The Plasmodium falciparum RING finger protein Pf RNF1 forms an interaction network with regulators of sexual development

The Plasmodium falciparum RING finger protein Pf RNF1 forms an interaction network with regulators of sexual development | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL This is a preprint and has not been peer reviewed. Data may be preliminary. 17 January 2025 V1 Latest version Share on The Plasmodium falciparum RING finger protein Pf RNF1 forms an interaction network with regulators of sexual development Authors : Afia Farrukh , Sherihan Musa , Ute Distler , Stefan Tenzer 0000-0003-3034-0017 , Gabriele Pradel 0000-0003-2264-5558 [email protected] , and Che Julius Ngwa Authors Info & Affiliations https://doi.org/10.22541/au.173711715.56527027/v1 424 views 217 downloads Contents Abstract Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract RNA-binding E3 ubiquitin ligases (RBULs) provide a link between RNA metabolic processes and the ubiquitin proteasome system (UPS). In humans, RBULs are involved in various biological processes, such as cell proliferation and differentiation, or sexual development. To date, little is known about their role in the protozoan parasite Plasmodium falciparum , the causative agent of malaria tropica. We previously identified a first P. falciparum RBUL, the RING finger E3 ligase Pf RNF1, which is highly expressed during gametocyte development. Here, we conducted BioID-based proximity interaction studies to unveil the Pf RNF1 interactome. We show that in immature gametocytes Pf RNF1 forms an interaction network that is mainly composed of RNA-binding proteins including the translational repressors DOZI and CITH and members of the CCR4-NOT complex, as well as UPS-related proteins. In particular, Pf RNF1 interacts with recently identified regulators of sexual development like the zinc finger protein Pf MD3, with which it shares the majority of interactors. The common interactome of Pf RNF1 and Pf MD3 comprises several yet unknown proteins specifically expressed in male or female gametocytes. Our results demonstrate that Pf RNF1 engages with RNA-binding proteins crucial for sex determination of gametocytes, thereby linking posttranscriptional regulation with the ubiquitin system. Rapid communication, Proteomics Accelerated Article: The Plasmodium falciparum RING finger protein Pf RNF1 forms an interaction network with regulators of sexual development Afia Farrukh 1 , Sherihan Musa 1 , Ute Distler 2 , Stefan Tenzer 2 , Gabriele Pradel* 1 and Che Julius Ngwa 1,3 1 Division of Cellular and Applied Infection Biology, RWTH Aachen University, Aachen, Germany 2 Institute of Immunology, University Medical Centre of the Johannes-Gutenberg University, Mainz, Germany 3 Recent address: Fraunhofer Institute for Molecular Biology and Applied Ecology IME, Aachen, Germany *Address correspondence to Gabriele Pradel, [email protected] Running head: P. falciparum RNF1 interacts with sex regulators Key words: malaria, gametocyte, sexual development, zinc finger protein, RBUL, transcription Abstract RNA-binding E3 ubiquitin ligases (RBULs) provide a link between RNA metabolic processes and the ubiquitin proteasome system (UPS). In humans, RBULs are involved in various biological processes, such as cell proliferation and differentiation, or sexual development. To date, little is known about their role in the protozoan parasite Plasmodium falciparum , the causative agent of malaria tropica. We previously identified a first P. falciparum RBUL, the RING finger E3 ligase Pf RNF1, which is highly expressed during gametocyte development. Here, we conducted BioID-based proximity interaction studies to unveil the Pf RNF1 interactome. We show that in immature gametocytes Pf RNF1 forms an interaction network that is mainly composed of RNA-binding proteins including the translational repressors DOZI and CITH and members of the CCR4-NOT complex, as well as UPS-related proteins. In particular, Pf RNF1 interacts with recently identified regulators of sexual development like the zinc finger protein Pf MD3, with which it shares the majority of interactors. The common interactome of Pf RNF1 and Pf MD3 comprises several yet unknown proteins specifically expressed in male or female gametocytes. Our results demonstrate that Pf RNF1 engages with RNA-binding proteins crucial for sexual determination of gametocytes, thereby linking posttranscriptional regulation with the ubiquitin system. Significance of the study RNA-binding ubiquitin ligases (RBULs) are proteostasis surveillance proteins with both ubiquitin ligase activity and RNA-binding properties. This study sheds new light on the RING finger E3 ligase Pf RNF1 of the human malaria parasite Plasmodium falciparum . We previously identified Pf RNF1 as the first plasmodial RBUL, which is highly expressed during the development of male and female gametocytes, hence parasite stages essential for malaria transmission to the mosquito vector. Using protein-protein interaction studies, we mapped out a network of proteins that Pf RNF1 interacts within the developing gametocytes. We discovered that Pf RNF1 