) FSH (mlU/mL) 7.68 ± 3.58 3.55 ± 2.47 7.04 ± 3.46 0.186 LH (mlU/mL) 12.05 ± 9.04 8.3 ± 2.69 10.49 ± 8.1 0.622 E2 (pg/mL) 208.86 ± 277.41 152.8 ± 103.38 156.48 ± 224.04 0,768 PRL (ng/mL) 14.42 ± 11.86 9.8 ± 11.03 12.57 ± 11.85 0.434 T (ng/mL) 0.38 ± 0.2 0.65 ± 0.07 0.43 ± 0.2 0.099 AMH (pg/mL) 4.69 ± 3.08 7.62 ± 1.82 4.6 ± 2.88 0.316 AMH: Anti-Müllerian hormone; CYP2A6 (1799T>A): Genetic polymorphism of cytochrome P4502A6 gene; E2: Estradiol; FSH: Follicle-stimulating hormone; LH: Luteinizing hormone; PCOS: Polycystic ovary syndrome; PRL: Prolactin; SD: Standard Deviation; T: Testosterone. P-value indicates statistical significance level (Kruskal–Wallis test). Figure 4 Baseline plasma concentrations of reproductive hormones stratified by CYP2A6∗2 (1799T>A) genotypes in Iraqi women with PCOS-induced infertility . Box-and-whisker plots compare pre-treatment (cycle day 2) plasma levels of: (A) Follicle-stimulating hormone (FSH; mIU/mL), (B) Luteinizing hormone (LH; mIU/mL), (C) Estradiol (E2; pg/mL), (D) Prolactin (PRL; ng/mL), (E) Testosterone (T; ng/mL), (F) Anti-Müllerian hormone (AMH; ng/mL). Genotype groups: Wild-type (AA; blue), Heterozygous (AT; orange), Mutant (TT; green). Central lines represent medians, boxes show interquartile ranges (IQRs), whiskers extend to 1.5 × IQR. No significant differences were observed between genotypes (Kruskal–Wallis test, P > 0.05) except for FSH and AMH in non-responders (see Table 6 ). Hormone assays were performed using immuno-enzymatic methods (Methods section). Figure 4 Figure 5 Ovarian response parameters and pregnancy outcomes across CYP2A6∗2 (1799T>A) genotypes in women with PCOS treated with letrozole . Box-and-whisker plots (A–B) and bar chart (C) display: A. Follicle size (mm), B. Endometrial thickness (mm), Pregnancy incidence (%). Stratified by CYP2A6∗2 genotypes: wild-type (AA; blue), heterozygous (AT; orange), and mutant (TT; green). Central lines represent medians, boxes show interquartile ranges (IQRs), and whiskers extend to minimum and maximum values. Panel C shows absolute counts with percentages. No significant differences were observed between genotypes for any parameter (Kruskal–Wallis test for A-B, chi-square test for C; all P > 0.05). Ultrasound measurements were taken on cycle day 12 post-letrozole administration. Pregnancy was confirmed by β-hCG testing and ultrasound. Figure 5 Response of women with PCOS with infertility to letrozole. PCOS: Polycystic ovary syndrome; SD: Standard deviation. P -value indicates the statistical significance level; Gestation incidence was categorized as Yes (pregnant) or No (not pregnant); Follicle size and endometrial thickness were measured in mm. Plasma level of sex hormones in women with PCOS with infertility who took letrozole and carried different genotypes of CYP 2A6 (1799T>A). AMH: Anti-Müllerian hormone; CYP2A6 (1799T>A): Genetic polymorphism of cytochrome P4502A6 gene; E2: Estradiol; FSH: Follicle-stimulating hormone; LH: Luteinizing hormone; PCOS: Polycystic ovary syndrome; PRL: Prolactin; SD: Standard Deviation; T: Testosterone. P-value indicates statistical significance level (Kruskal–Wallis test). Baseline plasma concentrations of reproductive hormones stratified by CYP2A6∗2 (1799T>A) genotypes in Iraqi women with PCOS-induced infertility . Box-and-whisker plots compare pre-treatment (cycle day 2) plasma levels of: (A) Follicle-stimulating hormone (FSH; mIU/mL), (B) Luteinizing hormone (LH; mIU/mL), (C) Estradiol (E2; pg/mL), (D) Prolactin (PRL; ng/mL), (E) Testosterone (T; ng/mL), (F) Anti-Müllerian hormone (AMH; ng/mL). Genotype groups: Wild-type (AA; blue), Heterozygous (AT; orange), Mutant (TT; green). Central lines