Cost-Reduction Strategy to Culture Patient Derived Bladder Tumor Organoids | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Cost-Reduction Strategy to Culture Patient Derived Bladder Tumor Organoids Mahsa Mollapour Sisakht, Fatemeh Gholizadeh, Shirin Hekmatirad, and 9 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4899481/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 04 Feb, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Organoids as an aggregation of stem cells can recapitulate the function of organs in miniature form and have developed great potential for clinical translation, drug screening and personalized medicine over the last decade. Most organoids are currently cultured in basement membrane matrices (BMMs), which is hampered by xenogeneic origin, batch-to-batch variability, cost and complexity. In addition, organoid culture relies on biochemical signals provided by various growth factors in the composition of the medium. We have developed a method for culturing organoids from bladder tumors in a sodium alginate hydrogel scaffold in addition to fibroblast conditioned medium (FCM)-enriched culture medium that is inexpensive and easily amenable to clinical applications. Tumor organoids in Alginate and FCM based medium grow in comparable to those cultured in BMMs and standard medium. The organoids express specific bladder organoid markers containing CK14, CK20, LGR5, Uroplakin III, FOX1A, GATA3, CK5 and CK44 and the proliferation potential showed by confocal microscopy. The results indicate that alginate is very promising for early passage human bladder organoid culture with increase the scalability potential. Furthermore, using FCM based medium as an alternative solution can be consider, especially for low-resource situation and to develop cost effective tumor organoids. Biological sciences/Biological techniques Biological sciences/Cancer Biological sciences/Stem cells Health sciences/Oncology Health sciences/Urology Physical sciences/Materials science Organoids Bladder tumor Alginate Fibroblast conditioned medium Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction A unique three-dimensional (3D) culture structure with the ability to mimic the development and regeneration of organs is called an organoid. Organoids develop from the self-organization of stem cells to eventually form structures that resemble in vivo organs ( 1 ). Effective organoid generation in in-vitro depends on recapitulating three main features: physical properties of the environment surrounding the cells; soluble cues; and type of starting cells. Accordingly, biomaterials and medium are needed to provide a compatible microenvironment that resembles the extracellular matrix ( 2 ). Currently, basement membrane derived matrices (BMMs), Cultrex BME and matrigel, are gold standard scaffolds for organoid culture ( 3 , 4 ). Both of these extracellular matrixes are hydrogels (type of soft material that absorbs large amounts of water to shape a 3D fiber network ( 5 )) composed of primary components including laminin, collagen IV, heparin sulfate proteoglycan perlecan and entactin ( 6 ). It should be noted that hydrogels are not only an inert scaffold, but also provide the biological and chemical conditions necessary for the proliferation and differentiation of cells ( 7 ). For example, laminin-1 contains numerous anchorage sites for the attachment of different cell types such as stem cells and laminin-derived peptides also contribute to differentiation, angiogenesis and metastasis. BME and matrigel also encompass tumor-derived proteins like fibroblast growth factors (FGFs), transforming growth factor beta (TGF-β) and matrix metalloproteinases (MMPs) which strongly contribute to the organoid formation. These properties together make them effective scaffolds for the development and culture of organoids and tumor organoids ( 8 ). However, BMMs are not flawless and have some drawbacks. Batch-to-batch variations and even inconsistencies in a single batch reported and has led to lack of reproducibility in 3D-culture experiments ( 9 ). In addition to the approximately 2000 proteins identified in these BMMs to date, proteomic studies continue to identify new proteins in these biomaterials that have not been reported previously ( 8 ). Moreover, since these are natural hydrogels extracted from mouse sarcoma, which has antigenicity potential and possibility of introduction xenogenic and/or viral contamination to be used in clinical studies ( 10 , 11 ). Besides, thermal-sensitivity, high cost and requirement of cold chain for transportation, make them challenging for establishment of organoid, especially in countries with low resources for research ( 12 ) ( 13 ). Meanwhile, tumor organoid culture medium needs a medium supplemented with several expensive growth factors such as R-spondin, Wnt3a, FGF2, FGF10, noggin, forskolin, A83 (TGFβ inhibitor) and epidermal growth factor (EGF). According to the estimate of Chang et al. the necessary cost to prepare 50 mL of this medium is about US $ 646 ( 14 ). Here we describe using alginate as a tissue-mimetic scaffold with viscoelastic behavior. Sodium Alginate is a cost effective and naturally derived from brown algae with controllable gelation after adding calcium chloride as a cross-linker ( 15 ). A series of studies have been conducted on organoid culture with this FDA-approved hydrogel ( 16 ) and promising results have been reported ( 17 , 18 ). Different studies showed variation of potential in using alginate as a supportive scaffold especially for long term culture ( 16 , 19 ), although the alginate shows hydrophilicity which prevents protein absorption and lack of cell adhesive properties, it seems considerable potential to provide growth and mechanical support for organoid culture ( 16 , 17 , 20 ). Here, we characterized an alternative tumor organoid culture platform by using alginate and fibroblast conditioned medium (FCM) in comparison with standard protocol of bladder organoid generation, to show the potential of using this scaffold and FCM as cost reduction strategy that help accessibility to organoid culture establishment, especially for early stage drug screening. Materials and methods 2.1. Sample collection Human bladder cancer tissue from 10 patients were obtained from patients undergoing TURBT (Transurethral resection of bladder tumor) at Emam Khomeini Hospital (Table.1). All patients were informed about the study in writing and verbally and signed an informed consent form. The study protocol was approved by the Ethics Committee of Tehran University of Medical Sciences prior to screening of patients (IR.TUMS.TIPS.REC.1402.139). All methods were performed in accordance with the relevant guidelines and regulations. During surgery, tumor tissue samples were collected into a falcon containing Advanced DMEM/F12 culture medium (Gibco) supplemented with 1% Glutamine, 1% Hepes and Primocin (invivogen) (1ml in 500ml) (:Advanced DMEM/F12 +++ ), placed on ice, and transported directly to the laboratory. Tissue samples were employed to establish primary tumor organoid culture. Table.1. Patients Characteristic Sex Age Pathological classification Invasiveness Pre cancer treatment F:2 M:8 Average: 62.2 Range (40–79) CIS: 2 PTa: 3 PT1:1 PT2:0 PT3:3 PT4:1 Low grade: 6 High grade: 4 NMIBC:6 MIBC:4 Non : 2 TURBT: 5 Mitomycin instillation: 0 BCG instillation:2 Neoadj. Chemotherapy:1 CIS: Carcinoma in situ; NMIBC: Non muscle invasive bladder cancer; MIBC: Muscle invasive bladder cancer; Non: noncancerous patients; TURBT: Transurethral resection of bladder tumor; Mitomycin instillation: the treatment involves instillations of liquid chemotherapy; BCG: Bacillus Calmette–Guerin; Neoadj. Chemotherapy: It is a type of induction therapy. 2.2. Hydrogel Alginate Preparation 3% Sodium Alginate (SA) hydrogel (ZFZ Co. Iran) was prepared by using Advanced DMEM/F12 +++ as solvent. The combination stirred on a magnetic stirrer under the hood for about one hour at room temperature or until the solid phase dissolved. 2.3. Establishment and maintenance of bladder tumor organoids 2.3.1. Tissue dissociation The tumor tissue were washed in human organoid washing medium cold Ad DMEM/F12 +++ (advanced Dulbecco's Modified Eagle Medium contain Hepes, Lglutamine and Primocin), and put in a petri dish to cut it in smaller pieces with a surgical blade; minced tissues were washed in 1 mL of washing medium and centrifuge at 350g for 5 min. After removal of the medium, tissues were then incubated in 1 mL of 1:10 dilution of collagenase1A (Sigma Aldrich) prepared in Earle's Balanced Salt Solution (EBSS) (Gibco) at 37ͦC for 30 min (meanwhile, the tissues were dissociated mechanically by pipetting). Incubated tissue with collagenase filtered 70 µm cell strainer, and filled up with Ad DMEM/F12 +++ for inactivation collagenase and centrifuged again at 350g for 5 min, this washing step was repeated twice. After removing the AdDMEM/F12 +++ , cell pellet was combined with alginate (Alg) solution (1:3) and dropped into the 40mM calcium chloride (40 mM), incubated for 8–10 min to be solidify and formed drop. The calcium chloride were replaced with bladder expansion medium which is Ad DMEM/F12 +++ supplemented with 10mM of the ROCK inhibitor Y-27632 (Sigma-Aldrich), B27 50X (Thermo Fisher), NAC (N-acetylcysteine) 500 mM (Sigma Aldrich), NIC (Nicotinamide) 1M (Sigma Aldrich), WNT homemade conditioned medium, R-Spondin-1 homemade conditioned medium (both gifted from Biochemistry department, EMC) and A83 (20mM) (Tocris). Standard medium contains FGF7 (Peprotech) 25 ng/ml, FGF10 (Peprotech) 100 ng/ml and FGF2 (Peprotech) 12.5 ng/ml. In case of FCM-based medium, FGF7, 10 and 2 was replaced with 40 ml of FCM (describe in section 2.5 ). Approximate amount of FGF2, 7 and 10 in 40 ml of home-made FCM medium prepared for bladder medium organoids were 8.07 ng/ml, 13.89 ng/ml, 8.79 ng/ml, respectively. The medium was filtered through 0.2 µm filter. The medium was changed every 2–3 days (Table.2). As control, same amount of the cell pellet after centrifuge, was dropped into the BME (Basement Membrane Extract) and the rest for each patients embedded into alginate 3%. Table.2. List of organoid culture medium reagents Reagents Stock Final concentration B27 50x 2% A83 20 mM 5 ϻM FGF2 (only for standard medium) 125 µg/mL 12.5 ng/ml FGF7 (only for standard medium) 250 µg/mL 25 ng/ml FGF10 (only for standard medium) 0.5 mg/mL 100 ng/ml N-acetylcysteine 500 mM 1.25 mM Nicotinamide 1 M 10 mM EGF 1mg/ml 40 ng/ml Primocin - 1 ml in 500 ml of AdDMEM Advanced DMEM/F12 - Substituted: Glutamide 5 mL Hepes 5 mL Primocin 2 mL Hydrogel Alginate - 3% calcium chloride - 40Mm Collagenase 1A 10 mg/ml 1 mg/mL Dispase - 1.90 U/mg EBSS - - Glutamine - 1% R-spondin Conditioned medium - 2.5% Rock Inhibitor/ Y-27632 10 mM 1 µM Wnt3a Conitioned medium - 2.5% Hepes - 1% DMEM high glucose - - Pen/strep - 1% FBS - 10% Top up with Advanced DMEM/F12 for standard medium containing FGFs - To 40 ml Top up with Fibroblast condition medium (FCM) for medium containing FCM instead of FGFs - To 40 ml 2.3.2. Expansion and maintenance Every 7–10 days according to the organoid density and size, to disrupt the alginate drop we used 500 ϻl of phosphate-buffered saline (PBS) and incubated in room temperature for 10 min, afterwards, the 1µg/ml dispase (Gibco) was added to each well in tissue culture plate, and the digestion process was conducted enzymatically and mechanically, digested organoids were combined with Alg/ AdDMEM/ F12 +++ to make the new drops. The general split ratio is 1:2–3, depending on growth rate ( 21 ). 2.4. Viability and size assessment AlamarBlue viability assay (Invitrogen DAL1025) was carried out in this study which is based on the fluorescence reading of resorufin converted into cell enzymes from resazurin and allows measurement of the signal from tumor organoids ( 22 ). Wells with organoids were randomly selected (in triplicates) after 3, 7 and 14 days. First, The reagent were diluted with BOM medium to make 10% Alamar blue, incubated for 4h in the incubator and then reading was performed according to the manufacturer’s instructions. Absorbance readings were taken at wavelengths 570 and 600 nm. The results were normalized to control (Matrix or scaffold). Cell imaging (Labomed, USA) was performed after each Alamar Blue assay. Each condition was repeated at least three times and readings were done in duplicate. Images was analyzed by using Image J software. Diameter of tumor organoids were measured in three image of each patients and in each group, data was represented as mean ± SD. 2.5. Fibroblast cell isolation, characterization and conditioned medium collection Human tissue samples from foreskin were obtained from three consenting healthy donor (n = 3), after receiving maternal consent. The samples were incubated in Dispase II (2.4 units/ml) (Gibco) for 16 h at 40˚C and then the epidermis was peeled off the dermis and discarded, and the dermis was washed and digested by using collagenase II (1%) (Gibco) at 37˚C for 40 min. The cells were then re-suspended in F12: DMEM (Gibco) medium supplemented with 10% fetal bovine serum (FBS; Gibco), 1% pen/strep antibiotic solution (Biosera). The medium was replaced every 2–3 days until the monolayer cells were 70–80% confluent, the cells were sub-cultured by using 0/025% trypsin/EDTA (Gibco), until passage 3 (P3) ( 23 ). The cells were characterized by flow-cytometry to detect the expression of specific fibroblast cell surface markers, CD73 and CD29 ( 24 ). The culture medium from 60–80% confluent fibroblasts (P3) (Fig. 2 C) was replaced with AdDMEM/F12+++ and incubated for 48 hr-72hr, the medium then collected and filtered using a 30-kDa Amicon Ultra-15 centrifugal filter (Sigma-Aldrich) to concentrate the proteins (FGF7 ≈ 19kDa, FGF2 ≈ 18kDa and FGF10 ≈ 19.3kDa) as described before ( 25 ). 2.6. Total RNA isolation and quantitative RT-PCR (RT-qPCR) Total RNA was isolated from tumor organoids using TRIzol (ThermoFisher) on 10–14 days after culturing in both conditions (standard culture and cultured with alginate), and residual genomic DNA was digested with DNase I (Life Technologies). The cDNA was synthesized using Superscript II reverse transcriptase (Life Technologies) by using random primers. RT-quantitative PCRs (RT-qPCRs) were performed on a CFX Connect real-time PCR detection system thermocycler (Bio-Rad) using GoTaq qPCR master mix (Promega) (3 min at 95°C, followed by 40 cycles of 95°C for 10 s and 60°C for 30 s). Melting-curve analysis was performed to assess specificity of RT-qPCR products. Primers used for real-time PCR are listed in Table 3 . Relative gene expression data were calculated using the ΔCT method ( 26 ). Cyclophilin was used as housekeeping gene for the analysis. Table 3 List of primers used for RT-PCR Gene Forward Reverse Uroplakin IIIA CGGAGGCATGATCGTCATC CAGCAAAACCCACAAGTAGAAAGA CD44 CCTCTCATTACCCACACACG CAGTAACTCCAAAGGACCCA CK5 CAAGGTTGATGCACTGATGG TCAGCGATGATGCTAAG CK20 CAGACACACGGTGAACTATGG GATCAGCTTCCACTGTTAGACG CK14 TTCTGAACGAGATGCGTGAC GCAGCTCAATCTCCAGGTTC GATA3A ACCACAACCACACTCTGGAGGA TCGGTTTCTGGTCTGGATGCCT LGR5 TGATGACCATTGCCTACA GTAAGGTTTATTAAAGAGAAG FOX1A TACACACCTTGGTAGTACGCC GCAATACTCGCCTTACGGCT Cyclophilin GGCAAATGCTGGACCCAACACA TGCTGGTCTTGCCATTCCTGGA 2.7. Immunofluorescence of tumor organoids Tumor organoids in all conditions were fixed by applying freshly prepared 4% paraformaldehyde (PFA) (Sigma Aldrich) in PBS buffer at room temperature for 30 minutes, followed by 3 times washing by washing solution (0.5% FBS in PBS). Then, the organoid was treated with 0.1 M glycine for 30 minutes at room temperature. In order to do permeabilization step, 300 µL of 0.5% triton in PBS was added to the falcon containing organoids and incubated for 30 min at room temperature. After 3 times washing by PBSTD washing solution (PBS + 0.3% triton + 1% DMSO + 0.5% FBS), goat serum (0.5%) diluted in PBS (1X) was used as blocking reagent to decrease the non-specific-binding, as most of the secondary antibodies are produced on goat. First antibodies listed in Table 3 incubated overnight at 4 ͦ c in an orbital shaker, the day after followed by at least 3 times washing by PBSTD washing solution, appropriate secondary antibodies (listed in Table.4) were incubated for 2 hours at room temperature in an orbital shaker. Followed by at least 3 times washing by using washing solution (0.5% FBS in PBS), mounting solution containing DAPI (Abcam) was applied on organoid and covered by cover slip. The samples were visualized by using Leica Stellaris 5 LIA confocal microscopy. Table 4 List of antibodies used for confocal imaging Primary Antibody Lot Number Secondary Antibody Lot Number Cytokeratin 20 (Mouse anti human) 41305934 Alexa Fluor 488 goat α-mouse 2066710 KI67 (Rat anti human) 151202 Alexa Fluor 555 goat α-rat 2089884 2.8. Scaffold and FCM characterization (SEM, FTIR and ELISA) To show the structure and morphology of calcium alginate with and without tumor organoid, we conducted SEM (Scanning Electron Microscopy) imaging by MIRA3 TESCAN ( 27 ). For sample containing tumor organoids, drops were collected in the falcon tube and fixed by using glutaraldehyde 4% (Sigma Aldrich), after washing with PBS, dehydration process was conducted by using the following concentrations of ethanol series (10 minutes for each level): 60%, 70%, 80%, 90%, 100%. Sample without organoids frozen at -80 ͦC and lyophilized by freeze-dryer (Pishtaz engineering, FD6, Iran) for 18 hr. FTIR was applied on the sample collected from fibroblast cultured in passage 3, the collected media stored at -80 ͦC and Fourier Transform Infrared Spectroscopy (FTIR) was conducted on the FCM and FCM prepared commercially (Cellprogen®, USA) as control. Before run the ELISA, we conducted spectrophotometry (WPA Biowave II, UK) on the different dilution (dilution made by adding AdDMEM +++ ) of commercial FCM (Cellprogen®, USA) to be adjust in terms of total protein concentration in compare with home-made FCM, UV absorbance was read for each diluted samples at 280 nm. 50% of commercial FCM and home-made FCM were used to measure missing GFs by ELISA (FGF10: Universal Biological RK09223; FGF7: MyBiosource MBS2020770 and FGF2: MyBioSource MBS2097899). The sample were centrifuged at 3000 rpm (Hettich, Germany), 40 µl of the supernatant and 50 µl of the standards were poured into separate wells in triplicate, then 50 µl of Streptavidin HRP and corresponded antibodies based on the company protocol were added to the sample’s well. The plates were incubated for 1 h at 37°C, then wells were washed four times with washing solution. Then 50 µl of chromogen A and chromogen B solutions were added respectively. Plate was shacked (Behdad, Iran) gently and incubate for 10 min in the dark room at 37 C°. The stop solution was added to all wells until the blue color turned to yellow. Absorbance was read at 450 nm by an ELISA reader (Biotek, USA). 