Comparative genomics reveals multipartite genomes undergoing loss in the fungal endosymbiotic genus Mycetohabitans

Comparative genomics reveals multipartite genomes undergoing loss in the fungal endosymbiotic genus Mycetohabitans | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Comparative genomics reveals multipartite genomes undergoing loss in the fungal endosymbiotic genus Mycetohabitans View ORCID Profile Bhuwan Abbot , Sara Field , View ORCID Profile Lauren Carneal , Richard Allen White III , Andra Buchan , Caroline West , Laira Lee , View ORCID Profile Morgan Elizabeth Carter doi: https://doi.org/10.1101/2025.06.12.659383 Bhuwan Abbot 1 Department of Biological Sciences, The University of North Carolina at Charlotte , Charlotte, NC, 28223, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Bhuwan Abbot Sara Field 1 Department of Biological Sciences, The University of North Carolina at Charlotte , Charlotte, NC, 28223, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Lauren Carneal 1 Department of Biological Sciences, The University of North Carolina at Charlotte , Charlotte, NC, 28223, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Lauren Carneal Richard Allen White III 2 Department of Bioinformatics and Genomics, The University of North Carolina at Charlotte , Charlotte, NC, 28223, USA 3 CIPHER Center, The University of North Carolina at Charlotte , Charlotte, NC, 28223, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Andra Buchan 2 Department of Bioinformatics and Genomics, The University of North Carolina at Charlotte , Charlotte, NC, 28223, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Caroline West 2 Department of Bioinformatics and Genomics, The University of North Carolina at Charlotte , Charlotte, NC, 28223, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Laira Lee 4 North Carolina School of Science and Mathematics – Morganton , Morganton, NC, 28655, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Morgan Elizabeth Carter 1 Department of Biological Sciences, The University of North Carolina at Charlotte , Charlotte, NC, 28223, USA 3 CIPHER Center, The University of North Carolina at Charlotte , Charlotte, NC, 28223, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Morgan Elizabeth Carter For correspondence: morgan.carter{at}charlotte.edu Abstract Full Text Info/History Metrics Supplementary material Preview PDF ABSTRACT Endosymbiotic bacteria extensively impact phenotypes of their eukaryotic hosts, while experiencing dramatic changes to their own genome as they become more host-restricted in lifestyle. Understanding the trajectory of such a genome has largely been done through study of animal-associated bacteria, especially insect endosymbionts. Yet, endofungal bacteria provide another natural experimental model for investigating how microbial genomes change when living inside of a host cell. Mycetohabitans spp. are culturable bacterial endosymbionts of the Mucoromycota fungus Rhizopus microsporus . To investigate the genome dynamics resulting from the endohyphal nature of this emerging model genus, we long-read sequenced and assembled new complete genomes to combine with previous assemblies, creating a global dataset of 28 complete Mycetohabitans genomes. All genomes were between 3.3 and 3.9 Mbp in size and were multipartite, structured into two conserved replicons with some strains having an additional plasmid. Based on evolutionary rate and gene content analysis of the different replicons, we termed the two major ones a chromosome and chromid. The differential presence of a third, mobilome-rich plasmid in some strains and the proliferation of transposable elements provide putative mechanisms for recombination or gene loss. The conservation of intact prophage and putative toxin-antitoxin systems, and extensive enrichment of secondary metabolite clusters in the Mycetohabitans genomes highlight the dynamic nature of this reducing genome. With fungal-bacterial symbioses becoming increasingly apparent phenomena, lessons learned from this symbiosis will inform our understanding of bacterial adaptation to novel hosts, and the process of microbe-microbe coevolution. SIGNIFICANCE Genomes change when organisms become closely associated, as bacterial partners undergo less opportunities for genetic exchange and become more reliant on their hosts. Our pangenome analysis of the endofungal genus Mycetohabitans shows a snapshot of evolution where the bacteria are moving from a facultative towards an obligate relationship with their host fungi. We find that Mycetohabitans genomes are marked by transposable elements, pseudogenes, a large biosynthetic repertoire, and novel bacteriophage. We provide a genomic resource to match publicly accessible strains for future work on endosymbiotic genetics and evolution. INTRODUCTION With the increasing ease of bacterial genome sequencing and metagenomics, genetic information on both culturable and unculturable microbes is becoming readily available. Consequently, bacterial evolution is now better understood to be a function of the organism’s lifestyle and environment, spotlighting endosymbiotic bacteria as particularly interesting cases to gain insight into genomic changes during coevolution ( Wernegreen 2015 ; Keeling and McCutcheon 2017 ). It is widely understood through studies of insect symbionts, like the well-studied Wolbachia genus, that bacteria with obligate host relationships typically have undergone genome reduction, widespread gene loss, and rapid genome evolution as a result of AT richness ( Wernegreen 2015 ; Porter and Sullivan 2023 ; Vancaester and Blaxter 2023 ). Obligate endosymbionts only represent the segment in this evolutionary journey with high host dependence, and their intractability in vitro poses difficulties for investigating processes leading to such a reduced genome. In contrast, genomes belonging to diatom endosymbionts in a transitionary state have expanded and accumulated transposable elements and pseudogenes, compared to those in a more stable endosymbiosis that have undergone the expected TE and core gene loss ( Grujcic, et al. 2025 ). Similarly, insect endosymbionts with larger genomes like those in the Sodalis genus have high pseudogenization ( Boyd, et al. 2024 ). Clearly, studying genetic features in intracellular bacteria that are recently host-restricted is needed to reach broad conclusions about genomic evolution during endosymbiosis. Diverse eukaryotes undergo bacterial colonization, from unicellular protists to multicellular organisms like animals, yielding symbiotic outcomes ranging from pathogenic to mutualistic. For example, a wide range of fungi are hosts to endosymbiotic bacteria varying in the permanence and co-dependence within relationships ( Robinson, et al. 2021 ; Pawlowska 2024 ). Arbuscular mycorrhizal fungi (phylum: Glomeromycotina) are extensively found to have obligate relationships with endohyphal bacteria with highly reduced genomes, indicating a fairly ancient relationship ( Naumann, et al. 2010 ). Multiple ascomycetes and basidiomycetes relevant to plant and human health have facultative bacterial endosymbionts impacting fungal phenotypes and environmental function, such as pathogenesis and metabolism ( Steffan, et al. 2020 ; Moses and Carter 2025 ). However, not much is known about the mechanistic basis of bacterial adaptation to fungal hosts and few genomic studies have been undertaken for this niche ( Amses, et al. 2023 ). Hence, fungal-bacterial endosymbioses represent a subfield with a wealth of untapped knowledge for new perspectives on genomic dynamics during bacterial evolution towards an endosymbiotic lifestyle. A valuable emerging model for fungal-bacterial endosymbiosis is the interaction between the Mucoromycota fungus Rhizopus microsporus and Mycetohabitans spp. (Betaproteobacteria). Initial studies identified Mycetohabitans rhizoxinica (Mrh) as enabling the fungus to cause rice seedling blight, as the bacterium produces the antimitotic toxin rhizoxin needed for pathogenicity ( Partida-Martinez and Hertweck 2005 , 2007). Rm commonly occurs as cosmopolitan mold and is an opportunistic human and plant pathogen with a global distribution. Many Rm isolates have M. rhizoxinica, M. endofungorum (Mef), or unclassified Mycetohabitans spp. (Msp) residing within their hyphae ( Lackner, et al. 2009 ; Dolatabadi, et al. 2016 ; Cabrera-Rangel, et al. 2022 ; Carpenter, et al. 2024 ). While not all Rm isolates harbor Mycetohabitans spp., the ones that do are dependent on their endosymbiont for fungal sporulation and are capable of only vegetive growth when cured ( Partida-Martinez, et al. 2007 ; Mondo, et al. 2017 ). Formerly classified within the genus Burkholderia and considered part of Burkholderia sensu lato, Mycetohabitans spp. have a reduced genome size of about 3 Mbp compared to the 5-8 Mbp observed in free-living Burkholderia , suggesting a specialized symbiosis ( Estrada-De Los Santos, et al. 2018 ). However, both partners can be cultured independently and the bacteria horizontally transferred, creating a tractable study system. Because of their endosymbiotic nature, limited sampling of Mycetohabitans isolates and a lack of complete genome assemblies have been obstacles for comparative studies into the structural organization of the endosymbiotic genome and the genetic diversity within this genus. Yet, the symbiosis between Rm and Mycetohabitans spp. presents an opportunity to investigate the mechanisms and processes enabling genome loss, and consequently the evolution of an obligate endosymbiotic lifestyle at a transitional period. In this study, we present new complete genome assemblies via long-read sequencing and assess the pangenome of a global collection of 28 complete Mycetohabitans genomes. We compare