represent medians, boxes show interquartile ranges (IQRs), whiskers extend to 1.5 × IQR. No significant differences were observed between genotypes (Kruskal–Wallis test, P > 0.05) except for FSH and AMH in non-responders (see Table 6 ). Hormone assays were performed using immuno-enzymatic methods (Methods section). Ovarian response parameters and pregnancy outcomes across CYP2A6∗2 (1799T>A) genotypes in women with PCOS treated with letrozole . Box-and-whisker plots (A–B) and bar chart (C) display: A. Follicle size (mm), B. Endometrial thickness (mm), Pregnancy incidence (%). Stratified by CYP2A6∗2 genotypes: wild-type (AA; blue), heterozygous (AT; orange), and mutant (TT; green). Central lines represent medians, boxes show interquartile ranges (IQRs), and whiskers extend to minimum and maximum values. Panel C shows absolute counts with percentages. No significant differences were observed between genotypes for any parameter (Kruskal–Wallis test for A-B, chi-square test for C; all P > 0.05). Ultrasound measurements were taken on cycle day 12 post-letrozole administration. Pregnancy was confirmed by β-hCG testing and ultrasound. There was no significant difference in response to letrozole between infertile women carrying different genotypes (wild-type AA, heterozygous AT, and mutant TT genotypes) of CYP2A6 (1799T>A) ( P > 0.05; Table 7 ) (see Table 8 ). Table 7 Follicle size, endometrial thickness, and incidence of gestation in PCOS women with infertility who took letrozole and carried different genotypes of CYP2A6 (1799T>A). Table 7 Variables Genotypes of CYP2A6 (1799T>A) P – value AA (No: 51) (mean ± SD) or No (%) AT (No: 2) (mean ± SD) or No (%) TT (No: 41) (mean ± SD) or No (%) Follicle size (mm) 18.2 ± 4.11 17.5 ± 3.54 17.76 ± 3.56 0.423 Endometrial thickness (mm) 7.8 ± 0.4 8 ± 0 7.93 ± 0.26 0.204 Incidence of gestation No 44 (86.3 %) 2 (100 %) 36 (87.8 %) 0.841 Yes 7 (13.7 %) 0 (100 %) 5 (12.2 %) CYP 2A6 (1799T>A): Genetic polymorphism of cytochrome P450 2A6 gene; PCOS: Polycystic ovary syndrome; SD: Standard deviation. Follicle size and endometrial thickness were measured in millimeters (mm); Incidence of gestation is expressed as the number (percentage) of women who became pregnant; P -value indicates statistical significance level (Kruskal–Wallis test). Table 8 Effect of CYP2A6 (1799T>A) alleles on the efficacy of letrozole. Table 8 Variables PCOS women with infertility P – value Response (n: 61) Non-response (n: 33) Alleles of CYP 2A6 (1799T>A) AA 34 (66.7 %) 17 (33.3 %) 0,859 AT 1 (50 %) 1 (50 %) TT 26 (63.4 %) 15 (36.6 %) CYP2A6 (1799T>A): Genetic polymorphism of cytochrome P4502A6 gene; PCOS: Polycystic ovary syndrome. Response: Ovulation and/or pregnancy occurred; Non-response: No ovulation and no pregnancy; P -value indicates statistical significance level (chi-square test). Follicle size, endometrial thickness, and incidence of gestation in PCOS women with infertility who took letrozole and carried different genotypes of CYP2A6 (1799T>A). CYP 2A6 (1799T>A): Genetic polymorphism of cytochrome P450 2A6 gene; PCOS: Polycystic ovary syndrome; SD: Standard deviation. Follicle size and endometrial thickness were measured in millimeters (mm); Incidence of gestation is expressed as the number (percentage) of women who became pregnant; P -value indicates statistical significance level (Kruskal–Wallis test). Effect of CYP2A6 (1799T>A) alleles on the efficacy of letrozole. CYP2A6 (1799T>A): Genetic polymorphism of cytochrome P4502A6 gene; PCOS: Polycystic ovary syndrome. Response: Ovulation and/or pregnancy occurred; Non-response: No ovulation and no pregnancy; P -value indicates statistical significance level (chi-square test).