forms a complex with other RNA-binding proteins, including those known to repress translation in female gametocytes, as well as proteins involved in mRNA and protein degradation. Notably, Pf RNF1 also interacts with recently identified sexual development regulators like the zinc finger protein Pf MD3, and the two proteins share many of the same interaction partners, including several novel proteins that are uniquely active in either male or female gametocytes. Our findings reveal a crucial position of Pf RNF1 for linking RNA processing and protein degradation in the malaria parasite transmission stages, highlighting its potential role in guiding sexual differentiation. Malaria, caused by Plasmodium parasites, leads to 597,000 deaths annually, with Plasmodium falciparum responsible for the most lethal infections [1]. Malaria pathogenesis is linked to the proliferating blood stages of the parasite, while the sexual stages, particularly the gametocytes, play a critical role for transmission of the disease by mosquitoes. The sexual phase of P. falciparum starts with sexual commitment, which occurs in a small fraction of asexual blood stage parasites and is triggered by environmental factors, such as nutrient depletion. This process is particularly regulated by the Apetala 2 (Ap2) transcription factor AP2-G, and leads to gametocytogenesis. During asexual blood stage replication, the AP2-G-encoding gene is silenced by heterochromatin protein 1 (HP1), but becomes activated following removal of HP1 by the gametocyte development protein 1 (GDV1). AP2-G then enables sexual commitment and the development of gametocytes through the cascading activation of gametocyte-specific genes (e.g., reviewed in [2-4]). AP2-G reprograms asexual blood stage parasites for sexual development, but how it drives male and female gametocyte differentiation is unclear. Plasmodium lacks sex chromosomes, suggesting that epigenetic factors control sex determination. Several AP2 proteins were assigned to regulating the sex-specific identity in gametocytes, e.g., AP2-FG and AP2-O3, which promote female gene profiles, while repressing male genes [5, 6]. Additionally, RNA-binding proteins (RBPs) play a critical role in regulating gene expression during gametocyte development. Some of the plasmodial RBPs, such as DOZI (development of zygote inhibited), CITH (worm CAR-I and fly Trailer Hitch) and PUF2 (Pumilio and Fem-3 binding factor 2), repress transcripts in female gametocytes and store them for later use following parasite transmission to mosquitoes, when the zygote needs to develop in the mosquito midgut (e.g., [7-10] ; reviewed in [11, 12]).A yet under-investigated group of RBPs with roles in gametocytogenesis are zinc finger proteins (ZFPs) (reviewed in [13]). In general, ZFPs, specifically ones bearing C3H1 motifs, play critical roles in RNA metabolic processes like mRNA splicing, polyadenylation, export, and translation, as well as ubiquitination and transcriptional repression (e.g., reviewed in [14, 15]). Recently, we characterized two C3H1-ZFPs with important roles during the development of male P. falciparum gametocytes, Pf MD3 (male development protein 3) and Pf ZNF4 (zinc finger protein 4). Both ZFPs were originally identified by us during a transcriptomic screen for genes deregulated upon treatment of gametocytes with the histone deacetylase (HDAC) inhibitor Trichostatin A (TSA) [16]. While parasites deficient of Pf MD3 are impaired in male gametocyte maturation, Pf ZNF4 deficiency blocks male gametogenesis through the downregulation of male-enriched genes associated to axoneme formation [17, 18]. The plasmodial MD3 is part of a group of sexual regulators that were identified during a global screen of barcoded P. berghei mutants and predicted to be important for the development of male and female gametocytes [19]. Another ZFP identified during the screening for TSA-deregulated genes of P. falciparum gametocytes is the RING finger domain-containing RNA-binding E3 ubiquitin ligase (RBUL) Pf RNF1 [16]. Generally, RBULs are key players in linking the RNA metabolism with the ubiquitin-proteasome system (UPS), and in humans, are involved in various biological processes, such as cell proliferation and differentiation, or sexual development (reviewed in [20, 21]). Here, we investigated the Pf RNF1 interactome during gametocytogenesis of P. falciparum using BioID-based interaction studies and demonstrated a comprehensive interaction network of Pf RNF1 with gametocyte-specific RBPs and sexual development regulators. Pf RNF1 is a 136-kDa protein with a C-terminal RING zinc finger domain (Fig. 1A). AlphaFold protein structure analysis predicted a globular protein with several central helices and a conserved C-terminal ring finger domain (Fig. 1B). Analysis of single-cell transcriptomics data provided by the Malaria Cell Atlas demonstrated low numbers of pfrnf1 -expressing cells in the sexual commitment and stalk phase of gametocyte development and increasing numbers of pfrnf1 -positive cells during branching and in gametocytes of male and female identity (Fig. 1C). Semi-quantitative RT-PCR using RNA