Evaluation of the effect of biochanin b and Sorafenib on cell survival, growth, migration, colony formation and apoptosis in hepatocellular carcinoma

Evaluation of the effect of biochanin b and Sorafenib on cell survival, growth, migration, colony formation and apoptosis in hepatocellular carcinoma | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Evaluation of the effect of biochanin b and Sorafenib on cell survival, growth, migration, colony formation and apoptosis in hepatocellular carcinoma Hamed Abdolkarimi, Mojtaba Jafarinia, Hossein Sadeghi, Mohsen Forouzanfar This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5856830/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background and Purpose: Formononetin is a phytoestrogen isolated from several medicinal plants, and it is extensively investigated for its anti-cancer effects in several cells. However, the impact of formononetin on hepatocellular carcinoma (HCC) has been unclear. In this study, the influence of formononetin on cell growth, metabolism, and signaling molecules is examined in the HepG2 cells, singly and in combination with sorafenib. This study investigates the individual and combined effects of formononetin and sorafenib on growth, metabolism, and signaling in HepG2 cells, focusing on miR-21 regulation and theirdownstream effects for the first time. This study underscored the dependent effects of the two drugs on the expression of miR-21. The drugs, either alone or together, indirectly affect the expression of other genes via miR-21 as well as directly. this study aiming to explore its molecular mechanisms and potential therapeutic values. Materials and Methods: Materials and Methods: HepG2 cells were treated with formononetin, sorafenib, or a combination of both. cell growth, colony formation, migration, apoptosis, gene expression, and protein contents were investigated. Formononetin (1-640 µM) and sorafenib (0.01-64µM) or itscombination (0.01µM sorafenib+1µM formononetin) were tested. Results: After 48 h, treatments reduced the cell viability and colony formation and induced apoptosis. miR-21 expression was significantly lowered by combination therapy which demonstrated the most potent inhibitory effect on EGFR, VEGF-A, MMP-9 expression, increasing BAD expression with the highest levels in the combination group, then sorafenib and followed by formononetin. Isolated compounds or their combination caused a reduction in survivin expression levels, with the least effect for formononetin and the most notable effect for combination treatment. Formononetin produced a more considerable reduction in the expression of EGFR and VEGF-A thansorafenib, but their combination caused the most prominent reductions. Conclusion Formononetin is a promising compound as an adjuvant therapy for HCC, especially when used in combination with sorafenib. The combination therapy not only enhances the inhibition of key oncogenic pathways involved, such as EGFR, VEGF-A, and MMP-9, but also induces pro-apoptotic machinery by downregulating miR-21 and upregulating BAD expression. All these data suggest that formononetin, in combination with sorafenib, may present a more effective therapeutic approach againstHCC. More in-depth preclinical and clinical studies are needed to support the findings and establish its clinical applicability. Formononetin Sorafenib miR-21 hepatocellular carcinoma HCC signaling pathway apoptosis cell survival growth migration colony formation. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Hepatocellular carcinoma (HCC) accounts for 75% of all liver cancers, making it the fifth most common cancer in men and the seventh in women globally. Annually, over half a million new cases are diagnosed, with a poor survival rate of 3 to 6 months post-diagnosis. HCC is the second leading cause of cancer-related deaths in the world (1-3). Key Molecular pathways implicated in HCC include dysregulation of PI3K/AKT, JAK-STAT, and VEGFR signaling and some genes included BIRC5 (survivin), MMP9 playing a critical role (4). Recent research using tissue culture models and animal experiments has emphasized the anticancer properties of medicinal plants, which interact with proteins involved in signal transduction, apoptosis, and cell cycle regulation (5). Especially medicinal plants like phytoestrogens such as biochanin b (also known as formononetin, C16H12O4; 7-hydroxy,4′-methoxy isoflavone) have gained much attention because of their potential anticancer effects. Its role in the treatment of cancer has been studied in many other malignancies (6-8). However, its effects on HCC remain under investigated. Formononetin can alter the signaling process in cancer cells (9-10). Therefore, it is proposed for cancer therapy because of its plenty of functions and intracellular targets. Favorable effect of formononetin on inhibition, proliferation and metastasis of various cancer cells has been elucidated (6). Formononetin has been shown to inhibit the proliferation and invasion of various cancer cells, including breast, colon, colorectal, non-small cell lung, and ovarian cancer cells (11-16). However, its detailed molecular mechanisms in hepatocellular carcinoma (HCC) are still not well defined and require further investigation. The present study is designed to investigate the effect of formononetin on cell growth, metabolism, and apoptosis-related signaling in HepG2 cells, comparing its effects with sorafenib both in combination and as single drugs. MicroRNA-21 (miR-21) is a key regulator of cellular processes, and its deregulation is associated with the development of various diseases, including cancer cardiovascular diseases, or inflammation induction. Overexpression of miR-21 has been implicated in tumorigenesis and is linked to poor prognosis in several cancers (17,18). Formononetin has been shown to significantly downregulate miR-21 expression, inhibit Akt phosphorylation in a dose-dependent manner, and induce apoptosis. It inhibits T24 cells proliferation and invasion (19). miR-21 expression, decreased PTEN expression and sequentially activates Akt. Sorafenib activates Akt. treatment of sorafenib led to the downregulation of PTEN, increased activation of Akt and caspase-3. miR-21 is believed to be a promising therapeutic target for overcoming sorafenib resistance in the treatment of HCC (20). Targeting this microRNA could improve the therapeutic outcomes in this type of cancer. Formononetin, Sorafenib, and miR-21 have been studied together due to the common pathways of action demonstrated in previous studies. This could give new insight into the combined therapeutic potential of these molecules in HCC and might lead to new ways of developing more effective treatment strategies. Material and Methods 1. Cell line and culture conditions: HepG2 cells were obtained from the Iranian Pasture Institute, Tehran, Iran. The cell culture medium EMEM supplemented with Fetal Bovine Serum (FBS) and Penicillin-Streptomycin (PenStrep) antibiotic solution was also obtained from DENA Molecular Biology Products, Mashhad, Iran (Cat numbers S-8054, S-8060, S-8062-5mL, respectively). HepG2 cells were grown in 6-well plates containing three independent replicates in each condition at different times including 24, 48, and 72h. The cells were cultured in EMEM supplemented with 10% FBS and 0.1% PenStrep, and the cells were incubated in a humidified incubator maintained at 37°C and 5% CO2. Figure 1 provides a graphical summary of this step and the subsequent procedures conducted in this study. The experimental workflow includes the following steps: cell culture, MTT assay for cytotoxicity evaluation, IC50 determination, trypan blue exclusion assay, colony formation assay, DAPI staining for apoptosis detection, scratch assay for cell migration analysis, RNA extraction followed by qRT-PCR and real-time PCR for gene expression analysis, and Western blotting for protein level assessment. This diagram summarizes the methodology employed to investigate the effects of Formononetin and Sorafenib and their combination on HepG2 cells. 2. The MTT assay: The EMEM medium supplemented with 10% FBS and 0.1% Pen-Strep antibiotic was used to test the effect of formononetin, sorafenib, and their combination on HepG2 cells by using MTT assay. Final concentration of formononetin tested was as follows: 1 µM, 1.25 µM, 2.5 µM, 5 µM, 10 µM, 20 µM, 40 µM, 80 µM, 160 µM, 320 µM, and 640 µM. The concentrations used for sorafenib were 0.01 µM, 0.125 µM, 0.25 µM, 0.5 µM, 1 µM, 2 µM, 4 µM, 8 µM, 16 µM, 32 µM and 64 µM. To validate the data, the cells in the logarithmic phase of growth were used. MTT assay was done according to the protocol provided by the manufacture (DNAbiotech, Iran). Briefly, 5 mg/ml MTT reagent in PBS was added to each well, and the plates were incubated at 37°C for 4 h. After incubation, the supernatant was carefully removed, and DMSO was added to dissolve the formazan crystals. The optical density (OD) of each well was measured at 570 nm using a microplate reader. Cell viability percentages were calculated relative to untreated cells, which served as the control group. Data are expressed as the mean ± SE of three independent experiments using Excel software (version 2017). In addition, a dose-response curve was plotted with percentages of viable cells against the logarithmic concentrations of compounds; then, nonlinear regression analyses for the IC50 values were calculated using Prism software (version 8.0). 3. Cell Viability of HepG2 cell line treated with sorafenib, formononetin, or their combination: HepG2 cells were exposed to 1 µM sorafenib, 10 µM formononetin, or the combination of both (1 µM sorafenib + 10 µM formononetin) for 24, 48, 72, 96, and 120 hours. Cell viability was determined by the trypan blue exclusion assay. Following the treatment periods, 800 µL of each treated cell suspension was plated to 24-well plates. The cells were detached by incubation with a 0.25% trypsin-EDTA solution (GIBCO) and then resuspended in complete medium. To determine cell viability, 0.4% trypan blue solution was used and viable cells were counted manually by using a hemocytometer. Comparative viability graphs were made in Excel (version 2017). Each experiment was repeated thrice to ensure the results were consistent and reliable. 4. Colony Formation: The culture wells were divided into four sets of treatment in order to examine the colony-forming ability of HepG2 cells: untreated cells (negative control), cells treated with 10 µM formononetin, 1 µM sorafenib, and combined treatment with 1 µM sorafenib and 10 µM formononetin. These treatments lasted for 48 hours. After treatment incubation time, the culture medium was removed carefully, and the cells were gently washed with ice-cold PBS to remove any residual compounds. The cells were fixed with absolute methanol for 15 minutes and stained using a 0.1% solution of crystal violet for 30 minutes. After staining, excess dye was removed by washing the cells twice with PBS. Colonies, defined as aggregations of more than 50 cells, were examined and counted using a light microscope at 400× magnification. The size and number of these colonies were recorded for further analysis. Control groups included untreated cells as a negative control and cells treated with Cisplatin as a positive control to validate the assay. To ensure reproducibility and reliability, the experiment was conducted in triplicate. The colony formation efficiency was measured and then analyzed using ImageJ software (version 2.0.0-rc-3). 5. DAPI staining: Apoptosis Evaluation HepG2 cells were grouped into four different treatment groups: untreated controls, cells treated with 10 µM formononetin, cells treated with 1 µM sorafenib, and cells treated with a combination of 10 µM formononetin and 1 µM sorafenib. After 48 hours of treatment time, the cells were washed with ice-cold PBS to remove the remaining residual media and treatment compounds. Next, the cells were fixed with 4% paraformaldehyde at room temperature for 15 min. They were then stained with 0.5 µg/mL 4,6-diamidino-2-phenylindole (DAPI) solution for 30 minutes in a dark environment to avoid photobleaching. Fluorescence microscopy (NCF950) was used to assess apoptotic cells by examining nuclear features, including condensation, fragmentation, and the presence of apoptotic bodies. The detection of apoptotic cells was based on these distinctive nuclear alterations. Images were quantified using ImageJ software (version 2.0.0-rc-3), and the results were compared between the various treatment groups. The experiment was done in triplicate to ensure the results' reliability and reproducibility. 6. Cell migration assay by scratch method: Scratch assay, a well-developed method to test the ability of tumor cells to migrate, was performed to determine whether formononetin, sorafenib, or the combination could inhibit the migration of HepG2 cells. This assay provides important information on the invasive and metastatic properties of malignant cells, which are critical in the development of tumors. The method was adapted from Liang et al. (21). Briefly, HepG2 cells were cultured in T-75 flasks with appropriate growth medium supplemented as per requirements till they reached nearly 95% confluence. Using a sterile scraper, a uniform scratch was created through the cell monolayer to simulate a wound. The control flasks were incubated without any treatment, while the treatment groups were exposed to 10 µM formononetin, 1 µM sorafenib, or a combination of 10 µM formononetin and 1 µM sorafenib. Images of the scratch area were taken at 0, 12, 24 and 48-hours post-scratching using a light microscope. The scratch width was measured and analyzed with ImageJ software (version 2.0.0-rc-3). The control group without any treatment of cells was set as the standard to represent 100% migration at every time point, and the treatment groups calculated their migration ratios relative to the control group to evaluate the impact of compounds on cell migration. The experiment was performed in triplicates to get reproducibility and reliability. 7. RNA Extraction and qRT-PCR Analysis: Total RNA was extracted from HepG2 cells after 48-hour incubation in the indicated experimental groups using the Total RNA Extraction Kit (Qiagen, Cat. No. 74104) according to the manufacturer's instructions. Synthesis of complementary DNA (cDNA) was performed using the cDNA Synthesis Kit (Takara, Dalian, China) following the provided protocol. Real-time quantitative PCR (qRT-PCR) was performed on an ABI Plus One Real-Time PCR System (Applied Biosystems, USA) using primers specifically designed for miR-21, BIRC5 (Survivin), EGFR, VEGF-A, BAD, and MMP9 genes. Primer sequences were optimized to ensure specificity and amplification efficiency. Normalization of gene expression levels was carried out with appropriate housekeeping gene, and relative quantification of target genes was determined with the 2^−ΔΔCt method. The experiment was conducted in triplicates for ensuring reliability and reproducibility of the results. 8. Western Blot Analysis: Western blotting was performed for semi-quantitative analysis of the gene expression of bad, vegf-a, egfr, mmp9, Survivin, pro caspase-3, erk1/2 and akt. In brief, following a 48-hour incubation period using HepG2 cells, total cellular proteins from both the control and treatment groups were extracted using RIPA buffer (Sigma-Aldrich, St. Louis, MO, USA), with a protease inhibitor cocktail (Sigma-Aldrich, Cat. No. P8340) to prevent protein degradation. Protein concentrations were determined by the Bradford assay (Pierce, Rockford, IL, USA), following the manufacturer's instructions. Proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) (Laemmli, 1970) on 10% gels, and the separated proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Invitrogen, Cat. No. IPVH00010) using a wet transfer system (Bio-Rad, Hercules, CA) at 100 V for 1 hour. The membranes were then blocked with 5% non-fat milk (w/v) in Tris-buffered saline with Tween-20 (TBST) for 1 hour at room temperature to reduce non-specific binding. The membranes were subsequently subjected to overnight incubation with primary monoclonal antibodies specific to the target proteins at 4°C. After three washes in TBST, membranes were incubated with HRP-conjugated secondary antibodies (goat anti-rabbit IgG; diluted 1:1000) for 1 hr at room temperature. After that, protein bands were visualized by ECL detection reagents (Thermo Scientific, Waltham, MA, USA); X-ray films (Thermo Scientific, Cat. No. 34090) were exposed for visualization. Band intensity was quantified using TotalLab software (version 1.3.1). The murine monoclonal anti-actin antibody (Proteintech, Cat. No. 66009-1-Ig, dilution 1:2000) was used as an internal control for normalizing protein expression levels. All Western blot experiments were performed in triplicate so that results could be comparable and reproducible. 