IRAK2 contributes to triple-negative breast cancer growth via NF-κB, ERK and stress-related signaling pathways

IRAK2 contributes to triple-negative breast cancer growth via NF-κB, ERK and stress-related signaling pathways | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article IRAK2 contributes to triple-negative breast cancer growth via NF-κB, ERK and stress-related signaling pathways Francesca Ferraro, Anja Steinle, Harini Narasimhan, Andreas Bleilevens, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1802684/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Purpose We previously screened kinases whose depletion elicited a differentiation response of the triple-negative breast cancer (TNBC) cell line MDA-MB-468. In particular, we demonstrated that the downregulation of the kinases ERN1 and ALPK1 affected cellular proliferation, self-renewal and tumor-forming capacity. Interleukin-1 receptor-associated kinase 2 (IRAK2) was identified in the screening and IRAK2 is highly enriched in our established breast cancer stem cells (BCSCs) isolated from human tumors of TNBC. Therefore, we wondered if IRAK2 depletion could affect BCSCs growth. Methods We downregulated IRAK2 in BCSCs and MDA-MB-468 by lentivirus-mediated shRNA targeting and assessed the effects of the knockdown evaluating keratins expression, cellular proliferation and self-renewal capacity. We injected the cells into the mammary glands of mice to evaluate the impact of IRAK2 knockdown on their tumor-forming capacity. We investigated the expression of genes belonging to IRAK2 pathway and related to cancer proliferation, UPR, autophagy and apoptosis in presence of IRAK2 downregulation. We performed transcriptome analysis to have an overview of the pathways affected by the knockdown. Results Cells characterized by IRAK2 downregulation exhibited decreased proliferation, sphere-forming capacity and delayed tumor formation. IRAK2 knockdown impaired NF-κB and ERK phosphorylation, IL-6 and cyclin D1 expression. Moreover, IRAK2 downregulation mitigated ERN1 signalling and autophagy, pathways adopted by cells to manage stress conditions, and induced apoptosis. Conclusion We showed that IRAK2 contributes to TNBC tumorigenicity and its knockdown compromises cellular ability to sustain aggressive growth and to endure cellular stress. Therefore we suggest IRAK2 as a promising target for the impairment of TNBC. triple-negative breast cancer breast cancer stem cells IRAK2 endoplasmic reticulum stress NF-κB ERK Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Breast cancer is the most common and second deadliest cancer diagnosed in women [ 1 ]. It can be categorized into luminal A, luminal B, human epidermal receptor 2 (HER2) enriched and triple-negative breast cancer (TNBC) depending on its estrogen, progesterone and HER2 receptors status [ 2 ]. TNBC lacks the expression of these receptors, which are commonly targeted in breast cancer therapies, and therefore provides limited treatment options [ 3 ]. A strong presence of breast cancer stem cells (BCSCs) in the tumor bulk is characteristic for TNBC, likely causing its aggressive nature [ 2 ]. BCSCs are a subset of cancer cells able to self-renew and to differentiate into heterogeneous lineages of breast cancer cells, sustaining the tumor growth [ 4 ]. Our laboratory isolated BCSCs from human tumors of TNBC, which form xenografts highly similar in their gene expression profile and histologically to the tumors of origin [ 5 – 8 ]. We previously reported several kinases responsible for stem cell maintenance in TNBC, among them Interleukin-1 Receptor Associated Kinase 2 (IRAK2) was identified [ 7 ]. IRAK2 is a serine/threonine kinase that participates in the “Myddosome” formation with other components of the IRAK family upon toll-like / interleukin-1 receptors (TLR/IL1R) activation [ 9 , 10 ]. IRAK2 pathway induces Nuclear Factor κ-light-chain-enhancer of activated B cells (NF-κB) and Mitogen-Activated Protein Kinases (MAPK) phosphorylation [ 10 ]. Extracellular Signal-Related Kinase 1/2 (ERK1/ERK2) is a subfamily of MAPK that induces the expression of genes involved in cellular proliferation, as cyclin D1 [ 11 ]. IRAK2, through Endoplasmic Reticulum to Nucleus 1 (ERN1) interaction, contributes to the unfolded protein response (UPR), a pathway that promotes cell survival and adaptation to stress [ 12 , 14 ]. In presence of ER stress, ERN1 excises IRE1α-X-box-binding protein 1 (Xbp1) mRNA, leading to the expression of chaperones and protein degradation factors, increasing the ER protein folding capacity [ 15 ]. UPR, autophagy and apoptosis are pathways finely regulated: cells integrate signals and, if their fate is to survive, activate UPR and autophagy, blocking apoptosis; if survival is not favorable, apoptosis is no more inhibited [ 16 ]. Since we previously identified IRAK2 as a potential stemness gatekeeper in TNBC, in the present study we elucidated its mode of action in our primary isolated BCSCs and MDA-MB-468 cell line. The effects of IRAK2 downregulation on cellular phenotype, proliferation, sphere-forming capacity and tumorigenicity were assessed. Moreover, the molecular pathways affected in the context of UPR, autophagy and apoptosis were explored. Finally, we performed transcriptome analysis to establish the common pathways differentially regulated by IRAK2 downregulation. 2. Materials And Methods 2.1. Cell culture BCSC1-5 were isolated from human TNBC specimens and cultured as previously described [ 5 , 6 , 8 ]. MDA-MB-468 (ATCC) present a GFP nuclear tag and was cultivated in DMEM (Gibco, 41966-029), 10% FBS (Gibco, 10500-064), 1% Penicillin/Streptomycin (Gibco, 15140-122). MDA-MB-468 with inducible knockdown were cultured with FBS without Tetracycline (Clontech, 631106) to avoid uncontrolled gene downregulation. 2.2. Lentiviral production and knockdown Stable or inducible control and knockdown vectors were designed by Pedro Aza Blanc (Sanford Burnham Institute, La Jolla, CA, USA). 1000 ng of the vectors of interest were incubated for 30 minutes in six-well plates (Falcon, 353046) with 400 µl of Opti-MEM (Life Technologies, 11058021), 4 µl of X-tremeGeneTM Transfection Reagent (Sigma Aldrich, 6366236001), 700 ng of pCMVdR8.74 (Addgene plasmid, #22036) and 350 ng of pMDVSVG (Addgene plasmid, #8454). Two million of 293FT cells (Invitrogen, #11625) were added to each well and 24 hours later medium was replaced with fresh UltraCULTURE™ (Lonza, 12-725F). 48 and 72 hours later medium containing lentiviruses was harvested and centrifuged at 500 g, room temperature (RT), for 10 minutes. The supernatant was filtered with 0.45 µm filters (Whatmann, WH10462100), overlayed at a 4:1 ratio with 10% sucrose-containing buffer [ 17 ], and centrifuged at 10000 g for four hours at 4°C. Pellets were resuspended in UltraCULTURE™. Lentivirus was serially diluted 1:2 in DMEM containing 15 µg/ml polybrene (Sigma Aldrich, 107689) and titrated on seeded 293FT cells, that were centrifuged at 1000 g for one hour. Selection was performed with 2 µg/ml of Puromycin (Sigma Aldrich, P8833-10MG). The highest viral dilution infecting cells was chosen as the multiplicity of infection (MOI) of one. Different MOI were tested on each cell line before proceeding with their infection. Cells were infected at the optimal MOI in medium containing 8 µg/ml polybrene, plates were centrifuged at 1000 g, RT, for one hour. pLKO-Tet-On vectors were used to perform inducible knockdown [ 18 , 19 ] supplementing cell media with 100 ng/ml of Doxycycline Hyclate (Sigma, D9891), refreshed every 48 hours. 2.3. Proliferation assay Cells were seeded at 3X10 3 cells/well in 96-well culture plates (Falcon, 353072) and their growth was followed with IncuCyte® Live-Cell Analysis System. After one week growth curves were built considering “cells percentage of confluency” for BCSCs or “green object count per image” for MDA-MB-468. 2.4. Sphere-forming capacity 2X10 2 or 2.5X10 2 cells were seeded in each well of a 96-well low-attachment flat bottom plate (Cornig, 3474) in 1:1 dilution with matrigel. 30 minutes after seeding, medium was added and the cells were let grow for two weeks. Sphere-forming capacity was quantified as the ratio between the spheres counted after two weeks and the number of cells seeded per well. 2.5. Immunofluorescence staining Adherent cells were washed with 1X PBS (Gibco, 70011-036), fixed with ice-cold methanol (VWR Chemicals, 20847295) at 4°C for 15 minutes, rinsed with PBS, permeabilized with 1X TBST and blocked with 1 mg/ml albumin (Carl Roth GmbH, 8076.4)/PBS. Cells were incubated overnight at 4°C with primary antibody and the following day incubated at RT for one hour with secondary antibody. Nuclei were stained with DAPI (Sigma Aldrich, D9542). Primary antibodies anti-keratin 5 (Covance PRB – 160P, 1:250), anti-keratin 8 (Biolegend, C5301, 1:250), anti-keratin 14 (Covar, #PRB-155P, 1:250), anti-keratin 18 (DAKO, M7010, 1:250) and anti-LC3-II (Cell Signaling, #38689, 1:1600) were used. Secondary antibodies Alexa Fluor 488 Donkey anti-Rabbit (ThermoFisher, #A21206, 1:500) and Alexa Fluor 468 Donkey anti-Mouse (Invitrogen, #A10037, 1:500) were used. 2.6. Immunohistochemistry Xenografts collected from in vivo experiments were fixed in PFA 4% for 24 hours at 4°C, embedded in paraffin, sliced in 2 µm thick sections and mounted on glass slides. DAB staining was performed immersing the slides in Xylol and descending concentration of Ethanol (100%, 96% and 70%; PanReac AppliChem, A4230). Antigens were retrieved using Citrate buffer (Dako, S236984) for one hour at 96°C. Slides were immersed in 5% H2O2/methanol (Perdrogen, SA31642) for 15 minutes and incubated with primary antibody overnight at 4°C. Slides were incubated for 40 minutes at RT with secondary antibody, exposed to DAB solution (Dako, K3468), stained with Hematoxylin (Dako, C5700), fixed and covered with mounting solution (Medite, 41401100) and a coverslip. DAB staining was quantified using ImageJ (HDAB in Color Deconvolution option). Optical density was evaluated using the equation \(OD=Log (\text{max}intensity ÷mean intensity )\) with max intensity = 255 and mean intensity = mean gray value calculated by ImageJ. Primary antibodies anti-ki67 (Sigma-Aldrich, #SAB4501880, 1:100) and anti-cyclin D1 (Invitrogen #PA532373, 1:100) were used. The secondary antibody Polyclonal Goat anti-Rabbit (Dako, #P044801, 1:100) was used. 2.7. RNA isolation and qRT-PCR RNA was extracted from cells pellet using miRNeasy® Mini Kit (Qiagen, 1038703) and reverse transcription was performed using EvoScript Reverse Transcriptase kit (Roche, 07912323001) following the manufacturer’s instructions. Samples were run in Roche’s LightCycler 480 with an activation step of 10 minutes at 95°C, amplification step repeated 50 times with each step consisting of 15 seconds at 95°C and one minute at 60°C and a last cooling step at 40°C. Primers and UPL used are indicated in the supplemented table (Table 1 ). Table 1 Primers and UPL used in qRT-PCR Gene Forward (5’-3’) Reverse (5’-3’) UPL ACTB CCAACCGCGAGAAGATGA CCAGAGGCGTACAGGGATAG #64 CCND1 GCTGTGCATCTACACCGACA TTGAGCTTGTTCACCAGGAG #55 CHOP AAGCAGCGCATGAAGGA G GCCGTTCATTCTCTTCA GCTA #2 ERN1 CTGCCCATCAACCTCTCTTC AGCTCTCGGGTTTTGGTGT #9 IRAK2 ATTCTTCCAGGCAGAGTTGC GCCCAGCACAGGTAAGACAT #87 XBP1 SP AGTTAAGACAGCGCTTGGGG TGCACCTGCTGCGGACTCAG #37 2.8. Protein isolation and western blot Lysis solution was prepared following cOmplete™ Lysis-M solution (Roche, 11697498001) manufacturer’s instructions supplementing it with 1:10 of PhosSTOP (Sigma, 93106075). Cell pellet was resuspended in 30–50 µl of lysis solution, incubated on ice for 30 minutes, centrifuged at 4°C for 15 minutes at 13000 rpm and the supernatants were stored at -80°C. Protein quantification was performed with the DC™ Protein Assay Kit II (Bio-Rad Laboratories, 5000112). 20 µg of proteins were loaded in Mini-PROTEAN TGX Precast Gels (Bio-Rad Laboratories, 456–9036), transferred on Trans-Blot® Turbo Transfer System (Bio-Rad laboratories, 1704156) membranes and incubated OVN at 4°C with primary antibody. The following day membranes were incubated at RT for one hour with secondary antibody, developed using the WEST-ZOL® plus Detection System (16024, iNtRON Biotechnology). Membranes were occasionally stripped incubating them for 45 minutes in stripping buffer (20 ml SDS 10%, 12.5 ml Tris HCl, 67.5 ml water, 0.8 ml ß-mercaptoethanol, pH 6.8). The primary antibodies anti-IRAK2 (Cell Signaling, #4367S, 1:1000), anti-IL-6 (Biozol, LS-C #165212, 1:1000), anti-cyclinD1 (Invitrogen, #PA532373, 1:1000), anti-ERN1 (Proteintech, #27528-1, 1:1000), anti-CHOP (Sigma Aldrich, #SAB5700602, 1:1000), anti-Bak1 (ThermoFisher, #MA5-32111, 1:1000), anti-ERK (Cell Signaling, #4696S, 1:1000), anti-P-ERK (Cell Signaling, #9101S, 1:1000) were used. The secondary antibodies Polyclonal Goat Anti Rabbit (Dako agilent, #P044801, 1:2000) and Polyclonal Rabbit Anti Mouse (Dako agilent, #P0260, 1:2000) were used. 2.9. ER stress induction 1X10 5 cells were exposed to 100 ng/ml Doxycycline for three days and subsequently treated for three hours with 5 µM Thapsigargin (Sigma Aldrich, T9033), followed by RNA isolation. 2.10. Autophagy evaluation Apopxin is an apoptosis sensor since it presents green fluorescence upon binding to membrane phosphatidylserine (PS). IRAK2 knockdown was induced with 100 ng/ml Doxycycline in BCSC1 and BCSC3 for four days and afterward, 1X10 4 cells/well were seeded in a 96-well culture plate, treated overnight with Chloroquine (Sigma-Aldrich, C6628-25G) 10 µM and subsequently fixed. After LC3-II immunofluorescence staining, vesicles puncta were quantified using the ImageJ plugin Automatic Nuclei Counter ITCN. Channels images were split, green images (LC3-II staining) were inverted and, using the plugin ITCN, the width (5 for BCSC1, 6 for BCSC3), minimum distance (2.5 for BCSC1, 3 for BCSC3) and threshold (1.5) to consider were defined. “Detect Dark Peaks” was selected and green spots (LC3-II puncta) were counted. Subsequently, nuclei in the blue images (DAPI staining) were manually counted. Autophagy was quantified evaluating the ratio between the counted dark peaks over the number of nuclei per picture. 