from rings, trophozoites and schizonts, as well as from immature, mature and activated gametocytes showed high pfrnf1 transcript levels in gametocytes compared to the asexual blood stages with particular high levels in immature gametocytes (Fig. 1D; Fig. S1A). Stage specificity and subcellular localization of Pf RNF1 was investigated using the existing antibodies anti- Pf RNF1.1 and anti- Pf RNF1.2 (Fig. S1B). Western blotting of lysates generated from rings, trophozoites, and schizonts as well as immature and mature gametocytes highlighted prominent Pf RNF1 levels in immature gametocytes, while only weak bands were detected in the other parasite stages (Fig. 1E). Indirect immunofluorescence assays (IFAs) localized Pf RNF1 to the cytoplasm and nucleus of the developing and activated gametocytes and confirmed peak Pf RNF1 levels in immature stage II gametocytes (Fig. 1F; S2). The expression data were in accord with our previous reports on Pf RNF1 [16]. To determine the Pf RNF1 interaction network, we generated a transgenic line episomally expressing a Pf RNF1-GFP-BirA fusion protein. Blood stage parasites were transfected with the vector pARL- Pf RNF1- pffnpa -GFP-BirA [22, 18], whereby the expression of Pf RNF1-GFP-BirA was controlled by the gametocyte-specific pffnpa promotor (Fig. S3A). Diagnostic PCR confirmed the presence of the respective vector in the transgenic line (Fig. S3B). IFA using anti-GFP antibody demonstrated the presence of GFP-tagged Pf RNF1 in the maturing gametocytes (Fig. S4A).Western blot analysis confirmed the presence of the Pf RNF1-GFP-BirA fusion protein with an expected molecular weight of ~280 kDa in gametocyte lysates of line Pf RNF1- pffnpa -GFP-BirA (Fig. S4B). Protein biotinylation in the immature gametocytes was verified by Western blotting, following incubation of the transgenic parasites with 50 µM biotin for 24 h. Immunoblotting with alkaline phosphatase-conjugated streptavidin resulted in multiple bands of potential biotinylated proteins including a band running at Pf RNF1-GFP-BirA (Fig. S4C). No prominent bands were detected in lysates of biotin-treated WT NF54 parasites. Immature gametocytes of line Pf RNF1- pffnpa -GFP-BirA were treated with 50 µM biotin for 24 h and subjected to mass spectrometry-based proximity-dependent biotin identification (BioID-MS) to identify the Pf RNF1 interactome. BioID-MS resulted in the identification of 233 significantly enriched hits in immature PfRNF1 - pffnpa -GFP-BirA gametocytes (Tables S1, S2). For further analyses, we excluded proteins with predicted signal peptides, resulting in a total of 226 putative interactors. These included components of the ribosomal subunits and the UPS, proteins involved in translation initiation (eIFs) and repression (e.g., CITH, DOZI) as well as in mRNA decay (e.g., CCR4-NOT components). The putative Pf RNF1 interactors were subjected to STRING-based analyses to investigate the protein-protein interaction networks, using the Markov Clustering algorithm. A total of 15 clusters were marked, eight of which included ≥ 4 proteins (Fig. 2A; Table S3). The most prominent cluster comprised ribosomal proteins and included a satellite cluster of proteasomal components (cluster red). Two proteins stood out from this cluster, showing multiple interactions with other cluster members, i.e. the NOC3 domain-containing protein PF3D7_1466800 (henceforth termed Pf NOC3DP), and the nuclear export mediator factor Pf NEMF (PF3D7_1202600). Further clusters included proteins involved in chromatin organization (cluster olive), nuclear transport (cluster green) and glycolytic processes (cluster brown), proteins of the mRNA decay (cluster light green) and the CCR4-NOT complex (cluster yellow) as well as heat shock proteins (cluster dark golden rod). During a recent study on the C3H1-ZFP Pf MD3, we identified Pf RNF1 as its interactor by BioID analysis and co-immunoprecipitation assays, and here, Pf MD3 was vice versa identified as an interactor of Pf RNF1. We therefore compared the interactomes of Pf RNF1 (226 proteins) and Pf MD3 (98 proteins) and identified 84 interactors shared by both ZFPs (Fig. 2B; Table S2). To investigate potential sex specificity of the interactors shared by Pf RNF1 and Pf MD3, we investigated their transcriptomic profiles that are available at the Malaria Cell Atlas. Of the 84 interactors, 11 were specific to gametocytes of both sexes, five were highly abundant in female and four highly abundant in male gametocytes (Fig. 2C). Three interactors had high transcript levels in gametocytes but further high transcript levels in the asexual blood stages; 61 interactors had comparable transcript levels in asexual blood stages and gametocytes or were solely expressed in the asexual blood stages. Noteworthy, the shared interactors found in gametocytes included the majority of the recently identified group of regulators of male and female gametocyte development, i.e., GD1, FD1, FD2, FD4, and MD2 [19]. Gene ontology (GO) enrichment analyses assigned the shared interactors in particular to the biological processes of translation and the regulation of RNA stability (Fig. 