Modulating Pseudomonas aeruginosa virulence by the anti-cholesterol drugs Atorvastatin and Rosuvastatin | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Modulating Pseudomonas aeruginosa virulence by the anti-cholesterol drugs Atorvastatin and Rosuvastatin Shaimaa I. Nazeih, Amira M. El-Ganiny, Ahmed G. Eissa, Samar S. Elbaramawi, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4031656/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Study of the Pseudomonas aeruginosa resistance has become an urgent topic since antibiotic resistance has escalated exceedingly. Even with the intense interest, development of new antibiotics and other therapeutic strategies for P. aeruginosa infections is at a painstakingly slow pace due to the complexity of drug resistance, as well as the lack of a deep understanding of the pathogenic mechanisms for P. aeruginosa . Repurposing of the already FDA-approved drugs is one of the promising strategies in combating Pseudomonas resistance or virulence. Results In this study we tested the anti-virulence effect of sub-minimum inhibitory concentration (MIC) of atorvastatin and rosuvastatin against P. aeruginosa. The assessed virulence factors include: biofilm formation and production of pyocyanin, protease, hemolysin and rhamnolipids. Significantly, atorvastatin and rosuvastatin decreased the production of bacterial biofilm and reduced other virulence factors. Moreover, the anti-quorum sensing (QS) activity of atorvastatin and rosuvastatin was assessed using qRT-PCR. the expression of QS genes was reduced using atorvastatin and rosuvastatin. Furthermore, in-vivo capability of statins to protect mice against P. aeruginosa was assessed, both drugs protected mice from P. aeruginosa and enhanced their survival. In addition, molecular docking was used to evaluate binding between statin and QS-receptors, rosuvastatin showed better interaction with QS-receptors than atorvastatin, as rosuvastatin has higher binding scores with LasR, RhlR, and LasB, while atorvastatin showed higher binding with the PqsR. Conclusion statins attenuated the pathogenicity of P. aeruginosa , locating it as a plausible potential therapeutic agent for the treatment of its infections. Pseudomonas aeruginosa Atorvastatin Rosuvastatin virulence inhibition qRT-PCR Molecular docking Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Pseudomonas aeruginosa is an opportunistic multi-drug resistant (MDR) pathogen, causing acute and chronic infection in immunocompromised patients. P. aeruginosa is one of the most common bacterial pathogens associated with chronic obstructive pulmonary disease (COPD), cystic fibrosis, traumas, burns, sepsis, and ventilator-associated pneumonia (VAP) including those caused by COVID-19 [ 1 – 3 ]. In addition, P. aeruginosa is one of the ESKAPE pathogens, which are a group of MDR pathogens associated with hospital-acquired infections worldwide [ 4 ]. ESCAPE pathogens are common causes of life-threatening infections among critically ill patients [ 4 , 5 ]. Nearly 700,000 people died due to antibiotic resistant-infections each year. For example, P. aeruginosa strains that were isolated from European populations have a combined resistance of 12.9% [ 6 ]. Furthermore, ESCAPE pathogens have extraordinary drug resistance. Some types of P. aeruginosa strains are Extensively drug-resistant (XDR), these strains exhibit resistance to nearly all antibiotics, including the last resort antibiotics such as carbapenems [ 7 , 8 ]. The world health organization (WHO) listed carbapenem-resistance P. aeruginosa strains among the “critical” pathogens, which urgently need novel antibiotics or strategies for treatment [ 9 ]. P. aeruginosa is known to present multiple drug tolerance which attributed to intrinsic, acquired, or adaptive mechanisms. Clinical use of conventional antimicrobials for management of P. aeruginosa infections is challenging, causing a serious global concern [ 10 ]. The severity and therapy failure in P. aeruginosa infections can be attributed to many factors including immune evasion (mediated by elastase, rhamnolipids and alkaline protease), antibiotic resistance (attributed to overexpression of efflux pump and modifying enzymes), cytotoxicity (e.g. exotoxin A and pyocyanin), iron scavenging (proteases and siderophores), and finally biofilm structure and dynamics [ 11 , 12 ]. It is well known that P. aeruginosa virulence factors expression and biofilm formation is controlled by quorum sensing (QS) systems. P. aeruginosa has at least three interconnected QS systems (Las, Rhl, and Pqs). Las system is on the top of this circuit, as it controls the expression of the other QS-systems [ 2 ]. Due to the notable increase in antimicrobial resistance rates, ongoing research is focusing on exploring new approaches and therapies beyond conventional antibiotics. These approaches include: using bacteriophages, monoclonal antibodies, antimicrobial peptides [ 13 , 14 ]. In addition to the use of antibiotic adjuvants to restore antibiotic activity such as efflux pump inhibitors and enzyme inhibitors [ 15 , 16 ]. The anti-virulence approach is another interesting approach that aims to reduce virulence and facilities pathogen elimination by the immune system. In addition, this approach imposes low selective pressure on P. aeruginosa , thus less likely to induce resistance development. Investigating the anti-virulence potential of the drugs that already approved by US food and drug administration (FDA); for treatment of other conditions; is one of the promising policies to face the antimicrobial resistance crisis [ 17 ]. The remodeling of these drugs would significantly reduce the lead time from bench to bedside. Statin drugs discovery was one of the clinical breakthroughs in the 20th century. A total of nine statins have been identified, seven of which were approved by FDA to treat high cholesterol, in about 40 million patients worldwide [ 18 ]. Furthermore, statins were found to have a number of cholesterol-independent effects [ 19 ]. Anti-inflammatory, immunomodulatory, and anticancer effects of statins are well recognized [ 20 ]. In addition, several studies have explored the pleiotropic effects of statins in combating microbial infections including sepsis and pneumonia [ 21 , 22 ]. Statins are strong potential candidates to be repurposed as novel antimicrobial agents. However, the evidence for this remains debated due to the presence of apparently inconsistent studies [ 23 , 24 ]. The current study aims to assess and illustrate the potential effects of atorvastatin and rosuvastatin on the growth, virulence and QS system of P. aeruginosa using in vitro, in vivo and in silico strategies. 2. Material and Methods 2.1. Bacteria, Media, and Growth Conditions P. aeruginosa PAO1 standard strain was obtained from culture collection of the Microbiology and Immunology Department, Faculty of Pharmacy, Zagazig University, Egypt. The culture media were obtained from Oxoid (Hampshire, UK). All of used chemicals were obtained from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise stated. PAOI overnight cultures were prepared in Luria–Bertani (LB) broth and adjusted to optical density equal to 0.5 McFarland Standard with about 1 × 10 8 CFU/mL (OD 600 of 0.4), prior to being used in each experiment. 2.2. Determination of Minimum Inhibitory Concentration and detection of the effect of subMIC of atorvastatin and rosuvastatin on bacterial growth and viability The broth micro-dilution method [ 25 ] was used to determine the minimum inhibitory concentration (MIC) of both atorvastatin and rosuvastatin. drug solution was two-fold serially diluted using Mueller–Hinton broth (MHB). The wells of 96-well microtiter plate were filled with 100 µL aliquots of the serially diluted drugs. PAO1 strain was grown overnight in MHB at 37°C incubator. The resulting culture was diluted with sterile saline to turbidity of 0.5 McFarland and then diluted 1:100 using MHB to have cell density of about 1 × 10 6 CFU/mL. Aliquots of 100 µL were added to all drug dilutions and the plate was incubated for 20 h at 37°C. The MIC was calculated by observing the least concentration of tested drugs that inhibited the visible turbidity. In order to ensure the antivirulence effect of tested drugs is not due to the inhibition of bacterial growth, the effect of atorvastatin and rosuvastatin at tested concentrations on P. aeruginosa growth was assessed according to Nacla et al [ 26 ]. Briefly, fresh P. aeruginosa cultures were inoculated overnight in LB broth provided with 1/8 MIC of tested drugs at 37°C for 24 h. The turbidites of P. aeruginosa cultures were measured at 600 nm using Biotek Spectrofuorometer (Biotek, USA), and viable bacterial cells were counted. Sub-inhibitory concentration of atorvastatin and rosuvastatin was used to investigate its anti-virulence and anti-quorum sensing activities against P. aeruginosa . DMSO was used as a solvent control and all the subsequent experiments were performed in triplicate, and the average and standard deviation were calculated. 2.3. Biofilm inhibition assay The inhibition of P. aeruginosa biofilm formation by tested agents was assessed by the crystal violet method of Stepanovic et al. [ 27 ]. One hundred microliter aliquots of P. aeruginosa suspension of an approximate cell inoculum of 1 ×10 6 CFU/mL were transferred to microtiter plate wells in the presence or absence of 1/8 MIC of tested drugs. The nonadherent cells were washed out after 24 h incubation at 37°C, and the biofilm-forming cells were fixed with methanol and stained with crystal violet (1%) for 20 min. The excess dye was washed out, plates were air-dried, adhered dye was extracted with 33% glacial acetic acid, and absorbances were measured at 590 nm using the Biotek Spectrofluorometer. 2.4. Pyocyanin Assay The virulent P. aeruginosa pyocyanin pigment was assayed in the presence or absence of 1/8 MIC of atorvastatin and rosuvastatin-treated PAO1, according to the method of Das and Manefeld [ 28 ]. Ten microliter aliquots of P. aeruginosa overnight cultures (adjusted to OD600 of 0.4) were mixed with 1 mL of LB broth provided with 1/8 MIC of atorvastatin and rosuvastatin-treated PAO1. After 48 h incubation at 37°C, the Eppendorf tubes were centrifuged at 10,000 rpm for 10 min, and the absorbances of pyocyanin pigment in the supernatants were measured at 691 nm by Biotek spectrofluorometer. 2.5. Protease Assay The effect of the tested statins on inhibition of protease by P. aeruginosa was carried out using the skimmed milk agar method. P. aeruginosa PAO1 overnight cultures in LB broth (either treated or untreated) were centrifuged at 10,000 rpm for 15 min and the protease activities were measured by adding the 100 µL aliquots of the supernatants to the wells made in skim milk agar plates (5%). The plates were incubated overnight at 37°C and the clear zones formed around the wells were measured as described previously [ 29 ] 2.6. Hemolysin Assay Hemolysin inhibitory activity of 1/8 MIC of tested drugs- was assayed in PAO1 strain using the method of Rossignol et al. [ 30 ]. Briefly, 0.5 mL of supernatants (prepared in previous step) were mixed with fresh 2% erythrocytes suspension in saline (0.8 mL) and incubated at 37°C for 2 h. The mixtures were centrifuged at 2500×g for 5 min at 4°C to separate the hemoglobin released from erythrocytes. Positive control (complete hemolysis) was prepared by erythrocytes suspension lysed by 0.1% SDS and negative control (no hemolysis) was prepared by incubation of erythrocytes in LB broth under the same conditions. The released hemoglobin was compared with the controls and the percentage hemolysis was calculated from this formula: % Hemolysis=[X-B/T-B] ×100, where X represent the treated or untreated samples, B represent the negative control and T represent the positive control. The hemolysis of atorvastatin and rosuvastatin-treated cultures was expressed as % compared to hemolysis of control untreated culture. 2.7. Rhamnolipids production The oil spreading technique was carried out as described previously [ 31 ]. Briefly, 20-mL distilled water was placed in 90-mm Petri dish followed by addition of 10-µL crude oil to the surface of water. Then, 10-µL PAO1 supernatant with and without sub-MIC of tested drugs was dropped onto the crude oil surface. The diameter of the clear zone on the oil surface was measured. 2.8. Mice survival assay The influence of sub MIC of tested statins drugs on PAO1 pathogenesis was assessed in vivo using the mice survival model [ 32 ]. The ethical standards of Medical Research Center, Zagazig standard, Zagazig, Egypt (where the experiment was conducted and the mice were provided from the animal house of faculty of pharmacy, Zagazig University) were followed in the animal study. An approximate cell density of 2.5 x 10 7 CFU/mL of P. aeruginosa PAO1 in phosphate-buffered saline (PBS) was prepared from overnight bacterial cultures in LB broth with and without ¼ MIC of tested drugs. Six random groups of three-weeks-old healthy female albino mice ( Mus musculus ) with approximately same weight were used, each group comprising 5 mice. In Group 1, mice were injected intra-peritoneal with 100 µL of atorvastatin-treated bacteria in sterile PBS, while group 2 was injected with 100 µL of rosuvastatin-treated bacteria in sterile PBS. A positive control group 3 was injected by 100 µL of untreated PAO1 only. Two negative control groups are included also; in group 4 mice are injected with 100 µL of sterile PBS and in group 5 mice were left un-inoculated. All groups were kept with normal feeding and aeration. The survival of mice in each group was recorded every day for 3 successive days. The results were calculated using GraphPad Prism 5 and plotted using Kaplan-Meier method. Method of euthanasia used was as acceptable by the most recent report of the AVMA (American Veterinary Medical Association) Guidelines on Euthanasia. The method used was Cervical dislocation (CD) under anesthesia or tranquilization by using intra peritoneal (IP) thiopental (100mg\Kg). After loss of physiological signs (breath and heartbeats), cervical dislocation will be performed after the primary euthanasia. 2.8. Effect of Atorvastatin and rosuvastatin on the expression of virulence-encoding genes The RNA was extracted from PAO1 cultures grown in the presence or absence of sub MIC of tested drugs using Gene JET RNA extraction kit (Thermo Scientific, Waltham, MA, USA). The extracted RNA was kept at − 80°C [ 33 ]. A cDNA reverse transcriptase kit (Applied Biosystem, Waltham, MA, USA) was employed to synthesize cDNA. A quantitative real-time PCR was conducted to quantify the expression of genes involved in the PAOI virulence using the SYBR Green I PCR Master Kit (Fermentas, Waltham, MA, USA) in a Step One instrument (Applied Biosystem, Waltham, MA, USA). A melting curve was performed according to the instructions of the manufacturer, and the relative expressions were calculated using the comparative threshold cycle (∆∆Ct) method [ 34 ]. The sequences of the used primers are listed in Table 1 . The expression levels were normalized to the housekeeping gene gyrA [ 35 ]. Table 1 Sequences of the primers used in the current study Gene name Primer sequence (5′→ 3′) gyrA F ◊ CGAGAAGCTGCTCTCCGAAT R ◊ TCCTCACGGATCACCTCCAT lasI F◊ CGCACATCTGGGAACTCA R◊ CGGCACGGATCATCATCT lasR F◊ CTGTGGATGCTCAAGGACTAC R◊ AACTGGTCTTGCCGATGG rhlR F ◊ GCCAGCGTCTTGTTCGG R ◊ CGGTCTGCCTGAGCCATC pqsR F ◊ CTGATCTGCCGGTAATTGG R◊ ATCGACGAGGAACTGAAGA 3.9. Molecular docking study P. aeruginosa crystal structures of LasR, RhlR, PqsR and LasB proteins [ 36 – 39 ] were retrieved from the Protein Data Bank ( https://www.rcsb.org/ ) on 22 June 2023 [ 40 ]. The receptor structures were prepared using the QuickPrep protocol on Molecular Operating Environment (MOE 2019.012) with Amber10: EHT forcefield [ 41 ]. Atorvastatin and rosuvastatin were obtained from PubChem database ( https://pubchem.ncbi.nlm.nih.gov/ accessed on 22 June 2023) as canonical SMILES. Each drug structure was prepared through energy minimization using the Computed Atlas for Surface Topography of Proteins (CASTp) software [ 42 ]. Docking was performed using Alpha triangle placement with Amber10: EHT forcefield. 