2.11. Apoptosis assay BCSC1 and BCSC3 were seeded at 1X10 4 cells/well in 96-well plates in presence of 100 ng/ml Doxycycline and apoptosis was assessed using the Apoptosis Assay kit (Abcam, ab176749) following manufacturer’s instructions. Green fluorescence was measured at Ex/Em = 490/525 nm with IncuCyte® Live-Cell Analysis System. Apoptosis was quantified considering green fluorescence measured over cell confluence. 2.12. NF-κB phosphorylation assay BCSC1 and BCSC3 were treated with 100 ng/ml Doxycycline for four days and seeded at 3X10 4 cells/well in 96-well culture plates. The EnzyFluo Phosphorylation Assay kit (BioAssay Systems, ABIN5691837) was used to quantify phosphorylated and total NF-κB following the manufacturer’s instructions. 2.13. Orthotopic Breast Cancer Xenografts 1x10 4 or 1x10 5 BCSCs or MDA-MB-468, with stable or inducible knockdown, were mixed with one million of irradiated fibroblasts (Hs27, ATCC, CRL-1634). Matrigel was added at 1:1 ratio and mixture was injected into the mammary fat pad of the 4th glands of NOD/SCID female mice. In the case of cells characterized by the inducible knockdown, when the first xenografts reached 3 mm diameters, IRAK2 knockdown was induced by feeding the animals ad libitum three times a week with gelatin containing 2 mg/ml Doxycycline and 0.08 g/ml of sugar. When the xenografts reached a diameter close to 15 mm, animals were sacrificed. For BCSC1 three mice received control BCSC1 and three IRAK2 knockdown BCSC1. For the stable knockdown animals were sacrificed after 28 days, for the inducible knockdown animals received Doxycycline for 19 days and were sacrificed 34 days after surgery. For MDA-MB-468 three mice were used as control and four for IRAK2 knockdown. They received knockdown induction for 27 days and were sacrificed 57 days after surgery. To isolate RNA and proteins from xenografts, 30–50 mg of tissue were disrupted with a tissue grinder. 700 µl of Qiazol lysis reagent was added to the tissue to isolate RNA following the usual procedure. Proteins lysis solution was added to the tissue and centrifuged for one minute at 2000 rpm at 4°C to isolate proteins. 2.14. Sequencing The library preparation method used was Invitrogen™ Collibri™ 3’ mRNA Library Prep Kit. Sequencing was performed as single read 1X 75 bp using the sequencing kit NextSeq 500/550 High Output Kit v2.5 (75 cycles) High Output Kit v2.5 (75 cycles) using NextSeq 500 instrument (Illumina). FASTQ files were generated using bcl2fastq (Illumina). To facilitate reproducible analysis, samples were processed using the publicly available nf-core/RNA-seq pipeline version 3.4 [ 20 ] implemented in Nextflow 21.04.0 [ 21 ] using Docker 20.10.8 [ 22 ] with the minimal command. Lane-level reads were trimmed using Trim Galore 0.6.7 [ 23 ] and aligned to the human genome (GRCh38.p13) using STAR 2.7.9a [ 24 ]. The gene-level assignment was then performed using featureCounts 1.6.457 [ 25 ] and transcript-level quantification was done by Salmon v1.5.2 [ 26 ]. Analysis was performed using custom scripts in R version 4.1.1 using the DESeq2 v.1.32.0 framework [ 27 ]. Differential expression analysis was done with DESEQ2 package in R [ 27 ] and following the instruction for Salmon quantification (Analyzing RNA-seq data with DESeq2). Gene ontology analysis was performed using the website ShinyGO and genes upregulated/downregulated classification analysis was performed using PANTHER classification system. 2.15. Statistical Analysis Significance was calculated as indicated with unpaired/paired t-test or Wilcoxon or Mann-Whitney test using GraphPad Prism. Data are expressed as mean SD ± standard error of mean (SEM). ns: P > 0.05; *: P ≤ 0.05; **: P ≤ 0.01; ***: P ≤ 0.001; ****: P ≤ 0.0001. 3. Results 3.1. IRAK2 is enriched by primary triple-negative breast cancer stem cell lines We isolated several primary BCSC lines from human tumors of TNBC, five of which were named BCSC1, BCSC2, BCSC3, BCSC4 and BCSC5 [ 5 , 6 , 8 ]. IRAK2 expression was assessed in these primary cell lines and the commercial cell line MDA-MB-468 at mRNA and protein levels (Fig. 1 a, 1 b and 1 c). BCSCs presented varying expression levels of IRAK2. Precisely, IRAK2 was strongly expressed in BCSC1, BCSC2 and BCSC5 compared to BCSC3, BCSC4 and MDA-MB-468. RNA microarray analysis showed elevated IRAK2 expression in primary cell lines compared to respective xenografts and tumors (Fig. 1 d), identifying IRAK2 as a BCSCs marker. Using a stable knockdown, IRAK2 expression was downregulated in BCSCs. BCSC1 knockdown cells presented 50% IRAK2 downregulation at mRNA level (Fig. S1b), confirmed at protein level (Fig. S1c and S1d), and showed tighter, smaller colonies compared to control cells (Fig. S1a). BCSC2 and BCSC5 showed a 60% IRAK2 knockdown at mRNA level and almost no phenotypic or proliferative alteration. BCSC3 and BCSC4 were highly affected by the knockdown and could not be cultivated further. Follow-up experiments were performed with BCSC1. We demonstrated that BCSC1 with IRAK2 downregulation showed significant slower proliferation (Fig. S1e). Furthermore, we evaluated shIRAK2 BCSC1 sphere-forming capacity to investigate stemness features and found it reduced by 53% (Fig. S1f and S1g). Considering that BCSCs viability, particularly BCSC3 and BCSC4, was impaired after IRAK2 stable knockdown, an inducible system was subsequently adopted, controlling IRAK2 shRNA transcription through Doxycycline administration [ 18 , 19 ]. Inducible knockdown was performed in BCSC1, BCSC2, BCSC3, BCSC5 and MDA-MB-468. After the infection and selection, cells were assessed for proliferation and sphere-forming capacity in presence of the knockdown. Although BCSC2 and BCSC5 presented a respective mRNA knockdown of 31% and 51%, they did not show phenotypic or proliferative alteration being excluded from follow-up experiments. Upon Doxycycline administration, BCSC1 presented IRAK2 70% knockdown at mRNA level, BCSC3 of 65% and MDA-MB-468 of 37% (Fig. 1 e). IRAK2 knockdown was confirmed in all cell lines at protein level (Fig. 1 f and 1 g). 3.2. IRAK2 downregulation affects BCSCs and MDA-MB-468 proliferation and sphere-forming capacity Upon IRAK2 induced downregulation, BCSCs and MDA-MB-468 displayed phenotypic changes, cells grew sparser and presented fewer cell-cell contacts (Fig. 2 a). Morphology changes characterizing the knockdown cells remained stable throughout sub-cultivation. BCSC1 presenting IRAK2-induced knockdown reproduced a phenotype analogous to the stable one, originating tighter and smaller colonies compared to control cells (Fig. 2 a). All cell lines presented significantly decreased proliferation in presence of IRAK2 induced knockdown (Fig. 2 b), suggesting that IRAK2 expression confers growth advantage. Particularly, BCSC3 and MDA-MB-468 knockdown cells proliferated dramatically less than their respective controls and never reached confluency (Fig. 2 b). BCSC1, BCSC3 and MDA-MB-468 sphere-forming capacity was assessed to investigate the effects of IRAK2 downregulation on cellular self-renewal. Sphere-forming capacity was reduced by 33% in shIRAK2 BCSC1, by 71% in BCSC3 and by 83% in MDA-MB-468 (Fig. 2 c and 2 d), confirming that IRAK2 is involved in cellular self-renewal capacity in vitro . We previously described IRAK2 downregulation inducing bi-potent cell line MDA-MB-468 luminal-like differentiation, impairing K5 and inducing K8 expression [ 7 ]. BCSC1 and BCSC3 present a bi-lineage phenotype as well, expressing both luminal epithelial and myoepithelial keratins [ 8 ]. Assessing keratins expression in control and shIRAK2 BCSC1 and BCSC3, there was not a significant difference, suggesting persistent luminal epithelial and myoepithelial characteristics of the cells (Fig. S2a and S2b). Consequently, we hypothesized that the effects on proliferation and self-renewal seen in primary BCSCs might not reflect the differentiation phenotype observed in the longtime established and homogenous MDA-MB-468 cell line. 3.3. IRAK2 knockdown delays BCSC1 and MDA-MB-468 tumor-forming capacity in vivo Given that we previously showed that BCSC1 transplanted into mice exhibits high tumorigenic potential [ 6 ], we wondered if IRAK2 downregulation could affect its tumor-forming ability. We reported that xenografts characterized by IRAK2 stable knockdown, which was confirmed at protein level (Fig. S3d and S3e), were smaller (Fig. S3a and S3b). Moreover, IRAK2 knockdown xenografts grew slower and weighted less compared to control xenografts (Fig. S3b and S3c). The expression of the proliferation marker ki67 was analyzed to identify proliferative differences, but we could not observe significant difference between control and knockdown tumors (Fig. S3f). BCSC1 and MDA-MB-468 tumorigenicity was subsequently evaluated using a Doxycycline feeding paradigm to assess the effects of IRAK2 downregulation after initial tumor growth. When BCSC1 and MDA-MB-468 xenografts reached 3 mm diameter, IRAK2 knockdown was induced by feeding mice with gelatin containing Doxycycline. IRAK2 knockdown in BCSC1 and MDA-MB-468 xenografts was confirmed at mRNA and protein levels (Fig. 3 d, 3 e and 3 f). BCSC1 and MDA-MB-468 shIRAK2 xenografts were significantly smaller and their growth was significantly delayed (P < 0.05) (Fig. 3 a and 3 b). BCSC1 and MDA-MB-468 shIRAK2 xenografts weight was reduced compared to respective controls (Fig. 3 c). Interestingly, MDA-MB-468 formed micrometastasis around the primary tumor, mainly in control animals (Fig. 3 a, right panels). Four out of six control xenografts presented one to three micrometastatic growths, while four out of eight shIRAK2 MDA-MB-468 xenografts presented only one small micrometastatic growth (Fig. 3 a, right side). These results confirmed our initial hypothesis of IRAK2 being involved in TNBC progression, as its stable or induced downregulation significantly delayed tumor growth. 3.4. IRAK2 downregulation affects NF-κB and ERK phosphorylation and IL-6 and cyclin D1 expression in BCSCs and MDA-MB-468 Since IRAK2 contributes to TLRs/IL-1Rs signaling and the UPR, pathways that activate NF-κB, we evaluated NF-κB phosphorylation upon IRAK2 induced knockdown. BCSC1 and BCSC3 presented decreased NF-κB phosphorylation after IRAK2 knockdown induction (Fig. 4 a). NF-κB activation may lead to IL-6 expression, therefore IRAK2 knockdown effects on IL-6 expression were evaluated performing western blot analysis. IL-6 was downregulated in shIRAK2 BCSC1 and BCSC3 (Fig. 4 b and 4 c). Since ERK may be activated downstream IRAK2 pathway activation, we assessed its phosphorylation, reporting it was significantly decreased in shIRAK2 BCSC3 and MDA-MB-468 (Fig. 4 d and 4 e). Given that IRAK2 downregulation impaired BCSC1, BCSC3 and MDA-MB-468 ability to proliferate, cyclin D1 expression was evaluated, as it allows cell cycle progression from G1 to S phase [ 28 ]. Furthermore, cyclin D1 expression can be induced by NF-κB translocation and ERK pathway [ 29 , 30 ]. Cyclin D1 expression was significantly decreased at protein level in shIRAK2 cells (Fig. 4 f and 4 g). Moreover cyclin D1 expression assessed by immunohistochemistry was affected in induced shIRAK2 BCSC1 xenografts (Fig. S4). These results indicated that IRAK2 is required for the activation of proteins recruited downstream its pathway. In particular, IRAK2, activating NF-κB and ERK pathways, which in turn promote cyclin D1 and IL-6 expression, favors cellular survival and tumor-progression ability. 3.5. IRAK2 is upregulated by ER stress and it participates in ERN1 pathway Given that previous studies showed IRAK2 contribution to the UPR signaling and our cells looked highly affected by IRAK2 knockdown, we reasoned that the phenotype we observed might result from cellular impaired ability to handle stress [ 12 ]. Thapsigargin was used to induce ER stress in BCSC1, BCSC3 and MDA-MB-468, and UPR genes expression was evaluated at mRNA level comparing the effects of IRAK2 knockdown and Thapsigargin exposure (Fig. 5 a). As expected, cells presented increased ERN1 and CHOP expression and augmented Xbp1 splicing in presence of Thapsigargin-induced ER stress. Interestingly, IRAK2 expression was likewise increased in presence of ER stress, as well as ERN1 and CHOP mRNA transcription and Xbp1 splicing were reduced upon IRAK2 downregulation. IRAK2 contribution to ERN1 pathway activation was confirmed in BCSC3, since in presence of ER stress and IRAK2 downregulation ERN1 and CHOP expression was decreased and Xbp1 splicing was reduced. At the protein level, ERN1 expression was significantly decreased in shIRAK2 BCSC1, BCSC3 and MDA-MB-468 (Fig. 5 b and 5 c), whereas CHOP expression was affected but not significantly (Fig. 5 d and 5 e). These results suggested that the phenotype observed upon IRAK2 knockdown could be correlated to IRAK2 interaction with ERN1. IRAK2 downregulation, affecting ERN1 pathway that favors homeostasis restoration in presence of stress, impairs cells ability to properly handle and overcome cellular stress, compromising cells proliferation and viability. 3.6. IRAK2 downregulation affects BCSC1 and BCSC3 autophagy and induces apoptosis Since UPR and autophagy are pathways strictly related and we previously showed IRAK2 participation in the UPR through ERN1 signaling pathway, we investigated autophagy in BCSC1 and BCSC3. Vesicles puncta quantification displayed decreased autophagy in shIRAK2 BCSC1 and BCSC3 (Fig. 6 a and 6 b). These results suggested that IRAK2, as well as mediating UPR, is also involved in autophagy, another pathway often exploited by cells to manage stress conditions. Given that UPR and autophagy pathways can switch to apoptosis when cells are incapable of restoring homeostasis, we evaluated if IRAK2 knockdown could also affect cells apoptotic processes. BCSC1 and BCSC3 showed increased apoptosis upon IRAK2 induced downregulation, which was statistically significant in BCSC3 (Fig. 6 c and 6 d). Moreover, evaluating the expression of the pro-apoptotic protein Bcl-2 homologous antagonist/killer (Bak1) in BCSC1, BCSC3 and MDA-MB-468, it was increased in IRAK2 induced knockdown BCSC3 compared to control cells (Fig. 6 e). These data suggested that IRAK2 participates to the activation of pathways that are necessary to regulate stress and restore homeostasis, and their impairment leads the cells towards apoptosis. 