DNA methylation regulation of CYP450-lipid metabolism by high-altitude hypoxia: linking neuroinflammation to cognitive impairment

DNA methylation regulation of CYP450-lipid metabolism by high-altitude hypoxia: linking neuroinflammation to cognitive impairment | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article DNA methylation regulation of CYP450-lipid metabolism by high-altitude hypoxia: linking neuroinflammation to cognitive impairment Qian Wang, Junjun Han, Guiqin Liu, Yabin Duan, Delong Duo, Junbo Zhu, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7565540/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 20 Mar, 2026 Read the published version in Journal of Neuroinflammation → Version 1 posted 11 You are reading this latest preprint version Abstract Under high-altitude hypoxia, neuroinflammation contributes to cognitive impairment, though the underlying mechanisms remain unclear. In this study, we established rat and astrocyte models of hypoxic exposure. We found that hypoxia induced significant alterations in blood biochemistry, widespread neuronal and glial damage, and impaired spatial learning and memory in rats, which were associated with the abnormal accumulation of p-Tau and Aβ. Hypoxia also triggered neuroinflammation, increasing the levels of inflammatory mediators and activating microglia and astrocytes. Targeted metabolomics and molecular analyses revealed disrupted oxidized lipid metabolism, including reduced synthesis of key metabolites such as arachidonic acid derivatives, accompanied by downregulation of cytochrome P450 (CYP450) expression. In vitro, hypoxia enhanced astrocyte inflammation, promoted Aβ/p-Tau accumulation, increased apoptosis, and suppressed CYP450. Inhibiting CYP450, especially epoxygenase, exacerbated hypoxia-induced inflammation and protein aggregation. Furthermore, CYP450 downregulation was associated with DNA methylation changes. These findings highlight the role of DNA methylation-mediated CYP450 and oxidative lipid metabolic dysregulation in hypoxia-induced neuroinflammation and cognitive deficits, offering new insights for the development of neuroprotective strategies targeting the CYP450-oxidized lipid axis. Cognitive impairment neuroinflammation oxidized lipid high-altitude hypoxia cytochrome P450 DNA methylation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 1. Introduction High-altitude environments are characterized by low oxygen levels. The reduction in oxygen partial pressure leads to decreased tissue oxygen utilization, which ultimately disrupts the body's internal balance. Consequently, for travelers at high altitudes, mountaineers, and special military personnel in high-altitude regions, hypoxia is the primary source of physiological harm. High-altitude hypoxia can inflict considerable harm on the respiratory, cardiovascular, and circulatory systems, along with the central nervous system (CNS), with especially pronounced consequences. Although comprising merely 2% of total body weight, brain tissue utilizes up to 20% of the body's total oxygen, rendering it highly susceptible to hypoxic conditions [ 1 ]. Exposure to mild hypoxia can induce a series of adverse neurological reactions. These initially manifest primarily as emotional disorders, such as anxiety and depression, accompanied by the activation of oxidative stress and neuroinflammatory responses. These changes can lead to alterations in synaptic plasticity and damage the microstructure of the brain, which can ultimately result in cognitive decline. As the severity of hypoxia increases or the exposure time is prolonged, these pathological changes may progress to high-altitude-specific brain injury. This can include high-altitude headache (HAH), acute mountain sickness (AMS), and, in severe cases, potentially fatal high-altitude cerebral edema (HACE) [ 2 , 3 ]. The brain possesses a high concentration of polyunsaturated fatty acids (PUFAs), rendering brain tissue particularly vulnerable to lipid metabolism abnormalities in hypoxic settings, thereby facilitating the onset of hypoxic neurological impairment [ 4 , 5 ]. Bioactive lipid mediators originating from the metabolism of arachidonic acid (AA) and associated PUFAs are termed oxidized lipids. These lipids are predominantly synthesized via three metabolic pathways: oxidation by cyclooxygenases (COX-1 and COX-2), yielding prostaglandins (PGs) and thromboxane compounds (TXs); oxidation by lipoxygenase (LOX), resulting in leukotrienes, lipoxins (LXs), and hydroxy-eicosatetraenoic acids (HETEs); and metabolism by cytochrome P450 (CYP450), producing eicosapentaenoic acids (EETs) and HETEs. Oxidized lipids exist throughout the body as free radicals. They influence cellular functions through autocrine or paracrine processes by binding to G protein-coupled receptors (GPCRs) or nuclear receptors located on cell membrane surfaces [ 6 , 7 ]. These oxidized lipids can elicit a diverse array of biological consequences. As principal regulators of disease pathology and significant mediators of inflammatory responses, they regulate diverse activities, including sleep, memory, learning functions, neuroinflammatory responses, and neurodegenerative and neuropsychiatric diseases [ 8 , 9 ]. Consequently, oxidized lipids are regarded as biomarkers that can clarify the phases of tissue damage and disease progression. CYP450 is a crucial catalytic enzyme in lipid oxidation synthesis whose expression is directly influenced by hypoxia. Its metabolites, including EETs and HETEs, have been demonstrated to play a role in regulating brain function under hypoxic conditions by modulating vascular tension and inflammatory responses [ 10 , 11 ]. However, there is no direct evidence that the CYP450-oxidized lipid axis facilitates the cognitive impairment and neuroinflammation associated with high-altitude hypoxia. Epigenetic regulation, particularly DNA methylation, may be a key link between hypoxic stress and the dysregulation of CYP450 expression. DNA methylation refers primarily to the process by which methyl groups are added to the C5 position of the cytosine ring within CpG dinucleotides via DNA methyltransferases. The promoter regions of several CYP450 genes, such as CYP1A2 , CYP2E1 , CYP2C9 , CYP2C19 , and CYP3A4 , contain CpG island structures, making their expression highly susceptible to dynamic regulation by DNA methylation [ 12 – 14 ]. Recently, numerous studies have shown that hypoxic stress can significantly induce genome-wide reprogramming of DNA methylation, thereby affecting gene expression patterns. This epigenetic regulatory mechanism is important for the body's adaptation to hypoxia [ 15 , 16 ]. Notably, previous studies have confirmed the abnormal methylation of specific CYP450 promoter regions, such as that of CYP2S1, under hypoxic conditions [ 17 ]. Nonetheless, whether DNA methylation also affects the expression of additional CYP450 members under hypoxic conditions remains to be further examined. This study employed ultrahigh-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) technology combined with animal behavioral assessment and epigenetic detection to systematically investigate the cascading regulatory mechanism of the DNA methylation-CYP450-oxidized lipid axis in hypoxia-induced brain injury on the basis of the above scientific questions. These findings not only bridge a knowledge gap regarding the molecular processes of brain damage caused by high-altitude hypoxic environments but also provide a crucial theoretical foundation for the development of neuroprotective treatments aimed at the CYP450-oxidized lipid pathway. 2. Materials and methods 2.1. Chemicals and reagents All oxidized lipid standards were purchased from Cayman Chemical (Ann Arbor, MI, USA). Enzyme-linked immunosorbent assay (ELISA) kits for HIF-1α, IL-6, NF-κB, iNOS, TNF-α, IL-1β, and 5-mC were obtained from Shanghai Kexing Trading (Shanghai, China). The following primary antibodies were used: polyclonal amyloid-β (Aβ) (Immunoway, Cat: YT0226, Plano, TX, USA); polyclonal phospho-Tau (p-Tau) (Bioss, Cat: bs-3489R, Beijing, China); monoclonal ionophore-binding protein 1 (IBA1) (zenbio, Cat: R382207, Chengdu, China); glial fibrillary acidic protein (GFAP) (Servicebio, Cat: GB11096, Wuhan, China); polyclonal β-actin (Immunoway, Cat: YT0099, Plano, TX, USA); polyclonal CYP2C23 (Proteintech, Cat: 16546-1-AP, Wuhan, China); polyclonal CYP2J3 (Proteintech, Cat: 13562-1-AP, Wuhan, China); polyclonal CYP211 (Biorbyt, Cat: Orb5951, Cambridge, UK); polyclonal CYP4F1 (Biorbyt, Cat: Orb214800, Cambridge, UK); monoclonal CYP2C22 (Abcam, Cat: Ab137015, Cambridge, UK); and monoclonal CYP4A2 (Abcam, Cat: Ab140635, Cambridge, UK). The RNA extraction kit (Cat: R30922), ReverTra Ace qPCR RT Master Mix (Cat: Q20620), and TransScript One-Step gDNA Removal and cDNA Synthesis Kit (Cat: R10905) were purchased from TransGen Biotech (Beijing, China). An Annexin V-FITC/PI cell apoptosis detection kit (Cat: G1511) was purchased from Servicebio (Wuhan, China). A rapid DNA extraction kit (Cat: B518221) was purchased from Sangon Biotech (Shanghai, China). The EZ DNA Methylation-Gold™ kit (Cat: D5005) was purchased from ZYMO RESEARCH (CA, USA). The 17-ODYA (Cat: HY-101016), MS-PPOH (Cat: HY-114759), and 5-azacitidine-2'-deoxycytidine (5-Aza-dC) (Cat: HY-A0004) were purchased from MedChemExpress (Monmouth Junction, NJ, USA). 2.2. Treatment of animals Male Sprague Dawley rats weighing 180–220 g were obtained from the Laboratory Animal Center of Xi'an Jiaotong University Medical College (License No. SCXK (Shaanxi) 2023–002). All the rats were housed in separate rooms per cage with a constant temperature (22 ± 2°C), constant humidity (55 ± 10%), and a 12 h light/12 h dark cycle. All experimental procedures were performed in strict accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and the protocol was approved by the Animal Ethics Committee of Qinghai University (Approval No. PJ-202302-12). The rats were randomly divided into four groups: a low-altitude control group (LAC, Xi'an City, Shaanxi Province, altitude: 390 m, PaO 2 : 20.2 kPa); a high-altitude hypoxia for 7 days group (HAH-7), a high-altitude hypoxia for 30 days group (HAH-30), and a high-altitude hypoxia for 90 days group (HAH-90). The HAH groups were housed in Maduo County, Guoluo Tibetan Autonomous Prefecture, Qinghai Province, China (altitude: 4,300 m, PaO 2 : 12.4 kPa) for the corresponding durations. The samples were promptly frozen and preserved in liquid nitrogen after post-collection before being dispatched to the Plateau Medicine Research Center at Qinghai University for analysis. 2.3. Morris water maze (MWM) experiment The MWM apparatus is a circular pool with a height of 50 cm, a diameter of 180 cm, and a depth of 30 cm. The water temperature in the MWM test was maintained at 22 ± 1°C. The pool was partitioned into four equal quadrants, featuring a circular platform with a diameter of 10 cm positioned at the center of quadrant 2 and submerged 2 cm beneath the water surface. The pool was surrounded by sufficient visual cues to serve as references. The actions of the rats in the water maze were recorded via the BAS-100 animal behavioral experiment analysis system (TECHMAN, Chengdu, China). Acquisitive training was conducted for 5 days, 4 times per day, in which the rats were sequentially placed into the water from the first, second, third, and fourth quadrants facing the wall of the pool, and the time it took for the rats to find a safe platform was recorded; if the rats did not find the platform within 2 min, they were guided to the platform for 20 s. The day after the final acquisition training session, the platform was removed and the rats were allowed to explore freely. The rats were placed in the water from the opposite side to the original location of the platform and were allowed to swim freely for 120 s (Fig. 3 A). The time spent in the quadrant where the platform was located, the average swimming speed, the number of times the rats entered the platform area, and the path of movement were recorded to test the ability of the rat to memorize space. 2.4. Determination of physiological and biochemical indices The rats in each group were anesthetized via an intraperitoneal injection of 20% urethane (1 g/kg) before blood collection. 1 mL of whole blood was drawn from the main abdominal vein into an anticoagulant tube containing EDTA-K 2 , and the following routine blood parameters were measured via an XN-10 automatic hematology analyzer (Sysmex Corporation, Tokyo, Japan): red blood cell count (RBC), hemoglobin (HGB), white blood cell count (WBC), platelet count (PLT), hematocrit (HCT), mean corpuscular volume (MCV), and mean platelet volume (MPV). 2 mL of whole blood was centrifuged in a tube without anticoagulant and centrifuged, and the serum was extracted. The following blood biochemical parameters were measured via an AU5800 automatic biochemistry analyzer (Olympus Corporation, Tokyo, Japan): alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), total protein (TP), albumin (ALB), lactate dehydrogenase (LDH), total bilirubin (TBIL), globulin (GLOB), uric acid (UA), creatinine (CREA), glucose (GLU), cholesterol (CHOL), and triglycerides (TG). 2.5. Hematoxylin-eosin (HE) staining The rats were anesthetized via the intraperitoneal injection of 20% urethane (1 g/kg). The abdominal cavity of each animal was exposed with surgical scissors and forceps to reveal the heart. A needle was inserted into the right atrium, and the sinusoidal vein was clamped with arterial forceps. The animals were then perfused with saline (for approximately 30 min) until their livers turned white and then with 4% paraformaldehyde until their livers hardened and their tails stiffened. After complete fixation, the head of the rat was cut off, and the brain was removed. The rat brains were soaked in 4% paraformaldehyde for 1 day, then dehydrated, paraffin-embedded, sectioned (5 µm), and stained with hematoxylin and eosin, and placed under a Pannoramic 250 digital section scanner (3DHISTECH, Hungary) for image acquisition of the sections. 2.6. Nissl staining Rat brain tissues fixed with 4% paraformaldehyde were taken, paraffin-embedded, and sectioned. The samples were stained with 1% toluidine blue at 56°C for 20 min, soaked in 70% alcohol for 1 min, and differentiated in 95% alcohol until the positive expression was shown clearly. The tissues were subsequently dehydrated in 75%, 85%, 95%, and 100% ethanol, each for 1 min, and then blocked with a neutral resin after transparency was achieved using xylene. The sections were positioned under a Pannoramic 250 digital section scanner (3DHISTECH, Hungary) for image acquisition. 2.7. Transmission electron microscopy (TEM) Samples prefixed with 3% glutaraldehyde were refixed with 1% osmium tetroxide, dehydrated in series with acetone, infiltrated with Epox 812 for a longer time, and embedded. The semithin sections were stained with methylene blue, and the ultrathin sections were cut with a diamond knife and stained with uranyl acetate and lead citrate. The sections were examined with a JEM-1400FLASH transmission electron microscope (JEOL, Tokyo, Japan). 2.8. Immunohistochemical analysis Rat brain tissues fixed with 4% paraformaldehyde were paraffin-embedded and sectioned. The sections were immersed in citrate buffer (pH 6.0) for antigen retrieval, subsequently followed by endogenous peroxidase blocking with 3% hydrogen peroxide at room temperature in the dark. Following three washes with PBS, the sections were blocked with bovine serum at room temperature for 20 min. The primary antibody was subsequently applied and incubated overnight at 4°C. After being washed with PBS, the sections were incubated with the secondary antibody at 37°C for 30 min and rewashed with PBS. DAB was used for chromogenic detection, and hematoxylin was used for restaining. The sections were dehydrated via a graded ethanol series, cleared in xylene, and subsequently mounted with neutral resin. Finally, images were acquired using a BA400 digital microscopy imaging system (Motic, Xiamen, China). 2.9. Targeted oxidized lipid metabolomics analysis Each group of rats was euthanized by decapitation, and their brains were swiftly collected and stored at -80°C. 50 mg of rat brain tissue was weighed accurately. After the addition of 600 µL of extract solution (80% methanol/H 2 O (v/v), precooled at -40°C, containing an isotopically labeled internal standard mixture), homogenize and sonicate in an ice bath. Then, an aliquot of the supernatant was transferred to an EP tube, and water was added. After vortexing for 30 s, the sample was further purified with SPE. The SPE cartridges were equilibrated with 1 mL of MeOH and 1 mL of water. After loading a sample, the samples were eluted with MeOH, and then the eluent was evaporated to dryness under a gentle stream of nitrogen and reconstituted in 30% ACN/H 2 O (v/v). After vortexing the recombinant solution, homogenize it using ultrasound. After centrifugation, transfer the recombinant solution to an EP tube with a filter membrane and centrifuge again. Take the supernatant for UHPLC-MS/MS analysis. The UHPLC separation was carried out using an ACQUITY Premier (Waters, Milford, Massachusetts, USA), equipped with a Waters ACQUITY UPLC BEH C18 column (150 × 2.1 mm, 1.7 µm, Waters). The mobile phase A was 0.01% formic acid in water, and the mobile phase B was 0.01% formic acid in acetonitrile. The column temperature was set at 50°C. The autosampler temperature was set at 4°C, and the injection volume was 10 µL. A SCIEX Triple Quad™ 6500 + mass spectrometer (Sciex), equipped with an IonDrive Turbo V electrospray ionization (ESI) interface, was applied for assay development. Typical ion source parameters were as follows: curtain gas = 40 psi, ion spray voltage = -4500 V, temperature = 500°C, ion source gas 1 = 30 psi, and ion source gas 2 = 30 psi. SCIEX Analyst Work Station Software (Version 1.6.3) and Multiquant 3.03 software were employed for MRM data acquisition and processing. 2.10. Cell culture Neonatal rats were decapitated after alcohol disinfection. The brains were isolated in cold dissection buffer, and the vascular membrane was removed. The tissue was minced and digested with 0.25% EDTA-free trypsin, followed by serum-containing medium to terminate digestion. After filtration through a 70 µm mesh, the cell suspension was centrifuged and resuspended in DMEM/F12 with 20% FBS. The cells were seeded at 1×10 6 /mL in polylysine-coated T25 flasks and cultured. Astrocytes were identified via fluorescence microscopy. They were then cultured in an incubator set at 37°C, 5% CO 2 , and 90% relative humidity. Once the cells reached the optimal culture conditions, the control group was treated with normal oxygen, while the hypoxia group was treated with 2% O 2 for 3, 6, 12, 24, and 48 h. 2.11. Immunofluorescence analysis The cell smears were fixed with 4% paraformaldehyde and then washed with a PBS buffer solution. The slides were incubated in a wet box with blocking serum at 37°C for 60 min to prevent nonspecific binding. Following the blocking, the primary antibody was applied at the appropriate concentration, and the slides were subsequently incubated overnight at 4°C. Following PBS washing, the fluorescently labeled secondary antibody was applied, and the slides were incubated at 37°C in the dark for 1 h. Subsequently, another wash with PBS was conducted. DAPI solution was added dropwise, and the samples were incubated in the dark for 10 min to stain the nuclei. The samples were subsequently washed with PBS, mounted with glycerol, and observed and imaged immediately under a DM3000 fluorescence microscope (Leica, Germany). 2.12. Flow cytometry Following digestion with pancreatic enzymes, the mixture was centrifuged to isolate the cells. Following washing with PBS, the cells were resuspended in prechilled 1× binding buffer. The cell concentration was modified, and Annexin V-FITC and PI were added. The mixture was mixed gently and incubated at room temperature in the dark for 10 min. Subsequently, prechilled 1× binding buffer was added, and immediate analysis was conducted with a BeamCyte-1026 flow cytometer (BeamCyte Biotechnology, Changzhou, China). 2.13. ELISA Rat brain tissue samples were minced and added to cold physiological saline, homogenized in an ice bath, and centrifuged at 3000 rpm for 10 min, after which the supernatant was collected. Astrocytes were centrifuged at 3000 rpm for 10 min to remove particles and polymers, and the supernatant was collected. The tissue homogenate and cell supernatant were then subjected to ELISA testing according to the manufacturer's experimental instructions. 2.14. Western blot Total protein was extracted from the brains of rats and astrocytes using RIPA lysis, and the bicinchoninic acid method was used for protein quantification. SDS-PAGE was used to separate the protein samples, which were subsequently transferred onto a polyvinylidene difluoride (PVDF) membrane. The PVDF membrane was immersed in TBST containing 5% skim milk powder and blocked on a room temperature shaker for 2 h. The corresponding primary antibodies were diluted with the blocking solution, as followes: CYP2C23 (1:2000), CYP2C11 (1:1000), CYP2C22 (1:1000), CYP2J3 (1:2000), CYP4A2 (1:4000), CYP4F1 (1:500), and β-actin (1:1000), and the PVDF membrane was immersed in the primary antibody incubation solution and incubated at 4°C overnight. The PVDF membrane was washed with TBST 5 times and incubated with appropriate secondary antibodies for 2 h at room temperature. The PVDF membrane was washed with TBST 5 times. The membranes were imaged using an Amersham Imager 600 ELC system (General Electric, Boston, USA). 