2D). Transcriptomic profiling of Pf RNF1 and Pf MD3 confirmed that both proteins are expressed throughout gametocyte development independent of the sex (Fig. 3A, B). Interactors of the two bait proteins that were particularly expressed in female gametocytes included in addition to Pf FD2, Pf FD4 and the CCR4-NOT component Pf NOT2 two unknown proteins, i.e., PF3D7_0825900 (henceforth termed female gametocyte protein Pf FGP1) and the above mentioned Pf NOC3DP (Fig. 3C; Table S2). The four proteins that were transcriptionally highly expressed in males included the RBP Pf PUF1, the structural inner membrane complex (IMC)-associated protein Pf PIP2, the kelch domain-containing protein PF3D7_1131600 (henceforth termed Pf KelchDP) and a yet unknown protein, PF3D7_0602000 (henceforth termed protein of developing gametocytes Pf PDG2). Noteworthy, Pf PDG2 was previously described as a C3H1-ZFP [23, 13], however a distinct zinc finger domain could not be annotated. The eleven proteins, which were highly expressed in both male and female gametocytes, included Pf RNF1, Pf ZNF4, Pf FD1, Pf MD3, Pf MDV1 (male development gene 1), and the structural IMC proteins Pf PIP2 and Pf PIP3. Further proteins of male and female gametocytes were the MKT1 domain-containing protein PF3D7_1003700 (henceforth termed Pf MTK1DP) the C3H1-ZFP PF3D7_0522900 (henceforth termed Pf ZFP-G1), the SUZ domain-containing protein PF3D7_0218200 (henceforth termed Pf SUZDP), and a yet unknown Plasmodium protein, PF3D7_1416600 (henceforth termed protein of developing gametocytes Pf PDG1). Three proteins exhibited high transcript expression in gametocytes as well as in asexual stage parasites, i.e., Pf GD1, Pf a35-2, and the ornithine aminotransferase Pf OAT (Fig. 3C, Table S2). Noteworthy, Pf MD2 appeared to be expressed in two transcript variants, both of which showed minor expression levels and were thus not included in the evaluation. Our combined data show that Pf RNF1 is a RBUL specific to gametocytes that forms a comprehensive interaction network with other ZFPs and recently identified regulators of gametocyte development. Expression of Pf RNF1 starts in the stalk phase of gametocyte development and continues during branching and the early sex identity phase with peak levels at gametocyte stage II. Pf RNF1 levels increase following treatment of gametocytes with TSA [16], suggesting that its expression during sexual development is epigenetically regulated. The most prominent interactors of Pf RNF1 can be divided in two groups. The first group comprises components of the UPS, like proteasome subunits, the ubiquitin-like protein PF3D7_0922100 and the ubiquitin-specific protease PF3D7_0904600. The second group comprises various types of RBPs. These include the ALBA family members ALBA1, ALBA3 and ALBA4, which have functions in mRNA homeostasis and translational regulation [24-26] as well as components of the CCR4-NOT core complex like CAF1, CAF40, NOT1-G, NOT1 and NOT2. The CCR4-NOT complex is a conserved large multifunctional assembly of proteins which function in mRNA decay [27]. The plasmodial components of the CCR4-NOT complex have mainly been studied in P. yoelii . It was demonstrated by loss-of-function studies that Py CCR4-1, Py NOT1-G, and Pf CAF1 play crucial roles during gametocyte development and gametogenesis by regulating mRNAs important for these processes [28, 29]. Other RBPs that interact with Pf RNF1 are associated with translational repression such as CITH, DOZI and PABP1. These RBPs store mRNAs that encode proteins required for the development of the mosquito midgut stages in cytosolic granules, and the transcripts are only introduced to protein synthesis at the onset of gametogenesis (reviewed in [12]). A further interacting RBP is Pf PUF1. Noteworthy, its deficiency leads to a sharp decline in the late stage gametocytes and a sex-ratio shift towards males [30]. Considering the fact that single cell transcriptomics assign Pf PUF1 particularly to the male branch, a function of Pf PUF1 in repressing male transcripts could be considered. Pf RNF1 also interacts with the C3H1-ZFP Pf MD3 [18], hence a regulator of male development. We recently showed that lack of Pf MD3 significantly impairs gametocyte maturation and leads to a sex-ratio shift towards females [18]. We now demonstrate that both ZFPs, Pf RNF1 and Pf MD3, share the majority of interactors. These include in particular members of gametocyte development regulators, as originally identified in P. berghei , i.e., GD1, FD1, FD2, FD4, and MD2 [19] as well as Pf ZNF4, a C3H1-ZFP crucial for male gametogenesis [17]. To be highlighted is the interaction of Pf RNF1 and Pf MD3 with Pf GD1, a regulator of female gametocyte development. P. berghei parasites lacking the orthologous Pb GD1 show a sex-ratio shift towards males, comparable to the above mentioned loss-of-function phenotype of Pf PUF1. Co-immunoprecipitation assays using Pb GD1 as bait revealed several interactors that were also shared between Pf RNF1 and Pf MD3, such as the RBPs Pf CITH, Pf PUF1, Pf NOT-1G, and Pf PABP1, as well as the ATP-dependent RNA helicase Pf DBP1, a 14-3-3 