evolutionary dynamics and genome composition of their replicons and investigate the secondary metabolite potential and phage presence within those genomes. Our results show an open pangenome with differential evolutionary stability and conservation across the multipartite genome, revealing the dynamics at play in a facultative-to-obligate transitional endosymbiotic genome. RESULTS Long read, complete genome sequences for Mycetohabitans strains We screened Rhizopus spp. isolates from the Agricultural Research Service Culture Collection (NRRL) for the presence of endohyphal Mycetohabitans strains via PCR. We identified novel strains Mrh B10 and Mrh B203, and confirmed endosymbionts in strains expected to be hosts based on bacterial sequence present in previous short-read fungal genome sequencing data ( Carpenter, et al. 2024 ). Positive cultures were used for extraction of the bacteria, and then genomic DNA preparation for Oxford Nanopore Technologies long-read sequencing. In total, we sequenced and assembled genomes for 20 bacterial strains ( Table 1 , Table S1, Figure S1 ), including Msp B46 which we re-sequenced due to our previous PacBio assembly not resolving into complete replicons ( Carpenter, et al. 2024 ) and the type strain Mrh B1 which was previously available as short-read Illumina assembly ( Lackner, et al. 2011 ). For re-sequenced strains, our new ONT assemblies had average nucleotide identity (ANI) values of greater than 99.97% to their respective previous assemblies, indicating robust base calling ( Jain, et al. 2018 ). View this table: View inline View popup Download powerpoint Table 1. Mycetohabitans spp. genomes sequenced and assembled in this study. The genome sizes range from 3.3 Mbp to 3.8 Mbp ( Figure S2 ), and all genomes were considered complete with BUSCO scores upward of 98.8% and having resolved into circular replicons ( Table 1 ). The genomes all had lower than 0.6% contamination as reported via CheckM ( Parks, et al. 2015 ). The GC content of all Mycetohabitans strains lies at ∼60% ( Table 1 , Table S2 ). All Mycetohabitans genomes have two conserved replicons – a chromosome (∼2.7 Mbp) and a chromid (∼700-900 kbp). A plasmid of ∼100-200 kbp is only found in 12 strains. The copy number of these plasmids within their bacterial hosts is not known, though they are related as they fall within the same MOB-Suite unique cluster, AG595 ( Table S3 ) ( Robertson and Nash 2018 ). For analyses in this study, we considered a pangenomic dataset of 28 total long read Mycetohabitans genomes ( Table S1 ) comprised of these new ONT assemblies and our previous PacBio assemblies ( Carpenter, et al. 2024 ). Mycetohabitans strains have atypical natural boundaries for average nucleotide identity In recent genomic studies of Burkholderia sensu lato, Mycetohabitans strains were underrepresented due to the lack of available genomes ( Mullins and Mahenthiralingam 2021 ; Bach, et al. 2022 ; Bach, et al. 2023 ). We used the Genome Taxonomy Database to phylogenetically analyze a representative set of Burkholderia sensu lato genomes. We also included those from closely-related Mycoavidus and Glomeribacter genera given their niche as endofungal bacteria and used Pandoraea as an outgroup ( Figure 1A ). The genus Candidatus Vallotia made up of bacterial symbionts of adelgids was previously proposed to be consolidated with Mycetohabitans ( Dial, et al. 2022 ; Szabó, et al. 2022 ); Candidatus Vallotia strains are now listed in the Genome Taxonomy Database as Mycetohabitans and were thus included in our phylogenetic analysis. Based on the data in Figure 1 , we have chosen to label them as Candidatus Vallotia and differentiate them from Mycetohabitans , further commented on in the discussion. Download figure Open in new tab Figure 1. Taxonomic placement of Mycetohabitans strains within Burkholderia sensu lato. A . An approximately-maximum-likelihood tree for Mycetohabitans genomes and representatives from closely related genera provided by the Genome Taxonomy Database. Branches that contained a single genus were collapsed and the number of taxa within is displayed in brackets, except for the Mycetohabitans and Ca . Vallotia clades. Branch length indicates substitutions per site. When known, the country of origin is indicated for the host fungus of each Mycetohabitans strain ( Table S1 ). Local support values were computed with the Shimodaira-Hasegawa test and are shown at relevant nodes ( Shimodaira and Hasegawa 1999 ); all support values within Mycetohabitans spp. were >70 and are not shown. B . Average nucleotide identity (ANI) comparisons of the Mycetohabitans genomes to each other and representative strains from Burkholderia sensu lato (accession numbers in Table S4 ). Dotted lines enclose comparisons between the same species of Mycetohabitans . C . Count data for the ANI values in panel B binned by 0.1. A dotted line indicates the natural gap at 94%. The Mycetohabitans genus forms a clade that is further validated by ANI analysis ( Figure 1B ). Inter-genus comparisons within Burkholderia sensu lato fall around 77-80%, a typical boundary for new genera. There is a discontinuity that begins around 83%, the expected beginning of the range for inter-species comparisons, but the intra-genus Mycetohabitans comparisons then span from 90% to >99% ( Figure 1C ). Comparisons between the type strain of Mef (B5) and Mrh strains are 90.7-91.9%, a rare range for ANI values ( Jain, et al. 2018 ; Konstantinidis 2023 ). The orphan strains Msp B46 and Msp B8 share ∼92.5% ANI and ∼91.5% with Mrh and ∼90% and ∼90.5% with Mef, respectively. Mrh strains share >97% ANI, with the exception of B23 and B48 that are only 95.2% ANI with the other Mrh strains. Similarly, the type strain of Mef, B5, shares only 94.2-96.2% ANI with all but one strain (B29; >99% ANI). However, other strains within two Mef subclades share 95.5-96% ANI, such as B13 and B75 sharing 96% ANI, supporting that this is one species, with a potential subspecies structure (commented on further in the discussion). Mycetohabitans genomes show high synteny within replicons across strains To investigate syntenic conservation across Mycetohabitans , we compared Mrh type strain B1 and Mef type strain B5 with the two isolates that did not fall into either named species, Msp B8 and Msp B46. Overall, protein cluster-based synteny between the four strains ranged from 69.9% to 80.8% ( Figure S3 ). We found highly syntenic chromosomes, with somewhat less synteny observed in the chromids ( Figure 2A ). There were syntenic DNA blocks between the chromosome and chromid, most notably the chromid in Msp B8 has some elements syntenic with the Mrh B1 chromosome. In this analysis, Mrh B1 is the only strain that has a 3 rd replicon, the plasmid. The smaller syntenic blocks from the chromosomes or chromids of the other strains with the B1 plasmid include the loci for the ParB/RepB/Spo0J family partition protein (ACOALE_03960) and ParA family protein (ACOALE_03965) ( Table S5 ). Additionally, we wanted to investigate the syntenic relationship between Mycetohabitans plasmids. Compared to that of the conserved replicons (chromosome and chromid), plasmids have lower shared protein sequence collinearity amongst each other, indicating higher diversity ( Figure S4 ). Download figure Open in new tab Figure 2. Genome synteny and content comparisons across the Mycetohabitans genus A . Synteny comparison between replicons from the Mycetohabitans rhizoxinica (Mrh) B1, Mycetohabitans endofungorum (Mef) B5, Mycetohabitans sp. (Msp) B8, and Msp B46 genomes with B1 treated as the reference. Deep red connectors represent chromosome, deep blue chromids, and orange plasmid. B . Anvi’o plot illustrating the Mycetohabitans pangenome, with each ring representing one complete genome. The inner dendrogram shows hierarchical clustering of gene clusters. Core gene clusters (black), accessory gene clusters (deep red) and unique gene clusters (cyan) are marked as the outermost circle and their percentage in the pangenome is summarized in the stacked bar chart, below which is a Heap’s law fit. C . Stacked bar plot showing percent genome masked by transposable elements (TE). Columns are split by TE family. D . Correlation plot between percent of genome masked by TEs and percent of coding DNA sequences (CDS) that are pseudogenized. Pearson coefficient (r) is indicated at the bottom right of the plot. In all panels where relevant, M. rhizoxinica strains are indicated in orange, M. endofungorum in teal, and M . sp. in grey. The Mycetohabitans genus forms an open pangenome To holistically explore the diversity of our 28 Mycetohabitans genomes, we generated an Anvi’o pangenome ( Figure 2B , Table S6 ). 