2.9. Software and Statistics Data are displayed as median if applicable. Individual groups were tested using the 2way ANOVA analytical test for correlation between continuous data. Graphs were plotted using GraphPad Prism v.8.4.0. Statistical analyses were conducted using GraphPad Prism v.9.4.1. p values < 0.05 were considered statistically significant. Result 3.1. Patients Characteristics PDOs were generated from specimens obtained from patients that underwent either TURBT, BCG instillation or Neoadjuvant chemotherapy (Fig. 1 , Table 1) at Emam Khomeini Hospital in Iran and representing the spectrum of Bladder Urothelial Carcinoma (BLCa), ranging from low-grade, non-invasive BLCa to high-grade invasive tumors, including both NMIBC (Non-muscle invasive bladder cancer) and MIBC (Muscle invasive bladder cancer). The study protocol was approved by the Ethics Committee of Tehran University of Medical Sciences prior to screening of patients (IR.TUMS.TIPS.REC.1402.139). Table 1 And Fig. 1 shows the patients characteristic enrolled in this study. 3.2. Tumor organoid cultured in calcium alginate scaffold characterization To stablish the bladder cancer organoid, we mechanically and enzymatically disassociated the tissue as we described above (section 2– 3 ). Cells resulted from disassociation, plated in non-adherent plate into the BME and supplied with growth factor listed in Table.2 as control group, from each sample, half of the cell suspension was entrapped into alginate (Fig. 2 .B) and maintained with same supplements ( 28 ). Tumor organoids were observed in BME based scaffolds after 3 days but minimum in 7 days in alginate group. Tumor bladder organoids had three different spherical morphologies which were variable from patient to patient: basal (mostly solid spherical), luminal (hollow cyst) and grape like subtypes in both condition. Figure 2 .A shows the tumor bladder organoids cultured in BME (upper row) and in alginate (lower row) when they expand first in BME and then sub-cultured into alginate following the high confluency. While, Fig. 2 .C revealed the tumor organoids generated from tissue. Obviously, the number and growth rate of tumor organoids cultured in BME were higher than alginate group, but this difference decreased when the organoids generated in BME first and then expanded in alginate. The culture efficacy of tumor organoids cultured in alginate were considerably lower than the BME group and few passage (between 1 to 3) observed, although the tumor organoids were passaged minimum 10 times in BME groups (Fig. 3 .F). Most of the bladder cancer organoids in alginate were solid spherical and grape like shape, although the number of hollow cyst and solid spherical organoids were increased in BME culture (Fig. 2 . A and C). Further characterization was performed by evaluate viability in 3, 7 and 14 days after culture on the organoids generated from tissue in both condition as well as diameter of the organoids in 3, 7, 10 and 14 days after culture. Viability was assessed by Alamar blue over matrix (BME in BME group without tumor organoid and alginate in alginate group without tumor organoid), 2 way ANOVA analysis revealed significant difference between BME in compare with alginate group in day 3 (P value: 0.0387) and day 7 (P value: 0.0398), although the viability for both groups were more than 100% in 14 days after culture, viability in BME group was significantly more than SA group in general and in 14 days (P Value: 0.0012) (Fig. 2 . D). As shown in the Fig. 2 . A, graph E, size of tumor organoids were similar in day 3 in both group, but in day 7 and day 10, BME group was significantly higher than alginate group in general. In alginate group, size in day 7 (P value: 0.0020) and day 10 (P value: 0.0009) was significantly higher than day 3. In BME group, size in day 7 (P value ≤ 0.0001) and day 10 (P value ≤ 0.0001) was significantly increased in compare with day 3, so the culture medium and scaffold could support growth of organoids, especially in 10 days. On the other hand, it was important to show the physical features of scaffold, with and without organoids. In order to show the scaffold can physically support spherical organoid generation and it possess enough pores which is essential for cells assembly and medium exchange ( 29 ), morphological analysis was conducted after lyophilization process by using SEM, the result showed highly porous network and interconnected pores (Fig. 2 F) which allow cell growth, migration, flow and transport the nutrient and metabolic waste ( 30 ). The porosity analysis by Image-J software showed that the average of pore sizes for 3% (w/v) alginate scaffolds on three different SEM images (magnification 200 ϻm) were ˷25 ϻm. Bladder cancer is a highly heterogeneous disease, recent genome wide expression studies identify genes and multiple molecular subclasses that led to BLC classification ( 31 ). Basal like cancer express higher level of CD44 and cytokeratins (CK5, 6, and 14) ( 32 ), these biomarkers (CD44, CK5, 6 and 14) are also enriched in normal epithelial stem cells and cancer-associated stem cells derived from epithelial lineage tumors. The epithelial lining of the bladder is composed of three layers; apical layer (umbrella cells) that expresses UPK3A, intermediate layer (polygonal cells) that expresses CK7, and basal layer (cuboidal cells) that expresses CK5 ( 33 ), Ck20, FOXA1 and GATA3 are also express higher in luminal subtype ( 34 ). RNA analysis by RTPCR in this study emphasize our tumor organoid model by using BME can mirroring critical features of human tumor bladder tissue. Cultured organoids recreate a significant portion of the cellular diversity of bladder tissue including the varied functionalities of luminal and basal cells. Except GATA3, all the genes were higher expressed and highly significant (P value ≤ 0.0001), in BME group in compare with sodium alginate group (P Value: 0.2029). For CK5 gene, expression was significantly higher in BME (P value: 0.0209). 3.3. Tumor organoid characterization in FCM based medium characterization Patient derived bladder tumor organoid tested in BME and Alg based scaffold with two different medium composition (Table.2), the medium named standard medium, prepared based on the protocol obtained from Erasmus Medical Center, urology department and in FCM medium (fibroblast conditioned medium), the fibroblast growth factor 2, 7 and 10 replaced with optimum amount of FCM (Table.1). Bright field microscopy showed similar morphology in both group when embedded in BME for 14 days (Fig. 3 .A), both dense spherical and luminal morphology were observed in organoids cultured in different medium. To prepare medium with FCM composition, we need to isolate and culture dermal fibroblast, the cells isolated by enzymatic digestion, strongly adherent HDF (human dermal fibroblast) cells shows the typical spindle-shape appearance, after 3 passages, flow cytometry analysis conducted to confirm characterization of fibroblast cells by evaluation of surface marker CD29 and CD73. Follow-up analysis using FlowJo software showed expression 99.8 and 96.7%, respectively. Fibroblast cells in 70–80% confluency (Fig. 3 .C) were cultured and supernatant was collected after 3 days incubation, the supernatant then analyzed by using FTIR and Elisa in compare with commercial FCM (Cellprogen®, USA). Result of FTIR showed in Fig. 3 .D, which black means control (commercial FCM) with peak related to the carbon-iodine bond in the 565 cm − 1 . The peak appearing in the region of 1088 is related to C-O stretching bond. A strong peak appearing in the region of 1639 is related to the stretching vibrations of C = C acyclic alkenes. The peak related to the region 2079 is related to N = C = S stretching vibrations and the peak appearing in the region of 3459 is related to N-H amine of the second type. On the other hand, red graph showed the analysis for home-made FCM, the band (peak) related to the carbon-iodine bond appeared in the 560 region that is near by the peak reported in Ctrl group. The C-N stretching bond appeared in the 1119 region. The C-O peak of vinyl ether is related to the symmetric and asymmetric stretching vibrations of 1043 and 1187 respectively, and the existence of a strong peak appearing in the region of 1639 is related to C = C stretching vibrations, which confirms this structure. The peak corresponding to the region 1461 is related to C-H aliphatic groups. The peak corresponding to the region 2083 is related to N = C = S stretching vibrations and the peak appearing in the region of 3448 is related to N-H amine of the second type. Comparison of two peaks showed similarity in trend and most of peaks, although the home-made FCM (red line) has several additional peaks, which can be due to the sample purification and concentration. Moreover, ELISA characterization have been done to show precise amount of 3 main absence growth factors (FGF2, FGF7 and FGF10) in homemade FCM and in comparison with commercial FCM, beside this experiment was needed to optimized volume of homemade FCM to prepare bladder organoid medium. Experiment was repeated for three times in triplicate, 347.4 pg/ml for FGF7, 201.9 pg/ml for FGF2 and 219.8 pg/ml for FGF10 obtained for homemade FCM and the difference was highly significant (P value ≤ 0.0001) for FGF7 (Fig. 3 . E). The standard curve was calculated for each growth factor and the R² = 0.9874, R² = 0.9901 and R² = 0.9936 for FGF7, FGF2 and FGF10, respectively (data not shown). In order to confirm the medium prepared by using homemade FCM (Table.2) capable to support tumor organoid culture, image J analysis have been done for the pictures obtained from bright field microscopy, graph in Fig. 3 . F represented the size of tumor organoid in compare with standard medium in day 3, 7, 10 and 14 which did not show significant difference. Moreover, tumor organoid cultured in FCM based medium embedded in BME and SA were evaluated for different tumor bladder markers by RTPCR. This experiment shows the potential of using Alg scaffold and homemade FCM together as a solution to prepare bladder tumor organoids for preclinical testing and early-stage drug screening. The result indicate very similar expression in presence of BME and cultured by using homemade FCM in compare with standard medium, with no significant difference in expression, on the other hand, tumor organoid cultured in Alg and maintained by homemade FCM showed slight variation but not significant, only CK14 as a marker of cancer-associated stem cells from basal like cells in standard medium was significantly higher than homemade FCM based medium (P value: 0.0307) which is may due precise downstream activation of commercial growth factor required for stem cell lineage. Culture efficiency was showed based on the number of passage for each condition, the result shows (Fig. 3 .F) more than 10 times sub-culturing for BME group and then for group cultured in BME and maintained with FCM based medium. Applying alginate to culture the organoid significantly decrease potential of long term culture, number of passaging and bio-banking possibility (Fig. 3 .G). Organoid generated in BME and sub-cultured in Alg indicate better passaging potential than organoids generated in Alg from tissue sample. To confirm the model is functional and accurate in term of architecture, size, and molecular expression markers of human tumor bladder tissue, we used confocal microscopy for tumor organoids cultured in sodium alginate in day 14 and organoids generated by using alginate and FCM based medium. Tumor organoids stained with DAPI, a dye that binds to healthy double-stranded DNA and is visible in blue in the UV range, images indicate truthful assembly of the cells in 3D matrix which is Alg (Fig. 4 . A), staining against KI67 (red fluorescence) as marker for proliferating cells and CK20 (green fluorescence) which is marker for basal layer of luminal subtype also showed clearly right position and positive expression in compare with tumor organoids cultured in BME. Same markers have been used for the tumor organoids cultured in sodium alginate and maintained by FCM based medium, tumor organoid cultured in BME by using FCM based medium in compare with standard culture condition, BME as scaffold and standard medium which resulted in accurate tumor organoid formation, CK20 and KI67 expression in compare with control group cultured in BME and maintained by standard medium (indicate as Ctrl in figure) (Fig. 4 . B). Discussion Recent advances in organoids have improved culture systems that support the differentiation and assembly of different cell types along with adult/cancer stem cells resemble the functionality of living organs for modeling complex diseases, especially cancer. The selection of a functional and physiological extracellular matrix (ECM) and culture medium containing a defined cocktail of niche factors are necessary for generating accurate in vitro experimental systems, as the biochemical and mechanical properties of the ECM and composition of culture medium strongly influence cell fate, structure, function ( 35 ), migration, adhesion and differentiation ( 36 ). Organoid cultures are traditionally maintained in BMMs, a gel-forming basement membrane material composed of laminin, collagen type IV, entactin, and heparan sulfate ( 8 ). While BMMs allow strong organoid growth, the drawbacks of organoids cultured in the BMM matrix are their unsuitableness for clinical use due to the murine tumor origin, the costly manufacturing, significant batch-to-batch variabilition, and temperature-sensitive gelation condition ( 8 , 37 ). Furthermore, large-scale organoid production has been limited due to the high cost of growth factors required for culture and maintenance ( 38 ), which makes it unaccusable for low-resource countries and also for personalized medicine on a large scale (high throughput screening). Various growth factors are pivotal in orchestrating the processes of cellular proliferation, viability, differentiation, and motility. Nevertheless, employing a singular, standardized medium proves inadequate for culturing the diverse array of organoid types originating from different tissues. Consequently, multiple investigations as a guide framework to discern the optimal media components tailored to specific organs ( 39 , 40 ). Due to the mentioned limitations in organoid culture, there is growing interest in the test of alternative natural and synthetic biomaterials for utilization in these promising systems to build more accessible and handle able as long as physiologically relevant 3D structures (41). Hydrogels are deemed highly suitable for 3D cell culture applications owing to their similarity to the extracellular matrix. Although a variety of synthetic and natural hydrogel polymers are being explored for different types of organoids such as intestine, liver, pancreas, kidney, and lung; they have not been tested for bladder organoid establishment ( 5 ). Synthetic materials such as polyethylene glycol (PEG), poly (hydroxyethyl methacrylate) (polyHEMA), polyvinyl alcohol (PVA), and polycaprolactone (PCL) exhibit the ability to form hydrogels ( 42 , 43 ). Likewise, natural polymers including alginate, chitosan, hyaluronan, dextran, collagen, and fibrin, possess hydrogel-forming capabilities while alginate, hyaluronan derived from bacterial fermentation, and dextran are non-animal derived materials ( 44 , 45 ). Natural hydrogels sourced from non-animal origins have garnered significant interest due to their biocompatibility and controllable gelation conditions. However, challenges persist in controlling gelation kinetics, material composition variations, and regulating mechanical properties ( 46 ). Alginate, sourced from brown algae, represents a natural polymer that can be utilized for organoid culture; in recent years, some types of organoids such as lung, mammary tumors, salivary glands, spinal cord, and intestine have been developed by using alginate. However, alginate has not been reported as a 3D support hydrogel for bladder tumor organoid culture ( 19 , 20 , 47 , 48 ). Alginate gelation process can be modulated through crosslinking by calcium chloride, calcium carbonate, barium chloride, and zinc chloride facilitating implementation with commercially available reagents for additional modifications. Nevertheless, unmodified alginate suffer from lack of cell adhesion surface protein and its hydrophilic feature hamper protein adsorption, relegate its primarily supportive role in 3D organoid culture ( 16 ). In this work, first we used sodium alginate (3%) as a BMM alternative to establish patient derived tumor bladder organoids and then we tried to modify the medium composition to make cost effective alternative in bladder organoid culture. Successful generation of tumor bladder organoids was supported by characteristic structures, the expression of tissue-specific markers at the gene level, and immunostaining to assess the expression and functionality at the protein level in comparison with standard protocol to culture organoids. Both matrices, sodium alginate, and BME, supported stem cell marker expression and further early differentiation to develop and mimic bladder tissue structure, while the morphological subtypes, size, and viability were almost similar with the same trend, the expression level of bladder tissue markers was strongly more significant in BME-retained organoids, except GATA3A which might be shows alginate could potentially lead organoid cultures toward a basal phenotype ( 49 ). This data indicates the role of the matrix microenvironment in cellular behavior by cell-matrix interactions ( 36 ), although both matrices showed acceptable level of viability and growth rate during 14 days. However, since long-term culture and the ability to subculture after freeze are prerequisites for establishing organoid biobanks, it is plausible that alginate may not be the optimal choice for establishment of bladder tumor organoid biobanks. These results are in line with the major studies in this field, indicating that the alginate scaffold can be used for early-stage organoid culture models and requires modifications for long-term maintenance and maybe biobanking. In this regard, some studies have shown that the alginate needs to be functionalized with the arginyl glycyl aspartic acid (RGD) peptide as a ligand for integrin, allowing control cellular responses to a biomaterial, such as attachment ( 50 ). Broguiere et al. found that natural non-adhesive alginate cannot be used for small intestinal organoids from single pluripotent cells. They found that RGD-enriched alginate provided long-term expansion support of organoids equivalent to BME-grown organoids ( 51 ). RGD or laminin-111 sites provide adhesion domains on the alginate scaffold which offer better physical support for stem cell proliferation and subsequent organoid culture and expansion. One of the main reasons of more successful organoid culture in MMPs is presence of RGD sites in the components of BBMs such as laminin ( 50 , 51 ). In contrast, a series of studies have been reported non-adhesive property of alginate as advantage to develop organoid model ( 16 , 