protein (PF3D7_0818200) and Pf MTK1DB [19]. Noteworthy, Pf RNF1 was identified in a protein interaction network with another regulator of male development, Pf MD1, which is also an interactor of Pf MD3. PfMD1 is a component of cytoplasmic granules and involved in male gametocyte development with the N-terminus of the regulator being crucial for a male fate, while the LOTUS domain at the C-terminus guides male gametocytogenesis [31]. In conclusion, our combined data pinpoint Pf RNF1 a multifunctional RBUL which links the UPS with RNA-binding proteins to regulate the posttranscriptional machinery during gametocyte development and sex identity of the malaria parasite P. falciparum . In humans, RBULs are currently investigated as novel targets for anticancer therapy (reviewed in [32]), which gives rise to hope that plasmodial RBULs like Pf RNF1 could represent a target structures for antimalarials and transmission-blocking agents in further studies. Experimental Procedures Gene identifiers The following PlasmoDB gene IDs were assigned to the genes and proteins examined in this study: Pf RNF1 (PF3D7_0314700); Pf 39 (PF3D7_1108600); Pf s230 (PF3D7_0209000); Pf AMA1 (PF3D7_1133400); Pf CCp2 (PF3D7_1455800); Pf FBPA (PF3D7_1444800); Pf FD1 (PF3D7_1241400); Pf FD2 (PF3D7_1146800); Pf FD4 (PF3D7_1220000); Pf FGP1 (PF3D7_0825900); Pf FNPA (PF3D7_1451600); Pf GD1 (PF3D7_0927200); Pf KelchDP (PF3D7_1131600); Pf MD3 (PF3D7_0315600); Pf MSP1 (PF3D7_0930300); Pf MTK1DP (PF3D7_1003700); Pf NOC3DP (PF3D7_1466800); Pf NOT2 (PF3D7_1128600); Pf PDG1 (PF3D7_1416600); Pf PDG2 (PF3D7_0602000); Pf PUF1 (PF3D7_0518700); Pf SUZDP (PF3D7_0218200); Pf ZFP-G1 (PF3D7_0522900); Pf ZNF4 (PF3D7_1134600). Antibodies The following primary antibodies were used in the study: mouse anti-GFP (Roche, Basel, Switzerland); rabbit anti- Pf s230 (BioGenes, Berlin, Germany); rabbit anti- Pf 39 (Davids Biotechnology, Regensburg, Germany); rabbit anti- Pf MSP-1 (ATCC, Manassas, USA); mouse anti- Pf RNF1.1 [18]; mouse anti- Pf RNF1.2 [16]. The following dilutions were used: 1) IFA: rabbit anti- Pf s230 (1:500); rabbit anti- Pf 39 (1:200); mouse anti- Pf RNF1.1 (1:20); mouse anti- Pf RNF1.2 (1:20); mouse anti-GFP (1:200), rabbit anti- Pf MSP1 (1:100); 2) Western blotting: rabbit anti- Pf 39 (1:10,000); mouse anti-GFP (1:1,000); mouse anti - Pf RNF1.2 (1:500). Parasite culture The gametocyte producing strain P. falciparum NF54 (termed WT NF54) was used in the experiments. Cultivation of parasites and purification of gametocytes were performed as described previously (e.g., [18, 33, 34]). Human erythrocyte concentrate and serum were purchased from the transfusion medicine department of the University Hospital Aachen, Germany. The work with human blood was approved by the University Hospital Aachen Ethics commission (EK007/13) and serum samples were pooled and the donors remained anonymous. Generation of line Pf RNF1- pffnpa -GFP-BirA The Pf RNF1- pffnpa -GFP-BirA parasite line was generated, using vector pARL- pffnpa -GFP-BirA as described previously [22, 18, 33]. The following primers were used for gene amplification: Pf RNF1- pffnpa -GFP-BirA-forward-primer (primer 1; Fig. S3A) atgcatggtaccATGGCTCATAAAGTAAAAAAAGAAAAAAAAAC; Pf RNF1- pffnpa -GFP-BirA-reverse-primer atgcatcctaggCTTCTTATAACTATTTCGAAGAT. The presence of the vector in the transfectant line was confirmed by diagnostic PCR (Fig. S3B) using the above forward primer (primer 1) as well as pARL-GFP-BirA-reverse-primer (primer 2; Fig. S3A) CAAGTGTTGGCCATGGAA. Amplification of the aldolase-encoding gene pffbpa was used as loading control as described previously [17]. Semi-quantitative RT-PCR To determine the transcript expression of Pf RNF1, total RNA was isolated from rings, trophozoites, schizonts, and immature and mature gametocytes as well as gametocytes at 30 min post-activation, and semi-quantitative RT-PCR was performed as described previously [17]. For transcript amplification of pfrnf1 , the following primers were used: Pf RNF1-RTPCR-forward-primer CAAACGCATGCAAAAGAAGA; Pf RNF1-RTPCR-reverse-primer GTATGAGTGCCCTCCGAAAA. Stage purity was verified by amplification of the asexual blood stage transcript pfama1 (apical membrane antigen 1) and the gametocyte-specific transcript pfccp2 (LCCL-domain containing protein 2); amplification of the pffbpa transcript (fructose bisphosphate aldolase) served as positive and loading control. Potential gDNA contamination was excluded by pffbpa amplification using RNA samples lacking reverse transcriptase. Primer sequences for these transcripts were described previously [17]. Western Blotting Parasite lysates of line Pf RNF1- pffnpa -GFP-BirA and WT NF54 were prepared and subjected to Western blotting as described previously [18, 33, 34]. Pf RNF1 was detected by immunoblotting with mouse anti-PfRNF1.2 antibody and Pf RNF1-GFP-BirA was detected using mouse anti-GFP antibody. Immunoblotting with antibodies against the endoplasmic reticulum-resident protein Pf 39 served as loading control. Lysates of non-infected red blood cells or WT NF54 served as negative controls. For detection of primary antibodies, goat anti-mouse and