3.7. IRAK2 knockdown affects pathways related to proliferation, response to stimuli and signal transduction Transcriptome analysis of shIRAK2 BCSC1, BCSC3 and MDA-MB-468 revealed that BCSC3 is highly affected by IRAK2 knockdown, presenting 1479 downregulated and 1103 upregulated genes, while BCSC1 and MDA-MB-468 display lesser genetic perturbation (Fig. 7 a). Thus, there are not many genes that are commonly downregulated or upregulated by the three cell lines upon IRAK2 knockdown (Fig. 7 b and 7 c). BCSC1, BCSC3 and MDA-MB-468 present one commonly and significantly downregulated gene, CMTM6, and one commonly upregulated, TAGLN. Genes commonly downregulated by BCSC1 and BCSC3 present gene ontology enrichment and belong to pathways involved in cell response to stimulus, communication, signal transduction and migration (Fig. S5a). shIRAK2 BCSC3 and MDA-MB-468 present common downregulation of genes connected to metabolism, localization, response to stimulus and signaling (Fig. S5b). Genes commonly upregulated by shIRAK2 BCSC1 and BCSC3 are involved in cellular processes, localization, metabolism, development, multicellular organismal processes, biological regulation and response to stimuli (Fig. S5c). shIRAK2 BCSC1 and MDA-MB-468 present two significantly upregulated genes in common, TAGLN and PAPPA. shIRAK2 BCSC3 and MDA-MB-468 commonly upregulated genes are associated with metabolic and cellular processes, biological regulation and adhesion (Fig. S5d). Evaluating each cell line singularly, shIRAK2 BCSC1 displays downregulation of genes involved in migration, proliferation, regulation of phosphorylation and response to stimuli (Fig. 7 d), and the upregulation of genes involved in adhesion and differentiation (Fig. 7 e). shIRAK2 BCSC3 shows downregulation of genes involved in chromosome organization, biosynthetic processes and cellular or macromolecule metabolic processes (Fig. 7 f) and the upregulation of genes involved in morphogenesis, exocytosis and cellular localization (Fig. 7 g). shIRAK2 MDA-MB-468 downregulated genes are involved in cellular and metabolic processes, biological regulations, response to stimulus, localization and signaling whereas the upregulated ones are related to biological adhesion, developmental processes, signaling and response to stimuli (Fig. S5e and S5f). These results supported our hypothesis of IRAK2 being involved in cells growth and viability. 4. Discussion We previously reported that IRAK2 downregulation in the commercial TNBC cell line MDA-MB-468 induced cells luminal-like differentiation [ 7 ]. Since cellular differentiation and proliferation present an inverse relationship, we wondered if IRAK2 targeting in BCSCs may impair TNBC aggressive growth [ 31 ]. We proved that IRAK2 contributes to BCSCs and MDA-MB-468 self-renewal and likely has a pro-oncogenic role. However, BCSCs bi-potential phenotype persisted upon IRAK2 downregulation, since cells keratins expression was not affected, implying an absence of overt differentiation. Hence, we investigated the molecular pathways responsible for the effects we observed. We reported that NF-κB and ERK phosphorylation was impaired in presence of IRAK2 knockdown and considering that NF-κB and ERK induce cell growth, their impairment upon IRAK2 knockdown could explain the decreased proliferation we had observed [ 32 , 33 ]. Moreover, IL-6 and cyclin D1 expression was reduced in presence of IRAK2 knockdown. Given that IL-6 contributes to tumor progression and inflammation, its impairment could be highly beneficial in the prospective of targeting IRAK2 as a therapeutic approach. Since cyclin D1 expression was impaired also in shIRAK2 BCSC1 xenografts, we suppose its affected expression may affect cell cycle progression delaying tumor growth. Complexively these results indicated that IRAK2 may drive cellular growth through NF-κB and ERK pathways activation. These pathways, in turn, may induce the transcription of genes like IL-6 and cyclin D1, allowing cellular proliferation and growth. It has been previously shown that ER stress induces IRAK2 expression and IRAK2 increments ER stress response establishing a loop with ERN1, a protein we demonstrated being gatekeeper of stemness in MDA-MB-468 [ 12 ]. We reported that IRAK2 expression is upregulated by BCSCs and MDA-MB-468 when an ER-stress inducer stimulates them, revealing IRAK2 involvement in UPR. IRAK2 knockdown per se affected ERN1 expression and Xbp1 splicing, suggesting a constitutive interaction between IRAK2 and ERN1 signaling. These data opened up a new prospective related to ERN1 role in MDA-MB-468. The cellular growth inhibition that we reported upon ERN1 depletion, as well as being caused by cells differentiating, could be addressed to ERN1 implications in UPR and explained as cells lost ability to manage ER stress. We reported that BCSC1 and BCSC3 presenting IRAK2 knockdown displayed a significantly decreased autophagy, suggesting that IRAK2 is required to maintain homeostasis through autophagy processes. Considering that ERN1 induces autophagy through TRAF2/JNK/c-Jun pathway or Xbp1 splicing [ 34 ], we concluded that the decreased autophagy we observed could be caused by IRAK2-mediated downregulation of ERN1. BCSC1 and BCSC3 displayed also increased apoptosis upon IRAK2 knockdown, with shIRAK2 BCSC3 presenting increased expression of the pro-apoptotic protein Bak1. These data recapitulated that IRAK2, as well as driving BCSCs and MDA-MB-468 aggressive growth, may also favor cellular ability to handle stress conditions promoting UPR and autophagy, avoiding apoptosis. Consequently, IRAK2 knockdown may affect, on one side, cellular proliferation and self-renewal capacity, and on the other, cellular resistance to hostile conditions. Transcriptome analysis of BCSC1, BCSC3 and MDA-MB-468 revealed that genes downregulated by IRAK2 knockdown are involved in proliferation, self-renewal capacity, cell cycle dysregulation, apoptosis and cell survival, often involving ERK, STAT3, AKT pathways, confirming our in vitro and in vivo data [ 35 – 37 ]. Moreover, the transcriptome analysis displayed that IRAK2 downregulation affects pathways involved in cellular metabolic processes, accordant with the recent discovery of IRAK2 involvement in pancreatic cancer metabolic reprogramming through NF-κB signaling [ 38 ]. Considering that conventional treatments for breast cancer present limited efficacy, lack of specificity for cancer cells and can cause several side effects on patients, there is a need for new better treatments [ 39 ]. Kinases targeting previously shown to inhibit TNBC growth successfully [ 40 , 41 ]. In particular, the targeting of proteins belonging to IRAK2 pathway, such as IRAK1 and IRAK4, previously proved that can affect cell growth, migration, tumorigenesis and chemoresistance [ 42 – 45 ]. Likewise the targeting of UPR-related proteins was shown to be a promising anticancer strategy [ 12 , 46 , 47 ]. Since we showed that IRAK2 downregulation impaired the proper activation of its pathway and we demonstrated IRAK2 participation in the UPR, we propose IRAK2 as a potential target to affect TNBC aggressive growth. 5. Conclusions We demonstrated that IRAK2 downregulation in TNBC stem cells is beneficial given that IRAK2 favors cells growth in 2D and 3D in vitro and contributes to tumor progression in vivo . Moreover, we reported that IRAK2 downregulation affected UPR and autophagy, pathways exploited by cancer cells to survive, furtherly supporting the beneficial impact of IRAK2 impairment in TNBC. Declarations Acknowledgments We acknowledge Birgit Klein, Saskia Breuel and Thomas Hansen for their technical support and Ralf Weiskirchen for manuscript reading and comments. Funding This study was funded by Deutsche Forschungsgemeinschaft (German Research Foundation), grant number 407869199. Authors and Affiliations Department of Obstetrics and Gynecology, University Hospital Aachen (UKA), D-52074 Aachen, Germany Francesca Ferraro, Anja Steinle, Harini Narasimhan, Andreas Bleilevens, Elmar Stickeler and Jochen Maurer Pathology Institute, University Hospital Aachen (UKA), D-52074 Aachen, Germany Till Braunschweig Contributions Jochen Maurer is responsible for the conceptualization, validation, resources, writing - review and editing, visualization, supervision, project administration, funding acquisition; Francesca Ferraro contributed to conceptualization, methodology, software analysis, formal analysis, investigation, data curation, writing - original draft preparation, writing - review and editing; Till Braunschweig, Anja Steinle and Andreas Bleilevens contributed to methodology; Harini Narasimhan contributed to methodology, writing - review and editing; Elmar Stickeler contributed to project administration; All authors have read and agreed to the published version of the manuscript. Corresponding author Correspondance to PD Dr. Jochen Maurer, [email protected] Ethics declarations All the experiments were performed according to the Declaration of Helsinki. All the experimental protocols were approved by the Institutional Review Board in the Ethics vote 307/13 (independent Ethics Committee University of Freiburg). Informed consent was obtained from all subjects involved in the study. Conflict of interest statement The authors have no relevant financial or non-financial interests to disclose. Data Availability Statement The data that support the findings of this study are available from the corresponding author upon reasonable request. References F. M. Alkabban and T. Ferguson, in StatPearls (StatPearls Publishing, Treasure Island (FL), 2021). K. Barzaman, J. Karami, Z. Zarei, A. Hosseinzadeh, M. H. Kazemi, S. Moradi-Kalbolandi, E. Safari, and L. Farahmand, Int Immunopharmacol 84 , 106535 (2020). W. D. Foulkes, I. E. Smith, and J. S. Reis-Filho, N Engl J Med 363 , 1938 (2010). S.-Q. Geng, A. T. Alexandrou, and J. J. Li, Cancer Lett 349 , 1 (2014). X. Li, J. Strietz, A. Bleilevens, E. Stickeler, and J. Maurer, Int J Mol Sci 21 , (2020). E. Metzger, S. S. Stepputtis, J. Strietz, B.-T. Preca, S. Urban, D. Willmann, A. Allen, F. Zenk, N. Iovino, P. Bronsert, A. Proske, M. Follo, M. Boerries, E. Stickeler, J. Xu, M. B. Wallace, J. A. Stafford, T. Kanouni, J. Maurer, and R. Schüle, Cancer Res 77 , 5900 (2017). J. Strietz, S. S. Stepputtis, B.-T. Preca, C. Vannier, M. M. Kim, D. J. Castro, Q. Au, M. Boerries, H. Busch, P. Aza-Blanc, S. Heynen-Genel, P. Bronsert, B. Kuster, E. Stickeler, T. Brabletz, R. G. Oshima, and J. Maurer, Oncotarget 7 , 83278 (2016). J. Strietz, S. S. Stepputtis, M. Follo, P. Bronsert, E. Stickeler, and J. Maurer, Int J Mol Sci 22 , 1808 (2021). S.-C. Lin, Y.-C. Lo, and H. Wu, Nature 465 , 885 (2010). E. Meylan and J. Tschopp, Nature Immunology 9 , 581 (2008). Y.-J. Guo, W.-W. Pan, S.-B. Liu, Z.-F. Shen, Y. Xu, and L.-L. Hu, Exp Ther Med 19 , 1997 (2020). S. Benosman, P. Ravanan, R. G. Correa, Y.-C. Hou, M. Yu, M. F. Gulen, X. Li, J. Thomas, M. Cuddy, Y. Matsuzawa, R. Sano, P. Diaz, S. Matsuzawa, and J. C. Reed, PLoS One 8 , (2013). H. Wang, S. M. Flannery, S. Dickhöfer, S. Huhn, J. George, A. V. Kubarenko, J. Lascorz, M. Bevier, J. Willemsen, T. Pichulik, C. Schafmayer, M. Binder, B. Manoury, S. R. Paludan, M. Alarcon-Riquelme, A. G. Bowie, A. Försti, and A. N. R. Weber, J Biol Chem 289 , 23123 (2014). L. Sisinni, M. Pietrafesa, S. Lepore, F. Maddalena, V. Condelli, F. Esposito, and M. Landriscina, Int J Mol Sci 20 , (2019). K. Zhang, H. Liu, Z. Song, Y. Jiang, H. Kim, L. Samavati, H. M. Nguyen, and Z.-Q. Yang, IScience 23 , 101503 (2020). R. Clarke, K. L. Cook, R. Hu, C. O. B. Facey, I. Tavassoly, J. L. Schwartz, W. T. Baumann, J. J. Tyson, J. Xuan, Y. Wang, A. Wärri, and A. N. Shajahan, Cancer Res 72 , 1321 (2012). W. Jiang, R. Hua, M. Wei, C. Li, Z. Qiu, X. Yang, and C. Zhang, Sci Rep 5 , 13875 (2015). S. Wee, D. Wiederschain, S.-M. Maira, A. Loo, C. Miller, R. deBeaumont, F. Stegmeier, Y.-M. Yao, and C. Lengauer, Proc Natl Acad Sci U S A 105 , 13057 (2008). D. Wiederschain, S. Wee, L. Chen, A. Loo, G. Yang, A. Huang, Y. Chen, G. Caponigro, Y. M. Yao, C. Lengauer, W. R. Sellers, and J. D. Benson, Cell Cycle (Georgetown, Tex.) 8 , 498 (2009). P. A. Ewels, A. Peltzer, S. Fillinger, H. Patel, J. Alneberg, A. Wilm, M. U. Garcia, P. Di Tommaso, and S. Nahnsen, Nat Biotechnol 38 , 276 (2020). P. Di Tommaso, M. Chatzou, E. W. Floden, P. P. Barja, E. Palumbo, and C. Notredame, Nat Biotechnol 35 , 316 (2017). D. Merkel, Linux Journal 2014 , (2014). D. Krueger, E. Caballero, J.-H. Jacobsen, A. Zhang, J. Binas, D. Zhang, R. L. Priol, and A. Courville, in Proceedings of the 38th International Conference on Machine Learning (PMLR, 2021), pp. 5815–5826. A. Dobin, C. A. Davis, F. Schlesinger, J. Drenkow, C. Zaleski, S. Jha, P. Batut, M. Chaisson, and T. R. Gingeras, Bioinformatics 29 , 15 (2013). Y. Liao, G. K. Smyth, and W. Shi, Bioinformatics 30 , 923 (2014). R. Patro, G. Duggal, M. I. Love, R. A. Irizarry, and C. Kingsford, Nat Methods 14 , 417 (2017). M. I. Love, W. Huber, and S. Anders, Genome Biol 15 , 550 (2014). J. P. Alao, Molecular Cancer 6 , 24 (2007). J.-C. Chambard, R. Lefloch, J. Pouysségur, and P. Lenormand, Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1773 , 1299 (2007). M. Hinz, D. Krappmann, A. Eichten, A. Heder, C. Scheidereit, and M. Strauss, Mol Cell Biol 19 , 2690 (1999). S. Ruijtenberg and S. van den Heuvel, Cell Cycle 15 , 196 (2016). S.-C. Sun, Nat Rev Immunol 17 , 545 (2017). K. Taniguchi and M. Karin, Nat Rev Immunol 18 , 309 (2018). M. G. Metcalf, R. Higuchi-Sanabria, G. Garcia, C. K. Tsui, and A. Dillin, Sci Adv 6 , eabb9614 (2020). Y. Tian, X. Sun, G. Cheng, E. Ji, S. Yang, J. Feng, and L. Zheng, Ann Transl Med 9 , 131 (2021). E. Cho, Y.-J. Kwon, D.-J. Ye, H.-S. Baek, T.-U. Kwon, H.-K. Choi, and Y.-J. Chun, Biomol Ther (Seoul) 591 (2019). W. Zhai, X. Ye, Y. Wang, Y. Feng, Y. Wang, Y. Lin, L. Ding, L. Yang, X. Wang, Y. Kuang, X. Fu, Y. Eugene Chin, B. Jia, B. Zhu, F. Ren, and Z. Chang, Br J Cancer 124 , 1437 (2021). J. Yang, D.-J. Liu, J.-H. Zheng, R.-Z. He, D.-P. Xu, M.-W. Yang, H.-F. Yao, X.-L. Fu, J.-Y. Yang, Y.-M. Huo, L.-Y. Tao, R. Hua, Y.-W. Sun, X.-M. Kong, S.-H. Jiang, and W. Liu, Cell Oncol (Dordr) (2022). K.