19 ) for example, Capeling et al. have demonstrated that alginate supports human intestinal organoid (HIO) growth in vitro and leads to HIO epithelial differentiation that is virtually indistinguishable from Matrigel-grown HIOs. Since HIOs possess an inner epithelium and outer mesenchyme, they hypothesized that adhesive cues provided by the matrix may be dispensable for HIO culture. This study demonstrate mechanical support from a simple-to-use and inexpensive hydrogel is sufficient to promote HIO survival and development ( 16 ) and show the successful rate might be dependent on the origin tissue. Changes in study design while working with alginate may led to success organoid model generation, for example M. Capeling et al., used non-adhesive alginate as outer layer of scaffold encapsulated with core of Matrigel embedded cells to culture intestinal organoids, or using microfluidic system to generate droplet of non-adhesive alginate for high-throughput screening and to culture mammary tumor organoids ( 19 , 52 ). In this study, first we culture tumor organoid through Alginate and with standard medium containing commercial recombinant growth factors such as EGF, Noggin, Wnt3a, and R-spondin, FGF10, FGF7 and FGF2 ( 53 ). Although this approach is effective, the use of purified growth factors were expensive and confine studies for scalability and reproducibility because of the huge amount of requirement to prepare fresh media with multiple components. Researcher tried alternative approach to maintain heterogeneity of tumor organoids by using direct and indirect co-culture system and to simplify medium composition and expenses ( 42 , 54 ). For instance, the Stappenbeck laboratory generated a cell line, known as the L-WRN cell line, which produces a conditioned medium containing Wnt3a, R-spondin 3, and Noggin ( 55 ). Similarly, in another study by Chang et al., a combined conditioned medium reflecting the composition of the fallopian tube, including epithelial, stromal, and endothelial cells, was proposed as alternative of commercial growth factor. They observed that combined medium effectively supported the organoid culture and enhanced the expression of stemness-related genes. However, organoid proliferation compared to the conventional medium had the same trend ( 14 ). Different techniques to co-culture cells in 3D are available, allowing for various levels of interaction between cell types. In contrary of direct co-culture, indirect co-culture involve using physical barrier between cell types, like a semi-permeable membrane, and/or using conditioned medium where communication occurs through the secretion of signaling molecules (secretome) that can impact cell behavior positively or negatively ( 56 ). So, here we tried using homemade FCM instead of three growth factors (FGF2, FGF7, and FGF10) reported in the culture of bladder organoids ( 22 , 57 ), which means reduction culture condition cost more than 2600 $ , except replacing BME with alginate. Supplemented bladder organoid culture medium with FCM has been tested for bladder tumor organoid generation and model characterization. In terms of the quality of FCM collected from fibroblast cells to enrich the culture medium, FTIR and ELISA tests have been conducted in comparison with commercial FCM. We determined that the chemical compositions of the two FCM samples were alike by using the correlation between infrared absorption band intensity and substance concentration. As a result, we proceeded to analyze FGF2, FGF7, and FGF10 using ELISA, confirming and quantifying their presence in our homemade FCM. Given that conditioned medium concentration can impact cellular behavior, it seems crucial to monitor batch-to-batch activity levels. Additionally, conditioned medium activity may be influenced by factors such as maintaining condition, hypoxia, karyotyping change from passage to passage, storage condition and duration, variations in conditioned medium collection periods, and minor technical discrepancies in conditioned medium production processes in different labs. RT-PCR results showed the expression of different basal and luminal markers in generated organoids which indicated enough heterogeneity in the model. FCM-based medium showed enough support of expression stemness markers such as LGR5, CD44, CK5 and 14 in both conditions, comparison of genes profiling by RTPCR of organoid embedded in Alg and BME showed almost similarity in the BME group, although in Alg, standard medium showed a considerable increase in different genes expression and significant difference in CK14 which showed BME can support stemness more than Alg. Stem cells rely on interactions with the ECM components to preserve their stemness, and BME offers a more authentic environment to facilities these interactions ( 58 ). Stem cells respond to mechanical signals, and a soft matrix can boost their stemness by replicating physiological conditions ( 59 ). Regarding protein expression of bladder marker, the luminal marker CK20 is expressed in the suprabasal/umbrella cells and dysregulation play role in most non-invasive tumors, CK20 pattern of staining is regarded as a marker of cell differentiation and maturation ( 60 , 61 ). UPK3A is also expressed in the luminal membrane of umbrella cells, forming an asymmetric unit membrane (AUM) involved in bladder flexibility and barrier function ( 57 ). Furthermore, they presented KI67 in the nucleus and CK20 and UPK3A in the outer rim of organoids, suggesting an organized structure. Ki67 are often used as markers of proliferative capacity to determine the malignancy of bladder cancer, associated with recurrence and progression of bladder cancer, and predict its prognosis ( 62 ). In summary, our study provides a proof-of-concept bladder tumor organoid culture in available and more cost effective hydrogel with controllable physical properties for optimization. In this study, we provide experimental evidence on how our approach with alginate hydrogels can resolve the major issues of using Matrigel including ( 1 ) batch-to-batch variation, ( 2 ) safety, and ( 3 ) high-cost issues ( 63 ). On the other hand, FCM based medium can reduce cost issue of application organoid technology for high throughput screening, especially for low-income countries to possess the edge of knowledge technology in the field of personalized medicine. We also confirmed the potential of using sodium alginate along with FCM based medium to generate tumor organoid model of bladder tissue. Nevertheless, alginate hydrogel have potential limitation in long term culture, and the culture efficiency reduce through multiple splitting, this need to be carefully investigate and addressed in case of generating biobank. Bladder tumor organoids exhibited less budding, compared to those cultured in Matrigel, which may indicate a rather less state of stemness which is also confirmed by decrease in gene expression and protein expression (especially for KI67).We have shown the potential of indirect co-culture system by using human dermal fibroblast conditioned medium to enrich bladder organoid medium, as another solution to reduce the cost, this confirmed by comparing gene expression and protein expression profile of cultured organoids in BME and maintained by standard medium and homemade FCM medium. Despite our data on the viability of human bladder organoids cultured in Alg and Alg-FCM, more functional studies like drug screening would be inevitable in the future. Conclusion Overall, we present in this report a 3D organoid system that supports tumor bladder organoids culture and grow with the potential for applications in disease modeling, early stage drug screening, clinical translation and regenerative medicine. Hydrogels with tunable properties as long as indirect co-culture system is a solution to limit multiple boundaries in the culture of organoids with Matrigel and BBMs. Our study represents the first characterized culture of bladder organoids in Sodium alginate scaffold and medium enriched with FCM in 14 days. This preclinical model can be used as promising tool for translational application in cancer research. Abbreviations ECM, Extracellular matrix BMMs, Basement membrane matrices FCM, Fibroblast conditioned medium 3D, Three-dimensional FGFs, Fibroblast growth factors MMPs, Matrix metalloproteinases TGF-β, Transforming growth factor beta EGF, Epidermal growth factor PBS, Phosphate-buffered saline PFA, Paraformaldehyde Alg, Alginate NAC, N-acetylcysteine NIC, Nicotinamide BME, Basement membrane extract FBS, Fetal bovine serum SEM, Scanning electron microscopy FTIR, Fourier transform infrared spectroscopy BLCa, Bladder urothelial carcinoma NMIBC, Non-muscle invasive bladder cancer MIBC, Muscle invasive bladder cancer SA, sodium alginate PEG, Polyethylene glycol PVA, Polyvinyl alcohol PolyHEMA, Poly (hydroxyethyl methacrylate) PCL, Polycaprolactone RGD, Arginyl glycyl aspartic acid HIO, Human intestinal organoid AUM, Asymmetric unit membrane Declarations Acknowledgement and Funding sources: This research was a collaboration between Erasmus Medical Center and the Tehran University of Medical Sciences (TUMS). The work was financially supported by Erasmus Medical Center, Erasmus plus grant and Tehran University of Medical Sciences (TUMS). Regulatory monitoring was conducted by the independent group of Tehran University of Medical Sciences. All investigators completed a human protocol approved by TUMS. The authors would like to thank Dr. Mohammad Amir Amirkhani from TUMS, Hassan Karimi as consultor in biomaterial section, Erasmus MC Urothelial Cancer Research Group, Miranda Van Dijk, Valeria Lozovanu, Mitchel Olislagers, and Dr. Gert Van Cappellen at imaging center of EMC. Data Availability Statement: The data used to support the findings of this study are included within the manuscript. Additional microscopy data reported in this paper will be shared by the lead contact upon request. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request. Further information and requests for resources and reagents should be directed to the lead contact, Dr. Mahsa Mollapour Sisakht ( [email protected] ). Conflict of interest: The authors declare no conflict of interest, financial or otherwise. CRediT authorship contribution statement: Mahsa Mollapour Sisakht: Writing – original draft, Project administration, Methodology, Investigation, Data curation, Formal analysis, Conceptualization. Fatemeh Gholizadeh: Writing – original draft, Methodology, Investigation. Shirin Hekmatirad : Writing – original draft, Methodology, Investigation. Tokameh Mahmoudi: Conceptualization, Writing – review & editing. Saeed Montazeri: Methodology, Investigation. Laleh Sharifi: Methodology, Investigation. Hamed Daemi: Methodology, Investigation, Conceptualization. Shahla Romal: Methodology, Investigation. Mohammad Hosein Yazdi: Writing – review & editing, Validation . Ahmad Reza Shahverdi: Writing – review & editing, Validation, Data curation. Mohammad Ali Faramarzi: Writing – review & editing, Validation and Data curation. Amir Ali Hamidieh: Writing – review & editing, Visualization, Validation, Methodology, and Conceptualization. References Kim J, Koo B-K, Knoblich JA. Human organoids: model systems for human biology and medicine. Nature Reviews Molecular Cell Biology. 2020;21(10):571-84. Rossi G, Manfrin A, Lutolf MP. Progress and potential in organoid research. Nature Reviews Genetics. 2018;19(11):671-87. Ye S, Boeter JW, Mihajlovic M, van Steenbeek FG, van Wolferen ME, Oosterhoff LA, et al. A chemically defined hydrogel for human liver organoid culture. Advanced functional materials. 2020;30(48):2000893. Prince E, Cruickshank J, Ba-Alawi W, Hodgson K, Haight J, Tobin C, et al. Biomimetic hydrogel supports initiation and growth of patient-derived breast tumor organoids. Nature communications. 2022;13(1):1466. Kratochvil MJ, Seymour AJ, Li TL, Paşca SP, Kuo CJ, Heilshorn SC. Engineered materials for organoid systems. Nature Reviews Materials. 2019;4(9):606-22. Hughes CS, Postovit LM, Lajoie GA. Matrigel: a complex protein mixture required for optimal growth of cell culture. Proteomics. 2010;10(9):1886-90. Curvello R, Alves D, Abud HE, Garnier G. A thermo-responsive collagen-nanocellulose hydrogel for the growth of intestinal organoids. Materials Science and Engineering: C. 2021;124:112051. Aisenbrey EA, Murphy WL. Synthetic alternatives to Matrigel. Nature Reviews Materials. 2020;5(7):539-51. Magno V, Meinhardt A, Werner C. Polymer hydrogels to guide organotypic and organoid cultures. Advanced Functional Materials. 2020;30(48):2000097. Schneeberger K, Spee B, Costa P, Sachs N, Clevers H, Malda J. Converging biofabrication and organoid technologies: the next frontier in hepatic and intestinal tissue engineering? Biofabrication. 2017;9(1):013001. Peterson NC. From bench to cageside: risk assessment for rodent pathogen contamination of cells and biologics. ILAR journal. 2008;49(3):310-5. Lee S-Y, Hwang HJ, Lee DW. Optimization of 3D-aggregated spheroid model (3D-ASM) for selecting high efficacy drugs. Scientific Reports. 2022;12(1):18937. Rodríguez-Fraticelli AE, Martín-Belmonte F. Methods for analysis of apical lumen trafficking using micropatterned 3D systems. Methods in cell biology. 118: Elsevier; 2013. p. 105-23. Chang Y-H, Wu K-C, Harnod T, Ding D-C. Comparison of the Cost and Effect of Combined Conditioned Medium and Conventional Medium for Fallopian Tube Organoid Cultures. Cell Transplantation. 2023;32:09636897231160216. Lee KY, Mooney DJ. Alginate: properties and biomedical applications. Progress in polymer science. 2012;37(1):106-26. Capeling MM, Czerwinski M, Huang S, Tsai Y-H, Wu A, Nagy MS, et al. Nonadhesive alginate hydrogels support growth of pluripotent stem cell-derived intestinal organoids. Stem cell reports. 2019;12(2):381-94. Cavo M, Fato M, Peñuela L, Beltrame F, Raiteri R, Scaglione S. Microenvironment complexity and matrix stiffness regulate breast cancer cell activity in a 3D in vitro model. Scientific reports. 2016;6(1):35367. Cavo M, Caria M, Pulsoni I, Beltrame F, Fato M, Scaglione S. A new cell-laden 3D Alginate-Matrigel hydrogel resembles human breast cancer cell malignant morphology, spread and invasion capability observed “in vivo”. Scientific reports. 2018;8(1):5333. Fang G, Lu H, Rodriguez de la Fuente L, Law AM, Lin G, Jin D, Gallego‐Ortega D. Mammary tumor organoid culture in non‐adhesive alginate for luminal mechanics and high‐throughput drug screening. Advanced Science. 2021;8(21):2102418. Dye BR, Decker JT, Hein RF, Miller AJ, Huang S, Spence JR, Shea LD. Human lung organoid culture in alginate with and without matrigel to model development and disease. Tissue Engineering Part A. 2022;28(21-22):893-906. Ferreira TC. Bladder Organoids: Theory and Practice of a 3D Culture Model: Universidade do Porto (Portugal); 2020. Whyard T, Liu J, Darras FS, Waltzer WC, Romanov V. Organoid model of urothelial cancer: establishment and applications for bladder cancer research. Biotechniques. 2020;69(3):193-9. Nilforoushzadeh MA, Sisakht MM, Amirkhani MA, Seifalian AM, Banafshe HR, Verdi J, Nouradini M. Engineered skin graft with stromal vascular fraction cells encapsulated in fibrin-collagen hydrogel: A clinical study for diabetic wound healing. J Tissue Eng Regen Med. 2020;14(3):424-40. Sober SA, Darmani H, Alhattab D, Awidi A. Flow cytometric characterization of cell surface markers to differentiate between fibroblasts and mesenchymal stem cells of different origin. Arch Med Sci. 2023;19(5):1487-96. Maarof M, Chowdhury SR, Saim A, Bt Hj Idrus R, Lokanathan Y. Concentration dependent effect of human dermal fibroblast conditioned medium (DFCM) from three various origins on keratinocytes wound healing. International journal of molecular sciences. 2020;21(8):2929. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402-8. Barceló X, Eichholz KF, Garcia O, Kelly DJ. Tuning the degradation rate of alginate-based bioinks for bioprinting functional cartilage tissue. Biomedicines. 2022;10(7):1621. Walz S, Pollehne P, Geng R, Schneider J, Maas M, Aicher WK, et al. A Protocol for Organoids from the Urine of Bladder Cancer Patients. Cells. 2023;12(17). Hoang P, Ma Z. Biomaterial-guided stem cell organoid engineering for modeling development and diseases. Acta Biomater. 2021;132:23-36. Su J, Xu H, Sun J, Gong X, Zhao H. Dual delivery of BMP-2 and bFGF from a new nano-composite scaffold, loaded with vascular stents for large-size mandibular defect regeneration. Int J Mol Sci. 2013;14(6):12714-28. Knowles MA, Hurst CD. Molecular biology of bladder cancer: new insights into pathogenesis and clinical diversity. Nat Rev Cancer. 2015;15(1):25-41. McConkey DJ, Choi W, Ochoa A, Dinney CP. Intrinsic subtypes and bladder cancer metastasis. Asian journal of urology. 2016;3(4):260-7. Elbadawy M, Fujisaka K, Yamamoto H, Tsunedomi R, Nagano H, Ayame H, et al. Establishment of an experimental model of normal dog bladder organoid using a three-dimensional culture method. Biomedicine & Pharmacotherapy. 2022;151:113105. Knowles MA, Hurst CD. Molecular biology of bladder cancer: new insights into pathogenesis and clinical diversity. Nature reviews cancer. 2015;15(1):25-41. Corrò C, Novellasdemunt L, Li VS. A brief history of organoids. American Journal of Physiology-Cell Physiology. 2020;319(1):C151-C65. Liu H, Wang Y, Cui K, Guo Y, Zhang X, Qin J. Advances in Hydrogels in Organoids and Organs‐on‐a‐Chip. Advanced Materials. 2019;31(50):1902042. Kaur S, Kaur I, Rawal P, Tripathi DM, Vasudevan A. Non-matrigel scaffolds for organoid cultures. Cancer Letters. 2021;504:58-66. D’Costa K, Kosic M, Lam A, Moradipour A, Zhao Y, Radisic M. Biomaterials and culture systems for development of organoid and organ-on-a-chip models. Annals of biomedical engineering. 2020;48:2002-27. Rauth S, Karmakar S, Batra SK, Ponnusamy MP. Recent advances in organoid development and applications in disease modeling. Biochimica et Biophysica Acta (BBA)-Reviews on Cancer. 2021;1875(2):188527. Tortorella I, Argentati C, Emiliani C, Martino S, Morena F. The role of physical cues in the development of stem cell-derived organoids. European Biophysics Journal. 2022:1-13. Cherne MD, Sidar B, Sebrell TA, Sanchez HS, Heaton K, Kassama FJ, et al. A synthetic hydrogel, VitroGel® ORGANOID-3, improves immune cell-epithelial interactions in a tissue chip co-culture model of human gastric organoids and dendritic cells. Frontiers in Pharmacology. 2021;12:707891. Ootani A, Li X, Sangiorgi E, Ho QT, Ueno H, Toda S, et al. Sustained in vitro intestinal epithelial culture within a Wnt-dependent stem cell niche. Nature medicine. 2009;15(6):701-6. Okita Y, Zheng L, Kawanishi K, Miyoshi H, Yanagihara K, Kato M. Polyvinyl alcohol scaffolds and supplementation support 3D and sphere culturing of human cancer cell lines by reducing apoptosis and promoting cellular proliferation. Genes Cells. 2021;26(5):336-43. Davoudi Z, Peroutka-Bigus N, Bellaire B, Jergens A, Wannemuehler M, Wang Q. Gut organoid as a new platform to study alginate and chitosan mediated PLGA nanoparticles for drug delivery. Marine drugs. 