Modulation of noradrenergic signalling reverses stress-induced changes in the hippocampus: involvement of orexinergic systems | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Modulation of noradrenergic signalling reverses stress-induced changes in the hippocampus: involvement of orexinergic systems Masoumeh Sarfi, Mahmoud Elahdadi Salmani, Taghi Lashkarbolouki, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4986129/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Stress can be beneficial for adapting to dangerous situations in the short term, but can be damaging in the long term, especially in the hippocampus. The noradrenergic and orexinergic systems play important roles in the stress response. This study investigated the effect of noradrenergic activation on the changes induced by chronic stress in the hippocampus and the involvement of orexinergic modulation in this process. Twenty male Wistar rats were subjected to chronic stress, acute stress, administration of α2 receptor antagonist yohimbine, or their combinations. Plasma corticosterone (CORT) was measured using a fluorometric method. Expression of prepro-orexin (prepro-OX), orexin receptor-1 (OXr1), and glucocorticoid receptor (GR) was analyzed using RT-PCR. Neuronal populations were quantified using Nissl staining. Chronic and acute stress increased plasma CORT levels, gene expression of prepro-OX, OXr1, and GR, while decreasing neuronal number, with the chronic stress having a more pronounced effect. The stress- induced and Yohimbine treated groups demonstrated a higher level of plasma CORT. Chronic stress substantially increased prepro-OX expression, while yohimbine recovered the profile in chronically stressed animals. OXr1 expression was profoundly higher in the chronic stress group, while chronic stress combined with yohimbine decreased that profile. Similarly, chronic stress upregulated glucocorticoid receptor, while chronic stress combined with yohimbine reversed the effect. Conversely, the chronic stress reduced hippocampal neuronal populations and chronic stress combined with yohimbine partially compensated the neuronal numbers compared to chronic stress alone. The results suggest that noradrenergic signalling can reverse the chronic stress-induced impairments in prepro-OX, OXr1, GR, and neuronal population. Stress Noradrenergic system Orexinergic modulation Glucocorticoid receptor Neuronal populations Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Stress exerts a profound influence on both mental and physical well-being (Selye, 1950 ). Central to the orchestration of stress responses is the hypothalamus-pituitary-adrenal (HPA) axis (Chrousos & Gold, 1992 ; Ramot et al., 2017 ). Yet, when subjected to prolonged activation, as in the case of chronic stress, this axis can be thrown into disorder, disrupting the delicate balance of internal processes and paving the way for a host of pathological conditions (McEwen, 2008 ). Additionally, the noradrenergic system wields substantial influence over stress-related physiological responses and behavioural outcomes (Bao et al., 2008 ; Chen et al., 2019 ). Activation of this system can lead to increased motivation, enhanced memory formation, and improved cognitive performance, all of which can be beneficial in dealing with stressors (Zerbes et al., 2019 ; Song et al., 2021 ). However, dysregulation or excessive activation of the noradrenergic system can contribute to the development of anxiety disorders, mood disorders, and other stress-related psychiatric conditions (Yamamoto et al., 2014 ; Espana et al., 2016 ). These physiological changes are crucial for individuals to effectively respond to stressful situations and adapt to the demands placed upon them. Within the intricate landscape of stress responses, the hippocampus emerges as a linchpin, charged with the consolidation and retrieval of contextual memories (Alfarez et al., 2003 ). However, its pivotal role is not without vulnerability. Both acute and chronic stressors have been shown to exact a toll on this vital brain region, precipitating alterations in neuronal structure, suppression of proliferation, and a reduction in overall volume (Stankiewicz et al., 2015 ; Schoenfeld et al., 2017 ). Chronic stress, in particular, can yield a spectrum of responses, ranging from adaptive adjustments to psychological maladjustment, underscoring the intricate interplay between stress and the hippocampus (McEwen, 1998 ). Furthermore, the deleterious impact of chronic stress and glucocorticoids on hippocampal function perpetuates a cycle of dysregulation within the HPA axis (McEwen, 2008 ). Even without elevated glucocorticoid levels during subsequent metabolic challenges, the hippocampus retains an imprint of its previous encounters with chronic stress, rendering it more susceptible to future perturbations (McEwen, 2008 ). Orexin neuropeptides, another vital cog in the stress-response machinery, are implicated not only in modulating the stress response but also in regulating mood (Lin & Huang, 2022 ). These neuropeptides, harboured within orexin-containing neurons, extend their reach to stress-regulatory nuclei such as the hippocampus and amygdala (Peyron et al., 1998 ; Salehabadi et al., 2020 ). Previous investigations have elucidated the surge in prepro-orexin (prepro-OX), the precursor protein for orexin neuropeptides, in response to chronic stress in rodent models, underscoring its pivotal role in stress adaptation (Soya & Sakurai, 2020 ). Moreover, orexin signalling has been linked to the activation of the noradrenergic system, revealing a complex interplay between these neurochemical entities (Sears et al., 2013 ; Hasegawa et al., 2014 ). On the other hand, reduced orexinergic activation in some pathological conditions might accompany a decrease in the noradrenergic system, particularly originating from the locus coeruleus (LC) (Hasegawa et al., 2014 ). The hippocampus, in addition to its role in memory processes, exerts a profound influence on cognition, emotion, and the regulation of the HPA axis, underscoring its multifaceted significance (Sapolsky et al., 2000 ). The repercussions of chronic stress on this vital brain structure are far-reaching, manifesting as both structural and functional alterations, including diminished neurogenesis and dendritic remodelling (McEwen & Seeman, 1999 ). Within this intricate milieu, the glucocorticoid receptor (GR) emerges as a critical player responsible for furnishing feedback inhibition to the HPA axis. Disturbances in GR expression have been implicated in rendering individuals more susceptible to the ravages of stress (Han et al., 2017 ). The present study embarks on a journey to unravel the intricacies of chronic and acute stress responses within the framework of the noradrenergic system and orexin signalling in rodent models. By scrutinizing the expression levels of prepro-OX, orexin receptor-1 (OXr1), and the glucocorticoid receptor in experimental groups subjected to a battery of stress paradigms, including chronic and acute stressors, as well as the administration of an alpha-2 receptor antagonist (yohimbine) that potentiates noradrenergic transmission, we aim to delineate the nuanced interplay between these crucial neural elements. Additionally, an in-depth exploration of the neuronal population within the hippocampus will shed light on the impact of stress on this pivotal brain region. This study aims to provide a fresh perspective on the neural substrates that govern stress adaptation and vulnerability. Material and methods 2.1. Animals In this study, male Wistar rats weighing between 200 and 250 grams were selected as participants. The rats were sourced from the Razi Institute in Karaj, Iran. All experimental protocols followed the guidelines outlined in the National Institute of Health Guide for the Care and Use of Laboratory Animals (1996) and adhered to the ethical standards for animal research set by Damghan University and under the ethical code IR.DU.REC.1401.009 on the ministry of health. The rats were housed in groups of four per cage under standard laboratory conditions, which included a 12-hour light and 12-hour dark cycle with lights turned on at 7 a.m. They were provided with unrestricted access to food and water. 2.2. Stress paradigm Each stress session entails 6 hours period of confinement in a Plexiglas restrainer, commencing at 9 a.m. daily. Stress models encompass a range of durations. Acute conditions are typically short, lasting for three days (3 sessions) (Santha et al., 2012 ), while chronic models span 21 consecutive days (Elfving et al., 2015 ). The rats were subjected to restraint stress in a separate room to ensure a controlled environment for the stressor application, distinct from their regular living space. Restraint stress was administered in an isolated chamber to minimize social stress transfer to the control group. 2.3. Drugs Yohimbine hydrochloride (Sigma Aldrich, cat: Y3125; Yohimbine), acquired from Sigma Aldrich, with concentration of 2 mg/kg (Richards et al., 2008 ) was dissolved with deionized water and intraperitoneally (i.p.) injected, half an hour before each stress session (in Ch.S and A.S groups) or every day at a fix time of 10 a.m. for non-stressed (C + Y) groups. Ketamine (90 mg/kg, i.p.) and Xylazine (6 mg/kg, i.p.) purchased from IRAN local market. 2.4. Experimental design The experimental groups were subjected to different stress paradigms or pharmacological interventions as described above. Following the designated treatment period, animals were euthanized after deep anesthesia induction with ketamine (90 mg/kg, i.p.) and xylazine (6 mg/kg, i.p.). Fresh hippocampal tissues were rapidly collected and stored at -70°C for subsequent analyses. The experimental groups (four rats for each and 20 in total) included a control group (Ctrl), a group exposed to chronic stress (Ch.S), a group exposed to acute stress (A.S), a group with noradrenergic system activation by Yohimbine in the control animals (C + Y), and a group with noradrenergic system activation by Yohimbine in the chronically stressed animals (Ch.S + Y). 2.5. CORT measurement After conducting the experiments, the four animals of each group were decapitated under mentioned anaesthesia. Trunk blood (2 ml) was collected from each animal using a syringe containing 0.25 ml of sodium citrate anticoagulant. The collected blood samples were then subjected to centrifugation at 2320×g for 20 minutes, and the resulting supernatant plasma was stored at -70˚C until further analysis. Plasma corticosterone (CORT) levels were assessed using a fluorescence-based assay (Spectrofluorometer Jasco 6200, Japan) as described in previous studies (Peterson, 1957 ; Katyare & Pandya, 2005 ). Initially, CORT standard solutions were prepared with concentrations ranging from 400 to 0.1 ng/ml. Plasma samples were extracted with a 2:1 chloroform: methanol mixture to isolate CORT. The resulting mixture was combined with 3 ml of chloroform, vortexed, and centrifuged at 2000×g. The bottom layer was then mixed with 300 µl of 0.1 N NaOH, vortexed, and centrifuged again at 2000×g. The resulting bottom layer was added to a mixture of 3 ml of a solution containing sulphuric acid and ethanol in a 4:1 ratio, followed by centrifugation at 2000×g. The resulting bottom layer was incubated in darkness for 5 minutes and subsequently measured using a spectrofluorometer with excitation and emission wavelengths. During excitation at 472 nm, the emission at 525 nm was measured. The concentrations of CORT in the samples were then calculated using the standard curve. 2.7. Reverse transcriptase semiquantitative PCR The hippocampal tissue samples were processed by homogenizing them in the lysis buffer provided with the RNX-plus RNA extraction kit (SinaClon, Iran), following the manufacturer's protocol. The RNX-plus kit utilizes a phenol-chloroform-based isolation method to extract total RNA. The resulting mixture was then subjected to chloroform extraction and centrifugation, separating it into aqueous and organic phases. The RNA-containing aqueous phase was isolated, and RNA was precipitated using isopropanol. Extracted RNA was run on a 0.75% agarose gel. RNA concentration was measured upon its absorbance in 260 nm and its quality and integrity upon a ratio of 260/280 nm and 0.5% agarose gel electrophoresis. One µg of total RNA was used in the first strand cDNA synthesis kit of SinaClon according to instructions. The cDNA was amplified by PCR using the following cycling conditions: initial denaturation at 94°C for 15 sec, annealing at 57°C for 1 min, extension at 72°C for 2.5 min for 30 cycles total using an Eppendorf Mastercycler semiquantitative PCR system. The quantity and purity of the RNA were evaluated using spectrophotometry. The RNA samples were reverse transcribed into complementary DNA (cDNA) using a reaction mixture containing random hexamer primers, dNTPs, and the reverse transcriptase enzyme. A 100 bp ladder was used to confirm product sizes. PCR primers were designed for the target genes, including prepro-OX (442 bp), OXr1 (330 bp), GR (428 bp), and GAPDH (131 bp), with specific product sizes. The specificity of the primers was confirmed. Prepro-OX forward: 5'- AGACTCCTTGGGTATTTGGAC − 3' Prepro-OX reverse: 5'- TAAAGCGGTGGCGGTTGCAGT − 3' GR forward: 5'- AGTTCCTGCAGCATTACCAC − 3' GR reverse: 5'- ACTCTTCATAGGATACCTGC − 3' OXr1 forward: 5'- TGGGCTGTGTCGCTGGCTG − 3' OXr1 reverse: 5'- GTTGGGGCTCTGTACACAGG − 3' GAPDH forward: 5'- CAATGACCCCTTCATTGACC − 3' GAPDH reverse: 5'- TGGAAGATGGTGATGGGATT − 3' PCR amplification of the cDNA samples was carried out using the validated gene-specific primers along with a reaction mix containing buffer, nucleotides, and Taq polymerase. The PCR amplicons were analyzed by 1.5% agarose gel electrophoresis, and the band densities were quantified using ImageJ software. Target gene expression was normalized to the internal control, GAPDH. 2.8. Nissl Staining Procedure To perform Nissl staining, a total of four animals were deeply anesthetized following the previously described method (Eghtesad et al., 2022 ). Transcardial perfusion was conducted, first with 50 mL of normal saline, followed by 10% formalin. After the perfusion, the brains were carefully removed from the skulls and immersed in 10% formalin for 24 to 48 hours. Subsequently, brain sections with a thickness of 40 µm were obtained utilizing a vibroslicer (Campden Instruments). These sections were sliced within a range of -3.72 to -4.44 mm from the bregma. To visualize cellular structures, the brain sections underwent Nissl staining using cresyl violet (Merck, Germany). The following steps were performed: 1. Preparation: Formalin-fixed hippocampi were moved to a 30% sucrose solution and allowed to incubate for 24 hours. After incubation, 40 µm sections were obtained and placed in a 24-well plate containing 0.1% PBS. The sections were then submerged in a solution mixture of 0.1% gelatine and 80% ethanol. Afterwards, the sections were mounted on glass slides and left to air dry for 24 hours. 