-A. Won and C. Spruck, Int J Oncol 57 , 1245 (2020). K. Sato, A. A. Padgaonkar, S. J. Baker, S. C. Cosenza, O. Rechkoblit, D. R. C. V. Subbaiah, J. Domingo-Domenech, A. Bartkowski, E. R. Port, A. K. Aggarwal, M. V. Ramana Reddy, H. Y. Irie, and E. P. Reddy, Nat Commun 12 , 4671 (2021). C. Damaskos, A. Garmpi, K. Nikolettos, M. Vavourakis, E. Diamantis, A. Patsouras, P. Farmaki, A. Nonni, D. Dimitroulis, D. Mantas, E. A. Antoniou, N. Nikolettos, K. Kontzoglou, and N. Garmpis, Anticancer Research 39 , 5285 (2019). W. Chen, T. Wei, Y. Chen, L. Yang, and X. Wu, Onco Targets Ther 13 , 12787 (2020). N. Li, J. Jiang, J. Fu, T. Yu, B. Wang, W. Qin, A. Xu, M. Wu, Y. Chen, and H. Wang, J Exp Clin Cancer Res 35 , 140 (2016). Z. N. Wee, S. M. J. M. Yatim, V. K. Kohlbauer, M. Feng, J. Y. Goh, B. Yi, P. L. Lee, S. Zhang, P. P. Wang, E. Lim, W. L. Tam, Y. Cai, H. J. Ditzel, D. S. B. Hoon, E. Y. Tan, and Q. Yu, Nat Commun 6 , (2015). D. Zhang, L. Li, H. Jiang, B. Knolhoff, A. C. Lockhart, A. Wang-Gillam, D. G. DeNardo, M. B. Ruzinova, and K.-H. Lim, Clin Cancer Res 23 , 1748 (2017). C. Kim and B. Kim, Nutrients 10 , (2018). J. Liu, Y. Chen, Q. Huang, W. Liu, X. Ji, F. Hu, Y. Zhu, L. Zhang, and G. Dong, Cell. Signal. 48 , 69 (2018). Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterial.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1802684","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":117134845,"identity":"4234e55e-b237-4a83-a429-1f49a819abc6","order_by":0,"name":"Francesca Ferraro","email":"","orcid":"","institution":"University Hospital Aachen (UKA)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Francesca","middleName":"","lastName":"Ferraro","suffix":""},{"id":117134846,"identity":"164438fa-e29a-48df-a996-8258da65c7ae","order_by":1,"name":"Anja Steinle","email":"","orcid":"","institution":"University Hospital Aachen (UKA)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Anja","middleName":"","lastName":"Steinle","suffix":""},{"id":117134847,"identity":"7f13491c-3dce-4bdc-9808-6428ee05a097","order_by":2,"name":"Harini Narasimhan","email":"","orcid":"","institution":"University Hospital Aachen (UKA)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Harini","middleName":"","lastName":"Narasimhan","suffix":""},{"id":117134848,"identity":"11686b30-f988-4d3c-a14f-28b889304cd1","order_by":3,"name":"Andreas Bleilevens","email":"","orcid":"","institution":"University Hospital Aachen (UKA)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Andreas","middleName":"","lastName":"Bleilevens","suffix":""},{"id":117134849,"identity":"d5c33486-b5e6-40c2-813c-8f40d2e294a0","order_by":4,"name":"Till Braunschweig","email":"","orcid":"","institution":"University Hospital Aachen (UKA)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Till","middleName":"","lastName":"Braunschweig","suffix":""},{"id":117134850,"identity":"411f27db-c548-401d-8d25-29d3f549ba28","order_by":5,"name":"Elmar Stickeler","email":"","orcid":"","institution":"University Hospital Aachen (UKA)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Elmar","middleName":"","lastName":"Stickeler","suffix":""},{"id":117134851,"identity":"a5dca320-6fba-428d-ae20-12ad8ce6a41a","order_by":6,"name":"Jochen Maurer","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA20lEQVRIiWNgGAWjYBACxgYILcfAA+clEKfFmHgtMJDYQLQW5mmHn0lXVNxL33Dm8MMPP3fY5DGwJx/A77DZaWaSZ84U524422Ys2XsmrZiB5xl+axhnJ5hJNrYl5G44z2Agzdh2OLFBIseAgJb0b5KN/xLSDc6zf/7N2PYfqCX/AwEtOUBbGhISDM72mAFtOQCyBa8OkJZiy4ZjCYYzz5wps+xtS05s43mG32GGs9M33myoSZDnO5O++cbPNrvEfvbkB/i1NKCLsOF3FgODPCEFo2AUjIJRMAoYALQUSwqzb9kmAAAAAElFTkSuQmCC","orcid":"","institution":"University Hospital Aachen (UKA)","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Jochen","middleName":"","lastName":"Maurer","suffix":""}],"badges":[],"createdAt":"2022-06-28 07:59:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1802684/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1802684/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":23535147,"identity":"11eb5ad2-3459-43af-a85d-6f4d4231c66d","added_by":"auto","created_at":"2022-07-06 15:41:27","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":113994,"visible":true,"origin":"","legend":"\u003cp\u003eIRAK2 expression and its induced knockdown in BCSCs and MDA-MB-468. \u003cstrong\u003ea\u003c/strong\u003e \u003cstrong\u003eb\u003c/strong\u003e IRAK2 expression in BCSCs and MDA-MB-468 was confirmed by qRT-PCR (a) and western blot (b). IRAK2 expression in qRT-PCR was normalized to the housekeeping gene (HKG) HPRT. \u003cstrong\u003ec\u003c/strong\u003e Quantification of western blot normalized to GAPDH. \u003cstrong\u003ed\u003c/strong\u003e IRAK2 absolute expression from microarray data of primary BCSC lines, respective xenografts and patients tumors of origin. \u003cstrong\u003ee\u003c/strong\u003e IRAK2 induced knockdown (shIRAK2) compared to respective controls (CV) in BCSC1 (BCSC1 ind), BCSC3 (BCSC3 ind) and MDA-MB-468 (MDA 468 ind) at mRNA level. \u003cstrong\u003ef\u003c/strong\u003e \u003cstrong\u003eg\u003c/strong\u003e IRAK2 induced knockdown at protein level (f) and relative quantification (g). Data (n=3) represent means ± SEM; *, P\u0026lt;0.05, **, P\u0026lt;0.01, ***, P\u0026lt;0.001, by unpaired t-test\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-1802684/v1/08a8a2855ef3775adda6f822.png"},{"id":23535152,"identity":"cd44f1b0-0423-4c12-a5ee-a27d151424cd","added_by":"auto","created_at":"2022-07-06 15:41:27","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":362690,"visible":true,"origin":"","legend":"\u003cp\u003eIRAK2 induced knockdown affects BCSCs and MDA-MB-468 proliferation and sphere-forming capacity. \u003cstrong\u003ea\u003c/strong\u003e Images representing BCSC1, BCSC3 and MDA-MB-468 phenotypes in presence of IRAK2 induced knockdown compared to control cells. Scale bars represent 200 μm. \u003cstrong\u003eb\u003c/strong\u003e \u003cstrong\u003ec\u003c/strong\u003e Reduced proliferation (b) and sphere-forming capacity (c) of cells in presence of IRAK2 induced knockdown compared to control cells. Proliferation data were analyzed with the Wilcoxon test. Scale bars represent 500 μm. \u003cstrong\u003ed\u003c/strong\u003e Sphere-forming capacity quantification. Statistical significance by unpaired t-test. Data (n=3) represent means ± SEM; *, P\u0026lt;0.05, **, P\u0026lt;0.01, ***, P\u0026lt;0.001 \u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-1802684/v1/7b0bb6807a2b4856e1b6c712.png"},{"id":23535735,"identity":"64253c90-2ac2-4f6a-a9ac-df8911cb1647","added_by":"auto","created_at":"2022-07-06 15:51:27","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":266369,"visible":true,"origin":"","legend":"\u003cp\u003eIRAK2 downregulation delays BCSC1 and MDA-MB-468 tumor-forming capacity. \u003cstrong\u003ea\u003c/strong\u003e BCSC1 and MDA-MB-468 control and IRAK2 induced knockdown xenografts. Concerning MDA-MB-468, control xenografts with the respective micrometastasis are depicted in the upper panels, while shIRAK2 xenografts with the associated micrometastasis are represented in the lower ones. Scale bars represent 1 cm. \u003cstrong\u003eb\u003c/strong\u003e Xenografts diameter during time. The arrows indicate the Doxycycline-mediated knockdown induction starting time. Mean values ± SEM, n=6 for CV and shIRAK2 for BCSC1, n=6 for CV and n=8 for shIRAK2 for MDA-MB-468. Statistical significance was evaluated by paired t-test. \u003cstrong\u003ec\u003c/strong\u003e Average control and IRAK2 knockdown xenografts weight. Graphs represent mean values ± SEM. Statistical significance was evaluated by Mann-Whitney test. \u003cstrong\u003ed\u003c/strong\u003e IRAK2 expression at mRNA level of control and knockdown xenografts. \u003cstrong\u003ee\u003c/strong\u003e \u003cstrong\u003ef\u003c/strong\u003e IRAK2 expression at protein level (e) and relative quantification (f) in control and knockdown xenografts. Data represent mean values ± SEM. Statistics by unpaired t-test. *, P\u0026lt;0.05, **, P\u0026lt;0.01, ***, P\u0026lt;0.001\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-1802684/v1/2424a34b684881d958e706c2.png"},{"id":23535148,"identity":"c40a1e62-c66e-46d3-9cff-59730e40b00d","added_by":"auto","created_at":"2022-07-06 15:41:27","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":138063,"visible":true,"origin":"","legend":"\u003cp\u003eIRAK2 knockdown affects NF-κB and ERK phosphorylation and IL-6 and cyclin D1 expression. \u003cstrong\u003ea\u003c/strong\u003e NF-κB phosphorylation in BCSC1 and BCSC3 comparing control and IRAK2 induced knockdown cells. \u003cstrong\u003eb\u003c/strong\u003e \u003cstrong\u003ec\u003c/strong\u003e IL-6 expression at protein level (b) and its relative quantification (c) in BCSC1, BCSC3 and MDA-MB-468 control and IRAK2 induced knockdown cells. \u003cstrong\u003ed\u003c/strong\u003e Western blots of phosphorylated and total ERK in control and IRAK2 induced knockdown BCSC1, BCSC3 and MDA-MB-468. \u003cstrong\u003ee\u003c/strong\u003e Quantification of western blot displaying the ratio of p-ERK and ERK expression. \u003cstrong\u003ef\u003c/strong\u003e \u003cstrong\u003eg\u003c/strong\u003e Cyclin D1 expression at protein level (f) and its relative quantification (g). Data (n=3) represent mean ± SEM, *, P\u0026lt;0.05, **, P\u0026lt;0.01, ***, P\u0026lt;0.001 by unpaired t-test\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-1802684/v1/487991e70c3cb7bd016170a9.png"},{"id":23536155,"identity":"7ee50e28-4efb-4601-b514-34d1cec2f088","added_by":"auto","created_at":"2022-07-06 16:01:27","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":120270,"visible":true,"origin":"","legend":"\u003cp\u003eIRAK2 is upregulated in presence of ER stress and its downregulation affects ERN1 pathway. \u003cstrong\u003ea\u003c/strong\u003e IRAK2, ERN1, Xbp1 spliced (Xbps) and CHOP expression at mRNA level in control and IRAK2 induced knockdown BCSC1, BCSC3 and MDA-MB-468, in presence and absence of Thapsigargin (TG). \u003cstrong\u003eb\u003c/strong\u003e \u003cstrong\u003ec\u003c/strong\u003e \u003cstrong\u003ed\u003c/strong\u003e \u003cstrong\u003ee\u003c/strong\u003e ERN1 (b) and CHOP (d) expression at protein level and their relative quantification (c for ERN1, e for CHOP) in CV and shIRAK2 BCSC1, BCSC3 and MDA-MB-468. Data (n=3) represent mean ± SEM, *, P\u0026lt;0.05, **, P\u0026lt;0.01, ***, P\u0026lt;0.001, ****, P\u0026lt;0.0001 by unpaired t-test\u0026nbsp;\u0026nbsp;\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-1802684/v1/caf7f4a74876b805bdfce95e.png"},{"id":23535910,"identity":"fcdde4bd-9e21-4b90-9a57-26294e7b0193","added_by":"auto","created_at":"2022-07-06 15:56:27","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":523484,"visible":true,"origin":"","legend":"\u003cp\u003eIRAK2 induced knockdown affects autophagy and induces apoptosis in BCSC1 and BCSC3. \u003cstrong\u003ea\u003c/strong\u003e\u0026nbsp;LC3-II immunofluorescence staining in control and IRAK2 induced knockdown BCSC1 and BCSC3, in presence and absence of Chloroquine. Scale bars represent 25 µm. \u003cstrong\u003eb\u003c/strong\u003e LC3-II immunofluorescence quantification is expressed as the ratio between green spots and the number of nuclei. \u003cstrong\u003ec\u003c/strong\u003e Apopxin green indicator staining in control and IRAK2 induced knockdown BCSC1 and BCSC3. Scale bars represent 400 µM. \u003cstrong\u003ed\u003c/strong\u003e Apopxin green quantification expressed as the ratio between green fluorescence and cell confluence. \u003cstrong\u003ee f\u003c/strong\u003e Bak1 expression at protein level in control and IRAK2 induced knockdown BCSC1, BCSC3 and MDA-MB-468 (e) and relative quantification (f). Data (n=3) represent means ± SEM, *, P\u0026lt;0.05, **, P\u0026lt;0.01, ***, P\u0026lt;0.001 by unpaired t-test\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-1802684/v1/047f96dd4e844861165f5de8.png"},{"id":23535621,"identity":"53038aba-5983-4189-845e-376a54161729","added_by":"auto","created_at":"2022-07-06 15:46:27","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":384725,"visible":true,"origin":"","legend":"\u003cp\u003eTranscriptome analysis of BCSC1, BCSC3 and MDA-MB-468 upon IRAK2 induced knockdown. \u003cstrong\u003ea\u003c/strong\u003e Genes upregulated or downregulated in BCSC1, BCSC3 and MDA-MB-468 upon IRAK2 induced knockdown. \u003cstrong\u003eb c\u003c/strong\u003e Venn diagrams representing downregulated (b) or upregulated (c) genes in BCSC1, BCSC3 and MDA-MB-468 upon IRAK2 induced knockdown. \u003cstrong\u003ed\u003c/strong\u003e \u003cstrong\u003ee\u003c/strong\u003e Gene ontology of BCSC1 downregulated (d) or upregulated (e) genes in presence of IRAK2 induced knockdown. \u003cstrong\u003ef\u003c/strong\u003e \u003cstrong\u003eg\u003c/strong\u003e Gene ontology of BCSC3 downregulated (f) or upregulated (g) genes in presence of IRAK2 induced knockdown\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-1802684/v1/557e6c2dab3e443465ce7d59.png"},{"id":23536174,"identity":"79170677-e4e1-4bb6-b975-09913d92b62e","added_by":"auto","created_at":"2022-07-06 16:01:31","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1307899,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1802684/v1/0e9a206f-feb3-48be-a455-52954ec0c309.pdf"},{"id":23535154,"identity":"7938a6a9-986b-4f9c-98a2-78dd358c9cd6","added_by":"auto","created_at":"2022-07-06 15:41:27","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2100239,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-1802684/v1/a8fc691eabb5a532ab3684f9.