9. Statistical Analysis: Data were expressed as mean ± SD, which were derived from repeated experimental tests for each group. One-way ANOVA was used to analyze parametric data from more than two groups. Repeated measure analysis was performed to test the effect of duration of treatment on viability in HepG2 cells treated with various concentrations of sorafenib, formononetin, or their combination. All statistical analyses and graph generations were performed with SPSS software (version 26) and Microsoft Excel (version 2019). Results 1. Survival of HepG2 cell line (MTT assay): Figure 2 shows the optical density of MTT assay indicating the survival of HepG2 cells treated with various concentrations of sorafenib ( Fig. 2 -A ) , and formononetin ( Fig. 2 -B ) for 24 h, 48 h, and 72 h. In addition, a combination of various concentrations of formononetin plus 1 µM sorafenib was assessed ( Fig. 2 -C ) . Higher concentration of each chemical showed higher toxicity. In fact, each concentration of sorafenib or formononetin had its highest toxicity independently of the exposure time. Therefore, the effect of tested concentrations of sorafenib, formononetin, or their combination on HepG2 cell survival is dose-dependent. Also, the cytotoxic effect of various concentrations of formononetin and sorafenib were not time dependent at 24 hour, or 48 hour or 72 hours (p > 0.05), except for HepG2 cells which were treated with formononetin with 10 µM (p = 0.049) or 20 µM (p = 0.007). IC50 of formononetin-treated HepG2 cells was gained after 19.04 hour with a concentration of 5 µM. 2. Viability of HepG2 cell: The HepG2 cells was treated with 1 µM sorafenib, 10 µM formononetin, or combined treatment with 1 µM sorafenib and 10 µM formononetin for 24 hours, 48 hours, 72 hours, 96 hours and 120 hours. The cell viability was examined by the trypan blue exclusion test. Control has the highest percentage of viable cells compared to all treated groups. Combination therapy exhibited the highest cytotoxicity in HepG2 cells. Further, the toxicity of the tested compounds was not time-dependent. The results table is shown in Fig. 3 − 1 . The results from the statistical analysis are presented below: The Shapiro-Wilk test used to examine normality illustrated that each group was distributed normally since the p-value for each group was over 0.05 and hence met the data requisites for further analysis. The one-way ANOVA analysis indicated there was a significant difference between groups, with a p-value = 0.00118; in particular, the comparisons between Control and Sorafenib + Formononetin showed a p-value = 0.0006, showing a high effect of this combined treatment on Cell Viability. All other comparisons, Control vs. Formononetin and Control vs. Sorafenib, did not show statistically significant results. Finally, the Tukey's HSD test confirmed that the only significant difference was obtained between the Control group and the Sorafenib + Formononetin groups with p-value = 0.0006. These results demonstrated that the combination of Sorafenib and Formononetin significantly has a role in the process of Cell Viability reduction while no significant differences in any other groups compared with the control group ( Fig. 3 − 2) . 3. Colony formation: Figure 3 represents the results of colony formation by HepG2 cells after two-weeks treatment with 1 µM sorafenib, 10 µM formononetin and their combination (1 µM sorafenib and 10 µM formononetin). HepG2 cells developed 76 colonies after two weeks whereas formononetin-treated and sorafenib-treated HepG2 cells formed 59 and 53 colonies, respectively. The combination of both chemicals inhibited the colony formation by HepG2 cells more effectively (49 colonies) ( Fig. 4 − 1) . The results of this study indicate that the combination treatment of Sorafenib and Formononetin significantly reduced colony formation. The ANOVA test revealed a highly significant difference between the groups (p-value of 3.72e-09), confirming the substantial effect of the treatments on colony number. Further analysis using the Tukey HSD test specifically highlighted that the combination group had the greatest impact on reducing colony formation, showing a significant decrease compared to the control group (p < 0.001), Sorafenib (p = 0.005), and Formononetin (p < 0.001). These findings suggest that the combination of Sorafenib and Formononetin is the most effective treatment for reducing colony formation, emphasizing the synergistic effects of these compounds in inhibiting cell growth ( Fig. 4 − 2) . 4. Apoptosis: HepG2 cells were subjected to 10 µM formononetin, 1 µM sorafenib, or a combination of 10 µM formononetin plus 1µM sorafenib. Following evaluation of the apoptotic cells using DAPI staining. In the control group, a minimal number of apoptotic nuclei are observed, with most nuclei displaying a normal, uniform structure without significant chromatin condensation or fragmentation. Treatment with 10 µM Formononetin results in a noticeable increase in apoptotic nuclei, characterized by clear chromatin condensation and nuclear fragmentation. Similarly, exposure to 1 µM Sorafenib induces a significant number of apoptotic nuclei, with prominent signs of chromatin condensation and fragmentation compared to both the control group and the formononetin group. The combination of 10 µM Formononetin and 1 µM Sorafenib shows the highest level of apoptosis, with extensive chromatin condensation, nuclear fragmentation, and apoptotic bodies ( Fig. 5 -a ) . These findings are further supported by the apoptosis percentage graph, added alongside the microscopy images ( Fig. 5 -b ) , where the control group shows the lowest apoptosis rate, both Formononetin and Sorafenib treatments demonstrate significant increases, and the combination therapy achieves the highest apoptotic effect, indicating enhanced efficacy when used together. 5. Cell Migration: Formononetin, sorafenib and their combination were not so effective in the inhibition of HepG2 cell migration when compared to initial hours of evaluation. After 12 hours, only sorafenib reduced the migration rate of HepG2 cells. But, after 24 hours and 48 hours the migration of sorafenib-treated cells was increased considerably. Overall, it seems that tested chemicals cannot prevent HepG2 cell migration. 6. Gene expression changes: In all treatment groups, miR-21 expression folds were decreased significantly compared to control group, except in formononetin-treated HepG2 cell that was insignificant. But, survivin folds were diminished meaningfully in treatment than control categories. Formononetin and its combination with sorafenib decreased EGFR, VEGF-A and MMP9 significantly, whereas sorafenib decreased them insignificantly. BAD folds were increased in treatment HepG2 cells than untreated ones but this increment was meaningful only in combination formula-exposed cells ( Fig. 6 ) . The significance of the expression results for each gene across the four groups was calculated using ANOVA, and the p-value was indicated in the top-right corner alongside the real-time PCR chart in Fig. 6 for each gene. 7. Western Blot: Formononetin, sorafenib and their combination increased the contents of BAD, cleaved caspase-3, and the ratio of caspase-3/procaspase-3; in these cases, sorafenib had a potent effect than formononetin and the combination of sorafenib plus formononetin was more potent than single agents. After treatment with formononetin, HepG2 cells expressed reduced levels of VEGF-A, Survivin, cleaved caspase-3, p-ERK1/2, p-ERK1/2/ERK1/2, and p-AKT/AKT proteins as well as their respective ratios. This reduction was further enhanced in HepG2 cells treated with sorafenib, and the greatest reduction was found in cells treated with combination therapy. The highest contents of EGFR, procaspase-3, p-ERK1/2, and p-AKT were exist in control HepG2 cells. Compared to control group, the EGFR was reduced in treated HepG2 cells thereabout in a similar content. Procaspase-3 contents were reduced in treatment groups where sorafenib-treated cells had more contents than formononetin or combination treatments; the lowest contents were in HepG2 cells treated with the mixture of both drugs. The most reductive effect on ERK1/2 protein and p-ERK1/2/ERK1/2 contents and ratio were seen for the combination of formononetin plus sorafenib. Formononetin-treated cells had higher contents of MMP9 protein than control, sorafenib or combination groups. But treated cells with Sorafenib and combination formula shown lower contents of MMP9 than control group. AKT contents in HepG2 cells was not changed considerably when comparing the control and treatment groups ( Fig. 7 ) . Discussion General Overview of the Discussion: The current study examined the effects of formononetin, sorafenib, and their combined use on the HepG2 cancer cells in terms of cell viability, apoptosis, migratory ability, colony formation, as well as expression levels of key genes and proteins. The findings demonstrated that both drugs, when used alone and in combination, exerted anti-proliferative and pro-apoptotic effects, although the combined treatment produced the most significant effects. Analysis of Findings Based on Research Objectives: 1. Effect of Formononetin alone: Formononetin alone significantly downregulates miR-21 and is also capable of dose-dependently inhibiting Akt phosphorylation, which, in turn, induces apoptosis. It also inhibits proliferation and invasion of T24 cells (19). Survivin is an apoptosis-inhibitory protein and a useful prognostic marker of breast cancer, as revealed in several recent studies (22, 23). Formononetin down-regulated the expression of several other anti-apoptosis mRNA and proteins such as survivin, and inhibitors of apoptosis proteins (IAP-2). There is a significant dose-dependent activation of caspase-3 by formononetin in U266 cells. We found a significant concentration-dependent activation of caspase-3 by formononetin in tumor tissues. They found that formononetin downregulates the expression of VEGF in a dose-dependent manner (24). In vitro experiments showed that formononetin reduced the expression of matrix metalloproteinase-2 (MMP-2) and MMP-9. Moreover, formononetin significantly inhibited the phosphorylation of Akt and PI3K. Taken together, these findings indicate that formononetin inhibited migration and invasion of breast cancer cells through downregulating the expression of MMP-2 and MMP-9 via the PI3K/Akt signaling pathway (25). Formononetin affects the tumor microenvironment through the inhibition of ERK1/2, AKT, and MAPK signaling pathways, consequently suppressing cell migration, invasion, and angiogenesis (26). Further, formononetin treatment modified apoptosis-related proteins, such as cleaved caspase-3, bax, and bcl-2 (27). The phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt) and extracellular signal-regulated kinase 1/2 (Erk1/2) signaling pathways function in a multitude of purposes in the growth, proliferation, differentiation, metabolism, and survival of a wide variety of cells and tissues (28). Formononetin has shown strong anti-cancer effects through downregulating the expression of miR-21, inhibiting Akt phosphorylation in dose-dependent manner, and promoting apoptosis. It also decreases anti-apoptotic proteins, including survivin and IAP-2, while activating caspase-3 in tumor tissues at the same time. Formononetin also inhibits MMP-2 and MMP-9 levels, thereby preventing the migration and invasion abilities of cancer cells by regulating the PI3K/Akt signaling pathway. Moreover, it alters the microenvironment of the tumor by switching off the ERK and AKT pathways and repressing cell migration, invasion, and angiogenesis. These findings suggest that formononetin may serve as a promising therapeutic agent in cancer treatment. 2. Effect of Sorafenib alone: Sorafenib decreased tumor volume accompanied by an increase of caspase‐3 activity in nude mice implanted with HepG2 cells. The progressive increase of CHOP (enhancer binding protein-homologous protein along with decreased ratios of Thr308P‐AKT/AKT and Ser473P‐AKT/AKT, was associated with a reduced autophagic flux and an increased caspase‐3 activity. Sorafenib may also indirectly regulate BAD activity through the downregulation of the anti-apoptotic protein Mcl-1 and the upregulation of pro-apoptotic proteins, thereby shifting the balance toward apoptosis in HepG2 cells (29). The influence of sorafenib on survivin, a member of the inhibitor of apoptosis (IAP) family, seemed to be dependent on duration of drug exposure. Shortly after sorafenib application protein levels were reduced; however, at more prolonged times of drug exposure, transcription seems to be reduced (30). Sorafenib inhibits MMP9 expression and activity in HGF-induced hepatocellular carcinoma models. This suppression is associated with reduced JNK phosphorylation, emphasizing the role of Sorafenib in inhibiting tumor growth and epithelial-mesenchymal transition (EMT) (31). Sorafenib exerts dual regulatory effects on VEGF signaling by directly inhibiting VEGF secretion and VEGF receptor (VEGFR-1, VEGFR-2, VEGFR-3) subsequently inhibiting angiogenesis while promoting apoptosis. However, under certain conditions, sorafenib may enhance TGF-β-induced VEGFR2 activation and angiogenesis, indicating a context-dependent interplay between TGF-β and VEGF pathways (32,33). Sorafenib influences vital genes and signaling pathways, such as BAD, MMP-9, VEGF, EGFR, BIRC5 (survivin), caspase-3, ERK, and AKT. Sorafenib reduces the tumor volume by increasing the activation of caspase-3, which promotes apoptosis. Sorafenib shifts the balance toward cell death by downregulating the anti-apoptotic protein Mcl-1 while increasing pro-apoptotic proteins such as BAD. Bcl-2 associated death promoter (BAD) acts as an initiator of the apoptotic process (34) and its increase results in cell death induction. sorafenib inhibits MMP-9 activity, which suppresses tumor invasion and epithelial-mesenchymal transition (EMT). This drug also inhibits VEGF secretion and its receptor activation, which inhibits angiogenesis, and modulates EGFR signaling. In addition, Sorafenib down-regulates survivin expression and reduces AKT and ERK phosphorylation, promoting further apoptosis and inhibiting cell survival. 