2. Dehydration: The sections underwent a dehydration process utilizing a series of ethanol and xylene solutions. Initially, the sections were briefly immersed in distilled water (DW) for one minute. Subsequently, they were sequentially immersed in an escalating concentration of ethanol, ranging from 70–100%, culminating in an immersion in xylene before being removed for the subsequent step. In this second round of dehydration, the sections were once again immersed in xylene, followed by sequential immersion in decreasing concentrations of ethanol, ranging from 100–70%, in the reverse order of the first round. 3. Staining and Mounting: The sections were stained with cresyl violet for two minutes to reveal the Nissl bodies. Following staining, the sections were once more sequentially immersed in an escalating concentration of ethanol, from 70–100%, concluding with an immersion in xylene before being removed for the next step. Coverslips were then affixed to the glass slides using Entellan glue. 4. Counting: Subsequent to the complete drying of the sections, neuronal cells within the CA1 region of the hippocampus were counted across six consecutive sections using a light microscope equipped with a 250 square micrometre grid. The average count from these six sections was regarded as the final value for that specific region of the animal. Following this Nissl staining protocol, the neuronal cell bodies within the hippocampal sections were effectively visualized and quantified for subsequent analysis. 2.9. Statistical analysis Statistical differences between groups were assessed using a one-way ANOVA test, followed by the Tukey post-hoc test where applicable. All statistical analyses were conducted using GraphPad Prism software V. 9.3.0. The significance level was established at p < 0.05. The data were presented as means ± SEM. Results 3.1. Chronic stress induces more pronounced changes in physiology and gene expression compared to acute stress. The first experiment investigated the effects of chronic and acute stress on various physiological and molecular parameters. Our findings support the notion that chronic stress serves as a more potent stressor compared to acute stress. The analysis of variance (ANOVA) revealed statistically significant variations in the plasma CORT levels across the different experimental groups [F (2, 9) = 107, p < 0.0001]. As expected, both chronic stress (Ch.S) and acute stress (A.S) elevated plasma CORT levels compared to the control group (p < 0.0001). The same degree of effect by both stressors suggests the capability of the models in activation of the HPA axis (Fig. 2 , Top Left Panel). The ANOVA analysis indicated substantial differences in the gene expression levels of prepro-OX when comparing the various experimental groups [F (2, 9) = 406.9, p < 0.0001], OXr1 [F (2, 9) = 474.1, p < 0.0001] and GR [F (2, 9) = 125.1, p < 0.0001] genes. Chronic stress had a more significant impact on the expression of stress-related genes compared to acute stress. The prepro-OX (Fig. 2 , Top Right Panel), OXr1 genes (Fig. 2 , Middle Left Panel) and GR gene (Fig. 2 , Middle Right Panel) displayed a greater fold change increase (p < 0.0001) in expression following chronic stress compared to control. There was a significant difference between Ch.S and A.S in prepro-OX (p < 0.0001), OXr1 gene (p < 0.001) and GR (p < 0.0001) genes. The ANOVA revealed significant variations in the neuronal counts across the different experimental groups [F (2, 9) = 107.0, p < 0.0001]. Both chronic and acute stress exposure resulted in a significant decrease in the number of neurons within the CA1 region of the hippocampus compared to the control group (Fig. 2 , Bottom Panel) (p < 0.0001). There was no difference between Ch.S and A.S in the neuronal number. These findings demonstrate that chronic stress exerts a more pronounced and enduring influence on both physiological and molecular markers of the stress response compared to acute stress. This implies a potential association between chronic stress and the development of stress-related disorders. 3.2. Effects of stress and noradrenergic system activation on plasma CORT level CORT is a hormone produced by the adrenal gland in response to stress, and it is considered an indicator of stress in the body. CORT levels can be measured in different matrices, such as plasma, mucus, scales, and skin conductance, to assess stress levels in animals. One-way ANOVA, in this study, revealed significant differences in plasma CORT between experimental groups [F (3, 12) = 41.62, p < 0.0001]. Post-hoc Tukey's test showed chronic stress (Ch.S), noradrenergic activation control (C + Y) and the combination of chronic stress and noradrenergic activation (Ch.S + Y) significantly elevated plasma CORT level vs controls (p < 0.0001) (Fig. 3 ). The findings indicate that CORT has developed in response to stress and/ or noradrenergic activation. 3.3. Effects of stress and noradrenergic system activation on hippocampal prepro-OX expression The orexin system is engaged during wakefulness, and it may be particularly active when driven by internal signals, such as stress, or external cues, like the prospect of a reward (Scammell & Winrow, 2011 ). This study aimed to examine the effects of chronic stress, acute stress, and noradrenergic system activation on prepro-OX expression in animal models. One-way ANOVA revealed significant differences in prepro-OX expression between experimental groups [F (3, 12) = 96.14, p < 0.0001]. Post-hoc Tukey's test showed chronic stress (Ch.S), and the combination of chronic stress and noradrenergic activation (Ch.S + Y) significantly elevated prepro-OX vs controls (p < 0.0001). Yohimbine (C + Y) also increased expression vs controls (p < 0.05). Ch.S + Y (p < 0.0001) exhibited a recovery of prepro-OX expression in relation to Ch.S alone, indicating noradrenergic stimulation reduces prepro-OX expression. Overall, chronic stress and yohimbine independently upregulated prepro-OX, while chronic stress combined with noradrenergic activation had the reverse effect (Fig. 4 ). The results collectively suggest complex regulatory patterns in prepro-OX expression in response to stress and noradrenergic activation. 3.4. Orexin receptor-1 expression profile in the hippocampus under stress conditions and noradrenergic activation OXr1 is involved in the body's response to stress, and it plays a crucial role in several key aspects of chronic anxiety, including arousal and hypervigilance (Grafe & Bhatnagar, 2018 ; Gorka et al., 2022 ). Statistical analysis via one-way ANOVA revealed a significant variance between experimental groups in OXr1 expression [F (3, 12) = 300.0, p < 0.0001]. Follow-up Tukey post-hoc testing revealed that rats subjected to chronic stress (Ch.S) and the combination of chronic stress with yohimbine (Ch.S + Y) exhibited significantly higher hippocampal OXr1 expression compared to controls (p < 0.0001). Similarly, rats that received yohimbine administration (C + Y) also showed significantly elevated hippocampal OXr1 levels relative to the control group (p < 0.001). Additionally, the Ch.S + Y group had significantly lower OXr1 expression relative to the Ch.S group (p < 0.0001), indicating the compensating effect of noradrenergic system activation (Fig. 5 ). These results highlight the dynamic regulation of OXr1 expression under various stress conditions and with noradrenergic stimulation. 3.5. Comparison of GR expression profile in the hippocampus under stress conditions and noradrenergic activation Expression of the GR in the hippocampus plays a role in stress-related disorders and stress regulation. One-way ANOVA revealed a significant effect of experimental groups on hippocampal GR expression profile [F (3, 12) = 216.4, p < 0.0001]. Subsequent Tukey post-hoc analysis showed GR expression was significantly increased in the chronic stress (Ch.S) group versus controls (p < 0.0001). Conversely, GR expression was significantly lower in the Ch.S + Y group compared to Ch.S alone (p < 0.0001). Notably, no significant GR expression difference was found between yohimbine-administered (C + Y) and control groups (Fig. 6 ). These findings illustrate the nuanced regulation of GR expression in the hippocampus under varying stress conditions and with noradrenergic activation. 3.6. Effects of stress and noradrenergic in the hippocampus under stress conditions and noradrenergic activation The neuronal population profile in the hippocampus is important for understanding various neurological disorders associated with stress. This study aimed to compare neuronal populations across experimental groups. The one-way ANOVA analysis revealed a significant effect of the experimental condition on the hippocampal neuronal population [F (3, 12) = 110.5, p < 0.0001]. Follow-up Tukey's test found neuronal counts were significantly lower in chronic stress (Ch.S) and their combination of chronic stress and noradrenergic activation (Ch.S + Y) groups (p < 0.001) versus controls. However, the Ch.S + Y group displayed significantly higher neuronal numbers compared to Ch.S alone (p < 0.001). Notably, no meaningful neuronal difference was observed between yohimbine (C + Y) and control groups (Fig. 7 ). These results provide crucial insights into the impact of stress conditions and noradrenergic activation on hippocampal neuronal populations, which is vital for understanding various stress-associated neurological disorders. Discussion This study aimed to compare chronic and acute stress and investigate the effects of stress and noradrenergic activation on the orexin and glucocorticoid receptor systems in the rat hippocampus. The study examined plasma CORT levels, prepro-OX expression, OXr1 expression, GR expression, and hippocampal neuronal populations. The key outcomes of the study are as follows: 1. The study revealed that both chronic and acute stress elevated corticosterone levels and reduced hippocampal CA1 neuronal count. However, chronic stress had a more pronounced effect on the expression of stress-related genes, including prepro-orexin, orexin receptor 1, and glucocorticoid receptor. 2. Chronic stress and noradrenergic activation profoundly elevated plasma CORT level and also prepro-OX expression, each compared to its respective controls. However, chronic stress combined with noradrenergic activation reduced prepro-OX expression compared to chronic stress alone. Rats subjected to chronic stress or yohimbine administration or their combination exhibited considerably higher hippocampal OXr1 expression. Yet, the combination of chronic stress and noradrenergic activation had notably lower OXr1 expression relative to the chronic stress group. Chronic stress substantially increased hippocampal glucocorticoid receptor expression compared to controls. In contrast, the combined chronic stress and noradrenergic activation condition exhibited significantly lower expression compared to chronic stress alone. Chronic stress and their combination of chronic stress and noradrenergic activation meaningfully reduced hippocampal neuronal populations compared to controls. However, chronic stress combined with noradrenergic activation increased neuronal numbers compared to chronic stress alone. The release of glucocorticoids, such as CORT in rodents, plays a crucial role in the HPA axis and serves as a biomarker of stress response (Tsigos et al., 2000 ; Bekhbat et al., 2018 ). The HPA axis is a vital component of the stress system, and glucocorticoids play a fundamental role in maintaining both resting and stress-related homeostasis (Nicolaides et al., 2015 ). The study showed that both chronic and acute stress exposure activated the HPA axis, as indicated by the elevation of plasma CORT levels in response to chronic and acute stress (Sapolsky et al., 2000 ; Mokhtarpour et al., 2016 ), along with a decrease in neuronal population in the CA1 region of the hippocampus. However, chronic stress had a more profound impact on the expression of stress-related genes, such as prepro-OX, OXr1, and GR, compared to acute stress. Specifically, chronic stress exposure resulted in a significantly greater fold-change increase in the expression of these genes compared to both the control group and the acute stress group. Given that chronic stress had a more pronounced effect on the expression of stress-related genes involved in neuroendocrine and neuronal functions, it appears to be a more suitable model for further investigating the activation of the noradrenergic system by yohimbine. The chronic stress model seems to recapitulate better the molecular and cellular changes associated with stress-related disorders, making it a more relevant choice for studying the mechanisms underlying noradrenergic system dysregulation. The study on stress and noradrenergic activation demonstrated that chronic stress and noradrenergic activation via yohimbine all increased plasma CORT compared to controls, implicating activation of the HPA axis stress response (Sapolsky et al., 2000 ). The stress- induced CORT build- up is a well-known effect which has been confirmed by many studies (Bhatnagar et al., 2006 ; Marin et al., 2007 ; Rabasa et al., 2011 ; Sheng et al., 2020 ), as well as ours (Mokhtarpour et al., 2016 ; Eghtesad et al., 2022 ). The study found that yohimbine mimics sympathetic activation by increasing norepinephrine, which is the first line of stress response. The data demonstrated an increase in CORT levels in the control animals injected with yohimbine, confirming this effect. This aligns with evidence that noradrenaline potentiates HPA axis signalling (Herman et al., 2003 ). The prepro-OX precursor protein is a 130 amino acid pre-pro-peptide encoded by the gene HRCT and located on chromosome 17 (17q21). Orexin-A and orexin-B are excitatory neuropeptides produced by cleavage of the prepro-OX protein (Sakurai, 2014 ). The study found that hippocampal prepro-OX expression was enhanced by chronic stress and yohimbine alone or in combination with chronic stress, similar to the effect of chronic stress (Eghtesad et al., 2022 ) and acute stress (Mokhtarpour et al., 2016 ) shown in previous studies focused on the lateral hypothalamus. This is consistent with the involvement of orexin signalling in stress pathways (Heydendael et al., 2012 ; Sokolowska et al., 2014 ). The enhanced expression of prepro-OX in the hippocampus may reflect activation of the HPA axis influencing orexinergic activity (Zhao et al., 2021 ) or even a direct impact of stress on the likely pathologic expression of prepro-OX in the hippocampus. Although this condition might happen as an adaptation compensation to pathologic changes in the LH orexinergic system, it may also aggravate the situation in the hippocampus. Yohimbine infusion could only partially