2.15. Quantitative real-time polymerase chain reaction (RT‒qPCR) Total RNA from rat brain tissue and astrocytes was extracted according to the kit instructions, and the purity of the RNA solution was checked using a NanoDrop 2000c spectrophotometer (Thermo, USA). The cDNA was synthesized by reverse transcription using the TransScript One-Step gDNA Removal and cDNA Synthesis Supermix Kit. The cDNA product from reverse transcription was amplified in three steps using a Roche Light Cycler 96 Real-Time Fluorescent Quantitative PCR Instrument (Roche, Switzerland), with the following reaction procedure: 94°C for 30 s, followed by 94°C for 5 s, 50 ‒ 60°C for 15 s, and 72°C for 10 s, and the lysis curve was added after 45 cycles. The relative expression of the target gene was expressed as the 2 −ΔΔCt value of the target protein and β-actin. The amplification primers for the target and internal reference genes are listed in Table 1 . Table 1 Design and sequence of the primers. Genes Primer Oligonucleotide primer sequences(5′-3′) β-actin Forward CTGAACGTGAAATTGTCCGAGA Reverse TTGCCAATGGTGATGACCTG CYP2C23 Forward TGCCCTACACAGATGCCATG Reverse AATGTCACAGGTCACCGCAT CYP2C11 Forward TGTTTGACCCTGGCCACTTT Reverse CCTCTCCAACACAAGCTCGT CYP2C22 Forward GAGGACTTTTGGGATGGGCA Reverse AAGGTGGGATCAAAAGGGGC CYP2J3 Forward CTACATGGCCCTCTACGCAG Reverse GACGGCATTGGTATAGGGCA CYP4A2 Forward CAGGTCCTACACCAAGGCTG Reverse GACAAACGGCCATCAGAGGA CYP4F1 Forward ACCCTGCTACTGTTTGGAGC Reverse GAGTGACCATGCCCACATGA DNMT1 Forward CGGACGGAGTAAACAGGCTT Reverse ACTCGCCTACAAGGAACAGC DNMT3a Forward GATGAGCCTGAGTATGAGGATGG Reverse CAAGACACAATTCGGCCTGG DNMT3b Forward AGCGGGTATGAGGAGTGCAT Reverse GGGAGCATCCTTCGTGTCTG MeCP2 Forward ATGGTAGCTGGGATGTTAGGG Reverse TGAGCTTTCTGATGTTTCTGCTT 2.16. Bisulfite-sequencing PCR (BSP) DNA was extracted from rat brain tissue using a rapid DNA extraction kit. Using the MethPrimer online tool ( http://www.urogene.org/methprimer/ ), CpG islands were predicted based on the rat CYP2C11 gene sequence, and BSP primers were designed. The upstream primer sequence was 5'-AATGTAGGTAATAAAAGTAAAATTTTAAG-3' and the downstream primer sequence was 5'-ACAAAAACTCTAACTCCTCTTTCAAA-3'. The PCR amplification process was as follows: 95°C predenaturation for 5 min, followed by 35 cycles of 94°C denaturation for 30 s, 55°C annealing for 30 s, and 72°C extension for 40 s, with a final extension at 72°C for 8 min. After amplification, the PCR products were purified by gel electrophoresis and ligated into the pUC18-T vector system. The ligation reaction was incubated overnight at 16°C, followed by transformation into competent cells. The bacteria were cultured overnight at 37°C on plates containing ampicillin that had been pre-coated with 100 mM IPTG and 20 mg/mL X-gal. PCR was performed using a single colony as a template. The resulting bands were then purified and recovered for first-generation sequencing. The obtained sequences were analyzed via the quantitative methylation analysis tool (QUMA; https://www.quma.cdb.riken.jp/ ). 2.17. Data analysis Data were processed using SPSS 27.0 statistical software, and results were expressed as mean ± standard deviation (SD). Comparisons between groups were made by one-way analysis of variance (ANOVA), and two-by-two comparisons were made using the least significant difference method (LSD). P < 0.05 indicates a statistically significant difference. 3. Results 3.1. High-altitude hypoxia induces neuroinflammation and cognitive impairment 3.1.1. Physiological and biochemical parameters and histomorphological changes in rats under high-altitude hypoxia High-altitude hypoxia significantly affected the hematological and biochemical parameters in rats. A routine blood analysis indicated time-dependent variations in the HAH group relative to the LAC group. HGB, RBC, and HCT levels exhibited a gradual increase in the HAH-7, HAH-30, and HAH-90 groups, whereas WBC levels showed a consistent decline. Furthermore, the MCV significantly decreased in the HAH-90 group, whereas the MPV significantly increased in both the HAH-7 and HAH-90 groups (Fig. 1 A). These alterations may be linked to oxidative stress induced by hypoxia, immune regulation, and erythropoiesis. The biochemical parameters indicated that, in comparison to the LAC group, the levels of ALP, GLU, and TG gradually decreased in the HAH-7, HAH-30, and HAH-90 groups. In contrast, the level of CRP gradually increased. ALT, AST, TBIL, and ALB significantly increased in the HAH-90 group, whereas TP, GLOB, and LDH significantly increased in both the HAH-30 and HAH-90 groups. CREA exhibited dynamic changes: a decrease was observed in the HAH-7 group, whereas increases were noted in the HAH-30 and HAH-90 groups (Fig. 1 B). Those findings suggest that high-altitude hypoxia impacts metabolic and organ functions in rats. The HE staining results indicated that the soft meningeal structure of the brain tissue from the LAC group remained intact and rich in blood vessels, exhibiting no significant inflammatory exudation. The cortical and hippocampal regions had dense and neatly arranged pyramidal cells. In the HAH group, as the duration of hypoxia increased, the cell bodies of dark-colored neurons in the cortical and hippocampal regions gradually decreased in size, their color gradually darkened, and their internal structures became blurred. Distinct axon-like structures were observed at the posterior region of the cell bodies (Fig. 2 A). Further Nissl staining of neurons revealed that those in the hippocampus region of the brains of rats in the LAC group exhibited a similar morphology, with plump neurons arranged in a regular pattern and distributed uniformly. Their cytoplasm contained abundant tiger-striped bodies and granular Nissl bodies. In contrast, rats exposed to a high-altitude hypoxic environment exhibited a sparse distribution of neurons in brain tissue, altered morphology, and indistinct nuclear morphology. The number of Nissl bodies in surviving neurons was reduced. Furthermore, the extent of neuronal damage worsened as the duration of hypoxia increased. Nissl-positive neuronal counts indicated that, compared with the LAC group, the HAH-90 group exhibited a significant reduction in positive neurons (Fig. 2 B). TEM revealed that the morphological structure of microglia and astrocytes in the hippocampus and cortical regions of the LAC group was normal and that the structure of neurons and synapses was intact. However, under high-altitude hypoxic conditions, significant pathological changes were observed in these cells: the perinuclear spaces of microglia were widened, their mitochondria were swollen with matrix dissolution and reduced electron density, and their rough endoplasmic reticulum was expanded with ribosomal detachment. Astrocytes exhibit similar mitochondrial damage, accompanied by increased autophagosomes and glial filaments. The neurons exhibited cell body shrinkage, widened perinuclear spaces, and abnormal chromatin. The synaptic structures were markedly abnormal, characterized by a reduced contact area between the presynaptic and postsynaptic membranes, thickening of the postsynaptic dense structures, blurred gaps, and fewer synaptic vesicles (Fig. 2 C). These findings indicate that high-altitude hypoxia results in extensive damage to neurons and glial cells in brain tissue. 3.1.2. High-altitude hypoxia induces learning and memory impairment in rats The MWM test is the most prevalent laboratory behavioral test for evaluating cognitive impairments in rodents. During the hidden platform test, the escape latency of the HAH-30 group significantly increased on days 2 and 5, and that of the HAH-90 group significantly increased on days 2, 3, 4, and 5 (Figs. 3 B and 3 F). In the probe test, compared with the LAC group, the HAH-7, HAH-30, and HAH-90 groups presented a significant reduction in the number of times they crossed the platform, and the HAH-7 and HAH-90 groups presented a significant reduction in the time spent in the target quadrant. The average swimming speed of the hypoxic groups did not differ significantly from that of the LAC group (Figs. 3 C, 3 D, 3 E, and 3 G). These findings demonstrate that high-altitude hypoxia impairs learning and memory in rats, with longer exposure durations correlating with more pronounced effects on these cognitive functions. The deposition of Aβ and the hyperphosphorylation of Tau proteins can induce neurofibrillary tangles, leading to cognitive impairment via processes such as neuroinflammation and oxidative stress. Immunohistochemical analysis revealed that, compared with the LAC group, the levels of p-Tau and Aβ were significantly higher in the brain tissue of rats in the HAH-7, HAH-30, and HAH-90 groups (Fig. 3 H). These findings suggest that exposure to hypoxia significantly enhances the accumulation of pathological proteins linked to cognitive impairment. 3.1.3. High-altitude hypoxia induces neuroinflammation in rats This study examined the influence of hypoxia on neuroinflammation by quantifying the expression levels of hypoxia-inducible factor (HIF-1α), proinflammatory cytokines (IL-6, IL-1β, and TNF-α), and inflammatory regulatory factors (NF-κB and iNOS) in rat brain tissue. The findings indicated that, in contrast to those in the LAC group, the levels of HIF-1α in rat brain tissue were significantly elevated after exposure to a high-altitude hypoxic environment, confirming the occurrence of hypoxic stress. Moreover, the levels of IL-1β, IL-6, TNF-α, NF-κB, and iNOS were dramatically increased, with more pronounced alterations observed as the duration of hypoxia increased (Fig. 4 A), indicating the activation of the inflammatory response under hypoxic conditions. To further investigate the regulatory role of hypoxia in neuroinflammation, immunohistochemistry was used to determine the expression of the microglial marker IBA1 and the astrocyte marker GFAP in brain tissue. The findings indicated that, in comparison with the LAC group, the HAH-7, HAH-30, and HAH-90 groups presented substantial increases in IBA1-positive cell counts. The HAH-30 and HAH-90 groups presented an increase in GFAP-positive cell counts (Fig. 4 B). These results indicate that high-altitude hypoxia promotes the expression of inflammatory factors and the inflammatory activation of glial cells. 3.2. High-altitude hypoxia induces lipid metabolism disorders and downregulates CYP450 expression in rat brain tissue 3.2.1. High-altitude hypoxia induces lipid metabolism disorders in rat brain tissue To investigate the role of oxidized lipids in hypoxia-induced neuroinflammation and cognitive impairment, this study employed targeted metabolomics to systematically analyze the differential profiles of oxidized lipids in rat brain tissues. Principal component analysis (PCA) was used to preliminarily examine the metabolite levels in each sample. The results revealed that the levels of oxidized lipid metabolites were relatively similar within each group. Additionally, as the duration of hypoxia increased, the three groups of rats exposed to high-altitude hypoxia trended to shift to the right in the PCA plot (Fig. 5 A). Further analysis using orthogonal partial least squares discriminant analysis (OPLS-DA) revealed no overlap between the LAC group and the HAH-30 and HAH-90 groups, with significant differences and clear distinctions (Fig. 5 B). These findings suggest that the levels of oxidized lipid metabolites in the samples undergo regular changes with prolonged hypoxia, and these changes are sufficient to serve as biomarkers distinguishing normal from hypoxic states. A total of 72 differentially expressed metabolites were detected through targeted oxidized lipidomes (Table 2 ), including ± 8-HDoHE, 9-OxoODE, ± 18-HETE, 8S,15S-DiHETE, and 16S-HETE, which were the five metabolites co-upregulated in the HAH-7, HAH-30, and HAH-90 groups. There were 51 co-downregulated metabolites, including 12S-HEPE, 15S-HEPE, ± 5,6-DiHETrE, 13S-HOTrE, 15-keto PGF1α, 8-iso PGF2α, 19S-HETE, EPA, and 13,14-dihydro-15-keto PGD2, among others. Based on PUFA substrates, these metabolites can be grouped into 44 ARA metabolites, 12 DHA metabolites, 7 LA metabolites, 4 DGLA metabolites, 3 EPA metabolites, and 2 ALA metabolites. Based on metabolic pathways, these metabolites can be classified into 20 CYP450 metabolites, 29 LOX metabolites, 19 COX metabolites, and 4 metabolites from other pathways. Table 2 Table of differential metabolite statistics Group Cpd_all Cpd_up Cpd_down LAC-HAH-7 72 14 58 LAC-HAH-30 72 12 60 LAC-HAH-90 72 13 59 Note: LAC, HAH-7, HAH-30, and HAH-90 refer to the low-altitude control group, high-altitude hypoxia 7-day group, high-altitude hypoxia 30-day group, and high-altitude hypoxia 90-day group. Following bidirectional cluster analysis of the samples and metabolic products, the heatmap clearly revealed distinct color blocks clustered in different regions. This finding indicates that oxidative lipid metabolism disorders are present in rat models of hypoxia-induced cognitive impairment and neuroinflammation, as manifested by the widespread downregulation of most PUFA metabolites (Fig. 5 C). Further KEGG pathway annotation of the measured metabolites revealed that the differentially metabolized oxidized lipids in rat brain tissue under hypoxia were enriched primarily in the AA metabolic pathway (Fig. 5 D). Univariate statistical analysis of the metabolites identified 25 AA pathway metabolites with P < 0.05 in the U-test. These metabolites were categorized by metabolic pathway into 12 metabolites from the COX pathway, 5 from the LOX pathway, and 8 from the CYP450 pathway (Fig. 5 E). The above results indicate that oxidative lipid metabolism in rat brain tissue is significantly disrupted in a high-altitude hypoxic environment, with products of the CYP450 metabolic pathway accounting for a large proportion of this disruption. As CYP450 plays a crucial role in lipid oxidation metabolism, changes in its expression or activity could directly impact lipid metabolic homeostasis. Therefore, we further investigated the effects of hypoxia on CYP450 expression. 3.2.2. High-altitude hypoxia reduces CYP450 expression in brain tissue To further investigate the regulatory role of CYP450 in lipid metabolism disorders and brain injury under hypoxic conditions, this study measured the mRNA and protein expression levels of 4 key CYP450 epoxygenases (CYP2C23, CYP2C11, CYP2C19, and CYP2J3) and 2 key ω-hydroxylases (CYP4A2 and CYP4F1). RT‒qPCR results revealed that the mRNA expression levels of CYP2C11 , CYP2C22 , CYP2J3 , and CYP4A2 were significantly reduced in brain tissue of the HAH-7, HAH-30, and HAH-90 groups compared with the LAC group. However, CYP2C23 was downregulated considerably only in the HAH-7 group (Fig. 6 A). The results of the Western blot analysis further validated the decrease in CYP450 protein expression levels in hypoxic environments. Compared with those in the LAC group, the protein expression levels of the CYP2C23, CYP2C11, and CYP2C22 were significantly reduced in the HAH-7, HAH-30, and HAH-90 groups. Inhibition of the CYP4F1 protein was observed only in the HAH-90 group (Fig. 6 B). These observations indicate that exposure to a high-altitude hypoxic environment markedly reduces CYP450 expression, potentially disrupting the lipid oxidation balance. 3.3. Hypoxic stress modulates the inflammatory responses of astrocytes through the downregulation of CYP450. 3.3.1. Hypoxic stress promotes astrocyte dysfunction and downregulates CYP450 To systematically evaluate the neurotoxic effects of hypoxia in an in vitro model, we cultured astrocytes under normoxic (21% O 2 ) and hypoxic (2% O 2 ) conditions for 3, 6, 12, 24, and 48 h, respectively. Cell viability assays revealed that astrocyte viability decreased in a time-dependent manner following hypoxia treatment. Notably, after 24 h at 2% O 2 , the cell viability decreased to below 50% (Fig. 7 A). ELISA studies revealed that the expression levels of IL-1β, IL-6, TNF-α, NF-κB, iNOS, and HIF-1α continued to increase with prolonged exposure to hypoxia (Fig. 7 B). Immunofluorescence assays revealed that the expression levels of the cognitive-related proteins Aβ and p-Tau were significantly higher in the 2% O 2 hypoxia group than in the normoxic group (Fig. 7 C). Additionally, the flow cytometry results revealed that the apoptosis rate in the hypoxic group was significantly higher than that in the normoxic group (Fig. 7 D). To investigate the impact of hypoxic stress on the expression of CYP450 in astrocytes, we measured the mRNA and protein expression levels of key CYP450 subtypes at various time points during hypoxia. RT‒qPCR analysis revealed that compared with that in the normoxic group, CYP2C23 mRNA expression significantly increased after 3 h of hypoxia, whereas CYP2C11 expression decreased from 6 to 48 h. CYP2C22 was transiently upregulated at 6 h, followed by downregulation from 12 to 48 h. CYP2J3 , CYP4A2 (except for upregulation at 3 h), and CYP4F1 exhibited sustained downregulation throughout all durations of hypoxia (Fig. 7 E). The Western blot results revealed consistent overall protein expression patterns but with temporal differences: the CYP2C23 protein level increased at 3 h but decreased from 24 to 48 h; both the CYP2C11 and CYP2J3 levels progressively decreased (from 6 to 48 h and from 3 to 48 h, respectively), while the CYP4A2 and CYP4F1 levels demonstrated late-phase suppression (from 24 to 48 h and from 12 to 48 h, respectively) (Fig. 7 F). These results indicate that the expression of apoptosis, inflammatory factors, and cognition-related proteins significantly increases in a time-dependent manner with prolonged hypoxia, whereas CYP450 expression gradually declines. These findings correspond with those observed in an in vivo study. Notably, the survival rate of astrocytes was observed to be less than 50% under 2% O 2 hypoxia for 24 h, with all indicators being substantial. Therefore, the subsequent hypoxia group was exposed to 2% O 2 hypoxia for 24 h to simulate moderate to severe hypoxia damage. 3.3.2. Inhibition of CYP450 increases astrocyte inflammation and abnormal accumulation of Aβ/p-Tau under hypoxic conditions. To further investigate the role of CYP450 in neuroinflammation and cognitive impairment, we employed a specific inhibitor intervention strategy to systematically assess the impact of CYP450 on cellular inflammatory responses and cognition-related protein expression by inhibiting the activity of CYP450 epoxygenase (MS-PPOH) and ω-hydroxylase (17-ODYA). According to the literature data and toxicity experiments on cell proliferation (Fig. 8 A), the concentrations of MS-PPOH and 17-ODYA employed in the experiments were established at 20 µM and 25 µM, respectively. Further measurements of CYP450 expression revealed that the mRNA and protein expression levels of the 6 CYP450s were significantly reduced in the hypoxia group compared with the normoxia group. Following treatment with MS-PPOH, the mRNA and protein expression levels of CYP2C23, CYP2C11, CYP2C22, and CYP2J3 decreased significantly compared with the hypoxia group, whereas the expression levels of CYP4A2 and CYP4F1 remained unchanged. Following treatment with 17-ODYA, the mRNA and protein expression levels of CYP4A2 and CYP4F1 decreased significantly, whereas there were no significant changes in the expression levels of CYP450 epoxygenases. These findings indicate that MS-PPOH exclusively inhibits CYP450 epoxygenase under hypoxic conditions, whereas 17-ODYA primarily inhibits ω-hydroxylase (Figs. 8 B and 8 C). Detection of inflammatory factors revealed that the hypoxic group presented significantly higher levels of IL-1β, IL-6, TNF-α, NF-κB, iNOS, and HIF-1α than did the normoxic group. Following intervention with 17-ODYA and MS-PPOH, the expression levels of these inflammatory factors increased further compared with the hypoxic group (Fig. 8 D). Immunofluorescence analysis revealed that Aβ and p-Tau levels were significantly higher in the hypoxic group, and treatment with 17-ODYA and MS-PPOH exacerbated the immunofluorescence intensity of both. To comprehensively assess the effects of hypoxia on oxidative stress and neuroinflammation, we also examined the levels of reactive oxygen species (ROS) and GFAP. The results revealed that the immunofluorescence intensity of both ROS and GFAP was increased in the hypoxia group and that intervention with 17-ODYA and MS-PPOH exacerbated this increase further (Fig. 8 E). Flow cytometry analysis indicated that the apoptosis rate in the 17-ODYA and MS-PPOH treatment groups was significantly higher than in the hypoxia-only group (Fig. 8 F). Notably, MS-PPOH had a greater inhibitory effect on inflammatory factors (IL-1β, TNF-α, NF-κB, and HIF-1α), cognitive-related proteins (Aβ and p-Tau), and apoptosis than did 17-ODYA. These findings suggest that reduced CYP450 epoxygenase activity is a key mechanism underlying hypoxia-induced astrocyte inflammation, abnormal Aβ and p-Tau accumulation, and increased apoptosis. 