3. Effect of miR-21 alone: down-regulation of miR-21 expression by antisense oligonucleotides inhibited glioma cell proliferation and induced cell apoptosis. Reduction of miR-21 activated caspase 3. miR-21 plays a critical role in regulating the apoptosis of cells in gliomas and can be a target for effective therapies . Down-regulation of miR-21, on the other hand, inhibited the EGFR and Akt pathways (35). Epidermal growth factor receptor (EGFR) is a receptor tyrosine kinases (RTK) protein also known as ErbB1 or HER-1. Different ligands can bind EGFR and activate its downstream signaling pathways. Therefore, its activation or upregulation has an important role in cancer development in a variety of solid human tumors such as hepatocellular carcinoma, non-small cell lung carcinomas and colorectal cancers (36). as well, Up-regulation of miR-21 can inhibit PTEN expression and lead to an activation of AKT and ERK pathways, finally enhance VEGF expression and induce tumor angiogenesis. Inhibition of miR-21 increased the protein expression of PTEN and decreased the relative expression of p-AKT and p-ERK (37). Serum vascular endothelial growth factor-A (VEGF-A) has been shown to be a proper prognostic factor for peoples with various types of malignancies. VEGF-A is secreted by various malignant tissues for their regeneration and growth regulation (38). MMP9 (Matrix Metallopeptidase 9) is involved in the degradation of extracellular matrix proteins such as type IV and V collagens and plays a role in both tumor development, tissue remodeling or regeneration and metastasis (39). MMP-2 and MMP-9 cell signaling pathway may be one of the mech­anisms in which miR-21 affects tumor cell growth. miR-21 promotes growth, invasion and migration of lung cancer cells (40). Down-regulation of miR-21 inhibits glioma cell proliferation, induces apoptosis, and suppresses key pathways like EGFR and Akt . Its exhibits activities on various signaling pathways, such as Akt, ERK, MMP-2, and MMP-9, besides its involvement in apoptosis induction and the inhibition of tumor growth, as also observed with formononetin. In lung cancer, miR-21 enhances growth, invasion, and migration via MMP-2 and MMP-9. It also affects anti-apoptotic proteins, including survivin and IAP-2, which are also targeted by formononetin. Up-regulation of miR-21 activates AKT and ERK pathways, which enhance VEGF expression and tumor angiogenesis. This regulation of the tumor microenvironment by miR-21, through the PI3K/Akt and ERK1/2 pathways, parallels the effects observed with formononetin. These findings suggest miR-21 as a crucial target for cancer therapy. The mechanisms of Formononetin, Sorafenib, and miR-21 share a great deal of similarity regarding the impact on apoptosis, survival pathways, and critical proteins like caspase-3, survivin, MMP-9, VEGF, and AKT. However, the detailed molecular mechanisms may differ since some pathways may be activated or inhibited depending on the context or treatment duration. 4. Effect of combination therapy: Regulation of miR-21 and related pathways : The major mechanism by which this combination therapy may succeed is in the downregulation of miR-21, a principal modulator of cancer progression and resistance. Several oncogenic pathways are downregulated, with resultant decreased expression of factors like EGFR, VEGF-A, and MMP-9 that are vital in tumor growth, angiogenesis, and metastasis. These data show that both the direct and indirect therapeutic actions of this combination are modulated through the regulation of miR-21. The combined use of formononetin and sorafenib showed an enhanced ability to induce apoptosis and suppress pathways related to cellular survival. Western blot analysis revealed increased pro-apoptotic markers (BAD, cleaved caspase-3) and significantly decreased survivin levels. Moreover, the ratio of phosphorylated to unphosphorylated AKT and ERK1/2 was significantly lower in the combination therapy group, thus showing its potency in blocking signaling pathways critical to the survival and proliferation of cancer cells. These results suggest that formononetin and sorafenib can be a promising adjuvant treatment approach for HCC. The simultaneous modulation of miR-21 and its downstream targets points to an action mechanism not previously reported, which should therefore be further investigated. Future studies should validate these findings in preclinical models and take advantage of targeted delivery systems, including nanoparticles, to improve the specificity and therapeutic index of this promising combinatorial treatment strategy. The downregulation of miR-21 enhances the combination therapy's efficacy by targeting pathways crucial for cancer cell survival and metastasis Decreased Cell Viability: Combination therapy resulted in enhanced cytotoxic effects in HepG2 cells compared to single treatments. MTT and trypan blue exclusion assays confirmed dose-dependent reduction in cell viability, most profoundly by the combination therapy. Induction of Apoptosis: The combination treatment resulted in the highest levels of apoptosis, as shown by DAPI staining and western blotting. A further enhancement of pro-apoptotic markers, including BAD and cleaved caspase-3, with decreased expression of the anti-apoptotic protein survivin, mechanistically underlines the advantages of the combination therapy. Suppression of Oncogenic Pathways: Combination therapy resulted in a strong downregulation of crucial signaling molecules, such as EGFR, VEGF-A, and MMP-9, which play important roles in the proliferation, angiogenesis, and metastasis of tumors. In addition, the phosphorylated-to-unphosphorylated ratios of AKT and ERK1/2 proteins were markedly reduced according to Western blot analysis, further highlighting that the combination was able to break down survival pathways. The data indicate that formononetin and sorafenib are promising candidates as adjuncts in the treatment of HCC. This combination not only increased apoptotic events and decreased cellular viability but also potently disrupted key oncogenic signaling pathways more than either pharmaceutical agent when given alone. These findings justify further investigation through preclinical animal models and clinical trials to assess the efficacy and safety of this new therapeutic approach. The combination of formononetin and sorafenib represents a novel and promising approach for hepatocellular carcinoma (HCC) treatment. This study highlights how the combination of formononetin and sorafenib, through the modulation of miR-21 expression and its associated downstream pathways, significantly enhances therapeutic efficacy compared to monotherapy, suggesting a complementary interaction between the two drugs. Explanation of Observed Discrepancies: 1. Resolving Discrepancies in Single-Agent Formononetin Therapy with Combination Therapy: Single-agent Formononetin treatment of HepG2 cells showed dose-dependent cytotoxicity; however, time dependency varied between experiments. Most strikingly, pronounced time-dependent effects were found after 72 h at 10 µM and 20 µM, whereas for other concentration levels, no such dependency was found. This would indicate that at low concentrations, Formononetin could interfere with specific molecular pathways that are inhibited at high concentrations. Such discrepancies highlight the complexity of its pharmacodynamics and warrant further molecular investigation. Formononetin may activate certain molecular pathways, such as stress response or apoptosis-related mechanisms, at lower doses (10 µM and 20 µM) that require time to fully manifest. At higher concentrations, could be overloaded or inhibited by toxic effects on cellular mechanisms. On the other hand, combination therapy of Formononetin (10 µM) and Sorafenib (1 µM) showed a time-dose-dependent consistent result in the MTT assay. The cytotoxicity observed was significantly dose-dependent, and there was no significant time-related difference at 24, 48, and 72 hours. Such a consistent response suggests that the combination treatment has more stable and reproducible effects compared to monotherapy, which makes it a more effective approach for reducing cell viability in hepatocellular carcinoma. ] 2. Cell Migration: As indicated by the migration assay results, formononetin, sorafenib, and the combination of the two showed limited inhibitory effects on HepG2 cell migration. Notably, sorafenib-treated cells showed increased migration at 24 and 48 hours, which is contrary to the primary therapeutic goal of decreasing cell migration. Future studies should further apply 3D cell culture models and investigate other cell lines to better understand the tumor microenvironment and gene expression associated with migration. 3. MMP9 Gene Expression and Cell Migration Results: The expression levels of MMP9 gene were downregulated in HepG2 cells treated with either formononetin alone or in combination with sorafenib, as shown by qRT-PCR analysis. However, the results from western blot showed that MMP9 protein content was upregulated in the formononetin group. These can be explained by post-translational regulatory mechanisms such as stabilization of proteins or decreased degradation. The combination therapy, being the primary scope of the present investigation, could markedly decrease both the gene expression and protein content of MMP-9. All these results suggest its probable efficacy in inhibiting HepG2 cell migration and metastasis, following the combination therapeutic principles to treat hepatocellular carcinoma. 4. Phosphorylated AKT and ERK1/2 protein expression: Western blotting revealed a significant reduction in the ratio of phosphorylated to non-phosphorylated AKT and ERK1/2, with this being most pronounced in the combination group. The primary objective of this study was to evaluate the effect of combination therapy on signaling pathways in HepG2 cells. However, this finding does not support previous studies indicating that formononetin (when administered alone) acts as an activator of the PI3K/AKT pathway, thus promoting AKT phosphorylation. The discrepancy observed could be attributed to post-translational events of either changing kinase activities or those occurring as a consequence of concurrent treatment of formononetin with sorafenib. Most interestingly, the reduction of p-AKT and ERK1/2 suggests inhibition of the key pathways that drive cell survival and proliferation within a cancer context and also gives further indication of potential benefits from a combination therapy. 5. Enhanced Apoptotic Response in HepG2 Cells: The results indicated that although each drug alone exerted some influence on apoptosis and expression of associated genes, these were not reliably statistically significant. Most interestingly, sorafenib given alone didn't cause a significant rise in BAD gene expression. However, combination treatment led to a significant increase in BAD expression. Moreover, with the combination treatment, a marked reduction in Survivin expression was associated with an increase in apoptosis. Taken together, these results are encouraging and imply that combination therapy could be a feasible approach to hepatocellular carcinoma treatment. Conclusion These present research findings show that formononetin, especially when combined with sorafenib, might have a potential role as an effective treatment modality against HCC by blocking important survival and metastasis pathways, inducing apoptosis, and regulates critical signaling molecules. Notably, in some studies, formononetin has shown stronger anticancer effects compared to sorafenib, which means its antitumor activity cannot be entirely dependent on sorafenib. Moreover, the use of formononetin in encapsulated forms, for example, micelles or nanoparticles, provides a promising approach in targeted cancer therapy. Future research should therefore focus on animal models and clinical trials to confirm these findings and explore optimized treatment strategies for HCC. Limitations and Recommendations for Future Studies: -The study relied on in vitro cell culture models, which may not have captured all aspects of the tumor behavior in vivo. -The results need to be validated further using animal models and clinical trials. -Exploring post-translational regulatory mechanisms in cells treated with a combination of formononetin and sorafenib. -Development of nanoparticle-based delivery systems in order to improve therapeutic efficiency as well as reduce off-target effects of the formononetin and sorafenib combination. Declarations Ethics Statement: The Ethics Committee of Marvdasht Branch Islamic Azad University approved this study, and the study was performed in accordance with the approved guidelines Funding The author(s) declare that no financial support was received for the research, authorship, and/or publication of this article. Acknowledgment The authors are grateful to office of vice-chancellor for Research of Marvdasht Branch Islamic Azad University, for the support of the current study Author contributions HA, HS, MJ, MF: writing–original draft, conceptualization, methodology, formal analysis, HA, HS: writing–review and editing, investigation supervision, validation, methodology, Declaration of Interest : The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. References McGlynn KA, Petrick JL, El-Serag HB. Epidemiology of Hepatocellular Carcinoma.Hepatology.2021;73Suppl 1(Suppl 1):4-13. Mittal S, El-Serag HB. Epidemiology of hepatocellular carcinoma: consider the population. J Clin Gastroenterol. 2013;47 Suppl (0): S2-6. Gibson CM. Hepatocellular carcinoma epidemiology and demographics 2020[Available from: https://www.wikidoc.org/index.php/Hepatocellular_carcinoma_epidemiology_and_ demographics . Passerini J, Romiti A, D'Antonio C, Mastromarino V,Marchetti P, Volpe M, et al. Tailored angiogenesis inhibition in cancer therapy: respecting the heart to improve the net outcome. Current Signal Transduction Therapy. 2012;7(3):265-88. Zhu M, Sun Y, Bai H, Wang Y, Yang B, Wang Q, et al. Effects of saponins from Chinese herbal medicines on signal transduction pathways in cancer: A review. Frontiers in Pharmacology. 2023; 14:1159985. Hsieh C-J, Hsu Y-L, Huang Y-F, Tsai E-M. Molecular mechanisms of anticancer effects of phytoestrogens in breast cancer. Current Protein and Peptide Science. 2018;19(3):323-32. Torrens-Mas M, Roca P. Phytoestrogens for cancer prevention and treatment. Biology. 2020;9(12):427. Aliya S, Alhammadi M, Park U, Tiwari JN, Lee J-H, Han Y-K, et al. The potential role of formononetin in cancer treatment: An updated review. Biomedicine & Pharmacotherapy. 2023; 168:115811. Park Y, Choo SP, Jung GS, Kim S, Lee MJ, Im W, et al. Formononetin Inhibits Progression of Endometriosis via Regulation of p27, pSTAT3, and Progesterone Receptor: In Vitro and In Vivo Studies. Nutrients. 2023;15(13):3001. Tay K-C, Tan LT-H, Chan CK, Hong SL, Chan K-G, Yap WH, et al. Formononetin: a review of its anticancer potentials and mechanisms. Frontiers in pharmacology. 2019; 10:820. DAI Y, CHEN Y, CHEN Y, XU Z, DING J. Effects of Formononetin on PTEN/AKT Signaling Pathway and Angiogenesis of Transplanted Tumor in Nude Mice with Breast Cancer Cells. Indian Journal of Pharmaceutical Sciences. 2023;85(3). Wang AL, Li Y, Zhao Q, Fan LQ. Formononetin inhibits colon carcinoma cell growth and invasion by microRNA-149-mediated EphB3 downregulation and inhibition of PI3K/AKT and STAT3 signaling pathways. Molecular Medicine Reports. 2018;17(6):7721-9. Yu W, Zhu K, Wang Y, Yu H, Guo J. Overexpression of miR-21-5p promotes proliferation and invasion of colon adenocarcinoma cells through targeting CHL1. Molecular Medicine. 2018;24(1):1-12. Wang X-h, Sun Z-g, Luo L, Liu L-n, Yan J, Xuan L. Formononetin promotes apoptosis of colorectal cancer cells via activation of mitochondria-dependent MAPK pathway. Tropical Journal of Pharmaceutical Research. 2019;18(2):243-9. Yang Y, Zhao Y, Ai X, Cheng B, Lu S. Formononetin suppresses the proliferation of human non-small cell lung cancer through induction of cell cycle arrest and apoptosis. International journal of clinical and experimental pathology.2014;7(12):8453. Zhang J, Liu L, Wang J, Ren B, Zhang L, Li W. Formononetin, an isoflavone from Astragalus membranaceus inhibits proliferation and metastasis of ovarian cancer cells. Journal of Ethnopharmacology. 2018; 221:91-9. Kumarswamy R, Volkmann I, Thum T. Regulation and function of miRNA-21 in health and disease. RNA Biol. 2011;8(5):706-13. Bautista-Sánchez D, Arriaga-Canon C, Pedroza-Torres A, De La Rosa-Velázquez IA, González-Barrios R, Contreras-Espinosa L, et al. The promising role of miR-21 as a cancer biomarker and its importance in RNA-based therapeutics. Molecular Therapy-Nucleic Acids. 