79,578 gene calls were clustered into 4,652 gene clusters which were further categorized as single-copy core genes (SCG), core, accessory and unique. While the SCGs were characterized by the program, core, accessory and singleton GCs were manually curated based on presence of the GC in all 28 genomes, 2 to 27 genomes, or only 1 genome, respectively. There were 1,752 core gene clusters with 52,055 gene calls (37.6%), 2,207 accessory gene clusters with 26,814 gene calls (47.44%) and 693 singleton gene clusters with 707 gene calls (14.89%). The categories cell wall mobility, translation, transcription, mobilome, signal transduction and defense mechanisms have high % gene presence in the Mycetohabitans genome ( Figure S5 ). There is no significant difference in COG percentages between the two species Mef and Mrh, except for the cell division category which was higher in Mef ( Figure S6 ). A Heap’s Law model ( Tettelin, et al. 2008 ) was used to estimate whether the Mycetohabitans pangenome is open or closed. Since the number of new genes increases upon addition of more genomes (as indicated by the α of 0.1), the Mycetohabitans genus forms an open pangenome ( Figure 2B ). Mycetohabitans strains have high pseudogene and transposable element content To investigate the pseudogene and transposable element (TE) content in Mycetohabitans genomes, we used the PGAP annotations for each of the genome, and the publicly available annotations for representative Burkholderia sensu lato endosymbionts listed in Table S4 . We computed the percentage of pseudogenized coding gene sequences (CDS) that are frameshifted, incomplete, or contain internal stop codons ( Tatusova, et al. 2016 ). The total putative pseudogene content ranged from 6.4% in Mrh B47 genome to 9.96% in Mef B13. Strains with the longest plasmids - Mef B14, B75, and B51 – of lengths 201,412, 181,953, and 231,357 respectively have 9.95%, 9.86% and 9.56% of their CDS putatively pseudogenized ( Figure 2D , Figure S7, Table S5 ). However, this pattern of correlation between plasmid length or presence, and pseudogene content is not consistent across Bukholderia sensu lato, as symbionts with other host ranges had pseudogene content ranging from 3.2% to 5.9% ( Figure S7, Table S5 ). Our analysis of TEs found that Mef B75 had the highest percentage (6.36%) of its genome masked by TEs, and Mrh B48 had the least, 1.58% ( Figure 2C , Table S5 ). The highest fraction of TE families in Mycetohabitans were IS5 and IS30. Compared to other symbiotic Burkholderia sensu lato genomes, Mycetohabitans spp. have much greater portions of their genomes masked by TEs as well as a greater number of insertion elements ( Figure S8 ). For example, Robbsia andropogonis had only 1.43% of its genome masked by TEs, lower than the least of Mycetohabitans , with IS4 as the family occupying the highest percent ( Figure 2D ). Candidatus Vallotia strains were found to have one IS21 element on their genome, masking only 0.2% of their genomes ( Figure 2D , Figure S8, Table S5 ). We wanted to check whether there is a correlation between TE and pseudogene content across the Mycetohabitans strains. Mef B75 and B51 both fall at the higher end of TE and pseudogene content, Msp B46, Mrh B47, B48, B49 and B50 all have both – low TE and pseudogene content ( Table S7, Figure 2C ). Interestingly Mef B60 has the second highest TE content of 4.53%, and falls towards the lower end of pseudogene content ( Table S7, Figure S7-8 ). All Mycetohabitans genomes have a secondary core replicon Though originally described as a megaplasmid in the Mrh B1 reference genome announcement, the presence of the secondary replicon and its conservation across Mycetohabitans strains supports a more stable role as a chromid ( Harrison, et al. 2010 ; Lackner, et al. 2011 ). To assess the characteristics of the chromid and structural makeup of the pangenome, we created single replicon “pangenome” comparisons ( Eren, et al. 2020 ). Anvi’o identified 3,500 and 1,335 gene clusters in the chromosomes and chromids, respectively ( Figure 3A-B ). The hierarchical clustering based on gene cluster frequencies within the two replicons group the strains similarly, with the exception that Msp B8 changes positions significantly by clustering with Mrh chromosomes, but Mef chromids. However, upon comparing the replication initiation protein-based phylogeny between the two, there are no significant signs of horizontal transfer of the chromids, indicating the observed change in clustering is likely due to a lack of genomes similar to B8 ( Figure S9 ). The chromosome has a higher fraction of core gene clusters compared to the chromids which are conversely more enriched in accessory gene content ( Figure 3A-B ). Additionally, the chromids lack the chromosome replication initiator protein DnaA, and instead have a separate replication initiation protein and partitioning-related proteins similar to that of the Mycetohabitans plasmids, i.e. the ParA/B family proteins ( Table S6 ). We used the tool Infernal to find the presence and location of rRNA or tRNA loci on the chromids but only found the presence of catalytic introns, riboswitches and C4 antisense RNAs. However, chromids do have some critical genes including the 30S ribosomal protein S21. Download figure Open in new tab Figure 3. Comparisons between replicons i.e. chromosome, chromid and plasmid across Mycetohabitans . Anvi’o plots to compare A .chromosomes and B . chromids across the strains. Each ring represents one Mycetohabitans strain’s relevant replicon and the inner dendrogram shows hierarchical clustering of gene clusters. Core gene clusters (black), accessory gene clusters (deep red) and unique gene clusters (cyan) are marked as the outermost circle and their percentage in the pangenome is summarized in the stacked bar chart. C . dN/dS value distribution for non-identical single-copy core genes in chromosomes and chromids D . Guanine-cytosine (%GC) content of each replicon is shown as a percentage with individual data points colored by species. P-value notations determined by T-test are indicated on the plot as asterisks. In all panels where relevant, M. rhizoxinica strains are indicated in orange, M. endofungorum in teal, and M . sp. in grey. As the differential amount of gene cluster conservation suggests differential rates of evolution, we estimated the accumulation of non-synonymous (dN) to synonymous (dS) mutations in these replicons ( Kryazhimskiy and Plotkin 2008 ). We calculated the dN/dS values for single-copy core genes in all Mycetohabitans strains that had non-identical sequences to B1, and plotted all those data points for each of the two replicons ( Figure 3C ). While greater dN/dS ratio indicates diversifying selection or adaptive evolution, a lower value would support higher selective or purifying forces acting on the replicon. The dN/dS ratio of chromid genes distributes similarly to that of the chromosome, supporting the description as a chromid and not a megaplasmid ( Harrison, et al. 2010 ). We further explored this distinction by comparing the guanine-cytosine content (%GC) between chromids and chromosomes of the same strain. The %GC of the chromid is on average 1.65% lower than that of the chromosome (difference ranging from 0.9%-2.7%), and %GC of the plasmid is on average 4.43% lower than that of the chromosome, ranging from 2.83%-6.05% ( Figure 3D ; Table S2 ). Though the standard chromid definition requires the %GC of a chromid be within 1% of a chromosome, the Mycetohabitans chromid %GC are more conserved and much closer to that of the chromosomes versus the inconsistent third replicon ( Harrison, et al. 2010 ). In conclusion, we have termed the secondary replicon as a chromid due to (1) being the second largest replicon, (2) having chromosome-like nucleotide composition, (3) having plasmid-like replication systems, (4) having evolutionary rate similar to that of the chromosome, and (5) containing essential genes such as cell wall mobility, signal transduction and transcription ( Figure S5 ). Mycetohabitans plasmids are dynamic accessory gene hubs that are potentially lost or transferred We used MOB Suite to characterize the plasmids found in Mycetohabitans strains, and predict their mobility and host range ( Robertson and Nash 2018 ). Overall, the predicted replicon type of the plasmid is not known. All but Mrh B23 plasmid have a relaxase belonging to MOBF family. Mrh B1 has an additional MOBP type relaxase, which may be why is has a putatively larger predicted host range of Pseudomonata. The predicted host range for the rest of the plasmids is within order Burkholderiales, with the exception of Mrh B23 which could not be predicted; the plasmids found in all strains except Mrh B23 are predicted to have conjugative mobility with a mating pair formation (MPF) type F. Mrh B23 having the shortest plasmid, and lacking a putative relaxases and mobilization mechanisms, suggests that it may be an artifactual remnant as a result of genome loss in this endosymbiont ( Table S3 ). A similar comparative analysis of the 12 Mycetohabitans plasmids using Anvi’o identified 362 gene clusters: 8 core, 218 accessory, and 136 unique ( Figure 4A ). The largest plasmid, Mef B51, has the highest number of genes and unique gene clusters. Out of the eight core gene clusters, only four are classified as single-copy core genes (SCGs) ( Parks, et al. 2018 ), emphasizing the highly accessory nature of plasmid genes. Two of these SCGs are components of Type II toxin/antitoxin system – RelE/ParE family toxin, and RelB family antitoxin, with another being unannotated and the final being Replication Protein O. We binned plasmid gene clusters into mobilome-related components and found 45 gene clusters related to transposases, 55 related to toxin-antitoxin system, 20 related to conjugation machinery/Type IV Secretion System, and 2 related to bacteriophage genome fragments ( Figure 4A ). Conjugation-related proteins are a conserved feature of all Mycetohabitans plasmids except for Mrh B23; only one gene cluster related to conjugation was found in the plasmid of Mrh B23, the pilus assembly gene, hicB , that can also be found in B55. Download figure Open in new tab Figure 4. Analysis of the inconsistently present third replicon across Mycetohabitans strains. A . Anvi’o plot of Mycetohabitans plasmids indicated as individual rings, with toxin/antitoxin system, btl type III effector gene, and mobilome-related gene clusters annotated on the outermost circle colored according the panel key. Average nucleotide identity (ANI) of the plasmids is depicted as a heat map. Bar plots show the total lengths and number of gene clusters (unique and overall) for each plasmid sequence. The inner dendrogram shows hierarchical clustering of gene clusters. B . Co-phylogeny comparing topology of dnaA relationship across chromosomes (left) to parA