This study enrolled 94 Iraqi women of reproductive age (18–35 years) with PCOS-induced infertility, diagnosed using Rotterdam criteria. 8 All participants met ≥2 Rotterdam criteria, which included: (1) oligo-/anovulation (cycle length >35 days or progesterone 0.8 ng/mL); and (3) polycystic ovaries on ultrasound (≥20 follicles/ovary or volume >10 mL). A sample size of 94 was determined based on power analysis (80 % power, α = 0.05) to detect a 20 % difference in letrozole response rates between genotypes. Women aged 18–35 years with PCOS (Rotterdam criteria), infertility, or no concurrent chronic diseases were included. Women with tubal obstruction, thyroid disorders, diabetes mellitus, or pregnancy during treatment were excluded from this study. Exclusion of thyroid dysfunction (thyroid-stimulating hormone 0.4–4.0 mIU/L), hyperprolactinemia (<25 ng/mL), and non-classic congenital adrenal hyperplasia (17-OHP <2 ng/mL) was confirmed. Written informed consent was provided by all participating women after clarification of the study's objective, and they were asked to fill out a specially illustrated questionnaire. Letrozole tablets (Femara®; NOVARTIS®, Basel, Switzerland) 2.5 mg was purchased from a commercial pharmacy. Kits for measuring FSH, LH, estradiol (E2), PRL, and T were obtained from Tosoh Co. (Tokyo, Japan), and an anti-Müllerian hormone (AMH) kit was obtained from AFIAS Co. (Korea). Other materials used in the genetic analysis included the FavorPrep™ Blood Genomic DNA Extraction Kit (Favorgen Biotech Co., Taiwan), Master Mix (Promega, Madison, WI, USA), DNA 100 bp ladder marker (Bioneer Co., Taejon-jikhalsi, Korea), and primers (Macrogen Inc., Seoul, Korea). A prospective, single-center, randomized, controlled pragmatic clinical trial was conducted from September 2023 to February 2024 at the Taiba Center for Infertility and In-Vitro Fertilization (Babylon City, Iraq) after approval was obtained by a scientific and ethical committee from the College of Pharmacy at Kerbala University (Karbala, Iraq). Ninety-four women with PCOS-induced infertility, aged 18–35 years, were recruited on the second day of their menstrual cycle, which preceded the start of the treatment. Cycle day 12 of at least two consecutive cycles following medication delivery was used for follow-up evaluations. The clinical, medical, and demographic information of all participants were documented. Ultrasound tests conducted by two different specialist sonographers on the second day of the menstrual cycle revealed information regarding endometrial thickness and follicle size. Hormonal tests for E2, FSH, LH, PRL, and T were also conducted. Only the second day of the cycle was used for the AMH tests. Hormonal testing and ultrasound scans were performed on the 12th day of the cycle and 2 months after letrozole administration. Ovulation was used to determine the response of infertile women to letrozole and was assessed using an ultrasound scan. Thus, infertile women were classified into a “response” category if one or two follicles achieved a size exceeding 18 mm and/or gestation occurred; and a “non-response” category if one or two follicles remained smaller than 18 mm and/or gestation did not occur. 21 The sample size was calculated a priori using the PS Power software. With a CYP2A62 allele frequency of 0.22 in pilot Iraqi data, α = 0.05, power = 80 %, and expected ovulation rate difference of 25 % between genotypes, 90 participants were required. The final sample size (n = 94) exceeded the target. Post-hoc power analysis confirmed an 82 % power to detect the observed 18 % ovulation rate difference (AA vs. TT genotypes) at P < 0.05. Body mass index (BMI) was used to categorize the patients based on their weight in relation to their height. The formulating for calculating the BMI is the ratio of body weight in kilograms (kg) to the square of body height in meters (m). Venous blood (6 mL) was collected from each participant: 2 mL was placed in EDTA tubes for DNA extraction and the remaining 4 mL was centrifuged (3000 rpm, 10 min) to create the serum that was used for subsequent hormone assays to measure the plasma levels of PRL, FSH, LH, AMH, T, and E2. Plasma levels of sex hormones (FSH, LH, PRL, T, E2, and AMH) were measured. FSH, LH, PRL, and T levels were quantified using an enzyme immunoassay. E2 levels were quantified using a competitive enzyme. A fluorescence immunoassay was used to quantify AMH levels. DNA extraction was conducted at the Al-Amin Center for Advanced Biotechnology and Research (Najaf city, Iraq). DNA genome was extracted using the