3.10. Statistical analysis The influence of statins drugs on Ps. aeruginosa QS-controlled virulence factors production was analyzed using GraphPad Prism 5 software package with One Way ANOVA according to Dunnet's or Tukey's Multiple Comparison Tests < 0.05 or P < 0.001 for significance. Results were calculated as the means ± standard errors of three biological experiments with three technical replicates each. 3. Results 3.1. Statins Did not affect the bacterial cell growth and viability Atorvastatin and rosuvastatin could inhibit the growth of P. aeruginosa PAO1 at 2.5 mg/mL. the anti-quorum sensing (QS) and anti-virulence activities of the two drugs were assessed at 1/8 MIC (0.31 mg/mL). To exclude the possibility of growth inhibiting activity of tested drugs on QS and virulence, the optical densities of the bacterial suspensions at 600 nm were measured after overnight incubation in LB broth. Moreover, the inhibitory effect of drugs on cell viability was assessed by plating PAO1 cultures and counting CFUs after treatment with 1/8 MIC of tested drugs. Optical density and viable count were not significantly reduced in tested drugs-treated culture as compared to the control (Fig. 1 ). 3.2. Statins diminish Pseudomonas virulence factors. Atorvastatin and Rosuvastatin significantly diminished the biofilm formation with percentages exceeding 40% when compared with the untreated control. The data are presented as percentage change from the untreated control (Fig. 2 a). in additions statins significantly decreased the production of pyocyanin pigment by more than 40% in comparison to control (Fig. 2 b). On the other hand, atorvastatin and rosuvastatin significantly decreased the clear zones around wells loaded with cell-free supernatants containing extracellular protease, indicating a significant decrease in proteolytic activity ( p < 0.001). The decrease percentages in the protease production were about 33% (Fig. 2 c). The Hemolytic activity of both control PAO1 and atorvastatin and rosuvastatin-treated culture supernatants was quantitatively assessed and the released hemoglobin was measured at 540 nm. Hemolytic activity was reduced by 52% in case of Pseudomonas-treated cells as compared to the untreated control (Fig. 2 d). Finally, rhamnolipid production was highly inhibited in presence of sub-MIC of both atorvastatin and rosuvastatin as the spreading of oil on surface of water was significantly decreased (Fig. 2 e). 3.3. Atorvastatin and Rosuvastatin ameliorate the survival of infected mice In mice mortality test, the 5 mice injected with untreated PAO started to die after 24 h of injection, and 4 of them were dead after 72 h. The control mice groups which were injected with solvents and saline were 100% alive throughout the experiment period. Mice groups injected with PAO1 treated with sub-MIC of Atorvasatatin showed significant improvement in survival rates; 100% survival was recorded in the group injected with Rosuvastatin treated PAO1 (Fig. 3 ) 3.4. Atorvastatin and rosuvastatin at sub-MICs reduced QS-genes’ expression The influence of atorvastatin and rosuvastatin treatment on the expression of PAO1 QS-encoding genes was evaluated by quantitative real-time PCR. The expression levels of rhlR, rhlI, lasR, lasI, pqsA, and pqsR were significantly decreased after PAO1 treatment with sub-MICs of atorvastatin or rosuvastatin compared to the untreated control (Fig. 4 ). 3.5. Molecular docking analysis In order to investigate the anti QS potential of atorvastatin and rosuvastatin on P. aeruginosa , computational studies were performed for three main proteins namely LasR (PDB code: 2UV0/1.80 Å), RhlR (PDB code: 8DQ0/ 3.74 Å)[ 2 ], PqsR (PDB code: 4JVD/ 2.95 Å) in addition to LasB (PDB code: 3DBK/1.40 Å). The surface area and volume of the binding sites were estimated as; 234.547Å 2 /112.60Å 3 , 350.183Å 2 /167.88Å 3 , 423.995Å 2 /223.137Å 3 , 219.326 Å 2 /143.951 Å 3 respectively. using the CASTp program, it was observed that all proteins had a relatively large pocket ( Fig. 5 ) and by inspection of that binding pocket, it is obvious that they are all hydrophobic in nature. This would recommend a good chance of superior fitting for atorvastatin and rosuvastatin as they are both big in size. For LasR protein, although atorvastatin was able to form key interactions within the active site (H-bond with ser129 and pi interactions with trp88) along with other interactions, this was at the expense of energy. Rosuvastatin (S = -5.0544) significantly surpassed atorvastatin (S= -2.0071), with the aid of extra hydrogen bonding potential above the key interactions. This relatively good docking score is a reflection of the superior fitting in the hydrophobic pocket ( Fig. 6 ). Regarding RhlR, although both atorvastatin and rosuvastatin was able to perfectly fit in the hydrophobic binding site, as indicated in Fig. 6 , they showed differential docking scores (S = -1.3238 and − 5.7929 respectively) indicating a possibility for better binding of rosuvastatin than atorvastatin. For P. aeruginosa PqsR, both atorvastatin and rosuvastatin was able to orient themselves in a way to fill both pockets A and B forming the active site showing comparable docking scores (S = -7.4092 and − 6.9914 Kcal/mol, respectively). Both compounds show key binding interactions with leu208 and Tyr258 that anchor the compounds in place. Visual inspection of the binding poses would indicate that atorvastatin is protruding from the active site, while rosuvastatin is diving deep inside the two pockets ( Fig. 6 ). For a zinc dependent protein like LasB, ligand interaction with its zinc metal is crucial. Both atorvastatin and rosuvastatin were able to interact with the zinc metal resulting in excellent protein-ligand binding energy (S= -10.7728, -11.2626 respectively) as shown in Fig. 6 . Discussion P. aeruginosa strains have strong drug resistance through various natural and acquired mechanisms, including the production of antibiotic inactivating or modifying enzymes, inhibiting drug penetration, changing the target site of the drug or expelling the drug via efflux pumps. In addition, P. aeruginosa develop adaptive antibiotic resistance mechanisms including biofilm-mediated resistance and formation of persister cells with high drug tolerance [ 8 , 11 , 43 ]. Due to the increasing difficulty in treating infections caused by P. aeruginosa strains, research on P. aeruginosa resistance has been an urgent topic for decades. Even with this intense interest, development of new antibiotics for P. aeruginosa is slowly due to the complexity of Pseudomonas resistance. Designing more effective therapeutic approaches has been an increasing urgency. Targeting virulence factors or the machinery controlling them using FDA-approved drugs is a promising approach that withdraw the attention of several research groups in recent years [ 44 – 47 ]. Statins drugs represent a new hope for the treatment and the prevention of bacterial infections with recalcitrant features. Currently, still there is a controversy around the usefulness of statins in targeting bacterial virulence [ 48 ]. The current study aims to illustrate the potential effects of the FDA approved drugs atorvastatin and rosuvastatin as anti-virulence and anti-QS agents against P. aeruginosa. First, the MICs of atorvastatin and rosuvastatin were determined using broth micro-dilution method. The MIC in our study was 2.5 mg/mL for both drugs. A previous study reported that simvastatin’s MIC ranged from 15.65 to 31.25 µg/mL for Staphylococcus aureus strains [ 49 ]. It is worth mentioning that this study and a more recent study reported that statins including simvastatin had no effect against tested Gram negative strains of P. aeruginosa and E. coli [ 49 , 50 ]. Another study reported that the growth of the respiratory tract pathogens P. aeruginosa , Acinetobacter baumannii , and Klebsiella pneumoniae was inhibited by statins with MICs ranging from 15 to 333 mg/L [ 21 ]. The elevated MIC for Gram negative pathogens including P. aeruginosa is expected due to the presence of the outer membrane of Gram-negative that act as a strong permeability barrier [ 16 , 51 ]. After this, the anti-virulence activity of atorvastatin and rosuvastatin was assessed at sub-inhibitory concentration (1/8 MIC). Atorvastatin and rosuvastatin at 1/8 MIC did not have any significant inhibitory effect on bacterial viability. the tested virulence factors include biofilm formation, pyocyanin and rhamnolipids production, in addition to protease and hemolysin secretion. Biofilm formation is one of the important virulence factors that are associated with resistance and contribute to the severity and chronicity of infections [ 35 , 43 ]. In our study, Atorvastatin and rosuvastatin could significantly reduce biofilm formation in P. aeruginosa PAO1 with percentages exceeding 40% inhibition. Consistent with our results, a previous study reported that simvastatin in sub-MIC concentrations (1/2 MIC to 1/16 MIC) significantly reduced S . aureus biofilm formation [ 49 ]. In addition, Simvastatin was reported to inhibit Candida albicans Biofilm formation in vitro, but at high concentration that impaired growth [ 52 ]. Furthermore, Simvastatin showed inhibitory effect on biofilm formed by the oral bacterial pathogen Porphyromonas Gingivalis [ 53 ]. All of these results support our finding that tested statins are promising inhibitors of biofilm formation. Pyocyanin is a secondary metabolite that enables P. aeruginosa to penetrate the membranes of the host cell, in addition, pyocyanin has redox-active properties that can interfere with various cell functions resulting in host cell damage [ 54 ]. Considerably, atorvastatin and rosuvastatin lowered the pyocyanin pigment production by more than 40%. It is well known that P. aeruginosa regulates pyocyanin production via QS system, QS is controlled by small signaling molecules termed auto-inducers (AI). It is reported that QS homoserine lactone AI analogues act as inhibitors of pyocyanin production in P. aeruginosa [ 55 ]. Statins had a conserved lactone ring in its structure [ 21 ], which may explain the capability of atorvastatin and rosuvastatin in reducing pyocyanin production in our study. To the best of our knowledge, our study is the first to report the effect of statins on pyocyanin production in P. aeruginosa . Proteases are strongly related to the pathogenesis of P. aeruginosa . Proteases target antibodies responsible for protection of mucous membranes. Proteases can also damage the tight junction between host epithelial cells, resulting in invasion of host tissues [ 56 , 57 ]. This study showed that atorvastatin and rosuvastatin significantly down regulated protease activity. In a similar manner, Gajdács and Spengler reported that atorvastatin and simvastatin inhibited virulence factors like protease which are mediated by QS-dependent gene expression [ 58 ]. Hemolysin causes inflammation and damage to the host tissues and interferes with neutrophil activity [ 59 ]. In this study atorvastatin and rosuvastatin significantly diminished the activity of hemolysin. It has been reported that rosuvastatin in combination with levofloxacin has a significant reduction in β-hemolysin produced by S. aureus [ 60 ]. In addition, a previous study showed that simvastatin suppressed α-hemolysin produced by MRSA [ 61 ]. Furthermore, it was reported that simvastatin and pravastatin cause significant cellular resistance to the cytotoxicity effect of the pore-forming toxin “α-hemolysin” and the main virulence factor of Streptococcus pneumoniae [ 62 ]. It is proposed that pyrimidine ring in statin molecules may be the cause of their antimicrobial activity [ 63 ]. The rhamnolipids are associated with P. aeruginosa pathogenesis, they act as bio-surfactants leading to stimulation of bacterial motility, surface properties modification and biofilm formation [ 64 ]. Our study proved that atorvastatin and rosuvastatin significantly inhibited rhamnolipids production. Similarly, a previous study showed that rhamnolipids production was significantly reduced in P. aeruginosa cells treated with by secnidazole [ 35 ]. It is well known that the QS systems of P. aeruginosa orchestrate its pathogenesis [ 36 – 38 ]. In this study, we evaluated the influence of statins on the expression of QS encoding genes. Rosuvastatin markedly down-regulated tested QS-genes of P. aeruginosa . This was comparable to previous research showing that atorvastatin inhibited QS autoinducers’ production and reduced virulence gene expression in P. aeruginosa , leading to decreased bacterial virulence [ 22 , 65 , 66 ]. Another study demonstrated that simvastatin and lovastatin interfere with the QS system of the Gram positive pathogen, Bacillus subtilis [ 67 ]. In addition, it was found that simvastatin reduced the expression of QS-genes and decreased biofilm formation in Listeria monocytogenes . Moreover, a previous study showed that the genes of P. aeruginosa pqs QS system, were down-regulated upon farnesol exposure [ 68 ]. farnesol was reported as inhibitor of 3-hydroxy-3-methylglutaryl (HMG)-CoA reductase and statins are also known to inhibit HMG-CoA reductase [ 69 ]. The phenotypic and genotypic results of statins against virulence of P. aeruginosa were supported by evaluation of the capacity of the two drugs to protect mice from Pseudomonas pathogenesis. In accordance with in-vitro and in-silico results, Atorvastatin in sub-MIC protected 80% of mice from P. aeruginosa pathogenesis in-vivo. Our findings were in accordance with two studies have recently demonstrated the in vivo efficacy of high concentrations of statins, whereby topical applications of simvastatin significantly enhanced bacterial clearance and healing of S. aureus -contaminated wounds in mouse models [ 61 , 70 ]. Finally, the binding affinity of rosuvastatin and atorvastatin to QS receptors was evaluated in silico . Collectively, rosuvastatin is expected to be better than atorvastatin as it was able to strongly bind LasR, RhlR, and LasB, however atorvastatin only showed satisfactory binding with the PqsR. The docking results suggest a promising inhibitory activity of both target drugs against the QS proteins that regulate the P. aeruginosa virulence factor. This inhibitory effect may be attributed to the structural similarity between statins and the N-acyl-homoserine lactone AI, as statins had a conserved lactone ring in its structure [ 21 ]. To the best of our Knowledge, this is the first in silico study of the effect of statin on QS-genes of P. aeruginosa , Collectively, Atorvastatin and Rosuvastatin showed a marked mitigation in P. aeruginosa virulence, via efficient hindrance to QS systems as proved by in vitro , in vivo and in silico analysis. Statins may have a potential as a new class of compounds for developing anti-virulence agents to target bacterial QS-systems. Declarations Ethical approval The ethical standards for animal welfare was approved by Zagazig University Institutional Animal Care and Use Committee, (ZU-IACUC), and granted the Approval number: ZU-IACUC/3/F/ 442 /2023. All the procedures were performed in accordance with the relevant guidelines. Consent for publication: Not applicable. Competing interests: The authors declare no competing interests. Funding This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors. Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB). Author Contribution S.I.N did the in vivo and rt PCRA.G did in vitro assay of tested drugsA.G.E and SS made in silico studiesA.G wrote and edit the final version of manuscriptAll authors reviewed the manuscript Acknowledgements The authors would like to acknowledge Prof. Dr. Fathy Serry (Professor of Microbiology and Immunology, Faculty of Pharmacy, Zagazig University) for the manuscript proofreading. Data availability The datasets used /or analyzed in the current study are available from the corresponding author on reasonable request. References Rossi E, La Rosa R, Bartell JA, Marvig RL, Haagensen JA, Sommer LM, et al. Pseudomonas aeruginosa adaptation and evolution in patients with cystic fibrosis. Nat Rev Microbiol. 2021;19(5):331–42. https://doi.org/10.1038/s41579-020-00477-5 . Jurado-Martin I, Sainz-Mejias M, McClean S. Pseudomonas aeruginosa : an audacious pathogen with an adaptable arsenal of virulence factors. Int J Mol Sci. 2021;22:3128. 10.3390/ijms22063128 . Cendra MDM, Torrents E. Pseudomonas aeruginosa biofilms and their partners in crime. Biotechnol Adv. 2021;49:107734. Santajit S, Indrawattana N. Mechanisms of antimicrobial resistance in ESKAPE pathogens. BioMed Res. Int. 2016; 2016 , 2475067 https://doi.org/10.1155/2016/2475067 . De Oliveira DM, Forde BM, Kidd TJ, Harris PN, Schembri MA, Beatson SA, et al. Antimicrobial resistance in ESKAPE pathogens. Clin Microb Rev. 2020;33(10):1128. https://doi.org/10.1128/cmr.00181-19 . Botelho J, Grosso F, Peixe L. Antibiotic resistance in Pseudomonas aeruginosa -mechanisms, epidemiology and evolution. Drug Resist Updat. 2019;44:100640. McCracken MG, Adam HJ, Blondeau JM, Walkty AJ, Karlowsky JA, Hoban DJ, et al. Characterization of carbapenem-resistant and XDR Pseudomonas aeruginosa in Canada: results of the CANWARD 2007–16 study. J Antimicrob Chemother. 2019;74(Supplement4):iv32–8. Baiomy AA, Serry FE, Kadry AA, Yahya G, Doijad S, Mostafa A, et al. Genome analysis of Pseudomonas aeruginosa strains from chronically infected patients with high levels of persister formation. Pathogens. 2023;12(3):426. https://doi.org/10.3390/pathogens12030426 . Daikos GL, da Cunha CA, Rossolini GM, Stone GG, Baillon-Plot N, Tawadrous M, et al. Review of ceftazidime-avibactam for the treatment of infections caused by Pseudomonas aeruginosa . Antibiotics. 2021;10(9):1126. Breidenstein EB, de la Fuente-Nunez C, Hancock RE. Pseudomonas aeruginosa : All roads lead to resistance. Trends Microbiol. 2011;19:419–26. Abbas HA, El-Ganiny AM, Kamel HA. Phenotypic and genotypic detection of antibiotic resistance of Pseudomonas aeruginosa isolated from urinary tract infections. Afr Health Sci. 2018;18(1):11–21. Tam VH, Chang KT, Abdelraouf K, Brioso CG, Ameka M, McCaskey LA, et al. Prevalence, resistance mechanisms, and susceptibility of multidrug-resistant bloodstream isolates of Pseudomonas aeruginosa . Antimicrob Agents Chemother. 2010;54:1160–4. Hauser AR, Mecsas J, Moir DT. Beyond antibiotics: new therapeutic approaches for bacterial infections. Clin Infect Dis. 2016;63(1):89–95. 10.1093/cid/ciw200 . Abdelghafar A, El-Ganiny AM, Shaker G, Askoura M. Isolation of a bacteriophage targeting Pseudomonas aeruginosa and exhibits a promising in vivo efficacy. AMB Express. 2023;13(1):79. https://doi.org/10.1186/s13568-023-01582-3 . Abdel-Karim SAAM, El-Ganiny AMA, El-Sayed MA, Abbas HAA. Promising FDA-approved drugs with efflux pump inhibitory activities against clinical isolates of Staphylococcus aureus . PLoS ONE. 2022;17(7):e0272417. Abdel-Halim MS, Askoura M, Mansour B, Yahya G, El-Ganiny AM. vitro activity of celastrol in combination with thymol against carbapenem-resistant Klebsiella pneumoniae isolates. J Antibiot. 2022;75(12):679–90. Liao C, Huang X, Wang Q, Yao D, Lu W. Virulence factors of Pseudomonas aeruginosa and anti-virulence strategies to combat its drug resistance. Front Cell Infect Microbiol. 2022;12:926758. 10.3389/fcimb.2022.926758 . Pinal-Fernandez I, Casal-Dominguez M, Mammen AL. Statins: pros and cons. Med Clin (Barc). 2018;150(10):398–402. 10.1016/j.medcli.2017.11.030 . Istvan ES, Deisenhofer J. Structural mechanism for statin inhibition of HMG-CoA reductase. Science. 2001;292:1160–4. 10.1126/science.1059344 . Dulak J, Józkowicz A. Anti-angiogenic and anti-inflammatory effects of statins: relevance to anticancer therapy. Curr Cancer Drug Targets. 2005;5:579–94. 10.2174/156800905774932824 . Hennessy E, Adams C, Reen FJ, O'Gara F. Is there potential for repurposing statins as novel antimicrobials? Antimicrob Agents Chemother. 2016;60(9):5111–21. 10.1128/AAC.00192-16 . Hennessy E, Mooij M, Legendre C, Jerry Reen F, O’Callaghan J, Adams C, et al. Statins inhibit in vitro virulence phenotypes of Pseudomonas aeruginosa . J Antibiot. 2013;66:99–101. https://doi.org/10.1038/ja.2012.95 . Ko HH, Lareu RR, Dix BR, Hughes JD. Statins: antimicrobial resistance breakers or makers? Peer J. 2017;5:e3952. https://doi.org/10.7717/peerj.3952 . Rana R, Sharma R, Kumar A. Repurposing of existing statin drugs for treatment of microbial infections: how much promising? Infect Disord Drug Targets. 2019;19(3):224–37. https://doi.org/10.2174/1871526518666180806123230 . Clinical and Laboratory Standards Institute. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically; Approved standard, CLSI Document M07-A9, 2012; Vol. 32, No. 3. Wayne, PA, USA. Nalca Y, Jansch L, Bredenbruch F, Geffers R, Buer J, Haussler S. Quorum-sensing antagonistic activities of azithromycin in Pseudomonas aeruginosa PAO1: A global approach. Antimicrob Agents Chemother. 2006;50:1680–8. Stepanović S, Vuković D, Hola V, Bonaventura GD, Djukić S, Ćirković I, et al. Quantification of biofilm in microtiter plates: overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. APMIS. 2007;115(8):891–9. https://doi.org/10.1111/j.1600-0463.2007.apm_630.x . Das T, Manefeld M. Pyocyanin promotes extracellular DNA release in Pseudomonas aeruginosa . PLoS ONE. 2012;7:e46718. https://doi.org/10.1371/journal.pone.0046718 . Vijayaraghavan P, Vincent SGP. A simple method for the detection of protease activity on agar plate using bromocresolgreen dye. J Biochem Technol. 2013;4(3):628–30. Rossignol G, Merieau A, Guerillon J, Veron W, Lesouhaitier O, Feuilloley MG, et al. Involvement of a phospholipase C in the hemolytic activity of a clinical strain of Pseudomonas fluorescens . BMC microbiol. 2008;8(1):189. https://doi.org/10.1186/1471-2180-8-189 . Morikawa M, Hirataa Y, Imanaka T. A study on the structure-function relationship of lipopeptide bio-surfactants. Biochim Biophys Acta. 2000;1488(3):211–8. Kim HS, Lee SH, Byun Y, Park HD. 6-Gingerol reduces Pseudomonas aeruginosa biofilm formation and virulence via quorum sensing inhibition. Sci Rep. 2015;5:8656. Clifford RJ, Milillo M, Prestwood J, Quintero R, Zurawski DV, et al. Detection of bacterial 16S rRNA and identification of four clinically important bacteria by real-time PCR. PLoS ONE. 2012;7:e4855839. Livak KJ, 76- Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆ct method. Methods. 2001;25:402–8. Saleh MM, Abbas HA, Askoura MM. Repositioning secnidazole as a novel virulence factors attenuating agent in Pseudomonas aeruginosa . Microb Pathog. 2019;127:31–8. 10.1016/j.micpath.2018.11.042 . Bottomley MJ, Muraglia E, Bazzo R, Carfì A. Molecular insights into quorum sensing in the human pathogen Pseudomonas aeruginosa from the structure of the virulence regulator LasR bound to its autoinducer. J Biol Chem. 2007;282(18):13592–600. 10.1074/jbc.M700556200 . Feathers JR, Richael EK, Simanek KA, Fromme JC, Paczkowski JE. Structure of the RhlR-PqsE complex from Pseudomonas aeruginosa reveals mechanistic insights into quorum-sensing gene regulation. Structure. 2022;30(12):1626–e16364. 10.1016/j.str.2022.10.008 . langovan A, Fletcher M, Rampioni G, Pustelny C, Rumbaugh K, Heeb S, et al. Structural basis for native agonist and synthetic inhibitor recognition by the Pseudomonas aeruginosa quorum sensing regulator PqsR (MvfR). PLOS Pathog. 2013;9(7):e1003508. 10.1371/journal.ppat.1003508 . Velázquez-Libera JL, Murillo-López JA F, de la Torre A, Caballero J. Structural requirements of n-alpha-mercaptoacetyl dipeptide (namdp) inhibitors of Pseudomonas aeruginosa virulence factor LasB: 3D-QSAR, molecular docking, and interaction fingerprint studies. Int J Mol Sci. 2019;20(24):6133. https://doi.org/10.3390/ijms20246133 . Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, et al. The Protein Data Bank. Nucleic Acids Res. 2000;28:235–42. 10.1093/nar/28.1.235 . Molecular Operating Environment (MOE. 2019.0102) Chemical Computing Group Inc, Montreal Quebec Canada Http://Www.Chemcomp.Com.2019.0102. Tian W, Chen C, Lei X, Zhao J, Liang J. CASTp 3.0: Computed Atlas of Surface Topography of Proteins. Nucleic Acids Res. 2018;46:W363–7. 10.1093/nar/gky473 . Soares A, Alexandre K, Etienne M. Tolerance and persistence of Pseudomonas aeruginosa in biofilms exposed to antibiotics: Molecular mechanisms, antibiotic strategies and therapeutic perspectives. Front Microbiol. 2020;11:2057. https://doi.org/10.3389/fmicb.2020.02057 . Seleem NM, Abd El Latif HK, Shaldam MA, El-Ganiny AM. Drugs with new lease of life as quorum sensing inhibitors: for combating MDR Acinetobacter baumannii infections. Eur J Clin Microbiol Infect Dis. 2020;39(9):1687–702. https://doi.org/10.1007/s1009 6-020-03882 . Qin S, Xiao W, Zhou C, Pu Q, Deng X, Lan L, et al. Pseudomonas aeruginosa : pathogenesis, virulence factors, antibiotic resistance, interaction with host, technology advances and emerging therapeutics. Signal Transduct Target Ther. 2022;25(1):199. 10.1038/s41392-022-01056-1 . Chadha J, Khullar L, Gulati P, Chhibber S, Harjai K. Repurposing Albendazole as a potent inhibitor of Quorum sensing-regulated virulence in Pseudomonas aeruginosa : Novel prospects of a classical drug. Microb Pathog. 2024;186:106468. https://doi.org/10.1016/j.micpath.2023.106468 . Chadha J, Khullar L, Gulati P, Chhibber S, Harjai K. Anti-Virulence Prospects of Metformin against Pseudomonas aeruginosa : A New dimension to a multifaceted drug. Microb Pathog. 2023;183:106281. https://doi.org/10.1016/j.micpath.2023.106281 . Valencia DY, Habila M, McClelland DJ, Degarege A, Madhivanan P, Krupp K. Infection-associated biofilms and statins: protocol for systematic review. BMJ Open. 2021;2511(5):e046290. 10.1136/bmjopen-2020-046290 . Graziano TS, Cuzzullin MC, Franco GC, Schwartz-Filho HO, de Andrade ED, Groppo FC, et al. Statins and antimicrobial effects: Simvastatin as a potential drug against Staphylococcus aureus biofilm. PLoS ONE. 2015;10(5):e0128098. 10.1371/journal.pone.0128098 . Ko HHT, Lareu RR, Dix BR, Hughes JD. In vitro antibacterial effects of statins against bacterial pathogens causing skin infections. Eur J Clin Microbiol Infect Dis. 2018;37(6):1125–35. 10.1007/s10096-018-3227-5 . Zgurskaya HI, López CA, Gnanakaran S. Permeability barrier of Gram-negative cell envelopes and approaches to bypass It. ACS Infect Dis. 2015;1:512–22. 10.1021/acsinfecdis.5b00097 . Liu G, Vellucci VF, Kyc S, Hostetter MK. Simvastatin inhibits Candida albicans biofilm in vitro . Pediatr Res. 2009;66(6):600–4. 10.1203/PDR.0b013e3181bd5bf8 . Kamińska M, Aliko A, Hellvard A, Bielecka E, Binder V, Marczyk A, et al. Effects of statins on multispecies oral biofilm identify simvastatin as a drug candidate targeting Porphyromonas gingivalis . J Periodontol. 2019;90(6):637–46. 10.1002/JPER.18-0179 . Hall S, McDermott C, Anoopkumar-Dukie S, McFarland AJ, Forbes A, Perkins AV, et al. Cellular effects of pyocyanin, a secreted virulence factor of Pseudomonas aeruginosa . Toxins. 2016;8:236. Morkunas B, Galloway WR, Wright M, Ibbeson BM, Hodgkinson JT, O'Connell KM, et al. Inhibition of the production of the Pseudomonas aeruginosa virulence factor pyocyanin in wild-type cells by quorum sensing autoinducer-mimics. Org Biomol Chem. 2012;10(42):8452–64. https://doi.org/10.1039/C2OB26501J . Gellatly SL, Hancock RE. Pseudomonas aeruginosa : New insights into pathogenesis and host defenses. Pathog Dis. 2013;67:159–73. Heras B, Scanlon MJ, Martin JL. Targeting virulence not viability in the search for future antibacterials. Br J Clin Pharm. 2015;79:208–15. Gajdács M, Spengler G. The role of drug repurposing in the development of novel antimicrobial drugs: Non-antibiotic pharmacological agents as quorum sensing-inhibitors. Antibiotics. 2019;8(4):270. https://doi.org/10.3390/antibiotics8040270 . Chugani S, Greenberg EP. The influence of human respiratory epithelia on Pseudomonas aeruginosa gene expression. Microb. Pathog. 2007; 42 , 29–35. 10.1016/j.micpath.2006.10.004 . Abdelaziz AA, El-Barrawy MA, El‐Nagar RAM. Potent synergistic combination of rosuvastatin and levofloxacin against Staphylococcus aureus : in vitro and in vivo study. J Appl Microbiol. 2021;131(1):182–96. 10.1111/jam.14968 . Thangamani S, Mohammad H, Abushahba MF, Hamed MI, Sobreira TJ, Hedrick VE, et al. Exploring simvastatin, an antihyperlipidemic drug, as a potential topical antibacterial agent. Sci Rep. 2015;5:16407. 10.1038/srep16407 . Statt S, Ruan JW, Jhen-Wei, Hung LY, Chang CY, Huang CT, et al. Statins enhance cellular resistance against bacterial pore-forming toxins in airway epithelial Cells. Am J Respir Cell Mol Biol. 2015;53(5):689–702. 10.1165/rcmb.2014-0391OC . Alagić-Džambić L, Omerović S, Džambić M. Antimicrobial activity of rosuvastatin. IJPT. 2015;6(4):7587–92. Alhede M, Bjarnsholt T, Givskov M, Alhede M. Pseudomonas aeruginosa Biofilms: Mechanisms of Immune Evasion. Adv Appl Microbiol. 2014;86:1–40. https://doi.org/10.1016/B978-0-12-800262-9.00001-9 . Stoltz DA, Ozer EA, Ng CJ, Yu JM, Reddy ST, Lusis AJ, et al. Paraoxonase-2 deficiency enhances Pseudomonas aeruginosa quorum sensing in murine tracheal epithelia. Am J Physiol Lung Cell Mol Physiol. 2007;292:852–60. Ozer EA, Pezzulo A, Shih DM, Chun C, Furlong C, Lusis AJ, et al. Human and murine paraoxonase 1 are host modulators of Pseudomonas aeruginosa quorum-sensing. FEMS Microbiol Lett. 2005;253:29–37. Verma N, Srivastava S, Malik R, Goyal P, Pandey J. Inhibition and disintegration of Bacillus subtilis biofilm with small molecule inhibitors identified through virtual screening for targeting TasA (28–261) , the major protein component of ECM. J Biomol Struct Dyn. 2023;41:2431–47. Li WR, Zeng TH, Xie XB, Shi QS, Li CL. Inhibition of the pqsABCDE and pqsH in the pqs quorum sensing system and related virulence factors of the Pseudomonas aeruginosa PAO1 strain by farnesol. Int Biodeterior Biodegrad. 2020;151:104956. Kaneko M, Togashi N, Hamashima H, Hirohara M, Inoue Y. Effect of farnesol on mevalonate pathway of Staphylococcus aureus . J Antibiot. 