3.4. DNA methylation-mediated transcriptional repression of CYP450 under hypoxic conditions 3.4.1. Hypoxia-induced upregulation of DNMTs / MeCP2 , along with hypermethylation of CYP2C11 Hypoxia can induce DNA methylation, and DNA methylation can regulate CYP450 expression. We investigated the effect of DNA methylation status on CYP450 expression under hypoxic conditions. ELISA analysis revealed that, compared with the LAC group, 5-mC expression levels were significantly higher in the HAH-7, HAH-30, and HAH-90 groups (Fig. 9 A), suggesting that overall DNA methylation levels in the brain are elevated in a high-altitude hypoxic environment. Further measurements were conducted to determine the mRNA levels of the DNA methyltransferases (DNMT1, DNMT3a, and DNMT3b), as well as the methylcytosine binding protein (MeCP2), in brain tissue under hypoxic conditions. Compared to the LAC group, the results revealed that hypoxia significantly increased the mRNA levels of DNMT1 , DNMT3a , and MeCP2 in rat brain tissue (Fig. 9 B), confirming hypoxia-induced epigenetic reprogramming. To confirm the role of DNA methylation in regulating CYP450, we measured its methylation levels in the brain tissue of rats in the HAH-90 group. We obtained the gene sequences of rat CYP2C11 , CYP2C22 , CYP2C23 , CYP2J3 , CYP4F1 , and CYP4A2 from the NCBI database. Using the MethPrimer online tool, we identified a CpG island in the CYP2C11 promoter region (Fig. 9 C). BSP detection results revealed that the number of methylated sites in the CYP2C11 gene promoter DNA in the brains of HAH-90 rats increased significantly compared with the LAC group, with the methylation rates of three sites (CpG#26, CpG#90, and CpG#142) being significantly higher (Figs. 9 D and 9 E). It is suggested that hypermethylation of specific CpG sites in the CYP2C11 promoter region may be an epigenetic mechanism for downregulating CYP2C11 gene expression under hypoxic conditions. 3.4.2. DNMT inhibition by 5-Aza-dC rescues hypoxia-induced CYP2C11 suppression and neuroinflammation To validate the regulatory role of DNA methylation in CYP2C11 expression, we treated astrocytes cultured under hypoxic conditions with the DNA methyltransferase inhibitor 5-Aza-dC. The experimental results indicate that, at concentrations of less than 1 µM, 5-Aza-dC does not affect the survival rate of cells (Fig. 10 A). Additionally, under hypoxic conditions, the inhibitory effect of 5-Aza-dC restored CYP2C11 protein and mRNA expression (Fig. 10 B), alleviating inflammatory responses and the abnormal accumulation of Aβ and p-Tau proteins in hypoxic astrocytes (Fig. 10 C and 10 D). These results confirm that elevated CYP2C11 methylation levels are a key factor in inflammatory responses and the accumulation of cognition-related proteins under hypoxic conditions. 4. Discussion This study used a high-altitude hypoxia-exposed rat model and astrocyte hypoxia stress experiments to systematically elucidate the pathological mechanisms underlying high-altitude hypoxia-induced neuroinflammation and cognitive impairment. The results revealed that exposure to high-altitude hypoxia leads to impaired learning and memory abilities, accompanied by the activation of neuroinflammatory responses. Mechanistic studies indicate that hypoxia-induced oxidative lipid metabolic disorders and downregulation of CYP450 expression further exacerbate CNS damage. This study also identified a molecular mechanism whereby DNA methylation under hypoxic conditions specifically regulates CYP2C11 expression. This influences the accumulation of cognition-related proteins and neuroinflammatory responses. These findings innovatively establish a DNA methylation-dependent regulatory axis involving CYP450, oxidized lipids, and neuroinflammation/cognitive impairment (Fig. 11 ), providing a potential intervention strategy targeting CYP450 for the prevention and treatment of high-altitude-related neural damage. The body undergoes various physiological and pathological changes in a high-altitude hypoxic environment. Among these changes, blood and serum biochemical indicators are important markers for assessing an individual's health status. This study demonstrated that exposure to a hypoxic environment increased the levels of HGB, RBC, and HCT, which is a typical adaptive response to high-altitude hypoxia. This occurs because hypoxia induces the release of erythropoietin (EPO), thereby facilitating erythropoiesis in the bone marrow. This increases the RBC count and hemoglobin concentration, thereby increasing the oxygen-carrying capacity of the blood and enhancing oxygen delivery to tissues. However, excessive proliferation of RBCs can increase blood viscosity, which may cause microcirculatory disorders and increase the prevalence of cerebrovascular diseases in high-altitude settings [ 18 ]. WBCs can reflect the body's immune status, as they are one of the body's defense systems against foreign pathogens. In line with previous research [ 19 ], this study revealed that hypoxia at high altitudes decreased the WBC of rats. These findings suggest that hypoxic conditions may induce inflammatory responses and that a sustained decrease in WBC may make high-altitude residents more susceptible to infection. However, another study found that acute hypoxia can lead to an increase in the WBC count [ 20 ]. This difference may be attributed to factors such as hypoxia modeling methods and hypoxia duration. In addition, this study revealed that high-altitude hypoxia significantly altered the serum biochemical indicators in rats. Hypoxia significantly impacts rat liver function, which may affect the production and activity of drug-metabolizing enzymes and consequently impact drug metabolism in the body [ 20 ]. Furthermore, renal function experience is notably altered under hypoxic conditions. CREA initially decreases but then increases under hypoxic conditions, which is likely attributed to a compensatory increase in the glomerular filtration rate or a reduction in muscle metabolism during the early stages of hypoxia. However, renal function gradually deteriorates as hypoxia persists. Impairment of liver and kidney function may result in the accumulation of toxins, causing inflammation and oxidative stress in the brain. In addition, the results of this study demonstrated that energy and glucose-lipid metabolism are altered under severe hypoxic conditions. The sustained decrease in GLU and TG indicates increased glycolysis and lipolysis as the duration of hypoxia increases. Reduced glucose utilization under hypoxic conditions may result in an insufficient energy supply to brain tissue, affecting neuronal electrical activity and cognitive function. In agreement with earlier research [ 21 ], CRP is a reliable and sensitive systemic inflammatory marker. Our findings indicate that CRP levels remain elevated following hypoxic exposure, suggesting that chronic inflammatory responses induced by hypoxia exacerbate neurodegeneration. These changes may suggest potential pathological damage and reflect the body's compensatory adaptation; however, the specific mechanisms necessitate further investigation. Inflammation is a pathological process characterized by tissue damage or destruction. Research has demonstrated that both acute and chronic hypoxia can disturb the equilibrium between pro- and anti-inflammatory mediators, resulting in increased levels of pro-inflammatory molecules such as IL-1β, TNF-α, and IL-6 [ 22 – 24 ]. This study further proves that an increase in hypoxia duration correlates with heightened expression of inflammatory markers in rat brain tissue and astrocytes. Sustained elevation of these factors not only damages neurons directly but also exacerbates neural damage by impairing the integrity of the blood-brain barrier (BBB) and promoting oxidative stress. Additionally, this study revealed that hypoxia induced the activation of both microglia and astrocytes. As the primary immune effector cells in the central nervous system, microglia release large amounts of proinflammatory factors upon activation, thereby amplifying the neuroinflammatory response. In addition to producing proinflammatory cytokines, astrocytes can release matrix metalloproteinases that degrade the extracellular matrix, leading to disruption of the BBB. Furthermore, they release nitric oxide (NO) to regulate cerebral blood flow during hypoxia [ 25 , 26 ]. In addition to the formation of inflammatory factors and glial cell activation, activation of the HIF-1α signaling pathway is also a key regulatory mechanism in the development of neuroinflammation. This study and previous research have both demonstrated that high-altitude hypoxia can markedly increase the expression of HIF-1α [ 27 , 28 ]. There is a certain degree of interaction between HIF-1α and IL-1β, TNF-α, IFN-γ, and NF-κB, and this interaction is influenced by the severity of inflammation [ 29 ]. Among them, the interaction between HIF-1α and NF-κB is more complex. On the one hand, NF-κB is a direct regulator of HIF-1α, which can activate NF-κB [ 30 , 31 ]. Moreover, HIF-1α can limit the inflammatory response by inhibiting the expression of NF-κB-dependent genes [ 32 , 33 ]. On the other hand, in some studies on hypoxic microenvironments, NF-κB can directly bind to the HIF-1α promoter, thereby enhancing the transcription of HIF-1α [ 34 ]. In summary, the interaction between HIF-1α and inflammatory cytokines may enhance the inflammatory response under hypoxia by regulating the expression of inflammatory cytokines. Many studies have focused on the impact of high-altitude hypoxic environments on cognitive function. Existing evidence indicates that the extent of hypoxic damage to brain function is influenced primarily by two factors: altitude and exposure time. Studies have generally confirmed that cognitive impairment increases with altitude [ 35 , 36 ]. In terms of exposure time, existing studies have revealed different patterns of impact on cognitive function between acute hypoxia and chronic hypoxia. Short-term acute hypoxia can rapidly impair cognitive ability. Studies by Wang et al. have demonstrated that exposure to high-altitude hypoxic environments over a short period can result in memory loss, impaired behavior, and slower thinking [ 37 , 38 ]. Chronic hypoxia may result in more persistent cognitive impairment. Ma et al. reported that mice exposed to a simulated altitude of 5000 m for 1 month exhibited severe cognitive impairment accompanied by increased levels of oxidative stress biomarkers [ 39 ]. Similarly, Ji et al. reported that rats raised at an altitude of 4300 m for 8 weeks exhibited significant cognitive impairments, along with neuronal damage in the hippocampus and cortex, increased apoptosis, and abnormal casein expression [ 40 , 41 ]. Furthermore, the results of an epidemiological survey indicate that the prevalence of cognitive impairment and dementia is significantly higher among elderly individuals living at high altitudes for extended periods [ 42 ]. Our research further confirmed that both acute and chronic hypoxia may damage learning and memory, with extended exposure leading to more significant impairment. This discovery corresponds to the findings of Rimoldi et al.'s research on adolescents [ 43 ]. However, some studies have reported an initial decline in cognitive function followed by partial recovery with prolonged exposure to hypoxia. For example, Zhang et al. found that mice exposed to an altitude of 7000 m for 1, 3, or 7 days presented initial cognitive impairment during the first three days, which improved by day 7 [ 44 ]. Xu et al. observed a similar phenomenon: cognitive function declined within two days of exposure at an altitude of 3800 m but progressively improved from day 3 onward, largely recovering to baseline performance by days 5 to 7 [ 45 ]. Research suggests that the 'decline-partial recovery' pattern of cognitive function following exposure to hypoxia may be associated with the activation of the body's hypoxic adaptation mechanisms. However, these studies focused only on short-term exposure to hypoxia within seven days and have failed to systematically assess the sustained effects of long-term exposure to hypoxia on cognitive function. In contrast, this study examined cognitive changes during the acute phase and further measured the dynamic evolution of cognitive function over the long term (30 and 90 days). These findings provide a more comprehensive understanding of patterns of cognitive function changes under different durations of hypoxia. This study design addresses the knowledge gap in the literature on the cognitive effects of long-term exposure to hypoxia, offering more comprehensive experimental evidence to improve our understanding of the mechanisms that compensate for and damage cognitive function in high-altitude hypoxic environments. Cognitive impairment is considered the preclinical stage of Alzheimer's disease (AD). Hyperphosphorylation of the tau protein and deposition of Aβ are typical neuropathological features of AD-related dementia. Consequently, tau phosphorylation and increased Aβ expression represent an early stage of cognitive impairment. This study confirms that hypoxia can stimulate tau phosphorylation and affect Aβ metabolism, a result that is consistent with the findings of previous studies. Gao et al. found that chronic exposure to hypoxia not only accelerated amyloid pathology in APP/PS1 transgenic mice but also mediated high tau phosphorylation through calprotectin [ 46 ]. Similarly, Zhang et al. found increased phosphorylation of the Thr181 and Thr213 sites of the tau protein, as well as increased Aβ levels, in APP/PS1 mice exposed to acute hypoxia (7% O 2 ) [ 47 ]. These findings suggest that hypoxia-induced Aβ deposition and tau phosphorylation may be the direct pathological basis for cognitive impairment under hypoxic conditions. Interestingly, the abnormal changes in the Aβ and p-Tau proteins under hypoxic conditions may be closely related to the activation of HIF-1α. Zhang et al. reported that the overexpression of HIF-1α under hypoxic conditions significantly increases the levels of beta-secretase 1 (BACE1) mRNA and protein, ultimately leading to increased Aβ production [ 48 , 49 ]. Similarly, HIF-1α regulates tau phosphorylation under hypoxic conditions. Lei et al. found that chronic hypoxia activates HIF-1α, which results in a deficiency of leucine carboxyl methyltransferase 1 (LCMT1) and protein phosphatase 2A (PP2A). These effects mediate the abnormal hyperphosphorylation of tau, ultimately impairing cognitive function [ 50 ]. In addition to the HIF-1α pathway, inflammation is an important underlying mechanism of abnormal tau and Aβ metabolism under hypoxic conditions. Previous studies have confirmed that IL-1β, TNF-α, and IL-6 play pivotal roles in the neuronal dysfunction and cognitive impairment caused by chronic neuroinflammation [ 51 – 53 ]. Through animal experiments, Krstic et al. demonstrated that mice with an activated immune system exhibited chronic elevation of inflammatory cytokines, increased levels of amyloid precursor protein (APP), altered tau phosphorylation, and severe working memory impairment in old age [ 54 ]. This study found that a rat model of hypoxia-induced cognitive impairment exhibited increased expression of inflammatory factors and accumulation of p-Tau and Aβ. Although existing evidence has not yet established a direct causal relationship between hypoxia-induced neuroinflammation and cognitive impairment, these findings provide important research clues for further exploration of the mechanism of neuroinflammation in cognitive impairment in hypoxic environments. Under high-altitude hypoxia, the body generates elevated levels of oxygen free radicals, leading to lipid peroxidation. An increasing body of evidence indicates that oxidized lipids are crucial in the initiation and advancement of cognitive impairment. Nasaruddin et al. used gas chromatography-mass spectrometry (GC-MS) to accurately quantify fatty acids (FAs) that are highly dependent on each other in patients with AD and Lewy body dementia (DLB). Their results revealed that pathological progression of either condition alters the FA composition of brain tissue [ 55 ]. Similarly, Shen et al. found that higher levels of the long-chain saturated fatty acids docosanoic acid (22:0) and lignoceric acid (24:0) were associated with better overall cognitive function in older adults [ 56 ]. Dhillon et al.'s research further supports this view. They found that levels of saturated fatty acids were significantly higher in patients with mild cognitive impairment (MCI), while levels of PUFAs were significantly lower [ 4 ]. This aligns well with the observed alterations in oxidative lipid metabolism trends in this investigation. These results suggest that maintaining the homeostasis of oxidized lipids is essential for preserving brain function and that characteristic changes in oxidized lipids under pathological conditions may serve as molecular markers reflecting the risk of cognitive impairment. Metabolomic analysis of oxidized lipids has become an increasingly important strategy for exploring disease-induced metabolic changes, demonstrating significant value in disease diagnosis and prognosis assessment. We found that increases in 8-HDoHE, 9-OxoODE, 18(11)-HETE, 8,15-DiHETE, and 16(17)-HETE, as well as decreases in PGD₂, EPA, 12(13)-DiHOME, PGE₂, and 12(13)-HEPE, etc., are associated with an increased risk of high-altitude, hypoxia-induced encephalopathy. Based on statistical significance and trends under hypoxic conditions, 16S-HETE and PGD1 may serve as biomarkers for diagnosing high-altitude hypoxic encephalopathy. These findings provide a new explanation for the metabolic mechanism of brain dysfunction caused by hypoxia at high altitudes. More importantly, they lay the theoretical foundation for preventive intervention strategies that target the regulation of oxidized lipid metabolism. Our research revealed that significant amounts of oxidized lipids are implicated in the cognitive impairment caused by hypoxia. Current research does not allow us to ascertain their precise role in this process; nonetheless, prior studies indicate a potential association with the inflammatory and vascular regulating actions of eicosanoids. Existing research has confirmed that oxidized lipids play a significant role in regulating both inflammatory responses and the innate immune system. Based on their functional characteristics, oxidized lipids can be categorized as either pro- or anti-inflammatory mediators. During the inflammatory process, changes occur in the biosynthesis of these mediators, which participate in key stages, including initiation, cascade amplification, and the timely resolution of inflammatory responses, through complex regulatory networks. This study found that, during acute hypoxia, certain proinflammatory mediators (such as LTB₄ and 12S-HETE) temporarily increase, whereas the levels of anti-inflammatory mediators (such as EETs and PGD₁) decrease. This exacerbates inflammatory damage. In contrast, during chronic hypoxia, the levels of most proinflammatory mediators (e.g., PGE₂ and 20-HETE) decrease persistently, whereas the levels of proresolution mediators (e.g., MaR2 and 15S-HETE) remain deficient. This leads to delayed inflammatory resolution. These changes result in abnormal activation and delayed resolution of neuroinflammation. On the other hand, it may be related to its vascular regulatory function. EETs and HETEs are particularly important in this context, as they play a central role in vascular responses, regulating vascular tone under hypoxic conditions and promoting angiogenesis [ 57 , 58 ]. In endothelial cells, EETs activate K + Ca channels, induce smooth muscle cell hyperpolarization, and inhibit L-type Ca 2+ channels. This process induces relaxation. Consequently, EETs act as endothelium-derived vasodilators, dilating blood vessels throughout the vascular system. This study found that exposure to high-altitude hypoxia reduced the biosynthesis of 8(9)-EET, 11(12)-EET, and 14(15)-EET in brain tissue during acute hypoxia. This may lead to cerebral vasoconstriction and reduced cerebral blood flow, thereby exacerbating the damage caused to the brain by hypoxia. HETEs reduce the probability of opening K + Ca channels and inhibit Na-K-ATPase. This leads to the depolarization of smooth muscle cell membranes and the activation of L-type Ca 2+ channels, inducing contraction. This study found that the biosynthesis of 20-HETE, which has a clear vasoconstrictive effect, decreased significantly with prolonged hypoxia, whereas the biosynthesis of 16S-HETE and 18-HETE increased significantly. While the precise vascular effects of these two metabolites remain unclear, given that other members of the HETE family generally exhibit vasoconstrictive properties, this abnormal increase may also intensify the vasoconstrictive response. Although reducing 20-HETE may alleviate hypoxia-induced vascular vasoconstriction, increasing 16-HETE/18-HETE suggests that there are more complex regulatory mechanisms in cerebral blood vessels under hypoxic conditions. Therefore, clarifying the functional contributions of each subtype using selective inhibitors or agonists will be an important area of future research. CYP450s constitute the most important family of metabolic enzymes in the body. Previous studies have concentrated on its function in drug metabolism; however, recent research has revealed its correlation with cognition, memory, and learning in the brain. CYP450 is a crucial endogenous metabolic enzyme that significantly contributes to cholesterol homeostasis. Djelti et al. used adeno-associated viral vectors to reduce Cyp46a1 expression in the hippocampi of C57BL/6 mice. This resulted in increased cholesterol concentrations and neuronal apoptosis, as well as cognitive deficits. These effects were more pronounced in the