2021;19(5):282. Hunt DR, Klett KC, Mascharak S, Wang H, Gong D, Lou J, et al. Engineered Matrices Enable the Culture of Human Patient-Derived Intestinal Organoids. Adv Sci (Weinh). 2021;8(10):2004705. Andersen T, Auk-Emblem P, Dornish M. 3D cell culture in alginate hydrogels. Microarrays. 2015;4(2):133-61. Chooi WH, Ng CY, Ow V, Harley J, Ng W, Hor JH, et al. Defined Alginate hydrogels support spinal cord organoid derivation, maturation, and modeling of spinal cord diseases. Advanced Healthcare Materials. 2023;12(9):2202342. Larsen M, Moskwa N, Jorgensen M, Ramesh P, Toro M, Evans E, et al. Alginate Hydrogel Microtubes for Salivary Gland Cell Organization and Cavitation. 2022. Minoli M, Cantore T, Hanhart D, Kiener M, Fedrizzi T, La Manna F, et al. Bladder cancer organoids as a functional system to model different disease stages and therapy response. Nature Communications. 2023;14(1):2214. Sandvig I, Karstensen K, Rokstad AM, Aachmann FL, Formo K, Sandvig A, et al. RGD‐peptide modified alginate by a chemoenzymatic strategy for tissue engineering applications. Journal of biomedical materials research Part A. 2015;103(3):896-906. Broguiere N, Isenmann L, Hirt C, Ringel T, Placzek S, Cavalli E, et al. Growth of epithelial organoids in a defined hydrogel. Advanced Materials. 2018;30(43):1801621. Capeling MM, Czerwinski M, Huang S, Tsai YH, Wu A, Nagy MS, et al. Nonadhesive Alginate Hydrogels Support Growth of Pluripotent Stem Cell-Derived Intestinal Organoids. Stem Cell Reports. 2019;12(2):381-94. Sato T, Vries RG, Snippert HJ, Van De Wetering M, Barker N, Stange DE, et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 2009;459(7244):262-5. VanDussen KL, Marinshaw JM, Shaikh N, Miyoshi H, Moon C, Tarr PI, et al. Development of an enhanced human gastrointestinal epithelial culture system to facilitate patient-based assays. Gut. 2015;64(6):911-20. VanDussen KL, Sonnek NM, Stappenbeck TS. L-WRN conditioned medium for gastrointestinal epithelial stem cell culture shows replicable batch-to-batch activity levels across multiple research teams. Stem Cell Research. 2019;37:101430. Liu R, Meng X, Yu X, Wang G, Dong Z, Zhou Z, et al. From 2D to 3D co-culture systems: a review of co-culture models to study the neural cells interaction. International journal of molecular sciences. 2022;23(21):13116. Mullenders J, de Jongh E, Brousali A, Roosen M, Blom JP, Begthel H, et al. Mouse and human urothelial cancer organoids: A tool for bladder cancer research. Proceedings of the National Academy of Sciences. 2019;116(10):4567-74. Jiang N, Tian X, Wang Q, Hao J, Jiang J, Wang H. Regulation Mechanisms and Maintenance Strategies of Stemness in Mesenchymal Stem Cells. Stem Cell Reviews and Reports. 2024;20(2):455-83. Pangjantuk A, Kaokaen P, Kunhorm P, Chaicharoenaudomrung N, Noisa P. 3D culture of alginate-hyaluronic acid hydrogel supports the stemness of human mesenchymal stem cells. Scientific Reports. 2024;14(1):4436. Said N. Establishing and characterization of human and murine bladder cancer organoids. Translational Andrology and Urology. 2019;8(Suppl 3):S310. Sanguedolce F, Russo D, Calò B, Cindolo L, Carrieri G, Cormio L. Diagnostic and prognostic roles of CK20 in the pathology of urothelial lesions. A systematic review. Pathology-Research and Practice. 2019;215(6):152413. Tian Y, Ma Z, Chen Z, Li M, Wu Z, Hong M, et al. Clinicopathological and prognostic value of Ki-67 expression in bladder cancer: a systematic review and meta-analysis. PloS one. 2016;11(7):e0158891. Kim S, Min S, Choi YS, Jo S-H, Jung JH, Han K, et al. Tissue extracellular matrix hydrogels as alternatives to Matrigel for culturing gastrointestinal organoids. Nature communications. 2022;13(1):1692. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 04 Feb, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 28 Oct, 2024 Reviews received at journal 27 Oct, 2024 Reviews received at journal 23 Oct, 2024 Reviewers agreed at journal 21 Oct, 2024 Reviewers agreed at journal 16 Oct, 2024 Reviewers invited by journal 14 Oct, 2024 Editor assigned by journal 14 Oct, 2024 Editor invited by journal 22 Aug, 2024 Submission checks completed at journal 21 Aug, 2024 First submitted to journal 12 Aug, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4899481","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":354783949,"identity":"0f2fd4e7-4143-418b-ade3-0dcd820eee7a","order_by":0,"name":"Mahsa Mollapour Sisakht","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABE0lEQVRIiWNgGAWjYHACxgMPwDTzgQ9AMoENSaYBl54DCWCKLXEGRAsz0Vp4DMFaGBBasAPdaYcPHEiouSNncPvMx4afe+zy+Bj4j0nd+MMgz9/A3PYBixaz22kJBxKOPTM2OJe7sbHnWXIx0GFs0rltDIYzDjA2z8CqJcfgQALb4cQNZ3i3P+A5wJzYBtbSwMC4gYGxGZvDIFr+gbTwPGz8c6AeoiXnD4M9Xi2JbWAtjM08Bw5DtbAxJOLWAvRLYt8zY8kzbIbNMgeOF7MxMxtb57ZJJM84jEtL8sEHH77dkeM7w/yw8c2B6jz59saHt3P+2Nj2t7c/xhXQQHAAiQ2JFglC8XMAr+woGAWjYBSMcAAAZFFqj8vB0xcAAAAASUVORK5CYII=","orcid":"","institution":"Biotechnology Research Center, Faculty of Pharmacy, Tehran University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Mahsa","middleName":"Mollapour","lastName":"Sisakht","suffix":""},{"id":354783953,"identity":"8e85c13b-7d33-4dc0-9e4e-28810774c340","order_by":1,"name":"Fatemeh Gholizadeh","email":"","orcid":"","institution":"Stem Cell and Regenerative Medicine innovation center, Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Fatemeh","middleName":"","lastName":"Gholizadeh","suffix":""},{"id":354783956,"identity":"54394274-8aac-46ad-a0b2-0c17b538a144","order_by":2,"name":"Shirin Hekmatirad","email":"","orcid":"","institution":"Stem Cell and Regenerative Medicine innovation center, Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Shirin","middleName":"","lastName":"Hekmatirad","suffix":""},{"id":354783957,"identity":"477eb5c8-9d34-428a-9080-b7e77f06f804","order_by":3,"name":"Tokameh Mahmoudi","email":"","orcid":"","institution":"Biotechnology Research Center, Faculty of Pharmacy, Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Tokameh","middleName":"","lastName":"Mahmoudi","suffix":""},{"id":354783961,"identity":"f2752f01-3ccf-45a1-b661-e0a0267f71eb","order_by":4,"name":"Saeed Montazeri","email":"","orcid":"","institution":"Uro-oncology Research Center, Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Saeed","middleName":"","lastName":"Montazeri","suffix":""},{"id":354783962,"identity":"d78b6120-a26f-4e88-a13f-43bfbbe57453","order_by":5,"name":"Laleh Sharifi","email":"","orcid":"","institution":"Uro-oncology Research Center, Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Laleh","middleName":"","lastName":"Sharifi","suffix":""},{"id":354783963,"identity":"098331cd-0dc1-45eb-a5f5-683f291595c7","order_by":6,"name":"Hamed Daemi","email":"","orcid":"","institution":"Department of Cell Engineering, Cell Science Research Center, Royan Institute for Stem Cell Biology and Technology, ACECR","correspondingAuthor":false,"prefix":"","firstName":"Hamed","middleName":"","lastName":"Daemi","suffix":""},{"id":354783964,"identity":"51eca832-1232-42fb-bfcf-218d2203b643","order_by":7,"name":"Shahla Romal","email":"","orcid":"","institution":"Department of Biochemistry, Erasmus University Medical Center Rotterdam","correspondingAuthor":false,"prefix":"","firstName":"Shahla","middleName":"","lastName":"Romal","suffix":""},{"id":354783965,"identity":"bf6f7ead-b2f8-4301-b4fa-744e5c1bf677","order_by":8,"name":"Mohammad Hosein Yazdi","email":"","orcid":"","institution":"Biotechnology Research Center, Faculty of Pharmacy, Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"Hosein","lastName":"Yazdi","suffix":""},{"id":354783966,"identity":"a1bbab29-9bdd-4eea-a2a9-a4c624dd2677","order_by":9,"name":"Mohammad Ali Faramarzi","email":"","orcid":"","institution":"Biotechnology Research Center, Faculty of Pharmacy, Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"Ali","lastName":"Faramarzi","suffix":""},{"id":354783967,"identity":"9901d04a-0d55-4c76-90ef-f15f2e82d2c7","order_by":10,"name":"Ahmad Reza Shahverdi","email":"","orcid":"","institution":"Recombinant Vaccine Research Center, Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Ahmad","middleName":"Reza","lastName":"Shahverdi","suffix":""},{"id":354783968,"identity":"a178e14b-3e7c-44c0-868c-f351cbc32f8d","order_by":11,"name":"Amir Ali Hamidieh","email":"","orcid":"","institution":"Pediatric Cell and Gene Therapy Research Center, Gene, Cell \u0026 Tissue Research Institute, Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Amir","middleName":"Ali","lastName":"Hamidieh","suffix":""}],"badges":[],"createdAt":"2024-08-12 09:54:38","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4899481/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4899481/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-87509-3","type":"published","date":"2025-02-04T15:57:12+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":66652783,"identity":"0a7f1098-faad-466d-aeac-0c3b2776eb75","added_by":"auto","created_at":"2024-10-15 07:51:06","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":608543,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic presentation of patients characteristic enrolled in this study. CIS: Carcinoma in situ; NMIBC: Non muscle invasive bladder cancer; MIBC: Muscle invasive bladder cancer; Non: noncancerous patients; TURBT: Transurethral resection of bladder tumor; Mitomycin instillation: the treatment involves instillations of liquid chemotherapy; BCG: Bacillus Calmette–Guerin; Neoadj. Chemotherapy: It is a type of induction therapy.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4899481/v1/d5c84392abd1cd124540c16e.png"},{"id":66652780,"identity":"e8bc097f-ded6-44fb-9908-28e6a0ae3425","added_by":"auto","created_at":"2024-10-15 07:51:06","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":411625,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of tumor organoids cultured in Alginate. A) Tumor organoids from patient #3 cultured in BME from tissue and then subcultured in Alginate in P1 in different days (3, 10 and 14), in compare with same patient subcultured in BME. Although they shows same trend in growth rate, morphology of the most of the organoids sub-cultured in Alginate changed to solid or basal organoid in compare with BME that shows more luminal organoids (scale bar: 100 ϻm). B) Different morphology of drops made by Alginate and BME. C) Tumor organoids from patient #2 isolated from tissue in P0 and cultured in Alginate in compare with BME shows in different days (3, 10 and 14), growth rate, size and number of organoids in BME group were more than Alginate group –right panel shows four different abandon morphologies in Alginate (solid and grape like) and in BME (solid and luminal) for same patient and in day 14 after isolation from tissue (scale bar: 100 ϻm). D) Viability assessment of tumor organoids in different days and different conditions (BME and Alginate), both groups shows acceptable viability more than 100%. E) Size measurement by Image J in different days and different conditions (BME and Alginate), in days 7 and 10 increase in growth rate were highly significant in BME group in compare with day 3. F) SEM microscopy to show the porosity of Alginate scaffold (upper figure) after preparation and before adding culture medium and lower figure shows the Alginate scaffold in day 10 and after culture, arrow shows the tumor organoids (Scale bar: 200 ϻm). G) RT-PCR analysis for eight genes on tumor organoids cultured from tissue after 14 days, delta CT data normalized to Cyclophilin, except GATA3A, all genes shows significant increase in BME group in compare with Alginate.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4899481/v1/08ec5342c49c87410b458e85.png"},{"id":66654178,"identity":"9d01f1fa-512b-460e-82c5-d8ea1048a415","added_by":"auto","created_at":"2024-10-15 07:59:06","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":232812,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of tumor organoids maintained with home-made fibroblast conditioned medium (FCM). A) Tumor organoids from patient #6 cultured in BME (obtained from tissue) and maintained with standard medium which contains commercial FGF2,7 and 10. B) Tumor organoids from patient #6 cultured in BME (obtained from tissue) and maintained with fibroblast conditioned medium (FCM) based medium instead of FGF2, 7 and 10. C) Flow cytometry analysis for CD73 and CD29 for fibroblast cells in passage 3, right figure shows the morphology and confluency of fibroblast cells at time of condition medium collection (scale bar: 100 ϻm). D) Fourier Transform Infrared Spectroscopy (FTIR) analysis for home-made FCM (red line) and 25% commercial FCM (CellProgen\u003csup\u003e© \u003c/sup\u003e) (black line). E) ELISA analysis to determine amount of FGF2, 7 and 10 in home-made FCM and comparison with diluted commercial FCM. F) Passage numbers of tumor organoids cultured in different conditions (Alginate, BME, Alginate maintained with home-made FCM, BME maintained with home-made FCM and tumor organoids isolated from tissue in P0 in BME and then sub-cultured in Alginate later from P1 onwards. G) Bio-banking potentials of tumor organoids cultured in different conditions (Alginate, BME, Alginate maintained with home-made FCM, BME maintained with home-made FCM and tumor organoids isolated from tissue in P0 in BME and then sub-cultured in Alginate later from P1 onwards. H) Size measurement and growth rate comparison for tumor organoids cultured in Alginate and maintained with standard medium contains commercial FGF2, 7 and 10 and home-made FCM based medium in different days (3, 7 and 10). I, L) RT-PCR analysis for eight genes on tumor organoids cultured from tissue after 14 days cultured in Alginate and BME and maintained with standard medium contains commercial FGF2, 7 and 10 and home-made FCM based medium, delta CT data normalized to Cyclophilin, tumor organoids cultured in BME in both conditions of medium (Std and home-made FCM) shows 10 times higher expression level in compare with tumor organoids cultured in Alginate.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4899481/v1/61fcc871babc38089000c05a.png"},{"id":66652782,"identity":"16bde2c8-325d-453c-9476-9d0de57775f4","added_by":"auto","created_at":"2024-10-15 07:51:06","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":167712,"visible":true,"origin":"","legend":"\u003cp\u003eConfocal microscopy images of bladder tumor organoids in different conditions. A) Confocal microscopy to show the protein expression of specific bladder marker (CK20 in green), nucleolus with DAPI in blue and proliferation marker (KI67) in red for tumor organoids cultured in Alginate in compare with organoids cultured in BME in day 14. B) Confocal microscopy to show the protein expression of specific bladder marker (CK20 in green), nucleolus with DAPI in blue and proliferation marker (KI67) in red for tumor organoids cultured in different conditions (Alginate maintained with home-made FCM, BME maintained with home-made FCM in compare with BME maintained with standard medium contains commercial FGFs.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4899481/v1/cb22bb8fc3e7d44fd8331f84.png"},{"id":75931479,"identity":"dc08d7b3-3ee3-4e2d-ba38-0414d6e5c5bf","added_by":"auto","created_at":"2025-02-10 16:14:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2875247,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4899481/v1/27ce4d59-17f1-427c-88a5-3f473531d206.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Cost-Reduction Strategy to Culture Patient Derived Bladder Tumor Organoids","fulltext":[{"header":"Introduction","content":"\u003cp\u003eA unique three-dimensional (3D) culture structure with the ability to mimic the development and regeneration of organs is called an organoid. Organoids develop from the self-organization of stem cells to eventually form structures that resemble in vivo organs (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Effective organoid generation in in-vitro depends on recapitulating three main features: physical properties of the environment surrounding the cells; soluble cues; and type of starting cells. Accordingly, biomaterials and medium are needed to provide a compatible microenvironment that resembles the extracellular matrix (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Currently, basement membrane derived matrices (BMMs), Cultrex BME and matrigel, are gold standard scaffolds for organoid culture (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). Both of these extracellular matrixes are hydrogels (type of soft material that absorbs large amounts of water to shape a 3D fiber network (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e)) composed of primary components including laminin, collagen IV, heparin sulfate proteoglycan perlecan and entactin (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). It should be noted that hydrogels are not only an inert scaffold, but also provide the biological and chemical conditions necessary for the proliferation and differentiation of cells (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). For example, laminin-1 contains numerous anchorage sites for the attachment of different cell types such as stem cells and laminin-derived peptides also contribute to differentiation, angiogenesis and metastasis. BME and matrigel also encompass tumor-derived proteins like fibroblast growth factors (FGFs), transforming growth factor beta (TGF-β) and matrix metalloproteinases (MMPs) which strongly contribute to the organoid formation. These properties together make them effective scaffolds for the development and culture of organoids and tumor organoids (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). However, BMMs are not flawless and have some drawbacks. Batch-to-batch variations and even inconsistencies in a single batch reported and has led to lack of reproducibility in 3D-culture experiments (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). In addition to the approximately 2000 proteins identified in these BMMs to date, proteomic studies continue to identify new proteins in these biomaterials that have not been reported previously (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Moreover, since these are natural hydrogels extracted from mouse sarcoma, which has antigenicity potential and possibility of introduction xenogenic and/or viral contamination to be used in clinical studies (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). Besides, thermal-sensitivity, high cost and requirement of cold chain for transportation, make them challenging for establishment of organoid, especially in countries with low resources for research (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e) (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Meanwhile, tumor organoid culture medium needs a medium supplemented with several expensive growth factors such as R-spondin, Wnt3a, FGF2, FGF10, noggin, forskolin, A83 (TGFβ inhibitor) and epidermal growth factor (EGF). According to the estimate of Chang et al. the necessary cost to prepare 50 mL of this medium is about US\u003cspan\u003e$\u003c/span\u003e646 (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Here we describe using alginate as a tissue-mimetic scaffold with viscoelastic behavior. Sodium Alginate is a cost effective and naturally derived from brown algae with controllable gelation after adding calcium chloride as a cross-linker (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). A series of studies have been conducted on organoid culture with this FDA-approved hydrogel (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e) and promising results have been reported (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). Different studies showed variation of potential in using alginate as a supportive scaffold especially for long term culture (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e), although the alginate shows hydrophilicity which prevents protein absorption and lack of cell adhesive properties, it seems considerable potential to provide growth and mechanical support for organoid culture (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Here, we characterized an alternative tumor organoid culture platform by using alginate and fibroblast conditioned medium (FCM) in comparison with standard protocol of bladder organoid generation, to show the potential of using this scaffold and FCM as cost reduction strategy that help accessibility to organoid culture establishment, especially for early stage drug screening.