mimic previous findings suggesting noradrenergic modulation of prepro-OX (Sakurai, 2014 ). The reversal of prepro-OX expression levels observed with the combination of chronic stress and yohimbine administration suggests the existence of complex regulatory mechanisms between neurotransmitters and neuropeptides. It is hypothesized that prepro-OX expression may be reduced following yohimbine-induced norepinephrine increase in stressed animals. However, yohimbine alone emulates the stress effect on the expression. OXr1 is a G protein-coupled receptor that is widely expressed throughout the brain, including the hippocampus. The activation of OXr1 has been shown to induce long-term structural and functional changes in the hippocampus (Song et al., 2015 ; Elahdadi Salmani et al., 2022 ). OXr1 expression increased in all stress-exposed and yohimbine groups, fitting with orexin's role in stress (Heydendael et al., 2012 ). This likely enhances hippocampal sensitivity to heighten arousal and vigilance during stress (Sakurai, 2014 ). The study found that the chronic stress and yohimbine group showed lower OXr1 expression compared to chronic stress alone, suggesting a compensatory mechanism preventing excessive signalling and an interplay of the signal transduction pathways for norepinephrine and orexin. In accordance, a selective OXr1 antagonist has been shown to attenuate stress-induced hyperarousal without hypnotic effects, indicating the potential of OXr1 as a therapeutic target for stress-related disorders (Grafe & Bhatnagar, 2018 ). Therefore, blocking the OXr1 by an antagonist or its downregulation using an internal agent (adrenergic system) may help retaliate the increased receptor expression. The GR is a nuclear receptor that functions as a ligand-activated transcription factor mediating the diverse physiological effects of glucocorticoids, such as CORT, in the hippocampus (Timmermans et al., 2019 ). Chronic stress, similar to acute stress, increased hippocampal GR expression, aligning with the established function of this receptor in negative feedback regulation of the HPA axis (de Kloet et al., 2005 ). In contrast, the combination of chronic stress and yohimbine administration significantly reduced GR expression. This implicates compensatory adaptation to mitigate potential GR overstimulation during prolonged stress exposure (Reul & de Kloet, 1985 ; George et al., 2013 ). The observed effect in the study may be attributed to the expressions of prepro-OX and OXr1 following yohimbine infusion, as well as the interaction between norepinephrine and orexin signalling pathways. However, the yohimbine-induced norepinephrine increase, which imitates mild stress, may have only employed mineralocorticoid receptors and not GRs in such a condition. Stress has been shown to have a significant impact on the structure and function of the hippocampus (McEwen et al., 2016 ). Chronic stress exposure has been found to cause shrinkage of dendrites of hippocampal CA3 and dentate gyrus neurons, as well as loss of spines in CA1, which may contribute to the cognitive deficits observed in stress-related disorders (Kim et al., 2015 ; McEwen et al., 2016 ). As expected, chronic and acute stress reduced the hippocampal neuron population, consistent with stress-induced structural alterations in this region (McEwen & Seeman, 1999 ; Chenani et al., 2022 ). Intriguingly, the chronic stress and yohimbine group showed greater neuronal populations versus chronic stress alone, suggesting a neuroprotective effect of noradrenergic signalling (Arnsten & Li, 2005 ). The increased expression of orexin receptor type-2 (OXr2) observed in a previous study (unpublished data) following electric shock acute stress may be responsible for the effect observed in this study, indicating a neuroprotective mechanism. Future studies may need to use a different stress model for the acute condition to understand better the interplay of stress and the noradrenergic system in the hippocampus. Overall, chronic stress, as the selected stress model, elicited an increase in HPA activity, orexin and glucocorticoid expression profiles, and a reduction of structural neuronal changes aligned with prior research. Unique findings emerged when examining interactions between chronic stress and noradrenergic stimulation. The combination revealed potential compensatory mechanisms not seen with either factor alone, including modulation of prepro-OX levels, orexin receptor expression, glucocorticoid receptor expression, and hippocampal neuronal viability. Conclusion In summary, this research highlighted the complex interplay between stress and noradrenergic signalling in the hippocampus. Stress alone increased prepro-OX, OXr1, and GR expression yet decreased neuronal populations. Noradrenergic activation by itself only heightened prepro-OX and OXr1 levels. However, the combination of chronic stress and noradrenergic stimulation led to the recovery of these hippocampal measures, implying compensatory adaptation. While yohimbine treatment did not alter neuron numbers or GR expression on its own, it appeared to engage protective mechanisms during prolonged stress exposure. As orexin- and glucocorticoid-related genes were only measured at the mRNA level, further study of protein and physiological function is warranted. These findings have important implications for understanding brain stress responses and developing treatments for stress-related disorders. Further work should uncover additional facets of these intricate interactions and inform strategies to mitigate neurological harm from chronic stress. Abbreviations Ctrl, Control; Ch.S, chronic stress; A.S, acute stress; C+Y, noradrenergic system activation by Yohimbine in the control animals; Ch.S+Y, noradrenergic system activation by Yohimbine in the chronically stressed animals; HPA, Hypothalamic Pituitary Axis, CORT, corticosterone; OXr1, orexin receptor type 1; GR, glucocorticoid receptor Declarations 6. Author contributions M.S. performed the formal analysis, investigation, and established the methodology. M.E.S. designed the study, oversaw its administration, and provided supervision to the research team. Additionally, he drafted the original manuscript and participated in its revision and editing. T.L. was responsible for data curation, further contributing to the formal analysis and methodology development. I.G. helped in the study's conceptualization and project administration. She also participated in the review and editing of the final manuscript. 7. Acknowledgment The authors acknowledge Damghan University for supporting this study. 8. Conflict of interest The authors declare that they have no conflicts of interest associated with this study. 9. Funding This research received financial backing from Damghan University as a component of a doctoral dissertation. The study was conducted under the ethical approval code IR.DU.REC.1401.009 from the Damghan University Research Ethics Committee. 10. Data availability statement The data used in this study are not publicly accessible due to restrictions imposed by the Research Ethics Committee. However, these data can be obtained by contacting the corresponding author. References Alfarez, D.N., Joels, M. & Krugers, H.J. (2003) Chronic unpredictable stress impairs long-term potentiation in rat hippocampal CA1 area and dentate gyrus in vitro. Eur J Neurosci , 17 , 1928-1934. Arnsten, A.F. & Li, B.M. (2005) Neurobiology of executive functions: catecholamine influences on prefrontal cortical functions. Biol Psychiatry , 57 , 1377-1384. Bao, A.M., Meynen, G. & Swaab, D.F. (2008) The stress system in depression and neurodegeneration: focus on the human hypothalamus. Brain Res Rev , 57 , 531-553. Bekhbat, M., Glasper, E.R., Rowson, S.A., Kelly, S.D. & Neigh, G.N. (2018) Measuring corticosterone concentrations over a physiological dynamic range in female rats. Physiol Behav , 194 , 73-76. Bhatnagar, S., Vining, C., Iyer, V. & Kinni, V. (2006) Changes in hypothalamic-pituitary-adrenal function, body temperature, body weight and food intake with repeated social stress exposure in rats. J Neuroendocrinol , 18 , 13-24. Chen, Y.W., Das, M., Oyarzabal, E.A., Cheng, Q., Plummer, N.W., Smith, K.G., Jones, G.K., Malawsky, D., Yakel, J.L., Shih, Y.I. & Jensen, P. (2019) Genetic identification of a population of noradrenergic neurons implicated in attenuation of stress-related responses. Mol Psychiatry , 24 , 710-725. Chenani, A., Weston, G., Ulivi, A.F., Castello-Waldow, T.P., Huettl, R.E., Chen, A. & Attardo, A. (2022) Repeated stress exposure leads to structural synaptic instability prior to disorganization of hippocampal coding and impairments in learning. Transl Psychiatry , 12 , 381. Chrousos, G.P. & Gold, P.W. (1992) The concepts of stress and stress system disorders. Overview of physical and behavioral homeostasis. JAMA , 267 , 1244-1252. de Kloet, E.R., Sibug, R.M., Helmerhorst, F.M. & Schmidt, M.V. (2005) Stress, genes and the mechanism of programming the brain for later life. Neurosci Biobehav Rev , 29 , 271-281. Eghtesad, M., Elahdadi Salmani, M., Lashkarbolouki, T. & Goudarzi, I. (2022) Lateral Hypothalamus Corticotropin-releasing Hormone Receptor-1 Inhibition and Modulating Stress-induced Anxiety Behavior. Basic Clin Neurosci , 13 , 373-384. Elahdadi Salmani, M., Sarfi, M. & Goudarzi, I. (2022) Hippocampal orexin receptors: Localization and function. Vitam Horm , 118 , 393-421. Elfving, B., Jakobsen, J.L., Madsen, J.C., Wegener, G. & Muller, H.K. (2015) Chronic restraint stress increases the protein expression of VEGF and its receptor VEGFR-2 in the prefrontal cortex. Synapse , 69 , 190-194. Espana, R.A., Schmeichel, B.E. & Berridge, C.W. (2016) Norepinephrine at the nexus of arousal, motivation and relapse. Brain Res , 1641 , 207-216. George, S.A., Stout, S.A., Tan, M., Knox, D. & Liberzon, I. (2013) Early handling attenuates enhancement of glucocorticoid receptors in the prefrontal cortex in an animal model of post-traumatic stress disorder. Biol Mood Anxiety Disord , 3 , 22. Gorka, S.M., Khorrami, K.J., Manzler, C.A. & Phan, K.L. (2022) Acute orexin antagonism selectively modulates anticipatory anxiety in humans: implications for addiction and anxiety. Transl Psychiatry , 12 , 308. Grafe, L.A. & Bhatnagar, S. (2018) Orexins and stress. Front Neuroendocrinol , 51 , 132-145. Han, Q.Q., Yang, L., Huang, H.J., Wang, Y.L., Yu, R., Wang, J., Pilot, A., Wu, G.C., Liu, Q. & Yu, J. (2017) Differential GR Expression and Translocation in the Hippocampus Mediates Susceptibility vs. Resilience to Chronic Social Defeat Stress. Front Neurosci , 11 , 287. Hasegawa, E., Yanagisawa, M., Sakurai, T. & Mieda, M. (2014) Orexin neurons suppress narcolepsy via 2 distinct efferent pathways. J Clin Invest , 124 , 604-616. Herman, J.P., Figueiredo, H., Mueller, N.K., Ulrich-Lai, Y., Ostrander, M.M., Choi, D.C. & Cullinan, W.E. (2003) Central mechanisms of stress integration: hierarchical circuitry controlling hypothalamo-pituitary-adrenocortical responsiveness. Front Neuroendocrinol , 24 , 151-180. Heydendael, W., Sengupta, A. & Bhatnagar, S. (2012) Putative genes mediating the effects of orexins in the posterior paraventricular thalamus on neuroendocrine and behavioral adaptations to repeated stress. Brain Res Bull , 89 , 203-210. Katyare, S.S. & Pandya, J.D. (2005) A simplified fluorimetric method for corticosterone estimation in rat serum, tissues and mitochondria. Indian J Biochem Biophys , 42 , 48-53. Kim, E.J., Pellman, B. & Kim, J.J. (2015) Stress effects on the hippocampus: a critical review. Learn Mem , 22 , 411-416. Lin, C.C. & Huang, T.L. (2022) Orexin/hypocretin and major psychiatric disorders. Adv Clin Chem , 109 , 185-212. Marin, M.T., Cruz, F.C. & Planeta, C.S. (2007) Chronic restraint or variable stresses differently affect the behavior, corticosterone secretion and body weight in rats. Physiol Behav , 90 , 29-35. McEwen, B.S. (1998) Stress, adaptation, and disease. Allostasis and allostatic load. Ann N Y Acad Sci , 840 , 33-44. McEwen, B.S. (2008) Central effects of stress hormones in health and disease: Understanding the protective and damaging effects of stress and stress mediators. Eur J Pharmacol , 583 , 174-185. McEwen, B.S., Nasca, C. & Gray, J.D. (2016) Stress Effects on Neuronal Structure: Hippocampus, Amygdala, and Prefrontal Cortex. Neuropsychopharmacology , 41 , 3-23. McEwen, B.S. & Seeman, T. (1999) Protective and damaging effects of mediators of stress. Elaborating and testing the concepts of allostasis and allostatic load. Ann N Y Acad Sci , 896 , 30-47. Mokhtarpour, M., Elahdadi Salmani, M., Lashkarbolouki, T., Abrari, K. & Goudarzi, I. (2016) Lateral hypothalamus orexinergic system modulates the stress effect on pentylenetetrazol induced seizures through corticotropin releasing hormone receptor type 1. Neuropharmacology , 110 , 15-24. Nicolaides, N.C., Kyratzi, E., Lamprokostopoulou, A., Chrousos, G.P. & Charmandari, E. (2015) Stress, the stress system and the role of glucocorticoids. Neuroimmunomodulation , 22 , 6-19. Peterson, R.E. (1957) The identification of corticosterone in human plasma and its assay by isotope dilution. J Biol Chem , 225 , 25-37. Peyron, C., Tighe, D.K., van den Pol, A.N., de Lecea, L., Heller, H.C., Sutcliffe, J.G. & Kilduff, T.S. (1998) Neurons containing hypocretin (orexin) project to multiple neuronal systems. J Neurosci , 18 , 9996-10015. Rabasa, C., Munoz-Abellan, C., Daviu, N., Nadal, R. & Armario, A. (2011) Repeated exposure to immobilization or two different footshock intensities reveals differential adaptation of the hypothalamic-pituitary-adrenal axis. Physiol Behav , 103 , 125-133. Ramot, A., Jiang, Z., Tian, J.B., Nahum, T., Kuperman, Y., Justice, N. & Chen, A. (2017) Hypothalamic CRFR1 is essential for HPA axis regulation following chronic stress. Nat Neurosci , 20 , 385-388. Reul, J.M. & de Kloet, E.R. (1985) Two receptor systems for corticosterone in rat brain: microdistribution and differential occupation. Endocrinology , 117 , 2505-2511. Richards, J.K., Simms, J.A., Steensland, P., Taha, S.A., Borgland, S.L., Bonci, A. & Bartlett, S.E. (2008) Inhibition of orexin-1/hypocretin-1 receptors inhibits yohimbine-induced reinstatement of ethanol and sucrose seeking in Long-Evans rats. Psychopharmacology (Berl) , 199 , 109-117. Sakurai, T. (2014) The role of orexin in motivated behaviours. Nat Rev Neurosci , 15 , 719-731. Salehabadi, S., Abrari, K., Elahdadi Salmani, M., Nasiri, M. & Lashkarbolouki, T. (2020) Investigating the role of the amygdala orexin receptor 1 in memory acquisition and extinction in a rat model of PTSD. Behav Brain Res , 384 , 112455. Santha, P., Pakaski, M., Fazekas, O.C., Fodor, E.K., Kalman, S., Kalman, J., Jr., Janka, Z., Szabo, G. & Kalman, J. (2012) Restraint stress in rats alters gene transcription and protein translation in the hippocampus. Neurochem Res , 37 , 958-964. Sapolsky, R.M., Romero, L.M. & Munck, A.U. (2000) How do