FavorPrep™ DNA Extraction Kit (Favorgen) DNA was stored at −20 °C after being isolated, according to the manufacturer's instructions, from 200 μL peripheral whole blood. The allele-specific polymerase chain reaction was used to amplify CYP2A6 (CYP2A6 ∗2) (1799T>A), and the primers were designed based on https://www.ncbi.nlm.nih.gov/ webpages as shown in Table 1 . The final thermal cycle, after a number of adjustments, was 3 min at 95 °C (initial denaturation). This was followed by 35 PCR cycles, each lasting 30 s at 95 °C (denaturation), 30 s at 58 °C (annealing temperature), 30 s at 72 °C, and finally, 10 min at 72 °C. A PCR Master Mix was optimized for use in routine PCR reactions to amplify DNA templates. PCR was optimized through multiple trials with varying template DNA and primer volumes. The PCR tubes were centrifuged for 30 s at 2000× g , and a thermocycler was used to initiate the process. Agarose gel electrophoresis was used to run the PCR products at 80 V for 1 h 1X Tris Borate EDTA (TBE) buffer was prepared by diluting 10X TBE buffer with distilled water. The gel electrophoresis protocol involved adding 1.5 g agarose powder, microwaving until boiling, and adding 5 μL ethidium bromide. The solution was agitated and allowed to cool to room temperature. DNA samples were mixed with a loading dye containing bromophenol blue, and then loaded into wells of the gel. The ethidium bromide-recolored groups were observed using a UV transilluminator. The CYP2A6∗2 genotype was evaluated according to the size of the DNA fragments. Table 1 Primer Sequences and Characteristics for Genotyping the CYP2A6∗2 (1799T>A, rs1801272) Genetic Polymorphism by Allele-Specific PCR. Table 1 Primer Sequence (5'->3′) Template strand Length Start Stop Tm GC% Forward primer CGGTCCCCAAAGACAATGGA Plus 20 277 296 59.96 55.00 Allele A CTTCCTCATCGACGCCCT Minus 18 618 601 58.79 61.11 Allele T CTTCCTCATCGACGCCCA Product length 342 AS-PCR: Allele-specific polymerase chain reaction; bp: Base pairs; CYP2A6∗2: Genetic variant of the CYP2A6 gene (1799T>A); GC%: Percentage of guanine-cytosine bases in the primer sequence; rs1801272: Reference SNP identifier for the genetic polymorphism; Tm: Melting temperature. Primer Sequences and Characteristics for Genotyping the CYP2A6∗2 (1799T>A, rs1801272) Genetic Polymorphism by Allele-Specific PCR. AS-PCR: Allele-specific polymerase chain reaction; bp: Base pairs; CYP2A6∗2: Genetic variant of the CYP2A6 gene (1799T>A); GC%: Percentage of guanine-cytosine bases in the primer sequence; rs1801272: Reference SNP identifier for the genetic polymorphism; Tm: Melting temperature. Statistical data analyses were performed using SPSS version 26 (IBM Corp., Armonk, NY, USA) and R version 4.2.0, released as an R Foundation product. The Shapiro–Wilk test was used to evaluate normality for continuous variables, and the results are presented as the mean ± standard deviation for normal distributions or median (interquartile range) for data that deviate from a normal distribution. The data for categorical variables are presented as frequencies in combination with percentage values. Independent Student's t -tests were used to analyze between-group contrasts for age and BMI because these variables displayed a normal distribution, whereas paired t -tests examined within-group relationships. Hormone levels and follicle size variables were examined using the Mann–Whitney U test for between-group comparisons and the Wilcoxon signed-rank test for within-group comparisons because of their non-normal distribution. Categorical variable assessments were performed using chi-square tests with Yates' continuity correction when analyzing 2 × 2 contingency tables, but when the expected cell frequencies fell below five, the Fisher's exact test was employed. Analysis of genotype–phenotype associations involved using one-way analysis of variance (ANOVA) with Tukey's post-hoc test for normally distributed data applied alongside the Kruskal–Wallis test with Dunn's post-hoc correction for non-normally distributed data. The effect sizes were determined using Cohen's d for t -tests, whereas the phi coefficient measured the chi-square test strength and eta-squared was used to analyze the ANOVA results. The analysis of binary outcomes regarding ovulation response required adjustment using multivariable logistic regression methods that incorporated age, BMI, and AMH as confounding variables. The family-wise error rate at alpha = 0.05 received Bonferroni correction during our analysis of multiple comparisons. Two-tailed P < 0.05 was considered statistically significant.