relationship across plasmids (right) inferred by Maximum Likelihood with MEGAX. Dots at inner nodes of trees represent bootstrap values as a fraction of 1000 bootstraps. In all panels where relevant, M. rhizoxinica strains are indicated in orange, M. endofungorum in teal, and M . sp. in black. One of the accessory gene clusters on the plasmid including strains Mrh B12, Mef B14, Mrh B1, Mrh B2, Mrh B514, Mef B51, Mef B53, Mrh B58, and Mef B75 contains btl genes which are known type III secretion system effector proteins that vary in number, sequence, and genomic location between strains ( Carter, et al. 2020 ; Carpenter, et al. 2024 ). Overall, the btl genes are found across all three replicons and vary in number of copies for different strains, consistent with previous findings ( Carpenter, et al. 2024 ). As no other effector proteins are validated, we did not further explore the diversity or genomic location of type III effectors. To check the conservation of plasmids within bacterial lineages and assess the possibility of horizontal exchange, we created phylogenetic trees based on core replication genes: the parA gene found on plasmid and the dnaA gene on the chromosome ( Figure 4B ). Within Mef, plasmid presence and relatedness mirrors the chromosome topology and is monophyletic. Yet, plasmid loss likely occurred in strains such as Mef B13 and B3 which cluster with plasmid-containing strains despite lacking plasmids themselves. However, within Mrh, there is more discord, as which strains do or do not have a plasmid is not as clearly clustered. Mrh B1 stands out with the most divergent plasmid from other Mrh strains, contrasting with the strain’s overall close relatedness with Mrh B12 ( Figures 1 - 2 ). That Mrh B12 and B1 have such distinct plasmids suggests plasmid horizontal transfer has occurred within the Mrh lineage, a hypothesis that is further supported by B23 and B58 having similar plasmids despite their overall divergence ( Figure 4B ). Mycetohabitans spp. are enriched in diverse biosynthetic gene clusters, with many associated with nonribosomal peptides From previous studies, it is known that Mycetohabitans spp. have a high percentage of their genome devoted to biosynthetic gene clusters (BGCs) compared to other species in Burkholderia sensu lato ( Mullins and Mahenthiralingam 2021 ). We identified a total of 373 unique biosynthetic gene clusters (BGCs) across the 28 Mycetohabitans strains using antiSMASH ( Figure S10 ) ( Blin, et al. 2023 ). On average, there are 13.3 BGCs per strain and no significant difference in the number of BGCs per species (anova, p<0.05). All strains were predicted to have BGC clusters for a terpene, a terpene/phosphonate, ribosomally synthesized lassopeptides, and numerous distinct nonribosomally synthesized peptides (NRPs) ( Figure 5A ). The majority of BGCs were found in chromosomes and chromids, with only two clusters predicted in plasmids: NRP group 29 in Mef B51 and NRP group 27 in Mef B75 ( Figure 5B ; Table S8 ). The classic rhizoxin cluster that led to the discovery of this genus was putatively found in all strains except Mrh B82 ( Partida-Martinez and Hertweck 2005 , 2007). B8 was the only strain predicted to have a hybrid polyketide synthase (PKS) and NRPS cluster other than rhizoxin, which produces necroxime ( Niehs, et al. 2020 ). The conservation of predicted ribosomally synthesized lassopeptide BGCs align with previous findings on a smaller set of genomes showing loci with homology to those from type strain B1 that produce burhizin-23, mycetohabin-16, and mycetohabin-15, though their ecological role remains unknown ( Bratovanov, et al. 2020 ). Download figure Open in new tab Figure 5. Prediction of biosynthetic gene clusters (BGCs) in Mycetohabitans genomes. A . Fractions of the types of BGC found in Mycetohabitans strains, grouped by species and colored by cluster type. B . Similarity of BGCs across Mycetohabitans strains and the replicons they are found in. Dots are annotated by shape and color to communicate genome region found in as well as similarity metrics. All underlying data and additional information like genomic location is in Table S8 . NRP; nonribosomal peptide. Download figure Open in new tab Figure 6. Predicted prophage regions in the Mycetohabitans spp. genomes. A . Simplified chromosome map for each strain showing the location of putative prophages indicated based on their quality score by CheckV. B . Average nucleotide identity (ANI) of all high-quality prophages identified across the 28 genomes, each indicated by the strain name and an identifying number. In all panels, M. rhizoxinica strains are indicated in orange, M. endofungorum in teal, and M . sp. in black. We used Clinker ( Gilchrist and Chooi 2021 ) to further group the secondary metabolite clusters beyond the initial predictions by antiSMASH, based on similarity in core biosynthetic genes and surrounding regulatory, additional biosynthetic, and transport genes. Not all NRP clusters grouped by Clinker are equally similar and clusters within a group possibly encode for different secondary metabolites. In total, there were 26 similar groups, with NRP Groups 8, 18, 28, 30, and 31 being unique/singleton BGCs. However, some BGCs are represented twice within Figure 5B if they were predicted to have genes for both an NRPS and another secondary metabolite product, such as phenazine. Although NRP Group 1 clusters are found across all strains, this cluster has some variety in structure with some BGCs having additional biosynthetic genes, suggesting further study is needed to assess expression and metabolite variation ( Figure S11 ). NRP Group 11 clusters, found mostly in Mrh strains, have an NRPS with similarity greater than 90% to the habA gene ( Niehs, et al. 2022 ). NRP Group 10 clusters are found across most strains and have core NRPS genes that are between 96-100% similar to the NRPS in the previously characterized rhizomide cluster ( Wang, et al. 2018 ). NRP Group 9 is highly conserved and was found in all Mrh strains as well as B23 and B46. Since it does not have similarity to the NRPSs of endopyrrole A cluster nor rhizomide ( Figure S12 ), this may be encoding a novel NRP of interest. Most Mycetohabitans spp. genomes have putative intact prophage We surveyed each genome for CRISPR-Cas systems that may serve as antiphage defenses and found no cas operons in any strain. A subset of the strains had low-confidence, single spacer CRISPR arrays, but these had no repeat similarity between them and likely represent false positives. We thus hypothesized that the genomes may contain intact prophage. Across the set of Mycetohabitans spp. genomes, all were predicted to have viral sequences on their chromosomes ( Figure 5A ), but not on the chromid or plasmids, with an average per strain of 1.3 high-quality prophages. Sixty prophage sequences were found, 36 of which were designated as high quality (predicted to be >90% complete). Seven genomes did not have any high-quality prophages: Msp B8, Mrh B82, Mrh B55, Mrh B48, Mef B5, Mef B60, and Mef B29. We ran ANI analysis to briefly assess the relationship of the high-quality prophages ( Figure 5B ). The predicted phages clustered in two distinct groups, except phage B34-2 which fell outside of both groups. Overall, Mrh tends to have a greater quantity of predicted higher quality phages, and Mef has a few strains with just viral genome fragments. Due to the novel nature of these phages, functional annotations within the prophage genes are mostly limited to standard structural components such as head proteins, tail, baseplate, etc. However, some of the genomes in the smaller of the two ANI clusters (upper right) have putative toxin/antitoxin genes and some on the middle group within the larger cluster has NtrX-like response regulators, suggesting possible functional outcomes from phage presence. DISCUSSION With this study, we aimed to uncover the genome dynamics during the transition of an endosymbiotic bacterium from facultative to obligate, using the endofungal Mycetohabitans genus as a model. By sequencing genomes with high quality, long-read Oxford Nanopore Technology sequencing we were able to dramatically increase the genomic resources available for this genus and conduct a more structurally focused assessment. Although Mycetohabitans are known to have low unique gene content compared to Burkholderia sensu lato, we still see an open pangenome with accumulation of non-essential and/or pseudogenes, a phenomenon typically observed in genomes of recently host-restricted endosymbionts ( McCutcheon and Moran 2012 ; Hendry, et al. 2018 ; Lind, et al. 2018 ; Bach, et al. 2022 ; Dewar, et al. 2024 ; Grujcic, et al. 2025 ). Added to this, the common trait of BGC enrichment resembles genome expansion of genes relevant to the role within a host, as demonstrated by insect symbiotic Arsenophonus spp. ( Siozios, et al. 2024 ). In many symbionts, seemingly non-core genes contributing to host functionality are conserved despite genome loss ( Carlier, et al. 2016 ). Overall, our pangenomic data for Mycetohabitans supports a hypothesis of expansion of transposable elements and BGCs, in the midst of genome reduction occurring, and likely the loss of the third replicon, though without as dramatic an expansion of pseudogenes and TEs as have been observed in other endosymbionts. Species boundaries within endosymbiotic genera are not well delineated, generally, and require more pangenomic studies and functional studies to assess diversity and grapple with how to define species. For example, the highly studied Wolbachia genus is divided into various monophyletic “supergroups” with genomes that have ∼93% or higher identity within them and appear to have undergone host switching across insect species ( Wang, et al. 2020 ; Mahmood, et al. 2023 ; Vancaester and Blaxter 2023 ). In contrast, many other endobacteria from single host species have high ANI values of >99% across genomes, such as those from the scaly-foot snail ( Chrysomallon squamiferum ) and the deep-sea mussel ( Gigantidas platifrons ) ( Lan, et al. 2022 ; Sun, et al. 2023 ). Our investigation of ANI across the Mycetohabitans genomes revealed high intragenus identity with less clear species boundaries. As two species have been named for the Mycetohabitans genus, we propose conserving these species designations and setting the ANI thresholds for Mycetohabitans spp. at 94% to indicate species based on the observed areas of discreteness ( Konstantinidis 2023 ). Though bacterial species are a complex concept, the assignment of this species boundary also aligns with the finding that homologous recombination efficiency decreases dramatically by 90% nucleotide identity (Power et al., 2021; Konstantinidis, 2023 ); though, genetic exchange within this genus has not been explicitly investigated. Within the historical context of continued efforts to appropriately taxonomically classify members of the diverse Burkholderia genus, we find that our data supports Vallotia remaining its own genus, in contrast to the proposal to combine it with Mycetohabitans ( Szabó, et al. 2021 ). Our analysis of Burkholderia sensu lato with all available Mycetohabitans and formerly Candidatus Vallotia genomes clearly shows that the two genera form distinct clades and have ANI separation ( Figure 1 ). This conclusion is further supported by the significant genome reduction in Vallotia compared to Mycetohabitans and complete difference in niche, as all sequences assigned to Vallotia are from adelgids (Insecta: Hemiptera: Adelgidae), while all Mycetohabitans strains are fungal-associated. That these two genera are both endosymbionts that have undergone clear specialization for their unique hosts serves as an interesting natural, evolution experiment and thus could be compared for insights into signatures of endosymbiosis. Further analyses incorporating Mycoavidus and Glomeribacter , or other Burkholderia-related endosymbionts would yield more insights as well ( Uehling, et al. 2017 ; Amses, et al. 2023 ). Like many other Burkholderia species, Mycetohabitans has a multi-partite genome ( diCenzo and Finan 2017 ; Bach, et al. 2022 ). Small syntenic blocks between the Mrh B1 plasmid with chromosomes and chromids of other genomes ( Figure 2A ) suggests potential recombination events between the chromosome, chromid, and plasmid, especially as the plasmid has been lost from some strains. The plasmids, being enriched in transposases ( Figure 4A ), may be functioning as a recombination hotspot, mediating gene loss ( Hendry, et al. 2018 ). Alternatively, we hypothesize that the Type II toxin and antitoxins conserved across all Mycetohabitans plasmids may be the reason why the plasmids are maintained by Mycetohabitans spp. This could be validated by knocking out this toxin-antitoxin system and testing whether the microbe retains the plasmid. We are considering the secondary replicon that is conserved across genomes to be a chromid, as defined in Harrison, et al. (2010) . Though some guidance suggests that %GC variation between chromosomes and chromids should be less than 1% ( diCenzo and Finan 2017 ), we observed a much higher differences between the plasmid and the chromosome (on average 4.43%) to the difference between the chromid and chromosome (on average 1.65%). Ultimately, the Mycetohabitans chromid has chromosome-like evolutionary dynamics including low diversifying evolution rate and a similar %GC content ( Figure 3C-D , Table S2 ), as well as conservation of genes involved in core metabolism like transcription and signal transduction ( Figure S6 ). Conversely, it shows plasmid-like gene content including toxin-antitoxin maintenance system, partitioning system, mobilome, and relatively high accessory gene content compared to the chromosome ( Figure 3A-B , Figure S6 ). Despite having numerous transposable elements and putative prophage, Mycetohabitans spp. genomes did not have any CRISPR-Cas systems, which are implicated in controlling deleterious mobile genetic elements ( Westra and Levin 2020 ). Yet, this aligns broadly with Burkholderia sensu lato, as most members have orphan CRISPR arrays with no cas operons, or no arrays at all, though we did not survey for non-CRISPR/Cas antiphage defenses ( Seo, et al. 2015 ; Pratama, et al. 2018 ). The extensive presence of toxin-antitoxin systems on the plasmids enabling their maintenance, combined with the lack of CRISPR-Cas systems may be allowing the bacteria to carry out sustained mobilization-mediated gene loss via pseudogenization ( Vigil-Stenman, et al. 2015 ; Siozios, et al. 2024 ). We found that Mycetohabitans strains do have higher TE and pseudogene content compared to other symbiotic Burkholderia sensu lato. However, how many transposons are actually functional is also to be questioned ( Cordaux 2009 ), and conclusions about pseudogenization would require further studies with data assessing transcriptional activity ( Goodhead, et al. 2020 ). The presence of mobile genetic elements also supports horizontal gene transfer, such as type III effector acquisition and/or functionalization towards symbiosis maintenance ( Dale, et al. 2001 ; Carter, et al. 2020 ; Carpenter, et al. 2024 ; Siozios, et al. 2024 ). This repertoire of Mycetohabitans genomes is derived from Rm isolates sampled from across the world, and the isolates corresponding to this genomic resource are accessible through public culture collections. The majority of the samples are from United States and Southeastern Asia, which represents a strength in covering diversity from these areas but a potential gap in other regions. The orphan strains Msp B8 and B46 are the only samples from Australia and South America, respectively, which may underlie their lack of identity with the named species and supports continued sampling and sequencing to capture missing diversity. Especially given that Msp B8 is the only strain predicted to produce necroximes through a BGC, though other endosymbionts in other genera do, supporting the hypothesis of undiscovered diversity on continents in the global south ( Niehs, et al. 2020 ; Büttner, et al. 2021 ). Additionally, we do not well understand the diversity represented within Rhizopus host fungi of Mycetohabitans , or the rate of horizontal transmission of symbionts. Connecting the bacterial genomic data presented here with improved fungal genomic resources and phylogenetics is a natural next step towards understanding how Mycetohabitans genetic diversity and speciation has been impacted by host organisms. METHODS Screening Rhizopus strains for presence of Mycetohabitans Genomic DNA was extracted from Rhizopus spp. grown on Potato Dextrose Agar (PDA) overnight at 28°C using the Quick-DNA Fungal/Bacterial Miniprep Kit (Zymo). PCR using primer sets for bacterial 16S rDNA gene (27F: 5’ AGAGTTTGATCTGGCTCAG 3’; 1492R: 5’ GGTTACCTTGTTACGACTT 3’) was done to confirm bacterial presence ( Heuer, et al. 1997 ). Fungal ITS sequence was amplified as a positive control for gDNA quality using the primers ITS86F (5’ GTGAATCATCGAATCTTTGAA 3’) and ITS4 (5’ TCCTCCGCTTATTGATATGC 3’) ( Turenne, et al. 1999 ). Standard buffer and protocol for OneTaq 2X Master Mix (New England Biolabs) was used with 30 cycles. Products were visualized using agarose gel electrophoresis. DNA extraction Rhizopus spp. were grown on PDA at 28°C until non-sporulating fungal mycelia was visible (2 days). Bacterial extractions were carried out by disrupting hyphal tissue suspended in 10 mM MgCl 2 using a bead beater, micropestle, or vortex. Bacteria were separated from fungal hyphae by syringe filtration through 2-2.7 µm filters and plated on King’s medium B or lysogeny broth amended with 1% glycerol, each prepared with 1% agar and 100 µg/mL cycloheximide. After incubation at 28°C until colonies were visible, Mycetohabitans spp. colonies were inoculated in LB with 1% glycerol or KB broth at 28°C for 3 days. DNA extractions were done using the Wizard® Genomic DNA Purification Kit (Promega) following the protocol for gram-negative bacteria, from turbid bacterial cultures. Genome sequencing and assembly The quantity of genomic DNA was assessed using a QubitFlex and sequenced by Plasmidsaurus Inc. using Oxford Nanopore Technology. Library preparation was carried out using v14 library prep chemistry with minimal fragmentation and the libraries were sequenced using Oxford Nanopore Technologies R10.4.1 PromethION flow cells. Assembly was also carried out by Plasmidsaurus using Filtlong v0.2 (github: rrwick/Filtlong) for eliminating low quality reads and downsampling when necessary, Miniasm v0.3 ( Li 2016 ) and Flye v2.9.1( Kolmogorov, et al. 2019 ) for assembly generation, and Medaka v1.8.0. (github: nanoporetech/medaka) for polishing. The circular assemblies of chromosomes and plasmids were rotated to dnaA and repO respectively using dnaapler ( Altschul, et al. 1990 ; Bouras, et al. 2024 ) and were submitted to NCBI under the BioProject PRJNA1167355, and annotated by PGAP ( Tatusova, et al. 2016 ). Since the initial assembly of Mrh B62 was not circularized, the identical assembly pipeline was followed with lower stringency of downsampling to obtain a circular genome. The Mycetohabitans genome assemblies were analyzed for completeness and quality using BUSCO with specifying the lineage as burkholderiales_odb10, and CheckM (v1.2.2) ( Parks, et al. 2015 ; Simão, et al. 2015 ). Phylogenetic and Average Nucleotide Identity Analysis To compare Mycetohabitans genomes to Burkholderia sensu lato and related genera of interest, the GTDB-Tk v2.4.0 de_novo_wf command was