glucocorticoids influence stress responses? Integrating permissive, suppressive, stimulatory, and preparative actions. Endocr Rev , 21 , 55-89. Scammell, T.E. & Winrow, C.J. (2011) Orexin receptors: pharmacology and therapeutic opportunities. Annu Rev Pharmacol Toxicol , 51 , 243-266. Schoenfeld, T.J., McCausland, H.C., Morris, H.D., Padmanaban, V. & Cameron, H.A. (2017) Stress and Loss of Adult Neurogenesis Differentially Reduce Hippocampal Volume. Biol Psychiatry , 82 , 914-923. Sears, R.M., Fink, A.E., Wigestrand, M.B., Farb, C.R., de Lecea, L. & Ledoux, J.E. (2013) Orexin/hypocretin system modulates amygdala-dependent threat learning through the locus coeruleus. Proc Natl Acad Sci U S A , 110 , 20260-20265. Selye, H. (1950) Stress and the general adaptation syndrome. Br Med J , 1 , 1383-1392. Sheng, J.A., Bales, N.J., Myers, S.A., Bautista, A.I., Roueinfar, M., Hale, T.M. & Handa, R.J. (2020) The Hypothalamic-Pituitary-Adrenal Axis: Development, Programming Actions of Hormones, and Maternal-Fetal Interactions. Front Behav Neurosci , 14 , 601939. Sokolowska, P., Urbanska, A., Bieganska, K., Wagner, W., Ciszewski, W., Namiecinska, M. & Zawilska, J.B. (2014) Orexins protect neuronal cell cultures against hypoxic stress: an involvement of Akt signaling. J Mol Neurosci , 52 , 48-55. Song, J., Kim, E., Kim, C.H., Song, H.T. & Lee, J.E. (2015) The role of orexin in post-stroke inflammation, cognitive decline, and depression. Mol Brain , 8 , 16. Song, Q., Bolsius, Y.G., Ronzoni, G., Henckens, M. & Roozendaal, B. (2021) Noradrenergic enhancement of object recognition and object location memory in mice. Stress , 24 , 181-188. Soya, S. & Sakurai, T. (2020) Evolution of Orexin Neuropeptide System: Structure and Function. Front Neurosci , 14 , 691. Stankiewicz, A.M., Goscik, J., Majewska, A., Swiergiel, A.H. & Juszczak, G.R. (2015) The Effect of Acute and Chronic Social Stress on the Hippocampal Transcriptome in Mice. PLoS One , 10 , e0142195. Timmermans, S., Souffriau, J. & Libert, C. (2019) A General Introduction to Glucocorticoid Biology. Front Immunol , 10 , 1545. Tsigos, C., Kyrou, I., Kassi, E. & Chrousos, G.P. (2000) Stress: Endocrine Physiology and Pathophysiology. In Feingold, K.R., Anawalt, B., Blackman, M.R., Boyce, A., Chrousos, G., Corpas, E., de Herder, W.W., Dhatariya, K., Dungan, K., Hofland, J., Kalra, S., Kaltsas, G., Kapoor, N., Koch, C., Kopp, P., Korbonits, M., Kovacs, C.S., Kuohung, W., Laferrere, B., Levy, M., McGee, E.A., McLachlan, R., New, M., Purnell, J., Sahay, R., Shah, A.S., Singer, F., Sperling, M.A., Stratakis, C.A., Trence, D.L., Wilson, D.P. (eds) Endotext , South Dartmouth (MA). Yamamoto, K., Shinba, T. & Yoshii, M. (2014) Psychiatric symptoms of noradrenergic dysfunction: a pathophysiological view. Psychiatry Clin Neurosci , 68 , 1-20. Zerbes, G., Kausche, F.M., Muller, J.C., Wiedemann, K. & Schwabe, L. (2019) Glucocorticoids, Noradrenergic Arousal, and the Control of Memory Retrieval. J Cogn Neurosci , 31 , 288-298. Zhao, S., Wang, S., Li, H., Guo, J., Li, J., Wang, D., Zhang, X., Yin, L., Li, R., Li, A., Li, H., Fan, Z., Yang, Q., Zhong, H. & Dong, H. (2021) Activation of Orexinergic Neurons Inhibits the Anesthetic Effect of Desflurane on Consciousness State via Paraventricular Thalamic Nucleus in Rats. Anesth Analg , 133 , 781-793. Additional Declarations No competing interests reported. Supplementary Files graphicalabstract.tif Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4986129","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":350330151,"identity":"95cd40e7-52c6-4a9d-8887-57371b6ac498","order_by":0,"name":"Masoumeh Sarfi","email":"","orcid":"","institution":"Damghan University","correspondingAuthor":false,"prefix":"","firstName":"Masoumeh","middleName":"","lastName":"Sarfi","suffix":""},{"id":350330153,"identity":"4cd86ebc-f608-4ed8-9a7b-8852dbf27198","order_by":1,"name":"Mahmoud Elahdadi Salmani","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzUlEQVRIiWNgGAWjYDACdgY2Bh4GZh5+hgQwn4ewFmaoFskGUrUwGBxIINJd/MzMzx68qbGWMT6eY8Dwo4ZBxryBgBbJZjZzwznH0nnMzrwxYOw5xsAjc4CAFoPDDGbSPGyHecxuAG3hbWDgkSDkMPvD7N+kef4d5jGekWPA+JcYLQbMPGbSvG2HeQwkcgyYibJF4jBPmeTcvnQeiTPPCg7LHJMgrIW/vX2bxJtv1vb87ckbH76psbEnqAUFHADaSpKGUTAKRsEoGAU4AADtjzG+OlE2/QAAAABJRU5ErkJggg==","orcid":"","institution":"Damghan University","correspondingAuthor":true,"prefix":"","firstName":"Mahmoud","middleName":"Elahdadi","lastName":"Salmani","suffix":""},{"id":350330154,"identity":"3078d96e-200a-45c4-b0a0-db5164c9861d","order_by":2,"name":"Taghi Lashkarbolouki","email":"","orcid":"","institution":"Damghan University","correspondingAuthor":false,"prefix":"","firstName":"Taghi","middleName":"","lastName":"Lashkarbolouki","suffix":""},{"id":350330155,"identity":"2e62b7df-1e3c-4b3b-9855-1e64f35d739a","order_by":3,"name":"Iran Goudarzi","email":"","orcid":"","institution":"Damghan University","correspondingAuthor":false,"prefix":"","firstName":"Iran","middleName":"","lastName":"Goudarzi","suffix":""}],"badges":[],"createdAt":"2024-08-27 17:08:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4986129/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4986129/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":65441660,"identity":"6f779299-ccc4-4709-a336-4b28a3abfc96","added_by":"auto","created_at":"2024-09-27 13:08:18","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":496754,"visible":true,"origin":"","legend":"\u003cp\u003eExperimental timeline of the study. The image depicts an experimental design involving different treatment groups of animals subjected to various interventions and analytical techniques. The rows correspond to the following groups (n=4): The control group (Ctrl) that did not receive any stress or drug treatments. Animals in the chronic stress group (Ch.S) underwent repeated stress sessions, with each black circle representing one 6-hour period of restraint stress. This acute stress group (A.S) experienced three restraint stress sessions, indicated by the three black dots. Animals in the Yohimbine group (C+Y) received daily intraperitoneal (i.p.) injections of the drug Yohimbine, denoted by the downward arrows. The animals in the chronic stress plus Yohimbine group (Ch.S+Y) were exposed to a combination of chronic restraint stress (black dots) and daily Yohimbine injections (arrows). The thick arrows with pictorial icons at the top illustrate the sequence of procedures performed, starting from the stress/drug application on the left. Subsequent steps include blood and tissue sampling, measurement of CORT levels, RT-PCR analysis, and Nissl staining, with representative images shown above each step. The legend symbols clarify that black dots represent 6-hour restraint stress sessions, while downward arrows signify daily Yohimbine injections.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4986129/v1/b2cdebc12a350eb06d3a04ce.png"},{"id":65441549,"identity":"a564ad3d-e82f-4414-ad32-691eaa26f6fc","added_by":"auto","created_at":"2024-09-27 13:08:01","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":531640,"visible":true,"origin":"","legend":"\u003cp\u003eChronic stress has a stronger impact on physiological and molecular markers. Top Left Panel: Plasma CORT levels (ng/ml) were elevated in both chronic stress (Ch.S) and acute stress (A.S) groups compared to the control group. However, chronic stress appears to cause a larger rise in CORT. Top Right Panel: Chronic stress had a more significant effect on the expression of the prepro-OX gene compared to control and acute stress groups. The data is shown as a fold change in gene expression. Middle Left Panel: Similar to the prepro-OX gene, chronic stress had a more pronounced effect on the expression of the OXr1 gene compared to control and acute stress groups. Middle Right Panel: Chronic stress also appears to influence the expression of the GR gene, as seen in the fold change data compared to control and acute stress groups. Bottom Panel: Both chronic and acute stress significantly reduce the number of neurons in the CA1 region compared to the control group.\u003c/p\u003e\n\u003cp\u003e**** p\u0026lt;0.0001, *** p\u0026lt;0.001, * p\u0026lt;0.05\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4986129/v1/6229f31f288d5ca81b8f7ec2.png"},{"id":65441545,"identity":"ce0dd250-7d5c-4d17-a5fb-1689d948c9c4","added_by":"auto","created_at":"2024-09-27 13:08:01","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":122155,"visible":true,"origin":"","legend":"\u003cp\u003ePlasma CORT levels in response to stress and noradrenergic activation. Plasma CORT levels were measured following exposure to chronic stress (Ch.S), noradrenergic activation control (C+Y), and the combination of chronic stress and noradrenergic activation (Ch.S+Y), showing significant elevations compared to control groups (p\u0026lt;0.0001).\u003c/p\u003e\n\u003cp\u003e**** p\u0026lt;0.0001\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4986129/v1/cc62b3b94a7f7df1ff6074c3.png"},{"id":65443488,"identity":"440826c1-8977-4db1-8248-37733d883511","added_by":"auto","created_at":"2024-09-27 13:24:01","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":366681,"visible":true,"origin":"","legend":"\u003cp\u003eHippocampal prepro-OX expression in response to stress and noradrenergic activation. Chronic stress exhibited notable elevations in prepro-OX compared to controls (p\u0026lt;0.0001). Yohimbine (C+Y) also showed an increase compared to controls (p\u0026lt;0.05). Additionally, Ch.S+Y (p\u0026lt;0.0001) demonstrated a recovery in prepro-OX expression relative to Ch.S alone, indicating a mitigating effect of noradrenergic stimulation on prepro-OX expression. The results collectively suggest complex regulatory patterns in prepro-OX expression in response to stress and noradrenergic activation.\u003c/p\u003e\n\u003cp\u003e**** p\u0026lt;0.0001, * p\u0026lt;0.05\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4986129/v1/4c09f18e8886788d6598b6bb.png"},{"id":65441547,"identity":"9b47b764-2778-4b30-9005-fc01d6c733cc","added_by":"auto","created_at":"2024-09-27 13:08:01","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":138447,"visible":true,"origin":"","legend":"\u003cp\u003eHippocampal OXr1 expression in response to stress and noradrenergic activation. Rats exposed to chronic stress (Ch.S) (p\u0026lt;0.0001) and yohimbine administration (C+Y) (p\u0026lt;0.001) exhibited significantly higher levels of hippocampal OXr1 expression compared to control groups. Moreover, the Ch.S+Y group demonstrated a noteworthy reduction in OXr1 expression in comparison to the Ch.S group (p\u0026lt;0.0001), indicating a compensatory effect of noradrenergic system activation.\u003c/p\u003e\n\u003cp\u003e**** p\u0026lt;0.0001, *** p\u0026lt;0.001\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4986129/v1/4aa0fe7b512206350f6e9473.png"},{"id":65443489,"identity":"94243713-c928-4012-9f56-f0746fd02133","added_by":"auto","created_at":"2024-09-27 13:24:01","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":120313,"visible":true,"origin":"","legend":"\u003cp\u003eHippocampal GR expression in response to stress and noradrenergic activation. A marked increase was demonstrated in GR expression in the chronic stress (Ch.S) group compared to controls (p\u0026lt;0.0001). Conversely, GR expression was notably lower in the Ch.S+Y compared to Ch.S alone (p\u0026lt;0.0001). Remarkably, no significant difference in GR expression was observed between the yohimbine-administered (C+Y) and control groups.\u003c/p\u003e\n\u003cp\u003e**** p\u0026lt;0.0001\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4986129/v1/5c5c976ee2feefce17cd6001.png"},{"id":65442277,"identity":"2ade5f7e-bdcd-424a-b0b6-f18daccd44af","added_by":"auto","created_at":"2024-09-27 13:16:01","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":114269,"visible":true,"origin":"","legend":"\u003cp\u003eHippocampal neuronal population profile in response to stress and noradrenergic activation. Neuronal counts were significantly lower in the chronic stress (Ch.S) (p\u0026lt;0.0001) compared to control groups. Remarkably, the Ch.S+Y group exhibited significantly higher neuronal numbers compared to the Ch.S group alone (p\u0026lt;0.001). Importantly, no substantial differences in neuronal counts were observed between the yohimbine (C+Y) and control groups.\u003c/p\u003e\n\u003cp\u003e**** p\u0026lt;0.0001, *** p\u0026lt;0.001\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4986129/v1/39e91e2d3d1ba8c36f9e5cb8.png"},{"id":66507898,"identity":"474a5ab4-d273-4922-9509-0a0771d16312","added_by":"auto","created_at":"2024-10-13 19:16:28","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2475897,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4986129/v1/3b3b4d3f-3331-41ba-bc72-95e69b134c1b.pdf"},{"id":65442279,"identity":"dca8b724-7ead-46a7-982d-a284cc3c724b","added_by":"auto","created_at":"2024-09-27 13:16:01","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":212534,"visible":true,"origin":"","legend":"","description":"","filename":"graphicalabstract.tif","url":"https://assets-eu.researchsquare.com/files/rs-4986129/v1/0a54f9b081eacc4ab1c339ec.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"Modulation of noradrenergic signalling reverses stress-induced changes in the hippocampus: involvement of orexinergic systems","fulltext":[{"header":"Introduction","content":"\u003cp\u003eStress exerts a profound influence on both mental and physical well-being (Selye, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e1950\u003c/span\u003e). Central to the orchestration of stress responses is the hypothalamus-pituitary-adrenal (HPA) axis (Chrousos \u0026amp; Gold, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1992\u003c/span\u003e; Ramot et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Yet, when subjected to prolonged activation, as in the case of chronic stress, this axis can be thrown into disorder, disrupting the delicate balance of internal processes and paving the way for a host of pathological conditions (McEwen, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Additionally, the noradrenergic system wields substantial influence over stress-related physiological responses and behavioural outcomes (Bao et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Chen et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Activation of this system can lead to increased motivation, enhanced memory formation, and improved cognitive performance, all of which can be beneficial in dealing with stressors (Zerbes et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Song et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, dysregulation or excessive activation of the noradrenergic system can contribute to the development of anxiety disorders, mood disorders, and other stress-related psychiatric conditions (Yamamoto et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Espana et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). These physiological changes are crucial for individuals to effectively respond to stressful situations and adapt to the demands placed upon them.