2020; 20:409-20. Yiying Wu, Xing Zhang, Zhengzhao Li, et al. Formononetin inhibits human bladder cancer cell proliferation and invasiveness via regulation of miR-21 and PTEN, The Royal Society of Chemistry 2017 Published on 13 January 2017. Downloaded by University of Regina on 04/02/2017 05:10:39. Changjun He, Xuesong Dong, Bo Zhai, et al. MiR-21 mediates sorafenib resistance of hepatocellular carcinoma cells by inhibiting autophagy via the PTEN/Akt pathway, Oncotarget, Vol. 6, No. 30 July 30, 2015. Pal SK, Shukla Y. Herbal medicine: current status and the future. Asian pacific journal of cancer prevention. 2003;4(4):281-8. Martínez-Sifuentes MA, Bassol-Mayagoitia S, Nava-Hernández MP, Ruiz-Flores P, Ramos-Treviño J, Haro-Santa cruz J, et al. Survivin in breast cancer: A review. Genetic Testing and Molecular Biomarkers. 2022;26(9):411-21. Quidute P, Quidute R, Perez MM, Pereira EC, Veiga GLd, Alves BdCA, et al. Survivin expression as a prognostic marker for breast cancer. Revista da Associação Médica Brasileira. 2023;69: e20230167. Chulwon Kim, Seok-Geun Lee, Woong Mo Yang, et al. Formononetin-induced oxidative stress abrogates the activation of STAT3/5 signaling axis and suppresses the tumor growth in multiple myeloma preclinical model.cancer letters (2018) S0304-3835(18)30371-9. R. Zhou, L. Xu, M. Ye, et al. Formononetin Inhibits Migration and Invasion of MDA-MB-231 and 4T1 Breast Cancer Cells by Suppressing MMP-2 and MMP-9 Through PI3K/AKT Sheik Aliya, Munirah Alhammadi, Uichang Park, et al. The potential role of formononetin in cancer treatment: An updated review, Biomedicine & Pharmacotherapy 168 (2023) 115811. Liu Yang GY, Fan Wei. Anti-hepatoma activity of targeted Pluronic F127/formononetin nanocomposite system in vitro. Chinese Journal of Tissue Engineering Research. 2021;25(4):526-31. Wu J, Kong M, Lou Y, Li L, Yang C, Xu H, et al. Simultaneous activation of Erk1/2 and Akt signaling is critical for formononetin-induced promotion of endothelial function. Frontiers in Pharmacology. 2021; 11:608518. María A. Rodríguez‐Hernández1, Raúl González1, Ángel J. de la Rosa, et al. Molecular characterization of autophagic and apoptotic signaling induced by sorafenib in liver cancer cells. J Cell Physiol. 692, wileyonlinelibrary.com/journal/jcp 2019;234:692–708. Joan Fernando, Patricia Sancho, Conrado M. Fernández-Rodriguez, et al. SORAFENIB SENSITIZES HEPATOCELLULAR CARCINOMA CELLS TO PHYSIOLOGICAL APOPTOTIC STIMULI. J Cell Physiol. 2012 April; 227(4): 1319–1325. doi:10.1002/jcp.22843. TAE-YONG HA, SHIN HWANG, KI-MYEONG MOON, et al. Sorafenib Inhibits Migration and Invasion of Hepatocellular Carcinoma Cells Through Suppression of Matrix Metalloproteinase Expression. ANTICANCER RESEARCH 35 : 1967-1976 (2015). Scott M. Wilhelm, Lila Adnane, Philippa Newell, et al. Preclinical overview of sorafenib, a multikinase inhibitor that targets both Raf and VEGF and PDGF receptor tyrosine kinase signaling. Mol Cancer Ther 2008;7(10). October 2008. Ting Wang, Yasuhiro Takikawa, Kazuyuki Suzuki, et al. Comparative analysis of sorafenib and Lenvatinib on HepG2 cells and human umbilical vein endothelial cells: Involvement of transforming growth factor‐β signaling in their molecular effects. Hepatology Research. 2024; 54:921–930. Sarkar A, Paul A, Banerjee T, Maji A, Saha S, Bishayee A, et al. Therapeutic advancements in targeting BCL-2 family proteins by epigenetic regulators, natural, and synthetic agents in cancer.European Journal of Pharmacology. 2023:175588. Xuan Zhou, Yu Ren, Lynette Moore, et al. Downregulation of miR-21 inhibits EGFR pathway and suppresses the growth of human glioblastoma cells independent of PTEN status, Laboratory Investigation (2010) 90, 144–155. Komposch K, Sibilia M. EGFR Signaling in Liver Diseases. International Journal of Molecular Sciences. 2015;17(1): E30-E. Longlong Bao , Yan Yan , Can Xu, et al. MicroRNA-21 suppresses PTEN and hSulf-1 expression and promotes hepatocellular carcinoma progression through AKT/ERK pathways. 0304-3835/$ - see front matter _ 2013 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.canlet.2013.05.007. Lacin S, Yalcin S. The prognostic value of circulating VEGF-A level in patients with hepatocellular cancer. Technology in Cancer Research &Treatment. 2020;19: 1533033820971677. Abdel-Tawab MS, Fouad H, Khalil DM, Shaaban S, Nafady S, Moawad HH, et al. The rolof miRNA-29b1, MMP-2, MMP-9 mRNAs, and proteins in early diagnosis of HCC. Egyptian Journal of Medical Human Genetics. 2023;24(1):57. Haiquan Li, Jie Zhao, Xiaomin Jia, et al. miR-21 promotes growth, invasion and migration of lung cancer cells by AKT/P-AKT/cleaved-caspase 3/MMP-2/MMP-9 signaling pathway, Int J Clin Exp Pathol 2020;13(4):692-700. Table Table 1. Primer pairs used in the current study to evaluate the gene expression using q-RT PCR Oligo name Oligo Sequence 5'--> 3' Amplicon size BAD-Forward CAACCAGCAGCAGCCATCAT 369 bp BAD-Reverse GGGCGAGGAAGTCCCTTCTTA MMP9-Forward CGTCTTCCAGTACCGAGAGAAA 216 bp MMP9-Reverse TGTATCCGGCAAACTGGCTC VEGF-Forward AGAAGGAGGAGGGCAGAATCAT 148 bp VEGF-Reverse GGGCACACAGGATGGCTTGAA EGFR-Forward TTGCCGCAAAGTGTGTAACG 142 bp EGFR-Reverse GTCACCCCTAAATGCCACCG Birc5-Forward CCAGTTTCAAAAATTCACCAAG 103 bp Birc5-Reverse GACGACCCCATAGAGGAACATA Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5856830","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":409534365,"identity":"3e2f7243-8134-4362-a2a6-9cd349e7326c","order_by":0,"name":"Hamed Abdolkarimi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7UlEQVRIiWNgGAWjYBACAxDBw8CQwHCAuRnIlGBgY29sADOI0MII1cJzkDQtIMUJ+B1mzn468cEbBrs8vuONzQY/91hE80k+bvzMw2CRj0uLZU/uZsM5DMnFkmcONif2PJPIbZNObJbmYZCwbMDlsAO524AKmBM33EhsPsBzAKylAaTFAKdfzr/d/puHoR6s5eAfkBbJg82/8Wq5kbuNmYfhMFhLMtgWCcY2/LbceLtZco7BcbBfjGVAWngS2yznGOBzWO7GD28qqoEh1nxY8s2Butz57ccf33hTUYdTC1QjESKjYBSMglEwCkgAADiUWZcdZcrGAAAAAElFTkSuQmCC","orcid":"","institution":"Islamic azad University","correspondingAuthor":true,"prefix":"","firstName":"Hamed","middleName":"","lastName":"Abdolkarimi","suffix":""},{"id":409534366,"identity":"3f118a92-b795-4a35-9f8c-6dba885249ed","order_by":1,"name":"Mojtaba Jafarinia","email":"","orcid":"","institution":"Islamic azad University","correspondingAuthor":false,"prefix":"","firstName":"Mojtaba","middleName":"","lastName":"Jafarinia","suffix":""},{"id":409534367,"identity":"d7b1f0c5-77dc-46b1-8e8d-90787b75cfc1","order_by":2,"name":"Hossein Sadeghi","email":"","orcid":"","institution":"Yasuj University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Hossein","middleName":"","lastName":"Sadeghi","suffix":""},{"id":409534368,"identity":"ad636c88-135a-4c0c-a5e2-45125e18fbd2","order_by":3,"name":"Mohsen Forouzanfar","email":"","orcid":"","institution":"Islamic azad University","correspondingAuthor":false,"prefix":"","firstName":"Mohsen","middleName":"","lastName":"Forouzanfar","suffix":""}],"badges":[],"createdAt":"2025-01-18 20:23:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5856830/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5856830/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":75347107,"identity":"56ce12bd-1296-4159-9891-91c3cda12c26","added_by":"auto","created_at":"2025-02-03 15:24:03","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":211150,"visible":true,"origin":"","legend":"\u003cp\u003eWorkflow of experimental procedures used in the study:\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5856830/v1/95b6ef394b5644fdd7a76485.png"},{"id":75347082,"identity":"da625461-6c25-497c-ace5-3d7e39709c7c","added_by":"auto","created_at":"2025-02-03 15:24:02","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":85646,"visible":true,"origin":"","legend":"\u003cp\u003eMTT assay result of treated HepG2 cells. Optical density changes determined for each culture well containing HepG2 cells in control group or treatment with Sorafenib at 24 hours (A; blue line), 48 hours (A; orange line), or 72 hours (A; gray line) (\u003cstrong\u003eFigure 2-a)\u003c/strong\u003e. Also, HepG2 cells were treated with formononetin for 24 hours (B; blue line), 48 hours (B; orange line), and 72 hours (B; gray line) (\u003cstrong\u003eFigure 2-b)\u003c/strong\u003e. \u0026nbsp;Furthermore, HepG2 cells were treated with various concentrations of formononetin plus 1μM sorafenib for 48 hours and the MTT assay performed. One can observe continuous decrease of optical density in \u003cstrong\u003eFigure 2-c\u003c/strong\u003e in a dose dependently manner.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5856830/v1/b17dca711b8bd804332dae72.png"},{"id":75347081,"identity":"7b4307d4-3c9f-4259-86e7-d166752d46aa","added_by":"auto","created_at":"2025-02-03 15:24:02","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":101518,"visible":true,"origin":"","legend":"\u003cp\u003eIt illustrates the outcomes of the trypan blue exclusion assay conducted on the HepG2 cells across both control and treatment groups. The viability of the untreated HepG2 cells remained stable over time, maintaining levels close to the maximum even after 120 hours. However, the cytotoxic impacts associated with sorafenib, formononetin, and their combined application increased progressively over time in HepG2 cells. Among all treatments, the combination treatment exhibited the highest degree of toxicity (\u003cstrong\u003eFigure 3-a). \u003c/strong\u003e\u0026nbsp;Tukey HSD test results illustrating mean differences between treatment groups in HepG2 cells. It indicates that the combination treatment showed a significant difference compared to the control group (p = 0.0006), while other comparisons were not statistically significant \u003cstrong\u003e(Figure 3-b).\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5856830/v1/dd32c856f91c21991a72abef.png"},{"id":75347080,"identity":"7c6e510a-da3f-4490-8eaf-59133ae0533b","added_by":"auto","created_at":"2025-02-03 15:24:02","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":217138,"visible":true,"origin":"","legend":"\u003cp\u003eResults of colony formation by HepG2 cells treated by sorafenib, formononetin, or their combination. Compared with untreated cells, formononetin, sorafenib and combination therapy inhibited the formation of colonies by HepG2 cells after two weeks treatment with shown concentrations (\u003cstrong\u003eFigure 4-a).\u003c/strong\u003e Results of the Tukey HSD test showing colony count comparisons between groups. The combination of Sorafenib and Formononetin (1+10 µM) exhibited the most significant effect on colony formation (p \u0026lt; 0.05) (\u003cstrong\u003eFigure 4-b).\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5856830/v1/4a7be3aaf1a43486eabec2e0.png"},{"id":75347112,"identity":"064787c5-b3ea-428c-bec7-28d378d8c996","added_by":"auto","created_at":"2025-02-03 15:24:03","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":305992,"visible":true,"origin":"","legend":"\u003cp\u003eDAPI staining for determination of apoptotic cells in untreated HepG2 cells, or treated cells with 10μM formononetin, 1μM sorafenib, or a combination of 1μM sorafenib plus 10μM formononetin (48 hours)\u003cstrong\u003e (Figure 5-a).\u003c/strong\u003e For each evaluation 3 separate wells were considered and the percentage of apoptotic cells calculated against total cell count in each microscopic field. Compared to control group, formononetin induced apoptosis of HepG2 cells. The apoptosis induction effect of sorafenib was higher than formononetin but lesser than combination of but chemicals (\u003cstrong\u003eFigure 5-b).\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-5856830/v1/f502bbdf6c228ed0f47c26fb.png"},{"id":75347578,"identity":"289a5411-240c-46f3-a089-f8ec1c53030e","added_by":"auto","created_at":"2025-02-03 15:32:03","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":232510,"visible":true,"origin":"","legend":"\u003cp\u003eComparing of expression folds of miR-21\u003cstrong\u003e(A),\u003c/strong\u003e Birc5 (surviving), EGFR\u003cstrong\u003e(B),\u003c/strong\u003eVEGF \u003cstrong\u003e(C),\u003c/strong\u003e BAD \u003cstrong\u003e(D),\u003c/strong\u003e and MMP9 \u003cstrong\u003e(E)\u003c/strong\u003e genes in control and treated HepG2 cells. Compares to control group, semiquantitative PCR shows that sorafenib or its combination with formononetin decreases miR-21 expression, significantly. Survivin folds were decreased meaningfully after treatment with each of chemicals or their mixture. Also, EGFR, VEGF and MMP9 were decreased, but just only significantly after treatment with formononetin and its combination with sorafenib. BAD expression folds were increased after treatment with chemicals, but only this increment was significant for the combination of sorafenib plus formononetin. Significant results are indicated by red and green arrows for comparison of each group with control category \u003cstrong\u003e(Figure6-F).\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-5856830/v1/b26d43872092ff6d4b37af8f.png"},{"id":75347115,"identity":"3145719b-889b-42b0-bf63-9abd16c80a68","added_by":"auto","created_at":"2025-02-03 15:24:03","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":223820,"visible":true,"origin":"","legend":"\u003cp\u003eThe control value was set as the reference group (value = 1). After 48 h of treatment of HepG2 cells with either formononetin or sorafenib alone or in combination, the cells were detached and then processed for western blot analysis. Protein contents of non-phosphorylated ERK1/2 was slightly higher in treatment group than control HepG2 cells whereas phosphorylated ERK1/2 ratio and p-ERK1/2/ERK1/2 was low in formononetin, lower in sorafenib and lowest in combination treated cells, compared to control cells.\u003cstrong\u003e (Figure 7-a)\u003c/strong\u003epresents comparative graphs of apoptosis-related proteins, including Bad, Survivin, Cleaved Caspase-3, Pro Caspase-3, and the Cleaved Caspase-3/Pro Caspase-3 ratio.\u003cstrong\u003e (Figure 7-b) \u003c/strong\u003edisplays Western blot bands corresponding to the expression of these five proteins.\u003cstrong\u003e(Figure 7-c) \u003c/strong\u003eillustrates the graphs of signaling pathway proteins, including Akt, p-Akt, and the p-Akt/Akt ratio, as well as Erk1/2, p-Erk1/2, and the p-Erk1/2/Erk1/2 ratio.\u003cstrong\u003e (Figure 7-d) \u003c/strong\u003eshows the corresponding Western blot bands related to panel (c). \u003cstrong\u003e(Figure 7-e) \u003c/strong\u003edisplays proteins involved in angiogenesis (\u003cem\u003eVEGF-A\u003c/em\u003e) and matrix remodeling (\u003cem\u003eMMP-9\u003c/em\u003e).\u003cstrong\u003e (Figure 7-f)\u003c/strong\u003epresents the corresponding Western blot bands for these two proteins.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-5856830/v1/d8e3746139475b8a07af636c.png"},{"id":79886320,"identity":"09dd1121-a121-47c9-9ff0-084ae718fb5a","added_by":"auto","created_at":"2025-04-04 06:04:45","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2462523,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5856830/v1/62c89446-73e7-4131-8ae8-b29d3dadfee3.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Evaluation of the effect of biochanin b and Sorafenib on cell survival, growth, migration, colony formation and apoptosis in hepatocellular carcinoma","fulltext":[{"header":"Introduction","content":"\u003cp\u003eHepatocellular carcinoma (HCC) accounts for 75% of all liver cancers, making it the fifth most common cancer in men and the seventh in women globally. Annually, over half a million new cases are diagnosed, with a poor survival rate of 3 to 6 months post-diagnosis. HCC is the second leading cause of cancer-related deaths in the world (1-3). Key Molecular pathways implicated in HCC include dysregulation of PI3K/AKT, JAK-STAT, and VEGFR signaling and some genes included BIRC5 (survivin), MMP9 playing a critical role (4).