anti-rabbit alkaline phosphatase-conjugated secondary antibodies (1:5,000; Sigma-Aldrich, Taufkirchen, Germany) were used. Biotinylated proteins were labelled using alkaline phosphatase-conjugated streptavidin (1:1,000; Sigma-Aldrich). Indirect Immunofluorescence Assay Methanol-fixed monolayers of blood-stage parasites of line Pf RNF1- pffnpa -GFP-BirA and WT NF54 were subjected to indirect immunofluorescence assays as described previously [18, 33]. Pf RNF1 was detected by immunolabeling with anti- Pf RNF1.1 and anti- Pf RNF1-2 antibodies and Pf RNF1-GFP-BirA was detected using mouse anti-GFP antibody. Asexual blood stages and gametocytes were highlighted by anti- Pf MSP1 and anti- Pf s230 antisera; sera from non-immunized mice was used for negative control. For detection of primary antibodies, goat anti-mouse Alexa Fluor 488 and anti-rabbit Alexa Fluor 594 (Invitrogen, Karlsruhe, Germany) were used. The parasite nuclei were stained with Hoechst 33342 (1:5,000; Invitrogen). BioID-MS analysis Percoll-enriched immature gametocytes of line Pf RNF1- pffnpa -GFP-BirA and WT NF54 were treated with 50 µM biotin for 24 h. The cells were subsequently harvested, processed by single-pot solid-phase-enhanced sample preparation and subjected to liquid chromatography-mass spectrometry analysis followed by label-free quantification as described previously [22, 34, 18, 33]. BioID-MS was performed on three independent streptavidin-purified protein samples with three technical replicas for each sample. Bioinformatics The 3D structure of Pf RNF1 was predicted using the AlphaFold programme ( https://alphafold.ebi.ac.uk, see entry O97260 ; [35, 36]). Gene expression, protein function, and GO term analysis were performed using the database PlasmoDB (http://plasmoDB.org; [23]). Transcriptomic profiling was carried out with the Malaria Cell Atlas (https://www.malariacellatlas.org/atlas/plasmodium-falciparum-atlas; [37]), using UMAP settings. A network analysis was conducted using the STRING database (version 11.0; [38]), utilizing the Markov Clustering (MCL) algorithm and default settings. Data availability The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium (http://proteomecentral.proteomexchange.org) via the jPOST partner repository with the dataset identifiers PXD040384 for ProteomeXchange and JPST002050 for jPOST. Funding The authors acknowledge funding by the Deutsche Forschungsgemeinschaft (project grants NG170/1-1 to CJN and PR905/20-1 to GP and grants PR905/19-1 to GP and TE599/9-1 to ST of the DFG priority programme SPP 2225). References 1. World malaria report 2024. WHO, https://www.who.int/publications/i/item/9789240104440. 2. Beri, D., Balan, B., & Tatu, U. (2018). Commit, hide and escape: the story of Plasmodium gametocytes. Parasitology, 145, 1772-1782. 3. Josling, G. A., Williamson, K. C., & Llinás, M. (2018) Regulation of Sexual Commitment and Gametocytogenesis in Malaria Parasites. Annual Review of Microbiology, 72, 501-519. 4. Voss, T. S., & Brancucci, N. M. (2024). Regulation of sexual commitment in malaria parasites - a complex affair. Current Opinion in Microbiology, 79, 102469. 5. Yuda, M., Kaneko, I., Iwanaga, S., Murata, Y., & Kato, T. (2020). Female-specific gene regulation in malaria parasites by an AP2-family transcription factor. Molecular Microbiology, 113, 40-51. 6. Li, Z., Cui, H., Guan, J., Liu, C., Yang, Z., & Yuan, J. (2021). Plasmodium transcription repressor AP2-O3 regulates sex-specific identity of gene expression in female gametocytes. EMBO Reports, 22, e51660. 7. Mair, G. R., Braks, J. A. M., Garver, L. S., Wiegant, J. C. A. G., Hall, N., Dirks, R. W., . . . Waters, A. P. (2006). Regulation of sexual development of Plasmodium by translational repression. Science, 313, 667-669. 8. Mair, G. R., Lasonder, E., Garver, L. S., Franke-Fayard, B. M. D., Carret, C. K., Wiegant, J. C. A. G., . . . Waters, A. P. (2010). Universal features of post-transcriptional gene regulation are critical for Plasmodium zygote development. PLoS Pathogens , 6 (2), e1000767. 9. Miao, J., Li, J., Fan, Q., Li, X. [Xiaolian], Li, X. [Xinyi], & Cui, L. (2010). The Puf-family RNA-binding protein PfPuf2 regulates sexual development and sex differentiation in the malaria parasite Plasmodium falciparum. Journal of Cell Science, 123, 1039-1049. 10. Miao, J., Fan, Q., Parker, D., Li, X., Li, J., & Cui, L. (2013). Puf mediates translation repression of transmission-blocking vaccine candidates in malaria parasites. PLoS Pathogens, 9, e1003268. 11. Bennink, S., Kiesow, M. J., & Pradel, G. (2016). The development of malaria parasites in the mosquito midgut. Cellular Microbiology, 18, 905-918. 12. Bennink, S., & Pradel, G. (2019). The molecular machinery of translational control in malaria parasites. Molecular Microbiology, 112, 1658-1673. 13. Ngwa, C. J., Farrukh, A., & Pradel, G. (2021). Zinc finger proteins of Plasmodium falciparum. Cellular Microbiology, 23, e13387. 14. Cassandri, M., Smirnov, A., Novelli, F., Pitolli, C., Agostini, M., Malewicz, M., . . . Raschellà, G. (2017). Zinc-finger proteins in health and disease. Cell Death Discovery, 3, 17071. 