\u003c/p\u003e \u003cp\u003eWithin the intricate landscape of stress responses, the hippocampus emerges as a linchpin, charged with the consolidation and retrieval of contextual memories (Alfarez et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). However, its pivotal role is not without vulnerability. Both acute and chronic stressors have been shown to exact a toll on this vital brain region, precipitating alterations in neuronal structure, suppression of proliferation, and a reduction in overall volume (Stankiewicz et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Schoenfeld et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Chronic stress, in particular, can yield a spectrum of responses, ranging from adaptive adjustments to psychological maladjustment, underscoring the intricate interplay between stress and the hippocampus (McEwen, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). Furthermore, the deleterious impact of chronic stress and glucocorticoids on hippocampal function perpetuates a cycle of dysregulation within the HPA axis (McEwen, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Even without elevated glucocorticoid levels during subsequent metabolic challenges, the hippocampus retains an imprint of its previous encounters with chronic stress, rendering it more susceptible to future perturbations (McEwen, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2008\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOrexin neuropeptides, another vital cog in the stress-response machinery, are implicated not only in modulating the stress response but also in regulating mood (Lin \u0026amp; Huang, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). These neuropeptides, harboured within orexin-containing neurons, extend their reach to stress-regulatory nuclei such as the hippocampus and amygdala (Peyron et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Salehabadi et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Previous investigations have elucidated the surge in prepro-orexin (prepro-OX), the precursor protein for orexin neuropeptides, in response to chronic stress in rodent models, underscoring its pivotal role in stress adaptation (Soya \u0026amp; Sakurai, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Moreover, orexin signalling has been linked to the activation of the noradrenergic system, revealing a complex interplay between these neurochemical entities (Sears et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Hasegawa et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). On the other hand, reduced orexinergic activation in some pathological conditions might accompany a decrease in the noradrenergic system, particularly originating from the locus coeruleus (LC) (Hasegawa et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe hippocampus, in addition to its role in memory processes, exerts a profound influence on cognition, emotion, and the regulation of the HPA axis, underscoring its multifaceted significance (Sapolsky et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). The repercussions of chronic stress on this vital brain structure are far-reaching, manifesting as both structural and functional alterations, including diminished neurogenesis and dendritic remodelling (McEwen \u0026amp; Seeman, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1999\u003c/span\u003e). Within this intricate milieu, the glucocorticoid receptor (GR) emerges as a critical player responsible for furnishing feedback inhibition to the HPA axis. Disturbances in GR expression have been implicated in rendering individuals more susceptible to the ravages of stress (Han et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe present study embarks on a journey to unravel the intricacies of chronic and acute stress responses within the framework of the noradrenergic system and orexin signalling in rodent models. By scrutinizing the expression levels of prepro-OX, orexin receptor-1 (OXr1), and the glucocorticoid receptor in experimental groups subjected to a battery of stress paradigms, including chronic and acute stressors, as well as the administration of an alpha-2 receptor antagonist (yohimbine) that potentiates noradrenergic transmission, we aim to delineate the nuanced interplay between these crucial neural elements. Additionally, an in-depth exploration of the neuronal population within the hippocampus will shed light on the impact of stress on this pivotal brain region. This study aims to provide a fresh perspective on the neural substrates that govern stress adaptation and vulnerability.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003e2.1. Animals\u003c/h2\u003e\n \u003cp\u003eIn this study, male Wistar rats weighing between 200 and 250 grams were selected as participants. The rats were sourced from the Razi Institute in Karaj, Iran. All experimental protocols followed the guidelines outlined in the National Institute of Health Guide for the Care and Use of Laboratory Animals (1996) and adhered to the ethical standards for animal research set by Damghan University and under the ethical code IR.DU.REC.1401.009 on the ministry of health. The rats were housed in groups of four per cage under standard laboratory conditions, which included a 12-hour light and 12-hour dark cycle with lights turned on at 7 a.m. They were provided with unrestricted access to food and water.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003e\u003cstrong\u003e2.2. Stress paradigm\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eEach stress session entails 6 hours period of confinement in a Plexiglas restrainer, commencing at 9 a.m. daily. Stress models encompass a range of durations. Acute conditions are typically short, lasting for three days (3 sessions) (Santha et al., \u003cspan class=\"CitationRef\"\u003e2012\u003c/span\u003e), while chronic models span 21 consecutive days (Elfving et al., \u003cspan class=\"CitationRef\"\u003e2015\u003c/span\u003e). The rats were subjected to restraint stress in a separate room to ensure a controlled environment for the stressor application, distinct from their regular living space. Restraint stress was administered in an isolated chamber to minimize social stress transfer to the control group.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003e2.3. Drugs\u003c/h2\u003e\n \u003cp\u003eYohimbine hydrochloride (Sigma Aldrich, cat: Y3125; Yohimbine), acquired from Sigma Aldrich, with concentration of 2 mg/kg (Richards et al., \u003cspan class=\"CitationRef\"\u003e2008\u003c/span\u003e) was dissolved with deionized water and intraperitoneally (i.p.) injected, half an hour before each stress session (in Ch.S and A.S groups) or every day at a fix time of 10 a.m. for non-stressed (C + Y) groups. Ketamine (90 mg/kg, i.p.) and Xylazine (6 mg/kg, i.p.) purchased from IRAN local market.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003e2.4. Experimental design\u003c/h2\u003e\n \u003cp\u003eThe experimental groups were subjected to different stress paradigms or pharmacological interventions as described above. Following the designated treatment period, animals were euthanized after deep anesthesia induction with ketamine (90 mg/kg, i.p.) and xylazine (6 mg/kg, i.p.). Fresh hippocampal tissues were rapidly collected and stored at -70°C for subsequent analyses. The experimental groups (four rats for each and 20 in total) included a control group (Ctrl), a group exposed to chronic stress (Ch.S), a group exposed to acute stress (A.S), a group with noradrenergic system activation by Yohimbine in the control animals (C + Y), and a group with noradrenergic system activation by Yohimbine in the chronically stressed animals (Ch.S + Y).\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003e2.5. CORT measurement\u003c/h3\u003e\n\u003cp\u003eAfter conducting the experiments, the four animals of each group were decapitated under mentioned anaesthesia. Trunk blood (2 ml) was collected from each animal using a syringe containing 0.25 ml of sodium citrate anticoagulant. The collected blood samples were then subjected to centrifugation at 2320×g for 20 minutes, and the resulting supernatant plasma was stored at -70˚C until further analysis.\u003c/p\u003e\n\u003cp\u003ePlasma corticosterone (CORT) levels were assessed using a fluorescence-based assay (Spectrofluorometer Jasco 6200, Japan) as described in previous studies (Peterson, \u003cspan class=\"CitationRef\"\u003e1957\u003c/span\u003e; Katyare \u0026amp; Pandya, \u003cspan class=\"CitationRef\"\u003e2005\u003c/span\u003e). Initially, CORT standard solutions were prepared with concentrations ranging from 400 to 0.1 ng/ml. Plasma samples were extracted with a 2:1 chloroform: methanol mixture to isolate CORT. The resulting mixture was combined with 3 ml of chloroform, vortexed, and centrifuged at 2000×g. The bottom layer was then mixed with 300 µl of 0.1 N NaOH, vortexed, and centrifuged again at 2000×g. The resulting bottom layer was added to a mixture of 3 ml of a solution containing sulphuric acid and ethanol in a 4:1 ratio, followed by centrifugation at 2000×g. The resulting bottom layer was incubated in darkness for 5 minutes and subsequently measured using a spectrofluorometer with excitation and emission wavelengths. During excitation at 472 nm, the emission at 525 nm was measured. The concentrations of CORT in the samples were then calculated using the standard curve.\u003c/p\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003e2.7. Reverse transcriptase semiquantitative PCR\u003c/h2\u003e\n \u003cp\u003eThe hippocampal tissue samples were processed by homogenizing them in the lysis buffer provided with the RNX-plus RNA extraction kit (SinaClon, Iran), following the manufacturer's protocol. The RNX-plus kit utilizes a phenol-chloroform-based isolation method to extract total RNA. The resulting mixture was then subjected to chloroform extraction and centrifugation, separating it into aqueous and organic phases. The RNA-containing aqueous phase was isolated, and RNA was precipitated using isopropanol. Extracted RNA was run on a 0.75% agarose gel. RNA concentration was measured upon its absorbance in 260 nm and its quality and integrity upon a ratio of 260/280 nm and 0.5% agarose gel electrophoresis. One µg of total RNA was used in the first strand cDNA synthesis kit of SinaClon according to instructions. The cDNA was amplified by PCR using the following cycling conditions: initial denaturation at 94°C for 15 sec, annealing at 57°C for 1 min, extension at 72°C for 2.5 min for 30 cycles total using an Eppendorf Mastercycler semiquantitative PCR system. The quantity and purity of the RNA were evaluated using spectrophotometry.\u003c/p\u003e\n \u003cp\u003eThe RNA samples were reverse transcribed into complementary DNA (cDNA) using a reaction mixture containing random hexamer primers, dNTPs, and the reverse transcriptase enzyme. A 100 bp ladder was used to confirm product sizes. PCR primers were designed for the target genes, including prepro-OX (442 bp), OXr1 (330 bp), GR (428 bp), and GAPDH (131 bp), with specific product sizes. The specificity of the primers was confirmed.\u003c/p\u003e\n \u003cp\u003ePrepro-OX forward: 5'- AGACTCCTTGGGTATTTGGAC − 3'\u003c/p\u003e\n \u003cp\u003ePrepro-OX reverse: 5'- TAAAGCGGTGGCGGTTGCAGT − 3'\u003c/p\u003e\n \u003cp\u003eGR forward: 5'- AGTTCCTGCAGCATTACCAC − 3'\u003c/p\u003e\n \u003cp\u003eGR reverse: 5'- ACTCTTCATAGGATACCTGC − 3'\u003c/p\u003e\n \u003cp\u003eOXr1 forward: 5'- TGGGCTGTGTCGCTGGCTG − 3'\u003c/p\u003e\n \u003cp\u003eOXr1 reverse: 5'- GTTGGGGCTCTGTACACAGG − 3'\u003c/p\u003e\n \u003cp\u003eGAPDH forward: 5'- CAATGACCCCTTCATTGACC − 3'\u003c/p\u003e\n \u003cp\u003eGAPDH reverse: 5'- TGGAAGATGGTGATGGGATT − 3'\u003c/p\u003e\n \u003cp\u003ePCR amplification of the cDNA samples was carried out using the validated gene-specific primers along with a reaction mix containing buffer, nucleotides, and Taq polymerase. The PCR amplicons were analyzed by 1.5% agarose gel electrophoresis, and the band densities were quantified using ImageJ software. Target gene expression was normalized to the internal control, GAPDH.\u003c/p\u003e\n \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e\n \u003ch2\u003e2.8. Nissl Staining Procedure\u003c/h2\u003e\n \u003cp\u003eTo perform Nissl staining, a total of four animals were deeply anesthetized following the previously described method (Eghtesad et al., \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). Transcardial perfusion was conducted, first with 50 mL of normal saline, followed by 10% formalin. After the perfusion, the brains were carefully removed from the skulls and immersed in 10% formalin for 24 to 48 hours.\u003c/p\u003e\n \u003cp\u003eSubsequently, brain sections with a thickness of 40 µm were obtained utilizing a vibroslicer (Campden Instruments). These sections were sliced within a range of -3.72 to -4.44 mm from the bregma. To visualize cellular structures, the brain sections underwent Nissl staining using cresyl violet (Merck, Germany). The following steps were performed:\u003c/p\u003e\n \u003cp\u003e\u003cspan\u003e1. Preparation: Formalin-fixed hippocampi were moved to a 30% sucrose solution and allowed to incubate for 24 hours. After incubation, 40 µm sections were obtained and placed in a 24-well plate containing 0.1% PBS. The sections were then submerged in a solution mixture of 0.1% gelatine and 80% ethanol. Afterwards, the sections were mounted on glass slides and left to air dry for 24 hours.\u003cbr\u003e\u003c/span\u003e \u003cspan\u003e2. Dehydration: The sections underwent a dehydration process utilizing a series of ethanol and xylene solutions. Initially, the sections were briefly immersed in distilled water (DW) for one minute. Subsequently, they were sequentially immersed in an escalating concentration of ethanol, ranging from 70–100%, culminating in an immersion in xylene before being removed for the subsequent step. In this second round of dehydration, the sections were once again immersed in xylene, followed by sequential immersion in decreasing concentrations of ethanol, ranging from 100–70%, in the reverse order of the first round.\u003cbr\u003e\u003c/span\u003e \u003cspan\u003e3. Staining and Mounting: The sections were stained with cresyl violet for two minutes to reveal the Nissl bodies. Following staining, the sections were once more sequentially immersed in an escalating concentration of ethanol, from 70–100%, concluding with an immersion in xylene before being removed for the next step. Coverslips were then affixed to the glass slides using Entellan glue.