CYP2A62 (1799T>A) did not significantly affect letrozole efficacy in Iraqi women with PCOS. Future studies should explore other genetic and metabolic pathways to elucidate letrozole resistance, focusing on: (1) pooling multi-ethnic data to assess heterozygous (AT) effects, (2) measuring letrozole plasma concentrations, and (3) exploring the combinatorial effects of CYP2A6/CYP3A4 variants.

Our study revealed that CYP2A62 (1799T>A) did not significantly alter letrozole efficacy in Iraqi women with PCOS, in contrast to previous breast cancer studies. 20 This discrepancy may stem from the following: (1) lower drug concentration requirements for ovarian aromatase inhibition versus tumor suppression, (2) Compensatory CYP3A4 metabolism in PCOS, and (3) dominant endocrine effects of hyperinsulinemia on folliculogenesis. In this study, letrozole significantly elevated the plasma levels of LH and E2 and reduced the plasma levels of PRL and T in infertile women with PCOS; thus, approximately nine women were pregnant. These results are consistent with those of other studies, which reported that plasma levels of E2 and LH increased on the day of ovulation, and the chance of fertilization increased. 22 , 23 Letrozole effectively stimulated the ovarian follicle to become reliable for fertilization and prepared endometrial tissue of women with infertility during gestation. In clinical trials, letrozole increased the probability of increasing the ovulation rate and live birth. 24 Plasma E2 and follicle size were considerably increased in women with letrozole-responsive infertility compared to those who were non-responsive to letrozole. The short-acting period of letrozole may be responsible for delayed ovulation and elevated serum E2 levels, which may lead to endometrial development and enhance the likelihood of obtaining pregnant. 25 In this study, the CYP2A6∗2 gene 1799A>T (rs1801272) genetic variation was detected in approximately 46 infertile women. CYP450 plays a critical role in the hepatic elimination of exogenous substances, including letrozole, which may change its pharmacokinetics and pharmacodynamics. Variants, such as CYP2A6∗2, are associated with reduced metabolic activity, resulting in higher plasma concentrations of letrozole. Other studies have reported that CYP2A6 genetic variation may account for approximately 28 % of the variability in letrozole levels. 26 This study found that the plasma level of FSH was significantly decreased and the plasma levels of AMH and endometrial thickness were significantly elevated in infertile women who did not respond to letrozole and carried the mutant TT genotype compared to women with infertility who did not respond to letrozole and carried the wild-type AA genotype. However, there was no notable difference between infertile women treated with letrozole who carried either the wild-type AA genotype or mutant TT genotype. The probability of ovulation and response to letrozole is reduced by elevated serum AMH levels in women. 27 Guo et al. showed that the elevated LH/FSH ratio, plasma AMH level, free androgenic index, and delayed menarche in women with infertility PCOS may be some of the most common reasons for increased letrozole doses to obtain a response. 28 In general, the CYP2A6∗2 gene 1799A>T (rs1801272) genetic variation was not significantly associated with the letrozole response in Iraqi women with infertility. Controversially, the CYP2A6 variant significantly influences the metabolism of letrozole, a critical drug for the treatment of hormone-receptor-positive breast cancer. This finding aligns with the study by Desta et al., who demonstrated that variations in drug-metabolizing enzymes can lead to differing responses to fertility medications, emphasizing the importance of pharmacogenomics in personalized treatment. 