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003e2.1. Sample collection\u003c/h2\u003e\n \u003cp\u003eHuman bladder cancer tissue from 10 patients were obtained from patients undergoing TURBT (Transurethral resection of bladder tumor) at Emam Khomeini Hospital (Table.1). All patients were informed about the study in writing and verbally and signed an informed consent form. The study protocol was approved by the Ethics Committee of Tehran University of Medical Sciences prior to screening of patients (IR.TUMS.TIPS.REC.1402.139). All methods were performed in accordance with the relevant guidelines and regulations. During surgery, tumor tissue samples were collected into a falcon containing Advanced DMEM/F12 culture medium (Gibco) supplemented with 1% Glutamine, 1% Hepes and Primocin (invivogen) (1ml in 500ml) (:Advanced DMEM/F12\u003csup\u003e+++\u003c/sup\u003e), placed on ice, and transported directly to the laboratory. Tissue samples were employed to establish primary tumor organoid culture.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eTable.1.\u003c/strong\u003e Patients Characteristic\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Taba\" border=\"1\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSex\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAge\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePathological classification\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eInvasiveness\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePre cancer treatment\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF:2\u003c/p\u003e\n \u003cp\u003eM:8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAverage: 62.2\u003c/p\u003e\n \u003cp\u003eRange (40\u0026ndash;79)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCIS: 2\u003c/p\u003e\n \u003cp\u003ePTa: 3\u003c/p\u003e\n \u003cp\u003ePT1:1\u003c/p\u003e\n \u003cp\u003ePT2:0\u003c/p\u003e\n \u003cp\u003ePT3:3\u003c/p\u003e\n \u003cp\u003ePT4:1\u003c/p\u003e\n \u003cp\u003eLow grade: 6\u003c/p\u003e\n \u003cp\u003eHigh grade: 4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNMIBC:6\u003c/p\u003e\n \u003cp\u003eMIBC:4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNon : 2\u003c/p\u003e\n \u003cp\u003eTURBT: 5\u003c/p\u003e\n \u003cp\u003eMitomycin instillation: 0\u003c/p\u003e\n \u003cp\u003eBCG instillation:2\u003c/p\u003e\n \u003cp\u003eNeoadj. Chemotherapy:1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003eCIS: Carcinoma in situ; NMIBC: Non muscle invasive bladder cancer; MIBC: Muscle invasive bladder cancer; Non: noncancerous patients; TURBT: Transurethral resection of bladder tumor; Mitomycin instillation: the treatment involves instillations of liquid chemotherapy; BCG: Bacillus Calmette\u0026ndash;Guerin; Neoadj. Chemotherapy: It is a type of induction therapy.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003e2.2. Hydrogel Alginate Preparation\u003c/h2\u003e\n \u003cp\u003e3% Sodium Alginate (SA) hydrogel (ZFZ Co. Iran) was prepared by using Advanced DMEM/F12\u003csup\u003e+++\u003c/sup\u003e as solvent. The combination stirred on a magnetic stirrer under the hood for about one hour at room temperature or until the solid phase dissolved.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003e2.3. Establishment and maintenance of bladder tumor organoids\u003c/h3\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003e2.3.1. Tissue dissociation\u003c/h2\u003e\n \u003cp\u003eThe tumor tissue were washed in human organoid washing medium cold Ad DMEM/F12\u003csup\u003e+++\u003c/sup\u003e (advanced Dulbecco\u0026apos;s Modified Eagle Medium contain Hepes, Lglutamine and Primocin), and put in a petri dish to cut it in smaller pieces with a surgical blade; minced tissues were washed in 1 mL of washing medium and centrifuge at 350g for 5 min. After removal of the medium, tissues were then incubated in 1 mL of 1:10 dilution of collagenase1A (Sigma Aldrich) prepared in Earle\u0026apos;s Balanced Salt Solution (EBSS) (Gibco) at 37ͦC for 30 min (meanwhile, the tissues were dissociated mechanically by pipetting). Incubated tissue with collagenase filtered 70 \u0026micro;m cell strainer, and filled up with Ad DMEM/F12\u003csup\u003e+++\u003c/sup\u003e for inactivation collagenase and centrifuged again at 350g for 5 min, this washing step was repeated twice. After removing the AdDMEM/F12\u003csup\u003e+++\u003c/sup\u003e, cell pellet was combined with alginate (Alg) solution (1:3) and dropped into the 40mM calcium chloride (40 mM), incubated for 8\u0026ndash;10 min to be solidify and formed drop. The calcium chloride were replaced with bladder expansion medium which is Ad DMEM/F12\u003csup\u003e+++\u003c/sup\u003e supplemented with 10mM of the ROCK inhibitor Y-27632 (Sigma-Aldrich), B27 50X (Thermo Fisher), NAC (N-acetylcysteine) 500 mM (Sigma Aldrich), NIC (Nicotinamide) 1M (Sigma Aldrich), WNT homemade conditioned medium, R-Spondin-1 homemade conditioned medium (both gifted from Biochemistry department, EMC) and A83 (20mM) (Tocris). Standard medium contains FGF7 (Peprotech) 25 ng/ml, FGF10 (Peprotech) 100 ng/ml and FGF2 (Peprotech) 12.5 ng/ml. In case of FCM-based medium, FGF7, 10 and 2 was replaced with 40 ml of FCM (describe in section \u003cspan class=\"InternalRef\"\u003e2.5\u003c/span\u003e). Approximate amount of FGF2, 7 and 10 in 40 ml of home-made FCM medium prepared for bladder medium organoids were 8.07 ng/ml, 13.89 ng/ml, 8.79 ng/ml, respectively. The medium was filtered through 0.2 \u0026micro;m filter. The medium was changed every 2\u0026ndash;3 days (Table.2). As control, same amount of the cell pellet after centrifuge, was dropped into the BME (Basement Membrane Extract) and the rest for each patients embedded into alginate 3%.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eTable.2.\u003c/strong\u003e List of organoid culture medium reagents\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Tabb\" border=\"1\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReagents\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eStock\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eFinal concentration\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eB27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e50x\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eA83\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20 mM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5 ϻM\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFGF2 (only for standard medium)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e125 \u0026micro;g/mL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12.5 ng/ml\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFGF7 (only for standard medium)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e250 \u0026micro;g/mL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e25 ng/ml\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFGF10 (only for standard medium)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.5 mg/mL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e100 ng/ml\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN-acetylcysteine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e500 mM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.25 mM\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNicotinamide\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1 M\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10 mM\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1mg/ml\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e40 ng/ml\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePrimocin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1 ml in 500 ml of AdDMEM\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAdvanced DMEM/F12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSubstituted: Glutamide 5 mL Hepes 5 mL Primocin 2 mL\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHydrogel Alginate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ecalcium chloride\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e40Mm\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCollagenase 1A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10 mg/ml\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1 mg/mL\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDispase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.90 U/mg\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEBSS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGlutamine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR-spondin\u003c/p\u003e\n \u003cp\u003eConditioned medium\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.5%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRock Inhibitor/\u003c/p\u003e\n \u003cp\u003eY-27632\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10 mM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1 \u0026micro;M\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWnt3a\u003c/p\u003e\n \u003cp\u003eConitioned medium\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.5%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHepes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDMEM high glucose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePen/strep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTop up with Advanced DMEM/F12 for standard medium containing FGFs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTo 40 ml\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTop up with Fibroblast condition medium (FCM) for medium containing FCM instead of FGFs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTo 40 ml\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n \u003ch2\u003e2.3.2. Expansion and maintenance\u003c/h2\u003e\n \u003cp\u003eEvery 7\u0026ndash;10 days according to the organoid density and size, to disrupt the alginate drop we used 500 ϻl of phosphate-buffered saline (PBS) and incubated in room temperature for 10 min, afterwards, the 1\u0026micro;g/ml dispase (Gibco) was added to each well in tissue culture plate, and the digestion process was conducted enzymatically and mechanically, digested organoids were combined with Alg/ AdDMEM/ F12\u003csup\u003e+++\u003c/sup\u003e to make the new drops. The general split ratio is 1:2\u0026ndash;3, depending on growth rate (\u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003e2.4. Viability and size assessment\u003c/h2\u003e\n \u003cp\u003eAlamarBlue viability assay (Invitrogen DAL1025) was carried out in this study which is based on the fluorescence reading of resorufin converted into cell enzymes from resazurin and allows measurement of the signal from tumor organoids (\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e). Wells with organoids were randomly selected (in triplicates) after 3, 7 and 14 days. First, The reagent were diluted with BOM medium to make 10% Alamar blue, incubated for 4h in the incubator and then reading was performed according to the manufacturer\u0026rsquo;s instructions. Absorbance readings were taken at wavelengths 570 and 600 nm. The results were normalized to control (Matrix or scaffold). Cell imaging (Labomed, USA) was performed after each Alamar Blue assay. Each condition was repeated at least three times and readings were done in duplicate. Images was analyzed by using Image J software. Diameter of tumor organoids were measured in three image of each patients and in each group, data was represented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n \u003ch2\u003e2.5. Fibroblast cell isolation, characterization and conditioned medium collection\u003c/h2\u003e\n \u003cp\u003eHuman tissue samples from foreskin were obtained from three consenting healthy donor (n\u0026thinsp;=\u0026thinsp;3), after receiving maternal consent. The samples were incubated in Dispase II (2.4 units/ml) (Gibco) for 16 h at 40˚C and then the epidermis was peeled off the dermis and discarded, and the dermis was washed and digested by using collagenase II (1%) (Gibco) at 37˚C for 40 min. The cells were then re-suspended in F12: DMEM (Gibco) medium supplemented with 10% fetal bovine serum (FBS; Gibco), 1% pen/strep antibiotic solution (Biosera). The medium was replaced every 2\u0026ndash;3 days until the monolayer cells were 70\u0026ndash;80% confluent, the cells were sub-cultured by using 0/025% trypsin/EDTA (Gibco), until passage 3 (P3) (\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e). The cells were characterized by flow-cytometry to detect the expression of specific fibroblast cell surface markers, CD73 and CD29 (\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eThe culture medium from 60\u0026ndash;80% confluent fibroblasts (P3) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC) was replaced with AdDMEM/F12+++ and incubated for 48 hr-72hr, the medium then collected and filtered using a 30-kDa Amicon Ultra-15 centrifugal filter (Sigma-Aldrich) to concentrate the proteins (FGF7\u0026thinsp;\u0026asymp;\u0026thinsp;19kDa, FGF2\u0026thinsp;\u0026asymp;\u0026thinsp;18kDa and FGF10\u0026thinsp;\u0026asymp;\u0026thinsp;19.3kDa) as described before (\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003e2.6. Total RNA isolation and quantitative RT-PCR (RT-qPCR)\u003c/h2\u003e\n \u003cp\u003eTotal RNA was isolated from tumor organoids using TRIzol (ThermoFisher) on 10\u0026ndash;14 days after culturing in both conditions (standard culture and cultured with alginate), and residual genomic DNA was digested with DNase I (Life Technologies). The cDNA was synthesized using Superscript II reverse transcriptase (Life Technologies) by using random primers. RT-quantitative PCRs (RT-qPCRs) were performed on a CFX Connect real-time PCR detection system thermocycler (Bio-Rad) using GoTaq qPCR master mix (Promega) (3 min at 95\u0026deg;C, followed by 40 cycles of 95\u0026deg;C for 10 s and 60\u0026deg;C for 30 s). Melting-curve analysis was performed to assess specificity of RT-qPCR products. Primers used for real-time PCR are listed in Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e. Relative gene expression data were calculated using the \u0026Delta;CT method (\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e). Cyclophilin was used as housekeeping gene for the analysis.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eList of primers used for RT-PCR\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUroplakin IIIA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGGAGGCATGATCGTCATC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAGCAAAACCCACAAGTAGAAAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCD44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCTCTCATTACCCACACACG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAGTAACTCCAAAGGACCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCK5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAAGGTTGATGCACTGATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCAGCGATGATGCTAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCK20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAGACACACGGTGAACTATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGATCAGCTTCCACTGTTAGACG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCK14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTCTGAACGAGATGCGTGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCAGCTCAATCTCCAGGTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGATA3A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACCACAACCACACTCTGGAGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCGGTTTCTGGTCTGGATGCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLGR5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGATGACCATTGCCTACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTAAGGTTTATTAAAGAGAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFOX1A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTACACACCTTGGTAGTACGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCAATACTCGCCTTACGGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCyclophilin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCAAATGCTGGACCCAACACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGCTGGTCTTGCCATTCCTGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003e2.7. Immunofluorescence of tumor organoids\u003c/h2\u003e\n \u003cp\u003eTumor organoids in all conditions were fixed by applying freshly prepared 4% paraformaldehyde (PFA) (Sigma Aldrich) in PBS buffer at room temperature for 30 minutes, followed by 3 times washing by washing solution (0.5% FBS in PBS). Then, the organoid was treated with 0.1 M glycine for 30 minutes at room temperature. In order to do permeabilization step, 300 \u0026micro;L of 0.5% triton in PBS was added to the falcon containing organoids and incubated for 30 min at room temperature. After 3 times washing by PBSTD washing solution (PBS\u0026thinsp;+\u0026thinsp;0.3% triton\u0026thinsp;+\u0026thinsp;1% DMSO\u0026thinsp;+\u0026thinsp;0.5% FBS), goat serum (0.5%) diluted in PBS (1X) was used as blocking reagent to decrease the non-specific-binding, as most of the secondary antibodies are produced on goat. First antibodies listed in Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e incubated overnight at 4 ͦ c in an orbital shaker, the day after followed by at least 3 times washing by PBSTD washing solution, appropriate secondary antibodies (listed in Table.4) were incubated for 2 hours at room temperature in an orbital shaker. Followed by at least 3 times washing by using washing solution (0.5% FBS in PBS), mounting solution containing DAPI (Abcam) was applied on organoid and covered by cover slip. The samples were visualized by using Leica Stellaris 5 LIA confocal microscopy.