\u003cbr\u003e\u003c/span\u003e \u003cspan\u003e4. Counting: Subsequent to the complete drying of the sections, neuronal cells within the CA1 region of the hippocampus were counted across six consecutive sections using a light microscope equipped with a 250 square micrometre grid. The average count from these six sections was regarded as the final value for that specific region of the animal.\u003cbr\u003e\u003c/span\u003e\u003c/p\u003e\n \u003cp\u003eFollowing this Nissl staining protocol, the neuronal cell bodies within the hippocampal sections were effectively visualized and quantified for subsequent analysis.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003e2.9. Statistical analysis\u003c/h2\u003e\n \u003cp\u003eStatistical differences between groups were assessed using a one-way ANOVA test, followed by the Tukey post-hoc test where applicable. All statistical analyses were conducted using GraphPad Prism software V. 9.3.0. The significance level was established at p \u0026lt; 0.05. The data were presented as means ± SEM.\u003c/p\u003e\n\u003c/div\u003e\n\n\n\n\n\n"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e3.1. Chronic stress induces more pronounced changes in physiology and gene expression compared to acute stress.\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eThe first experiment investigated the effects of chronic and acute stress on various physiological and molecular parameters. Our findings support the notion that chronic stress serves as a more potent stressor compared to acute stress.\u003c/p\u003e\u003cp\u003eThe analysis of variance (ANOVA) revealed statistically significant variations in the plasma CORT levels across the different experimental groups [F (2, 9) = 107, p \u0026lt; 0.0001]. As expected, both chronic stress (Ch.S) and acute stress (A.S) elevated plasma CORT levels compared to the control group (p \u0026lt; 0.0001). The same degree of effect by both stressors suggests the capability of the models in activation of the HPA axis (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, Top Left Panel).\u003c/p\u003e\u003cp\u003eThe ANOVA analysis indicated substantial differences in the gene expression levels of prepro-OX when comparing the various experimental groups [F (2, 9) = 406.9, p \u0026lt; 0.0001], OXr1 [F (2, 9) = 474.1, p \u0026lt; 0.0001] and GR [F (2, 9) = 125.1, p \u0026lt; 0.0001] genes. Chronic stress had a more significant impact on the expression of stress-related genes compared to acute stress. The prepro-OX (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, Top Right Panel), OXr1 genes (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, Middle Left Panel) and GR gene (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, Middle Right Panel) displayed a greater fold change increase (p \u0026lt; 0.0001) in expression following chronic stress compared to control. There was a significant difference between Ch.S and A.S in prepro-OX (p \u0026lt; 0.0001), OXr1 gene (p \u0026lt; 0.001) and GR (p \u0026lt; 0.0001) genes.\u003c/p\u003e\u003cp\u003eThe ANOVA revealed significant variations in the neuronal counts across the different experimental groups [F (2, 9) = 107.0, p \u0026lt; 0.0001]. Both chronic and acute stress exposure resulted in a significant decrease in the number of neurons within the CA1 region of the hippocampus compared to the control group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, Bottom Panel) (p \u0026lt; 0.0001). There was no difference between Ch.S and A.S in the neuronal number.\u003c/p\u003e\u003cp\u003eThese findings demonstrate that chronic stress exerts a more pronounced and enduring influence on both physiological and molecular markers of the stress response compared to acute stress. This implies a potential association between chronic stress and the development of stress-related disorders.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003e3.2. Effects of stress and noradrenergic system activation on plasma\u003c/strong\u003e CORT \u003cstrong\u003elevel\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eCORT is a hormone produced by the adrenal gland in response to stress, and it is considered an indicator of stress in the body. CORT levels can be measured in different matrices, such as plasma, mucus, scales, and skin conductance, to assess stress levels in animals. One-way ANOVA, in this study, revealed significant differences in plasma CORT between experimental groups [F (3, 12) = 41.62, p \u0026lt; 0.0001]. Post-hoc Tukey's test showed chronic stress (Ch.S), noradrenergic activation control (C + Y) and the combination of chronic stress and noradrenergic activation (Ch.S + Y) significantly elevated plasma CORT level vs controls (p \u0026lt; 0.0001) (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). The findings indicate that CORT has developed in response to stress and/ or noradrenergic activation.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003e3.3. Effects of stress and noradrenergic system activation on hippocampal\u003c/strong\u003e prepro-OX \u003cstrong\u003eexpression\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eThe orexin system is engaged during wakefulness, and it may be particularly active when driven by internal signals, such as stress, or external cues, like the prospect of a reward (Scammell \u0026amp; Winrow, \u003cspan class=\"CitationRef\"\u003e2011\u003c/span\u003e). This study aimed to examine the effects of chronic stress, acute stress, and noradrenergic system activation on prepro-OX expression in animal models. One-way ANOVA revealed significant differences in prepro-OX expression between experimental groups [F (3, 12) = 96.14, p \u0026lt; 0.0001]. Post-hoc Tukey's test showed chronic stress (Ch.S), and the combination of chronic stress and noradrenergic activation (Ch.S + Y) significantly elevated prepro-OX vs controls (p \u0026lt; 0.0001). Yohimbine (C + Y) also increased expression vs controls (p \u0026lt; 0.05). Ch.S + Y (p \u0026lt; 0.0001) exhibited a recovery of prepro-OX expression in relation to Ch.S alone, indicating noradrenergic stimulation reduces prepro-OX expression. Overall, chronic stress and yohimbine independently upregulated prepro-OX, while chronic stress combined with noradrenergic activation had the reverse effect (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e). The results collectively suggest complex regulatory patterns in prepro-OX expression in response to stress and noradrenergic activation.\u003c/p\u003e\u003ch2\u003e3.4. Orexin receptor-1 expression profile in the hippocampus under stress conditions and noradrenergic activation\u003c/h2\u003e\u003cp\u003eOXr1 is involved in the body's response to stress, and it plays a crucial role in several key aspects of chronic anxiety, including arousal and hypervigilance (Grafe \u0026amp; Bhatnagar, \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e; Gorka et al., \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). Statistical analysis via one-way ANOVA revealed a significant variance between experimental groups in OXr1 expression [F (3, 12) = 300.0, p \u0026lt; 0.0001]. Follow-up Tukey post-hoc testing revealed that rats subjected to chronic stress (Ch.S) and the combination of chronic stress with yohimbine (Ch.S + Y) exhibited significantly higher hippocampal OXr1 expression compared to controls (p \u0026lt; 0.0001). Similarly, rats that received yohimbine administration (C + Y) also showed significantly elevated hippocampal OXr1 levels relative to the control group (p \u0026lt; 0.001). Additionally, the Ch.S + Y group had significantly lower OXr1 expression relative to the Ch.S group (p \u0026lt; 0.0001), indicating the compensating effect of noradrenergic system activation (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). These results highlight the dynamic regulation of OXr1 expression under various stress conditions and with noradrenergic stimulation.\u003c/p\u003e\u003ch2\u003e3.5. Comparison of GR expression profile in the hippocampus under stress conditions and noradrenergic activation\u003c/h2\u003e\u003cp\u003eExpression of the GR in the hippocampus plays a role in stress-related disorders and stress regulation. One-way ANOVA revealed a significant effect of experimental groups on hippocampal GR expression profile [F (3, 12) = 216.4, p \u0026lt; 0.0001]. Subsequent Tukey post-hoc analysis showed GR expression was significantly increased in the chronic stress (Ch.S) group versus controls (p \u0026lt; 0.0001). Conversely, GR expression was significantly lower in the Ch.S + Y group compared to Ch.S alone (p \u0026lt; 0.0001). Notably, no significant GR expression difference was found between yohimbine-administered (C + Y) and control groups (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e). These findings illustrate the nuanced regulation of GR expression in the hippocampus under varying stress conditions and with noradrenergic activation.\u003c/p\u003e\u003ch2\u003e3.6. Effects of stress and noradrenergic in the hippocampus under stress conditions and noradrenergic activation\u003c/h2\u003e\u003cp\u003eThe neuronal population profile in the hippocampus is important for understanding various neurological disorders associated with stress. This study aimed to compare neuronal populations across experimental groups. The one-way ANOVA analysis revealed a significant effect of the experimental condition on the hippocampal neuronal population [F (3, 12) = 110.5, p \u0026lt; 0.0001]. Follow-up Tukey's test found neuronal counts were significantly lower in chronic stress (Ch.S) and their combination of chronic stress and noradrenergic activation (Ch.S + Y) groups (p \u0026lt; 0.001) versus controls. However, the Ch.S + Y group displayed significantly higher neuronal numbers compared to Ch.S alone (p \u0026lt; 0.001). Notably, no meaningful neuronal difference was observed between yohimbine (C + Y) and control groups (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e). These results provide crucial insights into the impact of stress conditions and noradrenergic activation on hippocampal neuronal populations, which is vital for understanding various stress-associated neurological disorders.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study aimed to compare chronic and acute stress and investigate the effects of stress and noradrenergic activation on the orexin and glucocorticoid receptor systems in the rat hippocampus. The study examined plasma CORT levels, prepro-OX expression, OXr1 expression, GR expression, and hippocampal neuronal populations. The key outcomes of the study are as follows: 1. The study revealed that both chronic and acute stress elevated corticosterone levels and reduced hippocampal CA1 neuronal count. However, chronic stress had a more pronounced effect on the expression of stress-related genes, including prepro-orexin, orexin receptor 1, and glucocorticoid receptor. 2. Chronic stress and noradrenergic activation profoundly elevated plasma CORT level and also prepro-OX expression, each compared to its respective controls. However, chronic stress combined with noradrenergic activation reduced prepro-OX expression compared to chronic stress alone. Rats subjected to chronic stress or yohimbine administration or their combination exhibited considerably higher hippocampal OXr1 expression. Yet, the combination of chronic stress and noradrenergic activation had notably lower OXr1 expression relative to the chronic stress group. Chronic stress substantially increased hippocampal glucocorticoid receptor expression compared to controls. In contrast, the combined chronic stress and noradrenergic activation condition exhibited significantly lower expression compared to chronic stress alone. Chronic stress and their combination of chronic stress and noradrenergic activation meaningfully reduced hippocampal neuronal populations compared to controls. However, chronic stress combined with noradrenergic activation increased neuronal numbers compared to chronic stress alone.\u003c/p\u003e\u003cp\u003eThe release of glucocorticoids, such as CORT in rodents, plays a crucial role in the HPA axis and serves as a biomarker of stress response (Tsigos et al., \u003cspan class=\"CitationRef\"\u003e2000\u003c/span\u003e; Bekhbat et al., \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). The HPA axis is a vital component of the stress system, and glucocorticoids play a fundamental role in maintaining both resting and stress-related homeostasis (Nicolaides et al., \u003cspan class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe study showed that both chronic and acute stress exposure activated the HPA axis, as indicated by the elevation of plasma CORT levels in response to chronic and acute stress (Sapolsky et al., \u003cspan class=\"CitationRef\"\u003e2000\u003c/span\u003e; Mokhtarpour et al., \u003cspan class=\"CitationRef\"\u003e2016\u003c/span\u003e), along with a decrease in neuronal population in the CA1 region of the hippocampus. However, chronic stress had a more profound impact on the expression of stress-related genes, such as prepro-OX, OXr1, and GR, compared to acute stress. Specifically, chronic stress exposure resulted in a significantly greater fold-change increase in the expression of these genes compared to both the control group and the acute stress group. Given that chronic stress had a more pronounced effect on the expression of stress-related genes involved in neuroendocrine and neuronal functions, it appears to be a more suitable model for further investigating the activation of the noradrenergic system by yohimbine. The chronic stress model seems to recapitulate better the molecular and cellular changes associated with stress-related disorders, making it a more relevant choice for studying the mechanisms underlying noradrenergic system dysregulation.