29 Our study demonstrated that the CYP2A6∗2 (1799T>A) polymorphism was not significantly associated with letrozole efficacy in Iraqi women with PCOS-induced infertility. Previous studies in patients with breast cancer have suggested that CYP2A6 variants influence letrozole metabolism. 19 , 20 Our results indicate that this specific variant does not predict therapeutic response in PCOS. Notably, letrozole significantly improved ovulation rates, follicle size, and endometrial thickness, which is consistent with its established role in reducing estrogen feedback and stimulating gonadotropin release (Amer et al., 2017; Yang et al., 2021). The high prevalence of the wild-type (AA) genotype (54.26 %) and mutant (TT) genotype (43.61 %) in our cohort suggests that CYP2A6∗2 is common, but not clinically determinative of the response to letrozole. The lack of an association between genotypes and hormonal/ultrasound outcomes ( Table 5 , Table 6 ) indicates that other pharmacogenetic or metabolic pathways (e.g., CYP3A4 and AMH levels) may play a more critical role in letrozole resistance (Vagios et al., 2021; Guo et al., 2023). This study establishes valuable insights using a well-planned methodological framework, which consists of a prospective research design and standardized ultrasound examination of follicles along with specific hormonal measurement methods. Our study based its CYP2A62 variant detection on allele-specific PCR methods to ensure accuracy, together with the substantial sample population of 94 Iraqi patients with PCOS, which increases the reliability of our results. Numerous limitations should be acknowledged regarding these findings. Very limited statistical evaluations were feasible for heterozygous (AT) carriers (n = 2) because of their extremely small sample size, which prevented the detection of minor allele effects. Our ability to determine baseline CYP2A62 allele frequencies and evaluate genotype-specific metabolic differences in the general population or fertile women and patients with PCOS without letrozole limitation arises from the lack of appropriate controls (women without PCOS), which was omitted to focus on genotype–phenotype correlations within PCOS patients; future studies should include controls to validate the findings. Two treatment cycles during the study period might not have spanned enough time to observe all pregnancy results, and measurements of letrozole plasma concentrations could have strengthened the genotype-to-drug kinetic relationships. Future studies should include controls to validate our findings. Our research findings have crucial clinical implications for managing PCOS-related infertility, although no meaningful relationship was detected between CYP2A6∗2 and the treatment results. Genotyping this particular variant should not become standard practice before starting letrozole treatment in Iraqi women since it shows no major impact on treatment outcomes. When letrozole standard doses fail to generate sufficient results in patients, healthcare practitioners should evaluate two alternative interventions: increasing the medication dose and substituting treatment with clomiphene citrate. Careful consideration should be given when other genetic elements or high AMH concentrations hinder therapeutic outcomes. All genotype groups showed marked improvements in ovulation parameters, thus demonstrating letrozole status as primary therapy; however, non-responders require individualized follow-up examinations based on multiple clinical and biochemical measures beyond CYP2A6 assessment. For clinicians, these findings suggest that (1) routine CYP2A6 genotyping may not predict letrozole response in PCOS, (2) non-responders should be evaluated for AMH levels (>7 ng/mL) and tubal factors, and (3) empirical dose escalation or switching to clomiphene citrate remains appropriate for resistant cases. Future studies are needed to analyze multiple genetic markers in combination with their connection to letrozole drug processing to enhance the forecasting of personalized therapeutic results.