run with default options and with taxa filters for Mycetohabitans, Burkholderia, Paraburkholderia, Caballeronia, Trinickia, Pararobbsia, Robbsia, Mycoavidus, Glomeribacter, Pandoraea, and Chitinasiproducens ( Chaumeil, et al. 2022 ). Pandoraea was specified as the outgroup. This pipeline pulls from the current GTDB taxonomy and uses the WAG+GAMMA model within FastTree to calculate trees. In total, 383 sequences were aligned using 120 markers based on the 27 Mycetohabitans genomes; our B1 assembly was excluded, as the previous assembly for B1 is the reference genome. For average nucleotide identity analysis, representative genomes of each genus in Burkholderia sensu lato were retrieved from NCBI ( Table S4 ). Together with the Mycetohabitans genomes, they were analyzed with FastANI ( Jain, et al. 2018 ). For phylogenetic comparisons of chromosomes, chromids, and plasmids, replication intiation sequences were extracted from each replicon. For the chromid and chromosome, the sequences from B1 were submitted to blastn, excluding the genus Mycetohabitans , and the top hit was added to the analysis for an outgroup. For the plasmids, parA was used. Sequences were aligned with MUSCLE within MEGAX ( Kumar, et al. 2018 ). Evolutionary history for each group was inferred with the Maximum Likelihood method and Tamura-Nei model, with default parameters and 1000 bootstraps using MEGAX. Final figures for all phylogenetic and ANI analyses were visualized and polished using FigTree v1.4.4, RStudio with key package ggtree v3.6.2 ( Yu, et al. 2017 ), and Adobe Illustrator. Pangenome creation, synteny, and plasmid typing Generation and visualization of the pangenome for 28 Mycetohabitans strains was done using Anvi’o v8 ( Eren, et al. 2020 ), according to the workflow used by Delmont & Eren ( Delmont and Eren 2018 ). anvi-script-process-genbank was used to split GenBank files into FASTAs, external gene calls and functions. For each Mycetohabitans genome, contig databases were developed by running anvi-gen-contigs-database – which uses Prodigal ( Hyatt, et al. 2010 ) – on the FASTA files, with the flag –exernal-gene-calls specifying “NCBI_PGAP” as the gene caller. anvi-import-functions was used to annotate the contigs databases with the corresponding functions file. Further, anvi-run-kegg-kofam was run to further annotate the contig databases with KEGG metabolic pathways. The contig databases were linked using anvi-script-gen-genomes-file and made into a unified genomes database using anvi-gen-genomes-storage . Pangenome creation and visualization was done using anvi-pan-genome , and anvi-display-pan respectively, followed by anvi-compute-genome-similarity for FastANI ( Jain, et al. 2018 ). The pangenome was manually binned into Core, Accessory and Unique gene clusters on the anvi-interactive platform based on the number of genomes each gene occurs in. Core gene clusters were found in a minimum of 28 genomes, accessory in anywhere between 2-28 genomes, and unique in a maximum of one. Identical workflows were used for creating replicon-specific comparisons after splitting the NCBI_PGAP-annotated genbanks into the three contigs using in-house scripts (github: cartercharlotte/Mycetohabitans-pangenome). Infernal version 1.1.5 was ran to investigate presence and location of various RNAs such as tRNA and rRNA in the chromid ( Nawrocki and Eddy 2013 ). GenBank files belonging to Mrh B1, Msp B8, Mef B5, and Msp B46 genomes were used to infer synteny using syny ( Julian and Pombert 2024 ). E-value threshold was set to 1e-10 for the synteny analyses. MOB Suite program MOB Typer was used for characterizing plasmid types ( Robertson and Nash 2018 ). Heap’s law analysis A gene presence absence matrix was generated from the computed pangenome using the command anvi-script-gen-function-matrix-across-genomes with specifying “NCBI_PGAP” as the –annotation-source and –gene-caller . R scripts were used to compute rarefaction curve for the data stored in matrix using the package vegan (github: vegandevs/vegan). Transposable Element and Pseudogene analysis ISEScan was used to infer TE stats on the whole genome FASTA files and the Burkholderia sensu lato genomes listed in Table S1 ( Xie and Tang 2017 ). The.sum output files were then used to plot the percent genome occupied by TEs using R. Pseudogenes predicted during PGAP annotation were collated from the genbank files into a dataframe, and visualized with R ( Tatusova, et al. 2016 ). Pearson correlation was performed on the TE and pseudogene percentages to determine whether there is a linear relationship between the two. dN/dS analysis FASTA files containing DNA sequences of single-copy core genes (SCG) ( Chaumeil, et al. 2022 ) were pulled from the chromosome and chromid genome comparisons using the command anvi-get-sequences-for-gene-clusters using the arguments --report-DNA-sequences and - -split-output-per-gene-cluster . These were then aligned using ClustalW ( Thompson, et al. 1994 ). R package Ape ( Paradis, et al. 2004 ) was used to calculate dN/dS values for each gene in each replicon, using the sequence of each gene in B1 as reference to compare with that gene sequence in the rest of the genomes. Files having non-identical gene sequences were used in these analyses, and the files that didn’t have unique sequences were excluded. antiSMASH and Clinker Assembled genome FASTA files for all strains were submitted to the antiSMASH v7 bacterial version software ( Blin, et al. 2023 ). Strictness level of “relaxed” was selected to identify both well-defined clusters containing all required parts as well as partial clusters missing one or more functional parts. All additional features of antiSMASH were run including KnownClusterBlast, MIBiG cluster comparison, Cluster Pfam analysis, TFBS analysis, ClusterBlast, ActiveSiteFinder, SubClusterBlast, RREFinder, Pfam-based GO term annotation, and TIGRFam analysis. Subsequent results were analyzed based on the cluster type predicted, organization of genes within the cluster, and the most similar known cluster. Genbank files from each cluster predicted by antiSMASH were submitted to clinker ( Gilchrist and Chooi 2021 ) through the command line with the identity threshold between genes being the default 30%. Clinker then performed global alignments between sequences in each cluster, produced a cluster similarity matrix, created optimal ordering by hierarchical clustering, and then output visualizations using clustermap.js. The visualizations were then manually sorted through to identify clusters where the core biosynthetic genes showed similarity as well as the non-core biosynthetic genes in the cluster such as secondary biosynthetic genes, transport, and regulatory genes. Bacteriophage and CRISPR Prediction The computational tool geNomad v1.11.1 ( Camargo, et al. 2024 ) was run on the set of Mycetohabitans spp. genomes to identify prophage. Predicted phage were quality assessed with CheckV version 1.01.01 ( Nayfach, et al. 2021 ) to estimate completeness. Average nucleotide identity analysis was run with FastANI v1.34 ( Jain, et al. 2018 ). CRISPRCasFinder was run on each genome to detect Cas proteins and CRISPR arrays using the general clustering model ( Couvin, et al. 2018 ). DATA AVAILABILITY All genomes assembled in this work are available at NCBI and raw sequencing reads at SRA under the BioProject ID PRJNA1167355; individual nucleotide accessions are indicated in Table 1 . All scripts and code used are available at github.com/cartercharlotte/Mycetohabitans-pangenome. Accession information for genomic data not generated in this study, but used for analyses, is listed in Tables S1 and S2. ACKNOWLEDGEMENTS This work was supported by start-up funding from UNC Charlotte to MEC. The authors thank the UNC Charlotte EVOLVE group, Md Moinuddin Sheam (UNC Charlotte), and David Baltrus (University of Arizona) for critical discussion of data analysis, the USDA ARS NRRL for providing fungal isolates, and the UNC Charlotte University Research Computing group for computational resources. Funder Information Declared University of North Carolina at Charlotte, https://ror.org/04dawnj30 Footnotes We have included additional analyses on transposable elements and pseudogenes, as well as clarification around the chromid and phylogenetics. References ↵ Altschul SF , Gish W , Miller W , Myers EW , Lipman DJ . 1990 . Basic local alignment search tool . J Mol Biol 215 : 403 – 410 . OpenUrl CrossRef PubMed Web of Science ↵ Amses K , Desiró A , Bryson A , Grigoriev I , Mondo S , Lipzen A , LaButti K , Riley R , Singan V , Salazar-Hamm P , et al. 2023 . Convergent reductive evolution and host adaptation in Mycoavidus bacterial endosymbionts of Mortierellaceae fungi . Fungal Genetics and Biology 169 : 103838 . OpenUrl CrossRef PubMed ↵ Bach E , Sant’Anna FH , Seger G , Passaglia LMP . 2022 . Pangenome inventory of Burkholderia sensu lato, Burkholderia sensu stricto, and the Burkholderia cepacia complex reveals the uniqueness of Burkholderia catarinensis . Genomics 114 : 398 – 408 . OpenUrl CrossRef PubMed ↵ Bach E , Volpiano CG , Sant’Anna FH , Passaglia LMP . 2023 . Genome-based taxonomy of Burkholderia sensu lato: Distinguishing closely related species . Genet Mol Biol 46 : e20230122 . OpenUrl CrossRef PubMed ↵ Blin K , Shaw S , Augustijn HE , Reitz ZL , Biermann F , Alanjary M , Fetter A , Terlouw BR , Metcalf WW , Helfrich EJN , et al. 2023 . antiSMASH 7.0: new and improved predictions for detection, regulation, chemical structures and visualisation . Nucleic Acids Research 51 : W46 – W50 . OpenUrl CrossRef PubMed ↵ Bouras G , Grigson SR , Papudeshi B , Mallawaarachchi V , Roach MJ . 