\u003c/p\u003e\n\u003cp\u003eRecent research using tissue culture models and animal experiments has emphasized the anticancer properties of medicinal plants, which interact with proteins involved in signal transduction, apoptosis, and cell cycle regulation (5). Especially medicinal plants like phytoestrogens such as biochanin b (also known as formononetin, C16H12O4; 7-hydroxy,4\u0026prime;-methoxy isoflavone) have gained much attention because of their potential anticancer effects. Its role in the treatment of cancer has been studied in many other malignancies (6-8). However, its effects on HCC remain under investigated. Formononetin can alter the signaling process in cancer cells (9-10). Therefore, it is proposed for cancer therapy because of its plenty of functions and intracellular targets. Favorable effect of formononetin on inhibition, proliferation and metastasis of various cancer cells has been elucidated (6). Formononetin has been shown to inhibit the proliferation and invasion of various cancer cells, including breast, colon, colorectal, non-small cell lung, and ovarian cancer cells (11-16). However, its detailed molecular mechanisms in hepatocellular carcinoma (HCC) are still not well defined and require further investigation. The present study is designed to investigate the effect of formononetin on cell growth, metabolism, and apoptosis-related signaling in HepG2 cells, comparing its effects with sorafenib both in combination and as single drugs.\u003c/p\u003e\n\u003cp\u003eMicroRNA-21 (miR-21) is a key regulator of cellular processes, and its deregulation is associated with the development of various diseases, including cancer cardiovascular diseases, or inflammation induction. Overexpression of miR-21 has been implicated in tumorigenesis and is linked to poor prognosis in several cancers (17,18). Formononetin has been shown to significantly downregulate miR-21 expression, inhibit Akt phosphorylation in a dose-dependent manner, and induce apoptosis. It inhibits T24 cells proliferation and invasion (19). miR-21 expression, decreased PTEN expression and sequentially activates Akt. Sorafenib activates Akt. treatment of sorafenib led to the downregulation of PTEN, increased activation of Akt and caspase-3. miR-21 is believed to be a promising therapeutic target for overcoming sorafenib resistance in the treatment of HCC (20). Targeting this microRNA could improve the therapeutic outcomes in this type of cancer. Formononetin, Sorafenib, and miR-21 have been studied together due to the common pathways of action demonstrated in previous studies. This could give new insight into the combined therapeutic potential of these molecules in HCC and might lead to new ways of developing more effective treatment strategies.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e1. Cell line and culture conditions:\u003c/h2\u003e \u003cp\u003eHepG2 cells were obtained from the Iranian Pasture Institute, Tehran, Iran. The cell culture medium EMEM supplemented with Fetal Bovine Serum (FBS) and Penicillin-Streptomycin (PenStrep) antibiotic solution was also obtained from DENA Molecular Biology Products, Mashhad, Iran (Cat numbers S-8054, S-8060, S-8062-5mL, respectively). HepG2 cells were grown in 6-well plates containing three independent replicates in each condition at different times including 24, 48, and 72h. The cells were cultured in EMEM supplemented with 10% FBS and 0.1% PenStrep, and the cells were incubated in a humidified incubator maintained at 37\u0026deg;C and 5% CO2. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e provides a graphical summary of this step and the subsequent procedures conducted in this study.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe experimental workflow includes the following steps: cell culture, MTT assay for cytotoxicity evaluation, IC50 determination, trypan blue exclusion assay, colony formation assay, DAPI staining for apoptosis detection, scratch assay for cell migration analysis, RNA extraction followed by qRT-PCR and real-time PCR for gene expression analysis, and Western blotting for protein level assessment. This diagram summarizes the methodology employed to investigate the effects of Formononetin and Sorafenib and their combination on HepG2 cells.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e2. The MTT assay:\u003c/h3\u003e\n\u003cp\u003eThe EMEM medium supplemented with 10% FBS and 0.1% Pen-Strep antibiotic was used to test the effect of formononetin, sorafenib, and their combination on HepG2 cells by using MTT assay. Final concentration of formononetin tested was as follows: 1 \u0026micro;M, 1.25 \u0026micro;M, 2.5 \u0026micro;M, 5 \u0026micro;M, 10 \u0026micro;M, 20 \u0026micro;M, 40 \u0026micro;M, 80 \u0026micro;M, 160 \u0026micro;M, 320 \u0026micro;M, and 640 \u0026micro;M. The concentrations used for sorafenib were 0.01 \u0026micro;M, 0.125 \u0026micro;M, 0.25 \u0026micro;M, 0.5 \u0026micro;M, 1 \u0026micro;M, 2 \u0026micro;M, 4 \u0026micro;M, 8 \u0026micro;M, 16 \u0026micro;M, 32 \u0026micro;M and 64 \u0026micro;M. To validate the data, the cells in the logarithmic phase of growth were used. MTT assay was done according to the protocol provided by the manufacture (DNAbiotech, Iran). Briefly, 5 mg/ml MTT reagent in PBS was added to each well, and the plates were incubated at 37\u0026deg;C for 4 h. After incubation, the supernatant was carefully removed, and DMSO was added to dissolve the formazan crystals. The optical density (OD) of each well was measured at 570 nm using a microplate reader. Cell viability percentages were calculated relative to untreated cells, which served as the control group.\u003c/p\u003e \u003cp\u003eData are expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE of three independent experiments using Excel software (version 2017). In addition, a dose-response curve was plotted with percentages of viable cells against the logarithmic concentrations of compounds; then, nonlinear regression analyses for the IC50 values were calculated using Prism software (version 8.0).\u003c/p\u003e\n\u003ch3\u003e3.\tCell Viability of HepG2 cell line treated with sorafenib, formononetin, or their combination:\u003c/h3\u003e\n\u003cp\u003eHepG2 cells were exposed to 1 \u0026micro;M sorafenib, 10 \u0026micro;M formononetin, or the combination of both (1 \u0026micro;M sorafenib\u0026thinsp;+\u0026thinsp;10 \u0026micro;M formononetin) for 24, 48, 72, 96, and 120 hours. Cell viability was determined by the trypan blue exclusion assay. Following the treatment periods, 800 \u0026micro;L of each treated cell suspension was plated to 24-well plates. The cells were detached by incubation with a 0.25% trypsin-EDTA solution (GIBCO) and then resuspended in complete medium.\u003c/p\u003e \u003cp\u003eTo determine cell viability, 0.4% trypan blue solution was used and viable cells were counted manually by using a hemocytometer. Comparative viability graphs were made in Excel (version 2017). Each experiment was repeated thrice to ensure the results were consistent and reliable.\u003c/p\u003e\n\u003ch3\u003e4. Colony Formation:\u003c/h3\u003e\n\u003cp\u003eThe culture wells were divided into four sets of treatment in order to examine the colony-forming ability of HepG2 cells: untreated cells (negative control), cells treated with 10 \u0026micro;M formononetin, 1 \u0026micro;M sorafenib, and combined treatment with 1 \u0026micro;M sorafenib and 10 \u0026micro;M formononetin. These treatments lasted for 48 hours. After treatment incubation time, the culture medium was removed carefully, and the cells were gently washed with ice-cold PBS to remove any residual compounds. The cells were fixed with absolute methanol for 15 minutes and stained using a 0.1% solution of crystal violet for 30 minutes.\u003c/p\u003e \u003cp\u003eAfter staining, excess dye was removed by washing the cells twice with PBS. Colonies, defined as aggregations of more than 50 cells, were examined and counted using a light microscope at 400\u0026times; magnification. The size and number of these colonies were recorded for further analysis. Control groups included untreated cells as a negative control and cells treated with Cisplatin as a positive control to validate the assay. To ensure reproducibility and reliability, the experiment was conducted in triplicate. The colony formation efficiency was measured and then analyzed using ImageJ software (version 2.0.0-rc-3).\u003c/p\u003e\n\u003ch3\u003e5. DAPI staining: Apoptosis Evaluation\u003c/h3\u003e\n\u003cp\u003eHepG2 cells were grouped into four different treatment groups: untreated controls, cells treated with 10 \u0026micro;M formononetin, cells treated with 1 \u0026micro;M sorafenib, and cells treated with a combination of 10 \u0026micro;M formononetin and 1 \u0026micro;M sorafenib. After 48 hours of treatment time, the cells were washed with ice-cold PBS to remove the remaining residual media and treatment compounds.\u003c/p\u003e \u003cp\u003eNext, the cells were fixed with 4% paraformaldehyde at room temperature for 15 min. They were then stained with 0.5 \u0026micro;g/mL 4,6-diamidino-2-phenylindole (DAPI) solution for 30 minutes in a dark environment to avoid photobleaching.\u003c/p\u003e \u003cp\u003eFluorescence microscopy (NCF950) was used to assess apoptotic cells by examining nuclear features, including condensation, fragmentation, and the presence of apoptotic bodies. The detection of apoptotic cells was based on these distinctive nuclear alterations. Images were quantified using ImageJ software (version 2.0.0-rc-3), and the results were compared between the various treatment groups. The experiment was done in triplicate to ensure the results' reliability and reproducibility.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e6. Cell migration assay by scratch method:\u003c/h2\u003e \u003cp\u003eScratch assay, a well-developed method to test the ability of tumor cells to migrate, was performed to determine whether formononetin, sorafenib, or the combination could inhibit the migration of HepG2 cells. This assay provides important information on the invasive and metastatic properties of malignant cells, which are critical in the development of tumors. The method was adapted from Liang et al. (21).\u003c/p\u003e \u003cp\u003eBriefly, HepG2 cells were cultured in T-75 flasks with appropriate growth medium supplemented as per requirements till they reached nearly 95% confluence. Using a sterile scraper, a uniform scratch was created through the cell monolayer to simulate a wound. The control flasks were incubated without any treatment, while the treatment groups were exposed to 10 \u0026micro;M formononetin, 1 \u0026micro;M sorafenib, or a combination of 10 \u0026micro;M formononetin and 1 \u0026micro;M sorafenib. Images of the scratch area were taken at 0, 12, 24 and 48-hours post-scratching using a light microscope.\u003c/p\u003e \u003cp\u003eThe scratch width was measured and analyzed with ImageJ software (version 2.0.0-rc-3). The control group without any treatment of cells was set as the standard to represent 100% migration at every time point, and the treatment groups calculated their migration ratios relative to the control group to evaluate the impact of compounds on cell migration. The experiment was performed in triplicates to get reproducibility and reliability.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e7. RNA Extraction and qRT-PCR Analysis:\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from HepG2 cells after 48-hour incubation in the indicated experimental groups using the Total RNA Extraction Kit (Qiagen, Cat. No. 74104) according to the manufacturer's instructions. Synthesis of complementary DNA (cDNA) was performed using the cDNA Synthesis Kit (Takara, Dalian, China) following the provided protocol.\u003c/p\u003e \u003cp\u003eReal-time quantitative PCR (qRT-PCR) was performed on an ABI Plus One Real-Time PCR System (Applied Biosystems, USA) using primers specifically designed for miR-21, BIRC5 (Survivin), EGFR, VEGF-A, BAD, and MMP9 genes. Primer sequences were optimized to ensure specificity and amplification efficiency.\u003c/p\u003e \u003cp\u003eNormalization of gene expression levels was carried out with appropriate housekeeping gene, and relative quantification of target genes was determined with the 2^\u0026minus;ΔΔCt method. The experiment was conducted in triplicates for ensuring reliability and reproducibility of the results.\u003c/p\u003e\n\u003ch3\u003e8. Western Blot Analysis:\u003c/h3\u003e\n\u003cp\u003eWestern blotting was performed for semi-quantitative analysis of the gene expression of bad, vegf-a, egfr, mmp9, Survivin, pro caspase-3, erk1/2 and akt. In brief, following a 48-hour incubation period using HepG2 cells, total cellular proteins from both the control and treatment groups were extracted using RIPA buffer (Sigma-Aldrich, St. Louis, MO, USA), with a protease inhibitor cocktail (Sigma-Aldrich, Cat. No. P8340) to prevent protein degradation. Protein concentrations were determined by the Bradford assay (Pierce, Rockford, IL, USA), following the manufacturer's instructions.\u003c/p\u003e \u003cp\u003eProteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) (Laemmli, 1970) on 10% gels, and the separated proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Invitrogen, Cat. No. IPVH00010) using a wet transfer system (Bio-Rad, Hercules, CA) at 100 V for 1 hour. The membranes were then blocked with 5% non-fat milk (w/v) in Tris-buffered saline with Tween-20 (TBST) for 1 hour at room temperature to reduce non-specific binding.\u003c/p\u003e \u003cp\u003eThe membranes were subsequently subjected to overnight incubation with primary monoclonal antibodies specific to the target proteins at 4\u0026deg;C. After three washes in TBST, membranes were incubated with HRP-conjugated secondary antibodies (goat anti-rabbit IgG; diluted 1:1000) for 1 hr at room temperature. After that, protein bands were visualized by ECL detection reagents (Thermo Scientific, Waltham, MA, USA); X-ray films (Thermo Scientific, Cat. No. 34090) were exposed for visualization. Band intensity was quantified using TotalLab software (version 1.3.1). The murine monoclonal anti-actin antibody (Proteintech, Cat. No. 66009-1-Ig, dilution 1:2000) was used as an internal control for normalizing protein expression levels. All Western blot experiments were performed in triplicate so that results could be comparable and reproducible.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e9. Statistical Analysis:\u003c/h2\u003e \u003cp\u003eData were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD, which were derived from repeated experimental tests for each group. One-way ANOVA was used to analyze parametric data from more than two groups. Repeated measure analysis was performed to test the effect of duration of treatment on viability in HepG2 cells treated with various concentrations of sorafenib, formononetin, or their combination. All statistical analyses and graph generations were performed with SPSS software (version 26) and Microsoft Excel (version 2019).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e1. Survival of HepG2 cell line (MTT assay):\u003c/h2\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e shows the optical density of MTT assay indicating the survival of HepG2 cells treated with various concentrations of sorafenib \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e-A\u003cb\u003e)\u003c/b\u003e, and formononetin \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e-B\u003cb\u003e)\u003c/b\u003e for 24 h, 48 h, and 72 h. In addition, a combination of various concentrations of formononetin plus 1 \u0026micro;M sorafenib was assessed \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e-C\u003cb\u003e)\u003c/b\u003e. Higher concentration of each chemical showed higher toxicity. In fact, each concentration of sorafenib or formononetin had its highest toxicity independently of the exposure time. Therefore, the effect of tested concentrations of sorafenib, formononetin, or their combination on HepG2 cell survival is dose-dependent. Also, the cytotoxic effect of various concentrations of formononetin and sorafenib were not time dependent at 24 hour, or 48 hour or 72 hours (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), except for HepG2 cells which were treated with formononetin with 10 \u0026micro;M (p\u0026thinsp;=\u0026thinsp;0.049) or 20 \u0026micro;M (p\u0026thinsp;=\u0026thinsp;0.007). IC50 of formononetin-treated HepG2 cells was gained after 19.04 hour with a concentration of 5 \u0026micro;M.