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"IRAK2 contributes to triple-negative breast cancer growth via NF-κB, ERK and stress-related signaling pathways","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eBreast cancer is the most common and second deadliest cancer diagnosed in women [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. It can be categorized into luminal A, luminal B, human epidermal receptor 2 (HER2) enriched and triple-negative breast cancer (TNBC) depending on its estrogen, progesterone and HER2 receptors status [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. TNBC lacks the expression of these receptors, which are commonly targeted in breast cancer therapies, and therefore provides limited treatment options [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. A strong presence of breast cancer stem cells (BCSCs) in the tumor bulk is characteristic for TNBC, likely causing its aggressive nature [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. BCSCs are a subset of cancer cells able to self-renew and to differentiate into heterogeneous lineages of breast cancer cells, sustaining the tumor growth [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Our laboratory isolated BCSCs from human tumors of TNBC, which form xenografts highly similar in their gene expression profile and histologically to the tumors of origin [\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWe previously reported several kinases responsible for stem cell maintenance in TNBC, among them Interleukin-1 Receptor Associated Kinase 2 (IRAK2) was identified [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. IRAK2 is a serine/threonine kinase that participates in the \u0026ldquo;Myddosome\u0026rdquo; formation with other components of the IRAK family upon toll-like / interleukin-1 receptors (TLR/IL1R) activation [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. IRAK2 pathway induces Nuclear Factor κ-light-chain-enhancer of activated B cells (NF-κB) and Mitogen-Activated Protein Kinases (MAPK) phosphorylation [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Extracellular Signal-Related Kinase 1/2 (ERK1/ERK2) is a subfamily of MAPK that induces the expression of genes involved in cellular proliferation, as cyclin D1 [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. IRAK2, through Endoplasmic Reticulum to Nucleus 1 (ERN1) interaction, contributes to the unfolded protein response (UPR), a pathway that promotes cell survival and adaptation to stress [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In presence of ER stress, ERN1 excises IRE1α-X-box-binding protein 1 (Xbp1) mRNA, leading to the expression of chaperones and protein degradation factors, increasing the ER protein folding capacity [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. UPR, autophagy and apoptosis are pathways finely regulated: cells integrate signals and, if their fate is to survive, activate UPR and autophagy, blocking apoptosis; if survival is not favorable, apoptosis is no more inhibited [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSince we previously identified IRAK2 as a potential stemness gatekeeper in TNBC, in the present study we elucidated its mode of action in our primary isolated BCSCs and MDA-MB-468 cell line. The effects of IRAK2 downregulation on cellular phenotype, proliferation, sphere-forming capacity and tumorigenicity were assessed. Moreover, the molecular pathways affected in the context of UPR, autophagy and apoptosis were explored. Finally, we performed transcriptome analysis to establish the common pathways differentially regulated by IRAK2 downregulation.\u003c/p\u003e"},{"header":"2. Materials And Methods","content":"\u003cdiv class=\"Section2\" id=\"Sec3\"\u003e\n \u003ch2\u003e2.1. Cell culture\u003c/h2\u003e\n \u003cp\u003eBCSC1-5 were isolated from human TNBC specimens and cultured as previously described [\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e]. MDA-MB-468 (ATCC) present a GFP nuclear tag and was cultivated in DMEM (Gibco, 41966-029), 10% FBS (Gibco, 10500-064), 1% Penicillin/Streptomycin (Gibco, 15140-122). MDA-MB-468 with inducible knockdown were cultured with FBS without Tetracycline (Clontech, 631106) to avoid uncontrolled gene downregulation.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec4\"\u003e\n \u003ch2\u003e2.2. Lentiviral production and knockdown\u003c/h2\u003e\n \u003cp\u003eStable or inducible control and knockdown vectors were designed by Pedro Aza Blanc (Sanford Burnham Institute, La Jolla, CA, USA). 1000 ng of the vectors of interest were incubated for 30 minutes in six-well plates (Falcon, 353046) with 400 \u0026micro;l of Opti-MEM (Life Technologies, 11058021), 4 \u0026micro;l of X-tremeGeneTM Transfection Reagent (Sigma Aldrich, 6366236001), 700 ng of pCMVdR8.74 (Addgene plasmid, #22036) and 350 ng of pMDVSVG (Addgene plasmid, #8454). Two million of 293FT cells (Invitrogen, #11625) were added to each well and 24 hours later medium was replaced with fresh UltraCULTURE\u0026trade; (Lonza, 12-725F). 48 and 72 hours later medium containing lentiviruses was harvested and centrifuged at 500 g, room temperature (RT), for 10 minutes. The supernatant was filtered with 0.45 \u0026micro;m filters (Whatmann, WH10462100), overlayed at a 4:1 ratio with 10% sucrose-containing buffer [\u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e], and centrifuged at 10000 g for four hours at 4\u0026deg;C. Pellets were resuspended in UltraCULTURE\u0026trade;. Lentivirus was serially diluted 1:2 in DMEM containing 15 \u0026micro;g/ml polybrene (Sigma Aldrich, 107689) and titrated on seeded 293FT cells, that were centrifuged at 1000 g for one hour. Selection was performed with 2 \u0026micro;g/ml of Puromycin (Sigma Aldrich, P8833-10MG). The highest viral dilution infecting cells was chosen as the multiplicity of infection (MOI) of one. Different MOI were tested on each cell line before proceeding with their infection. Cells were infected at the optimal MOI in medium containing 8 \u0026micro;g/ml polybrene, plates were centrifuged at 1000 g, RT, for one hour. pLKO-Tet-On vectors were used to perform inducible knockdown [\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e] supplementing cell media with 100 ng/ml of Doxycycline Hyclate (Sigma, D9891), refreshed every 48 hours.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec5\"\u003e\n \u003ch2\u003e2.3. Proliferation assay\u003c/h2\u003e\n \u003cp\u003eCells were seeded at 3X10\u003csup\u003e3\u003c/sup\u003e cells/well in 96-well culture plates (Falcon, 353072) and their growth was followed with IncuCyte\u0026reg; Live-Cell Analysis System. After one week growth curves were built considering \u0026ldquo;cells percentage of confluency\u0026rdquo; for BCSCs or \u0026ldquo;green object count per image\u0026rdquo; for MDA-MB-468.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec6\"\u003e\n \u003ch2\u003e2.4. Sphere-forming capacity\u003c/h2\u003e\n \u003cp\u003e2X10\u003csup\u003e2\u003c/sup\u003e or 2.5X10\u003csup\u003e2\u003c/sup\u003e cells were seeded in each well of a 96-well low-attachment flat bottom plate (Cornig, 3474) in 1:1 dilution with matrigel. 30 minutes after seeding, medium was added and the cells were let grow for two weeks. Sphere-forming capacity was quantified as the ratio between the spheres counted after two weeks and the number of cells seeded per well.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec7\"\u003e\n \u003ch2\u003e2.5. Immunofluorescence staining\u003c/h2\u003e\n \u003cp\u003eAdherent cells were washed with 1X PBS (Gibco, 70011-036), fixed with ice-cold methanol (VWR Chemicals, 20847295) at 4\u0026deg;C for 15 minutes, rinsed with PBS, permeabilized with 1X TBST and blocked with 1 mg/ml albumin (Carl Roth GmbH, 8076.4)/PBS. Cells were incubated overnight at 4\u0026deg;C with primary antibody and the following day incubated at RT for one hour with secondary antibody. Nuclei were stained with DAPI (Sigma Aldrich, D9542). Primary antibodies anti-keratin 5 (Covance PRB \u0026ndash; 160P, 1:250), anti-keratin 8 (Biolegend, C5301, 1:250), anti-keratin 14 (Covar, #PRB-155P, 1:250), anti-keratin 18 (DAKO, M7010, 1:250) and anti-LC3-II (Cell Signaling, #38689, 1:1600) were used. Secondary antibodies Alexa Fluor 488 Donkey anti-Rabbit (ThermoFisher, #A21206, 1:500) and Alexa Fluor 468 Donkey anti-Mouse (Invitrogen, #A10037, 1:500) were used.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec8\"\u003e\n \u003ch2\u003e2.6. Immunohistochemistry\u003c/h2\u003e\n \u003cp\u003eXenografts collected from \u003cem\u003ein vivo\u003c/em\u003e experiments were fixed in PFA 4% for 24 hours at 4\u0026deg;C, embedded in paraffin, sliced in 2 \u0026micro;m thick sections and mounted on glass slides. DAB staining was performed immersing the slides in Xylol and descending concentration of Ethanol (100%, 96% and 70%; PanReac AppliChem, A4230). Antigens were retrieved using Citrate buffer (Dako, S236984) for one hour at 96\u0026deg;C. Slides were immersed in 5% H2O2/methanol (Perdrogen, SA31642) for 15 minutes and incubated with primary antibody overnight at 4\u0026deg;C. Slides were incubated for 40 minutes at RT with secondary antibody, exposed to DAB solution (Dako, K3468), stained with Hematoxylin (Dako, C5700), fixed and covered with mounting solution (Medite, 41401100) and a coverslip.\u003c/p\u003e\n \u003cp\u003eDAB staining was quantified using ImageJ (HDAB in Color Deconvolution option). Optical density was evaluated using the equation \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(OD=Log (\\text{max}intensity \u0026divide;mean intensity )\\)\u003c/span\u003e\u003c/span\u003ewith max intensity\u0026thinsp;=\u0026thinsp;255 and mean intensity\u0026thinsp;=\u0026thinsp;mean gray value calculated by ImageJ. Primary antibodies anti-ki67 (Sigma-Aldrich, #SAB4501880, 1:100) and anti-cyclin D1 (Invitrogen #PA532373, 1:100) were used. The secondary antibody Polyclonal Goat anti-Rabbit (Dako, #P044801, 1:100) was used.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec9\"\u003e\n \u003ch2\u003e2.7. RNA isolation and qRT-PCR\u003c/h2\u003e\n \u003cp\u003eRNA was extracted from cells pellet using miRNeasy\u0026reg; Mini Kit (Qiagen, 1038703) and reverse transcription was performed using EvoScript Reverse Transcriptase kit (Roche, 07912323001) following the manufacturer\u0026rsquo;s instructions. Samples were run in Roche\u0026rsquo;s LightCycler 480 with an activation step of 10 minutes at 95\u0026deg;C, amplification step repeated 50 times with each step consisting of 15 seconds at 95\u0026deg;C and one minute at 60\u0026deg;C and a last cooling step at 40\u0026deg;C. Primers and UPL used are indicated in the supplemented table (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u0026nbsp;\u003ctable border=\"1\" id=\"Tab1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003ePrimers and UPL used in qRT-PCR\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eForward (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReverse (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eUPL\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACTB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCAACCGCGAGAAGATGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCAGAGGCGTACAGGGATAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e#64\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCND1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCTGTGCATCTACACCGACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTGAGCTTGTTCACCAGGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e#55\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCHOP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAAGCAGCGCATGAAGGA G\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCCGTTCATTCTCTTCA GCTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e#2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eERN1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTGCCCATCAACCTCTCTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGCTCTCGGGTTTTGGTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e#9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eIRAK2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATTCTTCCAGGCAGAGTTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCCCAGCACAGGTAAGACAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e#87\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXBP1 SP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGTTAAGACAGCGCTTGGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGCACCTGCTGCGGACTCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e#37\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003c/p\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec10\"\u003e\n \u003ch2\u003e2.8. Protein isolation and western blot\u003c/h2\u003e\n \u003cp\u003eLysis solution was prepared following cOmplete\u0026trade; Lysis-M solution (Roche, 11697498001) manufacturer\u0026rsquo;s instructions supplementing it with 1:10 of PhosSTOP (Sigma, 93106075). Cell pellet was resuspended in 30\u0026ndash;50 \u0026micro;l of lysis solution, incubated on ice for 30 minutes, centrifuged at 4\u0026deg;C for 15 minutes at 13000 rpm and the supernatants were stored at -80\u0026deg;C. Protein quantification was performed with the DC\u0026trade; Protein Assay Kit II (Bio-Rad Laboratories, 5000112). 20 \u0026micro;g of proteins were loaded in Mini-PROTEAN TGX Precast Gels (Bio-Rad Laboratories, 456\u0026ndash;9036), transferred on Trans-Blot\u0026reg; Turbo Transfer System (Bio-Rad laboratories, 1704156) membranes and incubated OVN at 4\u0026deg;C with primary antibody. The following day membranes were incubated at RT for one hour with secondary antibody, developed using the WEST-ZOL\u0026reg; plus Detection System (16024, iNtRON Biotechnology). Membranes were occasionally stripped incubating them for 45 minutes in stripping buffer (20 ml SDS 10%, 12.5 ml Tris HCl, 67.5 ml water, 0.8 ml \u0026szlig;-mercaptoethanol, pH 6.8). The primary antibodies anti-IRAK2 (Cell Signaling, #4367S, 1:1000), anti-IL-6 (Biozol, LS-C #165212, 1:1000), anti-cyclinD1 (Invitrogen, #PA532373, 1:1000), anti-ERN1 (Proteintech, #27528-1, 1:1000), anti-CHOP (Sigma Aldrich, #SAB5700602, 1:1000), anti-Bak1 (ThermoFisher, #MA5-32111, 1:1000), anti-ERK (Cell Signaling, #4696S, 1:1000), anti-P-ERK (Cell Signaling, #9101S, 1:1000) were used. The secondary antibodies Polyclonal Goat Anti Rabbit (Dako agilent, #P044801, 1:2000) and Polyclonal Rabbit Anti Mouse (Dako agilent, #P0260, 1:2000) were used.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec11\"\u003e\n \u003ch2\u003e2.9. ER stress induction\u003c/h2\u003e\n \u003cp\u003e1X10\u003csup\u003e5\u003c/sup\u003e cells were exposed to 100 ng/ml Doxycycline for three days and subsequently treated for three hours with 5 \u0026micro;M Thapsigargin (Sigma Aldrich, T9033), followed by RNA isolation.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec12\"\u003e\n \u003ch2\u003e2.10. Autophagy evaluation\u003c/h2\u003e\n \u003cp\u003eApopxin is an apoptosis sensor since it presents green fluorescence upon binding to membrane phosphatidylserine (PS). IRAK2 knockdown was induced with 100 ng/ml Doxycycline in BCSC1 and BCSC3 for four days and afterward, 1X10\u003csup\u003e4\u003c/sup\u003e cells/well were seeded in a 96-well culture plate, treated overnight with Chloroquine (Sigma-Aldrich, C6628-25G) 10 \u0026micro;M and subsequently fixed.