2024 . Dnaapler: A tool to reorient circular microbial genomes . Journal of Open Source Software 9 : 5968 . OpenUrl ↵ Boyd BM , James I , Johnson KP , Weiss RB , Bush SE , Clayton DH , Dale C. 2024 . Stochasticity, determinism, and contingency shape genome evolution of endosymbiotic bacteria . Nature Communications 15 : 4571 . OpenUrl PubMed ↵ Bratovanov EV , Ishida K , Heinze B , Pidot SJ , Stinear TP , Hegemann JD , Marahiel MA , Hertweck C. 2020 . Genome Mining and Heterologous Expression Reveal Two Distinct Families of Lasso Peptides Highly Conserved in Endofungal Bacteria . ACS Chem Biol 15 : 1169 – 1176 . OpenUrl CrossRef PubMed ↵ Büttner H , Niehs SP , Vandelannoote K , Cseresnyés Z , Dose B , Richter I , Gerst R , Figge MT , Stinear TP , Pidot SJ , et al. 2021 . Bacterial endosymbionts protect beneficial soil fungus from nematode attack . Proceedings of the National Academy of Sciences 118 : e2110669118 . OpenUrl Abstract / FREE Full Text ↵ Cabrera-Rangel JF , Mendoza-Servín JV , Córdova-López G , Alcalde-Vázquez R , García-Estrada RS , Winkler R , Partida-Martínez LP . 2022 . Symbiotic and toxinogenic Rhizopus spp . isolated from soils of different papaya producing regions in Mexico. Frontiers in Fungal Biology 3 . ↵ Camargo AP , Roux S , Schulz F , Babinski M , Xu Y , Hu B , Chain PSG , Nayfach S , Kyrpides NC . 2024 . Identification of mobile genetic elements with geNomad . Nature Biotechnology 42 : 1303 – 1312 . OpenUrl CrossRef PubMed ↵ Carlier A , Fehr L , Pinto-Carbó M , Schäberle T , Reher R , Dessein S , König G , Eberl L. 2016 . The genome analysis of Candidatus Burkholderia crenata reveals that secondary metabolism may be a key function of the Ardisia crenata leaf nodule symbiosis . Environmental Microbiology 18 : 2507 – 2522 . OpenUrl CrossRef ↵ Carpenter SCD , Bogdanove AJ , Abbot B , Stajich JE , Uehling JK , Lovett B , Kasson MT , Carter ME . 2024 . Prevalence and diversity of TAL effector-like proteins in fungal endosymbiotic Mycetohabitans spp . Microbial Genomics 10 . ↵ Carter ME , Carpenter SCD , Dubrow ZE , Sabol MR , Rinaldi FC , Lastovetsky OA , Mondo SJ , Pawlowska TE , Bogdanove AJ . 2020 . A TAL effector-like protein of an endofungal bacterium increases the stress tolerance and alters the transcriptome of the host . Proceedings of the National Academy of Sciences 117 : 17122 – 17129 . OpenUrl Abstract / FREE Full Text ↵ Chaumeil P-A , Mussig AJ , Hugenholtz P , Parks DH . 2022 . GTDB-Tk v2: memory friendly classification with the genome taxonomy database . Bioinformatics 38 : 5315 – 5316 . OpenUrl CrossRef PubMed ↵ Cordaux R. 2009 . Gene Conversion Maintains Nonfunctional Transposable Elements in an Obligate Mutualistic Endosymbiont . Molecular Biology and Evolution 26 : 1679 – 1682 . OpenUrl CrossRef PubMed ↵ Couvin D , Bernheim A , Toffano-Nioche C , Touchon M , Michalik J , Néron B , Rocha EPC , Vergnaud G , Gautheret D , Pourcel C. 2018 . CRISPRCasFinder, an update of CRISRFinder, includes a portable version, enhanced performance and integrates search for Cas proteins . Nucleic Acids Research 46 : W246 – W251 . OpenUrl CrossRef PubMed ↵ Dale C , Young SA , Haydon DT , Welburn SC . 2001 . The insect endosymbiont Sodalis glossinidius utilizes a type III secretion system for cell invasion . Proceedings of the National Academy of Sciences 98 : 1883 – 1888 . OpenUrl Abstract / FREE Full Text ↵ Delmont TO , Eren AM . 2018 . Linking pangenomes and metagenomes: the Prochlorococcus metapangenome . PeerJ 6 : e4320 . OpenUrl CrossRef PubMed ↵ Dewar AE , Hao C , Belcher LJ , Ghoul M , West SA . 2024 . Bacterial lifestyle shapes pangenomes . Proceedings of the National Academy of Sciences 121 : e2320170121 . OpenUrl CrossRef PubMed ↵ Dial DT , Weglarz KM , Aremu AO , Havill NP , Pearson TA , Burke GR , von Dohlen CD . 2022 . Transitional genomes and nutritional role reversals identified for dual symbionts of adelgids (Aphidoidea: Adelgidae) . Isme j 16 : 642 – 654 . OpenUrl CrossRef PubMed ↵ diCenzo GC , Finan TM . 2017 . The Divided Bacterial Genome: Structure, Function, and Evolution . Microbiol Mol Biol Rev s81 . ↵ Dolatabadi S , Scherlach K , Figge M , Hertweck C , Dijksterhuis J , Menken SB , de Hoog GS . 2016 . Food preparation with mucoralean fungi: A potential biosafety issue? Fungal Biol 120 : 393 – 401 . OpenUrl CrossRef PubMed ↵ Eren AM , Kiefl E , Shaiber A , Veseli I , Miller SE , Schechter MS , Fink I , Pan JN , Yousef M , Fogarty EC , et al. 2020 . Community-led, integrated, reproducible multi-omics with anvi’o . Nature Microbiology 6 : 3 – 6 . OpenUrl ↵ Estrada-De Los Santos P , Palmer M , Chávez-Ramírez B , Beukes C , Steenkamp E , Briscoe L , Khan N , Maluk M , Lafos M , Humm E , et al. 2018 . Whole Genome Analyses Suggests that Burkholderia sensu lato Contains Two Additional Novel Genera (Mycetohabitans gen . nov., and Trinickia gen. nov.): Implications for the Evolution of Diazotrophy and Nodulation in the Burkholderiaceae. Genes 9 : 389 . OpenUrl PubMed ↵ Gilchrist CLM , Chooi Y-H. 2021 . clinker & clustermap.js: automatic generation of gene cluster comparison figures . Bioinformatics 37 : 2473 – 2475 . OpenUrl CrossRef PubMed ↵ Goodhead I , Blow F , Brownridge P , Hughes M , Kenny J , Krishna R , McLean L , Pongchaikul P , Beynon R , Darby AC . 2020 . Large-scale and significant expression from pseudogenes in Sodalis glossinidius – a facultative bacterial endosymbiont . Microbial Genomics 6 . ↵ Grujcic V , Mehrshad M , Vigil-Stenman T , Lundin D , Foster RA . 2025 . Stepwise genome evolution from a facultative symbiont to an endosymbiont in the N2-fixing diatom-Richelia symbioses . Current Biology . ↵ Harrison PW , Lower RPJ , Kim NKD , Young JPW . 2010 . Introducing the bacterial ‘chromid’: not a chromosome, not a plasmid . Trends in Microbiology 18 : 141 – 148 . OpenUrl CrossRef PubMed Web of Science ↵ Hendry TA , Freed LL , Fader D , Fenolio D , Sutton TT , Lopez JV . 2018 . Ongoing Transposon-Mediated Genome Reduction in the Luminous Bacterial Symbionts of Deep-Sea Ceratioid Anglerfishes . mBio 9 : doi: 10.1128/mbio.01033-01018 . OpenUrl CrossRef ↵ Heuer H , Krsek M , Baker P , Smalla K , Wellington EM . 1997 . Analysis of actinomycete communities by specific amplification of genes encoding 16S rRNA and gel-electrophoretic separation in denaturing gradients . Appl Environ Microbiol 63 : 3233 – 3241 . OpenUrl Abstract / FREE Full Text ↵ Hyatt D , Chen G-L , Locascio PF , Land ML , Larimer FW , Hauser LJ . 2010 . Prodigal: prokaryotic gene recognition and translation initiation site identification . BMC Bioinformatics 11 : 119 . OpenUrl CrossRef PubMed ↵ Jain C , Rodriguez-R LM , Phillippy AM , Konstantinidis KT , Aluru S. 2018 . High throughput ANI analysis of 90K prokaryotic genomes reveals clear species boundaries . Nature Communications 9 : 5114 . OpenUrl PubMed ↵ Julian AT , Pombert JF . 2024 . SYNY: a pipeline to investigate and visualize collinearity between genomes . bioRxiv . ↵ Keeling PJ , McCutcheon JP . 2017 . Endosymbiosis: The feeling is not mutual . Journal of Theoretical Biology 434 : 75 – 79 . OpenUrl CrossRef PubMed ↵ Kolmogorov M , Yuan J , Lin Y , Pevzner PA . 2019 . Assembly of long, error-prone reads using repeat graphs . Nature Biotechnology 37 : 540 – 546 . OpenUrl CrossRef PubMed ↵ Konstantinidis KT . 2023 . Sequence-discrete species for prokaryotes and other microbes: A historical perspective and pending issues . mLife 2 : 341 – 349 . OpenUrl CrossRef PubMed ↵ Kryazhimskiy S , Plotkin JB . 2008 . The Population Genetics of dN/dS . PLOS Genetics 4 : e1000304 . OpenUrl ↵ Kumar S , Stecher G , Li M , Knyaz C , Tamura K. 2018 . MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms . Mol Biol Evol 35 : 1547 – 1549 . OpenUrl CrossRef PubMed ↵ Lackner G , Möbius N , Scherlach K , Partida-Martinez Laila P , Winkler R , Schmitt I , Hertweck C. 2009 . Global Distribution and Evolution of a Toxinogenic Burkholderia-Rhizopus Symbiosis . Applied and Environmental Microbiology 75 : 2982 – 2986 . OpenUrl Abstract / FREE Full Text ↵ Lackner G , Moebius N , Partida-Martinez LP , Boland S , Hertweck C. 2011 . Evolution of an endofungal Lifestyle: Deductions from the Burkholderia rhizoxinica Genome . BMC Genomics 12 : 210 . OpenUrl CrossRef PubMed ↵ Lan Y , Sun J , Chen C , Wang H , Xiao Y , Perez M , Yang Y , Kwan YH , Sun Y , Zhou Y , et al. 2022 . Endosymbiont population genomics sheds light on transmission mode, partner specificity, and stability of the scaly-foot snail holobiont . The ISME Journal 16 : 2132 – 2143 . OpenUrl PubMed ↵ Li H. 2016 . Minimap and miniasm: fast mapping and de novo assembly for noisy long sequences . Bioinformatics 32 : 2103 – 2110 . OpenUrl CrossRef PubMed ↵ Lind AE , Lewis WH , Spang A , Guy L , Embley TM , Ettema TJG . 2018 . Genomes of two archaeal endosymbionts show convergent adaptations to an intracellular lifestyle . The ISME Journal 12 : 2655 – 2667 . OpenUrl PubMed ↵ Mahmood S , Nováková E , Martinů J , Sychra O , Hypša V. 2023 . Supergroup F Wolbachia with extremely reduced genome: transition to obligate insect symbionts . Microbiome 11 : 22 . OpenUrl CrossRef PubMed ↵ McCutcheon JP , Moran NA . 2012 . Extreme genome reduction in symbiotic bacteria . Nature Reviews Microbiology 10 : 13 – 26 . OpenUrl CrossRef PubMed ↵ Mondo SJ , Lastovetsky OA , Gaspar ML , Schwardt NH , Barber CC , Riley R , Sun H , Grigoriev IV , Pawlowska TE . 2017 . Bacterial endosymbionts influence host sexuality and reveal reproductive genes of early divergent fungi . Nature Communications 8 : 1843 . OpenUrl PubMed ↵ Moses D , Carter M. 2025 . A Plant Health View on Endohyphal Bacteria and Their Fungal Hosts . Phytobiomes Journal 0 : PBIOMES-12-24-0117-MRVW . OpenUrl ↵ Mullins AJ , Mahenthiralingam E. 2021 . The Hidden Genomic Diversity, Specialized Metabolite Capacity, and Revised Taxonomy of Burkholderia Sensu Lato . Frontiers in Microbiology Volume 12-2021. ↵ Naumann M , Schüßler A , Bonfante P. 2010 . The obligate endobacteria of arbuscular mycorrhizal fungi are ancient heritable components related to the Mollicutes . The ISME Journal 4 : 862 – 871 . OpenUrl PubMed ↵ Nawrocki EP , Eddy SR . 