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2. Viability of HepG2 cell:\u003c/h2\u003e \u003cp\u003eThe HepG2 cells was treated with 1 \u0026micro;M sorafenib, 10 \u0026micro;M formononetin, or combined treatment with 1 \u0026micro;M sorafenib and 10 \u0026micro;M formononetin for 24 hours, 48 hours, 72 hours, 96 hours and 120 hours. The cell viability was examined by the trypan blue exclusion test. Control has the highest percentage of viable cells compared to all treated groups. Combination therapy exhibited the highest cytotoxicity in HepG2 cells. Further, the toxicity of the tested compounds was not time-dependent. The results table is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u0026thinsp;\u003cb\u003e\u0026minus;\u0026thinsp;1\u003c/b\u003e. The results from the statistical analysis are presented below: The Shapiro-Wilk test used to examine normality illustrated that each group was distributed normally since the p-value for each group was over 0.05 and hence met the data requisites for further analysis. The one-way ANOVA analysis indicated there was a significant difference between groups, with a p-value\u0026thinsp;=\u0026thinsp;0.00118; in particular, the comparisons between Control and Sorafenib\u0026thinsp;+\u0026thinsp;Formononetin showed a p-value\u0026thinsp;=\u0026thinsp;0.0006, showing a high effect of this combined treatment on Cell Viability. All other comparisons, Control vs. Formononetin and Control vs. Sorafenib, did not show statistically significant results. Finally, the Tukey's HSD test confirmed that the only significant difference was obtained between the Control group and the Sorafenib\u0026thinsp;+\u0026thinsp;Formononetin groups with p-value\u0026thinsp;=\u0026thinsp;0.0006. These results demonstrated that the combination of Sorafenib and Formononetin significantly has a role in the process of Cell Viability reduction while no significant differences in any other groups compared with the control group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u0026thinsp;\u003cb\u003e\u0026minus;\u0026thinsp;2)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3. Colony formation:\u003c/h2\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e represents the results of colony formation by HepG2 cells after two-weeks treatment with 1 \u0026micro;M sorafenib, 10 \u0026micro;M formononetin and their combination (1 \u0026micro;M sorafenib and 10 \u0026micro;M formononetin). HepG2 cells developed 76 colonies after two weeks whereas formononetin-treated and sorafenib-treated HepG2 cells formed 59 and 53 colonies, respectively. The combination of both chemicals inhibited the colony formation by HepG2 cells more effectively (49 colonies) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u0026thinsp;\u003cb\u003e\u0026minus;\u0026thinsp;1)\u003c/b\u003e. The results of this study indicate that the combination treatment of Sorafenib and Formononetin significantly reduced colony formation. The ANOVA test revealed a highly significant difference between the groups (p-value of 3.72e-09), confirming the substantial effect of the treatments on colony number. Further analysis using the Tukey HSD test specifically highlighted that the combination group had the greatest impact on reducing colony formation, showing a significant decrease compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), Sorafenib (p\u0026thinsp;=\u0026thinsp;0.005), and Formononetin (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). These findings suggest that the combination of Sorafenib and Formononetin is the most effective treatment for reducing colony formation, emphasizing the synergistic effects of these compounds in inhibiting cell growth \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u0026thinsp;\u003cb\u003e\u0026minus;\u0026thinsp;2)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e4. Apoptosis:\u003c/h2\u003e \u003cp\u003eHepG2 cells were subjected to 10 \u0026micro;M formononetin, 1 \u0026micro;M sorafenib, or a combination of 10 \u0026micro;M formononetin plus 1\u0026micro;M sorafenib. Following evaluation of the apoptotic cells using DAPI staining. In the control group, a minimal number of apoptotic nuclei are observed, with most nuclei displaying a normal, uniform structure without significant chromatin condensation or fragmentation. Treatment with 10 \u0026micro;M Formononetin results in a noticeable increase in apoptotic nuclei, characterized by clear chromatin condensation and nuclear fragmentation. Similarly, exposure to 1 \u0026micro;M Sorafenib induces a significant number of apoptotic nuclei, with prominent signs of chromatin condensation and fragmentation compared to both the control group and the formononetin group. The combination of 10 \u0026micro;M Formononetin and 1 \u0026micro;M Sorafenib shows the highest level of apoptosis, with extensive chromatin condensation, nuclear fragmentation, and apoptotic bodies \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e-a\u003cb\u003e)\u003c/b\u003e. These findings are further supported by the apoptosis percentage graph, added alongside the microscopy images \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e-b\u003cb\u003e)\u003c/b\u003e, where the control group shows the lowest apoptosis rate, both Formononetin and Sorafenib treatments demonstrate significant increases, and the combination therapy achieves the highest apoptotic effect, indicating enhanced efficacy when used together.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e5. Cell Migration:\u003c/h2\u003e \u003cp\u003eFormononetin, sorafenib and their combination were not so effective in the inhibition of HepG2 cell migration when compared to initial hours of evaluation. After 12 hours, only sorafenib reduced the migration rate of HepG2 cells. But, after 24 hours and 48 hours the migration of sorafenib-treated cells was increased considerably. Overall, it seems that tested chemicals cannot prevent HepG2 cell migration.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e6. Gene expression changes:\u003c/h2\u003e \u003cp\u003eIn all treatment groups, miR-21 expression folds were decreased significantly compared to control group, except in formononetin-treated HepG2 cell that was insignificant. But, survivin folds were diminished meaningfully in treatment than control categories.\u003c/p\u003e \u003cp\u003eFormononetin and its combination with sorafenib decreased EGFR, VEGF-A and MMP9 significantly, whereas sorafenib decreased them insignificantly. BAD folds were increased in treatment HepG2 cells than untreated ones but this increment was meaningful only in combination formula-exposed cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. The significance of the expression results for each gene across the four groups was calculated using ANOVA, and the p-value was indicated in the top-right corner alongside the real-time PCR chart in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e for each gene.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e7. Western Blot:\u003c/h2\u003e \u003cp\u003eFormononetin, sorafenib and their combination increased the contents of BAD, cleaved caspase-3, and the ratio of caspase-3/procaspase-3; in these cases, sorafenib had a potent effect than formononetin and the combination of sorafenib plus formononetin was more potent than single agents. After treatment with formononetin, HepG2 cells expressed reduced levels of VEGF-A, Survivin, cleaved caspase-3, p-ERK1/2, p-ERK1/2/ERK1/2, and p-AKT/AKT proteins as well as their respective ratios. This reduction was further enhanced in HepG2 cells treated with sorafenib, and the greatest reduction was found in cells treated with combination therapy.\u003c/p\u003e \u003cp\u003eThe highest contents of EGFR, procaspase-3, p-ERK1/2, and p-AKT were exist in control HepG2 cells. Compared to control group, the EGFR was reduced in treated HepG2 cells thereabout in a similar content. Procaspase-3 contents were reduced in treatment groups where sorafenib-treated cells had more contents than formononetin or combination treatments; the lowest contents were in HepG2 cells treated with the mixture of both drugs. The most reductive effect on ERK1/2 protein and p-ERK1/2/ERK1/2 contents and ratio were seen for the combination of formononetin plus sorafenib. Formononetin-treated cells had higher contents of MMP9 protein than control, sorafenib or combination groups. But treated cells with Sorafenib and combination formula shown lower contents of MMP9 than control group. AKT contents in HepG2 cells was not changed considerably when comparing the control and treatment groups \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003e\u003cstrong\u003eGeneral\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eOverview\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eof\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ethe Discussion:\u003c/strong\u003e\u003cbr\u003eThe current study examined the effects of formononetin, sorafenib, and their combined use on the HepG2 cancer cells in terms of cell viability, apoptosis, migratory ability, colony formation, as well as expression levels of key genes and proteins. The findings demonstrated that both drugs, when used alone and in combination, exerted anti-proliferative and pro-apoptotic effects, although the combined treatment produced the most significant effects.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnalysis of Findings Based on Research Objectives:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e1. Effect of Formononetin alone:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFormononetin alone significantly downregulates miR-21 and is also capable of dose-dependently inhibiting Akt phosphorylation, which, in turn, induces apoptosis. It also inhibits proliferation and invasion of T24 cells (19). Survivin is an apoptosis-inhibitory protein and a useful prognostic marker of breast cancer, as revealed in several recent studies (22, 23). Formononetin down-regulated the expression of several other anti-apoptosis mRNA and proteins such as survivin, and inhibitors of apoptosis proteins (IAP-2). There is a significant dose-dependent activation of caspase-3 by formononetin in U266 cells. We found a significant concentration-dependent activation of caspase-3 by formononetin in tumor tissues. They found that formononetin downregulates the expression of VEGF in a dose-dependent manner (24). In vitro experiments showed that formononetin reduced the expression of matrix metalloproteinase-2 (MMP-2) and MMP-9. Moreover, formononetin significantly inhibited the phosphorylation of Akt and PI3K. Taken together, these findings indicate that formononetin inhibited migration and invasion of breast cancer cells through downregulating the expression of MMP-2 and MMP-9 via the PI3K/Akt signaling pathway (25).\u003c/p\u003e\n\u003cp\u003eFormononetin affects the tumor microenvironment through the inhibition of ERK1/2, AKT, and MAPK signaling pathways, consequently suppressing cell migration, invasion, and angiogenesis (26). Further, formononetin treatment modified apoptosis-related proteins, such as cleaved caspase-3, bax, and bcl-2 (27). The phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt) and extracellular signal-regulated kinase 1/2 (Erk1/2) signaling pathways function in a multitude of purposes in the growth, proliferation, differentiation, metabolism, and survival of a wide variety of cells and tissues (28). Formononetin has shown strong anti-cancer effects through downregulating the expression of miR-21, inhibiting Akt phosphorylation in dose-dependent manner, and promoting apoptosis. It also decreases anti-apoptotic proteins, including survivin and IAP-2, while activating caspase-3 in tumor tissues at the same time. Formononetin also inhibits MMP-2 and MMP-9 levels, thereby preventing the migration and invasion abilities of cancer cells by regulating the PI3K/Akt signaling pathway. Moreover, it alters the microenvironment of the tumor by switching off the ERK and AKT pathways and repressing cell migration, invasion, and angiogenesis. These findings suggest that formononetin may serve as a promising therapeutic agent in cancer treatment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2. Effect of Sorafenib alone:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSorafenib decreased tumor volume accompanied by an increase of caspase‐3 activity in nude mice implanted with HepG2 cells.\u0026nbsp;The progressive increase of CHOP (enhancer binding protein-homologous protein along\u0026nbsp;with\u0026nbsp;decreased ratios\u0026nbsp;of Thr308P‐AKT/AKT and Ser473P‐AKT/AKT,\u0026nbsp;was\u0026nbsp;associated with\u0026nbsp;a\u0026nbsp;reduced\u0026nbsp;autophagic flux and an\u0026nbsp;increased\u0026nbsp;caspase‐3 activity. Sorafenib may\u0026nbsp;also\u0026nbsp;indirectly\u0026nbsp;regulate\u0026nbsp;BAD activity\u0026nbsp;through\u0026nbsp;the\u0026nbsp;downregulation of\u0026nbsp;the anti-apoptotic protein Mcl-1 and\u0026nbsp;the\u0026nbsp;upregulation of\u0026nbsp;pro-apoptotic proteins,\u0026nbsp;thereby shifting the balance toward apoptosis in HepG2 cells (29).\u003c/p\u003e\n\u003cp\u003eThe influence of sorafenib on survivin, a member of the inhibitor of apoptosis (IAP) family, seemed to be dependent on duration of drug exposure. Shortly after sorafenib application protein levels were reduced; however, at more prolonged times of drug exposure, transcription seems to be reduced (30).\u0026nbsp;Sorafenib inhibits MMP9 expression and activity in HGF-induced hepatocellular carcinoma models. This suppression is associated with reduced JNK phosphorylation, emphasizing\u0026nbsp;the\u0026nbsp;role\u0026nbsp;of Sorafenib\u0026nbsp;in\u0026nbsp;inhibiting\u0026nbsp;tumor\u0026nbsp;growth\u0026nbsp;and epithelial-mesenchymal transition (EMT) (31).\u0026nbsp;Sorafenib exerts dual regulatory effects on VEGF signaling by directly inhibiting VEGF secretion and VEGF receptor (VEGFR-1, VEGFR-2, VEGFR-3) subsequently\u0026nbsp;inhibiting\u0026nbsp;angiogenesis\u0026nbsp;while\u0026nbsp;promoting apoptosis. However, under certain conditions, sorafenib may enhance TGF-\u0026beta;-induced VEGFR2 activation and angiogenesis, indicating a context-dependent interplay between TGF-\u0026beta; and VEGF pathways (32,33).\u003c/p\u003e\n\u003cp\u003eSorafenib influences vital genes and signaling pathways, such as BAD, MMP-9, VEGF, EGFR, BIRC5 (survivin), caspase-3, ERK, and AKT. Sorafenib reduces the tumor volume by increasing the activation of caspase-3, which promotes apoptosis. Sorafenib shifts the balance toward cell death by downregulating the anti-apoptotic protein Mcl-1 while increasing pro-apoptotic proteins such as BAD. Bcl-2 associated death promoter (BAD) acts as an initiator of the apoptotic process (34) and its increase results in cell death induction. sorafenib inhibits MMP-9 activity, which suppresses tumor invasion and epithelial-mesenchymal transition (EMT). This drug also inhibits VEGF secretion and its receptor activation, which inhibits angiogenesis, and modulates EGFR signaling. In addition, Sorafenib down-regulates survivin expression and reduces AKT and ERK phosphorylation, promoting further apoptosis and inhibiting cell survival.