\u003c/p\u003e\n \u003cp\u003eAfter LC3-II immunofluorescence staining, vesicles puncta were quantified using the ImageJ plugin Automatic Nuclei Counter ITCN. Channels images were split, green images (LC3-II staining) were inverted and, using the plugin ITCN, the width (5 for BCSC1, 6 for BCSC3), minimum distance (2.5 for BCSC1, 3 for BCSC3) and threshold (1.5) to consider were defined. \u0026ldquo;Detect Dark Peaks\u0026rdquo; was selected and green spots (LC3-II puncta) were counted. Subsequently, nuclei in the blue images (DAPI staining) were manually counted. Autophagy was quantified evaluating the ratio between the counted dark peaks over the number of nuclei per picture.\u003c/p\u003e\n \u003ch2\u003e2.11. Apoptosis assay\u003c/h2\u003e\n \u003cp\u003eBCSC1 and BCSC3 were seeded at 1X10\u003csup\u003e4\u003c/sup\u003e cells/well in 96-well plates in presence of 100 ng/ml Doxycycline and apoptosis was assessed using the Apoptosis Assay kit (Abcam, ab176749) following manufacturer\u0026rsquo;s instructions. Green fluorescence was measured at Ex/Em\u0026thinsp;=\u0026thinsp;490/525 nm with IncuCyte\u0026reg; Live-Cell Analysis System. Apoptosis was quantified considering green fluorescence measured over cell confluence.\u003c/p\u003e\n \u003ch2\u003e2.12. NF-\u0026kappa;B phosphorylation assay\u003c/h2\u003e\n \u003cp\u003eBCSC1 and BCSC3 were treated with 100 ng/ml Doxycycline for four days and seeded at 3X10\u003csup\u003e4\u003c/sup\u003e cells/well in 96-well culture plates. The EnzyFluo Phosphorylation Assay kit (BioAssay Systems, ABIN5691837) was used to quantify phosphorylated and total NF-\u0026kappa;B following the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n \u003ch2\u003e2.13. Orthotopic Breast Cancer Xenografts\u003c/h2\u003e\n \u003cp\u003e1x10\u003csup\u003e4\u003c/sup\u003e or 1x10\u003csup\u003e5\u003c/sup\u003e BCSCs or MDA-MB-468, with stable or inducible knockdown, were mixed with one million of irradiated fibroblasts (Hs27, ATCC, CRL-1634). Matrigel was added at 1:1 ratio and mixture was injected into the mammary fat pad of the 4th glands of NOD/SCID female mice. In the case of cells characterized by the inducible knockdown, when the first xenografts reached 3 mm diameters, IRAK2 knockdown was induced by feeding the animals \u003cem\u003ead libitum\u003c/em\u003e three times a week with gelatin containing 2 mg/ml Doxycycline and 0.08 g/ml of sugar. When the xenografts reached a diameter close to 15 mm, animals were sacrificed. For BCSC1 three mice received control BCSC1 and three IRAK2 knockdown BCSC1. For the stable knockdown animals were sacrificed after 28 days, for the inducible knockdown animals received Doxycycline for 19 days and were sacrificed 34 days after surgery. For MDA-MB-468 three mice were used as control and four for IRAK2 knockdown. They received knockdown induction for 27 days and were sacrificed 57 days after surgery. To isolate RNA and proteins from xenografts, 30\u0026ndash;50 mg of tissue were disrupted with a tissue grinder. 700 \u0026micro;l of Qiazol lysis reagent was added to the tissue to isolate RNA following the usual procedure. Proteins lysis solution was added to the tissue and centrifuged for one minute at 2000 rpm at 4\u0026deg;C to isolate proteins.\u003c/p\u003e\n \u003ch2\u003e2.14. Sequencing\u003c/h2\u003e\n \u003cp\u003eThe library preparation method used was Invitrogen\u0026trade; Collibri\u0026trade; 3\u0026rsquo; mRNA Library Prep Kit. Sequencing was performed as single read 1X 75 bp using the sequencing kit NextSeq 500/550 High Output Kit v2.5 (75 cycles) High Output Kit v2.5 (75 cycles) using NextSeq 500 instrument (Illumina). FASTQ files were generated using bcl2fastq (Illumina). To facilitate reproducible analysis, samples were processed using the publicly available nf-core/RNA-seq pipeline version 3.4 [\u003cspan class=\"CitationRef\"\u003e20\u003c/span\u003e] implemented in Nextflow 21.04.0 [\u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e] using Docker 20.10.8 [\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e] with the minimal command. Lane-level reads were trimmed using Trim Galore 0.6.7 [\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e] and aligned to the human genome (GRCh38.p13) using STAR 2.7.9a [\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e]. The gene-level assignment was then performed using featureCounts 1.6.457 [\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e] and transcript-level quantification was done by Salmon v1.5.2 [\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e]. Analysis was performed using custom scripts in R version 4.1.1 using the DESeq2 v.1.32.0 framework [\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e]. Differential expression analysis was done with DESEQ2 package in R [\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e] and following the instruction for Salmon quantification (Analyzing RNA-seq data with DESeq2). Gene ontology analysis was performed using the website ShinyGO and genes upregulated/downregulated classification analysis was performed using PANTHER classification system.\u003c/p\u003e\n \u003ch2\u003e2.15. Statistical Analysis\u003c/h2\u003e\n \u003cp\u003eSignificance was calculated as indicated with unpaired/paired t-test or Wilcoxon or Mann-Whitney test using GraphPad Prism. Data are expressed as mean SD\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of mean (SEM). ns: P\u0026thinsp;\u0026gt;\u0026thinsp;0.05; *: P\u0026thinsp;\u0026le;\u0026thinsp;0.05; **: P\u0026thinsp;\u0026le;\u0026thinsp;0.01; ***: P\u0026thinsp;\u0026le;\u0026thinsp;0.001; ****: P\u0026thinsp;\u0026le;\u0026thinsp;0.0001.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv class=\"Section2\" id=\"Sec14\"\u003e\n \u003ch2\u003e3.1. IRAK2 is enriched by primary triple-negative breast cancer stem cell lines\u003c/h2\u003e\n \u003cp\u003eWe isolated several primary BCSC lines from human tumors of TNBC, five of which were named BCSC1, BCSC2, BCSC3, BCSC4 and BCSC5 [\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e]. IRAK2 expression was assessed in these primary cell lines and the commercial cell line MDA-MB-468 at mRNA and protein levels (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea, \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eb and \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ec). BCSCs presented varying expression levels of IRAK2. Precisely, IRAK2 was strongly expressed in BCSC1, BCSC2 and BCSC5 compared to BCSC3, BCSC4 and MDA-MB-468. RNA microarray analysis showed elevated IRAK2 expression in primary cell lines compared to respective xenografts and tumors (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ed), identifying IRAK2 as a BCSCs marker.\u003c/p\u003e\n \u003cp\u003eUsing a stable knockdown, IRAK2 expression was downregulated in BCSCs. BCSC1 knockdown cells presented 50% IRAK2 downregulation at mRNA level (Fig. S1b), confirmed at protein level (Fig. S1c and S1d), and showed tighter, smaller colonies compared to control cells (Fig. S1a). BCSC2 and BCSC5 showed a 60% IRAK2 knockdown at mRNA level and almost no phenotypic or proliferative alteration. BCSC3 and BCSC4 were highly affected by the knockdown and could not be cultivated further. Follow-up experiments were performed with BCSC1. We demonstrated that BCSC1 with IRAK2 downregulation showed significant slower proliferation (Fig. S1e). Furthermore, we evaluated shIRAK2 BCSC1 sphere-forming capacity to investigate stemness features and found it reduced by 53% (Fig. S1f and S1g).\u003c/p\u003e\n \u003cp\u003eConsidering that BCSCs viability, particularly BCSC3 and BCSC4, was impaired after IRAK2 stable knockdown, an inducible system was subsequently adopted, controlling IRAK2 shRNA transcription through Doxycycline administration [\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e]. Inducible knockdown was performed in BCSC1, BCSC2, BCSC3, BCSC5 and MDA-MB-468. After the infection and selection, cells were assessed for proliferation and sphere-forming capacity in presence of the knockdown. Although BCSC2 and BCSC5 presented a respective mRNA knockdown of 31% and 51%, they did not show phenotypic or proliferative alteration being excluded from follow-up experiments. Upon Doxycycline administration, BCSC1 presented IRAK2 70% knockdown at mRNA level, BCSC3 of 65% and MDA-MB-468 of 37% (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ee). IRAK2 knockdown was confirmed in all cell lines at protein level (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ef and \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eg).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec15\"\u003e\n \u003ch2\u003e3.2. IRAK2 downregulation affects BCSCs and MDA-MB-468 proliferation and sphere-forming capacity\u003c/h2\u003e\n \u003cp\u003eUpon IRAK2 induced downregulation, BCSCs and MDA-MB-468 displayed phenotypic changes, cells grew sparser and presented fewer cell-cell contacts (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea). Morphology changes characterizing the knockdown cells remained stable throughout sub-cultivation. BCSC1 presenting IRAK2-induced knockdown reproduced a phenotype analogous to the stable one, originating tighter and smaller colonies compared to control cells (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea).\u003c/p\u003e\n \u003cp\u003eAll cell lines presented significantly decreased proliferation in presence of IRAK2 induced knockdown (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb), suggesting that IRAK2 expression confers growth advantage. Particularly, BCSC3 and MDA-MB-468 knockdown cells proliferated dramatically less than their respective controls and never reached confluency (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb).\u003c/p\u003e\n \u003cp\u003eBCSC1, BCSC3 and MDA-MB-468 sphere-forming capacity was assessed to investigate the effects of IRAK2 downregulation on cellular self-renewal. Sphere-forming capacity was reduced by 33% in shIRAK2 BCSC1, by 71% in BCSC3 and by 83% in MDA-MB-468 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ec and \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ed), confirming that IRAK2 is involved in cellular self-renewal capacity \u003cem\u003ein vitro\u003c/em\u003e.\u003c/p\u003e\n \u003cp\u003eWe previously described IRAK2 downregulation inducing bi-potent cell line MDA-MB-468 luminal-like differentiation, impairing K5 and inducing K8 expression [\u003cspan class=\"CitationRef\"\u003e7\u003c/span\u003e]. BCSC1 and BCSC3 present a bi-lineage phenotype as well, expressing both luminal epithelial and myoepithelial keratins [\u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e]. Assessing keratins expression in control and shIRAK2 BCSC1 and BCSC3, there was not a significant difference, suggesting persistent luminal epithelial and myoepithelial characteristics of the cells (Fig. S2a and S2b).\u003c/p\u003e\n \u003cp\u003eConsequently, we hypothesized that the effects on proliferation and self-renewal seen in primary BCSCs might not reflect the differentiation phenotype observed in the longtime established and homogenous MDA-MB-468 cell line.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec16\"\u003e\n \u003ch2\u003e3.3. IRAK2 knockdown delays BCSC1 and MDA-MB-468 tumor-forming capacity \u003cem\u003ein vivo\u003c/em\u003e\u003c/h2\u003e\n \u003cp\u003eGiven that we previously showed that BCSC1 transplanted into mice exhibits high tumorigenic potential [\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e], we wondered if IRAK2 downregulation could affect its tumor-forming ability. We reported that xenografts characterized by IRAK2 stable knockdown, which was confirmed at protein level (Fig. S3d and S3e), were smaller (Fig. S3a and S3b). Moreover, IRAK2 knockdown xenografts grew slower and weighted less compared to control xenografts (Fig. S3b and S3c). The expression of the proliferation marker ki67 was analyzed to identify proliferative differences, but we could not observe significant difference between control and knockdown tumors (Fig. S3f).\u003c/p\u003e\n \u003cp\u003eBCSC1 and MDA-MB-468 tumorigenicity was subsequently evaluated using a Doxycycline feeding paradigm to assess the effects of IRAK2 downregulation after initial tumor growth. When BCSC1 and MDA-MB-468 xenografts reached 3 mm diameter, IRAK2 knockdown was induced by feeding mice with gelatin containing Doxycycline. IRAK2 knockdown in BCSC1 and MDA-MB-468 xenografts was confirmed at mRNA and protein levels (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ed, \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ee and \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ef). BCSC1 and MDA-MB-468 shIRAK2 xenografts were significantly smaller and their growth was significantly delayed (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea and \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb). BCSC1 and MDA-MB-468 shIRAK2 xenografts weight was reduced compared to respective controls (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ec).\u003c/p\u003e\n \u003cp\u003eInterestingly, MDA-MB-468 formed micrometastasis around the primary tumor, mainly in control animals (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea, right panels). Four out of six control xenografts presented one to three micrometastatic growths, while four out of eight shIRAK2 MDA-MB-468 xenografts presented only one small micrometastatic growth (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea, right side).\u003c/p\u003e\n \u003cp\u003eThese results confirmed our initial hypothesis of IRAK2 being involved in TNBC progression, as its stable or induced downregulation significantly delayed tumor growth.\u003c/p\u003e\n \u003ch2\u003e\u003cstrong\u003e3.4. IRAK2 downregulation affects NF-\u0026kappa;B and ERK phosphorylation and IL-6 and cyclin D1 expression in BCSCs and MDA-MB-468\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eSince IRAK2 contributes to TLRs/IL-1Rs signaling and the UPR, pathways that activate NF-\u0026kappa;B, we evaluated NF-\u0026kappa;B phosphorylation upon IRAK2 induced knockdown. BCSC1 and BCSC3 presented decreased NF-\u0026kappa;B phosphorylation after IRAK2 knockdown induction (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea).\u003c/p\u003e\n \u003cp\u003eNF-\u0026kappa;B activation may lead to IL-6 expression, therefore IRAK2 knockdown effects on IL-6 expression were evaluated performing western blot analysis. IL-6 was downregulated in shIRAK2 BCSC1 and BCSC3 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eb and \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ec).\u003c/p\u003e\n \u003cp\u003eSince ERK may be activated downstream IRAK2 pathway activation, we assessed its phosphorylation, reporting it was significantly decreased in shIRAK2 BCSC3 and MDA-MB-468 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ed and \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ee).\u003c/p\u003e\n \u003cp\u003eGiven that IRAK2 downregulation impaired BCSC1, BCSC3 and MDA-MB-468 ability to proliferate, cyclin D1 expression was evaluated, as it allows cell cycle progression from G1 to S phase [\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e]. Furthermore, cyclin D1 expression can be induced by NF-\u0026kappa;B translocation and ERK pathway [\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e]. Cyclin D1 expression was significantly decreased at protein level in shIRAK2 cells (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ef and \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eg). Moreover cyclin D1 expression assessed by immunohistochemistry was affected in induced shIRAK2 BCSC1 xenografts (Fig. S4).\u003c/p\u003e\n \u003cp\u003eThese results indicated that IRAK2 is required for the activation of proteins recruited downstream its pathway. In particular, IRAK2, activating NF-\u0026kappa;B and ERK pathways, which in turn promote cyclin D1 and IL-6 expression, favors cellular survival and tumor-progression ability.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec17\"\u003e\n \u003ch2\u003e3.5. IRAK2 is upregulated by ER stress and it participates in ERN1 pathway\u003c/h2\u003e\n \u003cp\u003eGiven that previous studies showed IRAK2 contribution to the UPR signaling and our cells looked highly affected by IRAK2 knockdown, we reasoned that the phenotype we observed might result from cellular impaired ability to handle stress [\u003cspan class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e\n \u003cp\u003eThapsigargin was used to induce ER stress in BCSC1, BCSC3 and MDA-MB-468, and UPR genes expression was evaluated at mRNA level comparing the effects of IRAK2 knockdown and Thapsigargin exposure (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ea). As expected, cells presented increased ERN1 and CHOP expression and augmented Xbp1 splicing in presence of Thapsigargin-induced ER stress. Interestingly, IRAK2 expression was likewise increased in presence of ER stress, as well as ERN1 and CHOP mRNA transcription and Xbp1 splicing were reduced upon IRAK2 downregulation. IRAK2 contribution to ERN1 pathway activation was confirmed in BCSC3, since in presence of ER stress and IRAK2 downregulation ERN1 and CHOP expression was decreased and Xbp1 splicing was reduced. At the protein level, ERN1 expression was significantly decreased in shIRAK2 BCSC1, BCSC3 and MDA-MB-468 (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eb and \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ec), whereas CHOP expression was affected but not significantly (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ed and \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ee).\u003c/p\u003e\n \u003cp\u003eThese results suggested that the phenotype observed upon IRAK2 knockdown could be correlated to IRAK2 interaction with ERN1. IRAK2 downregulation, affecting ERN1 pathway that favors homeostasis restoration in presence of stress, impairs cells ability to properly handle and overcome cellular stress, compromising cells proliferation and viability.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec18\"\u003e\n \u003ch2\u003e3.6. IRAK2 downregulation affects BCSC1 and BCSC3 autophagy and induces apoptosis\u003c/h2\u003e\n \u003cp\u003eSince UPR and autophagy are pathways strictly related and we previously showed IRAK2 participation in the UPR through ERN1 signaling pathway, we investigated autophagy in BCSC1 and BCSC3. Vesicles puncta quantification displayed decreased autophagy in shIRAK2 BCSC1 and BCSC3 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003ea and \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eb). These results suggested that IRAK2, as well as mediating UPR, is also involved in autophagy, another pathway often exploited by cells to manage stress conditions.\u003c/p\u003e\n \u003cp\u003eGiven that UPR and autophagy pathways can switch to apoptosis when cells are incapable of restoring homeostasis, we evaluated if IRAK2 knockdown could also affect cells apoptotic processes. BCSC1 and BCSC3 showed increased apoptosis upon IRAK2 induced downregulation, which was statistically significant in BCSC3 (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003ec and \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003ed). Moreover, evaluating the expression of the pro-apoptotic protein Bcl-2 homologous antagonist/killer (Bak1) in BCSC1, BCSC3 and MDA-MB-468, it was increased in IRAK2 induced knockdown BCSC3 compared to control cells (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003ee).\u003c/p\u003e\n \u003cp\u003eThese data suggested that IRAK2 participates to the activation of pathways that are necessary to regulate stress and restore homeostasis, and their impairment leads the cells towards apoptosis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec19\"\u003e\n \u003ch2\u003e3.7. IRAK2 knockdown affects pathways related to proliferation, response to stimuli and signal transduction\u003c/h2\u003e\n \u003cp\u003eTranscriptome analysis of shIRAK2 BCSC1, BCSC3 and MDA-MB-468 revealed that BCSC3 is highly affected by IRAK2 knockdown, presenting 1479 downregulated and 1103 upregulated genes, while BCSC1 and MDA-MB-468 display lesser genetic perturbation (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003ea). Thus, there are not many genes that are commonly downregulated or upregulated by the three cell lines upon IRAK2 knockdown (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eb and \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003ec).\u003c/p\u003e\n \u003cp\u003eBCSC1, BCSC3 and MDA-MB-468 present one commonly and significantly downregulated gene, CMTM6, and one commonly upregulated, TAGLN. Genes commonly downregulated by BCSC1 and BCSC3 present gene ontology enrichment and belong to pathways involved in cell response to stimulus, communication, signal transduction and migration (Fig. S5a). shIRAK2 BCSC3 and MDA-MB-468 present common downregulation of genes connected to metabolism, localization, response to stimulus and signaling (Fig. S5b). Genes commonly upregulated by shIRAK2 BCSC1 and BCSC3 are involved in cellular processes, localization, metabolism, development, multicellular organismal processes, biological regulation and response to stimuli (Fig. S5c). shIRAK2 BCSC1 and MDA-MB-468 present two significantly upregulated genes in common, TAGLN and PAPPA. shIRAK2 BCSC3 and MDA-MB-468 commonly upregulated genes are associated with metabolic and cellular processes, biological regulation and adhesion (Fig. S5d).\u003c/p\u003e\n \u003cp\u003eEvaluating each cell line singularly, shIRAK2 BCSC1 displays downregulation of genes involved in migration, proliferation, regulation of phosphorylation and response to stimuli (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003ed), and the upregulation of genes involved in adhesion and differentiation (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003ee). shIRAK2 BCSC3 shows downregulation of genes involved in chromosome organization, biosynthetic processes and cellular or macromolecule metabolic processes (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003ef) and the upregulation of genes involved in morphogenesis, exocytosis and cellular localization (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eg). shIRAK2 MDA-MB-468 downregulated genes are involved in cellular and metabolic processes, biological regulations, response to stimulus, localization and signaling whereas the upregulated ones are related to biological adhesion, developmental processes, signaling and response to stimuli (Fig. S5e and S5f). These results supported our hypothesis of IRAK2 being involved in cells growth and viability.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eWe previously reported that IRAK2 downregulation in the commercial TNBC cell line MDA-MB-468 induced cells luminal-like differentiation [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Since cellular differentiation and proliferation present an inverse relationship, we wondered if IRAK2 targeting in BCSCs may impair TNBC aggressive growth [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWe proved that IRAK2 contributes to BCSCs and MDA-MB-468 self-renewal and likely has a pro-oncogenic role. However, BCSCs bi-potential phenotype persisted upon IRAK2 downregulation, since cells keratins expression was not affected, implying an absence of overt differentiation. Hence, we investigated the molecular pathways responsible for the effects we observed. We reported that NF-κB and ERK phosphorylation was impaired in presence of IRAK2 knockdown and considering that NF-κB and ERK induce cell growth, their impairment upon IRAK2 knockdown could explain the decreased proliferation we had observed [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Moreover, IL-6 and cyclin D1 expression was reduced in presence of IRAK2 knockdown. Given that IL-6 contributes to tumor progression and inflammation, its impairment could be highly beneficial in the prospective of targeting IRAK2 as a therapeutic approach. Since cyclin D1 expression was impaired also in shIRAK2 BCSC1 xenografts, we suppose its affected expression may affect cell cycle progression delaying tumor growth. Complexively these results indicated that IRAK2 may drive cellular growth through NF-κB and ERK pathways activation. These pathways, in turn, may induce the transcription of genes like IL-6 and cyclin D1, allowing cellular proliferation and growth.\u003c/p\u003e \u003cp\u003eIt has been previously shown that ER stress induces IRAK2 expression and IRAK2 increments ER stress response establishing a loop with ERN1, a protein we demonstrated being gatekeeper of stemness in MDA-MB-468 [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. We reported that IRAK2 expression is upregulated by BCSCs and MDA-MB-468 when an ER-stress inducer stimulates them, revealing IRAK2 involvement in UPR. IRAK2 knockdown per se affected ERN1 expression and Xbp1 splicing, suggesting a constitutive interaction between IRAK2 and ERN1 signaling. These data opened up a new prospective related to ERN1 role in MDA-MB-468. The cellular growth inhibition that we reported upon ERN1 depletion, as well as being caused by cells differentiating, could be addressed to ERN1 implications in UPR and explained as cells lost ability to manage ER stress.\u003c/p\u003e \u003cp\u003eWe reported that BCSC1 and BCSC3 presenting IRAK2 knockdown displayed a significantly decreased autophagy, suggesting that IRAK2 is required to maintain homeostasis through autophagy processes. Considering that ERN1 induces autophagy through TRAF2/JNK/c-Jun pathway or Xbp1 splicing [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], we concluded that the decreased autophagy we observed could be caused by IRAK2-mediated downregulation of ERN1. BCSC1 and BCSC3 displayed also increased apoptosis upon IRAK2 knockdown, with shIRAK2 BCSC3 presenting increased expression of the pro-apoptotic protein Bak1. These data recapitulated that IRAK2, as well as driving BCSCs and MDA-MB-468 aggressive growth, may also favor cellular ability to handle stress conditions promoting UPR and autophagy, avoiding apoptosis. Consequently, IRAK2 knockdown may affect, on one side, cellular proliferation and self-renewal capacity, and on the other, cellular resistance to hostile conditions.\u003c/p\u003e \u003cp\u003eTranscriptome analysis of BCSC1, BCSC3 and MDA-MB-468 revealed that genes downregulated by IRAK2 knockdown are involved in proliferation, self-renewal capacity, cell cycle dysregulation, apoptosis and cell survival, often involving ERK, STAT3, AKT pathways, confirming our \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e data [\u003cspan additionalcitationids=\"CR36\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Moreover, the transcriptome analysis displayed that IRAK2 downregulation affects pathways involved in cellular metabolic processes, accordant with the recent discovery of IRAK2 involvement in pancreatic cancer metabolic reprogramming through NF-κB signaling [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eConsidering that conventional treatments for breast cancer present limited efficacy, lack of specificity for cancer cells and can cause several side effects on patients, there is a need for new better treatments [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Kinases targeting previously shown to inhibit TNBC growth successfully [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. In particular, the targeting of proteins belonging to IRAK2 pathway, such as IRAK1 and IRAK4, previously proved that can affect cell growth, migration, tumorigenesis and chemoresistance [\u003cspan additionalcitationids=\"CR43 CR44\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Likewise the targeting of UPR-related proteins was shown to be a promising anticancer strategy [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSince we showed that IRAK2 downregulation impaired the proper activation of its pathway and we demonstrated IRAK2 participation in the UPR, we propose IRAK2 as a potential target to affect TNBC aggressive growth.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eWe demonstrated that IRAK2 downregulation in TNBC stem cells is beneficial given that IRAK2 favors cells growth in 2D and 3D \u003cem\u003ein vitro\u003c/em\u003e and contributes to tumor progression \u003cem\u003ein vivo\u003c/em\u003e. Moreover, we reported that IRAK2 downregulation affected UPR and autophagy, pathways exploited by cancer cells to survive, furtherly supporting the beneficial impact of IRAK2 impairment in TNBC.