\u003c/p\u003e\u003cp\u003eThe study on stress and noradrenergic activation demonstrated that chronic stress and noradrenergic activation via yohimbine all increased plasma CORT compared to controls, implicating activation of the HPA axis stress response (Sapolsky et al., \u003cspan class=\"CitationRef\"\u003e2000\u003c/span\u003e). The stress- induced CORT build- up is a well-known effect which has been confirmed by many studies (Bhatnagar et al., \u003cspan class=\"CitationRef\"\u003e2006\u003c/span\u003e; Marin et al., \u003cspan class=\"CitationRef\"\u003e2007\u003c/span\u003e; Rabasa et al., \u003cspan class=\"CitationRef\"\u003e2011\u003c/span\u003e; Sheng et al., \u003cspan class=\"CitationRef\"\u003e2020\u003c/span\u003e), as well as ours (Mokhtarpour et al., \u003cspan class=\"CitationRef\"\u003e2016\u003c/span\u003e; Eghtesad et al., \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). The study found that yohimbine mimics sympathetic activation by increasing norepinephrine, which is the first line of stress response. The data demonstrated an increase in CORT levels in the control animals injected with yohimbine, confirming this effect. This aligns with evidence that noradrenaline potentiates HPA axis signalling (Herman et al., \u003cspan class=\"CitationRef\"\u003e2003\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe prepro-OX precursor protein is a 130 amino acid pre-pro-peptide encoded by the gene HRCT and located on chromosome 17 (17q21). Orexin-A and orexin-B are excitatory neuropeptides produced by cleavage of the prepro-OX protein (Sakurai, \u003cspan class=\"CitationRef\"\u003e2014\u003c/span\u003e). The study found that hippocampal prepro-OX expression was enhanced by chronic stress and yohimbine alone or in combination with chronic stress, similar to the effect of chronic stress (Eghtesad et al., \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e) and acute stress (Mokhtarpour et al., \u003cspan class=\"CitationRef\"\u003e2016\u003c/span\u003e) shown in previous studies focused on the lateral hypothalamus. This is consistent with the involvement of orexin signalling in stress pathways (Heydendael et al., \u003cspan class=\"CitationRef\"\u003e2012\u003c/span\u003e; Sokolowska et al., \u003cspan class=\"CitationRef\"\u003e2014\u003c/span\u003e). The enhanced expression of prepro-OX in the hippocampus may reflect activation of the HPA axis influencing orexinergic activity (Zhao et al., \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e) or even a direct impact of stress on the likely pathologic expression of prepro-OX in the hippocampus. Although this condition might happen as an adaptation compensation to pathologic changes in the LH orexinergic system, it may also aggravate the situation in the hippocampus. Yohimbine infusion could only partially mimic previous findings suggesting noradrenergic modulation of prepro-OX (Sakurai, \u003cspan class=\"CitationRef\"\u003e2014\u003c/span\u003e). The reversal of prepro-OX expression levels observed with the combination of chronic stress and yohimbine administration suggests the existence of complex regulatory mechanisms between neurotransmitters and neuropeptides. It is hypothesized that prepro-OX expression may be reduced following yohimbine-induced norepinephrine increase in stressed animals. However, yohimbine alone emulates the stress effect on the expression.\u003c/p\u003e\u003cp\u003eOXr1 is a G protein-coupled receptor that is widely expressed throughout the brain, including the hippocampus. The activation of OXr1 has been shown to induce long-term structural and functional changes in the hippocampus (Song et al., \u003cspan class=\"CitationRef\"\u003e2015\u003c/span\u003e; Elahdadi Salmani et al., \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). OXr1 expression increased in all stress-exposed and yohimbine groups, fitting with orexin's role in stress (Heydendael et al., \u003cspan class=\"CitationRef\"\u003e2012\u003c/span\u003e). This likely enhances hippocampal sensitivity to heighten arousal and vigilance during stress (Sakurai, \u003cspan class=\"CitationRef\"\u003e2014\u003c/span\u003e). The study found that the chronic stress and yohimbine group showed lower OXr1 expression compared to chronic stress alone, suggesting a compensatory mechanism preventing excessive signalling and an interplay of the signal transduction pathways for norepinephrine and orexin. In accordance, a selective OXr1 antagonist has been shown to attenuate stress-induced hyperarousal without hypnotic effects, indicating the potential of OXr1 as a therapeutic target for stress-related disorders (Grafe \u0026amp; Bhatnagar, \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). Therefore, blocking the OXr1 by an antagonist or its downregulation using an internal agent (adrenergic system) may help retaliate the increased receptor expression.\u003c/p\u003e\u003cp\u003eThe GR is a nuclear receptor that functions as a ligand-activated transcription factor mediating the diverse physiological effects of glucocorticoids, such as CORT, in the hippocampus (Timmermans et al., \u003cspan class=\"CitationRef\"\u003e2019\u003c/span\u003e). Chronic stress, similar to acute stress, increased hippocampal GR expression, aligning with the established function of this receptor in negative feedback regulation of the HPA axis (de Kloet et al., \u003cspan class=\"CitationRef\"\u003e2005\u003c/span\u003e). In contrast, the combination of chronic stress and yohimbine administration significantly reduced GR expression. This implicates compensatory adaptation to mitigate potential GR overstimulation during prolonged stress exposure (Reul \u0026amp; de Kloet, \u003cspan class=\"CitationRef\"\u003e1985\u003c/span\u003e; George et al., \u003cspan class=\"CitationRef\"\u003e2013\u003c/span\u003e). The observed effect in the study may be attributed to the expressions of prepro-OX and OXr1 following yohimbine infusion, as well as the interaction between norepinephrine and orexin signalling pathways. However, the yohimbine-induced norepinephrine increase, which imitates mild stress, may have only employed mineralocorticoid receptors and not GRs in such a condition.\u003c/p\u003e\u003cp\u003eStress has been shown to have a significant impact on the structure and function of the hippocampus (McEwen et al., \u003cspan class=\"CitationRef\"\u003e2016\u003c/span\u003e). Chronic stress exposure has been found to cause shrinkage of dendrites of hippocampal CA3 and dentate gyrus neurons, as well as loss of spines in CA1, which may contribute to the cognitive deficits observed in stress-related disorders (Kim et al., \u003cspan class=\"CitationRef\"\u003e2015\u003c/span\u003e; McEwen et al., \u003cspan class=\"CitationRef\"\u003e2016\u003c/span\u003e). As expected, chronic and acute stress reduced the hippocampal neuron population, consistent with stress-induced structural alterations in this region (McEwen \u0026amp; Seeman, \u003cspan class=\"CitationRef\"\u003e1999\u003c/span\u003e; Chenani et al., \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). Intriguingly, the chronic stress and yohimbine group showed greater neuronal populations versus chronic stress alone, suggesting a neuroprotective effect of noradrenergic signalling (Arnsten \u0026amp; Li, \u003cspan class=\"CitationRef\"\u003e2005\u003c/span\u003e). The increased expression of orexin receptor type-2 (OXr2) observed in a previous study (unpublished data) following electric shock acute stress may be responsible for the effect observed in this study, indicating a neuroprotective mechanism. Future studies may need to use a different stress model for the acute condition to understand better the interplay of stress and the noradrenergic system in the hippocampus.\u003c/p\u003e\u003cp\u003eOverall, chronic stress, as the selected stress model, elicited an increase in HPA activity, orexin and glucocorticoid expression profiles, and a reduction of structural neuronal changes aligned with prior research. Unique findings emerged when examining interactions between chronic stress and noradrenergic stimulation. The combination revealed potential compensatory mechanisms not seen with either factor alone, including modulation of prepro-OX levels, orexin receptor expression, glucocorticoid receptor expression, and hippocampal neuronal viability.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, this research highlighted the complex interplay between stress and noradrenergic signalling in the hippocampus. Stress alone increased prepro-OX, OXr1, and GR expression yet decreased neuronal populations. Noradrenergic activation by itself only heightened prepro-OX and OXr1 levels. However, the combination of chronic stress and noradrenergic stimulation led to the recovery of these hippocampal measures, implying compensatory adaptation. While yohimbine treatment did not alter neuron numbers or GR expression on its own, it appeared to engage protective mechanisms during prolonged stress exposure. As orexin- and glucocorticoid-related genes were only measured at the mRNA level, further study of protein and physiological function is warranted. These findings have important implications for understanding brain stress responses and developing treatments for stress-related disorders. Further work should uncover additional facets of these intricate interactions and inform strategies to mitigate neurological harm from chronic stress.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eCtrl, Control; Ch.S, chronic stress; \u0026nbsp;A.S, acute stress; \u0026nbsp;C+Y, noradrenergic system activation by Yohimbine in the control animals; \u0026nbsp; Ch.S+Y, \u0026nbsp;noradrenergic system activation by Yohimbine in the chronically stressed animals; HPA, Hypothalamic Pituitary Axis, CORT, corticosterone; OXr1, orexin receptor type 1; GR, glucocorticoid receptor\u003c/p\u003e\n"},{"header":"Declarations","content":"\u003cp\u003e6. Author contributions\u003c/p\u003e\n\u003cp\u003eM.S. performed the formal analysis, investigation, and established the methodology. M.E.S. designed the study, oversaw its administration, and provided supervision to the research team. Additionally, he drafted the original manuscript and participated in its revision and editing. T.L. was responsible for data curation, further contributing to the formal analysis and methodology development. I.G. helped in the study\u0026apos;s conceptualization and project administration. She also participated in the review and editing of the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003e7. Acknowledgment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors acknowledge Damghan University for supporting this study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e8. Conflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflicts of interest associated with this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e9. Funding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research received financial backing from Damghan University as a component of a doctoral dissertation. The study was conducted under the ethical approval code IR.DU.REC.1401.009 from the Damghan University Research Ethics Committee.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e10. Data availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data used in this study are not publicly accessible due to restrictions imposed by the Research Ethics Committee. However, these data can be obtained by contacting the corresponding author.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAlfarez, D.N., Joels, M. \u0026amp; Krugers, H.J. (2003) Chronic unpredictable stress impairs long-term potentiation in rat hippocampal CA1 area and dentate gyrus in vitro. \u003cem\u003eEur J Neurosci\u003c/em\u003e, \u003cstrong\u003e17\u003c/strong\u003e, 1928-1934.\u003c/li\u003e\n \u003cli\u003eArnsten, A.F. \u0026amp; Li, B.M. (2005) Neurobiology of executive functions: catecholamine influences on prefrontal cortical functions. \u003cem\u003eBiol Psychiatry\u003c/em\u003e, \u003cstrong\u003e57\u003c/strong\u003e, 1377-1384.\u003c/li\u003e\n \u003cli\u003eBao, A.M., Meynen, G. \u0026amp; Swaab, D.F. (2008) The stress system in depression and neurodegeneration: focus on the human hypothalamus. \u003cem\u003eBrain Res Rev\u003c/em\u003e, \u003cstrong\u003e57\u003c/strong\u003e, 531-553.\u003c/li\u003e\n \u003cli\u003eBekhbat, M., Glasper, E.R., Rowson, S.A., Kelly, S.D. \u0026amp; Neigh, G.N. (2018) Measuring corticosterone concentrations over a physiological dynamic range in female rats. \u003cem\u003ePhysiol Behav\u003c/em\u003e, \u003cstrong\u003e194\u003c/strong\u003e, 73-76.\u003c/li\u003e\n \u003cli\u003eBhatnagar, S., Vining, C., Iyer, V. \u0026amp; Kinni, V. (2006) Changes in hypothalamic-pituitary-adrenal function, body temperature, body weight and food intake with repeated social stress exposure in rats. \u003cem\u003eJ Neuroendocrinol\u003c/em\u003e, \u003cstrong\u003e18\u003c/strong\u003e, 13-24.\u003c/li\u003e\n \u003cli\u003eChen, Y.W., Das, M., Oyarzabal, E.A., Cheng, Q., Plummer, N.W., Smith, K.G., Jones, G.K., Malawsky, D., Yakel, J.L., Shih, Y.I. \u0026amp; Jensen, P. (2019) Genetic identification of a population of noradrenergic neurons implicated in attenuation of stress-related responses. \u003cem\u003eMol Psychiatry\u003c/em\u003e, \u003cstrong\u003e24\u003c/strong\u003e, 710-725.\u003c/li\u003e\n \u003cli\u003eChenani, A., Weston, G., Ulivi, A.F., Castello-Waldow, T.P., Huettl, R.E., Chen, A. \u0026amp; Attardo, A. (2022) Repeated stress exposure leads to structural synaptic instability prior to disorganization of hippocampal coding and impairments in learning. \u003cem\u003eTransl Psychiatry\u003c/em\u003e, \u003cstrong\u003e12\u003c/strong\u003e, 381.\u003c/li\u003e\n \u003cli\u003eChrousos, G.P. \u0026amp; Gold, P.W. (1992) The concepts of stress and stress system disorders. Overview of physical and behavioral homeostasis. \u003cem\u003eJAMA\u003c/em\u003e, \u003cstrong\u003e267\u003c/strong\u003e, 1244-1252.\u003c/li\u003e\n \u003cli\u003ede Kloet, E.R., Sibug, R.M., Helmerhorst, F.M. \u0026amp; Schmidt, M.V. (2005) Stress, genes and the mechanism of programming the brain for later life. \u003cem\u003eNeurosci Biobehav Rev\u003c/em\u003e, \u003cstrong\u003e29\u003c/strong\u003e, 271-281.\u003c/li\u003e\n \u003cli\u003eEghtesad, M., Elahdadi Salmani, M., Lashkarbolouki, T. \u0026amp; Goudarzi, I. (2022) Lateral Hypothalamus Corticotropin-releasing Hormone Receptor-1 Inhibition and Modulating Stress-induced Anxiety Behavior. \u003cem\u003eBasic Clin Neurosci\u003c/em\u003e, \u003cstrong\u003e13\u003c/strong\u003e, 373-384.\u003c/li\u003e\n \u003cli\u003eElahdadi Salmani, M., Sarfi, M. \u0026amp; Goudarzi, I. (2022) Hippocampal orexin receptors: Localization and function. \u003cem\u003eVitam Horm\u003c/em\u003e, \u003cstrong\u003e118\u003c/strong\u003e, 393-421.\u003c/li\u003e\n \u003cli\u003eElfving, B., Jakobsen, J.L., Madsen, J.C., Wegener, G. \u0026amp; Muller, H.K. (2015) Chronic restraint stress increases the protein expression of VEGF and its receptor VEGFR-2 in the prefrontal cortex. \u003cem\u003eSynapse\u003c/em\u003e, \u003cstrong\u003e69\u003c/strong\u003e, 190-194.\u003c/li\u003e\n \u003cli\u003eEspana, R.A., Schmeichel, B.E. \u0026amp; Berridge, C.W. (2016) Norepinephrine at the nexus of arousal, motivation and relapse. \u003cem\u003eBrain Res\u003c/em\u003e, \u003cstrong\u003e1641\u003c/strong\u003e, 207-216.\u003c/li\u003e\n \u003cli\u003eGeorge, S.A., Stout, S.A., Tan, M., Knox, D. \u0026amp; Liberzon, I. (2013) Early handling attenuates enhancement of glucocorticoid receptors in the prefrontal cortex in an animal model of post-traumatic stress disorder. \u003cem\u003eBiol Mood Anxiety Disord\u003c/em\u003e, \u003cstrong\u003e3\u003c/strong\u003e, 22.\u003c/li\u003e\n \u003cli\u003eGorka, S.M., Khorrami, K.J., Manzler, C.A. \u0026amp; Phan, K.L. (2022) Acute orexin antagonism selectively modulates anticipatory anxiety in humans: implications for addiction and anxiety. \u003cem\u003eTransl Psychiatry\u003c/em\u003e, \u003cstrong\u003e12\u003c/strong\u003e, 308.