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3. Effect of miR-21 alone:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003edown-regulation of miR-21 expression by antisense oligonucleotides inhibited glioma cell proliferation and induced cell apoptosis. Reduction of miR-21 activated caspase 3. miR-21 plays a critical role in regulating the apoptosis of cells in gliomas and can be a target for effective therapies . Down-regulation of miR-21, on the other hand, inhibited the EGFR and Akt pathways (35). Epidermal growth factor receptor (EGFR) is a receptor tyrosine kinases (RTK) protein also known as ErbB1 or HER-1. Different \u0026nbsp; ligands \u0026nbsp; can \u0026nbsp; \u0026nbsp;bind \u0026nbsp; EGFR \u0026nbsp; and \u0026nbsp; \u0026nbsp;activate \u0026nbsp; its downstream signaling pathways. Therefore, its activation or upregulation has an important role in cancer development in a variety \u0026nbsp; of \u0026nbsp; solid \u0026nbsp; \u0026nbsp;human \u0026nbsp; tumors \u0026nbsp; such \u0026nbsp; \u0026nbsp;as \u0026nbsp; hepatocellular carcinoma, non-small cell lung carcinomas and colorectal cancers (36). as well, Up-regulation of miR-21 can inhibit PTEN expression and lead to an activation of AKT and ERK pathways, finally enhance VEGF expression and induce tumor angiogenesis. Inhibition of miR-21 increased the protein expression of PTEN and decreased the relative expression of p-AKT and p-ERK (37). Serum vascular endothelial growth factor-A (VEGF-A) has been shown to be a proper prognostic factor for peoples with various types of malignancies. VEGF-A is secreted by various malignant tissues for their regeneration and growth regulation (38). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMMP9 (Matrix Metallopeptidase 9) is involved in the degradation of extracellular matrix proteins such as type IV and V collagens and plays a role in both tumor development, tissue remodeling or regeneration and metastasis (39).\u0026nbsp;MMP-2 and MMP-9 cell signaling pathway may be one of the mech\u0026shy;anisms in which miR-21 affects tumor cell growth. miR-21 promotes growth, invasion and migration of lung cancer cells (40).\u003c/p\u003e\n\u003cp\u003eDown-regulation of miR-21 inhibits glioma cell proliferation, induces apoptosis, and suppresses key pathways like EGFR and Akt\u003cstrong\u003e.\u003c/strong\u003e Its exhibits activities on various signaling pathways, such as Akt, ERK, MMP-2, and MMP-9, besides its involvement in apoptosis induction and the inhibition of tumor growth, as also observed with formononetin. In lung cancer, miR-21 enhances growth, invasion, and migration via MMP-2 and MMP-9. It also affects anti-apoptotic proteins, including survivin and IAP-2, which are also targeted by formononetin. Up-regulation of miR-21 activates AKT and ERK pathways, which enhance VEGF expression and tumor angiogenesis.\u003cstrong\u003eThis regulation of the tumor microenvironment by miR-21, through the PI3K/Akt and ERK1/2 pathways, parallels the effects observed with formononetin.\u003c/strong\u003e These findings suggest miR-21 as a crucial target for cancer therapy.\u003c/p\u003e\n\u003cp\u003eThe mechanisms of Formononetin, Sorafenib, and miR-21 share a great deal of similarity regarding the impact on apoptosis, survival pathways, and critical proteins like caspase-3, survivin, MMP-9, VEGF, and AKT. However, the detailed molecular mechanisms may differ since some pathways may be activated or inhibited depending on the context or treatment duration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eEffect of combination therapy:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRegulation of miR-21 and related pathways\u003c/strong\u003e: The major mechanism by which this combination therapy may succeed is in the downregulation of miR-21, a principal modulator of cancer progression and resistance. Several oncogenic pathways are downregulated, with resultant decreased expression of factors like EGFR, VEGF-A, and MMP-9 that are vital in tumor growth, angiogenesis, and metastasis. These data show that both the direct and indirect therapeutic actions of this combination are modulated through the regulation of miR-21.\u0026nbsp;The combined use of formononetin and sorafenib showed an enhanced ability to induce apoptosis and suppress pathways related to cellular survival. Western blot analysis revealed increased pro-apoptotic markers (BAD, cleaved caspase-3) and significantly decreased survivin levels.\u003c/p\u003e\n\u003cp\u003eMoreover, the ratio of phosphorylated to unphosphorylated AKT and ERK1/2 was significantly lower in the combination therapy group, thus showing its potency in blocking signaling pathways critical to the survival and proliferation of cancer cells.\u003c/p\u003e\n\u003cp\u003eThese results suggest that formononetin and sorafenib can be a promising adjuvant treatment approach for HCC. The simultaneous modulation of miR-21 and its downstream targets points to an action mechanism not previously reported, which should therefore be further investigated. Future studies should validate these findings in preclinical models and take advantage of targeted delivery systems, including nanoparticles, to improve the specificity and therapeutic index of this promising combinatorial treatment strategy.\u0026nbsp;The downregulation of miR-21 enhances the combination therapy\u0026apos;s efficacy by targeting pathways crucial for cancer cell survival and metastasis\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDecreased\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;Cell Viability:\u003c/strong\u003e Combination therapy resulted in enhanced cytotoxic effects in HepG2 cells compared to single treatments. MTT and trypan blue exclusion assays confirmed dose-dependent reduction in cell viability, most profoundly by the combination therapy.\u003cbr\u003e\u003cstrong\u003eInduction of Apoptosis:\u003c/strong\u003e The combination treatment resulted in the highest levels of apoptosis, as shown by DAPI staining and western blotting. A further enhancement of pro-apoptotic markers, including BAD and cleaved caspase-3, with decreased expression of the anti-apoptotic protein survivin, mechanistically underlines the advantages of the combination therapy.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSuppression of Oncogenic Pathways:\u003c/strong\u003e Combination therapy resulted in a strong downregulation of crucial signaling molecules, such as EGFR, VEGF-A, and MMP-9, which play important roles in the proliferation, angiogenesis, and metastasis of tumors. In addition, the phosphorylated-to-unphosphorylated ratios of AKT and ERK1/2 proteins were markedly reduced according to Western blot analysis, further highlighting that the combination was able to break down survival pathways.\u003c/p\u003e\n\u003cp\u003eThe data indicate that formononetin and sorafenib are promising candidates as adjuncts in the treatment of HCC. This combination not only increased apoptotic events and decreased cellular viability but also potently disrupted key oncogenic signaling pathways more than either pharmaceutical agent when given alone. These findings justify further investigation through preclinical animal models and clinical trials to assess the efficacy and safety of this new therapeutic approach. The combination of formononetin and sorafenib represents a novel and promising approach for hepatocellular carcinoma (HCC) treatment. \u0026nbsp;This study highlights how the combination of formononetin and sorafenib, through the modulation of miR-21 expression and its associated downstream pathways, significantly enhances therapeutic efficacy compared to monotherapy, suggesting a complementary interaction between the two drugs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExplanation of Observed Discrepancies:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e1. \u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eResolving Discrepancies in Single-Agent Formononetin Therapy with Combination Therapy:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSingle-agent Formononetin treatment of HepG2 cells showed dose-dependent cytotoxicity; however, time dependency varied between experiments. Most strikingly, pronounced time-dependent effects were found after 72 h at 10 \u0026micro;M and 20 \u0026micro;M, whereas for other concentration levels, no such dependency was found. This would indicate that at low concentrations, Formononetin could interfere with specific molecular pathways that are inhibited at high concentrations. Such discrepancies highlight the complexity of its pharmacodynamics and warrant further molecular investigation. Formononetin may activate certain molecular pathways, such as stress response or apoptosis-related mechanisms, at lower doses (10 \u0026micro;M and 20 \u0026micro;M) that require time to fully manifest. At higher concentrations, could be overloaded or inhibited by toxic effects on cellular mechanisms.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOn the other hand, combination therapy of Formononetin (10 \u0026micro;M) and Sorafenib (1 \u0026micro;M) showed a time-dose-dependent consistent result in the MTT assay. The cytotoxicity observed was significantly dose-dependent, and there was no significant time-related difference at 24, 48, and 72 hours. Such a consistent response suggests that the combination treatment has more stable and reproducible effects compared to monotherapy, which makes it a more effective approach for reducing cell viability in hepatocellular carcinoma.\u003cstrong\u003e]\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.\u003c/strong\u003e\u003cstrong\u003e\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e\u003c/strong\u003e\u003cstrong\u003eCell Migration:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs indicated by the migration assay results, formononetin, sorafenib, and the combination of the two showed limited inhibitory effects on HepG2 cell migration. Notably, sorafenib-treated cells showed increased migration at 24 and 48 hours, which is contrary to the primary therapeutic goal of decreasing cell migration. Future studies should further apply 3D cell culture models and investigate other cell lines to better understand the tumor microenvironment and gene expression associated with migration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eMMP9\u003cspan dir=\"RTL\"\u003e \u003c/span\u003eGene Expression and Cell Migration Results:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe expression levels of MMP9 gene were downregulated in HepG2 cells treated with either formononetin alone or in combination with sorafenib, as shown by qRT-PCR analysis. However, the results from western blot showed that MMP9 protein content was upregulated in the formononetin group. These can be explained by post-translational regulatory mechanisms such as stabilization of proteins or decreased degradation. The combination therapy, being the primary scope of the present investigation, could markedly decrease both the gene expression and protein content of MMP-9. All these results suggest its probable efficacy in inhibiting HepG2 cell migration and metastasis, following the combination therapeutic principles to treat hepatocellular carcinoma.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cspan dir=\"RTL\"\u003e\u003c/span\u003e\u003c/strong\u003e\u003cstrong\u003e4. Phosphorylated AKT and ERK1/2 protein expression:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWestern blotting revealed a significant reduction in the ratio of phosphorylated to non-phosphorylated AKT and ERK1/2, with this being most pronounced in the combination group. The primary objective of this study was to evaluate the effect of combination therapy on signaling pathways in HepG2 cells. However, this finding does not support previous studies indicating that formononetin (when administered alone) acts as an activator of the PI3K/AKT pathway, thus promoting AKT phosphorylation. The discrepancy observed could be attributed to post-translational events of either changing kinase activities or those occurring as a consequence of concurrent treatment of formononetin with sorafenib. Most interestingly, the reduction of p-AKT and ERK1/2 suggests inhibition of the key pathways that drive cell survival and proliferation within a cancer context and also gives further indication of potential benefits from a combination therapy.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e5.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eEnhanced Apoptotic Response in HepG2 Cells:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results indicated that although each drug alone exerted some influence on apoptosis and expression of associated genes, these were not reliably statistically significant. Most interestingly, sorafenib given alone didn\u0026apos;t cause a significant rise in BAD gene expression. However, combination treatment led to a significant increase in BAD expression. Moreover, with the combination treatment, a marked reduction in Survivin expression was associated with an increase in apoptosis. Taken together, these results are encouraging and imply that combination therapy could be a feasible approach to hepatocellular carcinoma treatment.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThese present research findings show that formononetin, especially when combined with sorafenib, might have a potential role as an effective treatment modality against HCC by blocking important survival and metastasis pathways, inducing apoptosis, and regulates critical signaling molecules. Notably, in some studies, formononetin has shown stronger anticancer effects compared to sorafenib, which means its antitumor activity cannot be entirely dependent on sorafenib. Moreover, the use of formononetin in encapsulated forms, for example, micelles or nanoparticles, provides a promising approach in targeted cancer therapy. Future research should therefore focus on animal models and clinical trials to confirm these findings and explore optimized treatment strategies for HCC.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLimitations and Recommendations for Future Studies:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e-The study relied on in vitro cell culture models, which may not\u0026nbsp;have captured all aspects of the tumor behavior in vivo.\u003c/p\u003e\n\u003cp\u003e-The results need to be validated further using animal models and clinical trials.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e-Exploring post-translational regulatory mechanisms in cells treated with a combination of formononetin and sorafenib.\u003c/p\u003e\n\u003cp\u003e-Development of nanoparticle-based delivery systems in order to improve therapeutic efficiency as well as reduce off-target effects of the formononetin and sorafenib combination.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics Statement:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Ethics Committee of Marvdasht Branch Islamic Azad University approved this study, and the study was performed in accordance with the approved guidelines\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe author(s) declare that no financial support was received for the research, authorship, and/or publication of this article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgment\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors are grateful to office of vice-chancellor for Research of Marvdasht Branch Islamic Azad University, for the support of the current study\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHA, HS, MJ, MF: writing\u0026ndash;original draft, conceptualization, methodology, formal analysis, HA, HS: writing\u0026ndash;review and editing, investigation supervision, validation, methodology,\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Interest\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMcGlynn KA, Petrick JL, El-Serag HB. Epidemiology of Hepatocellular Carcinoma.Hepatology.2021;73Suppl 1(Suppl 1):4-13. \u003c/li\u003e\n\u003cli\u003eMittal S, El-Serag HB. Epidemiology of hepatocellular carcinoma: consider the population. J Clin Gastroenterol. 2013;47 Suppl (0): S2-6. \u003c/li\u003e\n\u003cli\u003eGibson CM. Hepatocellular carcinoma epidemiology and demographics 2020[Available from: https://www.wikidoc.org/index.php/Hepatocellular_carcinoma_epidemiology_and_\u003cu\u003e demographics\u003c/u\u003e.\u003c/li\u003e\n\u003cli\u003ePasserini J, Romiti A, D\u0026apos;Antonio C, Mastromarino V,Marchetti P, Volpe M, et al. Tailored angiogenesis inhibition in cancer therapy: respecting the heart to improve the net outcome. Current Signal Transduction Therapy. 