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe acknowledge Birgit Klein, Saskia Breuel and Thomas Hansen for their technical support and Ralf Weiskirchen for manuscript reading and comments.\u003cstrong\u003e \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by Deutsche Forschungsgemeinschaft (German Research Foundation), grant number 407869199. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors and Affiliations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDepartment of Obstetrics and Gynecology, University Hospital Aachen (UKA), D-52074 Aachen, Germany \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFrancesca Ferraro, Anja Steinle, Harini Narasimhan, Andreas Bleilevens, Elmar Stickeler and Jochen Maurer\u003cstrong\u003e \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePathology Institute, University Hospital Aachen (UKA), D-52074 Aachen, Germany\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTill Braunschweig \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJochen Maurer is responsible for the conceptualization, validation, resources, writing - review and editing, visualization, supervision, project administration, funding acquisition; Francesca Ferraro contributed to conceptualization, methodology, software analysis, formal analysis, investigation, data curation, writing - original draft preparation, writing - review and editing; Till Braunschweig, Anja Steinle and Andreas Bleilevens contributed to methodology; Harini Narasimhan contributed to methodology, writing - review and editing; Elmar Stickeler contributed to project administration; All authors have read and agreed to the published version of the manuscript. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding author\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondance to PD Dr. Jochen Maurer, [email protected]\u003cstrong\u003e \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the experiments were performed according to the Declaration of Helsinki. All the experimental protocols were approved by the Institutional Review Board in the Ethics vote 307/13 (independent Ethics Committee University of Freiburg). Informed consent was obtained from all subjects involved in the study. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose. \u003cstrong\u003e \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eF. M. Alkabban and T. Ferguson, in \u003cem\u003eStatPearls\u003c/em\u003e (StatPearls Publishing, Treasure Island (FL), 2021).\u003c/li\u003e\n\u003cli\u003eK. Barzaman, J. Karami, Z. Zarei, A. Hosseinzadeh, M. H. Kazemi, S. Moradi-Kalbolandi, E. Safari, and L. Farahmand, Int Immunopharmacol \u003cstrong\u003e84\u003c/strong\u003e, 106535 (2020).\u003c/li\u003e\n\u003cli\u003eW. D. Foulkes, I. E. Smith, and J. S. Reis-Filho, N Engl J Med \u003cstrong\u003e363\u003c/strong\u003e, 1938 (2010).\u003c/li\u003e\n\u003cli\u003eS.-Q. Geng, A. T. Alexandrou, and J. J. Li, Cancer Lett \u003cstrong\u003e349\u003c/strong\u003e, 1 (2014).\u003c/li\u003e\n\u003cli\u003eX. Li, J. Strietz, A. Bleilevens, E. Stickeler, and J. Maurer, Int J Mol Sci \u003cstrong\u003e21\u003c/strong\u003e, (2020).\u003c/li\u003e\n\u003cli\u003eE. Metzger, S. S. Stepputtis, J. Strietz, B.-T. Preca, S. Urban, D. Willmann, A. Allen, F. Zenk, N. Iovino, P. Bronsert, A. Proske, M. Follo, M. Boerries, E. Stickeler, J. Xu, M. B. Wallace, J. A. Stafford, T. Kanouni, J. Maurer, and R. Sch\u0026uuml;le, Cancer Res \u003cstrong\u003e77\u003c/strong\u003e, 5900 (2017).\u003c/li\u003e\n\u003cli\u003eJ. Strietz, S. S. Stepputtis, B.-T. Preca, C. Vannier, M. M. Kim, D. J. Castro, Q. Au, M. Boerries, H. Busch, P. Aza-Blanc, S. Heynen-Genel, P. Bronsert, B. Kuster, E. Stickeler, T. Brabletz, R. G. Oshima, and J. Maurer, Oncotarget \u003cstrong\u003e7\u003c/strong\u003e, 83278 (2016).\u003c/li\u003e\n\u003cli\u003eJ. Strietz, S. S. Stepputtis, M. Follo, P. Bronsert, E. Stickeler, and J. Maurer, Int J Mol Sci \u003cstrong\u003e22\u003c/strong\u003e, 1808 (2021).\u003c/li\u003e\n\u003cli\u003eS.-C. Lin, Y.-C. Lo, and H. Wu, Nature \u003cstrong\u003e465\u003c/strong\u003e, 885 (2010).\u003c/li\u003e\n\u003cli\u003eE. Meylan and J. Tschopp, Nature Immunology \u003cstrong\u003e9\u003c/strong\u003e, 581 (2008).\u003c/li\u003e\n\u003cli\u003eY.-J. Guo, W.-W. Pan, S.-B. Liu, Z.-F. Shen, Y. Xu, and L.-L. Hu, Exp Ther Med \u003cstrong\u003e19\u003c/strong\u003e, 1997 (2020).\u003c/li\u003e\n\u003cli\u003eS. Benosman, P. Ravanan, R. G. Correa, Y.-C. Hou, M. Yu, M. F. Gulen, X. Li, J. Thomas, M. Cuddy, Y. Matsuzawa, R. Sano, P. Diaz, S. Matsuzawa, and J. C. Reed, PLoS One \u003cstrong\u003e8\u003c/strong\u003e, (2013).\u003c/li\u003e\n\u003cli\u003eH. Wang, S. M. Flannery, S. Dickh\u0026ouml;fer, S. Huhn, J. George, A. V. Kubarenko, J. Lascorz, M. Bevier, J. Willemsen, T. Pichulik, C. Schafmayer, M. Binder, B. Manoury, S. R. Paludan, M. Alarcon-Riquelme, A. G. Bowie, A. F\u0026ouml;rsti, and A. N. R. Weber, J Biol Chem \u003cstrong\u003e289\u003c/strong\u003e, 23123 (2014).\u003c/li\u003e\n\u003cli\u003eL. Sisinni, M. Pietrafesa, S. Lepore, F. Maddalena, V. Condelli, F. Esposito, and M. Landriscina, Int J Mol Sci \u003cstrong\u003e20\u003c/strong\u003e, (2019).\u003c/li\u003e\n\u003cli\u003eK. Zhang, H. Liu, Z. Song, Y. Jiang, H. Kim, L. Samavati, H. M. Nguyen, and Z.-Q. Yang, IScience \u003cstrong\u003e23\u003c/strong\u003e, 101503 (2020).\u003c/li\u003e\n\u003cli\u003eR. Clarke, K. L. Cook, R. Hu, C. O. B. Facey, I. Tavassoly, J. L. Schwartz, W. T. Baumann, J. J. Tyson, J. Xuan, Y. Wang, A. W\u0026auml;rri, and A. N. Shajahan, Cancer Res \u003cstrong\u003e72\u003c/strong\u003e, 1321 (2012).\u003c/li\u003e\n\u003cli\u003eW. Jiang, R. Hua, M. Wei, C. Li, Z. Qiu, X. Yang, and C. Zhang, Sci Rep \u003cstrong\u003e5\u003c/strong\u003e, 13875 (2015).\u003c/li\u003e\n\u003cli\u003eS. Wee, D. Wiederschain, S.-M. Maira, A. Loo, C. Miller, R. deBeaumont, F. Stegmeier, Y.-M. Yao, and C. Lengauer, Proc Natl Acad Sci U S A \u003cstrong\u003e105\u003c/strong\u003e, 13057 (2008).\u003c/li\u003e\n\u003cli\u003eD. Wiederschain, S. Wee, L. Chen, A. Loo, G. Yang, A. Huang, Y. Chen, G. Caponigro, Y. M. Yao, C. Lengauer, W. R. Sellers, and J. D. Benson, Cell Cycle (Georgetown, Tex.) \u003cstrong\u003e8\u003c/strong\u003e, 498 (2009).\u003c/li\u003e\n\u003cli\u003eP. A. Ewels, A. Peltzer, S. Fillinger, H. Patel, J. Alneberg, A. Wilm, M. U. Garcia, P. Di Tommaso, and S. Nahnsen, Nat Biotechnol \u003cstrong\u003e38\u003c/strong\u003e, 276 (2020).\u003c/li\u003e\n\u003cli\u003eP. Di Tommaso, M. Chatzou, E. W. Floden, P. P. Barja, E. Palumbo, and C. Notredame, Nat Biotechnol \u003cstrong\u003e35\u003c/strong\u003e, 316 (2017).\u003c/li\u003e\n\u003cli\u003eD. Merkel, Linux Journal \u003cstrong\u003e2014\u003c/strong\u003e, (2014).\u003c/li\u003e\n\u003cli\u003eD. Krueger, E. Caballero, J.-H. Jacobsen, A. Zhang, J. Binas, D. Zhang, R. L. Priol, and A. Courville, in \u003cem\u003eProceedings of the 38th International Conference on Machine Learning\u003c/em\u003e (PMLR, 2021), pp. 5815\u0026ndash;5826.\u003c/li\u003e\n\u003cli\u003eA. Dobin, C. A. Davis, F. Schlesinger, J. Drenkow, C. Zaleski, S. Jha, P. Batut, M. Chaisson, and T. R. Gingeras, Bioinformatics \u003cstrong\u003e29\u003c/strong\u003e, 15 (2013).\u003c/li\u003e\n\u003cli\u003eY. Liao, G. K. Smyth, and W. Shi, Bioinformatics \u003cstrong\u003e30\u003c/strong\u003e, 923 (2014).\u003c/li\u003e\n\u003cli\u003eR. Patro, G. Duggal, M. I. Love, R. A. Irizarry, and C. Kingsford, Nat Methods \u003cstrong\u003e14\u003c/strong\u003e, 417 (2017).\u003c/li\u003e\n\u003cli\u003eM. I. Love, W. Huber, and S. Anders, Genome Biol \u003cstrong\u003e15\u003c/strong\u003e, 550 (2014).\u003c/li\u003e\n\u003cli\u003eJ. P. Alao, Molecular Cancer \u003cstrong\u003e6\u003c/strong\u003e, 24 (2007).\u003c/li\u003e\n\u003cli\u003eJ.-C. Chambard, R. Lefloch, J. Pouyss\u0026eacute;gur, and P. Lenormand, Biochimica et Biophysica Acta (BBA) - Molecular Cell Research \u003cstrong\u003e1773\u003c/strong\u003e, 1299 (2007).\u003c/li\u003e\n\u003cli\u003eM. Hinz, D. Krappmann, A. Eichten, A. Heder, C. Scheidereit, and M. Strauss, Mol Cell Biol \u003cstrong\u003e19\u003c/strong\u003e, 2690 (1999).\u003c/li\u003e\n\u003cli\u003eS. Ruijtenberg and S. van den Heuvel, Cell Cycle \u003cstrong\u003e15\u003c/strong\u003e, 196 (2016).\u003c/li\u003e\n\u003cli\u003eS.-C. Sun, Nat Rev Immunol \u003cstrong\u003e17\u003c/strong\u003e, 545 (2017).\u003c/li\u003e\n\u003cli\u003eK. Taniguchi and M. Karin, Nat Rev Immunol \u003cstrong\u003e18\u003c/strong\u003e, 309 (2018).\u003c/li\u003e\n\u003cli\u003eM. G. Metcalf, R. Higuchi-Sanabria, G. Garcia, C. K. Tsui, and A. Dillin, Sci Adv \u003cstrong\u003e6\u003c/strong\u003e, eabb9614 (2020).\u003c/li\u003e\n\u003cli\u003eY. Tian, X. Sun, G. Cheng, E. Ji, S. Yang, J. Feng, and L. Zheng, Ann Transl Med \u003cstrong\u003e9\u003c/strong\u003e, 131 (2021).\u003c/li\u003e\n\u003cli\u003eE. Cho, Y.-J. Kwon, D.-J. Ye, H.-S. Baek, T.-U. Kwon, H.-K. Choi, and Y.-J. Chun, Biomol Ther (Seoul) 591 (2019).\u003c/li\u003e\n\u003cli\u003eW. Zhai, X. Ye, Y. Wang, Y. Feng, Y. Wang, Y. Lin, L. Ding, L. Yang, X. Wang, Y. Kuang, X. Fu, Y. Eugene Chin, B. Jia, B. Zhu, F. Ren, and Z. Chang, Br J Cancer \u003cstrong\u003e124\u003c/strong\u003e, 1437 (2021).\u003c/li\u003e\n\u003cli\u003eJ. Yang, D.-J. Liu, J.-H. Zheng, R.-Z. He, D.-P. Xu, M.-W. Yang, H.-F. Yao, X.-L. Fu, J.-Y. Yang, Y.-M. Huo, L.-Y. Tao, R. Hua, Y.-W. Sun, X.-M. Kong, S.-H. Jiang, and W. Liu, Cell Oncol (Dordr) (2022).\u003c/li\u003e\n\u003cli\u003eK.-A. Won and C. Spruck, Int J Oncol \u003cstrong\u003e57\u003c/strong\u003e, 1245 (2020).\u003c/li\u003e\n\u003cli\u003eK. Sato, A. A. Padgaonkar, S. J. Baker, S. C. Cosenza, O. Rechkoblit, D. R. C. V. Subbaiah, J. Domingo-Domenech, A. Bartkowski, E. R. Port, A. K. Aggarwal, M. V. Ramana Reddy, H. Y. Irie, and E. P. Reddy, Nat Commun \u003cstrong\u003e12\u003c/strong\u003e, 4671 (2021).\u003c/li\u003e\n\u003cli\u003eC. Damaskos, A. Garmpi, K. Nikolettos, M. Vavourakis, E. Diamantis, A. Patsouras, P. Farmaki, A. Nonni, D. Dimitroulis, D. Mantas, E. A. Antoniou, N. Nikolettos, K. Kontzoglou, and N. Garmpis, Anticancer Research \u003cstrong\u003e39\u003c/strong\u003e, 5285 (2019).\u003c/li\u003e\n\u003cli\u003eW. Chen, T. Wei, Y. Chen, L. Yang, and X. Wu, Onco Targets Ther \u003cstrong\u003e13\u003c/strong\u003e, 12787 (2020).\u003c/li\u003e\n\u003cli\u003eN. Li, J. Jiang, J. Fu, T. Yu, B. Wang, W. Qin, A. Xu, M. Wu, Y. Chen, and H. Wang, J Exp Clin Cancer Res \u003cstrong\u003e35\u003c/strong\u003e, 140 (2016).\u003c/li\u003e\n\u003cli\u003eZ. N. Wee, S. M. J. M. Yatim, V. K. Kohlbauer, M. Feng, J. Y. Goh, B. Yi, P. L. Lee, S. Zhang, P. P. Wang, E. Lim, W. L. Tam, Y. Cai, H. J. Ditzel, D. S. B. Hoon, E. Y. Tan, and Q. Yu, Nat Commun \u003cstrong\u003e6\u003c/strong\u003e, (2015).\u003c/li\u003e\n\u003cli\u003eD. Zhang, L. Li, H. Jiang, B. Knolhoff, A. C. Lockhart, A. Wang-Gillam, D. G. DeNardo, M. B. Ruzinova, and K.-H. Lim, Clin Cancer Res \u003cstrong\u003e23\u003c/strong\u003e, 1748 (2017).\u003c/li\u003e\n\u003cli\u003eC. Kim and B. Kim, Nutrients \u003cstrong\u003e10\u003c/strong\u003e, (2018).\u003c/li\u003e\n\u003cli\u003eJ. Liu, Y. Chen, Q. Huang, W. Liu, X. Ji, F. Hu, Y. Zhu, L. Zhang, and G. Dong, Cell. Signal. \u003cstrong\u003e48\u003c/strong\u003e, 69 (2018).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"triple-negative breast cancer, breast cancer stem cells, IRAK2, endoplasmic reticulum stress, NF-κB, ERK","lastPublishedDoi":"10.21203/rs.3.rs-1802684/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1802684/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003ePurpose\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eWe previously screened kinases whose depletion elicited a differentiation response of the triple-negative breast cancer (TNBC) cell line MDA-MB-468. In particular, we demonstrated that the downregulation of the kinases ERN1 and ALPK1 affected cellular proliferation, self-renewal and tumor-forming capacity. Interleukin-1 receptor-associated kinase 2 (IRAK2) was identified in the screening and IRAK2 is highly enriched in our established breast cancer stem cells (BCSCs) isolated from human tumors of TNBC. Therefore, we wondered if IRAK2 depletion could affect BCSCs growth. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eWe downregulated IRAK2 in BCSCs and MDA-MB-468 by lentivirus-mediated shRNA targeting and assessed the effects of the knockdown evaluating keratins expression, cellular proliferation and self-renewal capacity. We injected the cells into the mammary glands of mice to evaluate the impact of IRAK2 knockdown on their tumor-forming capacity. We investigated the expression of genes belonging to IRAK2 pathway and related to cancer proliferation, UPR, autophagy and apoptosis in presence of IRAK2 downregulation. We performed transcriptome analysis to have an overview of the pathways affected by the knockdown. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults \u003c/strong\u003e\u003c/p\u003e\u003cp\u003eCells characterized by IRAK2 downregulation exhibited decreased proliferation, sphere-forming capacity and delayed tumor formation. IRAK2 knockdown impaired NF-κB and ERK phosphorylation, IL-6 and cyclin D1 expression. Moreover, IRAK2 downregulation mitigated ERN1 signalling and autophagy, pathways adopted by cells to manage stress conditions, and induced apoptosis.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eWe showed that IRAK2 contributes to TNBC tumorigenicity and its knockdown compromises cellular ability to sustain aggressive growth and to endure cellular stress. Therefore we suggest IRAK2 as a promising target for the impairment of TNBC.\u003c/p\u003e","manuscriptTitle":"IRAK2 contributes to triple-negative breast cancer growth via NF-κB, ERK and stress-related signaling pathways","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-07-06 15:41:25","doi":"10.21203/rs.3.rs-1802684/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d284208a-53a0-46a2-bfd5-1926e983474f","owner":[],"postedDate":"July 6th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-07-06T15:41:27+00:00","versionOfRecord":[],"versionCreatedAt":"2022-07-06 15:41:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1802684","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1802684","identity":"rs-1802684","version":["v1"]},"buildId":"omnImTCwR2MFx8CMYfrG7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}