2013 . Infernal 1.1: 100-fold faster RNA homology searches . Bioinformatics 29 : 2933 – 2935 . OpenUrl CrossRef PubMed Web of Science ↵ Nayfach S , Camargo AP , Schulz F , Eloe-Fadrosh E , Roux S , Kyrpides NC . 2021 . CheckV assesses the quality and completeness of metagenome-assembled viral genomes . Nature Biotechnology 39 : 578 – 585 . OpenUrl CrossRef PubMed ↵ Niehs SP , Dose B , Richter S , Pidot SJ , Dahse HM , Stinear TP , Hertweck C. 2020 . Mining Symbionts of a Spider-Transmitted Fungus Illuminates Uncharted Biosynthetic Pathways to Cytotoxic Benzolactones . Angew Chem Int Ed Engl 59 : 7766 – 7771 . OpenUrl CrossRef ↵ Niehs SP , Scherlach K , Dose B , Uzum Z , Stinear TP , Pidot SJ , Hertweck C. 2022 . A highly conserved gene locus in endofungal bacteria codes for the biosynthesis of symbiosis-specific cyclopeptides . PNAS Nexus 1 . ↵ Paradis E , Claude J , Strimmer K. 2004 . APE: Analyses of Phylogenetics and Evolution in R language . Bioinformatics 20 : 289 – 290 . OpenUrl CrossRef PubMed Web of Science ↵ Parks DH , Chuvochina M , Waite DW , Rinke C , Skarshewski A , Chaumeil P-A , Hugenholtz P. 2018 . A standardized bacterial taxonomy based on genome phylogeny substantially revises the tree of life . Nature Biotechnology 36 : 996 – 1004 . OpenUrl CrossRef PubMed ↵ Parks DH , Imelfort M , Skennerton CT , Hugenholtz P , Tyson GW . 2015 . CheckM: assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes . Genome Res 25 : 1043 – 1055 . OpenUrl Abstract / FREE Full Text Partida-Martinez LP , Hertweck C. 2007 . A Gene Cluster Encoding Rhizoxin Biosynthesis in “Burkholderia rhizoxina” , the Bacterial Endosymbiont of the Fungus Rhizopus microsporus . 8 : 41 – 45 . OpenUrl ↵ Partida-Martinez LP , Hertweck C. 2005 . Pathogenic fungus harbours endosymbiotic bacteria for toxin production . Nature 437 : 884 – 888 . OpenUrl CrossRef PubMed Web of Science ↵ Partida-Martinez LP , Monajembashi S , Greulich K-O , Hertweck C. 2007 . Endosymbiont-Dependent Host Reproduction Maintains Bacterial-Fungal Mutualism . Current Biology 17 : 773 – 777 . OpenUrl CrossRef PubMed Web of Science ↵ Pawlowska TE . 2024 . Symbioses between fungi and bacteria: from mechanisms to impacts on biodiversity . Current Opinion in Microbiology 80 : 102496 . OpenUrl CrossRef PubMed ↵ Porter J , Sullivan W. 2023 . The cellular lives of Wolbachia . Nature Reviews Microbiology 21 : 750 – 766 . OpenUrl CrossRef PubMed ↵ Pratama AA , Chaib De Mares M , Van Elsas JD . 2018 . Evolutionary History of Bacteriophages in the Genus Paraburkholderia . Frontiers in Microbiology 9 . ↵ Robertson J , Nash JHE . 2018 . MOB-suite: software tools for clustering, reconstruction and typing of plasmids from draft assemblies . Microb Genom 4 . ↵ Robinson AJ , House GL , Morales DP , Kelliher JM , Gallegos-Graves LV , LeBrun ES , Davenport KW , Palmieri F , Lohberger A , Bregnard D , et al. 2021 . Widespread bacterial diversity within the bacteriome of fungi . Communications Biology 4 : 1168 . OpenUrl PubMed ↵ Seo Y-S , Lim JY , Park J , Kim S , Lee H-H , Cheong H , Kim S-M , Moon JS , Hwang I. 2015 . Comparative genome analysis of rice-pathogenic Burkholderia provides insight into capacity to adapt to different environments and hosts . BMC Genomics 16 : 349 . OpenUrl CrossRef PubMed ↵ Shimodaira H , Hasegawa M. 1999 . Multiple Comparisons of Log-Likelihoods with Applications to Phylogenetic Inference . Molecular Biology and Evolution 16 : 1114 – 1114 . OpenUrl CrossRef Web of Science ↵ Simão FA , Waterhouse RM , Ioannidis P , Kriventseva EV , Zdobnov EM . 2015 . BUSCO: assessing genome assembly and annotation completeness with single-copy orthologs . Bioinformatics 31 : 3210 – 3212 . OpenUrl CrossRef PubMed ↵ Siozios S , Nadal-Jimenez P , Azagi T , Sprong H , Frost CL , Parratt SR , Taylor G , Brettell L , Liew KC , Croft L , et al. 2024 . Genome dynamics across the evolutionary transition to endosymbiosis . Current Biology 34 : 5659 - 5670.e5657 . OpenUrl CrossRef PubMed ↵ Steffan BN , Venkatesh N , Keller NP . 2020 . Let’s Get Physical: Bacterial-Fungal Interactions and Their Consequences in Agriculture and Health . J Fungi (Basel) 6 . ↵ Sun Y , Wang M , Cao L , Seim I , Zhou L , Chen J , Wang H , Zhong Z , Chen H , Fu L , et al. 2023 . Mosaic environment-driven evolution of the deep-sea mussel Gigantidas platifrons bacterial endosymbiont . Microbiome 11 : 253 . OpenUrl CrossRef PubMed ↵ Szabó G , Schulz F , Manzano-Marín A , Toenshoff ER , Horn M. 2022 . Evolutionarily recent dual obligatory symbiosis among adelgids indicates a transition between fungus- and insect-associated lifestyles . The ISME Journal 16 : 247 – 256 . OpenUrl PubMed ↵ Szabó G , Schulz F , Manzano-Marín A , Toenshoff ER , Horn M. 2021 . Evolutionarily recent dual obligatory symbiosis among adelgids indicates a transition between fungus- and insect-associated lifestyles . The ISME Journal 16 : 247 – 256 . OpenUrl PubMed ↵ Tatusova T , DiCuccio M , Badretdin A , Chetvernin V , Nawrocki EP , Zaslavsky L , Lomsadze A , Pruitt KD , Borodovsky M , Ostell J. 2016 . NCBI prokaryotic genome annotation pipeline . Nucleic Acids Res 44 : 6614 – 6624 . OpenUrl CrossRef PubMed ↵ Tettelin H , Riley D , Cattuto C , Medini D. 2008 . Comparative genomics: the bacterial pan-genome . Current Opinion in Microbiology 11 : 472 – 477 . OpenUrl CrossRef PubMed Web of Science ↵ Thompson JD , Higgins DG , Gibson TJ . 1994 . CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice . Nucleic Acids Res 22 : 4673 – 4680 . OpenUrl CrossRef PubMed Web of Science ↵ Turenne CY , Sanche SE , Hoban DJ , Karlowsky JA , Kabani AM . 1999 . Rapid identification of fungi by using the ITS2 genetic region and an automated fluorescent capillary electrophoresis system . J Clin Microbiol 37 : 1846 – 1851 . OpenUrl Abstract / FREE Full Text ↵ Uehling J , Gryganskyi A , Hameed K , Tschaplinski T , Misztal PK , Wu S , Desirò A , Vande Pol N , Du Z , Zienkiewicz A , et al. 2017 . Comparative genomics of Mortierella elongata and its bacterial endosymbiont Mycoavidus cysteinexigens . Environmental Microbiology 19 : 2964 – 2983 . OpenUrl CrossRef ↵ Vancaester E , Blaxter M. 2023 . Phylogenomic analysis of Wolbachia genomes from the Darwin Tree of Life biodiversity genomics project . PLOS Biology 21 : e3001972 . OpenUrl CrossRef PubMed ↵ Vigil-Stenman T , Larsson J , Nylander JAA , Bergman B. 2015 . Local hopping mobile DNA implicated in pseudogene formation and reductive evolution in an obligate cyanobacteria-plant symbiosis . BMC Genomics 16 : 193 . OpenUrl CrossRef PubMed ↵ Wang X , Xiong X , Cao W , Zhang C , Werren JH , Wang X. 2020 . Phylogenomic Analysis of Wolbachia Strains Reveals Patterns of Genome Evolution and Recombination . Genome Biol Evol 12 : 2508 – 2520 . OpenUrl CrossRef PubMed ↵ Wang X , Zhou H , Chen H , Jing X , Zheng W , Li R , Sun T , Liu J , Fu J , Huo L , et al. 2018 . Discovery of recombinases enables genome mining of cryptic biosynthetic gene clusters in Burkholderiales species . Proceedings of the National Academy of Sciences 115 : E4255 – E4263 . OpenUrl Abstract / FREE Full Text ↵ Wernegreen JJ . 2015 . Endosymbiont evolution: predictions from theory and surprises from genomes . Ann N Y Acad Sci 1360 : 16 – 35 . OpenUrl CrossRef PubMed ↵ Westra ER , Levin BR . 2020 . It is unclear how important CRISPR-Cas systems are for protecting natural populations of bacteria against infections by mobile genetic elements . Proceedings of the National Academy of Sciences 117 : 27777 – 27785 . OpenUrl Abstract / FREE Full Text ↵ Xie Z , Tang H. 2017 . ISEScan: automated identification of insertion sequence elements in prokaryotic genomes . Bioinformatics 33 : 3340 – 3347 . OpenUrl CrossRef PubMed ↵ Yu G , Smith DK , Zhu H , Guan Y , Lam TT-Y. 2017 . ggtree: an r package for visualization and annotation of phylogenetic trees with their covariates and other associated data . Methods in Ecology and Evolution 8 : 28 – 36 . OpenUrl CrossRef View the discussion thread. Back to top Previous Next Posted September 15, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Comparative genomics reveals multipartite genomes undergoing loss in the fungal endosymbiotic genus Mycetohabitans Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Comparative genomics reveals multipartite genomes undergoing loss in the fungal endosymbiotic genus Mycetohabitans Bhuwan Abbot , Sara Field , Lauren Carneal , Richard Allen White III , Andra Buchan , Caroline West , Laira Lee , Morgan Elizabeth Carter bioRxiv 2025.06.12.659383; doi: https://doi.org/10.1101/2025.06.12.659383 Share This Article: Copy Citation Tools Comparative genomics reveals multipartite genomes undergoing loss in the fungal endosymbiotic genus Mycetohabitans Bhuwan Abbot , Sara Field , Lauren Carneal , Richard Allen White III , Andra Buchan , Caroline West , Laira Lee , Morgan Elizabeth Carter bioRxiv 2025.06.12.659383; doi: https://doi.org/10.1101/2025.06.12.659383 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Genomics Subject Areas All Articles Animal Behavior and Cognition (7636) Biochemistry (17704) Bioengineering (13898) Bioinformatics (41967) Biophysics (21460) Cancer Biology (18599) Cell Biology (25525) Clinical Trials (138) Developmental Biology (13384) Ecology (19909) Epidemiology (2067) Evolutionary Biology (24326) Genetics (15613) Genomics (22512) Immunology (17740) Microbiology (40423) Molecular Biology (17191) Neuroscience (88645) Paleontology (667) Pathology (2835) Pharmacology and Toxicology (4825) Physiology (7646) Plant Biology (15158) Scientific Communication and Education (2046) Synthetic Biology (4302) Systems Biology (9825) Zoology (2271)