2012;7(3):265-88.\u003c/li\u003e\n\u003cli\u003eZhu M, Sun Y, Bai H, Wang Y, Yang B, Wang Q, et al. Effects of saponins from Chinese herbal medicines on signal transduction pathways in cancer: A review. Frontiers in Pharmacology. 2023; 14:1159985. \u003c/li\u003e\n\u003cli\u003eHsieh C-J, Hsu Y-L, Huang Y-F, Tsai E-M. Molecular mechanisms of anticancer effects of phytoestrogens in breast cancer. Current Protein and Peptide Science. 2018;19(3):323-32. \u003c/li\u003e\n\u003cli\u003eTorrens-Mas M, Roca P. Phytoestrogens for cancer prevention and treatment. Biology. 2020;9(12):427. \u003c/li\u003e\n\u003cli\u003eAliya S, Alhammadi M, Park U, Tiwari JN, Lee J-H, Han Y-K, et al. The potential role of formononetin in cancer treatment: An updated review. Biomedicine \u0026amp; Pharmacotherapy. 2023; 168:115811. \u003c/li\u003e\n\u003cli\u003ePark Y, Choo SP, Jung GS, Kim S, Lee MJ, Im W, et al. Formononetin Inhibits Progression of Endometriosis via Regulation of p27, pSTAT3, and Progesterone Receptor: In Vitro and In Vivo Studies. Nutrients. 2023;15(13):3001. \u003c/li\u003e\n\u003cli\u003eTay K-C, Tan LT-H, Chan CK, Hong SL, Chan K-G, Yap WH, et al. Formononetin: a review of its anticancer potentials and mechanisms. Frontiers in pharmacology. 2019; 10:820. \u003c/li\u003e\n\u003cli\u003eDAI Y, CHEN Y, CHEN Y, XU Z, DING J. Effects of Formononetin on PTEN/AKT Signaling Pathway and Angiogenesis of Transplanted Tumor in Nude Mice with Breast Cancer Cells. Indian Journal of Pharmaceutical Sciences. 2023;85(3). \u003c/li\u003e\n\u003cli\u003eWang AL, Li Y, Zhao Q, Fan LQ. Formononetin inhibits colon carcinoma cell growth and invasion by microRNA-149-mediated EphB3 downregulation and inhibition of PI3K/AKT and STAT3 signaling pathways. Molecular Medicine Reports. 2018;17(6):7721-9. \u003c/li\u003e\n\u003cli\u003eYu W, Zhu K, Wang Y, Yu H, Guo J. Overexpression of miR-21-5p promotes proliferation and invasion of colon adenocarcinoma cells through targeting CHL1. Molecular Medicine. 2018;24(1):1-12. \u003c/li\u003e\n\u003cli\u003eWang X-h, Sun Z-g, Luo L, Liu L-n, Yan J, Xuan L. Formononetin promotes apoptosis of colorectal cancer cells via activation of mitochondria-dependent MAPK pathway. Tropical Journal of Pharmaceutical Research. 2019;18(2):243-9. \u003c/li\u003e\n\u003cli\u003eYang Y, Zhao Y, Ai X, Cheng B, Lu S. Formononetin suppresses the proliferation of human non-small cell lung cancer through induction of cell cycle arrest and apoptosis. International journal of clinical and experimental pathology.2014;7(12):8453. \u003c/li\u003e\n\u003cli\u003eZhang J, Liu L, Wang J, Ren B, Zhang L, Li W. Formononetin, an isoflavone from Astragalus membranaceus inhibits proliferation and metastasis of ovarian cancer cells. Journal of Ethnopharmacology. 2018; 221:91-9. \u003c/li\u003e\n\u003cli\u003eKumarswamy R, Volkmann I, Thum T. Regulation and function of miRNA-21 in health and disease. RNA Biol. 2011;8(5):706-13. \u003c/li\u003e\n\u003cli\u003eBautista-S\u0026aacute;nchez D, Arriaga-Canon C, Pedroza-Torres A, De La Rosa-Vel\u0026aacute;zquez IA, Gonz\u0026aacute;lez-Barrios R, Contreras-Espinosa L, et al. The promising role of miR-21 as a cancer biomarker and its importance in RNA-based therapeutics. Molecular Therapy-Nucleic Acids. 2020; 20:409-20. \u003c/li\u003e\n\u003cli\u003eYiying Wu, Xing Zhang, Zhengzhao Li, et al. Formononetin inhibits human bladder cancer cell proliferation and invasiveness via regulation of miR-21 and PTEN, The Royal Society of Chemistry 2017 Published on 13 January 2017. Downloaded by University of Regina on 04/02/2017 05:10:39.\u003c/li\u003e\n\u003cli\u003eChangjun He, Xuesong Dong, Bo Zhai, et al. MiR-21 mediates sorafenib resistance of hepatocellular carcinoma cells by inhibiting autophagy via the PTEN/Akt pathway, Oncotarget, Vol. 6, No. 30 \u003cem\u003eJuly 30, 2015.\u003c/em\u003e\u003c/li\u003e\n\u003cli\u003ePal SK, Shukla Y. Herbal medicine: current status and the future. Asian pacific journal of cancer prevention. 2003;4(4):281-8. \u003c/li\u003e\n\u003cli\u003eMart\u0026iacute;nez-Sifuentes MA, Bassol-Mayagoitia S, Nava-Hern\u0026aacute;ndez MP, Ruiz-Flores P, Ramos-Trevi\u0026ntilde;o J, Haro-Santa cruz J, et al. Survivin in breast cancer: A review. Genetic Testing and Molecular Biomarkers. 2022;26(9):411-21. \u003c/li\u003e\n\u003cli\u003eQuidute P, Quidute R, Perez MM, Pereira EC, Veiga GLd, Alves BdCA, et al. Survivin expression as a prognostic marker for breast cancer. Revista da Associa\u0026ccedil;\u0026atilde;o M\u0026eacute;dica Brasileira. 2023;69: e20230167. \u003c/li\u003e\n\u003cli\u003eChulwon Kim, Seok-Geun Lee, Woong Mo Yang, et al. Formononetin-induced oxidative stress abrogates the activation of STAT3/5 signaling axis and suppresses the tumor growth in multiple myeloma preclinical model.cancer letters (2018) S0304-3835(18)30371-9.\u003c/li\u003e\n\u003cli\u003eR. Zhou, L. Xu, M. Ye, et al. Formononetin Inhibits Migration and Invasion of MDA-MB-231 and 4T1 Breast Cancer Cells by Suppressing MMP-2 and MMP-9 Through PI3K/AKT\u003c/li\u003e\n\u003cli\u003eSheik Aliya, Munirah Alhammadi, Uichang Park, et al. The potential role of formononetin in cancer treatment: An updated review, Biomedicine \u0026amp; Pharmacotherapy 168 (2023) 115811.\u003c/li\u003e\n\u003cli\u003eLiu Yang GY, Fan Wei. Anti-hepatoma activity of targeted Pluronic F127/formononetin nanocomposite system in vitro. Chinese Journal of Tissue Engineering Research. 2021;25(4):526-31.\u003c/li\u003e\n\u003cli\u003eWu J, Kong M, Lou Y, Li L, Yang C, Xu H, et al. Simultaneous activation of Erk1/2 and Akt signaling is critical for formononetin-induced promotion of endothelial function. Frontiers in Pharmacology. 2021; 11:608518. \u003c/li\u003e\n\u003cli\u003eMar\u0026iacute;a A. Rodr\u0026iacute;guez‐Hern\u0026aacute;ndez1, Ra\u0026uacute;l Gonz\u0026aacute;lez1, \u0026Aacute;ngel J. de la Rosa, et al. Molecular characterization of autophagic and apoptotic signaling induced by sorafenib in liver cancer cells. J Cell Physiol. 692, wileyonlinelibrary.com/journal/jcp 2019;234:692\u0026ndash;708.\u003c/li\u003e\n\u003cli\u003eJoan Fernando, Patricia Sancho, Conrado M. Fern\u0026aacute;ndez-Rodriguez, et al. SORAFENIB SENSITIZES HEPATOCELLULAR CARCINOMA CELLS TO PHYSIOLOGICAL APOPTOTIC STIMULI. J Cell Physiol. 2012 April; 227(4): 1319\u0026ndash;1325. doi:10.1002/jcp.22843.\u003c/li\u003e\n\u003cli\u003eTAE-YONG HA, SHIN HWANG, KI-MYEONG MOON, et al. Sorafenib Inhibits Migration and Invasion of Hepatocellular Carcinoma Cells Through Suppression of Matrix Metalloproteinase Expression. ANTICANCER RESEARCH \u003cem\u003e35\u003c/em\u003e: 1967-1976 (2015).\u003c/li\u003e\n\u003cli\u003eScott M. Wilhelm, Lila Adnane, Philippa Newell, et al. Preclinical overview of sorafenib, a multikinase inhibitor that targets both Raf and VEGF and PDGF receptor tyrosine kinase signaling. Mol Cancer Ther 2008;7(10). October 2008.\u003c/li\u003e\n\u003cli\u003eTing Wang, Yasuhiro Takikawa, Kazuyuki Suzuki, et al. Comparative analysis of sorafenib and Lenvatinib on HepG2 cells and human umbilical vein endothelial cells: Involvement of transforming growth factor‐\u0026beta; signaling in their molecular effects.\u003cem\u003e Hepatology Research. \u003c/em\u003e2024; 54:921\u0026ndash;930.\u003c/li\u003e\n\u003cli\u003eSarkar A, Paul A, Banerjee T, Maji A, Saha S, Bishayee A, et al. Therapeutic advancements in targeting BCL-2 family proteins by epigenetic regulators, natural, and synthetic agents in cancer.European Journal of Pharmacology. 2023:175588. \u003c/li\u003e\n\u003cli\u003eXuan Zhou, Yu Ren, Lynette Moore, et al. Downregulation of miR-21 inhibits EGFR pathway and suppresses the growth of human glioblastoma cells independent of PTEN status, Laboratory Investigation (2010) 90, 144\u0026ndash;155.\u003c/li\u003e\n\u003cli\u003eKomposch K, Sibilia M. EGFR Signaling in Liver Diseases. International Journal of Molecular Sciences. 2015;17(1): E30-E.\u003c/li\u003e\n\u003cli\u003eLonglong Bao , Yan Yan , Can Xu, et al. MicroRNA-21 suppresses PTEN and hSulf-1 expression and promotes hepatocellular carcinoma progression through AKT/ERK pathways. 0304-3835/$ - see front matter _ 2013 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.canlet.2013.05.007.\u003c/li\u003e\n\u003cli\u003eLacin S, Yalcin S. The prognostic value of circulating VEGF-A level in patients with hepatocellular cancer. Technology in Cancer Research \u0026amp;Treatment. 2020;19: 1533033820971677. \u003c/li\u003e\n\u003cli\u003eAbdel-Tawab MS, Fouad H, Khalil DM, Shaaban S, Nafady S, Moawad HH, et al. The rolof miRNA-29b1, MMP-2, MMP-9 mRNAs, and proteins in early diagnosis of HCC. Egyptian Journal of Medical Human Genetics. 2023;24(1):57. \u003c/li\u003e\n\u003cli\u003eHaiquan Li, Jie Zhao, Xiaomin Jia, et al. miR-21 promotes growth, invasion and migration of lung cancer cells by AKT/P-AKT/cleaved-caspase 3/MMP-2/MMP-9 signaling pathway, Int J Clin Exp Pathol 2020;13(4):692-700.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003cp\u003e\u003cstrong\u003eTable 1.\u003c/strong\u003e Primer pairs used in the current study to evaluate the gene expression using q-RT PCR\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"615\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 179px;\"\u003e\n \u003cp\u003eOligo name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 306px;\"\u003e\n \u003cp\u003eOligo Sequence 5\u0026apos;--\u0026gt;\u0026nbsp;3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 130px;\"\u003e\n \u003cp\u003eAmplicon size\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 179px;\"\u003e\n \u003cp\u003eBAD-Forward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 306px;\"\u003e\n \u003cp\u003eCAACCAGCAGCAGCCATCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 130px;\"\u003e\n \u003cp\u003e\u003csub\u003e369 bp\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 179px;\"\u003e\n \u003cp\u003eBAD-Reverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 306px;\"\u003e\n \u003cp\u003eGGGCGAGGAAGTCCCTTCTTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 179px;\"\u003e\n \u003cp\u003eMMP9-Forward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 306px;\"\u003e\n \u003cp\u003eCGTCTTCCAGTACCGAGAGAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 130px;\"\u003e\n \u003cp\u003e\u003csub\u003e216 bp\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 179px;\"\u003e\n \u003cp\u003eMMP9-Reverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 306px;\"\u003e\n \u003cp\u003eTGTATCCGGCAAACTGGCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 179px;\"\u003e\n \u003cp\u003eVEGF-Forward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 306px;\"\u003e\n \u003cp\u003eAGAAGGAGGAGGGCAGAATCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 130px;\"\u003e\n \u003cp\u003e\u003csub\u003e148 bp\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 179px;\"\u003e\n \u003cp\u003eVEGF-Reverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 306px;\"\u003e\n \u003cp\u003eGGGCACACAGGATGGCTTGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 179px;\"\u003e\n \u003cp\u003eEGFR-Forward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 306px;\"\u003e\n \u003cp\u003eTTGCCGCAAAGTGTGTAACG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 130px;\"\u003e\n \u003cp\u003e\u003csub\u003e142 bp\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 179px;\"\u003e\n \u003cp\u003eEGFR-Reverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 306px;\"\u003e\n \u003cp\u003eGTCACCCCTAAATGCCACCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 179px;\"\u003e\n \u003cp\u003eBirc5-Forward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 306px;\"\u003e\n \u003cp\u003eCCAGTTTCAAAAATTCACCAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 130px;\"\u003e\n \u003cp\u003e\u003csub\u003e103 bp\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 179px;\"\u003e\n \u003cp\u003eBirc5-Reverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 306px;\"\u003e\n \u003cp\u003eGACGACCCCATAGAGGAACATA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Formononetin, Sorafenib, miR-21, hepatocellular carcinoma, HCC, signaling pathway, apoptosis, cell survival, growth, migration, colony formation.","lastPublishedDoi":"10.21203/rs.3.rs-5856830/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5856830/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground and Purpose:\u003c/strong\u003e Formononetin is a phytoestrogen isolated from several medicinal plants, and it is extensively investigated for its anti-cancer effects in several cells. However, the impact of formononetin on hepatocellular carcinoma (HCC) has been unclear. In this study, the influence of formononetin on cell growth, metabolism, and signaling molecules is examined in the HepG2 cells, singly and in combination with sorafenib. This study investigates the individual and combined effects of formononetin and sorafenib on growth, metabolism, and signaling in HepG2 cells, focusing on miR-21 regulation and theirdownstream effects for the first time. This study underscored the dependent effects of the two drugs on the expression of miR-21. The drugs, either alone or together, indirectly affect the expression of other genes via miR-21 as well as directly. this study aiming to explore its molecular mechanisms and potential therapeutic values.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMaterials and Methods:\u003c/strong\u003e Materials and Methods: HepG2 cells were treated with formononetin, sorafenib, or a combination of both. cell growth, colony formation, migration, apoptosis, gene expression, and protein contents were investigated. Formononetin (1-640 µM) and sorafenib (0.01-64µM) or itscombination (0.01µM sorafenib+1µM formononetin) were tested.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e After 48 h, treatments reduced the cell viability and colony formation and induced apoptosis. miR-21 expression was significantly lowered by combination therapy which demonstrated the most potent inhibitory effect on EGFR, VEGF-A, MMP-9 expression, increasing BAD expression with the highest levels in the combination group, then sorafenib and followed by formononetin. Isolated compounds or their combination caused a reduction in survivin expression levels, with the least effect for formononetin and the most notable effect for combination treatment. Formononetin produced a more considerable reduction in the expression of EGFR and VEGF-A thansorafenib, but their combination caused the most prominent reductions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e Formononetin is a promising compound as an adjuvant therapy for HCC, especially when used in combination with sorafenib. The combination therapy not only enhances the inhibition of key oncogenic pathways involved, such as EGFR, VEGF-A, and MMP-9, but also induces pro-apoptotic machinery by downregulating miR-21 and upregulating BAD expression. All these data suggest that formononetin, in combination with sorafenib, may present a more effective therapeutic approach againstHCC. More in-depth preclinical and clinical studies are needed to support the findings and establish its clinical applicability.\u003c/p\u003e","manuscriptTitle":"Evaluation of the effect of biochanin b and Sorafenib on cell survival, growth, migration, colony formation and apoptosis in hepatocellular carcinoma","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-02-03 15:23:56","doi":"10.21203/rs.3.rs-5856830/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1d0d7e6b-6e6d-47d3-8a03-314b29e7d999","owner":[],"postedDate":"February 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-04-04T05:38:45+00:00","versionOfRecord":[],"versionCreatedAt":"2025-02-03 15:23:56","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5856830","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5856830","identity":"rs-5856830","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}