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eList of antibodies used for confocal imaging\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimary Antibody\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eLot Number\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSecondary Antibody\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eLot Number\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCytokeratin 20\u003c/p\u003e\n \u003cp\u003e(Mouse anti human)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e41305934\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAlexa Fluor 488\u003c/p\u003e\n \u003cp\u003egoat \u0026alpha;-mouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2066710\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eKI67\u003c/p\u003e\n \u003cp\u003e(Rat anti human)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e151202\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAlexa Fluor 555\u003c/p\u003e\n \u003cp\u003egoat \u0026alpha;-rat\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2089884\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003e2.8. Scaffold and FCM characterization (SEM, FTIR and ELISA)\u003c/h2\u003e\n \u003cp\u003eTo show the structure and morphology of calcium alginate with and without tumor organoid, we conducted SEM (Scanning Electron Microscopy) imaging by MIRA3 TESCAN (\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e). For sample containing tumor organoids, drops were collected in the falcon tube and fixed by using glutaraldehyde 4% (Sigma Aldrich), after washing with PBS, dehydration process was conducted by using the following concentrations of ethanol series (10 minutes for each level): 60%, 70%, 80%, 90%, 100%. Sample without organoids frozen at -80 ͦC and lyophilized by freeze-dryer (Pishtaz engineering, FD6, Iran) for 18 hr. FTIR was applied on the sample collected from fibroblast cultured in passage 3, the collected media stored at -80 ͦC and Fourier Transform Infrared Spectroscopy (FTIR) was conducted on the FCM and FCM prepared commercially (Cellprogen\u0026reg;, USA) as control. Before run the ELISA, we conducted spectrophotometry (WPA Biowave II, UK) on the different dilution (dilution made by adding AdDMEM\u003csup\u003e+++\u003c/sup\u003e) of commercial FCM (Cellprogen\u0026reg;, USA) to be adjust in terms of total protein concentration in compare with home-made FCM, UV absorbance was read for each diluted samples at 280 nm. 50% of commercial FCM and home-made FCM were used to measure missing GFs by ELISA (FGF10: Universal Biological RK09223; FGF7: MyBiosource MBS2020770 and FGF2: MyBioSource MBS2097899). The sample were centrifuged at 3000 rpm (Hettich, Germany), 40 \u0026micro;l of the supernatant and 50 \u0026micro;l of the standards were poured into separate wells in triplicate, then 50 \u0026micro;l of Streptavidin HRP and corresponded antibodies based on the company protocol were added to the sample\u0026rsquo;s well. The plates were incubated for 1 h at 37\u0026deg;C, then wells were washed four times with washing solution. Then 50 \u0026micro;l of chromogen A and chromogen B solutions were added respectively. Plate was shacked (Behdad, Iran) gently and incubate for 10 min in the dark room at 37 C\u0026deg;. The stop solution was added to all wells until the blue color turned to yellow. Absorbance was read at 450 nm by an ELISA reader (Biotek, USA).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003e2.9. Software and Statistics\u003c/h2\u003e\n \u003cp\u003eData are displayed as median if applicable. Individual groups were tested using the 2way ANOVA analytical test for correlation between continuous data. Graphs were plotted using GraphPad Prism v.8.4.0. Statistical analyses were conducted using GraphPad Prism v.9.4.1. p values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered statistically significant.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Result","content":"\u003ch2\u003e3.1. Patients Characteristics\u003c/h2\u003e\u003cp\u003ePDOs were generated from specimens obtained from patients that underwent either TURBT, BCG instillation or Neoadjuvant chemotherapy (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, Table\u0026nbsp;1) at Emam Khomeini Hospital in Iran and representing the spectrum of Bladder Urothelial Carcinoma (BLCa), ranging from low-grade, non-invasive BLCa to high-grade invasive tumors, including both NMIBC (Non-muscle invasive bladder cancer) and MIBC (Muscle invasive bladder cancer). The study protocol was approved by the Ethics Committee of Tehran University of Medical Sciences prior to screening of patients (IR.TUMS.TIPS.REC.1402.139). Table\u0026nbsp;1 And Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e shows the patients characteristic enrolled in this study.\u003c/p\u003e\u003ch2\u003e3.2. Tumor organoid cultured in calcium alginate scaffold characterization\u003c/h2\u003e\u003cp\u003eTo stablish the bladder cancer organoid, we mechanically and enzymatically disassociated the tissue as we described above (section 2–\u003cspan refid=\"Sec14\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Cells resulted from disassociation, plated in non-adherent plate into the BME and supplied with growth factor listed in Table.2 as control group, from each sample, half of the cell suspension was entrapped into alginate (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.B) and maintained with same supplements (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). Tumor organoids were observed in BME based scaffolds after 3 days but minimum in 7 days in alginate group. Tumor bladder organoids had three different spherical morphologies which were variable from patient to patient: basal (mostly solid spherical), luminal (hollow cyst) and grape like subtypes in both condition. Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.A shows the tumor bladder organoids cultured in BME (upper row) and in alginate (lower row) when they expand first in BME and then sub-cultured into alginate following the high confluency. While, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.C revealed the tumor organoids generated from tissue.\u003c/p\u003e\u003cp\u003eObviously, the number and growth rate of tumor organoids cultured in BME were higher than alginate group, but this difference decreased when the organoids generated in BME first and then expanded in alginate. The culture efficacy of tumor organoids cultured in alginate were considerably lower than the BME group and few passage (between 1 to 3) observed, although the tumor organoids were passaged minimum 10 times in BME groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.F).\u003c/p\u003e\u003cp\u003eMost of the bladder cancer organoids in alginate were solid spherical and grape like shape, although the number of hollow cyst and solid spherical organoids were increased in BME culture (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. A and C). Further characterization was performed by evaluate viability in 3, 7 and 14 days after culture on the organoids generated from tissue in both condition as well as diameter of the organoids in 3, 7, 10 and 14 days after culture. Viability was assessed by Alamar blue over matrix (BME in BME group without tumor organoid and alginate in alginate group without tumor organoid), 2 way ANOVA analysis revealed significant difference between BME in compare with alginate group in day 3 (P value: 0.0387) and day 7 (P value: 0.0398), although the viability for both groups were more than 100% in 14 days after culture, viability in BME group was significantly more than SA group in general and in 14 days (P Value: 0.0012) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. D).\u003c/p\u003e\u003cp\u003eAs shown in the Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. A, graph E, size of tumor organoids were similar in day 3 in both group, but in day 7 and day 10, BME group was significantly higher than alginate group in general. In alginate group, size in day 7 (P value: 0.0020) and day 10 (P value: 0.0009) was significantly higher than day 3.\u003c/p\u003e\u003cp\u003eIn BME group, size in day 7 (P value ≤ 0.0001) and day 10 (P value ≤ 0.0001) was significantly increased in compare with day 3, so the culture medium and scaffold could support growth of organoids, especially in 10 days. On the other hand, it was important to show the physical features of scaffold, with and without organoids. In order to show the scaffold can physically support spherical organoid generation and it possess enough pores which is essential for cells assembly and medium exchange (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e), morphological analysis was conducted after lyophilization process by using SEM, the result showed highly porous network and interconnected pores (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF) which allow cell growth, migration, flow and transport the nutrient and metabolic waste (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). The porosity analysis by Image-J software showed that the average of pore sizes for 3% (w/v) alginate scaffolds on three different SEM images (magnification 200 ϻm) were ˷25 ϻm.\u003c/p\u003e\u003cp\u003eBladder cancer is a highly heterogeneous disease, recent genome wide expression studies identify genes and multiple molecular subclasses that led to BLC classification (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). Basal like cancer express higher level of CD44 and cytokeratins (CK5, 6, and 14) (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e), these biomarkers (CD44, CK5, 6 and 14) are also enriched in normal epithelial stem cells and cancer-associated stem cells derived from epithelial lineage tumors. The epithelial lining of the bladder is composed of three layers; apical layer (umbrella cells) that expresses UPK3A, intermediate layer (polygonal cells) that expresses CK7, and basal layer (cuboidal cells) that expresses CK5 (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e), Ck20, FOXA1 and GATA3 are also express higher in luminal subtype (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eRNA analysis by RTPCR in this study emphasize our tumor organoid model by using BME can mirroring critical features of human tumor bladder tissue. Cultured organoids recreate a significant portion of the cellular diversity of bladder tissue including the varied functionalities of luminal and basal cells. Except GATA3, all the genes were higher expressed and highly significant (P value ≤ 0.0001), in BME group in compare with sodium alginate group (P Value: 0.2029). For CK5 gene, expression was significantly higher in BME (P value: 0.0209).\u003c/p\u003e\u003ch2\u003e3.3. Tumor organoid characterization in FCM based medium characterization\u003c/h2\u003e\u003cp\u003ePatient derived bladder tumor organoid tested in BME and Alg based scaffold with two different medium composition (Table.2), the medium named standard medium, prepared based on the protocol obtained from Erasmus Medical Center, urology department and in FCM medium (fibroblast conditioned medium), the fibroblast growth factor 2, 7 and 10 replaced with optimum amount of FCM (Table.1). Bright field microscopy showed similar morphology in both group when embedded in BME for 14 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.A), both dense spherical and luminal morphology were observed in organoids cultured in different medium. To prepare medium with FCM composition, we need to isolate and culture dermal fibroblast, the cells isolated by enzymatic digestion, strongly adherent HDF (human dermal fibroblast) cells shows the typical spindle-shape appearance, after 3 passages, flow cytometry analysis conducted to confirm characterization of fibroblast cells by evaluation of surface marker CD29 and CD73. Follow-up analysis using FlowJo software showed expression 99.8 and 96.7%, respectively. Fibroblast cells in 70–80% confluency (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.C) were cultured and supernatant was collected after 3 days incubation, the supernatant then analyzed by using FTIR and Elisa in compare with commercial FCM (Cellprogen®, USA). Result of FTIR showed in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.D, which black means control (commercial FCM) with peak related to the carbon-iodine bond in the 565 cm\u003csup\u003e− 1\u003c/sup\u003e. The peak appearing in the region of 1088 is related to C-O stretching bond. A strong peak appearing in the region of 1639 is related to the stretching vibrations of C = C acyclic alkenes. The peak related to the region 2079 is related to N = C = S stretching vibrations and the peak appearing in the region of 3459 is related to N-H amine of the second type. On the other hand, red graph showed the analysis for home-made FCM, the band (peak) related to the carbon-iodine bond appeared in the 560 region that is near by the peak reported in Ctrl group. The C-N stretching bond appeared in the 1119 region. The C-O peak of vinyl ether is related to the symmetric and asymmetric stretching vibrations of 1043 and 1187 respectively, and the existence of a strong peak appearing in the region of 1639 is related to C = C stretching vibrations, which confirms this structure. The peak corresponding to the region 1461 is related to C-H aliphatic groups. The peak corresponding to the region 2083 is related to N = C = S stretching vibrations and the peak appearing in the region of 3448 is related to N-H amine of the second type. Comparison of two peaks showed similarity in trend and most of peaks, although the home-made FCM (red line) has several additional peaks, which can be due to the sample purification and concentration.\u003c/p\u003e\u003cp\u003eMoreover, ELISA characterization have been done to show precise amount of 3 main absence growth factors (FGF2, FGF7 and FGF10) in homemade FCM and in comparison with commercial FCM, beside this experiment was needed to optimized volume of homemade FCM to prepare bladder organoid medium. Experiment was repeated for three times in triplicate, 347.4 pg/ml for FGF7, 201.9 pg/ml for FGF2 and 219.8 pg/ml for FGF10 obtained for homemade FCM and the difference was highly significant (P value ≤ 0.0001) for FGF7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. E). The standard curve was calculated for each growth factor and the R² = 0.9874, R² = 0.9901 and R² = 0.9936 for FGF7, FGF2 and FGF10, respectively (data not shown).\u003c/p\u003e\u003cp\u003eIn order to confirm the medium prepared by using homemade FCM (Table.2) capable to support tumor organoid culture, image J analysis have been done for the pictures obtained from bright field microscopy, graph in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. F represented the size of tumor organoid in compare with standard medium in day 3, 7, 10 and 14 which did not show significant difference. Moreover, tumor organoid cultured in FCM based medium embedded in BME and SA were evaluated for different tumor bladder markers by RTPCR. This experiment shows the potential of using Alg scaffold and homemade FCM together as a solution to prepare bladder tumor organoids for preclinical testing and early-stage drug screening. The result indicate very similar expression in presence of BME and cultured by using homemade FCM in compare with standard medium, with no significant difference in expression, on the other hand, tumor organoid cultured in Alg and maintained by homemade FCM showed slight variation but not significant, only CK14 as a marker of cancer-associated stem cells from basal like cells in standard medium was significantly higher than homemade FCM based medium (P value: 0.0307) which is may due precise downstream activation of commercial growth factor required for stem cell lineage.\u003c/p\u003e\u003cp\u003eCulture efficiency was showed based on the number of passage for each condition, the result shows (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.F) more than 10 times sub-culturing for BME group and then for group cultured in BME and maintained with FCM based medium. Applying alginate to culture the organoid significantly decrease potential of long term culture, number of passaging and bio-banking possibility (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.G). Organoid generated in BME and sub-cultured in Alg indicate better passaging potential than organoids generated in Alg from tissue sample.\u003c/p\u003e\u003cp\u003eTo confirm the model is functional and accurate in term of architecture, size, and molecular expression markers of human tumor bladder tissue, we used confocal microscopy for tumor organoids cultured in sodium alginate in day 14 and organoids generated by using alginate and FCM based medium. Tumor organoids stained with DAPI, a dye that binds to healthy double-stranded DNA and is visible in blue in the UV range, images indicate truthful assembly of the cells in 3D matrix which is Alg (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. A), staining against KI67 (red fluorescence) as marker for proliferating cells and CK20 (green fluorescence) which is marker for basal layer of luminal subtype also showed clearly right position and positive expression in compare with tumor organoids cultured in BME. Same markers have been used for the tumor organoids cultured in sodium alginate and maintained by FCM based medium, tumor organoid cultured in BME by using FCM based medium in compare with standard culture condition, BME as scaffold and standard medium which resulted in accurate tumor organoid formation, CK20 and KI67 expression in compare with control group cultured in BME and maintained by standard medium (indicate as Ctrl in figure) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. B).