15. Kamaliyan, Z., & Clarke, T. L. (2024). Zinc finger proteins: Guardians of genome stability. Frontiers in Cell and Developmental Biology, 12, 1448789. 16. Ngwa, C. J., Kiesow, M. J., Papst, O., Orchard, L. M., Filarsky, M., Rosinski, A. N., . . . Pradel, G. (2017). Transcriptional Profiling Defines Histone Acetylation as a Regulator of Gene Expression during Human-to-Mosquito Transmission of the Malaria Parasite Plasmodium falciparum. Frontiers in Cellular and Infection Microbiology, 7, 320. 17. Hanhsen, B., Farrukh, A., Pradel, G., & Ngwa, C. J. (2022). The Plasmodium falciparum CCCH Zinc Finger Protein ZNF4 Plays an Important Role in Gametocyte Exflagellation through the Regulation of Male Enriched Transcripts. Cells, 11, 1666. 18. Farrukh, A., Musabyimana, J. P., Distler, U., Mahlich, V. J., Mueller, J., Bick, F., . . . Ngwa, C. J. (2024). The Plasmodium falciparum CCCH zinc finger protein MD3 regulates male gametocytogenesis through its interaction with RNA-binding proteins. Molecular Microbiology, 121, 543-564. 19. Russell, A. J. C., Sanderson, T., Bushell, E., Talman, A. M., Anar, B., Girling, G., . . . Billker, O. (2023). Regulators of male and female sexual development are critical for the transmission of a malaria parasite. Cell Host & Microbe, 31, 305-319.e10. 20. Thapa, P., Shanmugam, N., & Pokrzywa, W. (2020). Ubiquitin Signaling Regulates RNA Biogenesis, Processing, and Metabolism. BioEssays : News and Reviews in Molecular, Cellular and Developmental Biology, 42, e1900171. 21. Guseva, E. A., Emelianova, M. A., Sidorova, V. N., Tyulpakov, A. N., Dontsova, O. A., & Sergiev, P. V. (2024). Diversity of Molecular Functions of RNA-Binding Ubiquitin Ligases from the MKRN Protein Family. Biochemistry. Biokhimiia, 89, 1558-1572. 22. Musabyimana, J. P., Distler, U., Sassmannshausen, J., Berks, C., Manti, J., Bennink, S., . . . Pradel, G. (2022). Plasmodium falciparum S-Adenosylmethionine Synthetase Is Essential for Parasite Survival through a Complex Interaction Network with Cytoplasmic and Nuclear Proteins. Microorganisms, 10, 1419. 23. Aurrecoechea, C., Brestelli, J., Brunk, B. P., Dommer, J., Fischer, S., Gajria, B., . . . Wang, H. (2009). Plasmodb: A functional genomic database for malaria parasites. Nucleic Acids Research, 37(Database issue), D539-43. 24. Vembar, S. S., Macpherson, C. R., Sismeiro, O., Coppée, J.‑Y., & Scherf, A. (2015). The PfAlba1 RNA-binding protein is an important regulator of translational timing in Plasmodium falciparum blood stages. Genome Biology, 16, 212. 25. Muñoz, E. E., Hart, K. J., Walker, M. P., Kennedy, M. F., Shipley, M. M., & Lindner, S. E. (2017) ALBA4 modulates its stage-specific interactions and specific mRNA fates during Plasmodium yoelii growth and transmission. Molecular Microbiology 106, 266-284. 26. Banerjee, C., Nag, S., Goyal, M., Saha, D., Siddiqui, A. A., Mazumder, S., Debsharma, S., Pramanik, S., & Bandyopadhyay U. Nuclease activity of Plasmodium falciparum Alba family protein PfAlba3.Cell Reports 42, 112292. 27. Chalabi Hagkarim, N., & Grand, R. J. (2020). The Regulatory Properties of the Ccr4-Not Complex. Cells, 9, 2379. 28. Hart, K. J., Oberstaller, J., Walker, M. P., Minns, A. M., Kennedy, M. F., Padykula, I., . . . Lindner, S. E. (2019). Plasmodium male gametocyte development and transmission are critically regulated by the two putative deadenylases of the CAF1/CCR4/NOT complex. PLoS Pathogens, 15, e1007164. 29. Hart, K. J., Power, B. J., Rios, K. T., Sebastian, A., & Lindner, S. E. (2021). The Plasmodium NOT1-G paralogue is an essential regulator of sexual stage maturation and parasite transmission. PLoS Biology, 19, e3001434. 30. Shrestha, S., Li, X., Ning, G., Miao, J., & Cui, L. (2016). The RNA-binding protein Puf1 functions in the maintenance of gametocytes in Plasmodium falciparum. Journal of Cell Science, 129, 3144-3152. 31. Gomes, A. R., Marin-Menendez, A., Adjalley, S. H., Bardy, C., Cassan, C., Lee, M. C. S., & Talman, A. M. (2022). A transcriptional switch controls sex determination in Plasmodium falciparum. Nature, 612, 528-533. 32. George, M., Masamba, P., Iwalokun, B. A., & Kappo, A. P. (2023). Zooming into the structure-function of RING finger proteins for anti-cancer therapeutic applications. American Journal of Cancer Research, 13, 2773-2789. 33. Sassmannshausen, J., Bennink, S., Distler, U., Küchenhoff, J., Minns, A. M., Lindner, S. E., . . . Pradel, G. (2024). Comparative proteomics of vesicles essential for the egress of Plasmodium falciparum gametocytes from red blood cells. Molecular Microbiology, 121, 431-452. 34. Musabyimana, J.‑P., Musa, S., Manti, J., Distler, U., Tenzer, S., Ngwa, C. J., & Pradel, G. (2024). The Plasmodium falciparum histone methyltransferase SET10 participates in a chromatin modulation network crucial for intraerythrocytic development. MSphere, 9, e0049524. 35. Jumper, J., Evans, R., Pritzel, A., Green, T., Figurnov, M., Ronneberger, O., . . . Hassabis, D. (2021). Highly accurate protein structure prediction with AlphaFold. Nature, 596, 583-589. 