2011;64:547–9. https://doi.org/10.1038/ja.2011.49 . Wang CC, Yang PW, Yang SF, Hsieh KP, Tseng SP, Lin YC. Topical simvastatin promotes healing of Staphylococcus aureus -contaminated cutaneous wounds. Int Wound J. 2016;13(6):1150–7. 10.1111/iwj.12431 . Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4031656","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":286322675,"identity":"c24a87f3-358f-4269-a7a4-44975fa61f12","order_by":0,"name":"Shaimaa I. Nazeih","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+UlEQVRIiWNgGAWjYDACCQaGA3BOYoMNWIQkLWnEaUEAxobDhLXIz25+eOhGjR2DOfvxhw8e7jif2D+7+eADhhqbaFxaDO4cMziccyyZwbInIdkg8cztxBl3jiUbMBxLy23ApUUiAaiFjZnB4EDCMYnEttuJDTdyzCSALsSpRX5G+ofDOf/qGQzOP2z/kdh2LnE+IS0MN3IMDue2HWYwuJHMxpDYdiBxAyEtBjdyCg7n9h0HMp4xAx2WbLzxRlqyQQIevwAdtvlzzrdqoMPSH3782WYnO+9G8sEHH2pscDsMCuphChzBjAQCylGAPSmKR8EoGAWjYGQAAGRtZZUCd4YrAAAAAElFTkSuQmCC","orcid":"","institution":"Zagazig University","correspondingAuthor":true,"prefix":"","firstName":"Shaimaa","middleName":"I.","lastName":"Nazeih","suffix":""},{"id":286322676,"identity":"75c0fb20-837c-48a1-8c70-97be38e94e64","order_by":1,"name":"Amira M. El-Ganiny","email":"","orcid":"","institution":"Zagazig University","correspondingAuthor":false,"prefix":"","firstName":"Amira","middleName":"M.","lastName":"El-Ganiny","suffix":""},{"id":286322677,"identity":"db6577d0-501f-487a-9ff1-eff2f4a906c1","order_by":2,"name":"Ahmed G. Eissa","email":"","orcid":"","institution":"Zagazig University","correspondingAuthor":false,"prefix":"","firstName":"Ahmed","middleName":"G.","lastName":"Eissa","suffix":""},{"id":286322678,"identity":"288926d3-e2e2-41d2-b8b5-3b18ee8e6845","order_by":3,"name":"Samar S. Elbaramawi","email":"","orcid":"","institution":"Zagazig University","correspondingAuthor":false,"prefix":"","firstName":"Samar","middleName":"S.","lastName":"Elbaramawi","suffix":""},{"id":286322679,"identity":"0d8a8693-f512-45b1-a7d7-0f10b39a6a61","order_by":4,"name":"Amany I. Gad","email":"","orcid":"","institution":"Egyptian Chinese University","correspondingAuthor":false,"prefix":"","firstName":"Amany","middleName":"I.","lastName":"Gad","suffix":""}],"badges":[],"createdAt":"2024-03-07 20:05:08","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4031656/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4031656/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":53995565,"identity":"304552c0-e7b8-4050-af5f-78faa0f09f56","added_by":"auto","created_at":"2024-04-03 07:11:23","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":198282,"visible":true,"origin":"","legend":"\u003cp\u003eA Effect of atorvastatin and rosuvastatin on PAO1 growth and viability. \u003cstrong\u003ea)\u003c/strong\u003e The growth was assessed by measuring OD\u003csub\u003e600\u003c/sub\u003e of bacterial suspensions after overnight incubation in the absence and presence of 1/8 MIC of tested drugs and b) viability was assessed by viable counting of drugs-treated and control PAO1 cultures after 24\u0026nbsp;h of incubation. The test was done in duplicates. Tested drugs showed no statistically significant effect on bacterial growth. The data shown are the means ± standard errors. One-way ANOVA test was employed to assess significance; ns, non-significant:\u0026nbsp;\u003cem\u003ep\u003c/em\u003e\u0026nbsp;\u0026gt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4031656/v1/8e50a3b4c04d3e4bde114f03.jpeg"},{"id":53995566,"identity":"021b45a9-624b-4a17-bbb7-d5e56b4c8bc2","added_by":"auto","created_at":"2024-04-03 07:11:23","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":37078,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of atorvastatin and rosuvastatin on the tested virulence factors. \u003cstrong\u003ea):\u003c/strong\u003e tested statin drugs significantly diminished the biofilm formation, \u003cstrong\u003eb):\u003c/strong\u003eAtorvastatin and Rosuvastatin significantly diminished production of pyocyanin, \u003cstrong\u003ec):\u003c/strong\u003e atorvastatin and rosuvastatin significantly decreased the clear zones around the wells loaded with extracellular protease indicating decrease in protease production (33%), \u003cstrong\u003ed): \u003c/strong\u003eatorvastatin and rosuvastatin significantly decrease the hemolytic activity by 52% in treated PAO than untreated, \u003cstrong\u003ee):\u003c/strong\u003e atorvastatin and rosuvastatin significantly decrease the Rhamnolipids activity by 40% in treated PAO than untreated. The data are presented as percentage change from control, and One-way ANOVA test was employed to assess significance; ***: \u003cem\u003ep\u003c/em\u003e ≤ 0.001.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4031656/v1/e22bf436a30aa53dee49ed2c.png"},{"id":53995567,"identity":"21c9f9da-3ba1-4b1c-9600-7ba2d9b91853","added_by":"auto","created_at":"2024-04-03 07:11:23","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":17074,"visible":true,"origin":"","legend":"\u003cp\u003eRosuvastatin and Atorvastatin reduce \u003cem\u003eP. aeruginosa\u003c/em\u003e pathogenesis in mice infection model. 5 groups composed of 5 mice each were used: two negative control groups either uninfected or injected with sterile PBS, A positive control group was injected with untreated PAO1, and the last 2 group were injected with Atorvastatin and Rosuvastatin in sub-MIC treated PAO1. Mice survival was observed, plotted using the Kaplan–Meier method, and significance (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05) was calculated using a Log-rank test, GraphPad Prism 8. While no deaths were observed in the two negative controls, only 20% of mice were survived in positive control groups. Atorvastatin conferred 80% protection, and Rosuvastatin showed 100% protection and all mice survived till the end of the experiment (Log rank test for trend \u003cem\u003ep\u003c/em\u003e = 0.0019). ** = \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4031656/v1/3fe586cf87b918e01d4112fe.png"},{"id":53995568,"identity":"53b7026d-0c29-4ba3-8a02-47380dc18c4c","added_by":"auto","created_at":"2024-04-03 07:11:23","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":21742,"visible":true,"origin":"","legend":"\u003cp\u003eDown-regulation of\u0026nbsp;\u003cem\u003eP. aeruginosa\u003c/em\u003e\u0026nbsp;QS genes. RNA was isolated from\u0026nbsp;\u003cem\u003eP. aeruginosa\u003c/em\u003e\u0026nbsp;cultures treated and untreated with statins drugs in sub-MIC to be used in cDNA synthesis. In qRT-PCR, changes in the expression for each QS gene were normalized in relation to the Ct values of housekeeping gene\u0026nbsp;\u003cem\u003egyrA\u003c/em\u003e. Expression fold change in gene expression in Atorvasatin and Rosuvastatin treated\u0026nbsp;\u003cem\u003eP. aeruginosa\u003c/em\u003e\u0026nbsp;was calculated by the 2\u003csup\u003e−ΔΔCT\u003c/sup\u003e\u0026nbsp;method and compared to untreated bacteria. The data shown are the mean ± standard errors from three experiments.\u0026nbsp;\u003cem\u003ep\u003c/em\u003e\u0026nbsp;\u0026lt; 0.05 was considered significant using the one-way ANOVA test. Three tested drugs significantly decreased the expression of genes\u0026nbsp;\u003cem\u003elasI\u003c/em\u003e,\u0026nbsp;\u003cem\u003elasR\u003c/em\u003e,\u0026nbsp;\u003cem\u003erhlR\u003c/em\u003e,\u0026nbsp;and\u0026nbsp;\u003cem\u003epqsR\u003c/em\u003e\u0026nbsp;(\u003cem\u003ep\u003c/em\u003e\u0026nbsp;\u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-4031656/v1/43b418b642fe330802159bed.png"},{"id":53995570,"identity":"f4ff06f0-3e87-451c-a246-d9f970803963","added_by":"auto","created_at":"2024-04-03 07:11:23","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":224691,"visible":true,"origin":"","legend":"\u003cp\u003eCartoon representation of the binding site topology; blue colour, were calculated via CASTp; \u003ca href=\"http://sts.bioe.uic.edu/castp/index.html\"\u003ehttp://sts.bioe.uic.edu/castp/index.html\u003c/a\u003e.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-4031656/v1/47079c21a51cec6c4c74467a.png"},{"id":53995569,"identity":"f0d98f32-4d06-48ca-83f5-68ed74f0866d","added_by":"auto","created_at":"2024-04-03 07:11:23","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":935389,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eIn silico\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e analysis showing the putative binding modes (2D \u0026amp; 3D) of A) Atorvastatin \u003c/strong\u003eand\u003cstrong\u003e B) Rosuvastatin into the QS-receptors.\u003c/strong\u003e For LasR, the binding scores with Atorvastatin and Rosuvastatin were -2.0071 and -5.0544 Kcal/mol, respectively. For RhlR, the binding scores with Atorvastatin and Rosuvastatin were -1.3238 and -5.7929 Kcal/mol, respectively. For \u003cstrong\u003ePqsR\u003c/strong\u003e, the binding scores of Atorvastatin and Rosuvastatin were -7.2231 and -6.9914 Kcal/mol, respectively. For LasB, the binding scores for Atorvastatin and Rosuvastatin were -10.7728 and -11.2626 Kcal/mol, respectively.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-4031656/v1/0a29c2f8c61314087ac97b54.png"},{"id":74828994,"identity":"7b4478f1-7086-4b9c-b72f-ff2acb8ad9a1","added_by":"auto","created_at":"2025-01-27 10:17:20","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2487731,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4031656/v1/1aa9bcc7-1062-4a82-8d4c-bd8d76fa4b73.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Modulating Pseudomonas aeruginosa virulence by the anti-cholesterol drugs Atorvastatin and Rosuvastatin","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003e \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e is an opportunistic multi-drug resistant (MDR) pathogen, causing acute and chronic infection in immunocompromised patients. \u003cem\u003eP. aeruginosa\u003c/em\u003e is one of the most common bacterial pathogens associated with chronic obstructive pulmonary disease (COPD), cystic fibrosis, traumas, burns, sepsis, and ventilator-associated pneumonia (VAP) including those caused by COVID-19 [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In addition, \u003cem\u003eP. aeruginosa\u003c/em\u003e is one of the ESKAPE pathogens, which are a group of MDR pathogens associated with hospital-acquired infections worldwide [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eESCAPE pathogens are common causes of life-threatening infections among critically ill patients [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Nearly 700,000 people died due to antibiotic resistant-infections each year. For example, \u003cem\u003eP. aeruginosa\u003c/em\u003e strains that were isolated from European populations have a combined resistance of 12.9% [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Furthermore, ESCAPE pathogens have extraordinary drug resistance. Some types of \u003cem\u003eP. aeruginosa\u003c/em\u003e strains are Extensively drug-resistant (XDR), these strains exhibit resistance to nearly all antibiotics, including the last resort antibiotics such as carbapenems [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The world health organization (WHO) listed carbapenem-resistance \u003cem\u003eP. aeruginosa\u003c/em\u003e strains among the \u0026ldquo;critical\u0026rdquo; pathogens, which urgently need novel antibiotics or strategies for treatment [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eP. aeruginosa\u003c/em\u003e is known to present multiple drug tolerance which attributed to intrinsic, acquired, or adaptive mechanisms. Clinical use of conventional antimicrobials for management of \u003cem\u003eP. aeruginosa\u003c/em\u003e infections is challenging, causing a serious global concern [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The severity and therapy failure in \u003cem\u003eP. aeruginosa\u003c/em\u003e infections can be attributed to many factors including immune evasion (mediated by elastase, rhamnolipids and alkaline protease), antibiotic resistance (attributed to overexpression of efflux pump and modifying enzymes), cytotoxicity (e.g. exotoxin A and pyocyanin), iron scavenging (proteases and siderophores), and finally biofilm structure and dynamics [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. It is well known that \u003cem\u003eP. aeruginosa\u003c/em\u003e virulence factors expression and biofilm formation is controlled by quorum sensing (QS) systems. \u003cem\u003eP. aeruginosa\u003c/em\u003e has at least three interconnected QS systems (Las, Rhl, and Pqs). Las system is on the top of this circuit, as it controls the expression of the other QS-systems [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDue to the notable increase in antimicrobial resistance rates, ongoing research is focusing on exploring new approaches and therapies beyond conventional antibiotics. These approaches include: using bacteriophages, monoclonal antibodies, antimicrobial peptides [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In addition to the use of antibiotic adjuvants to restore antibiotic activity such as efflux pump inhibitors and enzyme inhibitors [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The anti-virulence approach is another interesting approach that aims to reduce virulence and facilities pathogen elimination by the immune system. In addition, this approach imposes low selective pressure on \u003cem\u003eP. aeruginosa\u003c/em\u003e, thus less likely to induce resistance development. Investigating the anti-virulence potential of the drugs that already approved by US food and drug administration (FDA); for treatment of other conditions; is one of the promising policies to face the antimicrobial resistance crisis [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The remodeling of these drugs would significantly reduce the lead time from bench to bedside.\u003c/p\u003e \u003cp\u003eStatin drugs discovery was one of the clinical breakthroughs in the 20th century. A total of nine statins have been identified, seven of which were approved by FDA to treat high cholesterol, in about 40\u0026nbsp;million patients worldwide [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Furthermore, statins were found to have a number of cholesterol-independent effects [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Anti-inflammatory, immunomodulatory, and anticancer effects of statins are well recognized [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In addition, several studies have explored the pleiotropic effects of statins in combating microbial infections including sepsis and pneumonia [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eStatins are strong potential candidates to be repurposed as novel antimicrobial agents. However, the evidence for this remains debated due to the presence of apparently inconsistent studies [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The current study aims to assess and illustrate the potential effects of atorvastatin and rosuvastatin on the growth, virulence and QS system of \u003cem\u003eP. aeruginosa\u003c/em\u003e using in vitro, in vivo and in silico strategies.\u003c/p\u003e"},{"header":"2. Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Bacteria, Media, and Growth Conditions\u003c/h2\u003e \u003cp\u003e \u003cem\u003eP. aeruginosa\u003c/em\u003e PAO1 standard strain was obtained from culture collection of the Microbiology and Immunology Department, Faculty of Pharmacy, Zagazig University, Egypt. The culture media were obtained from Oxoid (Hampshire, UK). All of used chemicals were obtained from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise stated. PAOI overnight cultures were prepared in Luria\u0026ndash;Bertani (LB) broth and adjusted to optical density equal to 0.5 McFarland Standard with about 1 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e CFU/mL (OD\u003csub\u003e600\u003c/sub\u003e of 0.4), prior to being used in each experiment.\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.2. Determination of Minimum Inhibitory Concentration and detection of the effect of subMIC of atorvastatin and rosuvastatin on bacterial growth and viability\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe broth micro-dilution method [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] was used to determine the minimum inhibitory concentration (MIC) of both atorvastatin and rosuvastatin. drug solution was two-fold serially diluted using Mueller\u0026ndash;Hinton broth (MHB). The wells of 96-well microtiter plate were filled with 100 \u0026micro;L aliquots of the serially diluted drugs. PAO1 strain was grown overnight in MHB at 37\u0026deg;C incubator. The resulting culture was diluted with sterile saline to turbidity of 0.5 McFarland and then diluted 1:100 using MHB to have cell density of about 1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e CFU/mL. Aliquots of 100 \u0026micro;L were added to all drug dilutions and the plate was incubated for 20 h at 37\u0026deg;C. The MIC was calculated by observing the least concentration of tested drugs that inhibited the visible turbidity.\u003c/p\u003e \u003cp\u003eIn order to ensure the antivirulence effect of tested drugs is not due to the inhibition of bacterial growth, the effect of atorvastatin and rosuvastatin at tested concentrations on \u003cem\u003eP. aeruginosa\u003c/em\u003e growth was assessed according to \u003cb\u003eNacla\u003c/b\u003e \u003cb\u003eet al\u003c/b\u003e [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Briefly, fresh \u003cem\u003eP. aeruginosa\u003c/em\u003e cultures were inoculated overnight in LB broth provided with 1/8 MIC of tested drugs at 37\u0026deg;C for 24 h. The turbidites of \u003cem\u003eP. aeruginosa\u003c/em\u003e cultures were measured at 600 nm using Biotek Spectrofuorometer (Biotek, USA), and viable bacterial cells were counted.\u003c/p\u003e \u003cp\u003eSub-inhibitory concentration of atorvastatin and rosuvastatin was used to investigate its anti-virulence and anti-quorum sensing activities against \u003cem\u003eP. aeruginosa\u003c/em\u003e. DMSO was used as a solvent control and all the subsequent experiments were performed in triplicate, and the average and standard deviation were calculated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Biofilm inhibition assay\u003c/h2\u003e \u003cp\u003eThe inhibition of \u003cem\u003eP. aeruginosa\u003c/em\u003e biofilm formation by tested agents was assessed by the crystal violet method of \u003cb\u003eStepanovic\u003c/b\u003e \u003cb\u003eet al.\u003c/b\u003e [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. One hundred microliter aliquots of \u003cem\u003eP. aeruginosa\u003c/em\u003e suspension of an approximate cell inoculum of 1 \u0026times;10\u003csup\u003e6\u003c/sup\u003e CFU/mL were transferred to microtiter plate wells in the presence or absence of 1/8 MIC of tested drugs. The nonadherent cells were washed out after 24 h incubation at 37\u0026deg;C, and the biofilm-forming cells were fixed with methanol and stained with crystal violet (1%) for 20 min. The excess dye was washed out, plates were air-dried, adhered dye was extracted with 33% glacial acetic acid, and absorbances were measured at 590 nm using the Biotek Spectrofluorometer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Pyocyanin Assay\u003c/h2\u003e \u003cp\u003eThe virulent \u003cem\u003eP. aeruginosa\u003c/em\u003e pyocyanin pigment was assayed in the presence or absence of 1/8 MIC of atorvastatin and rosuvastatin-treated PAO1, according to the method of \u003cb\u003eDas and Manefeld\u003c/b\u003e [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Ten microliter aliquots of \u003cem\u003eP. aeruginosa\u003c/em\u003e overnight cultures (adjusted to OD600 of 0.4) were mixed with 1 mL of LB broth provided with 1/8 MIC of atorvastatin and rosuvastatin-treated PAO1. After 48 h incubation at 37\u0026deg;C, the Eppendorf tubes were centrifuged at 10,000 rpm for 10 min, and the absorbances of pyocyanin pigment in the supernatants were measured at 691 nm by Biotek spectrofluorometer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Protease Assay\u003c/h2\u003e \u003cp\u003eThe effect of the tested statins on inhibition of protease by \u003cem\u003eP. aeruginosa\u003c/em\u003e was carried out using the skimmed milk agar method. \u003cem\u003eP. aeruginosa\u003c/em\u003e PAO1 overnight cultures in LB broth (either treated or untreated) were centrifuged at 10,000 rpm for 15 min and the protease activities were measured by adding the 100 \u0026micro;L aliquots of the supernatants to the wells made in skim milk agar plates (5%). The plates were incubated overnight at 37\u0026deg;C and the clear zones formed around the wells were measured as described previously [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Hemolysin Assay\u003c/h2\u003e \u003cp\u003eHemolysin inhibitory activity of 1/8 MIC of tested drugs- was assayed in PAO1 strain using the method of \u003cb\u003eRossignol\u003c/b\u003e \u003cb\u003eet al.\u003c/b\u003e [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Briefly, 0.5 mL of supernatants (prepared in previous step) were mixed with fresh 2% erythrocytes suspension in saline (0.8 mL) and incubated at 37\u0026deg;C for 2 h. The mixtures were centrifuged at 2500\u0026times;g for 5 min at 4\u0026deg;C to separate the hemoglobin released from erythrocytes. Positive control (complete hemolysis) was prepared by erythrocytes suspension lysed by 0.1% SDS and negative control (no hemolysis) was prepared by incubation of erythrocytes in LB broth under the same conditions. The released hemoglobin was compared with the controls and the percentage hemolysis was calculated from this formula: % Hemolysis=[X-B/T-B] \u0026times;100, where X represent the treated or untreated samples, B represent the negative control and T represent the positive control. The hemolysis of atorvastatin and rosuvastatin-treated cultures was expressed as % compared to hemolysis of control untreated culture.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Rhamnolipids production\u003c/h2\u003e \u003cp\u003eThe oil spreading technique was carried out as described previously [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Briefly, 20-mL distilled water was placed in 90-mm Petri dish followed by addition of 10-\u0026micro;L crude oil to the surface of water. Then, 10-\u0026micro;L PAO1 supernatant with and without sub-MIC of tested drugs was dropped onto the crude oil surface. The diameter of the clear zone on the oil surface was measured.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Mice survival assay\u003c/h2\u003e \u003cp\u003eThe influence of sub MIC of tested statins drugs on PAO1 pathogenesis was assessed \u003cem\u003ein vivo\u003c/em\u003e using the mice survival model [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The ethical standards of Medical Research Center, Zagazig standard, Zagazig, Egypt (where the experiment was conducted and the mice were provided from the animal house of faculty of pharmacy, Zagazig University) were followed in the animal study. An approximate cell density of 2.5 x 10\u003csup\u003e7\u003c/sup\u003e CFU/mL of \u003cem\u003eP. aeruginosa\u003c/em\u003e PAO1 in phosphate-buffered saline (PBS) was prepared from overnight bacterial cultures in LB broth with and without \u0026frac14; MIC of tested drugs. Six random groups of three-weeks-old healthy female albino mice (\u003cem\u003eMus musculus\u003c/em\u003e) with approximately same weight were used, each group comprising 5 mice. In Group 1, mice were injected intra-peritoneal with 100 \u0026micro;L of atorvastatin-treated bacteria in sterile PBS, while group 2 was injected with 100 \u0026micro;L of rosuvastatin-treated bacteria in sterile PBS. A positive control group 3 was injected by 100 \u0026micro;L of untreated PAO1 only. Two negative control groups are included also; in group 4 mice are injected with 100 \u0026micro;L of sterile PBS and in group 5 mice were left un-inoculated. All groups were kept with normal feeding and aeration. The survival of mice in each group was recorded every day for 3 successive days. The results were calculated using GraphPad Prism 5 and plotted using Kaplan-Meier method.\u003c/p\u003e \u003cp\u003eMethod of euthanasia used was as acceptable by the most recent report of the AVMA (American Veterinary Medical Association) Guidelines on Euthanasia. The method used was Cervical dislocation (CD) under anesthesia or tranquilization by using intra peritoneal (IP) thiopental (100mg\\Kg). After loss of physiological signs (breath and heartbeats), cervical dislocation will be performed after the primary euthanasia.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e\u003cem\u003e2.8.\u003c/em\u003e Effect of Atorvastatin and rosuvastatin on the expression of virulence-encoding genes\u003c/h2\u003e \u003cp\u003eThe RNA was extracted from PAO1 cultures grown in the presence or absence of sub MIC of tested drugs using Gene JET RNA extraction kit (Thermo Scientific, Waltham, MA, USA). The extracted RNA was kept at \u0026minus;\u0026thinsp;80\u0026deg;C [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. A cDNA reverse transcriptase kit (Applied Biosystem, Waltham, MA, USA) was employed to synthesize cDNA. A quantitative real-time PCR was conducted to quantify the expression of genes involved in the \u003cem\u003ePAOI\u003c/em\u003e virulence using the SYBR Green I PCR Master Kit (Fermentas, Waltham, MA, USA) in a Step One instrument (Applied Biosystem, Waltham, MA, USA). A melting curve was performed according to the instructions of the manufacturer, and the relative expressions were calculated using the comparative threshold cycle (∆∆Ct) method [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The sequences of the used primers are listed in Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The expression levels were normalized to the housekeeping gene \u003cem\u003egyrA\u003c/em\u003e [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequences of the primers used in the current study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence (5\u0026prime;\u0026rarr; 3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003egyrA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eF\u003c/b\u003e\u0026loz; CGAGAAGCTGCTCTCCGAAT\u003c/p\u003e \u003cp\u003e\u003cb\u003eR\u003c/b\u003e \u0026loz; TCCTCACGGATCACCTCCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003elasI\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eF\u0026loz;\u003c/b\u003e CGCACATCTGGGAACTCA\u003c/p\u003e \u003cp\u003e\u003cb\u003eR\u0026loz;\u003c/b\u003e CGGCACGGATCATCATCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003elasR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eF\u0026loz;\u003c/b\u003e CTGTGGATGCTCAAGGACTAC\u003c/p\u003e \u003cp\u003e\u003cb\u003eR\u0026loz;\u003c/b\u003e AACTGGTCTTGCCGATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003erhlR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eF \u0026loz;\u003c/b\u003e GCCAGCGTCTTGTTCGG\u003c/p\u003e \u003cp\u003e\u003cb\u003eR \u0026loz;\u003c/b\u003e CGGTCTGCCTGAGCCATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003epqsR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eF \u0026loz;\u003c/b\u003e CTGATCTGCCGGTAATTGG\u003c/p\u003e \u003cp\u003e\u003cb\u003eR\u0026loz;\u003c/b\u003e ATCGACGAGGAACTGAAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e3.9. Molecular docking study\u003c/h2\u003e \u003cp\u003e \u003cem\u003eP. aeruginosa\u003c/em\u003e crystal structures of LasR, RhlR, PqsR and LasB proteins [\u003cspan additionalcitationids=\"CR37 CR38\" citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e] were retrieved from the Protein Data Bank (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.rcsb.org/\u003c/span\u003e\u003cspan address=\"https://www.rcsb.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) on 22 June 2023 [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. The receptor structures were prepared using the QuickPrep protocol on Molecular Operating Environment (MOE 2019.012) with Amber10: EHT forcefield [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Atorvastatin and rosuvastatin were obtained from PubChem database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubchem.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://pubchem.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e accessed on 22 June 2023) as canonical SMILES. Each drug structure was prepared through energy minimization using the Computed Atlas for Surface Topography of Proteins (CASTp) software [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Docking was performed using Alpha triangle placement with Amber10: EHT forcefield.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.10. Statistical analysis\u003c/h2\u003e \u003cp\u003eThe influence of statins drugs on \u003cem\u003ePs. aeruginosa\u003c/em\u003e QS-controlled virulence factors production was analyzed using GraphPad Prism 5 software package with One Way ANOVA according to Dunnet's or Tukey's Multiple Comparison Tests\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or P\u0026thinsp;\u0026lt;\u0026thinsp;0.001 for significance. Results were calculated as the means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard errors of three biological experiments with three technical replicates each.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Statins Did not affect the bacterial cell growth and viability\u003c/h2\u003e \u003cp\u003eAtorvastatin and rosuvastatin could inhibit the growth of \u003cem\u003eP. aeruginosa\u003c/em\u003e PAO1 at 2.5 mg/mL. the anti-quorum sensing (QS) and anti-virulence activities of the two drugs were assessed at 1/8 MIC (0.31 mg/mL). To exclude the possibility of growth inhibiting activity of tested drugs on QS and virulence, the optical densities of the bacterial suspensions at 600 nm were measured after overnight incubation in LB broth. Moreover, the inhibitory effect of drugs on cell viability was assessed by plating PAO1 cultures and counting CFUs after treatment with 1/8 MIC of tested drugs. Optical density and viable count were not significantly reduced in tested drugs-treated culture as compared to the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u003cb\u003e).\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Statins diminish \u003cem\u003ePseudomonas\u003c/em\u003e virulence factors.\u003c/h2\u003e \u003cp\u003eAtorvastatin and Rosuvastatin significantly diminished the biofilm formation with percentages exceeding 40% when compared with the untreated control. The data are presented as percentage change from the untreated control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). in additions statins significantly decreased the production of pyocyanin pigment by more than 40% in comparison to control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003eOn the other hand, atorvastatin and rosuvastatin significantly decreased the clear zones around wells loaded with cell-free supernatants containing extracellular protease, indicating a significant decrease in proteolytic activity (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). The decrease percentages in the protease production were about 33% (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec).\u003c/p\u003e \u003cp\u003eThe Hemolytic activity of both control PAO1 and atorvastatin and rosuvastatin-treated culture supernatants was quantitatively assessed and the released hemoglobin was measured at 540 nm. Hemolytic activity was reduced by 52% in case of Pseudomonas-treated cells as compared to the untreated control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed). Finally, rhamnolipid production was highly inhibited in presence of sub-MIC of both atorvastatin and rosuvastatin as the spreading of oil on surface of water was significantly decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Atorvastatin and Rosuvastatin ameliorate the survival of infected mice\u003c/h2\u003e \u003cp\u003eIn mice mortality test, the 5 mice injected with untreated PAO started to die after 24 h of injection, and 4 of them were dead after 72 h. The control mice groups which were injected with solvents and saline were 100% alive throughout the experiment period. Mice groups injected with PAO1 treated with sub-MIC of Atorvasatatin showed significant improvement in survival rates; 100% survival was recorded in the group injected with Rosuvastatin treated PAO1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Atorvastatin and rosuvastatin at sub-MICs reduced QS-genes\u0026rsquo; expression\u003c/h2\u003e \u003cp\u003eThe influence of atorvastatin and rosuvastatin treatment on the expression of PAO1 QS-encoding genes was evaluated by quantitative real-time PCR. The expression levels of rhlR, rhlI, lasR, lasI, pqsA, and pqsR were significantly decreased after PAO1 treatment with sub-MICs of atorvastatin or rosuvastatin compared to the untreated control (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u003cb\u003e).\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Molecular docking analysis\u003c/h2\u003e \u003cp\u003eIn order to investigate the anti QS potential of atorvastatin and rosuvastatin on \u003cem\u003eP. aeruginosa\u003c/em\u003e, computational studies were performed for three main proteins namely LasR (PDB code: 2UV0/1.80 \u0026Aring;), RhlR (PDB code: 8DQ0/ 3.74 \u0026Aring;)[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], PqsR (PDB code: 4JVD/ 2.95 \u0026Aring;) in addition to LasB (PDB code: 3DBK/1.40 \u0026Aring;). The surface area and volume of the binding sites were estimated as; 234.547\u0026Aring;\u003csup\u003e2\u003c/sup\u003e/112.60\u0026Aring;\u003csup\u003e3\u003c/sup\u003e, 350.183\u0026Aring;\u003csup\u003e2\u003c/sup\u003e/167.88\u0026Aring;\u003csup\u003e3\u003c/sup\u003e, 423.995\u0026Aring;\u003csup\u003e2\u003c/sup\u003e/223.137\u0026Aring;\u003csup\u003e3\u003c/sup\u003e, 219.326 \u0026Aring;\u003csup\u003e2\u003c/sup\u003e/143.951 \u0026Aring;\u003csup\u003e3\u003c/sup\u003e respectively. using the CASTp program, it was observed that all proteins had a relatively large pocket \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e and by inspection of that binding pocket, it is obvious that they are all hydrophobic in nature. This would recommend a good chance of superior fitting for atorvastatin and rosuvastatin as they are both big in size.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFor LasR protein, although atorvastatin was able to form key interactions within the active site (H-bond with ser129 and pi interactions with trp88) along with other interactions, this was at the expense of energy. Rosuvastatin (S = -5.0544) significantly surpassed atorvastatin (S= -2.0071), with the aid of extra hydrogen bonding potential above the key interactions. This relatively good docking score is a reflection of the superior fitting in the hydrophobic pocket \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u003cb\u003e).\u003c/b\u003e\u003c/p\u003e \u003cp\u003eRegarding RhlR, although both atorvastatin and rosuvastatin was able to perfectly fit in the hydrophobic binding site, as indicated in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, they showed differential docking scores (S = -1.3238 and \u0026minus;\u0026thinsp;5.7929 respectively) indicating a possibility for better binding of rosuvastatin than atorvastatin.\u003c/p\u003e \u003cp\u003eFor \u003cem\u003eP. aeruginosa\u003c/em\u003e PqsR, both atorvastatin and rosuvastatin was able to orient themselves in a way to fill both pockets A and B forming the active site showing comparable docking scores (S = -7.4092 and \u0026minus;\u0026thinsp;6.9914 Kcal/mol, respectively). Both compounds show key binding interactions with leu208 and Tyr258 that anchor the compounds in place. Visual inspection of the binding poses would indicate that atorvastatin is protruding from the active site, while rosuvastatin is diving deep inside the two pockets \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u003cb\u003e).\u003c/b\u003e\u003c/p\u003e \u003cp\u003eFor a zinc dependent protein like LasB, ligand interaction with its zinc metal is crucial. Both atorvastatin and rosuvastatin were able to interact with the zinc metal resulting in excellent protein-ligand binding energy (S= -10.7728, -11.2626 respectively) as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e.\u003c/p\u003e "},{"header":"Discussion","content":"\u003cp\u003e \u003cem\u003eP. aeruginosa\u003c/em\u003e strains have strong drug resistance through various natural and acquired mechanisms, including the production of antibiotic inactivating or modifying enzymes, inhibiting drug penetration, changing the target site of the drug or expelling the drug via efflux pumps. In addition, \u003cem\u003eP. aeruginosa\u003c/em\u003e develop adaptive antibiotic resistance mechanisms including biofilm-mediated resistance and formation of persister cells with high drug tolerance [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDue to the increasing difficulty in treating infections caused by \u003cem\u003eP. aeruginosa\u003c/em\u003e strains, research on \u003cem\u003eP. aeruginosa\u003c/em\u003e resistance has been an urgent topic for decades. Even with this intense interest, development of new antibiotics for \u003cem\u003eP. aeruginosa\u003c/em\u003e is slowly due to the complexity of \u003cem\u003ePseudomonas\u003c/em\u003e resistance. Designing more effective therapeutic approaches has been an increasing urgency. Targeting virulence factors or the machinery controlling them using FDA-approved drugs is a promising approach that withdraw the attention of several research groups in recent years [\u003cspan additionalcitationids=\"CR45 CR46\" citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eStatins drugs represent a new hope for the treatment and the prevention of bacterial infections with recalcitrant features. Currently, still there is a controversy around the usefulness of statins in targeting bacterial virulence [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. The current study aims to illustrate the potential effects of the FDA approved drugs atorvastatin and rosuvastatin as anti-virulence and anti-QS agents against \u003cem\u003eP. aeruginosa.\u003c/em\u003e\u003c/p\u003e \u003cp\u003eFirst, the MICs of atorvastatin and rosuvastatin were determined using broth micro-dilution method. The MIC in our study was 2.5 mg/mL for both drugs. A previous study reported that simvastatin\u0026rsquo;s MIC ranged from 15.65 to 31.25 \u0026micro;g/mL for \u003cem\u003eStaphylococcus aureus\u003c/em\u003e strains [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. It is worth mentioning that this study and a more recent study reported that statins including simvastatin had no effect against tested Gram negative strains of \u003cem\u003eP. aeruginosa\u003c/em\u003e and \u003cem\u003eE. coli\u003c/em\u003e [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Another study reported that the growth of the respiratory tract pathogens \u003cem\u003eP. aeruginosa\u003c/em\u003e, \u003cem\u003eAcinetobacter baumannii\u003c/em\u003e, and \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e was inhibited by statins with MICs ranging from 15 to 333 mg/L [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The elevated MIC for Gram negative pathogens including \u003cem\u003eP. aeruginosa\u003c/em\u003e is expected due to the presence of the outer membrane of Gram-negative that act as a strong permeability barrier [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAfter this, the anti-virulence activity of atorvastatin and rosuvastatin was assessed at sub-inhibitory concentration (1/8 MIC). Atorvastatin and rosuvastatin at 1/8 MIC did not have any significant inhibitory effect on bacterial viability. the tested virulence factors include biofilm formation, pyocyanin and rhamnolipids production, in addition to protease and hemolysin secretion. Biofilm formation is one of the important virulence factors that are associated with resistance and contribute to the severity and chronicity of infections [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. In our study, Atorvastatin and rosuvastatin could significantly reduce biofilm formation in \u003cem\u003eP. aeruginosa\u003c/em\u003e PAO1 with percentages exceeding 40% inhibition. Consistent with our results, a previous study reported that simvastatin in sub-MIC concentrations (1/2 MIC to 1/16 MIC) significantly reduced \u003cem\u003eS\u003c/em\u003e. \u003cem\u003eaureus\u003c/em\u003e biofilm formation [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. In addition, Simvastatin was reported to inhibit \u003cem\u003eCandida albicans\u003c/em\u003e Biofilm formation in vitro, but at high concentration that impaired growth [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Furthermore, Simvastatin showed inhibitory effect on biofilm formed by the oral bacterial pathogen \u003cem\u003ePorphyromonas Gingivalis\u003c/em\u003e [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. All of these results support our finding that tested statins are promising inhibitors of biofilm formation.\u003c/p\u003e \u003cp\u003ePyocyanin is a secondary metabolite that enables \u003cem\u003eP. aeruginosa\u003c/em\u003e to penetrate the membranes of the host cell, in addition, pyocyanin has redox-active properties that can interfere with various cell functions resulting in host cell damage [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. Considerably, atorvastatin and rosuvastatin lowered the pyocyanin pigment production by more than 40%. It is well known that \u003cem\u003eP. aeruginosa\u003c/em\u003e regulates pyocyanin production via QS system, QS is controlled by small signaling molecules termed auto-inducers (AI). It is reported that QS homoserine lactone AI analogues act as inhibitors of pyocyanin production in \u003cem\u003eP. aeruginosa\u003c/em\u003e [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Statins had a conserved lactone ring in its structure [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], which may explain the capability of atorvastatin and rosuvastatin in reducing pyocyanin production in our study. To the best of our knowledge, our study is the first to report the effect of statins on pyocyanin production in \u003cem\u003eP. aeruginosa\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eProteases are strongly related to the pathogenesis of \u003cem\u003eP. aeruginosa\u003c/em\u003e. Proteases target antibodies responsible for protection of mucous membranes. Proteases can also damage the tight junction between host epithelial cells, resulting in invasion of host tissues [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. This study showed that atorvastatin and rosuvastatin significantly down regulated protease activity. In a similar manner, Gajd\u0026aacute;cs and Spengler reported that atorvastatin and simvastatin inhibited virulence factors like protease which are mediated by QS-dependent gene expression [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHemolysin causes inflammation and damage to the host tissues and interferes with neutrophil activity [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. In this study atorvastatin and rosuvastatin significantly diminished the activity of hemolysin. It has been reported that rosuvastatin in combination with levofloxacin has a significant reduction in β-hemolysin produced by \u003cem\u003eS. aureus\u003c/em\u003e [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. In addition, a previous study showed that simvastatin suppressed α-hemolysin produced by MRSA [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. Furthermore, it was reported that simvastatin and pravastatin cause significant cellular resistance to the cytotoxicity effect of the pore-forming toxin \u0026ldquo;α-hemolysin\u0026rdquo; and the main virulence factor of \u003cem\u003eStreptococcus pneumoniae\u003c/em\u003e [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. It is proposed that pyrimidine ring in statin molecules may be the cause of their antimicrobial activity [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe rhamnolipids are associated with \u003cem\u003eP. aeruginosa\u003c/em\u003e pathogenesis, they act as bio-surfactants leading to stimulation of bacterial motility, surface properties modification and biofilm formation [\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]. Our study proved that atorvastatin and rosuvastatin significantly inhibited rhamnolipids production. Similarly, a previous study showed that rhamnolipids production was significantly reduced in \u003cem\u003eP. aeruginosa\u003c/em\u003e cells treated with by secnidazole [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIt is well known that the QS systems of \u003cem\u003eP. aeruginosa\u003c/em\u003e orchestrate its pathogenesis [\u003cspan additionalcitationids=\"CR37\" citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. In this study, we evaluated the influence of statins on the expression of QS encoding genes. Rosuvastatin markedly down-regulated tested QS-genes of \u003cem\u003eP. aeruginosa\u003c/em\u003e. This was comparable to previous research showing that atorvastatin inhibited QS autoinducers\u0026rsquo; production and reduced virulence gene expression in \u003cem\u003eP. aeruginosa\u003c/em\u003e, leading to decreased bacterial virulence [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e]. Another study demonstrated that simvastatin and lovastatin interfere with the QS system of the Gram positive pathogen, \u003cem\u003eBacillus subtilis\u003c/em\u003e [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]. In addition, it was found that simvastatin reduced the expression of QS-genes and decreased biofilm formation in \u003cem\u003eListeria monocytogenes\u003c/em\u003e. Moreover, a previous study showed that the genes of \u003cem\u003eP. aeruginosa pqs\u003c/em\u003e QS system, were down-regulated upon farnesol exposure [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]. farnesol was reported as inhibitor of 3-hydroxy-3-methylglutaryl (HMG)-CoA reductase and statins are also known to inhibit HMG-CoA reductase [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe phenotypic and genotypic results of statins against virulence of \u003cem\u003eP. aeruginosa\u003c/em\u003e were supported by evaluation of the capacity of the two drugs to protect mice from \u003cem\u003ePseudomonas\u003c/em\u003e pathogenesis. In accordance with \u003cem\u003ein-vitro\u003c/em\u003e and \u003cem\u003ein-silico\u003c/em\u003e results, Atorvastatin in sub-MIC protected 80% of mice from \u003cem\u003eP. aeruginosa\u003c/em\u003e pathogenesis in-vivo. Our findings were in accordance with two studies have recently demonstrated the \u003cem\u003ein vivo\u003c/em\u003e efficacy of high concentrations of statins, whereby topical applications of simvastatin significantly enhanced bacterial clearance and healing of \u003cem\u003eS. aureus\u003c/em\u003e-contaminated wounds in mouse models [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e, \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFinally, the binding affinity of rosuvastatin and atorvastatin to QS receptors was evaluated \u003cem\u003ein silico\u003c/em\u003e. Collectively, rosuvastatin is expected to be better than atorvastatin as it was able to strongly bind LasR, RhlR, and LasB, however atorvastatin only showed satisfactory binding with the PqsR. The docking results suggest a promising inhibitory activity of both target drugs against the QS proteins that regulate the \u003cem\u003eP. aeruginosa\u003c/em\u003e virulence factor. This inhibitory effect may be attributed to the structural similarity between statins and the N-acyl-homoserine lactone AI, as statins had a conserved lactone ring in its structure [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. To the best of our Knowledge, this is the first \u003cem\u003ein silico\u003c/em\u003e study of the effect of statin on QS-genes of \u003cem\u003eP. aeruginosa\u003c/em\u003e, Collectively, Atorvastatin and Rosuvastatin showed a marked mitigation in \u003cem\u003eP. aeruginosa\u003c/em\u003e virulence, via efficient hindrance to QS systems as proved by \u003cem\u003ein vitro\u003c/em\u003e, \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein silico\u003c/em\u003e analysis. Statins may have a potential as a new class of compounds for developing anti-virulence agents to target bacterial QS-systems.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003cstrong\u003eEthical approval\u003c/strong\u003e \u003cp\u003e The ethical standards for animal welfare was approved by Zagazig University Institutional Animal Care and Use Committee, (ZU-IACUC), and granted the Approval number: ZU-IACUC/3/F/ 442 /2023. All the procedures were performed in accordance with the relevant guidelines.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent for publication:\u003c/strong\u003e \u003cp\u003eNot applicable.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eCompeting interests:\u003c/strong\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors. Open access funding provided by The Science, Technology \u0026amp; Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eS.I.N did the in vivo and rt PCRA.G did in vitro assay of tested drugsA.G.E and SS made in silico studiesA.G wrote and edit the final version of manuscriptAll authors reviewed the manuscript\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eThe authors would like to acknowledge Prof. Dr. Fathy Serry (Professor of Microbiology and Immunology, Faculty of Pharmacy, Zagazig University) for the manuscript proofreading.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eThe datasets used /or analyzed in the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eRossi E, La Rosa R, Bartell JA, Marvig RL, Haagensen JA, Sommer LM, et al. \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e adaptation and evolution in patients with cystic fibrosis. Nat Rev Microbiol. 2021;19(5):331\u0026ndash;42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41579-020-00477-5\u003c/span\u003e\u003cspan address=\"10.1038/s41579-020-00477-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJurado-Martin I, Sainz-Mejias M, McClean S. \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e: an audacious pathogen with an adaptable arsenal of virulence factors. Int J Mol Sci. 2021;22:3128. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms22063128\u003c/span\u003e\u003cspan address=\"10.3390/ijms22063128\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCendra MDM, Torrents E. \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e biofilms and their partners in crime. Biotechnol Adv. 2021;49:107734.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantajit S, Indrawattana N. Mechanisms of antimicrobial resistance in ESKAPE pathogens. \u003cem\u003eBioMed Res. Int.\u003c/em\u003e 2016; \u003cem\u003e2016\u003c/em\u003e, 2475067 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2016/2475067\u003c/span\u003e\u003cspan address=\"10.1155/2016/2475067\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Oliveira DM, Forde BM, Kidd TJ, Harris PN, Schembri MA, Beatson SA, et al. Antimicrobial resistance in ESKAPE pathogens. Clin Microb Rev. 2020;33(10):1128. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/cmr.00181-19\u003c/span\u003e\u003cspan address=\"10.1128/cmr.00181-19\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBotelho J, Grosso F, Peixe L. Antibiotic resistance in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e-mechanisms, epidemiology and evolution. Drug Resist Updat. 2019;44:100640.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcCracken MG, Adam HJ, Blondeau JM, Walkty AJ, Karlowsky JA, Hoban DJ, et al. Characterization of carbapenem-resistant and XDR \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e in Canada: results of the CANWARD 2007\u0026ndash;16 study. J Antimicrob Chemother. 2019;74(Supplement4):iv32\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaiomy AA, Serry FE, Kadry AA, Yahya G, Doijad S, Mostafa A, et al. Genome analysis of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e strains from chronically infected patients with high levels of persister formation. Pathogens. 2023;12(3):426. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/pathogens12030426\u003c/span\u003e\u003cspan address=\"10.3390/pathogens12030426\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDaikos GL, da Cunha CA, Rossolini GM, Stone GG, Baillon-Plot N, Tawadrous M, et al. Review of ceftazidime-avibactam for the treatment of infections caused by \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. Antibiotics. 2021;10(9):1126.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBreidenstein EB, de la Fuente-Nunez C, Hancock RE. \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e: All roads lead to resistance. Trends Microbiol. 2011;19:419\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbbas HA, El-Ganiny AM, Kamel HA. Phenotypic and genotypic detection of antibiotic resistance of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e isolated from urinary tract infections. Afr Health Sci. 2018;18(1):11\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTam VH, Chang KT, Abdelraouf K, Brioso CG, Ameka M, McCaskey LA, et al. Prevalence, resistance mechanisms, and susceptibility of multidrug-resistant bloodstream isolates of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. Antimicrob Agents Chemother. 2010;54:1160\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHauser AR, Mecsas J, Moir DT. Beyond antibiotics: new therapeutic approaches for bacterial infections. Clin Infect Dis. 2016;63(1):89\u0026ndash;95. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/cid/ciw200\u003c/span\u003e\u003cspan address=\"10.1093/cid/ciw200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdelghafar A, El-Ganiny AM, Shaker G, Askoura M. Isolation of a bacteriophage targeting \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e and exhibits a promising in vivo efficacy. AMB Express. 2023;13(1):79. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13568-023-01582-3\u003c/span\u003e\u003cspan address=\"10.1186/s13568-023-01582-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdel-Karim SAAM, El-Ganiny AMA, El-Sayed MA, Abbas HAA. Promising FDA-approved drugs with efflux pump inhibitory activities against clinical isolates of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e. PLoS ONE. 2022;17(7):e0272417.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdel-Halim MS, Askoura M, Mansour B, Yahya G, El-Ganiny AM. \u003cem\u003evitro\u003c/em\u003e activity of celastrol in combination with thymol against carbapenem-resistant \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e isolates. J Antibiot. 2022;75(12):679\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiao C, Huang X, Wang Q, Yao D, Lu W. Virulence factors of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e and anti-virulence strategies to combat its drug resistance. Front Cell Infect Microbiol. 2022;12:926758. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcimb.2022.926758\u003c/span\u003e\u003cspan address=\"10.3389/fcimb.2022.926758\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePinal-Fernandez I, Casal-Dominguez M, Mammen AL. Statins: pros and cons. Med Clin (Barc). 2018;150(10):398\u0026ndash;402. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.medcli.2017.11.030\u003c/span\u003e\u003cspan address=\"10.1016/j.medcli.2017.11.030\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIstvan ES, Deisenhofer J. Structural mechanism for statin inhibition of HMG-CoA reductase. Science. 2001;292:1160\u0026ndash;4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/science.1059344\u003c/span\u003e\u003cspan address=\"10.1126/science.1059344\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDulak J, J\u0026oacute;zkowicz A. Anti-angiogenic and anti-inflammatory effects of statins: relevance to anticancer therapy. Curr Cancer Drug Targets. 2005;5:579\u0026ndash;94. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2174/156800905774932824\u003c/span\u003e\u003cspan address=\"10.2174/156800905774932824\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHennessy E, Adams C, Reen FJ, O'Gara F. Is there potential for repurposing statins as novel antimicrobials? Antimicrob Agents Chemother. 2016;60(9):5111\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/AAC.00192-16\u003c/span\u003e\u003cspan address=\"10.1128/AAC.00192-16\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHennessy E, Mooij M, Legendre C, Jerry Reen F, O\u0026rsquo;Callaghan J, Adams C, et al. Statins inhibit \u003cem\u003ein vitro\u003c/em\u003e virulence phenotypes of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. J Antibiot. 2013;66:99\u0026ndash;101. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ja.2012.95\u003c/span\u003e\u003cspan address=\"10.1038/ja.2012.95\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKo HH, Lareu RR, Dix BR, Hughes JD. Statins: antimicrobial resistance breakers or makers? Peer J. 2017;5:e3952. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7717/peerj.3952\u003c/span\u003e\u003cspan address=\"10.7717/peerj.3952\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRana R, Sharma R, Kumar A. Repurposing of existing statin drugs for treatment of microbial infections: how much promising? Infect Disord Drug Targets. 2019;19(3):224\u0026ndash;37. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2174/1871526518666180806123230\u003c/span\u003e\u003cspan address=\"10.2174/1871526518666180806123230\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClinical and Laboratory Standards Institute. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically; Approved standard, CLSI Document M07-A9, 2012; Vol. 32, No. 3. Wayne, PA, USA.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNalca Y, Jansch L, Bredenbruch F, Geffers R, Buer J, Haussler S. Quorum-sensing antagonistic activities of azithromycin in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e PAO1: A global approach. Antimicrob Agents Chemother. 2006;50:1680\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStepanović S, Vuković D, Hola V, Bonaventura GD, Djukić S, Ćirković I, et al. Quantification of biofilm in microtiter plates: overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. APMIS. 2007;115(8):891\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1600-0463.2007.apm_630.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1600-0463.2007.apm_630.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDas T, Manefeld M. Pyocyanin promotes extracellular DNA release in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. PLoS ONE. 2012;7:e46718. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0046718\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0046718\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVijayaraghavan P, Vincent SGP. A simple method for the detection of protease activity on agar plate using bromocresolgreen dye. J Biochem Technol. 2013;4(3):628\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRossignol G, Merieau A, Guerillon J, Veron W, Lesouhaitier O, Feuilloley MG, et al. Involvement of a phospholipase C in the hemolytic activity of a clinical strain of \u003cem\u003ePseudomonas fluorescens\u003c/em\u003e. BMC microbiol. 2008;8(1):189. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1471-2180-8-189\u003c/span\u003e\u003cspan address=\"10.1186/1471-2180-8-189\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorikawa M, Hirataa Y, Imanaka T. A study on the structure-function relationship of lipopeptide bio-surfactants. Biochim Biophys Acta. 2000;1488(3):211\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim HS, Lee SH, Byun Y, Park HD. 6-Gingerol reduces \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e biofilm formation and virulence via quorum sensing inhibition. Sci Rep. 2015;5:8656.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClifford RJ, Milillo M, Prestwood J, Quintero R, Zurawski DV, et al. Detection of bacterial 16S rRNA and identification of four clinically important bacteria by real-time PCR. PLoS ONE. 2012;7:e4855839.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivak KJ, 76- Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆ct method. Methods. 2001;25:402\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaleh MM, Abbas HA, Askoura MM. Repositioning secnidazole as a novel virulence factors attenuating agent in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. Microb Pathog. 2019;127:31\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.micpath.2018.11.042\u003c/span\u003e\u003cspan address=\"10.1016/j.micpath.2018.11.042\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBottomley MJ, Muraglia E, Bazzo R, Carf\u0026igrave; A. Molecular insights into quorum sensing in the human pathogen \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e from the structure of the virulence regulator LasR bound to its autoinducer. J Biol Chem. 2007;282(18):13592\u0026ndash;600. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M700556200\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M700556200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeathers JR, Richael EK, Simanek KA, Fromme JC, Paczkowski JE. Structure of the RhlR-PqsE complex from \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e reveals mechanistic insights into quorum-sensing gene regulation. Structure. 