APP23 AD mouse model [ 59 ]. Another study also found that female CYP46A1 transgenic mice showed improved spatial memory ability in the MWM test [ 60 ], further confirming the correlation between CYP46A1 and learning and memory ability. In addition, CYP2E1, CYP2D1, and CYP7A1 are also associated with learning and cognition to a certain extent [ 61 , 62 ]. In summary, these studies suggest that CYP450s are important for cognitive processes. Interestingly, research has shown that hypoxia significantly affects the expression levels of CYP450 in brain tissue. Jacob et al. exposed human cerebral microvascular endothelial cell lines to hypoxic conditions for 6 h and found that the expression of CYP1A1 and CYP1B1 was significantly reduced [ 63 ]. Similarly, another study reported that, under hypoxic conditions, the activity of CYP19a1b, as well as the mRNA and protein expression levels of CYP19a1, decreased significantly in the hypothalamus of Atlantic croaker [ 64 ]. These studies suggest that changes in the expression of CYP450 in the brain under hypoxic conditions may be related to changes in brain function under hypoxic conditions, particularly hypoxia-induced cognitive impairment, which has been reported in previous studies. Wan et al. exposed male C57BL/6 mice to an altitude of 4300 m for 6 months and analyzed the proteins in their hippocampal tissue quantitatively. The results showed that differentially expressed proteins were enriched in the 'drug metabolism-other enzymes' and 'drug metabolism-CYP450' pathways [ 65 ]. This highlights the importance of CYP450 in hypoxia-induced cognitive impairment, a finding that was confirmed by our results. We found that the mRNA and protein expression of CYP450 was altered in the brains of rats with hypoxia-induced cognitive impairment and that CYP450 inhibition exacerbated the abnormal accumulation of inflammatory factors and cognition-related proteins under hypoxic conditions. These results provide new experimental evidence to help us understand the role of CYP450 in hypoxia-induced cognitive impairment and could inform the development of neuroprotective strategies targeting the CYP450 metabolic pathway. Our research revealed a novel mechanism by which hypoxia induces specific methylation of the CYP2C11 promoter via DNMTs and MeCP2, thereby inhibiting its expression. These findings expand the current understanding of the regulatory mechanisms of CYP450 under hypoxic conditions. Previous studies have shown that nuclear receptors such as the pregnane X receptor (PXR), constitutive androstane receptor (CAR), aryl hydrocarbon receptor (AhR), and hepatocyte nuclear factor (HNF) are involved in regulating CYP450 expression at the transcriptional level under hypoxic conditions [ 10 ]. Moreover, multiple cytokines (such as HIF-1α, Nrf2, IL-1β, and IL-6) and gut microbiota metabolites participate in this regulatory network [ 66 , 67 ]. At the epigenetic level, although it has been confirmed that miRNAs regulate transporter function by modulating PXR under hypoxic conditions [ 68 ], their direct regulation of CYP450 remains unclear. Similarly, although it has been demonstrated that DNA methylation is an important epigenetic mechanism that regulates CYP450 expression, the specifics of this regulation under hypoxic conditions and its molecular basis are still unclear. This study is the first to link the suppression of CYP450 expression to methylation at specific CpG sites, revealing a novel mechanism for the regulation of CYP450 under hypoxic conditions. Notably, this study, by identifying key CpG sites and conducting 5-Aza-dC intervention experiments, confirmed the importance of epigenetic modifications in regulating CYP450 expression under hypoxic conditions and offered a novel perspective on the role of epigenetic regulation of CYP450 in neurological diseases. Comprehensive studies indicate that DNA methylation facilitates early central nervous system development, contributes to neuronal growth and differentiation, is crucial for adult neurogenesis, and regulates genes vital to learning and memory-related cognitive functions [ 69 ]. Research has elucidated that DNA methylation alterations of the CYP450 gene may significantly contribute to the pathogenesis of neurodegenerative diseases such as AD [ 70 ], and our investigation confirms this conclusion. This study is the first to elucidate the regulatory axis involving DNA methylation-mediated CYP450, oxidized lipids, and neuroinflammation in the context of hypoxia. These findings provide a new theoretical basis for understanding the pathogenesis of cognitive impairment and neuroinflammation in high-altitude hypoxic environments. This research has significant scientific value. First, elucidating the association between metabolic characteristics and events of high-altitude hypoxic encephalopathy could provide new biomarkers for disease monitoring and diagnosis. Second, this study confirmed the critical function of CYP450 in hypoxic neuroprotection, offering a significant theoretical basis for the formulation of targeted pharmaceuticals. Finally, a novel mechanism of DNA methylation of CYP450 under hypoxic conditions in neural damage has been identified, offering a fresh perspective for the research and treatment of hypoxic brain injury disorders. However, this study has several limitations. First, although the use of SD rats and primary astrocytes provided consistency within the experimental framework, the conclusions necessitate additional validation through primate models or human samples to ascertain whether the correlation between CYP450 and neural damage under hypoxic conditions is species independent. Second, although our study identified CYP450 and oxidized lipid metabolites as crucial targets in the onset of inflammation and cognitive decline under hypoxic conditions, the molecular interactions between oxidized lipid metabolites and Aβ/p-Tau proteins remain ambiguous. Additional confirmation is necessary using in vitro co-incubation experiments and protein interaction analysis methods. Third, the main focus of this study was the methylation regulatory mechanism of CYP2C11. However, the reduced expression of other CYP450 subtypes under hypoxic conditions suggests the existence of additional regulatory pathways. Future research could combine gene-editing techniques, such as CRISPR-Cas9, with multiomics integrated analysis strategies to systematically elucidate the expression regulatory network of the CYP450 family under hypoxic conditions. This would provide valuable insight into the molecular mechanisms underlying high-altitude adaptive responses. Abbreviations AA arachidonic acid AhR aryl hydrocarbon receptor AMS acute mountain sickness Aβ amyloid-β BSP bisulfite-sequencing PCR CAR constitutive androstane receptor COX cyclooxygenase CYP450 cytochrome P450 EETs eicosapentaenoic acids ELISA enzyme-linked immunosorbent assay GFAP glial fibrillary acidic protein HACE high-altitude cerebral edema HAH high-altitude headache HE hematoxylin-eosin HETEs eicosatetraenoic acids HIF-1α hypoxia-inducible factor-1α HNF hepatocyte nuclear factor IBA1 ionophore-binding protein 1 LOX lipoxygenase p-Tau phospho-Tau PUFAs polyunsaturated fatty acids PXR pregnane X receptor ROS reactive oxygen species RT‒qPCR quantitative real-time polymerase chain reaction TEM transmission electron microscopy UHPLC-MS/MS ultrahigh-performance liquid chromatography-tandem mass spectrometry Declarations Consent for publication Not applicable Consent for publication Not applicable Availability of data and materials The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests. Funding This study was supported by the National Natural Science Foundation of China (No. 82260731, China), Qinghai University Research Ability Enhancement Project (2025KTST08, China), and Qinghai Provincial Department of Science and Technology (2024-ZJ-724, China). Acknowledgements Not applicable Author contributions Qian Wang: Conceptualisation, Methodology, Investigation, Validation, Formal analysis, and Writing–original draft. Junjun Han: Methodology and Data curation. Guiqin Liu and Yabin Duan: Investigation and writing-review. Delong Duo and Junbo Zhu: Data curation, Software, and Formal analysis. Yue Lin and Yawen Xin: Resources, Visualization, and Investigation. Xiangyang Li: Writing-review & editing, Resources, Supervision, Project administration, and Funding acquisition. Ting Li: Writing-review, Supervision, and Project administration. All authors contributed to the article, agreed to be accountable for all aspects of the work, and approved the submitted version. References Erecińska M, Silver IA. Tissue oxygen tension and brain sensitivity to hypoxia. Respir Physiol 2001;128(3). Chen X, Zhang J, Lin Y, Li Y, Wang H, Wang Z et al. Mechanism, prevention and treatment of cognitive impairment caused by high altitude exposure. Front Physiol 2023;14. Aboouf MA, Thiersch M, Soliz J, Gassmann M, Schneider Gasser EM. The brain at high altitude: from molecular signaling to cognitive performance. Int J Mol Sci 2023;24(12). Dhillon VS, Thomas P, Lee SL, Deo P, Fenech M. Red blood cell fatty acid profiles are significantly altered in south australian mild cognitive impairment and alzheimer's disease cases compared to matched controls. Int J Mol Sci 2023;24(18). Chauhan G, Roy K, Kumar G, Kumari P, Alam S, Kishore K et al. Distinct influence of COX-1 and COX-2 on neuroinflammatory response and associated cognitive deficits during high altitude hypoxia. Neuropharmacology 2019;146. Funk CD. Prostaglandins and leukotrienes: advances in eicosanoid biology. Science 2001;294(5548). Zhang G, Kodani S, Hammock BD. Stabilized epoxygenated fatty acids regulate inflammation, pain, angiogenesis and cancer. Prog Lipid Res 2014;53. Welty FK. Omega-3 fatty acids and cognitive function. Curr Opin Lipidol 2023;34(1). Bazinet RP, Layé S. Polyunsaturated fatty acids and their metabolites in brain function and disease. Nat Rev Neurosci 2014;15(12). Wang Q, Liu G, Duan Y, Duo D, Zhu J, Li X. Exploring cytochrome P450 under hypoxia: potential pharmacological significance in drug metabolism and protection against high-altitude diseases. Drug Metab Dispos 2025;53(2). Halder SK, Milner R. The impact of chronic mild hypoxia on cerebrovascular remodelling; uncoupling of angiogenesis and vascular breakdown. Fluids Barriers CNS 2021;18(1). Penaloza CG, Cruz M, Germain G, Jabeen S, Javdan M, Lockshin RA et al. Higher sensitivity of female cells to ethanol: methylation of DNA lowers Cyp2e1, generating more ROS. Cell Commun Signal 2020;18(1). Sukmawan R, Hoetama E, Suridanda Danny S, Giantini A, Listiyaningsih E, Gilang Rejeki V et al. Increase in the risk of clopidogrel resistance and consequent TIMI flow impairment by DNA hypomethylation of CYP2C19 gene in STEMI patients undergoing primary percutaneous coronary intervention (PPCI). Pharmacol Res Perspect 2021;9(2). Jiang W, Wu H, Yu X, Wang Y, Gu W, Wei W et al. Third-hand smoke exposure is associated with abnormal serum melatonin level via hypomethylation of CYP1A2 promoter: Evidence from human and animal studies. Environ Pollut 2021;277. Lin Z, Lu Y, Yu G, Teng H, Wang B, Yang Y et al. Genome-wide DNA methylation landscape of four Chinese populations and epigenetic variation linked to Tibetan high-altitude adaptation. Sci China Life Sci 2023;66(10). Zhang S, Fu W, Jia X, Bade R, Liu X, Xie Y et al. Hypoxic preconditioning modulates BDNF and its signaling through DNA methylation to promote learning and memory in mice. ACS Chem Neurosci 2023;14(12). Jin T, Lu H, Zhang Z, Wang Y, Yang W, Wang Y et al. CYP2S1 gene methylation among High-altitude pulmonary edema. Gene 2022;834. Villafuerte FC, Simonson TS, Bermudez D, León-Velarde F. High-altitude erythrocytosis: mechanisms of adaptive and maladaptive responses. Physiol (Bethesda) 2022;37(4). Yan C, Tian D, Zhang C, Zhang Q, Sun Y. Evaluation of blood cellular and biochemical parameters in rats under a chronic hypoxic environment at high altitude. Ann Med 2023;55(1). Zhu J, Duan Y, Duo D, Yang J, Bai X, Liu G et al. High-altitude hypoxia influences the activities of the drug-metabolizing enzyme CYP3A1 and the pharmacokinetics of four cardiovascular system drugs. Pharmaceuticals (Basel) 2022;15(10). Hartmann G, Tschöp M, Fischer R, Bidlingmaier C, Riepl R, Tschöp K et al. High altitude increases circulating interleukin-6, interleukin-1 receptor antagonist and C-reactive protein. Cytokine 2000;12(3). Jiang S, Fan F, Yang L, Chen K, Sun Z, Zhang Y et al. Salidroside attenuates high altitude hypobaric hypoxia-induced brain injury in mice via inhibiting NF-κB/NLRP3 pathway. Eur J Pharmacol 2022;925. Xie N, Fan F, Jiang S, Hou Y, Zhang Y, Cairang N et al. Rhodiola crenulate alleviates hypobaric hypoxia-induced brain injury via adjusting NF-κB/NLRP3-mediated inflammation. Phytomedicine 2022;103. Tian L, Liu G, Zhao Q, Han J, Lin Y, Wang Q et al. Pharmacokinetics of midazolam in plasma and brain tissue of rats after exposure to acute and chronic high altitude hypoxia. High Alt Med Biol 2025;26(3). Karve IP, Taylor JM, Crack PJ. The contribution of astrocytes and microglia to traumatic brain injury. Br J Pharmacol 2016;173(4). Christie IN, Theparambil SM, Braga A, Doronin M, Hosford PS, Brazhe A et al. Astrocytes produce nitric oxide via nitrite reduction in mitochondria to regulate cerebral blood flow during brain hypoxia. Cell Rep 2023;42(12). Cheng J, Sun Y, He J, Wang Z, Li W, Wang R. The mechanism of colon tissue damage mediated by HIF-1α/NF-κB/STAT1 in high-altitude environment. Front Physiol 2022;13. Juan H, Qijun W, Yuanheng H, Yangfang L. A study of high-altitude hypoxia-induced cell stress in murine model. Cell Biochem Biophys 2012;64(2). de Lemos ML, de la Torre AV, Petrov D, Brox S, Folch J, Pallàs M et al. Evaluation of hypoxia inducible factor expression in inflammatory and neurodegenerative brain models. Int J Biochem Cell Biol 2013;45(7). Wang D, Wang M, Sun S, Zhang C, Song Y, Li J et al. Hypoxia-induced NLRP3 inflammasome activation via the HIF-1α/NF-κB signaling pathway in human dental pulp fibroblasts. BMC Oral Health 2024;24(1). Jiang Y, Zhu Y, Wang X, Gong J, Hu C, Guo B et al. Temporal regulation of HIF-1 and NF-κB in hypoxic hepatocarcinoma cells Oncotarget. 2015;6(11). Hirai K, Furusho H, Hirota K, Sasaki H. Activation of hypoxia-inducible factor 1 attenuates periapical inflammation and bone loss. Int J Oral Sci 2018;10(2). Zhang Y, Yan M, Yue Y, Cheng Y. Hypoxia-inducible factor-1α modulates the toll-like receptor 4/nuclear factor kappa b signaling pathway in experimental necrotizing enterocolitis. Mediators Inflamm. 2024;2024. Han S, Xu W, Wang Z, Qi X, Wang Y, Ni Y et al. Crosstalk between the HIF-1 and Toll-like receptor/nuclear factor-κB pathways in the oral squamous cell carcinoma microenvironment. Oncotarget 2016;7(25). Algaze I, Phillips L, Inglis P, Lathrop G, Gadbois J, Rizzolo K et al. Incidence of mild cognitive impairment with ascending altitude. High Alt Med Biol 2020;21(2). Zhang YQ, Zhang WJ, Liu JH, Ji WZ. Effects of chronic hypoxic environment on cognitive function and neuroimaging measures in a high-altitude population. Front Aging Neurosci 2022;14. Bhattacharjee M, Manoharan S, Deshetty UM, Perumal E. Acute hypobaric hypoxia exposure causes neurobehavioral impairments in rats: role of brain catecholamines and tetrahydrobiopterin alterations. Neurochem Res 2023;48(2). Wang L, Sang L, Cui Y, Li P, Qiao L, Wang Q et al. Effects of acute high-altitude exposure on working memory: A functional near-infrared spectroscopy study. Brain Behav 2022;12(12). Ma YY, Li X, Yu ZY, Luo T, Tan CR, Bai YD et al. Oral antioxidant edaravone protects against cognitive deficits induced by chronic hypobaric hypoxia at high altitudes. Transl Psychiatry 2024;14(1). Ji W, Zhang Y, Ge RL, Wan Y, Liu J. NMDA receptor-mediated excitotoxicity is involved in neuronal apoptosis and cognitive impairment induced by chronic hypobaric hypoxia exposure at high altitude. High Alt Med Biol 2021;22(1). Ji W, Zhang Y, Luo J, Wan Y, Liu J, Ge RL. Memantine ameliorates cognitive impairment induced by exposure to chronic hypoxia environment at high altitude by inhibiting excitotoxicity. Life Sci 2021;270. Urrunaga-Pastor D, Chambergo-Michilot D, Runzer-Colmenares FM, Pacheco-Mendoza J, Benites-Zapata VA. Prevalence of cognitive impairment and dementia in older adults living at high altitude: a systematic review and meta-analysis. Dement Geriatr Cogn Disord 2021;50(2). Rimoldi SF, Rexhaj E, Duplain H, Urben S, Billieux J, Allemann Y et al. Acute and chronic altitude-induced cognitive dysfunction in children and adolescents. J Pediatr 2016;169. Zhang H, Zhang X, Liu Z, Mei Y, Liu Y, Wei X et al. Time-course effects and mechanisms of hypobaric hypoxia on nervous system in mice. Neurosci Lett 2023;801. Xu S, Zheng ZY, Zhao GC, Lu ZH, Nie H, Wang XJ et al. The study on effects of acute exposure to high altitude hypoxia on cognitive function in lowlander. Behav Brain Res 2025;484. Gao L, Tian S, Gao H, Xu Y. Hypoxia increases Aβ-induced tau phosphorylation by calpain and promotes behavioral consequences in AD transgenic mice. J Mol Neurosci 2013;51(1). Zhang F, Zhong R, Qi H, Li S, Cheng C, Liu X et al. Impacts of acute hypoxia on Alzheimer's disease-like pathologies in APP(swe)/PS1(dE9) mice and their wild type littermates. Front Neurosci 2018;12. Zhang X, Zhou K, Wang R, Cui J, Lipton SA, Liao FF et al. Hypoxia-inducible factor 1alpha (HIF-1alpha)-mediated hypoxia increases BACE1 expression and beta-amyloid generation. J Biol Chem 2007;282(15). Guglielmotto M, Aragno M, Autelli R, Giliberto L, Novo E, Colombatto S et al. The up-regulation of BACE1 mediated by hypoxia and ischemic injury: role of oxidative stress and HIF1alpha. J Neurochem 2009;108(4). Lei L, Feng J, Wu G, Wei Z, Wang JZ, Zhang B et al. HIF-1α causes LCMT1/PP2A deficiency and mediates tau hyperphosphorylation and cognitive dysfunction during chronic hypoxia. Int J Mol Sci 2022;23(24). West NA, Kullo IJ, Morris MC, Mosley TH. Sex-specific associations of inflammation markers with cognitive decline. Exp Gerontol 2020;138. Belarbi K, Jopson T, Tweedie D, Arellano C, Luo W, Greig NH et al. TNF-α protein synthesis inhibitor restores neuronal function and reverses cognitive deficits induced by chronic neuroinflammation. J Neuroinflammation. 2012;9. Quintanilla RA, Orellana DI, González-Billault C, Maccioni RB. Interleukin-6 induces Alzheimer-type phosphorylation of tau protein by deregulating the cdk5/p35 pathway. Exp Cell Res 2004;295(1). Krstic D, Madhusudan A, Doehner J, Vogel P, Notter T, Imhof C et al. Systemic immune challenges trigger and drive Alzheimer-like neuropathology in mice. J Neuroinflammation 2012;9. Nasaruddin ML, Pan X, McGuinness B, Passmore P, Kehoe PG, Hölscher C et al. Evidence that parietal lobe fatty acids may be more profoundly affected in moderate Alzheimer's Disease (AD) pathology than in severe AD pathology. Metabolites 2018;8(4). Shen Y, Wei C, Taishi Y, Zhang G, Su Z, Zhao P et al. Association between the circulating very long-chain saturated fatty acid and cognitive function in older adults: findings from the NHANES. BMC Public Health 2024;24(1). Michaelis UR, Xia N, Barbosa-Sicard E, Falck JR, Fleming I. Role of cytochrome P450 2C epoxygenases in hypoxia-induced cell migration and angiogenesis in retinal endothelial cells. Invest Ophthalmol Vis Sci 2008;49(3). Xia Y, Xia L, Jin Z, Jin R, Paudel O, Sham JSK. Cytochrome P450 epoxygenase-dependent activation of TRPV4 channel participates in enhanced serotonin-induced pulmonary vasoconstriction in chronic hypoxic pulmonary hypertension. Anal Cell Pathol (Amst) 2020;2020. Djelti F, Braudeau J, Hudry E, Dhenain M, Varin J, Bièche I et al. CYP46A1 inhibition, brain cholesterol accumulation and neurodegeneration pave the way for Alzheimer's disease. Brain 2015;138(Pt 8). Maioli S, Båvner A, Ali Z, Heverin M, Ismail MA, Puerta E et al. Is it possible to improve memory function by upregulation of the cholesterol 24S-hydroxylase (CYP46A1) in the brain? PLoS ONE 2013;8(7). Gjota-Ergin S, Gökçek-Saraç Ç, Adalı O, Jakubowska-Doğru E. Relationship between the hippocampal expression of selected cytochrome P450 isoforms and the animal performance in the hippocampus-dependent learning task. Neurosci Lett 2018;673. Zhang F, Li J, Na S, Wu J, Yang Z, Xie X et al. The involvement of PPARs in the selective regulation of brain CYP2D by growth hormone. Neuroscience 2018;379. Jacob A, Potin S, Saubaméa B, Crete D, Scherrmann JM, Curis E et al. Hypoxia interferes with aryl hydrocarbon receptor pathway in hCMEC/D3 human cerebral microvascular endothelial cells. J Neurochem 2015;132(4). Rahman MS, Thomas P. Molecular characterization and expression of cytochrome P450 aromatase in atlantic croaker brain: regulation by antioxidant status and nitric oxide synthase during hypoxia stress. Front Physiol 2021;12. Wan Y, Ge RL, Cao Y, Luo L, Ji W. Chronic hypobaric hypoxia stimulates differential expression of cognitive proteins in hippocampal tissue. High Alt Med Biol 2025;26(2). Liu M, Alkayed NJ. Hypoxic preconditioning and tolerance via hypoxia inducible factor (HIF) 1alpha-linked induction of P450 2C11 epoxygenase in astrocytes. J Cereb Blood Flow Metab 2005;25(8). Bai X, Yang J, Liu G, Zhu J, Wang Q, Gu W et al. Regulation of CYP450 and drug transporter mediated by gut microbiota under high-altitude hypoxia. Front Pharmacol 2022;13. Duan Y, Bai X, Yang J, Zhou Y, Gu W, Liu G et al. Exposure to high-altitude environment is associated with drug transporters change: microRNA-873-5p-mediated