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eRecent advances in organoids have improved culture systems that support the differentiation and assembly of different cell types along with adult/cancer stem cells resemble the functionality of living organs for modeling complex diseases, especially cancer. The selection of a functional and physiological extracellular matrix (ECM) and culture medium containing a defined cocktail of niche factors are necessary for generating accurate in vitro experimental systems, as the biochemical and mechanical properties of the ECM and composition of culture medium strongly influence cell fate, structure, function (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e), migration, adhesion and differentiation (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOrganoid cultures are traditionally maintained in BMMs, a gel-forming basement membrane material composed of laminin, collagen type IV, entactin, and heparan sulfate (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). While BMMs allow strong organoid growth, the drawbacks of organoids cultured in the BMM matrix are their unsuitableness for clinical use due to the murine tumor origin, the costly manufacturing, significant batch-to-batch variabilition, and temperature-sensitive gelation condition (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). Furthermore, large-scale organoid production has been limited due to the high cost of growth factors required for culture and maintenance (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e), which makes it unaccusable for low-resource countries and also for personalized medicine on a large scale (high throughput screening). Various growth factors are pivotal in orchestrating the processes of cellular proliferation, viability, differentiation, and motility. Nevertheless, employing a singular, standardized medium proves inadequate for culturing the diverse array of organoid types originating from different tissues. Consequently, multiple investigations as a guide framework to discern the optimal media components tailored to specific organs (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). Due to the mentioned limitations in organoid culture, there is growing interest in the test of alternative natural and synthetic biomaterials for utilization in these promising systems to build more accessible and handle able as long as physiologically relevant 3D structures (41). Hydrogels are deemed highly suitable for 3D cell culture applications owing to their similarity to the extracellular matrix. Although a variety of synthetic and natural hydrogel polymers are being explored for different types of organoids such as intestine, liver, pancreas, kidney, and lung; they have not been tested for bladder organoid establishment (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSynthetic materials such as polyethylene glycol (PEG), poly (hydroxyethyl methacrylate) (polyHEMA), polyvinyl alcohol (PVA), and polycaprolactone (PCL) exhibit the ability to form hydrogels (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). Likewise, natural polymers including alginate, chitosan, hyaluronan, dextran, collagen, and fibrin, possess hydrogel-forming capabilities while alginate, hyaluronan derived from bacterial fermentation, and dextran are non-animal derived materials (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eNatural hydrogels sourced from non-animal origins have garnered significant interest due to their biocompatibility and controllable gelation conditions. However, challenges persist in controlling gelation kinetics, material composition variations, and regulating mechanical properties (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e). Alginate, sourced from brown algae, represents a natural polymer that can be utilized for organoid culture; in recent years, some types of organoids such as lung, mammary tumors, salivary glands, spinal cord, and intestine have been developed by using alginate. However, alginate has not been reported as a 3D support hydrogel for bladder tumor organoid culture (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e). Alginate gelation process can be modulated through crosslinking by calcium chloride, calcium carbonate, barium chloride, and zinc chloride facilitating implementation with commercially available reagents for additional modifications. Nevertheless, unmodified alginate suffer from lack of cell adhesion surface protein and its hydrophilic feature hamper protein adsorption, relegate its primarily supportive role in 3D organoid culture (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this work, first we used sodium alginate (3%) as a BMM alternative to establish patient derived tumor bladder organoids and then we tried to modify the medium composition to make cost effective alternative in bladder organoid culture.\u003c/p\u003e \u003cp\u003eSuccessful generation of tumor bladder organoids was supported by characteristic structures, the expression of tissue-specific markers at the gene level, and immunostaining to assess the expression and functionality at the protein level in comparison with standard protocol to culture organoids. Both matrices, sodium alginate, and BME, supported stem cell marker expression and further early differentiation to develop and mimic bladder tissue structure, while the morphological subtypes, size, and viability were almost similar with the same trend, the expression level of bladder tissue markers was strongly more significant in BME-retained organoids, except GATA3A which might be shows alginate could potentially lead organoid cultures toward a basal phenotype (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e). This data indicates the role of the matrix microenvironment in cellular behavior by cell-matrix interactions (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e), although both matrices showed acceptable level of viability and growth rate during 14 days. However, since long-term culture and the ability to subculture after freeze are prerequisites for establishing organoid biobanks, it is plausible that alginate may not be the optimal choice for establishment of bladder tumor organoid biobanks. These results are in line with the major studies in this field, indicating that the alginate scaffold can be used for early-stage organoid culture models and requires modifications for long-term maintenance and maybe biobanking. In this regard, some studies have shown that the alginate needs to be functionalized with the arginyl glycyl aspartic acid (RGD) peptide as a ligand for integrin, allowing control cellular responses to a biomaterial, such as attachment (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e). Broguiere et al. found that natural non-adhesive alginate cannot be used for small intestinal organoids from single pluripotent cells. They found that RGD-enriched alginate provided long-term expansion support of organoids equivalent to BME-grown organoids (\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e). RGD or laminin-111 sites provide adhesion domains on the alginate scaffold which offer better physical support for stem cell proliferation and subsequent organoid culture and expansion. One of the main reasons of more successful organoid culture in MMPs is presence of RGD sites in the components of BBMs such as laminin (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn contrast, a series of studies have been reported non-adhesive property of alginate as advantage to develop organoid model (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e) for example, Capeling et al. have demonstrated that alginate supports human intestinal organoid (HIO) growth in vitro and leads to HIO epithelial differentiation that is virtually indistinguishable from Matrigel-grown HIOs. Since HIOs possess an inner epithelium and outer mesenchyme, they hypothesized that adhesive cues provided by the matrix may be dispensable for HIO culture. This study demonstrate mechanical support from a simple-to-use and inexpensive hydrogel is sufficient to promote HIO survival and development (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e) and show the successful rate might be dependent on the origin tissue. Changes in study design while working with alginate may led to success organoid model generation, for example M. Capeling et al., used non-adhesive alginate as outer layer of scaffold encapsulated with core of Matrigel embedded cells to culture intestinal organoids, or using microfluidic system to generate droplet of non-adhesive alginate for high-throughput screening and to culture mammary tumor organoids (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this study, first we culture tumor organoid through Alginate and with standard medium containing commercial recombinant growth factors such as EGF, Noggin, Wnt3a, and R-spondin, FGF10, FGF7 and FGF2 (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e). Although this approach is effective, the use of purified growth factors were expensive and confine studies for scalability and reproducibility because of the huge amount of requirement to prepare fresh media with multiple components. Researcher tried alternative approach to maintain heterogeneity of tumor organoids by using direct and indirect co-culture system and to simplify medium composition and expenses (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e). For instance, the Stappenbeck laboratory generated a cell line, known as the L-WRN cell line, which produces a conditioned medium containing Wnt3a, R-spondin 3, and Noggin (\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e). Similarly, in another study by Chang et al., a combined conditioned medium reflecting the composition of the fallopian tube, including epithelial, stromal, and endothelial cells, was proposed as alternative of commercial growth factor. They observed that combined medium effectively supported the organoid culture and enhanced the expression of stemness-related genes. However, organoid proliferation compared to the conventional medium had the same trend (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDifferent techniques to co-culture cells in 3D are available, allowing for various levels of interaction between cell types. In contrary of direct co-culture, indirect co-culture involve using physical barrier between cell types, like a semi-permeable membrane, and/or using conditioned medium where communication occurs through the secretion of signaling molecules (secretome) that can impact cell behavior positively or negatively (\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSo, here we tried using homemade FCM instead of three growth factors (FGF2, FGF7, and FGF10) reported in the culture of bladder organoids (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e), which means reduction culture condition cost more than 2600\u003cspan\u003e$\u003c/span\u003e, except replacing BME with alginate. Supplemented bladder organoid culture medium with FCM has been tested for bladder tumor organoid generation and model characterization. In terms of the quality of FCM collected from fibroblast cells to enrich the culture medium, FTIR and ELISA tests have been conducted in comparison with commercial FCM. We determined that the chemical compositions of the two FCM samples were alike by using the correlation between infrared absorption band intensity and substance concentration. As a result, we proceeded to analyze FGF2, FGF7, and FGF10 using ELISA, confirming and quantifying their presence in our homemade FCM.\u003c/p\u003e \u003cp\u003eGiven that conditioned medium concentration can impact cellular behavior, it seems crucial to monitor batch-to-batch activity levels. Additionally, conditioned medium activity may be influenced by factors such as maintaining condition, hypoxia, karyotyping change from passage to passage, storage condition and duration, variations in conditioned medium collection periods, and minor technical discrepancies in conditioned medium production processes in different labs.\u003c/p\u003e \u003cp\u003eRT-PCR results showed the expression of different basal and luminal markers in generated organoids which indicated enough heterogeneity in the model. FCM-based medium showed enough support of expression stemness markers such as LGR5, CD44, CK5 and 14 in both conditions, comparison of genes profiling by RTPCR of organoid embedded in Alg and BME showed almost similarity in the BME group, although in Alg, standard medium showed a considerable increase in different genes expression and significant difference in CK14 which showed BME can support stemness more than Alg. Stem cells rely on interactions with the ECM components to preserve their stemness, and BME offers a more authentic environment to facilities these interactions (\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e). Stem cells respond to mechanical signals, and a soft matrix can boost their stemness by replicating physiological conditions (\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eRegarding protein expression of bladder marker, the luminal marker CK20 is expressed in the suprabasal/umbrella cells and dysregulation play role in most non-invasive tumors, CK20 pattern of staining is regarded as a marker of cell differentiation and maturation (\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e, \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e). UPK3A is also expressed in the luminal membrane of umbrella cells, forming an asymmetric unit membrane (AUM) involved in bladder flexibility and barrier function (\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e). Furthermore, they presented KI67 in the nucleus and CK20 and UPK3A in the outer rim of organoids, suggesting an organized structure. Ki67 are often used as markers of proliferative capacity to determine the malignancy of bladder cancer, associated with recurrence and progression of bladder cancer, and predict its prognosis (\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn summary, our study provides a proof-of-concept bladder tumor organoid culture in available and more cost effective hydrogel with controllable physical properties for optimization. In this study, we provide experimental evidence on how our approach with alginate hydrogels can resolve the major issues of using Matrigel including (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e) batch-to-batch variation, (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) safety, and (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) high-cost issues (\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e). On the other hand, FCM based medium can reduce cost issue of application organoid technology for high throughput screening, especially for low-income countries to possess the edge of knowledge technology in the field of personalized medicine. We also confirmed the potential of using sodium alginate along with FCM based medium to generate tumor organoid model of bladder tissue. Nevertheless, alginate hydrogel have potential limitation in long term culture, and the culture efficiency reduce through multiple splitting, this need to be carefully investigate and addressed in case of generating biobank. Bladder tumor organoids exhibited less budding, compared to those cultured in Matrigel, which may indicate a rather less state of stemness which is also confirmed by decrease in gene expression and protein expression (especially for KI67).We have shown the potential of indirect co-culture system by using human dermal fibroblast conditioned medium to enrich bladder organoid medium, as another solution to reduce the cost, this confirmed by comparing gene expression and protein expression profile of cultured organoids in BME and maintained by standard medium and homemade FCM medium. Despite our data on the viability of human bladder organoids cultured in Alg and Alg-FCM, more functional studies like drug screening would be inevitable in the future.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOverall, we present in this report a 3D organoid system that supports tumor bladder organoids culture and grow with the potential for applications in disease modeling, early stage drug screening, clinical translation and regenerative medicine. Hydrogels with tunable properties as long as indirect co-culture system is a solution to limit multiple boundaries in the culture of organoids with Matrigel and BBMs. Our study represents the first characterized culture of bladder organoids in Sodium alginate scaffold and medium enriched with FCM in 14 days. This preclinical model can be used as promising tool for translational application in cancer research.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eECM, Extracellular matrix\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBMMs, Basement membrane matrices\u003c/p\u003e\n\u003cp\u003eFCM, Fibroblast conditioned medium\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e3D, Three-dimensional\u003c/p\u003e\n\u003cp\u003eFGFs, Fibroblast growth factors\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMMPs, Matrix metalloproteinases\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTGF-β, Transforming growth factor beta\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eEGF, Epidermal growth factor\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePBS,\u0026nbsp;Phosphate-buffered saline\u003c/p\u003e\n\u003cp\u003ePFA, Paraformaldehyde\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAlg, Alginate\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNAC,\u0026nbsp;N-acetylcysteine\u003c/p\u003e\n\u003cp\u003eNIC,\u0026nbsp;Nicotinamide\u003c/p\u003e\n\u003cp\u003eBME,\u0026nbsp;Basement membrane extract\u003c/p\u003e\n\u003cp\u003eFBS,\u0026nbsp;Fetal bovine serum\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSEM,\u0026nbsp;Scanning electron microscopy\u003c/p\u003e\n\u003cp\u003eFTIR, Fourier transform infrared spectroscopy\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBLCa, Bladder urothelial carcinoma\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNMIBC,\u0026nbsp;Non-muscle invasive bladder cancer\u003c/p\u003e\n\u003cp\u003eMIBC,\u0026nbsp;Muscle invasive bladder cancer\u003c/p\u003e\n\u003cp\u003eSA, sodium alginate\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePEG, Polyethylene glycol\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePVA, Polyvinyl alcohol\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePolyHEMA, Poly (hydroxyethyl methacrylate)\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePCL, Polycaprolactone\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eRGD, Arginyl glycyl aspartic acid\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHIO, Human intestinal organoid\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAUM, Asymmetric unit membrane\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgement and Funding sources:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was a collaboration between Erasmus Medical Center and the Tehran University of Medical Sciences (TUMS). The work was financially supported by Erasmus Medical Center, Erasmus plus grant and Tehran University of Medical Sciences (TUMS). Regulatory monitoring was conducted by the independent group of Tehran University of Medical Sciences. All investigators completed a human protocol approved by TUMS. The authors would like to thank Dr. Mohammad Amir Amirkhani from TUMS, Hassan Karimi as consultor in biomaterial section, Erasmus MC Urothelial Cancer Research Group, Miranda Van Dijk, Valeria Lozovanu, Mitchel Olislagers, and Dr. Gert Van Cappellen at imaging center of EMC.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement:\u0026nbsp;\u003c/strong\u003eThe data used to support the findings of this study are included within the manuscript. Additional microscopy data reported in this paper will be shared by the lead contact upon request. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request. Further information and requests for resources and reagents should be directed to the lead contact, Dr. Mahsa Mollapour Sisakht (