2022;30(12):1626\u0026ndash;e16364. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.str.2022.10.008\u003c/span\u003e\u003cspan address=\"10.1016/j.str.2022.10.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003elangovan A, Fletcher M, Rampioni G, Pustelny C, Rumbaugh K, Heeb S, et al. Structural basis for native agonist and synthetic inhibitor recognition by the \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e quorum sensing regulator \u003cem\u003ePqsR\u003c/em\u003e (MvfR). PLOS Pathog. 2013;9(7):e1003508. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.ppat.1003508\u003c/span\u003e\u003cspan address=\"10.1371/journal.ppat.1003508\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVel\u0026aacute;zquez-Libera JL, Murillo-L\u0026oacute;pez JA F, de la Torre A, Caballero J. Structural requirements of n-alpha-mercaptoacetyl dipeptide (namdp) inhibitors of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e virulence factor LasB: 3D-QSAR, molecular docking, and interaction fingerprint studies. Int J Mol Sci. 2019;20(24):6133. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms20246133\u003c/span\u003e\u003cspan address=\"10.3390/ijms20246133\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, et al. The Protein Data Bank. Nucleic Acids Res. 2000;28:235\u0026ndash;42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/28.1.235\u003c/span\u003e\u003cspan address=\"10.1093/nar/28.1.235\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMolecular Operating Environment (MOE. 2019.0102) Chemical Computing Group Inc, Montreal Quebec Canada Http://Www.Chemcomp.Com.2019.0102.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTian W, Chen C, Lei X, Zhao J, Liang J. CASTp 3.0: Computed Atlas of Surface Topography of Proteins. Nucleic Acids Res. 2018;46:W363\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/gky473\u003c/span\u003e\u003cspan address=\"10.1093/nar/gky473\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoares A, Alexandre K, Etienne M. Tolerance and persistence of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e in biofilms exposed to antibiotics: Molecular mechanisms, antibiotic strategies and therapeutic perspectives. Front Microbiol. 2020;11:2057. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2020.02057\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2020.02057\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeleem NM, Abd El Latif HK, Shaldam MA, El-Ganiny AM. Drugs with new lease of life as quorum sensing inhibitors: for combating MDR \u003cem\u003eAcinetobacter baumannii\u003c/em\u003e infections. Eur J Clin Microbiol Infect Dis. 2020;39(9):1687\u0026ndash;702. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s1009 6-020-03882\u003c/span\u003e\u003cspan address=\"10.1007/s1009 6-020-03882\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQin S, Xiao W, Zhou C, Pu Q, Deng X, Lan L, et al. \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e: pathogenesis, virulence factors, antibiotic resistance, interaction with host, technology advances and emerging therapeutics. Signal Transduct Target Ther. 2022;25(1):199. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41392-022-01056-1\u003c/span\u003e\u003cspan address=\"10.1038/s41392-022-01056-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChadha J, Khullar L, Gulati P, Chhibber S, Harjai K. Repurposing Albendazole as a potent inhibitor of Quorum sensing-regulated virulence in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e: Novel prospects of a classical drug. Microb Pathog. 2024;186:106468. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.micpath.2023.106468\u003c/span\u003e\u003cspan address=\"10.1016/j.micpath.2023.106468\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChadha J, Khullar L, Gulati P, Chhibber S, Harjai K. Anti-Virulence Prospects of Metformin against \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e: A New dimension to a multifaceted drug. Microb Pathog. 2023;183:106281. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.micpath.2023.106281\u003c/span\u003e\u003cspan address=\"10.1016/j.micpath.2023.106281\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eValencia DY, Habila M, McClelland DJ, Degarege A, Madhivanan P, Krupp K. Infection-associated biofilms and statins: protocol for systematic review. BMJ Open. 2021;2511(5):e046290. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1136/bmjopen-2020-046290\u003c/span\u003e\u003cspan address=\"10.1136/bmjopen-2020-046290\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGraziano TS, Cuzzullin MC, Franco GC, Schwartz-Filho HO, de Andrade ED, Groppo FC, et al. Statins and antimicrobial effects: Simvastatin as a potential drug against \u003cem\u003eStaphylococcus aureus\u003c/em\u003e biofilm. PLoS ONE. 2015;10(5):e0128098. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0128098\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0128098\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKo HHT, Lareu RR, Dix BR, Hughes JD. \u003cem\u003eIn vitro\u003c/em\u003e antibacterial effects of statins against bacterial pathogens causing skin infections. Eur J Clin Microbiol Infect Dis. 2018;37(6):1125\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10096-018-3227-5\u003c/span\u003e\u003cspan address=\"10.1007/s10096-018-3227-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZgurskaya HI, L\u0026oacute;pez CA, Gnanakaran S. Permeability barrier of Gram-negative cell envelopes and approaches to bypass It. ACS Infect Dis. 2015;1:512\u0026ndash;22. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acsinfecdis.5b00097\u003c/span\u003e\u003cspan address=\"10.1021/acsinfecdis.5b00097\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu G, Vellucci VF, Kyc S, Hostetter MK. Simvastatin inhibits \u003cem\u003eCandida albicans\u003c/em\u003e biofilm \u003cem\u003ein vitro\u003c/em\u003e. Pediatr Res. 2009;66(6):600\u0026ndash;4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1203/PDR.0b013e3181bd5bf8\u003c/span\u003e\u003cspan address=\"10.1203/PDR.0b013e3181bd5bf8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamińska M, Aliko A, Hellvard A, Bielecka E, Binder V, Marczyk A, et al. Effects of statins on multispecies oral biofilm identify simvastatin as a drug candidate targeting \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e. J Periodontol. 2019;90(6):637\u0026ndash;46. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/JPER.18-0179\u003c/span\u003e\u003cspan address=\"10.1002/JPER.18-0179\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHall S, McDermott C, Anoopkumar-Dukie S, McFarland AJ, Forbes A, Perkins AV, et al. Cellular effects of pyocyanin, a secreted virulence factor of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. Toxins. 2016;8:236.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorkunas B, Galloway WR, Wright M, Ibbeson BM, Hodgkinson JT, O'Connell KM, et al. Inhibition of the production of the \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e virulence factor pyocyanin in wild-type cells by quorum sensing autoinducer-mimics. Org Biomol Chem. 2012;10(42):8452\u0026ndash;64. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1039/C2OB26501J\u003c/span\u003e\u003cspan address=\"10.1039/C2OB26501J\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGellatly SL, Hancock RE. \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e: New insights into pathogenesis and host defenses. Pathog Dis. 2013;67:159\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeras B, Scanlon MJ, Martin JL. Targeting virulence not viability in the search for future antibacterials. Br J Clin Pharm. 2015;79:208\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGajd\u0026aacute;cs M, Spengler G. The role of drug repurposing in the development of novel antimicrobial drugs: Non-antibiotic pharmacological agents as quorum sensing-inhibitors. Antibiotics. 2019;8(4):270. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/antibiotics8040270\u003c/span\u003e\u003cspan address=\"10.3390/antibiotics8040270\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChugani S, Greenberg EP. The influence of human respiratory epithelia on \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e gene expression. \u003cem\u003eMicrob. Pathog.\u003c/em\u003e 2007; \u003cem\u003e42\u003c/em\u003e, 29\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.micpath.2006.10.004\u003c/span\u003e\u003cspan address=\"10.1016/j.micpath.2006.10.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdelaziz AA, El-Barrawy MA, El‐Nagar RAM. Potent synergistic combination of rosuvastatin and levofloxacin against \u003cem\u003eStaphylococcus aureus\u003c/em\u003e: \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e study. J Appl Microbiol. 2021;131(1):182\u0026ndash;96. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/jam.14968\u003c/span\u003e\u003cspan address=\"10.1111/jam.14968\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThangamani S, Mohammad H, Abushahba MF, Hamed MI, Sobreira TJ, Hedrick VE, et al. Exploring simvastatin, an antihyperlipidemic drug, as a potential topical antibacterial agent. Sci Rep. 2015;5:16407. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/srep16407\u003c/span\u003e\u003cspan address=\"10.1038/srep16407\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStatt S, Ruan JW, Jhen-Wei, Hung LY, Chang CY, Huang CT, et al. Statins enhance cellular resistance against bacterial pore-forming toxins in airway epithelial Cells. Am J Respir Cell Mol Biol. 2015;53(5):689\u0026ndash;702. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1165/rcmb.2014-0391OC\u003c/span\u003e\u003cspan address=\"10.1165/rcmb.2014-0391OC\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlagić-Džambić L, Omerović S, Džambić M. Antimicrobial activity of rosuvastatin. IJPT. 2015;6(4):7587\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlhede M, Bjarnsholt T, Givskov M, Alhede M. \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e Biofilms: Mechanisms of Immune Evasion. Adv Appl Microbiol. 2014;86:1\u0026ndash;40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/B978-0-12-800262-9.00001-9\u003c/span\u003e\u003cspan address=\"10.1016/B978-0-12-800262-9.00001-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStoltz DA, Ozer EA, Ng CJ, Yu JM, Reddy ST, Lusis AJ, et al. Paraoxonase-2 deficiency enhances \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e quorum sensing in murine tracheal epithelia. Am J Physiol Lung Cell Mol Physiol. 2007;292:852\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOzer EA, Pezzulo A, Shih DM, Chun C, Furlong C, Lusis AJ, et al. Human and murine paraoxonase 1 are host modulators of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e quorum-sensing. FEMS Microbiol Lett. 2005;253:29\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerma N, Srivastava S, Malik R, Goyal P, Pandey J. Inhibition and disintegration of \u003cem\u003eBacillus subtilis\u003c/em\u003e biofilm with small molecule inhibitors identified through virtual screening for targeting TasA\u003csub\u003e(28\u0026ndash;261)\u003c/sub\u003e, the major protein component of ECM. J Biomol Struct Dyn. 2023;41:2431\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi WR, Zeng TH, Xie XB, Shi QS, Li CL. Inhibition of the pqsABCDE and pqsH in the pqs quorum sensing system and related virulence factors of the \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e PAO1 strain by farnesol. Int Biodeterior Biodegrad. 2020;151:104956.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaneko M, Togashi N, Hamashima H, Hirohara M, Inoue Y. Effect of farnesol on mevalonate pathway of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e. J Antibiot. 2011;64:547\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ja.2011.49\u003c/span\u003e\u003cspan address=\"10.1038/ja.2011.49\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang CC, Yang PW, Yang SF, Hsieh KP, Tseng SP, Lin YC. Topical simvastatin promotes healing of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e-contaminated cutaneous wounds. Int Wound J. 2016;13(6):1150\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/iwj.12431\u003c/span\u003e\u003cspan address=\"10.1111/iwj.12431\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Pseudomonas aeruginosa, Atorvastatin, Rosuvastatin, virulence inhibition, qRT-PCR, Molecular docking","lastPublishedDoi":"10.21203/rs.3.rs-4031656/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4031656/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eStudy of the \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e resistance has become an urgent topic since antibiotic resistance has escalated exceedingly. Even with the intense interest, development of new antibiotics and other therapeutic strategies for \u003cem\u003eP. aeruginosa\u003c/em\u003e infections is at a painstakingly slow pace due to the complexity of drug resistance, as well as the lack of a deep understanding of the pathogenic mechanisms for \u003cem\u003eP. aeruginosa\u003c/em\u003e. Repurposing of the already FDA-approved drugs is one of the promising strategies in combating \u003cem\u003ePseudomonas\u003c/em\u003e resistance or virulence.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eIn this study we tested the anti-virulence effect of sub-minimum inhibitory concentration (MIC) of atorvastatin and rosuvastatin against \u003cem\u003eP. aeruginosa.\u003c/em\u003e The assessed virulence factors include: biofilm formation and production of pyocyanin, protease, hemolysin and rhamnolipids. Significantly, atorvastatin and rosuvastatin decreased the production of bacterial biofilm and reduced other virulence factors. Moreover, the anti-quorum sensing (QS) activity of atorvastatin and rosuvastatin was assessed using qRT-PCR. the expression of QS genes was reduced using atorvastatin and rosuvastatin. Furthermore, \u003cem\u003ein-vivo\u003c/em\u003e capability of statins to protect mice against \u003cem\u003eP. aeruginosa\u003c/em\u003e was assessed, both drugs protected mice from \u003cem\u003eP. aeruginosa\u003c/em\u003e and enhanced their survival. In addition, molecular docking was used to evaluate binding between statin and QS-receptors, rosuvastatin showed better interaction with QS-receptors than atorvastatin, as rosuvastatin has higher binding scores with LasR, RhlR, and LasB, while atorvastatin showed higher binding with the PqsR.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003estatins attenuated the pathogenicity of \u003cem\u003eP. aeruginosa\u003c/em\u003e, locating it as a plausible potential therapeutic agent for the treatment of its infections.\u003c/p\u003e","manuscriptTitle":"Modulating Pseudomonas aeruginosa virulence by the anti-cholesterol drugs Atorvastatin and Rosuvastatin","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-03 07:11:18","doi":"10.21203/rs.3.rs-4031656/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cc92e3c4-6d80-4c06-8a88-fdf8ee368da0","owner":[],"postedDate":"April 3rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-01-27T10:09:02+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-03 07:11:18","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4031656","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4031656","identity":"rs-4031656","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.