alteration of function and expression levels of drug transporters under hypoxia. Drug Metab Dispos 2022;50(2). Cui D, Xu X. DNA methyltransferases, DNA methylation, and age-associated cognitive function. Int J Mol Sci 2018;19(5). Bahado-Singh RO, Vishweswaraiah S, Turkoglu O, Graham SF, Radhakrishna U. Alzheimer's precision neurology: epigenetics of cytochrome P450 genes in circulating cell-free dna for disease prediction and mechanism. Int J Mol Sci 2023;24(3). Additional Declarations No competing interests reported. Supplementary Files Originalimagesofwesternblot.docx Cite Share Download PDF Status: Published Journal Publication published 20 Mar, 2026 Read the published version in Journal of Neuroinflammation → Version 1 posted Editorial decision: Revision requested 02 Nov, 2025 Reviews received at journal 02 Nov, 2025 Reviews received at journal 01 Nov, 2025 Reviewers agreed at journal 06 Oct, 2025 Reviewers agreed at journal 06 Oct, 2025 Reviewers agreed at journal 14 Sep, 2025 Reviewers agreed at journal 12 Sep, 2025 Reviewers invited by journal 12 Sep, 2025 Editor assigned by journal 12 Sep, 2025 Submission checks completed at journal 11 Sep, 2025 First submitted to journal 08 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7565540","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":516463759,"identity":"fdccb934-f86d-40e7-b07b-e92a7d9940d0","order_by":0,"name":"Qian Wang","email":"","orcid":"","institution":"Qinghai University","correspondingAuthor":false,"prefix":"","firstName":"Qian","middleName":"","lastName":"Wang","suffix":""},{"id":516463760,"identity":"c7f06ed4-edc7-4040-8c68-95bcc9104d8f","order_by":1,"name":"Junjun Han","email":"","orcid":"","institution":"Qinghai University","correspondingAuthor":false,"prefix":"","firstName":"Junjun","middleName":"","lastName":"Han","suffix":""},{"id":516463761,"identity":"40fa8a40-4a03-4c94-86a5-39120d681f6a","order_by":2,"name":"Guiqin Liu","email":"","orcid":"","institution":"Qinghai University","correspondingAuthor":false,"prefix":"","firstName":"Guiqin","middleName":"","lastName":"Liu","suffix":""},{"id":516463762,"identity":"3c549065-cfd2-4c7a-9ff4-34e31f393f11","order_by":3,"name":"Yabin Duan","email":"","orcid":"","institution":"Qinghai University Affiliated Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yabin","middleName":"","lastName":"Duan","suffix":""},{"id":516463763,"identity":"432a5547-0aa1-466f-977f-2a906829bfa4","order_by":4,"name":"Delong Duo","email":"","orcid":"","institution":"Qinghai Provincial Peoples Hospital","correspondingAuthor":false,"prefix":"","firstName":"Delong","middleName":"","lastName":"Duo","suffix":""},{"id":516463764,"identity":"88ca11af-ddea-44c0-babf-de42c7256474","order_by":5,"name":"Junbo Zhu","email":"","orcid":"","institution":"Qinghai University","correspondingAuthor":false,"prefix":"","firstName":"Junbo","middleName":"","lastName":"Zhu","suffix":""},{"id":516463765,"identity":"15222d58-9142-48b4-99ad-d478f9353240","order_by":6,"name":"Yue Lin","email":"","orcid":"","institution":"Qinghai University","correspondingAuthor":false,"prefix":"","firstName":"Yue","middleName":"","lastName":"Lin","suffix":""},{"id":516463768,"identity":"19fe9031-4773-42ab-9b89-99b503f83a7e","order_by":7,"name":"Yawen Xin","email":"","orcid":"","institution":"Qinghai University","correspondingAuthor":false,"prefix":"","firstName":"Yawen","middleName":"","lastName":"Xin","suffix":""},{"id":516463773,"identity":"183f6cc0-fbbc-4cc7-98c5-3175c5d6f27f","order_by":8,"name":"Xiangyang Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAArUlEQVRIiWNgGAWjYDACCSB+wMAgx8befoAELQkMDMZ8PGcSSNOSOE/CwYA4HXy3uxM/JLYdTm+TAOr8UbGNsBbJO2c3SyScOZzbJt14gLHnzG3CWgxu5G5jSKgAapE5kMDM2Ea0FoPD6WwSCQakaKk4nEC8FskbuSC/pBu2AQP5IFF+4buRu/HDxzZrefn29oMPflQQoYXhAJhsRmITqaWOOMWjYBSMglEwMgEAbE1Ancqjb/4AAAAASUVORK5CYII=","orcid":"","institution":"Qinghai University","correspondingAuthor":true,"prefix":"","firstName":"Xiangyang","middleName":"","lastName":"Li","suffix":""},{"id":516463774,"identity":"fb42ad2d-d18a-4ced-a1b2-2e682cb4972e","order_by":9,"name":"Ting Li","email":"","orcid":"","institution":"Qinghai University","correspondingAuthor":false,"prefix":"","firstName":"Ting","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2025-09-08 14:53:26","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7565540/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7565540/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12974-026-03775-6","type":"published","date":"2026-03-20T15:57:32+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":91702757,"identity":"babf8772-0ce5-422d-8bee-60409e3ebff6","added_by":"auto","created_at":"2025-09-19 10:52:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":308380,"visible":true,"origin":"","legend":"\u003cp\u003eChanges in physiological and biochemical parameters in rats under high-altitude hypoxia. (A) Changes in the blood parameters of the rats. (B) Changes in the biochemical parameters of the rats. (LAC: low-altitude control group, HAH-7: high-altitude hypoxia 7-day group, HAH-30: high-altitude hypoxia 30-day group, HAH-90: high-altitude hypoxia 90-day group, \u003cem\u003en\u003c/em\u003e = 10, *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 vs. LAC group)\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-7565540/v1/fa12f6858a758e7dc9bfd81e.png"},{"id":91702761,"identity":"d63b3da5-8030-4a13-94d0-30e1a46b992a","added_by":"auto","created_at":"2025-09-19 10:52:57","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":704759,"visible":true,"origin":"","legend":"\u003cp\u003eHistological changes in the rat brain under high-altitude hypoxia. (A) Rat brain tissue HE staining (400×). (B) Neuronal Nissl staining and counting results for rat hippocampal tissue (400×). (C) TEM analysis of the ultrastructures of the hippocampal and cortical regions (25000×). (LAC: low-altitude control group, HAH-7: high-altitude hypoxia 7-day group, HAH-30: high-altitude hypoxia 30-day group, HAH-90: high-altitude hypoxia 90-day group, \u003cem\u003en\u003c/em\u003e = 3, *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 vs. LAC group)\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-7565540/v1/9e8c240627b0a9c5c8768eb0.png"},{"id":91702758,"identity":"8af98b1c-1e08-4a5f-8c52-5133c163d9c1","added_by":"auto","created_at":"2025-09-19 10:52:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":523496,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of high-altitude hypoxia on memory and learning ability in rats. (A) The procedure for the Morris water maze experiment. (B) The escape latency of rats in the training trials of the hidden platform test. (C) Number of times the rat crossed the platform in the probe test. (D) Relative time spent by the rats in the target quadrant in the probe test. (E) The average swimming speed of the rats in the probe test. (F) The representative search traces of rats in the hidden platform test. (G) The representative search traces of rats in the probe test. (H) Immunohistochemical results of p-Tau and Aβ in high-altitude hypoxia (40×). (LAC: low-altitude control group, HAH-7: high-altitude hypoxia 7-day group, HAH-30: high-altitude hypoxia 30-day group, HAH-90: high-altitude hypoxia 90-day group,\u003cem\u003e \u003c/em\u003e*\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 vs. LAC group)\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-7565540/v1/a249e558ef033e0d09fe95ea.png"},{"id":91702759,"identity":"6bae0395-a960-430e-90c8-0a215a148fcf","added_by":"auto","created_at":"2025-09-19 10:52:56","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":338457,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of high-altitude hypoxia on the level of neuroinflammation in rats. (A) Expression levels of inflammatory factors in brain tissue under high-altitude hypoxia. (B) Immunohistochemical results of IBA1 and GFAP under high-altitude hypoxia (40×). (LAC: low-altitude control group, HAH-7: high-altitude hypoxia 7-day group, HAH-30: high-altitude hypoxia 30-day group, HAH-90: high-altitude hypoxia 90-day group, *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 vs. LAC group)\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-7565540/v1/98f9984cf474b89a9961411d.png"},{"id":91703707,"identity":"03e4b7dd-dc51-4058-94eb-9e74870fefe3","added_by":"auto","created_at":"2025-09-19 11:00:57","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":485570,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of high-altitude hypoxia on oxidative lipid metabolites. (A) Score scatter plot for the PCA model. (B) Score scatter plot for the OPLS-DA model. (C) Heatmap of hierarchical clustering analysis results. (D) KEGG enrichment analysis of differential metabolites. (E) Effects of high-altitude hypoxia on the levels of oxidative lipid metabolites in the arachidonic acid pathway. (LAC: low-altitude control group, HAH-7: high-altitude hypoxia 7-day group, HAH-30: high-altitude hypoxia 30-day group, HAH-90: high-altitude hypoxia 90-day group, \u003cem\u003en\u003c/em\u003e = 5, *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 vs. LAC group)\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-7565540/v1/1f3b24c8f33b5e4c3919d702.png"},{"id":91702766,"identity":"e89cdd5a-7d75-4774-9a9d-927ca8e0b49a","added_by":"auto","created_at":"2025-09-19 10:52:57","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":240571,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of hypoxia on the expression of cytochrome P450 in rats. (A) mRNA expression of cytochrome P450. (B) Protein expression of cytochrome P450 (LAC: low-altitude control group, HAH-7: high-altitude hypoxia 7-day group, HAH-30: high-altitude hypoxia 30-day group, HAH-90: high-altitude hypoxia 90-day group, \u003cem\u003en\u003c/em\u003e = 3, *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 vs. LAC group)\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-7565540/v1/4849b1caadba08b01aca6bcb.png"},{"id":91703705,"identity":"c5110e9c-1fd1-47f1-af6e-1933ae904731","added_by":"auto","created_at":"2025-09-19 11:00:57","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":468544,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of hypoxia on astrocytes. (A) Effect of hypoxia on astrocyte survival. (B) Effect of hypoxia on inflammatory factor expression. (C) Effects of hypoxia on Aβ and p-Tau expression. (D) Effect of hypoxia on apoptosis. (E) Effect of hypoxia on CYP450 mRNA expression. (F) Effect of hypoxia on CYP450 protein expression. (\u003cem\u003en\u003c/em\u003e= 3, *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 vs. normoxia group)\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-7565540/v1/96dad30e10c4d926f0b92a60.png"},{"id":91702772,"identity":"37983f9a-e9f2-4c78-9df2-1973506f2de8","added_by":"auto","created_at":"2025-09-19 10:52:57","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":570493,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of CYP450 inhibition on astrocytes under hypoxic conditions. (A) Reproductive toxicity testing of MS-PPOH and 17-ODYA on astrocytes. (B) Changes in CYP450 mRNA expression after CYP450 inhibition. (C) Changes in CYP450 protein expression after CYP450 inhibition. (D) Changes in inflammatory factor expression after CYP450 inhibition. (E) Immunofluorescence staining of Aβ, p-Tau, GFAP, and ROS expression following CYP450 inhibition (400×; green: Aβ/p-Tau/GFAP/ROS; blue: DAPI). (F) Changes in apoptosis after CYP450 inhibition. (\u003cem\u003en\u003c/em\u003e = 3, *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 vs. normoxia group, \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 vs. hypoxia group)\u003c/p\u003e","description":"","filename":"image8.png","url":"https://assets-eu.researchsquare.com/files/rs-7565540/v1/6f81cac08913527efde6ebc7.png"},{"id":91703710,"identity":"474aa750-d496-4d41-a4db-2cb0664618d6","added_by":"auto","created_at":"2025-09-19 11:00:57","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":684497,"visible":true,"origin":"","legend":"\u003cp\u003eThe effects of high-altitude hypoxia on DNA methylation. (A) Effects of high-altitude hypoxia on the expression of 5-mC in rats. (B) Effects of high-altitude hypoxia on the expression of epigenetic markers in rats. (C) Predicted CpG islands in the \u003cem\u003eCYP2C11\u003c/em\u003egene promoter region. (D) BSP analysis results for the methylation sites of \u003cem\u003eCYP2C11\u003c/em\u003e. (E) Effect of hypoxia on the methylation rates of partial methylation sites in the\u003cem\u003e CYP2C11\u003c/em\u003e gene promoter region. (LAC: low-altitude control group, HAH-7: high-altitude hypoxia 7-day group, HAH-30: high-altitude hypoxia 30-day group, HAH-90: high-altitude hypoxia 90-day group, \u003cem\u003en \u003c/em\u003e= 3, *\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05 vs. LAC group)\u003c/p\u003e","description":"","filename":"image9.png","url":"https://assets-eu.researchsquare.com/files/rs-7565540/v1/7643b166dfd1a8595c58707b.png"},{"id":91702765,"identity":"e0983938-01f6-424a-94c0-1f80e79c05a3","added_by":"auto","created_at":"2025-09-19 10:52:57","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":234852,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of 5-Aza-dC inhibition on astrocytes under hypoxic conditions. (A) Reproductive toxicity testing of 5-Aza-dC on astrocytes. (B) Effects of 5-Aza-dC treatment on CYP2C11 protein and mRNA expression. (C) Effects of 5-Aza-dC treatment on inflammatory factor expression. (D) Effects of 5-Aza-dC treatment on Aβ and p-Tau expression. (400×; green: Aβ and p-Tau; blue: DAPI) (\u003cem\u003en\u003c/em\u003e = 3, *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 vs. normoxia group, \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 vs. hypoxia group)\u003c/p\u003e","description":"","filename":"image10.png","url":"https://assets-eu.researchsquare.com/files/rs-7565540/v1/fab61abc7a01f08e15bf8787.png"},{"id":91702770,"identity":"d1819b96-f353-47b7-b23a-3edb1c610dcf","added_by":"auto","created_at":"2025-09-19 10:52:57","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":480996,"visible":true,"origin":"","legend":"\u003cp\u003eThe mechanism by which high-altitude hypoxia exacerbates neuroinflammation and cognitive impairment through the CYP450-oxidised lipid axis mediated by DNA methylation.\u003c/p\u003e","description":"","filename":"image11.png","url":"https://assets-eu.researchsquare.com/files/rs-7565540/v1/b937795bb658fc40448906b0.png"},{"id":105223257,"identity":"4a70822f-16e1-42fa-bdf7-7cafc5f418bb","added_by":"auto","created_at":"2026-03-23 16:00:47","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6625299,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7565540/v1/6517d0ac-fba9-4a82-b248-7d5fabcac0d6.pdf"},{"id":91703703,"identity":"6c3508a2-25e3-44ba-9295-ed68c560bf14","added_by":"auto","created_at":"2025-09-19 11:00:57","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":4734280,"visible":true,"origin":"","legend":"","description":"","filename":"Originalimagesofwesternblot.docx","url":"https://assets-eu.researchsquare.com/files/rs-7565540/v1/e62b716e2358c6351198e56b.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"DNA methylation regulation of CYP450-lipid metabolism by high-altitude hypoxia: linking neuroinflammation to cognitive impairment","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eHigh-altitude environments are characterized by low oxygen levels. The reduction in oxygen partial pressure leads to decreased tissue oxygen utilization, which ultimately disrupts the body's internal balance. Consequently, for travelers at high altitudes, mountaineers, and special military personnel in high-altitude regions, hypoxia is the primary source of physiological harm. High-altitude hypoxia can inflict considerable harm on the respiratory, cardiovascular, and circulatory systems, along with the central nervous system (CNS), with especially pronounced consequences. Although comprising merely 2% of total body weight, brain tissue utilizes up to 20% of the body's total oxygen, rendering it highly susceptible to hypoxic conditions [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Exposure to mild hypoxia can induce a series of adverse neurological reactions. These initially manifest primarily as emotional disorders, such as anxiety and depression, accompanied by the activation of oxidative stress and neuroinflammatory responses. These changes can lead to alterations in synaptic plasticity and damage the microstructure of the brain, which can ultimately result in cognitive decline. As the severity of hypoxia increases or the exposure time is prolonged, these pathological changes may progress to high-altitude-specific brain injury. This can include high-altitude headache (HAH), acute mountain sickness (AMS), and, in severe cases, potentially fatal high-altitude cerebral edema (HACE) [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe brain possesses a high concentration of polyunsaturated fatty acids (PUFAs), rendering brain tissue particularly vulnerable to lipid metabolism abnormalities in hypoxic settings, thereby facilitating the onset of hypoxic neurological impairment [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Bioactive lipid mediators originating from the metabolism of arachidonic acid (AA) and associated PUFAs are termed oxidized lipids. These lipids are predominantly synthesized via three metabolic pathways: oxidation by cyclooxygenases (COX-1 and COX-2), yielding prostaglandins (PGs) and thromboxane compounds (TXs); oxidation by lipoxygenase (LOX), resulting in leukotrienes, lipoxins (LXs), and hydroxy-eicosatetraenoic acids (HETEs); and metabolism by cytochrome P450 (CYP450), producing eicosapentaenoic acids (EETs) and HETEs. Oxidized lipids exist throughout the body as free radicals. They influence cellular functions through autocrine or paracrine processes by binding to G protein-coupled receptors (GPCRs) or nuclear receptors located on cell membrane surfaces [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. These oxidized lipids can elicit a diverse array of biological consequences. As principal regulators of disease pathology and significant mediators of inflammatory responses, they regulate diverse activities, including sleep, memory, learning functions, neuroinflammatory responses, and neurodegenerative and neuropsychiatric diseases [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Consequently, oxidized lipids are regarded as biomarkers that can clarify the phases of tissue damage and disease progression. CYP450 is a crucial catalytic enzyme in lipid oxidation synthesis whose expression is directly influenced by hypoxia. Its metabolites, including EETs and HETEs, have been demonstrated to play a role in regulating brain function under hypoxic conditions by modulating vascular tension and inflammatory responses [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. However, there is no direct evidence that the CYP450-oxidized lipid axis facilitates the cognitive impairment and neuroinflammation associated with high-altitude hypoxia.\u003c/p\u003e\u003cp\u003eEpigenetic regulation, particularly DNA methylation, may be a key link between hypoxic stress and the dysregulation of CYP450 expression. DNA methylation refers primarily to the process by which methyl groups are added to the C5 position of the cytosine ring within CpG dinucleotides via DNA methyltransferases. The promoter regions of several CYP450 genes, such as \u003cem\u003eCYP1A2\u003c/em\u003e, \u003cem\u003eCYP2E1\u003c/em\u003e, \u003cem\u003eCYP2C9\u003c/em\u003e, \u003cem\u003eCYP2C19\u003c/em\u003e, and \u003cem\u003eCYP3A4\u003c/em\u003e, contain CpG island structures, making their expression highly susceptible to dynamic regulation by DNA methylation [\u003cspan additionalcitationids=\"CR13\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Recently, numerous studies have shown that hypoxic stress can significantly induce genome-wide reprogramming of DNA methylation, thereby affecting gene expression patterns. This epigenetic regulatory mechanism is important for the body's adaptation to hypoxia [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Notably, previous studies have confirmed the abnormal methylation of specific CYP450 promoter regions, such as that of CYP2S1, under hypoxic conditions [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Nonetheless, whether DNA methylation also affects the expression of additional CYP450 members under hypoxic conditions remains to be further examined.\u003c/p\u003e\u003cp\u003eThis study employed ultrahigh-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) technology combined with animal behavioral assessment and epigenetic detection to systematically investigate the cascading regulatory mechanism of the DNA methylation-CYP450-oxidized lipid axis in hypoxia-induced brain injury on the basis of the above scientific questions. These findings not only bridge a knowledge gap regarding the molecular processes of brain damage caused by high-altitude hypoxic environments but also provide a crucial theoretical foundation for the development of neuroprotective treatments aimed at the CYP450-oxidized lipid pathway.