\u003c/li\u003e\n \u003cli\u003eGrafe, L.A. \u0026amp; Bhatnagar, S. (2018) Orexins and stress. \u003cem\u003eFront Neuroendocrinol\u003c/em\u003e, \u003cstrong\u003e51\u003c/strong\u003e, 132-145.\u003c/li\u003e\n \u003cli\u003eHan, Q.Q., Yang, L., Huang, H.J., Wang, Y.L., Yu, R., Wang, J., Pilot, A., Wu, G.C., Liu, Q. \u0026amp; Yu, J. (2017) Differential GR Expression and Translocation in the Hippocampus Mediates Susceptibility vs. Resilience to Chronic Social Defeat Stress. \u003cem\u003eFront Neurosci\u003c/em\u003e, \u003cstrong\u003e11\u003c/strong\u003e, 287.\u003c/li\u003e\n \u003cli\u003eHasegawa, E., Yanagisawa, M., Sakurai, T. \u0026amp; Mieda, M. (2014) Orexin neurons suppress narcolepsy via 2 distinct efferent pathways. \u003cem\u003eJ Clin Invest\u003c/em\u003e, \u003cstrong\u003e124\u003c/strong\u003e, 604-616.\u003c/li\u003e\n \u003cli\u003eHerman, J.P., Figueiredo, H., Mueller, N.K., Ulrich-Lai, Y., Ostrander, M.M., Choi, D.C. \u0026amp; Cullinan, W.E. (2003) Central mechanisms of stress integration: hierarchical circuitry controlling hypothalamo-pituitary-adrenocortical responsiveness. \u003cem\u003eFront Neuroendocrinol\u003c/em\u003e, \u003cstrong\u003e24\u003c/strong\u003e, 151-180.\u003c/li\u003e\n \u003cli\u003eHeydendael, W., Sengupta, A. \u0026amp; Bhatnagar, S. (2012) Putative genes mediating the effects of orexins in the posterior paraventricular thalamus on neuroendocrine and behavioral adaptations to repeated stress. \u003cem\u003eBrain Res Bull\u003c/em\u003e, \u003cstrong\u003e89\u003c/strong\u003e, 203-210.\u003c/li\u003e\n \u003cli\u003eKatyare, S.S. \u0026amp; Pandya, J.D. (2005) A simplified fluorimetric method for corticosterone estimation in rat serum, tissues and mitochondria. \u003cem\u003eIndian J Biochem Biophys\u003c/em\u003e, \u003cstrong\u003e42\u003c/strong\u003e, 48-53.\u003c/li\u003e\n \u003cli\u003eKim, E.J., Pellman, B. \u0026amp; Kim, J.J. (2015) Stress effects on the hippocampus: a critical review. \u003cem\u003eLearn Mem\u003c/em\u003e, \u003cstrong\u003e22\u003c/strong\u003e, 411-416.\u003c/li\u003e\n \u003cli\u003eLin, C.C. \u0026amp; Huang, T.L. (2022) Orexin/hypocretin and major psychiatric disorders. \u003cem\u003eAdv Clin Chem\u003c/em\u003e, \u003cstrong\u003e109\u003c/strong\u003e, 185-212.\u003c/li\u003e\n \u003cli\u003eMarin, M.T., Cruz, F.C. \u0026amp; Planeta, C.S. (2007) Chronic restraint or variable stresses differently affect the behavior, corticosterone secretion and body weight in rats. \u003cem\u003ePhysiol Behav\u003c/em\u003e, \u003cstrong\u003e90\u003c/strong\u003e, 29-35.\u003c/li\u003e\n \u003cli\u003eMcEwen, B.S. (1998) Stress, adaptation, and disease. Allostasis and allostatic load. \u003cem\u003eAnn N Y Acad Sci\u003c/em\u003e, \u003cstrong\u003e840\u003c/strong\u003e, 33-44.\u003c/li\u003e\n \u003cli\u003eMcEwen, B.S. (2008) Central effects of stress hormones in health and disease: Understanding the protective and damaging effects of stress and stress mediators. \u003cem\u003eEur J Pharmacol\u003c/em\u003e, \u003cstrong\u003e583\u003c/strong\u003e, 174-185.\u003c/li\u003e\n \u003cli\u003eMcEwen, B.S., Nasca, C. \u0026amp; Gray, J.D. (2016) Stress Effects on Neuronal Structure: Hippocampus, Amygdala, and Prefrontal Cortex. \u003cem\u003eNeuropsychopharmacology\u003c/em\u003e, \u003cstrong\u003e41\u003c/strong\u003e, 3-23.\u003c/li\u003e\n \u003cli\u003eMcEwen, B.S. \u0026amp; Seeman, T. (1999) Protective and damaging effects of mediators of stress. Elaborating and testing the concepts of allostasis and allostatic load. \u003cem\u003eAnn N Y Acad Sci\u003c/em\u003e, \u003cstrong\u003e896\u003c/strong\u003e, 30-47.\u003c/li\u003e\n \u003cli\u003eMokhtarpour, M., Elahdadi Salmani, M., Lashkarbolouki, T., Abrari, K. \u0026amp; Goudarzi, I. (2016) Lateral hypothalamus orexinergic system modulates the stress effect on pentylenetetrazol induced seizures through corticotropin releasing hormone receptor type 1. \u003cem\u003eNeuropharmacology\u003c/em\u003e, \u003cstrong\u003e110\u003c/strong\u003e, 15-24.\u003c/li\u003e\n \u003cli\u003eNicolaides, N.C., Kyratzi, E., Lamprokostopoulou, A., Chrousos, G.P. \u0026amp; Charmandari, E. (2015) Stress, the stress system and the role of glucocorticoids. \u003cem\u003eNeuroimmunomodulation\u003c/em\u003e, \u003cstrong\u003e22\u003c/strong\u003e, 6-19.\u003c/li\u003e\n \u003cli\u003ePeterson, R.E. (1957) The identification of corticosterone in human plasma and its assay by isotope dilution. \u003cem\u003eJ Biol Chem\u003c/em\u003e, \u003cstrong\u003e225\u003c/strong\u003e, 25-37.\u003c/li\u003e\n \u003cli\u003ePeyron, C., Tighe, D.K., van den Pol, A.N., de Lecea, L., Heller, H.C., Sutcliffe, J.G. \u0026amp; Kilduff, T.S. (1998) Neurons containing hypocretin (orexin) project to multiple neuronal systems. \u003cem\u003eJ Neurosci\u003c/em\u003e, \u003cstrong\u003e18\u003c/strong\u003e, 9996-10015.\u003c/li\u003e\n \u003cli\u003eRabasa, C., Munoz-Abellan, C., Daviu, N., Nadal, R. \u0026amp; Armario, A. (2011) Repeated exposure to immobilization or two different footshock intensities reveals differential adaptation of the hypothalamic-pituitary-adrenal axis. \u003cem\u003ePhysiol Behav\u003c/em\u003e, \u003cstrong\u003e103\u003c/strong\u003e, 125-133.\u003c/li\u003e\n \u003cli\u003eRamot, A., Jiang, Z., Tian, J.B., Nahum, T., Kuperman, Y., Justice, N. \u0026amp; Chen, A. (2017) Hypothalamic CRFR1 is essential for HPA axis regulation following chronic stress. \u003cem\u003eNat Neurosci\u003c/em\u003e, \u003cstrong\u003e20\u003c/strong\u003e, 385-388.\u003c/li\u003e\n \u003cli\u003eReul, J.M. \u0026amp; de Kloet, E.R. (1985) Two receptor systems for corticosterone in rat brain: microdistribution and differential occupation. \u003cem\u003eEndocrinology\u003c/em\u003e, \u003cstrong\u003e117\u003c/strong\u003e, 2505-2511.\u003c/li\u003e\n \u003cli\u003eRichards, J.K., Simms, J.A., Steensland, P., Taha, S.A., Borgland, S.L., Bonci, A. \u0026amp; Bartlett, S.E. (2008) Inhibition of orexin-1/hypocretin-1 receptors inhibits yohimbine-induced reinstatement of ethanol and sucrose seeking in Long-Evans rats. \u003cem\u003ePsychopharmacology (Berl)\u003c/em\u003e, \u003cstrong\u003e199\u003c/strong\u003e, 109-117.\u003c/li\u003e\n \u003cli\u003eSakurai, T. (2014) The role of orexin in motivated behaviours. \u003cem\u003eNat Rev Neurosci\u003c/em\u003e, \u003cstrong\u003e15\u003c/strong\u003e, 719-731.\u003c/li\u003e\n \u003cli\u003eSalehabadi, S., Abrari, K., Elahdadi Salmani, M., Nasiri, M. \u0026amp; Lashkarbolouki, T. (2020) Investigating the role of the amygdala orexin receptor 1 in memory acquisition and extinction in a rat model of PTSD. \u003cem\u003eBehav Brain Res\u003c/em\u003e, \u003cstrong\u003e384\u003c/strong\u003e, 112455.\u003c/li\u003e\n \u003cli\u003eSantha, P., Pakaski, M., Fazekas, O.C., Fodor, E.K., Kalman, S., Kalman, J., Jr., Janka, Z., Szabo, G. \u0026amp; Kalman, J. (2012) Restraint stress in rats alters gene transcription and protein translation in the hippocampus. \u003cem\u003eNeurochem Res\u003c/em\u003e, \u003cstrong\u003e37\u003c/strong\u003e, 958-964.\u003c/li\u003e\n \u003cli\u003eSapolsky, R.M., Romero, L.M. \u0026amp; Munck, A.U. (2000) How do glucocorticoids influence stress responses? Integrating permissive, suppressive, stimulatory, and preparative actions. \u003cem\u003eEndocr Rev\u003c/em\u003e, \u003cstrong\u003e21\u003c/strong\u003e, 55-89.\u003c/li\u003e\n \u003cli\u003eScammell, T.E. \u0026amp; Winrow, C.J. (2011) Orexin receptors: pharmacology and therapeutic opportunities. \u003cem\u003eAnnu Rev Pharmacol Toxicol\u003c/em\u003e, \u003cstrong\u003e51\u003c/strong\u003e, 243-266.\u003c/li\u003e\n \u003cli\u003eSchoenfeld, T.J., McCausland, H.C., Morris, H.D., Padmanaban, V. \u0026amp; Cameron, H.A. (2017) Stress and Loss of Adult Neurogenesis Differentially Reduce Hippocampal Volume. \u003cem\u003eBiol Psychiatry\u003c/em\u003e, \u003cstrong\u003e82\u003c/strong\u003e, 914-923.\u003c/li\u003e\n \u003cli\u003eSears, R.M., Fink, A.E., Wigestrand, M.B., Farb, C.R., de Lecea, L. \u0026amp; Ledoux, J.E. (2013) Orexin/hypocretin system modulates amygdala-dependent threat learning through the locus coeruleus. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e, \u003cstrong\u003e110\u003c/strong\u003e, 20260-20265.\u003c/li\u003e\n \u003cli\u003eSelye, H. (1950) Stress and the general adaptation syndrome. \u003cem\u003eBr Med J\u003c/em\u003e, \u003cstrong\u003e1\u003c/strong\u003e, 1383-1392.\u003c/li\u003e\n \u003cli\u003eSheng, J.A., Bales, N.J., Myers, S.A., Bautista, A.I., Roueinfar, M., Hale, T.M. \u0026amp; Handa, R.J. (2020) The Hypothalamic-Pituitary-Adrenal Axis: Development, Programming Actions of Hormones, and Maternal-Fetal Interactions. \u003cem\u003eFront Behav Neurosci\u003c/em\u003e, \u003cstrong\u003e14\u003c/strong\u003e, 601939.\u003c/li\u003e\n \u003cli\u003eSokolowska, P., Urbanska, A., Bieganska, K., Wagner, W., Ciszewski, W., Namiecinska, M. \u0026amp; Zawilska, J.B. (2014) Orexins protect neuronal cell cultures against hypoxic stress: an involvement of Akt signaling. \u003cem\u003eJ Mol Neurosci\u003c/em\u003e, \u003cstrong\u003e52\u003c/strong\u003e, 48-55.\u003c/li\u003e\n \u003cli\u003eSong, J., Kim, E., Kim, C.H., Song, H.T. \u0026amp; Lee, J.E. (2015) The role of orexin in post-stroke inflammation, cognitive decline, and depression. \u003cem\u003eMol Brain\u003c/em\u003e, \u003cstrong\u003e8\u003c/strong\u003e, 16.\u003c/li\u003e\n \u003cli\u003eSong, Q., Bolsius, Y.G., Ronzoni, G., Henckens, M. \u0026amp; Roozendaal, B. (2021) Noradrenergic enhancement of object recognition and object location memory in mice. \u003cem\u003eStress\u003c/em\u003e, \u003cstrong\u003e24\u003c/strong\u003e, 181-188.\u003c/li\u003e\n \u003cli\u003eSoya, S. \u0026amp; Sakurai, T. (2020) Evolution of Orexin Neuropeptide System: Structure and Function. \u003cem\u003eFront Neurosci\u003c/em\u003e, \u003cstrong\u003e14\u003c/strong\u003e, 691.\u003c/li\u003e\n \u003cli\u003eStankiewicz, A.M., Goscik, J., Majewska, A., Swiergiel, A.H. \u0026amp; Juszczak, G.R. (2015) The Effect of Acute and Chronic Social Stress on the Hippocampal Transcriptome in Mice. \u003cem\u003ePLoS One\u003c/em\u003e, \u003cstrong\u003e10\u003c/strong\u003e, e0142195.\u003c/li\u003e\n \u003cli\u003eTimmermans, S., Souffriau, J. \u0026amp; Libert, C. (2019) A General Introduction to Glucocorticoid Biology. \u003cem\u003eFront Immunol\u003c/em\u003e, \u003cstrong\u003e10\u003c/strong\u003e, 1545.\u003c/li\u003e\n \u003cli\u003eTsigos, C., Kyrou, I., Kassi, E. \u0026amp; Chrousos, G.P. (2000) Stress: Endocrine Physiology and Pathophysiology. In Feingold, K.R., Anawalt, B., Blackman, M.R., Boyce, A., Chrousos, G., Corpas, E., de Herder, W.W., Dhatariya, K., Dungan, K., Hofland, J., Kalra, S., Kaltsas, G., Kapoor, N., Koch, C., Kopp, P., Korbonits, M., Kovacs, C.S., Kuohung, W., Laferrere, B., Levy, M., McGee, E.A., McLachlan, R., New, M., Purnell, J., Sahay, R., Shah, A.S., Singer, F., Sperling, M.A., Stratakis, C.A., Trence, D.L., Wilson, D.P. (eds) \u003cem\u003eEndotext\u003c/em\u003e, South Dartmouth (MA).\u003c/li\u003e\n \u003cli\u003eYamamoto, K., Shinba, T. \u0026amp; Yoshii, M. (2014) Psychiatric symptoms of noradrenergic dysfunction: a pathophysiological view. \u003cem\u003ePsychiatry Clin Neurosci\u003c/em\u003e, \u003cstrong\u003e68\u003c/strong\u003e, 1-20.\u003c/li\u003e\n \u003cli\u003eZerbes, G., Kausche, F.M., Muller, J.C., Wiedemann, K. \u0026amp; Schwabe, L. (2019) Glucocorticoids, Noradrenergic Arousal, and the Control of Memory Retrieval. \u003cem\u003eJ Cogn Neurosci\u003c/em\u003e, \u003cstrong\u003e31\u003c/strong\u003e, 288-298.\u003c/li\u003e\n \u003cli\u003eZhao, S., Wang, S., Li, H., Guo, J., Li, J., Wang, D., Zhang, X., Yin, L., Li, R., Li, A., Li, H., Fan, Z., Yang, Q., Zhong, H. \u0026amp; Dong, H. (2021) Activation of Orexinergic Neurons Inhibits the Anesthetic Effect of Desflurane on Consciousness State via Paraventricular Thalamic Nucleus in Rats. \u003cem\u003eAnesth Analg\u003c/em\u003e, \u003cstrong\u003e133\u003c/strong\u003e, 781-793.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Stress, Noradrenergic system, Orexinergic modulation, Glucocorticoid receptor, Neuronal populations","lastPublishedDoi":"10.21203/rs.3.rs-4986129/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4986129/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eStress can be beneficial for adapting to dangerous situations in the short term, but can be damaging in the long term, especially in the hippocampus. The noradrenergic and orexinergic systems play important roles in the stress response. This study investigated the effect of noradrenergic activation on the changes induced by chronic stress in the hippocampus and the involvement of orexinergic modulation in this process.\u003c/p\u003e \u003cp\u003eTwenty male Wistar rats were subjected to chronic stress, acute stress, administration of α2 receptor antagonist yohimbine, or their combinations. Plasma corticosterone (CORT) was measured using a fluorometric method. Expression of prepro-orexin (prepro-OX), orexin receptor-1 (OXr1), and glucocorticoid receptor (GR) was analyzed using RT-PCR. Neuronal populations were quantified using Nissl staining.\u003c/p\u003e \u003cp\u003eChronic and acute stress increased plasma CORT levels, gene expression of prepro-OX, OXr1, and GR, while decreasing neuronal number, with the chronic stress having a more pronounced effect. The stress- induced and Yohimbine treated groups demonstrated a higher level of plasma CORT. Chronic stress substantially increased prepro-OX expression, while yohimbine recovered the profile in chronically stressed animals. OXr1 expression was profoundly higher in the chronic stress group, while chronic stress combined with yohimbine decreased that profile. Similarly, chronic stress upregulated glucocorticoid receptor, while chronic stress combined with yohimbine reversed the effect. Conversely, the chronic stress reduced hippocampal neuronal populations and chronic stress combined with yohimbine partially compensated the neuronal numbers compared to chronic stress alone.\u003c/p\u003e \u003cp\u003eThe results suggest that noradrenergic signalling can reverse the chronic stress-induced impairments in prepro-OX, OXr1, GR, and neuronal population.\u003c/p\u003e","manuscriptTitle":"Modulation of noradrenergic signalling reverses stress-induced changes in the hippocampus: involvement of orexinergic systems","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-27 13:07:56","doi":"10.21203/rs.3.rs-4986129/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"63f5c339-6fd3-4a10-8811-b86e4e9dff85","owner":[],"postedDate":"September 27th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-10-13T19:08:18+00:00","versionOfRecord":[],"versionCreatedAt":"2024-09-27 13:07:56","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4986129","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4986129","identity":"rs-4986129","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.