Infertility is defined as the inability to conceive after 365 days or more of regular, unprotected sexual intercourse. 1 Polycystic ovarian syndrome (PCOS) is a complicated disease involving endocrine reproductive and metabolic disorders resulting in human anovulation. According to various diagnostic criteria, the morbidity rate of PCOS in women ranges between 6 % and 20 %. 2 In Iraq, PCOS affects approximately 18 % (17.8 ± 2.8 %) of women of reproductive age, consistent with global estimates; the prevalence ranges from 11 % to 26 % in women aged 20–40 years. 3 Infertility is categorized as primary or secondary based on whether a woman has previously been pregnant. 4 It is a common problem in most countries worldwide, affecting approximately 11–26 % of married Iraqi women aged 20–40 years. 5 The factors affecting female infertility include premature ovarian failure, endometriosis, PCOS, uterine fibroids, and endometrial polyps 6 , 7 . . Many women of reproductive age are affected by an endocrine-gynecological condition known as PCOS. PCOS is often associated with enlarged and dysfunctional ovaries, excessive androgen levels, and insulin resistance. It has a worldwide prevalence of 4–20 % in females of reproductive age. 7 This syndrome is diagnosed based on the Rotterdam criterion, which requires the presence of at least two of three characteristics: (a) oligo- or anovulation, (b) hyperandrogenism, and (c) polycystic ovaries. 8 Follicle-stimulating hormone (FSH) and luteinizing hormone (LH) work together to regulate the growth of follicles and ovulation via complex coordination by the hypothalamus–pituitary–gonadal axis. 9 In PCOS, disrupted gonadotropin secretion leads to elevated LH/FSH ratios, exacerbating hyperandrogenism and anovulation 2 , 10 Many hormones such as FSH, LH, and prolactin (PRL) play crucial roles in regulating normal follicle development and ovarian function. Disruptions in these hormones, such as increased or decreased release or interference with their actions on receptors, may lead to irregular menstrual cycles, low fertility, and ovulation-related issues. 11 Letrozole is a highly effective third-generation drug that has been used to treat infertility by blocking the final step in the estrogen biosynthesis pathway, reducing estrogen levels. 12 In patients with PCOS who do not respond to clomiphene citrate (CC), letrozole appears to be a very effective ovulation inducer with fewer side effects and a lower cost than injectable gonadotropins, as well as comparable ovulation and conception rates. 13 Letrozole has good oral bioavailability, a large distribution volume, approximately 60 % binding to plasma proteins, and is extensively distributed throughout the body. Its terminal elimination half-life is approximately 42 h. 14 The main routes of letrozole clearance are hepatic metabolism involving the cytochrome P450 (CYP450) isoenzymes, CYP3A4 and CYP2A6. The inactive metabolite of letrozole is frequently produced by CYP2A6, which has a high affinity for letrozole and is saturated at therapeutic doses. 15 CYP2A6 is a phase I drug-metabolizing enzyme that metabolizes approximately 3 % of medicines, including letrozole; thus, the efficacy and toxicity profile of its substrate is affected by CYP2A6 genetic variation. 16 The 1799 T>A single-nucleotide polymorphism (SNP) (rs1801272) was selected because of its known effect on CYP2A6 enzyme activity, potentially influencing letrozole metabolism and efficacy in women with PCOS. 17 , 18 CYP2A6, a key enzyme in letrozole metabolism, exhibits genetic polymorphisms that may alter drug clearance. 17 Although CYP2A6 variants are well studied in pharmacokinetics, their role in the context of the PCOS-specific letrozole response remains unclear. This study provides three key innovations. (1) It is the first investigation of CYP2A62 (1799T>A) in letrozole-treated Iraqi patients with PCOS, addressing a critical gap in Middle Eastern pharmacogenomics. (2) It simultaneously evaluates hormonal, ultrasonographic, and pregnancy outcomes, a multidimensional approach lacking in prior studies. (3) It demonstrates that the metabolic effects of CYP2A6 may be context-dependent, showing divergence from breast cancer models where this variant significantly affects letrozole clearance. 19 While metabolic comorbidities (e.g., insulin resistance) influence PCOS pathophysiology, CYP2A6 is prioritized because: (1) it mediates >85 % of letrozole's primary metabolism at therapeutic doses 17 ; (2) the 1799T>A variant causes clinically relevant enzyme deficiency; and (3) preliminary data have shown that the minor allele frequency of this SNP exceeds 20 % in Arab populations, which is higher than that of other CYP2A6 variants. This focused approach enables clear interpretation of the pharmacogenetic effects without confounding by polygenic metabolic interactions. This study investigated the effect of a genetic polymorphism in CYP2A6 (CYP2A6∗2) (1799T > A) on the therapeutic response to letrozole in Iraqi women with infertility.

The authors have no conflict of interest to declare.