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1. Chemicals and reagents\u003c/h2\u003e\u003cp\u003eAll oxidized lipid standards were purchased from Cayman Chemical (Ann Arbor, MI, USA). Enzyme-linked immunosorbent assay (ELISA) kits for HIF-1α, IL-6, NF-κB, iNOS, TNF-α, IL-1β, and 5-mC were obtained from Shanghai Kexing Trading (Shanghai, China). The following primary antibodies were used: polyclonal amyloid-β (Aβ) (Immunoway, Cat: YT0226, Plano, TX, USA); polyclonal phospho-Tau (p-Tau) (Bioss, Cat: bs-3489R, Beijing, China); monoclonal ionophore-binding protein 1 (IBA1) (zenbio, Cat: R382207, Chengdu, China); glial fibrillary acidic protein (GFAP) (Servicebio, Cat: GB11096, Wuhan, China); polyclonal β-actin (Immunoway, Cat: YT0099, Plano, TX, USA); polyclonal CYP2C23 (Proteintech, Cat: 16546-1-AP, Wuhan, China); polyclonal CYP2J3 (Proteintech, Cat: 13562-1-AP, Wuhan, China); polyclonal CYP211 (Biorbyt, Cat: Orb5951, Cambridge, UK); polyclonal CYP4F1 (Biorbyt, Cat: Orb214800, Cambridge, UK); monoclonal CYP2C22 (Abcam, Cat: Ab137015, Cambridge, UK); and monoclonal CYP4A2 (Abcam, Cat: Ab140635, Cambridge, UK). The RNA extraction kit (Cat: R30922), ReverTra Ace qPCR RT Master Mix (Cat: Q20620), and TransScript One-Step gDNA Removal and cDNA Synthesis Kit (Cat: R10905) were purchased from TransGen Biotech (Beijing, China). An Annexin V-FITC/PI cell apoptosis detection kit (Cat: G1511) was purchased from Servicebio (Wuhan, China). A rapid DNA extraction kit (Cat: B518221) was purchased from Sangon Biotech (Shanghai, China). The EZ DNA Methylation-Gold\u0026trade; kit (Cat: D5005) was purchased from ZYMO RESEARCH (CA, USA). The 17-ODYA (Cat: HY-101016), MS-PPOH (Cat: HY-114759), and 5-azacitidine-2'-deoxycytidine (5-Aza-dC) (Cat: HY-A0004) were purchased from MedChemExpress (Monmouth Junction, NJ, USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2. Treatment of animals\u003c/h2\u003e\u003cp\u003eMale Sprague Dawley rats weighing 180\u0026ndash;220 g were obtained from the Laboratory Animal Center of Xi'an Jiaotong University Medical College (License No. SCXK (Shaanxi) 2023\u0026ndash;002). All the rats were housed in separate rooms per cage with a constant temperature (22\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C), constant humidity (55\u0026thinsp;\u0026plusmn;\u0026thinsp;10%), and a 12 h light/12 h dark cycle. All experimental procedures were performed in strict accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and the protocol was approved by the Animal Ethics Committee of Qinghai University (Approval No. PJ-202302-12).\u003c/p\u003e\u003cp\u003eThe rats were randomly divided into four groups: a low-altitude control group (LAC, Xi'an City, Shaanxi Province, altitude: 390 m, PaO\u003csub\u003e2\u003c/sub\u003e: 20.2 kPa); a high-altitude hypoxia for 7 days group (HAH-7), a high-altitude hypoxia for 30 days group (HAH-30), and a high-altitude hypoxia for 90 days group (HAH-90). The HAH groups were housed in Maduo County, Guoluo Tibetan Autonomous Prefecture, Qinghai Province, China (altitude: 4,300 m, PaO\u003csub\u003e2\u003c/sub\u003e: 12.4 kPa) for the corresponding durations. The samples were promptly frozen and preserved in liquid nitrogen after post-collection before being dispatched to the Plateau Medicine Research Center at Qinghai University for analysis.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3. Morris water maze (MWM) experiment\u003c/h2\u003e\u003cp\u003eThe MWM apparatus is a circular pool with a height of 50 cm, a diameter of 180 cm, and a depth of 30 cm. The water temperature in the MWM test was maintained at 22\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C. The pool was partitioned into four equal quadrants, featuring a circular platform with a diameter of 10 cm positioned at the center of quadrant 2 and submerged 2 cm beneath the water surface. The pool was surrounded by sufficient visual cues to serve as references. The actions of the rats in the water maze were recorded via the BAS-100 animal behavioral experiment analysis system (TECHMAN, Chengdu, China). Acquisitive training was conducted for 5 days, 4 times per day, in which the rats were sequentially placed into the water from the first, second, third, and fourth quadrants facing the wall of the pool, and the time it took for the rats to find a safe platform was recorded; if the rats did not find the platform within 2 min, they were guided to the platform for 20 s. The day after the final acquisition training session, the platform was removed and the rats were allowed to explore freely. The rats were placed in the water from the opposite side to the original location of the platform and were allowed to swim freely for 120 s (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). The time spent in the quadrant where the platform was located, the average swimming speed, the number of times the rats entered the platform area, and the path of movement were recorded to test the ability of the rat to memorize space.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4. Determination of physiological and biochemical indices\u003c/h2\u003e\u003cp\u003eThe rats in each group were anesthetized via an intraperitoneal injection of 20% urethane (1 g/kg) before blood collection. 1 mL of whole blood was drawn from the main abdominal vein into an anticoagulant tube containing EDTA-K\u003csub\u003e2\u003c/sub\u003e, and the following routine blood parameters were measured via an XN-10 automatic hematology analyzer (Sysmex Corporation, Tokyo, Japan): red blood cell count (RBC), hemoglobin (HGB), white blood cell count (WBC), platelet count (PLT), hematocrit (HCT), mean corpuscular volume (MCV), and mean platelet volume (MPV). 2 mL of whole blood was centrifuged in a tube without anticoagulant and centrifuged, and the serum was extracted. The following blood biochemical parameters were measured via an AU5800 automatic biochemistry analyzer (Olympus Corporation, Tokyo, Japan): alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), total protein (TP), albumin (ALB), lactate dehydrogenase (LDH), total bilirubin (TBIL), globulin (GLOB), uric acid (UA), creatinine (CREA), glucose (GLU), cholesterol (CHOL), and triglycerides (TG).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5. Hematoxylin-eosin (HE) staining\u003c/h2\u003e\u003cp\u003eThe rats were anesthetized via the intraperitoneal injection of 20% urethane (1 g/kg). The abdominal cavity of each animal was exposed with surgical scissors and forceps to reveal the heart. A needle was inserted into the right atrium, and the sinusoidal vein was clamped with arterial forceps. The animals were then perfused with saline (for approximately 30 min) until their livers turned white and then with 4% paraformaldehyde until their livers hardened and their tails stiffened. After complete fixation, the head of the rat was cut off, and the brain was removed. The rat brains were soaked in 4% paraformaldehyde for 1 day, then dehydrated, paraffin-embedded, sectioned (5 \u0026micro;m), and stained with hematoxylin and eosin, and placed under a Pannoramic 250 digital section scanner (3DHISTECH, Hungary) for image acquisition of the sections.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6. Nissl staining\u003c/h2\u003e\u003cp\u003eRat brain tissues fixed with 4% paraformaldehyde were taken, paraffin-embedded, and sectioned. The samples were stained with 1% toluidine blue at 56\u0026deg;C for 20 min, soaked in 70% alcohol for 1 min, and differentiated in 95% alcohol until the positive expression was shown clearly. The tissues were subsequently dehydrated in 75%, 85%, 95%, and 100% ethanol, each for 1 min, and then blocked with a neutral resin after transparency was achieved using xylene. The sections were positioned under a Pannoramic 250 digital section scanner (3DHISTECH, Hungary) for image acquisition.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7. Transmission electron microscopy (TEM)\u003c/h2\u003e\u003cp\u003eSamples prefixed with 3% glutaraldehyde were refixed with 1% osmium tetroxide, dehydrated in series with acetone, infiltrated with Epox 812 for a longer time, and embedded. The semithin sections were stained with methylene blue, and the ultrathin sections were cut with a diamond knife and stained with uranyl acetate and lead citrate. The sections were examined with a JEM-1400FLASH transmission electron microscope (JEOL, Tokyo, Japan).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8. Immunohistochemical analysis\u003c/h2\u003e\u003cp\u003eRat brain tissues fixed with 4% paraformaldehyde were paraffin-embedded and sectioned. The sections were immersed in citrate buffer (pH 6.0) for antigen retrieval, subsequently followed by endogenous peroxidase blocking with 3% hydrogen peroxide at room temperature in the dark. Following three washes with PBS, the sections were blocked with bovine serum at room temperature for 20 min. The primary antibody was subsequently applied and incubated overnight at 4\u0026deg;C. After being washed with PBS, the sections were incubated with the secondary antibody at 37\u0026deg;C for 30 min and rewashed with PBS. DAB was used for chromogenic detection, and hematoxylin was used for restaining. The sections were dehydrated via a graded ethanol series, cleared in xylene, and subsequently mounted with neutral resin. Finally, images were acquired using a BA400 digital microscopy imaging system (Motic, Xiamen, China).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9. Targeted oxidized lipid metabolomics analysis\u003c/h2\u003e\u003cp\u003eEach group of rats was euthanized by decapitation, and their brains were swiftly collected and stored at -80\u0026deg;C. 50 mg of rat brain tissue was weighed accurately. After the addition of 600 \u0026micro;L of extract solution (80% methanol/H\u003csub\u003e2\u003c/sub\u003eO (v/v), precooled at -40\u0026deg;C, containing an isotopically labeled internal standard mixture), homogenize and sonicate in an ice bath. Then, an aliquot of the supernatant was transferred to an EP tube, and water was added. After vortexing for 30 s, the sample was further purified with SPE. The SPE cartridges were equilibrated with 1 mL of MeOH and 1 mL of water. After loading a sample, the samples were eluted with MeOH, and then the eluent was evaporated to dryness under a gentle stream of nitrogen and reconstituted in 30% ACN/H\u003csub\u003e2\u003c/sub\u003eO (v/v). After vortexing the recombinant solution, homogenize it using ultrasound. After centrifugation, transfer the recombinant solution to an EP tube with a filter membrane and centrifuge again. Take the supernatant for UHPLC-MS/MS analysis.\u003c/p\u003e\u003cp\u003eThe UHPLC separation was carried out using an ACQUITY Premier (Waters, Milford, Massachusetts, USA), equipped with a Waters ACQUITY UPLC BEH C18 column (150 \u0026times; 2.1 mm, 1.7 \u0026micro;m, Waters). The mobile phase A was 0.01% formic acid in water, and the mobile phase B was 0.01% formic acid in acetonitrile. The column temperature was set at 50\u0026deg;C. The autosampler temperature was set at 4\u0026deg;C, and the injection volume was 10 \u0026micro;L.\u003c/p\u003e\u003cp\u003eA SCIEX Triple Quad\u0026trade; 6500\u0026thinsp;+\u0026thinsp;mass spectrometer (Sciex), equipped with an IonDrive Turbo V electrospray ionization (ESI) interface, was applied for assay development. Typical ion source parameters were as follows: curtain gas\u0026thinsp;=\u0026thinsp;40 psi, ion spray voltage = -4500 V, temperature\u0026thinsp;=\u0026thinsp;500\u0026deg;C, ion source gas 1\u0026thinsp;=\u0026thinsp;30 psi, and ion source gas 2\u0026thinsp;=\u0026thinsp;30 psi. SCIEX Analyst Work Station Software (Version 1.6.3) and Multiquant 3.03 software were employed for MRM data acquisition and processing.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.10. Cell culture\u003c/h2\u003e\u003cp\u003eNeonatal rats were decapitated after alcohol disinfection. The brains were isolated in cold dissection buffer, and the vascular membrane was removed. The tissue was minced and digested with 0.25% EDTA-free trypsin, followed by serum-containing medium to terminate digestion. After filtration through a 70 \u0026micro;m mesh, the cell suspension was centrifuged and resuspended in DMEM/F12 with 20% FBS. The cells were seeded at 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e/mL in polylysine-coated T25 flasks and cultured. Astrocytes were identified via fluorescence microscopy. They were then cultured in an incubator set at 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e, and 90% relative humidity. Once the cells reached the optimal culture conditions, the control group was treated with normal oxygen, while the hypoxia group was treated with 2% O\u003csub\u003e2\u003c/sub\u003e for 3, 6, 12, 24, and 48 h.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e2.11. Immunofluorescence analysis\u003c/h2\u003e\u003cp\u003eThe cell smears were fixed with 4% paraformaldehyde and then washed with a PBS buffer solution. The slides were incubated in a wet box with blocking serum at 37\u0026deg;C for 60 min to prevent nonspecific binding. Following the blocking, the primary antibody was applied at the appropriate concentration, and the slides were subsequently incubated overnight at 4\u0026deg;C. Following PBS washing, the fluorescently labeled secondary antibody was applied, and the slides were incubated at 37\u0026deg;C in the dark for 1 h. Subsequently, another wash with PBS was conducted. DAPI solution was added dropwise, and the samples were incubated in the dark for 10 min to stain the nuclei. The samples were subsequently washed with PBS, mounted with glycerol, and observed and imaged immediately under a DM3000 fluorescence microscope (Leica, Germany).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e2.12. Flow cytometry\u003c/h2\u003e\u003cp\u003eFollowing digestion with pancreatic enzymes, the mixture was centrifuged to isolate the cells. Following washing with PBS, the cells were resuspended in prechilled 1\u0026times; binding buffer. The cell concentration was modified, and Annexin V-FITC and PI were added. The mixture was mixed gently and incubated at room temperature in the dark for 10 min. Subsequently, prechilled 1\u0026times; binding buffer was added, and immediate analysis was conducted with a BeamCyte-1026 flow cytometer (BeamCyte Biotechnology, Changzhou, China).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e2.13. ELISA\u003c/h2\u003e\u003cp\u003eRat brain tissue samples were minced and added to cold physiological saline, homogenized in an ice bath, and centrifuged at 3000 rpm for 10 min, after which the supernatant was collected. Astrocytes were centrifuged at 3000 rpm for 10 min to remove particles and polymers, and the supernatant was collected. The tissue homogenate and cell supernatant were then subjected to ELISA testing according to the manufacturer's experimental instructions.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e2.14. Western blot\u003c/h2\u003e\u003cp\u003eTotal protein was extracted from the brains of rats and astrocytes using RIPA lysis, and the bicinchoninic acid method was used for protein quantification. SDS-PAGE was used to separate the protein samples, which were subsequently transferred onto a polyvinylidene difluoride (PVDF) membrane. The PVDF membrane was immersed in TBST containing 5% skim milk powder and blocked on a room temperature shaker for 2 h. The corresponding primary antibodies were diluted with the blocking solution, as followes: CYP2C23 (1:2000), CYP2C11 (1:1000), CYP2C22 (1:1000), CYP2J3 (1:2000), CYP4A2 (1:4000), CYP4F1 (1:500), and β-actin (1:1000), and the PVDF membrane was immersed in the primary antibody incubation solution and incubated at 4\u0026deg;C overnight. The PVDF membrane was washed with TBST 5 times and incubated with appropriate secondary antibodies for 2 h at room temperature. The PVDF membrane was washed with TBST 5 times. The membranes were imaged using an Amersham Imager 600 ELC system (General Electric, Boston, USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e2.15. Quantitative real-time polymerase chain reaction (RT‒qPCR)\u003c/h2\u003e\u003cp\u003eTotal RNA from rat brain tissue and astrocytes was extracted according to the kit instructions, and the purity of the RNA solution was checked using a NanoDrop 2000c spectrophotometer (Thermo, USA). The cDNA was synthesized by reverse transcription using the TransScript One-Step gDNA Removal and cDNA Synthesis Supermix Kit. The cDNA product from reverse transcription was amplified in three steps using a Roche Light Cycler 96 Real-Time Fluorescent Quantitative PCR Instrument (Roche, Switzerland), with the following reaction procedure: 94\u0026deg;C for 30 s, followed by 94\u0026deg;C for 5 s, 50\u003cb\u003e‒\u003c/b\u003e60\u0026deg;C for 15 s, and 72\u0026deg;C for 10 s, and the lysis curve was added after 45 cycles. The relative expression of the target gene was expressed as the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e value of the target protein and β-actin. The amplification primers for the target and internal reference genes are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eDesign and sequence of the primers.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGenes\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eOligonucleotide primer sequences(5\u0026prime;-3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eβ-actin\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTGAACGTGAAATTGTCCGAGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTGCCAATGGTGATGACCTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eCYP2C23\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGCCCTACACAGATGCCATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAATGTCACAGGTCACCGCAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eCYP2C11\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGTTTGACCCTGGCCACTTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCTCTCCAACACAAGCTCGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eCYP2C22\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGAGGACTTTTGGGATGGGCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAAGGTGGGATCAAAAGGGGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eCYP2J3\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTACATGGCCCTCTACGCAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGACGGCATTGGTATAGGGCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eCYP4A2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCAGGTCCTACACCAAGGCTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGACAAACGGCCATCAGAGGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eCYP4F1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACCCTGCTACTGTTTGGAGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGAGTGACCATGCCCACATGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eDNMT1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGGACGGAGTAAACAGGCTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACTCGCCTACAAGGAACAGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eDNMT3a\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGATGAGCCTGAGTATGAGGATGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCAAGACACAATTCGGCCTGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eDNMT3b\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGCGGGTATGAGGAGTGCAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGGAGCATCCTTCGTGTCTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eMeCP2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATGGTAGCTGGGATGTTAGGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGAGCTTTCTGATGTTTCTGCTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e2.16. Bisulfite-sequencing PCR (BSP)\u003c/h2\u003e\u003cp\u003eDNA was extracted from rat brain tissue using a rapid DNA extraction kit. Using the MethPrimer online tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.urogene.org/methprimer/\u003c/span\u003e\u003cspan address=\"http://www.urogene.org/methprimer/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), CpG islands were predicted based on the rat \u003cem\u003eCYP2C11\u003c/em\u003e gene sequence, and BSP primers were designed. The upstream primer sequence was 5'-AATGTAGGTAATAAAAGTAAAATTTTAAG-3' and the downstream primer sequence was 5'-ACAAAAACTCTAACTCCTCTTTCAAA-3'. The PCR amplification process was as follows: 95\u0026deg;C predenaturation for 5 min, followed by 35 cycles of 94\u0026deg;C denaturation for 30 s, 55\u0026deg;C annealing for 30 s, and 72\u0026deg;C extension for 40 s, with a final extension at 72\u0026deg;C for 8 min. After amplification, the PCR products were purified by gel electrophoresis and ligated into the pUC18-T vector system. The ligation reaction was incubated overnight at 16\u0026deg;C, followed by transformation into competent cells. The bacteria were cultured overnight at 37\u0026deg;C on plates containing ampicillin that had been pre-coated with 100 mM IPTG and 20 mg/mL X-gal. PCR was performed using a single colony as a template. The resulting bands were then purified and recovered for first-generation sequencing. The obtained sequences were analyzed via the quantitative methylation analysis tool (QUMA; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.quma.cdb.riken.jp/\u003c/span\u003e\u003cspan address=\"https://www.quma.cdb.riken.jp/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e2.17. Data analysis\u003c/h2\u003e\u003cp\u003eData were processed using SPSS 27.0 statistical software, and results were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Comparisons between groups were made by one-way analysis of variance (ANOVA), and two-by-two comparisons were made using the least significant difference method (LSD). \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 indicates a statistically significant difference.