[email protected]).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest:\u0026nbsp;\u003c/strong\u003eThe authors declare no conflict of interest, financial or otherwise.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCRediT authorship contribution statement:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMahsa Mollapour Sisakht:\u003c/strong\u003e Writing – original draft, Project administration, Methodology, Investigation, Data curation,\u0026nbsp;Formal analysis, Conceptualization. \u003cstrong\u003eFatemeh Gholizadeh:\u003c/strong\u003e Writing – original draft, Methodology, Investigation.\u0026nbsp;\u003cstrong\u003eShirin Hekmatirad\u003cstrong\u003e:\u003c/strong\u003e\u003c/strong\u003e Writing – original draft, Methodology, Investigation.\u0026nbsp;\u003cstrong\u003e\u0026nbsp;Tokameh Mahmoudi:\u0026nbsp;\u003c/strong\u003eConceptualization, Writing – review \u0026amp; editing.\u0026nbsp;\u003cstrong\u003eSaeed Montazeri:\u003c/strong\u003e Methodology, Investigation.\u003cstrong\u003e\u0026nbsp;Laleh Sharifi:\u003c/strong\u003e Methodology, Investigation.\u003cstrong\u003e\u0026nbsp;Hamed Daemi:\u003c/strong\u003e Methodology, Investigation,\u0026nbsp;Conceptualization. \u003cstrong\u003eShahla Romal:\u003c/strong\u003e Methodology, Investigation.\u0026nbsp;\u003cstrong\u003eMohammad Hosein Yazdi:\u0026nbsp;\u003c/strong\u003eWriting – review \u0026amp; editing, Validation\u003cstrong\u003e. Ahmad Reza Shahverdi:\u003c/strong\u003e Writing – review \u0026amp; editing, Validation, Data curation.\u003cstrong\u003e\u0026nbsp;Mohammad Ali Faramarzi:\u0026nbsp;\u003c/strong\u003eWriting – review \u0026amp; editing, Validation and Data curation.\u003cstrong\u003e\u0026nbsp;Amir Ali Hamidieh:\u0026nbsp;\u003c/strong\u003eWriting – review \u0026amp; editing, Visualization, Validation, Methodology, and Conceptualization.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKim J, Koo B-K, Knoblich JA. Human organoids: model systems for human biology and medicine. Nature Reviews Molecular Cell Biology. 2020;21(10):571-84.\u003c/li\u003e\n\u003cli\u003eRossi G, Manfrin A, Lutolf MP. Progress and potential in organoid research. Nature Reviews Genetics. 2018;19(11):671-87.\u003c/li\u003e\n\u003cli\u003eYe S, Boeter JW, Mihajlovic M, van Steenbeek FG, van Wolferen ME, Oosterhoff LA, et al. A chemically defined hydrogel for human liver organoid culture. Advanced functional materials. 2020;30(48):2000893.\u003c/li\u003e\n\u003cli\u003ePrince E, Cruickshank J, Ba-Alawi W, Hodgson K, Haight J, Tobin C, et al. Biomimetic hydrogel supports initiation and growth of patient-derived breast tumor organoids. Nature communications. 2022;13(1):1466.\u003c/li\u003e\n\u003cli\u003eKratochvil MJ, Seymour AJ, Li TL, Paşca SP, Kuo CJ, Heilshorn SC. Engineered materials for organoid systems. Nature Reviews Materials. 2019;4(9):606-22.\u003c/li\u003e\n\u003cli\u003eHughes CS, Postovit LM, Lajoie GA. Matrigel: a complex protein mixture required for optimal growth of cell culture. Proteomics. 2010;10(9):1886-90.\u003c/li\u003e\n\u003cli\u003eCurvello R, Alves D, Abud HE, Garnier G. A thermo-responsive collagen-nanocellulose hydrogel for the growth of intestinal organoids. Materials Science and Engineering: C. 2021;124:112051.\u003c/li\u003e\n\u003cli\u003eAisenbrey EA, Murphy WL. Synthetic alternatives to Matrigel. Nature Reviews Materials. 2020;5(7):539-51.\u003c/li\u003e\n\u003cli\u003eMagno V, Meinhardt A, Werner C. Polymer hydrogels to guide organotypic and organoid cultures. Advanced Functional Materials. 2020;30(48):2000097.\u003c/li\u003e\n\u003cli\u003eSchneeberger K, Spee B, Costa P, Sachs N, Clevers H, Malda J. Converging biofabrication and organoid technologies: the next frontier in hepatic and intestinal tissue engineering? Biofabrication. 2017;9(1):013001.\u003c/li\u003e\n\u003cli\u003ePeterson NC. From bench to cageside: risk assessment for rodent pathogen contamination of cells and biologics. ILAR journal. 2008;49(3):310-5.\u003c/li\u003e\n\u003cli\u003eLee S-Y, Hwang HJ, Lee DW. Optimization of 3D-aggregated spheroid model (3D-ASM) for selecting high efficacy drugs. Scientific Reports. 2022;12(1):18937.\u003c/li\u003e\n\u003cli\u003eRodr\u0026iacute;guez-Fraticelli AE, Mart\u0026iacute;n-Belmonte F. Methods for analysis of apical lumen trafficking using micropatterned 3D systems. Methods in cell biology. 118: Elsevier; 2013. p. 105-23.\u003c/li\u003e\n\u003cli\u003eChang Y-H, Wu K-C, Harnod T, Ding D-C. Comparison of the Cost and Effect of Combined Conditioned Medium and Conventional Medium for Fallopian Tube Organoid Cultures. Cell Transplantation. 2023;32:09636897231160216.\u003c/li\u003e\n\u003cli\u003eLee KY, Mooney DJ. Alginate: properties and biomedical applications. Progress in polymer science. 2012;37(1):106-26.\u003c/li\u003e\n\u003cli\u003eCapeling MM, Czerwinski M, Huang S, Tsai Y-H, Wu A, Nagy MS, et al. Nonadhesive alginate hydrogels support growth of pluripotent stem cell-derived intestinal organoids. Stem cell reports. 2019;12(2):381-94.\u003c/li\u003e\n\u003cli\u003eCavo M, Fato M, Pe\u0026ntilde;uela L, Beltrame F, Raiteri R, Scaglione S. Microenvironment complexity and matrix stiffness regulate breast cancer cell activity in a 3D in vitro model. Scientific reports. 2016;6(1):35367.\u003c/li\u003e\n\u003cli\u003eCavo M, Caria M, Pulsoni I, Beltrame F, Fato M, Scaglione S. A new cell-laden 3D Alginate-Matrigel hydrogel resembles human breast cancer cell malignant morphology, spread and invasion capability observed \u0026ldquo;in vivo\u0026rdquo;. Scientific reports. 2018;8(1):5333.\u003c/li\u003e\n\u003cli\u003eFang G, Lu H, Rodriguez de la Fuente L, Law AM, Lin G, Jin D, Gallego‐Ortega D. Mammary tumor organoid culture in non‐adhesive alginate for luminal mechanics and high‐throughput drug screening. Advanced Science. 2021;8(21):2102418.\u003c/li\u003e\n\u003cli\u003eDye BR, Decker JT, Hein RF, Miller AJ, Huang S, Spence JR, Shea LD. Human lung organoid culture in alginate with and without matrigel to model development and disease. Tissue Engineering Part A. 2022;28(21-22):893-906.\u003c/li\u003e\n\u003cli\u003eFerreira TC. Bladder Organoids: Theory and Practice of a 3D Culture Model: Universidade do Porto (Portugal); 2020.\u003c/li\u003e\n\u003cli\u003eWhyard T, Liu J, Darras FS, Waltzer WC, Romanov V. Organoid model of urothelial cancer: establishment and applications for bladder cancer research. Biotechniques. 2020;69(3):193-9.\u003c/li\u003e\n\u003cli\u003eNilforoushzadeh MA, Sisakht MM, Amirkhani MA, Seifalian AM, Banafshe HR, Verdi J, Nouradini M. Engineered skin graft with stromal vascular fraction cells encapsulated in fibrin-collagen hydrogel: A clinical study for diabetic wound healing. J Tissue Eng Regen Med. 2020;14(3):424-40.\u003c/li\u003e\n\u003cli\u003eSober SA, Darmani H, Alhattab D, Awidi A. Flow cytometric characterization of cell surface markers to differentiate between fibroblasts and mesenchymal stem cells of different origin. Arch Med Sci. 2023;19(5):1487-96.\u003c/li\u003e\n\u003cli\u003eMaarof M, Chowdhury SR, Saim A, Bt Hj Idrus R, Lokanathan Y. Concentration dependent effect of human dermal fibroblast conditioned medium (DFCM) from three various origins on keratinocytes wound healing. International journal of molecular sciences. 2020;21(8):2929.\u003c/li\u003e\n\u003cli\u003eLivak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402-8.\u003c/li\u003e\n\u003cli\u003eBarcel\u0026oacute; X, Eichholz KF, Garcia O, Kelly DJ. Tuning the degradation rate of alginate-based bioinks for bioprinting functional cartilage tissue. Biomedicines. 2022;10(7):1621.\u003c/li\u003e\n\u003cli\u003eWalz S, Pollehne P, Geng R, Schneider J, Maas M, Aicher WK, et al. A Protocol for Organoids from the Urine of Bladder Cancer Patients. Cells. 2023;12(17).\u003c/li\u003e\n\u003cli\u003eHoang P, Ma Z. Biomaterial-guided stem cell organoid engineering for modeling development and diseases. Acta Biomater. 2021;132:23-36.\u003c/li\u003e\n\u003cli\u003eSu J, Xu H, Sun J, Gong X, Zhao H. Dual delivery of BMP-2 and bFGF from a new nano-composite scaffold, loaded with vascular stents for large-size mandibular defect regeneration. Int J Mol Sci. 2013;14(6):12714-28.\u003c/li\u003e\n\u003cli\u003eKnowles MA, Hurst CD. Molecular biology of bladder cancer: new insights into pathogenesis and clinical diversity. Nat Rev Cancer. 2015;15(1):25-41.\u003c/li\u003e\n\u003cli\u003eMcConkey DJ, Choi W, Ochoa A, Dinney CP. Intrinsic subtypes and bladder cancer metastasis. Asian journal of urology. 2016;3(4):260-7.\u003c/li\u003e\n\u003cli\u003eElbadawy M, Fujisaka K, Yamamoto H, Tsunedomi R, Nagano H, Ayame H, et al. Establishment of an experimental model of normal dog bladder organoid using a three-dimensional culture method. Biomedicine \u0026amp; Pharmacotherapy. 2022;151:113105.\u003c/li\u003e\n\u003cli\u003eKnowles MA, Hurst CD. Molecular biology of bladder cancer: new insights into pathogenesis and clinical diversity. Nature reviews cancer. 2015;15(1):25-41.\u003c/li\u003e\n\u003cli\u003eCorr\u0026ograve; C, Novellasdemunt L, Li VS. A brief history of organoids. American Journal of Physiology-Cell Physiology. 2020;319(1):C151-C65.\u003c/li\u003e\n\u003cli\u003eLiu H, Wang Y, Cui K, Guo Y, Zhang X, Qin J. Advances in Hydrogels in Organoids and Organs‐on‐a‐Chip. Advanced Materials. 2019;31(50):1902042.\u003c/li\u003e\n\u003cli\u003eKaur S, Kaur I, Rawal P, Tripathi DM, Vasudevan A. Non-matrigel scaffolds for organoid cultures. Cancer Letters. 2021;504:58-66.\u003c/li\u003e\n\u003cli\u003eD\u0026rsquo;Costa K, Kosic M, Lam A, Moradipour A, Zhao Y, Radisic M. Biomaterials and culture systems for development of organoid and organ-on-a-chip models. Annals of biomedical engineering. 2020;48:2002-27.\u003c/li\u003e\n\u003cli\u003eRauth S, Karmakar S, Batra SK, Ponnusamy MP. Recent advances in organoid development and applications in disease modeling. Biochimica et Biophysica Acta (BBA)-Reviews on Cancer. 2021;1875(2):188527.\u003c/li\u003e\n\u003cli\u003eTortorella I, Argentati C, Emiliani C, Martino S, Morena F. The role of physical cues in the development of stem cell-derived organoids. European Biophysics Journal. 2022:1-13.\u003c/li\u003e\n\u003cli\u003eCherne MD, Sidar B, Sebrell TA, Sanchez HS, Heaton K, Kassama FJ, et al. A synthetic hydrogel, VitroGel\u0026reg; ORGANOID-3, improves immune cell-epithelial interactions in a tissue chip co-culture model of human gastric organoids and dendritic cells. Frontiers in Pharmacology. 2021;12:707891.\u003c/li\u003e\n\u003cli\u003eOotani A, Li X, Sangiorgi E, Ho QT, Ueno H, Toda S, et al. Sustained in vitro intestinal epithelial culture within a Wnt-dependent stem cell niche. Nature medicine. 2009;15(6):701-6.\u003c/li\u003e\n\u003cli\u003eOkita Y, Zheng L, Kawanishi K, Miyoshi H, Yanagihara K, Kato M. Polyvinyl alcohol scaffolds and supplementation support 3D and sphere culturing of human cancer cell lines by reducing apoptosis and promoting cellular proliferation. Genes Cells. 2021;26(5):336-43.\u003c/li\u003e\n\u003cli\u003eDavoudi Z, Peroutka-Bigus N, Bellaire B, Jergens A, Wannemuehler M, Wang Q. Gut organoid as a new platform to study alginate and chitosan mediated PLGA nanoparticles for drug delivery. Marine drugs. 2021;19(5):282.\u003c/li\u003e\n\u003cli\u003eHunt DR, Klett KC, Mascharak S, Wang H, Gong D, Lou J, et al. Engineered Matrices Enable the Culture of Human Patient-Derived Intestinal Organoids. Adv Sci (Weinh). 2021;8(10):2004705.\u003c/li\u003e\n\u003cli\u003eAndersen T, Auk-Emblem P, Dornish M. 3D cell culture in alginate hydrogels. Microarrays. 2015;4(2):133-61.\u003c/li\u003e\n\u003cli\u003eChooi WH, Ng CY, Ow V, Harley J, Ng W, Hor JH, et al. Defined Alginate hydrogels support spinal cord organoid derivation, maturation, and modeling of spinal cord diseases. Advanced Healthcare Materials. 2023;12(9):2202342.\u003c/li\u003e\n\u003cli\u003eLarsen M, Moskwa N, Jorgensen M, Ramesh P, Toro M, Evans E, et al. Alginate Hydrogel Microtubes for Salivary Gland Cell Organization and Cavitation. 2022.\u003c/li\u003e\n\u003cli\u003eMinoli M, Cantore T, Hanhart D, Kiener M, Fedrizzi T, La Manna F, et al. Bladder cancer organoids as a functional system to model different disease stages and therapy response. Nature Communications. 2023;14(1):2214.\u003c/li\u003e\n\u003cli\u003eSandvig I, Karstensen K, Rokstad AM, Aachmann FL, Formo K, Sandvig A, et al. RGD‐peptide modified alginate by a chemoenzymatic strategy for tissue engineering applications. Journal of biomedical materials research Part A. 2015;103(3):896-906.\u003c/li\u003e\n\u003cli\u003eBroguiere N, Isenmann L, Hirt C, Ringel T, Placzek S, Cavalli E, et al. Growth of epithelial organoids in a defined hydrogel. Advanced Materials. 2018;30(43):1801621.\u003c/li\u003e\n\u003cli\u003eCapeling MM, Czerwinski M, Huang S, Tsai YH, Wu A, Nagy MS, et al. Nonadhesive Alginate Hydrogels Support Growth of Pluripotent Stem Cell-Derived Intestinal Organoids. Stem Cell Reports. 2019;12(2):381-94.\u003c/li\u003e\n\u003cli\u003eSato T, Vries RG, Snippert HJ, Van De Wetering M, Barker N, Stange DE, et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 2009;459(7244):262-5.\u003c/li\u003e\n\u003cli\u003eVanDussen KL, Marinshaw JM, Shaikh N, Miyoshi H, Moon C, Tarr PI, et al. Development of an enhanced human gastrointestinal epithelial culture system to facilitate patient-based assays. Gut. 2015;64(6):911-20.\u003c/li\u003e\n\u003cli\u003eVanDussen KL, Sonnek NM, Stappenbeck TS. L-WRN conditioned medium for gastrointestinal epithelial stem cell culture shows replicable batch-to-batch activity levels across multiple research teams. Stem Cell Research. 2019;37:101430.\u003c/li\u003e\n\u003cli\u003eLiu R, Meng X, Yu X, Wang G, Dong Z, Zhou Z, et al. From 2D to 3D co-culture systems: a review of co-culture models to study the neural cells interaction. International journal of molecular sciences. 2022;23(21):13116.\u003c/li\u003e\n\u003cli\u003eMullenders J, de Jongh E, Brousali A, Roosen M, Blom JP, Begthel H, et al. Mouse and human urothelial cancer organoids: A tool for bladder cancer research. Proceedings of the National Academy of Sciences. 2019;116(10):4567-74.\u003c/li\u003e\n\u003cli\u003eJiang N, Tian X, Wang Q, Hao J, Jiang J, Wang H. Regulation Mechanisms and Maintenance Strategies of Stemness in Mesenchymal Stem Cells. Stem Cell Reviews and Reports. 2024;20(2):455-83.\u003c/li\u003e\n\u003cli\u003ePangjantuk A, Kaokaen P, Kunhorm P, Chaicharoenaudomrung N, Noisa P. 3D culture of alginate-hyaluronic acid hydrogel supports the stemness of human mesenchymal stem cells. Scientific Reports. 2024;14(1):4436.\u003c/li\u003e\n\u003cli\u003eSaid N. Establishing and characterization of human and murine bladder cancer organoids. Translational Andrology and Urology. 2019;8(Suppl 3):S310.\u003c/li\u003e\n\u003cli\u003eSanguedolce F, Russo D, Cal\u0026ograve; B, Cindolo L, Carrieri G, Cormio L. Diagnostic and prognostic roles of CK20 in the pathology of urothelial lesions. A systematic review. Pathology-Research and Practice. 2019;215(6):152413.\u003c/li\u003e\n\u003cli\u003eTian Y, Ma Z, Chen Z, Li M, Wu Z, Hong M, et al. Clinicopathological and prognostic value of Ki-67 expression in bladder cancer: a systematic review and meta-analysis. PloS one. 2016;11(7):e0158891.\u003c/li\u003e\n\u003cli\u003eKim S, Min S, Choi YS, Jo S-H, Jung JH, Han K, et al. Tissue extracellular matrix hydrogels as alternatives to Matrigel for culturing gastrointestinal organoids. Nature communications. 2022;13(1):1692.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Organoids, Bladder tumor, Alginate, Fibroblast conditioned medium ","lastPublishedDoi":"10.21203/rs.3.rs-4899481/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4899481/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eOrganoids as an aggregation of stem cells can recapitulate the function of organs in miniature form and have developed great potential for clinical translation, drug screening and personalized medicine over the last decade. Most organoids are currently cultured in basement membrane matrices (BMMs), which is hampered by xenogeneic origin, batch-to-batch variability, cost and complexity. In addition, organoid culture relies on biochemical signals provided by various growth factors in the composition of the medium. We have developed a method for culturing organoids from bladder tumors in a sodium alginate hydrogel scaffold in addition to fibroblast conditioned medium (FCM)-enriched culture medium that is inexpensive and easily amenable to clinical applications. Tumor organoids in Alginate and FCM based medium grow in comparable to those cultured in BMMs and standard medium. The organoids express specific bladder organoid markers containing CK14, CK20, LGR5, Uroplakin III, FOX1A, GATA3, CK5 and CK44 and the proliferation potential showed by confocal microscopy. The results indicate that alginate is very promising for early passage human bladder organoid culture with increase the scalability potential. Furthermore, using FCM based medium as an alternative solution can be consider, especially for low-resource situation and to develop cost effective tumor organoids.\u003c/p\u003e","manuscriptTitle":"Cost-Reduction Strategy to Culture Patient Derived Bladder Tumor Organoids","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-15 07:51:01","doi":"10.21203/rs.3.rs-4899481/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-10-28T05:17:37+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-27T11:48:48+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-24T01:35:38+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"278221563176089398627073322146214883811","date":"2024-10-21T06:58:54+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"197013167972333800398783758886152863547","date":"2024-10-17T01:28:36+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-10-15T01:02:20+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-10-15T00:57:15+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-08-22T09:52:45+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-08-21T12:22:49+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-08-12T09:53:15+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"11501f1e-1539-46ff-a421-15416af32f47","owner":[],"postedDate":"October 15th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":37708707,"name":"Biological sciences/Biological techniques"},{"id":37708708,"name":"Biological sciences/Cancer"},{"id":37708709,"name":"Biological sciences/Stem cells"},{"id":37708710,"name":"Health sciences/Oncology"},{"id":37708711,"name":"Health sciences/Urology"},{"id":37708712,"name":"Physical sciences/Materials science"}],"tags":[],"updatedAt":"2025-02-10T16:13:14+00:00","versionOfRecord":{"articleIdentity":"rs-4899481","link":"https://doi.org/10.1038/s41598-025-87509-3","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-02-04 15:57:12","publishedOnDateReadable":"February 4th, 2025"},"versionCreatedAt":"2024-10-15 07:51:01","video":"","vorDoi":"10.1038/s41598-025-87509-3","vorDoiUrl":"https://doi.org/10.1038/s41598-025-87509-3","workflowStages":[]},"version":"v1","identity":"rs-4899481","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4899481","identity":"rs-4899481","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.