36. Varadi, M., Anyango, S., Deshpande, M., Nair, S., Natassia, C., Yordanova, G., . . . Velankar, S. (2022). Alphafold Protein Structure Database: Massively expanding the structural coverage of protein-sequence space with high-accuracy models. Nucleic Acids Research, 50, D439-D444. 37. Howick, V. M., Russell, A. J. C., Andrews, T., Heaton, H., Reid, A. J., Natarajan, K., . . . Lawniczak, M. K. N. (2019). The Malaria Cell Atlas: Single parasite transcriptomes across the complete Plasmodium life cycle. Science, 365, eaaw2619. 38. Szklarczyk, D., Gable, A. L., Lyon, D., Junge, A., Wyder, S., Huerta-Cepas, J., . . . Mering, C. von (2019). String v11: Protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Research, 47, D607-D613. Figure Legends Fig. 1. Pf RNF1 is expressed during gametocyte development of P. falciparum . (A) Schematic depicting Pf RNF1. The RING finger domain (R) is highlighted. (B) Predicted 3-D structure of Pf RNF1. The 3-D structure was generated using the AlphaFold database. (C) Single-cell gene expression of Pf RNF1 across the stalk and branching phase of gametocyte development. The image depicts a UMAP plot generated using the Malaria Cell Atlas database. (D) Transcript expression of Pf RNF1 in blood stage parasites. Complementary DNA from rings (RI), trophozoites (TZ), schizonts (SZ), and immature (imGC), mature (mGC), and gametocytes at 30 min post-activation (aGC) of WT NF54 were subjected to diagnostic RT-PCR using pfrnf1 -specific primers. Transcript amplification of pffbpa was used as housekeeping control, and samples without reverse transcriptase (-RT) served as genomic DNA controls. (E) Protein expression of Pf RNF1 in blood stage parasites. Lysates from RI, TZ, SZ, imGC, and mGC stages of WT NF54 were immunoblotted with mouse anti- Pf RNF1.2 antisera to detect Pf RNF1 (~136 kDa). Non-infected red blood cells (niRBCs) served as a negative control, and immunoblotting with rabbit antisera directed against the ER-resident Pf 39 (~39 kDa) served as loading control. (F) Localization of Pf RNF1 in gametocytes. Methanol-fixed TZ, SZ, and GC II-V stages of WT NF54 were immunolabeled with mouse anti- Pf RNF1.2 antisera (green). Asexual blood stages and gametocytes were highlighted with rabbit antisera directed against Pf MSP1 and Pf s230, respectively (red); nuclei were highlighted with Hoechst 33342 nuclear stain (blue). Bar, 5 µm. Fig. 2. Pf RNF1 forms an interaction network composed of RBPs and translational regulators. (A) Network analysis of the Pf RNF1 interactors in immature gametocytes. A protein-protein network of the 226 putative Pf RNF1 interactors in immature gametocytes was generated using the STRING database and the Markov Clustering (MCL) algorithm. Disconnected nodes were excluded. Selected clusters and interactors are highlighted. (B) Venn diagram depicting interactors shared between Pf RNF1 (226 interactors) and Pf MD3 (98 interactors; [18]). (C) Bar diagram depicting numbers and sex specificity of interactors shared between Pf RNF1 and Pf MD3 with high expression in gametocytes. The expression profiles were analyzed using the Malaria Cell Atlas. (D) Word cloud depicting the biological processes of interactors shared between Pf RNF1 and Pf MD3. The GO enrichment analysis was performed, using the PlasmoDB database. Fig. 3. Single-cell transcriptome profiling of interactors shared between Pf RNF1 and Pf MD3 reveals novel gametocyte-specific proteins. (A) Representative image of single-cell transcriptomes across the asexual blood stages, developing gametocytes, and sexually differentiated male and female gametocytes. (B) Single-cell gene expression of Pf RNF1 and Pf MD3. (C) Single-cell transcriptome profiling of 15 interactors shared by Pf RNF1 and Pf MD3 with high expression in gametocytes. The images depict UMAP plots generated using the Malaria Cell Atlas database. Figure 1 Figure 2 Figure 3 Information & Authors Information Version history V1 Version 1 17 January 2025 Copyright This work is licensed under a Non Exclusive No Reuse License. Keywords gametocyte malaria rbul sexual development transcription zinc finger protein Authors Affiliations Afia Farrukh RWTH Aachen University View all articles by this author Sherihan Musa RWTH Aachen University View all articles by this author Ute Distler Medical Centre of the Johannes-Gutenberg University View all articles by this author Stefan Tenzer 0000-0003-3034-0017 University Medical Center of the Johannes-Gutenberg-University Mainz View all articles by this author Gabriele Pradel 0000-0003-2264-5558 [email protected] RWTH Aachen University View all articles by this author Che Julius Ngwa RWTH Aachen University View all articles by this author Metrics & Citations Metrics Article Usage 424 views 217 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Afia Farrukh, Sherihan Musa, Ute Distler, et al. The Plasmodium falciparum RING finger protein Pf RNF1 forms an interaction network with regulators of sexual development. Authorea . 17 January 2025. DOI: https://doi.org/10.22541/au.173711715.56527027/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.173711715.56527027/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9ff59a7dddebdf94',t:'MTc3OTM4NzcxNA=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();