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003e3.1. High-altitude hypoxia induces neuroinflammation and cognitive impairment\u003c/h2\u003e\u003cdiv id=\"Sec22\" class=\"Section3\"\u003e\u003ch2\u003e3.1.1. Physiological and biochemical parameters and histomorphological changes in rats under high-altitude hypoxia\u003c/h2\u003e\u003cp\u003eHigh-altitude hypoxia significantly affected the hematological and biochemical parameters in rats. A routine blood analysis indicated time-dependent variations in the HAH group relative to the LAC group. HGB, RBC, and HCT levels exhibited a gradual increase in the HAH-7, HAH-30, and HAH-90 groups, whereas WBC levels showed a consistent decline. Furthermore, the MCV significantly decreased in the HAH-90 group, whereas the MPV significantly increased in both the HAH-7 and HAH-90 groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). These alterations may be linked to oxidative stress induced by hypoxia, immune regulation, and erythropoiesis. The biochemical parameters indicated that, in comparison to the LAC group, the levels of ALP, GLU, and TG gradually decreased in the HAH-7, HAH-30, and HAH-90 groups. In contrast, the level of CRP gradually increased. ALT, AST, TBIL, and ALB significantly increased in the HAH-90 group, whereas TP, GLOB, and LDH significantly increased in both the HAH-30 and HAH-90 groups. CREA exhibited dynamic changes: a decrease was observed in the HAH-7 group, whereas increases were noted in the HAH-30 and HAH-90 groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Those findings suggest that high-altitude hypoxia impacts metabolic and organ functions in rats.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe HE staining results indicated that the soft meningeal structure of the brain tissue from the LAC group remained intact and rich in blood vessels, exhibiting no significant inflammatory exudation. The cortical and hippocampal regions had dense and neatly arranged pyramidal cells. In the HAH group, as the duration of hypoxia increased, the cell bodies of dark-colored neurons in the cortical and hippocampal regions gradually decreased in size, their color gradually darkened, and their internal structures became blurred. Distinct axon-like structures were observed at the posterior region of the cell bodies (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Further Nissl staining of neurons revealed that those in the hippocampus region of the brains of rats in the LAC group exhibited a similar morphology, with plump neurons arranged in a regular pattern and distributed uniformly. Their cytoplasm contained abundant tiger-striped bodies and granular Nissl bodies. In contrast, rats exposed to a high-altitude hypoxic environment exhibited a sparse distribution of neurons in brain tissue, altered morphology, and indistinct nuclear morphology. The number of Nissl bodies in surviving neurons was reduced. Furthermore, the extent of neuronal damage worsened as the duration of hypoxia increased. Nissl-positive neuronal counts indicated that, compared with the LAC group, the HAH-90 group exhibited a significant reduction in positive neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). TEM revealed that the morphological structure of microglia and astrocytes in the hippocampus and cortical regions of the LAC group was normal and that the structure of neurons and synapses was intact. However, under high-altitude hypoxic conditions, significant pathological changes were observed in these cells: the perinuclear spaces of microglia were widened, their mitochondria were swollen with matrix dissolution and reduced electron density, and their rough endoplasmic reticulum was expanded with ribosomal detachment. Astrocytes exhibit similar mitochondrial damage, accompanied by increased autophagosomes and glial filaments. The neurons exhibited cell body shrinkage, widened perinuclear spaces, and abnormal chromatin. The synaptic structures were markedly abnormal, characterized by a reduced contact area between the presynaptic and postsynaptic membranes, thickening of the postsynaptic dense structures, blurred gaps, and fewer synaptic vesicles (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). These findings indicate that high-altitude hypoxia results in extensive damage to neurons and glial cells in brain tissue.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\u003ch2\u003e3.1.2. High-altitude hypoxia induces learning and memory impairment in rats\u003c/h2\u003e\u003cp\u003eThe MWM test is the most prevalent laboratory behavioral test for evaluating cognitive impairments in rodents. During the hidden platform test, the escape latency of the HAH-30 group significantly increased on days 2 and 5, and that of the HAH-90 group significantly increased on days 2, 3, 4, and 5 (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). In the probe test, compared with the LAC group, the HAH-7, HAH-30, and HAH-90 groups presented a significant reduction in the number of times they crossed the platform, and the HAH-7 and HAH-90 groups presented a significant reduction in the time spent in the target quadrant. The average swimming speed of the hypoxic groups did not differ significantly from that of the LAC group (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). These findings demonstrate that high-altitude hypoxia impairs learning and memory in rats, with longer exposure durations correlating with more pronounced effects on these cognitive functions.\u003c/p\u003e\u003cp\u003eThe deposition of Aβ and the hyperphosphorylation of Tau proteins can induce neurofibrillary tangles, leading to cognitive impairment via processes such as neuroinflammation and oxidative stress. Immunohistochemical analysis revealed that, compared with the LAC group, the levels of p-Tau and Aβ were significantly higher in the brain tissue of rats in the HAH-7, HAH-30, and HAH-90 groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH). These findings suggest that exposure to hypoxia significantly enhances the accumulation of pathological proteins linked to cognitive impairment.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec24\" class=\"Section3\"\u003e\u003ch2\u003e3.1.3. High-altitude hypoxia induces neuroinflammation in rats\u003c/h2\u003e\u003cp\u003eThis study examined the influence of hypoxia on neuroinflammation by quantifying the expression levels of hypoxia-inducible factor (HIF-1α), proinflammatory cytokines (IL-6, IL-1β, and TNF-α), and inflammatory regulatory factors (NF-κB and iNOS) in rat brain tissue. The findings indicated that, in contrast to those in the LAC group, the levels of HIF-1α in rat brain tissue were significantly elevated after exposure to a high-altitude hypoxic environment, confirming the occurrence of hypoxic stress. Moreover, the levels of IL-1β, IL-6, TNF-α, NF-κB, and iNOS were dramatically increased, with more pronounced alterations observed as the duration of hypoxia increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA), indicating the activation of the inflammatory response under hypoxic conditions. To further investigate the regulatory role of hypoxia in neuroinflammation, immunohistochemistry was used to determine the expression of the microglial marker IBA1 and the astrocyte marker GFAP in brain tissue. The findings indicated that, in comparison with the LAC group, the HAH-7, HAH-30, and HAH-90 groups presented substantial increases in IBA1-positive cell counts. The HAH-30 and HAH-90 groups presented an increase in GFAP-positive cell counts (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). These results indicate that high-altitude hypoxia promotes the expression of inflammatory factors and the inflammatory activation of glial cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec25\" class=\"Section2\"\u003e\u003ch2\u003e3.2. High-altitude hypoxia induces lipid metabolism disorders and downregulates CYP450 expression in rat brain tissue\u003c/h2\u003e\u003cdiv id=\"Sec26\" class=\"Section3\"\u003e\u003ch2\u003e3.2.1. High-altitude hypoxia induces lipid metabolism disorders in rat brain tissue\u003c/h2\u003e\u003cp\u003eTo investigate the role of oxidized lipids in hypoxia-induced neuroinflammation and cognitive impairment, this study employed targeted metabolomics to systematically analyze the differential profiles of oxidized lipids in rat brain tissues. Principal component analysis (PCA) was used to preliminarily examine the metabolite levels in each sample. The results revealed that the levels of oxidized lipid metabolites were relatively similar within each group. Additionally, as the duration of hypoxia increased, the three groups of rats exposed to high-altitude hypoxia trended to shift to the right in the PCA plot (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Further analysis using orthogonal partial least squares discriminant analysis (OPLS-DA) revealed no overlap between the LAC group and the HAH-30 and HAH-90 groups, with significant differences and clear distinctions (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). These findings suggest that the levels of oxidized lipid metabolites in the samples undergo regular changes with prolonged hypoxia, and these changes are sufficient to serve as biomarkers distinguishing normal from hypoxic states.\u003c/p\u003e\u003cp\u003eA total of 72 differentially expressed metabolites were detected through targeted oxidized lipidomes (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), including\u0026thinsp;\u0026plusmn;\u0026thinsp;8-HDoHE, 9-OxoODE, \u0026plusmn;\u0026thinsp;18-HETE, 8S,15S-DiHETE, and 16S-HETE, which were the five metabolites co-upregulated in the HAH-7, HAH-30, and HAH-90 groups. There were 51 co-downregulated metabolites, including 12S-HEPE, 15S-HEPE, \u0026plusmn;\u0026thinsp;5,6-DiHETrE, 13S-HOTrE, 15-keto PGF1α, 8-iso PGF2α, 19S-HETE, EPA, and 13,14-dihydro-15-keto PGD2, among others. Based on PUFA substrates, these metabolites can be grouped into 44 ARA metabolites, 12 DHA metabolites, 7 LA metabolites, 4 DGLA metabolites, 3 EPA metabolites, and 2 ALA metabolites. Based on metabolic pathways, these metabolites can be classified into 20 CYP450 metabolites, 29 LOX metabolites, 19 COX metabolites, and 4 metabolites from other pathways.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eTable of differential metabolite statistics\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGroup\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCpd_all\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCpd_up\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCpd_down\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLAC-HAH-7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e72\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e14\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e58\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLAC-HAH-30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e72\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLAC-HAH-90\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e72\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e13\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e59\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"4\"\u003eNote: LAC, HAH-7, HAH-30, and HAH-90 refer to the low-altitude control group, high-altitude hypoxia 7-day group, high-altitude hypoxia 30-day group, and high-altitude hypoxia 90-day group.\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eFollowing bidirectional cluster analysis of the samples and metabolic products, the heatmap clearly revealed distinct color blocks clustered in different regions. This finding indicates that oxidative lipid metabolism disorders are present in rat models of hypoxia-induced cognitive impairment and neuroinflammation, as manifested by the widespread downregulation of most PUFA metabolites (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Further KEGG pathway annotation of the measured metabolites revealed that the differentially metabolized oxidized lipids in rat brain tissue under hypoxia were enriched primarily in the AA metabolic pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Univariate statistical analysis of the metabolites identified 25 AA pathway metabolites with \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 in the U-test. These metabolites were categorized by metabolic pathway into 12 metabolites from the COX pathway, 5 from the LOX pathway, and 8 from the CYP450 pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). The above results indicate that oxidative lipid metabolism in rat brain tissue is significantly disrupted in a high-altitude hypoxic environment, with products of the CYP450 metabolic pathway accounting for a large proportion of this disruption. As CYP450 plays a crucial role in lipid oxidation metabolism, changes in its expression or activity could directly impact lipid metabolic homeostasis. Therefore, we further investigated the effects of hypoxia on CYP450 expression.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec27\" class=\"Section3\"\u003e\u003ch2\u003e3.2.2. High-altitude hypoxia reduces CYP450 expression in brain tissue\u003c/h2\u003e\u003cp\u003eTo further investigate the regulatory role of CYP450 in lipid metabolism disorders and brain injury under hypoxic conditions, this study measured the mRNA and protein expression levels of 4 key CYP450 epoxygenases (CYP2C23, CYP2C11, CYP2C19, and CYP2J3) and 2 key ω-hydroxylases (CYP4A2 and CYP4F1). RT‒qPCR results revealed that the mRNA expression levels of \u003cem\u003eCYP2C11\u003c/em\u003e, \u003cem\u003eCYP2C22\u003c/em\u003e, \u003cem\u003eCYP2J3\u003c/em\u003e, and \u003cem\u003eCYP4A2\u003c/em\u003e were significantly reduced in brain tissue of the HAH-7, HAH-30, and HAH-90 groups compared with the LAC group. However, \u003cem\u003eCYP2C23\u003c/em\u003e was downregulated considerably only in the HAH-7 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). The results of the Western blot analysis further validated the decrease in CYP450 protein expression levels in hypoxic environments. Compared with those in the LAC group, the protein expression levels of the CYP2C23, CYP2C11, and CYP2C22 were significantly reduced in the HAH-7, HAH-30, and HAH-90 groups. Inhibition of the CYP4F1 protein was observed only in the HAH-90 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). These observations indicate that exposure to a high-altitude hypoxic environment markedly reduces CYP450 expression, potentially disrupting the lipid oxidation balance.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec28\" class=\"Section2\"\u003e\u003ch2\u003e3.3. Hypoxic stress modulates the inflammatory responses of astrocytes through the downregulation of CYP450.\u003c/h2\u003e\u003cdiv id=\"Sec29\" class=\"Section3\"\u003e\u003ch2\u003e3.3.1. Hypoxic stress promotes astrocyte dysfunction and downregulates CYP450\u003c/h2\u003e\u003cp\u003eTo systematically evaluate the neurotoxic effects of hypoxia in an in vitro model, we cultured astrocytes under normoxic (21% O\u003csub\u003e2\u003c/sub\u003e) and hypoxic (2% O\u003csub\u003e2\u003c/sub\u003e) conditions for 3, 6, 12, 24, and 48 h, respectively. Cell viability assays revealed that astrocyte viability decreased in a time-dependent manner following hypoxia treatment. Notably, after 24 h at 2% O\u003csub\u003e2\u003c/sub\u003e, the cell viability decreased to below 50% (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). ELISA studies revealed that the expression levels of IL-1β, IL-6, TNF-α, NF-κB, iNOS, and HIF-1α continued to increase with prolonged exposure to hypoxia (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). Immunofluorescence assays revealed that the expression levels of the cognitive-related proteins Aβ and p-Tau were significantly higher in the 2% O\u003csub\u003e2\u003c/sub\u003e hypoxia group than in the normoxic group (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). Additionally, the flow cytometry results revealed that the apoptosis rate in the hypoxic group was significantly higher than that in the normoxic group (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003eTo investigate the impact of hypoxic stress on the expression of CYP450 in astrocytes, we measured the mRNA and protein expression levels of key CYP450 subtypes at various time points during hypoxia. RT‒qPCR analysis revealed that compared with that in the normoxic group, \u003cem\u003eCYP2C23\u003c/em\u003e mRNA expression significantly increased after 3 h of hypoxia, whereas \u003cem\u003eCYP2C11\u003c/em\u003e expression decreased from 6 to 48 h. \u003cem\u003eCYP2C22\u003c/em\u003e was transiently upregulated at 6 h, followed by downregulation from 12 to 48 h. \u003cem\u003eCYP2J3\u003c/em\u003e, \u003cem\u003eCYP4A2\u003c/em\u003e (except for upregulation at 3 h), and \u003cem\u003eCYP4F1\u003c/em\u003e exhibited sustained downregulation throughout all durations of hypoxia (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE). The Western blot results revealed consistent overall protein expression patterns but with temporal differences: the CYP2C23 protein level increased at 3 h but decreased from 24 to 48 h; both the CYP2C11 and CYP2J3 levels progressively decreased (from 6 to 48 h and from 3 to 48 h, respectively), while the CYP4A2 and CYP4F1 levels demonstrated late-phase suppression (from 24 to 48 h and from 12 to 48 h, respectively) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF). These results indicate that the expression of apoptosis, inflammatory factors, and cognition-related proteins significantly increases in a time-dependent manner with prolonged hypoxia, whereas CYP450 expression gradually declines. These findings correspond with those observed in an in vivo study. Notably, the survival rate of astrocytes was observed to be less than 50% under 2% O\u003csub\u003e2\u003c/sub\u003e hypoxia for 24 h, with all indicators being substantial. Therefore, the subsequent hypoxia group was exposed to 2% O\u003csub\u003e2\u003c/sub\u003e hypoxia for 24 h to simulate moderate to severe hypoxia damage.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec30\" class=\"Section3\"\u003e\u003ch2\u003e3.3.2. Inhibition of CYP450 increases astrocyte inflammation and abnormal accumulation of Aβ/p-Tau under hypoxic conditions.\u003c/h2\u003e\u003cp\u003eTo further investigate the role of CYP450 in neuroinflammation and cognitive impairment, we employed a specific inhibitor intervention strategy to systematically assess the impact of CYP450 on cellular inflammatory responses and cognition-related protein expression by inhibiting the activity of CYP450 epoxygenase (MS-PPOH) and ω-hydroxylase (17-ODYA). According to the literature data and toxicity experiments on cell proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA), the concentrations of MS-PPOH and 17-ODYA employed in the experiments were established at 20 \u0026micro;M and 25 \u0026micro;M, respectively. Further measurements of CYP450 expression revealed that the mRNA and protein expression levels of the 6 CYP450s were significantly reduced in the hypoxia group compared with the normoxia group. Following treatment with MS-PPOH, the mRNA and protein expression levels of CYP2C23, CYP2C11, CYP2C22, and CYP2J3 decreased significantly compared with the hypoxia group, whereas the expression levels of CYP4A2 and CYP4F1 remained unchanged. Following treatment with 17-ODYA, the mRNA and protein expression levels of CYP4A2 and CYP4F1 decreased significantly, whereas there were no significant changes in the expression levels of CYP450 epoxygenases. These findings indicate that MS-PPOH exclusively inhibits CYP450 epoxygenase under hypoxic conditions, whereas 17-ODYA primarily inhibits ω-hydroxylase (Figs.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB and \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003eDetection of inflammatory factors revealed that the hypoxic group presented significantly higher levels of IL-1β, IL-6, TNF-α, NF-κB, iNOS, and HIF-1α than did the normoxic group. Following intervention with 17-ODYA and MS-PPOH, the expression levels of these inflammatory factors increased further compared with the hypoxic group (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD). Immunofluorescence analysis revealed that Aβ and p-Tau levels were significantly higher in the hypoxic group, and treatment with 17-ODYA and MS-PPOH exacerbated the immunofluorescence intensity of both. To comprehensively assess the effects of hypoxia on oxidative stress and neuroinflammation, we also examined the levels of reactive oxygen species (ROS) and GFAP. The results revealed that the immunofluorescence intensity of both ROS and GFAP was increased in the hypoxia group and that intervention with 17-ODYA and MS-PPOH exacerbated this increase further (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE). Flow cytometry analysis indicated that the apoptosis rate in the 17-ODYA and MS-PPOH treatment groups was significantly higher than in the hypoxia-only group (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eF). Notably, MS-PPOH had a greater inhibitory effect on inflammatory factors (IL-1β, TNF-α, NF-κB, and HIF-1α), cognitive-related proteins (Aβ and p-Tau), and apoptosis than did 17-ODYA. These findings suggest that reduced CYP450 epoxygenase activity is a key mechanism underlying hypoxia-induced astrocyte inflammation, abnormal Aβ and p-Tau accumulation, and increased apoptosis.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec31\" class=\"Section2\"\u003e\u003ch2\u003e3.4. DNA methylation-mediated transcriptional repression of CYP450 under hypoxic conditions\u003c/h2\u003e\u003cdiv id=\"Sec32\" class=\"Section3\"\u003e\u003ch2\u003e3.4.1. Hypoxia-induced upregulation of \u003cem\u003eDNMTs\u003c/em\u003e/\u003cem\u003eMeCP2\u003c/em\u003e, along with hypermethylation of \u003cem\u003eCYP2C11\u003c/em\u003e\u003c/h2\u003e\u003cp\u003eHypoxia can induce DNA methylation, and DNA methylation can regulate CYP450 expression. We investigated the effect of DNA methylation status on CYP450 expression under hypoxic conditions. ELISA analysis revealed that, compared with the LAC group, 5-mC expression levels were significantly higher in the HAH-7, HAH-30, and HAH-90 groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA), suggesting that overall DNA methylation levels in the brain are elevated in a high-altitude hypoxic environment. Further measurements were conducted to determine the mRNA levels of the DNA methyltransferases (DNMT1, DNMT3a, and DNMT3b), as well as the methylcytosine binding protein (MeCP2), in brain tissue under hypoxic conditions. Compared to the LAC group, the results revealed that hypoxia significantly increased the mRNA levels of \u003cem\u003eDNMT1\u003c/em\u003e, \u003cem\u003eDNMT3a\u003c/em\u003e, and \u003cem\u003eMeCP2\u003c/em\u003e in rat brain tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB), confirming hypoxia-induced epigenetic reprogramming.\u003c/p\u003e\u003cp\u003eTo confirm the role of DNA methylation in regulating CYP450, we measured its methylation levels in the brain tissue of rats in the HAH-90 group. We obtained the gene sequences of rat \u003cem\u003eCYP2C11\u003c/em\u003e, \u003cem\u003eCYP2C22\u003c/em\u003e, \u003cem\u003eCYP2C23\u003c/em\u003e, \u003cem\u003eCYP2J3\u003c/em\u003e, \u003cem\u003eCYP4F1\u003c/em\u003e, and \u003cem\u003eCYP4A2\u003c/em\u003e from the NCBI database. Using the MethPrimer online tool, we identified a CpG island in the \u003cem\u003eCYP2C11\u003c/em\u003e promoter region (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eC). BSP detection results revealed that the number of methylated sites in the \u003cem\u003eCYP2C11\u003c/em\u003e gene promoter DNA in the brains of HAH-90 rats increased significantly compared with the LAC group, with the methylation rates of three sites (CpG#26, CpG#90, and CpG#142) being significantly higher (Figs.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eD and \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eE). It is suggested that hypermethylation of specific CpG sites in the \u003cem\u003eCYP2C11\u003c/em\u003e promoter region may be an epigenetic mechanism for downregulating \u003cem\u003eCYP2C11\u003c/em\u003e gene expression under hypoxic conditions.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec33\" class=\"Section3\"\u003e\u003ch2\u003e3.4.2. DNMT inhibition by 5-Aza-dC rescues hypoxia-induced CYP2C11 suppression and neuroinflammation\u003c/h2\u003e\u003cp\u003eTo validate the regulatory role of DNA methylation in CYP2C11 expression, we treated astrocytes cultured under hypoxic conditions with the DNA methyltransferase inhibitor 5-Aza-dC. The experimental results indicate that, at concentrations of less than 1 \u0026micro;M, 5-Aza-dC does not affect the survival rate of cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eA). Additionally, under hypoxic conditions, the inhibitory effect of 5-Aza-dC restored CYP2C11 protein and mRNA expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eB), alleviating inflammatory responses and the abnormal accumulation of Aβ and p-Tau proteins in hypoxic astrocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eC and \u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eD). These results confirm that elevated CYP2C11 methylation levels are a key factor in inflammatory responses and the accumulation of cognition-related proteins under hypoxic conditions.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThis study used a high-altitude hypoxia-exposed rat model and astrocyte hypoxia stress experiments to systematically elucidate the pathological mechanisms underlying high-altitude hypoxia-induced neuroinflammation and cognitive impairment. The results revealed that exposure to high-altitude hypoxia leads to impaired learning and memory abilities, accompanied by the activation of neuroinflammatory responses. Mechanistic studies indicate that hypoxia-induced oxidative lipid metabolic disorders and downregulation of CYP450 expression further exacerbate CNS damage. This study also identified a molecular mechanism whereby DNA methylation under hypoxic conditions specifically regulates CYP2C11 expression. This influences the accumulation of cognition-related proteins and neuroinflammatory responses. These findings innovatively establish a DNA methylation-dependent regulatory axis involving CYP450, oxidized lipids, and neuroinflammation/cognitive impairment (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003e), providing a potential intervention strategy targeting CYP450 for the prevention and treatment of high-altitude-related neural damage.\u003c/p\u003e\u003cp\u003eThe body undergoes various physiological and pathological changes in a high-altitude hypoxic environment. Among these changes, blood and serum biochemical indicators are important markers for assessing an individual's health status. This study demonstrated that exposure to a hypoxic environment increased the levels of HGB, RBC, and HCT, which is a typical adaptive response to high-altitude hypoxia. This occurs because hypoxia induces the release of erythropoietin (EPO), thereby facilitating erythropoiesis in the bone marrow. This increases the RBC count and hemoglobin concentration, thereby increasing the oxygen-carrying capacity of the blood and enhancing oxygen delivery to tissues. However, excessive proliferation of RBCs can increase blood viscosity, which may cause microcirculatory disorders and increase the prevalence of cerebrovascular diseases in high-altitude settings [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. WBCs can reflect the body's immune status, as they are one of the body's defense systems against foreign pathogens. In line with previous research [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], this study revealed that hypoxia at high altitudes decreased the WBC of rats. These findings suggest that hypoxic conditions may induce inflammatory responses and that a sustained decrease in WBC may make high-altitude residents more susceptible to infection. However, another study found that acute hypoxia can lead to an increase in the WBC count [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. This difference may be attributed to factors such as hypoxia modeling methods and hypoxia duration. In addition, this study revealed that high-altitude hypoxia significantly altered the serum biochemical indicators in rats. Hypoxia significantly impacts rat liver function, which may affect the production and activity of drug-metabolizing enzymes and consequently impact drug metabolism in the body [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Furthermore, renal function experience is notably altered under hypoxic conditions. CREA initially decreases but then increases under hypoxic conditions, which is likely attributed to a compensatory increase in the glomerular filtration rate or a reduction in muscle metabolism during the early stages of hypoxia. However, renal function gradually deteriorates as hypoxia persists. Impairment of liver and kidney function may result in the accumulation of toxins, causing inflammation and oxidative stress in the brain. In addition, the results of this study demonstrated that energy and glucose-lipid metabolism are altered under severe hypoxic conditions. The sustained decrease in GLU and TG indicates increased glycolysis and lipolysis as the duration of hypoxia increases. Reduced glucose utilization under hypoxic conditions may result in an insufficient energy supply to brain tissue, affecting neuronal electrical activity and cognitive function. In agreement with earlier research [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], CRP is a reliable and sensitive systemic inflammatory marker. Our findings indicate that CRP levels remain elevated following hypoxic exposure, suggesting that chronic inflammatory responses induced by hypoxia exacerbate neurodegeneration. These changes may suggest potential pathological damage and reflect the body's compensatory adaptation; however, the specific mechanisms necessitate further investigation.\u003c/p\u003e\u003cp\u003eInflammation is a pathological process characterized by tissue damage or destruction. Research has demonstrated that both acute and chronic hypoxia can disturb the equilibrium between pro- and anti-inflammatory mediators, resulting in increased levels of pro-inflammatory molecules such as IL-1β, TNF-α, and IL-6 [\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. This study further proves that an increase in hypoxia duration correlates with heightened expression of inflammatory markers in rat brain tissue and astrocytes. Sustained elevation of these factors not only damages neurons directly but also exacerbates neural damage by impairing the integrity of the blood-brain barrier (BBB) and promoting oxidative stress. Additionally, this study revealed that hypoxia induced the activation of both microglia and astrocytes. As the primary immune effector cells in the central nervous system, microglia release large amounts of proinflammatory factors upon activation, thereby amplifying the neuroinflammatory response. In addition to producing proinflammatory cytokines, astrocytes can release matrix metalloproteinases that degrade the extracellular matrix, leading to disruption of the BBB. Furthermore, they release nitric oxide (NO) to regulate cerebral blood flow during hypoxia [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In addition to the formation of inflammatory factors and glial cell activation, activation of the HIF-1α signaling pathway is also a key regulatory mechanism in the development of neuroinflammation. This study and previous research have both demonstrated that high-altitude hypoxia can markedly increase the expression of HIF-1α [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. There is a certain degree of interaction between HIF-1α and IL-1β, TNF-α, IFN-γ, and NF-κB, and this interaction is influenced by the severity of inflammation [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Among them, the interaction between HIF-1α and NF-κB is more complex. On the one hand, NF-κB is a direct regulator of HIF-1α, which can activate NF-κB [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Moreover, HIF-1α can limit the inflammatory response by inhibiting the expression of NF-κB-dependent genes [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. On the other hand, in some studies on hypoxic microenvironments, NF-κB can directly bind to the HIF-1α promoter, thereby enhancing the transcription of HIF-1α [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In summary, the interaction between HIF-1α and inflammatory cytokines may enhance the inflammatory response under hypoxia by regulating the expression of inflammatory cytokines.\u003c/p\u003e\u003cp\u003eMany studies have focused on the impact of high-altitude hypoxic environments on cognitive function. Existing evidence indicates that the extent of hypoxic damage to brain function is influenced primarily by two factors: altitude and exposure time. Studies have generally confirmed that cognitive impairment increases with altitude [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In terms of exposure time, existing studies have revealed different patterns of impact on cognitive function between acute hypoxia and chronic hypoxia. Short-term acute hypoxia can rapidly impair cognitive ability. Studies by Wang et al. have demonstrated that exposure to high-altitude hypoxic environments over a short period can result in memory loss, impaired behavior, and slower thinking [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Chronic hypoxia may result in more persistent cognitive impairment. Ma et al. reported that mice exposed to a simulated altitude of 5000 m for 1 month exhibited severe cognitive impairment accompanied by increased levels of oxidative stress biomarkers [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Similarly, Ji et al. reported that rats raised at an altitude of 4300 m for 8 weeks exhibited significant cognitive impairments, along with neuronal damage in the hippocampus and cortex, increased apoptosis, and abnormal casein expression [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Furthermore, the results of an epidemiological survey indicate that the prevalence of cognitive impairment and dementia is significantly higher among elderly individuals living at high altitudes for extended periods [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Our research further confirmed that both acute and chronic hypoxia may damage learning and memory, with extended exposure leading to more significant impairment. This discovery corresponds to the findings of Rimoldi et al.'s research on adolescents [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. However, some studies have reported an initial decline in cognitive function followed by partial recovery with prolonged exposure to hypoxia. For example, Zhang et al. found that mice exposed to an altitude of 7000 m for 1, 3, or 7 days presented initial cognitive impairment during the first three days, which improved by day 7 [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Xu et al. observed a similar phenomenon: cognitive function declined within two days of exposure at an altitude of 3800 m but progressively improved from day 3 onward, largely recovering to baseline performance by days 5 to 7 [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Research suggests that the 'decline-partial recovery' pattern of cognitive function following exposure to hypoxia may be associated with the activation of the body's hypoxic adaptation mechanisms. However, these studies focused only on short-term exposure to hypoxia within seven days and have failed to systematically assess the sustained effects of long-term exposure to hypoxia on cognitive function. In contrast, this study examined cognitive changes during the acute phase and further measured the dynamic evolution of cognitive function over the long term (30 and 90 days). These findings provide a more comprehensive understanding of patterns of cognitive function changes under different durations of hypoxia. This study design addresses the knowledge gap in the literature on the cognitive effects of long-term exposure to hypoxia, offering more comprehensive experimental evidence to improve our understanding of the mechanisms that compensate for and damage cognitive function in high-altitude hypoxic environments.\u003c/p\u003e\u003cp\u003eCognitive impairment is considered the preclinical stage of Alzheimer's disease (AD). Hyperphosphorylation of the tau protein and deposition of Aβ are typical neuropathological features of AD-related dementia. Consequently, tau phosphorylation and increased Aβ expression represent an early stage of cognitive impairment. This study confirms that hypoxia can stimulate tau phosphorylation and affect Aβ metabolism, a result that is consistent with the findings of previous studies. Gao et al. found that chronic exposure to hypoxia not only accelerated amyloid pathology in APP/PS1 transgenic mice but also mediated high tau phosphorylation through calprotectin [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Similarly, Zhang et al. found increased phosphorylation of the Thr181 and Thr213 sites of the tau protein, as well as increased Aβ levels, in APP/PS1 mice exposed to acute hypoxia (7% O\u003csub\u003e2\u003c/sub\u003e) [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. These findings suggest that hypoxia-induced Aβ deposition and tau phosphorylation may be the direct pathological basis for cognitive impairment under hypoxic conditions. Interestingly, the abnormal changes in the Aβ and p-Tau proteins under hypoxic conditions may be closely related to the activation of HIF-1α. Zhang et al. reported that the overexpression of HIF-1α under hypoxic conditions significantly increases the levels of beta-secretase 1 (BACE1) mRNA and protein, ultimately leading to increased Aβ production [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Similarly, HIF-1α regulates tau phosphorylation under hypoxic conditions. Lei et al. found that chronic hypoxia activates HIF-1α, which results in a deficiency of leucine carboxyl methyltransferase 1 (LCMT1) and protein phosphatase 2A (PP2A). These effects mediate the abnormal hyperphosphorylation of tau, ultimately impairing cognitive function [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. In addition to the HIF-1α pathway, inflammation is an important underlying mechanism of abnormal tau and Aβ metabolism under hypoxic conditions. Previous studies have confirmed that IL-1β, TNF-α, and IL-6 play pivotal roles in the neuronal dysfunction and cognitive impairment caused by chronic neuroinflammation [\u003cspan additionalcitationids=\"CR52\" citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Through animal experiments, Krstic et al. demonstrated that mice with an activated immune system exhibited chronic elevation of inflammatory cytokines, increased levels of amyloid precursor protein (APP), altered tau phosphorylation, and severe working memory impairment in old age [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. This study found that a rat model of hypoxia-induced cognitive impairment exhibited increased expression of inflammatory factors and accumulation of p-Tau and Aβ. Although existing evidence has not yet established a direct causal relationship between hypoxia-induced neuroinflammation and cognitive impairment, these findings provide important research clues for further exploration of the mechanism of neuroinflammation in cognitive impairment in hypoxic environments.\u003c/p\u003e\u003cp\u003eUnder high-altitude hypoxia, the body generates elevated levels of oxygen free radicals, leading to lipid peroxidation. An increasing body of evidence indicates that oxidized lipids are crucial in the initiation and advancement of cognitive impairment. Nasaruddin et al. used gas chromatography-mass spectrometry (GC-MS) to accurately quantify fatty acids (FAs) that are highly dependent on each other in patients with AD and Lewy body dementia (DLB). Their results revealed that pathological progression of either condition alters the FA composition of brain tissue [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Similarly, Shen et al. found that higher levels of the long-chain saturated fatty acids docosanoic acid (22:0) and lignoceric acid (24:0) were associated with better overall cognitive function in older adults [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Dhillon et al.'s research further supports this view. They found that levels of saturated fatty acids were significantly higher in patients with mild cognitive impairment (MCI), while levels of PUFAs were significantly lower [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. This aligns well with the observed alterations in oxidative lipid metabolism trends in this investigation. These results suggest that maintaining the homeostasis of oxidized lipids is essential for preserving brain function and that characteristic changes in oxidized lipids under pathological conditions may serve as molecular markers reflecting the risk of cognitive impairment. Metabolomic analysis of oxidized lipids has become an increasingly important strategy for exploring disease-induced metabolic changes, demonstrating significant value in disease diagnosis and prognosis assessment. We found that increases in 8-HDoHE, 9-OxoODE, 18(11)-HETE, 8,15-DiHETE, and 16(17)-HETE, as well as decreases in PGD₂, EPA, 12(13)-DiHOME, PGE₂, and 12(13)-HEPE, etc., are associated with an increased risk of high-altitude, hypoxia-induced encephalopathy. Based on statistical significance and trends under hypoxic conditions, 16S-HETE and PGD1 may serve as biomarkers for diagnosing high-altitude hypoxic encephalopathy. These findings provide a new explanation for the metabolic mechanism of brain dysfunction caused by hypoxia at high altitudes. More importantly, they lay the theoretical foundation for preventive intervention strategies that target the regulation of oxidized lipid metabolism.\u003c/p\u003e\u003cp\u003eOur research revealed that significant amounts of oxidized lipids are implicated in the cognitive impairment caused by hypoxia. Current research does not allow us to ascertain their precise role in this process; nonetheless, prior studies indicate a potential association with the inflammatory and vascular regulating actions of eicosanoids. Existing research has confirmed that oxidized lipids play a significant role in regulating both inflammatory responses and the innate immune system. Based on their functional characteristics, oxidized lipids can be categorized as either pro- or anti-inflammatory mediators. During the inflammatory process, changes occur in the biosynthesis of these mediators, which participate in key stages, including initiation, cascade amplification, and the timely resolution of inflammatory responses, through complex regulatory networks. This study found that, during acute hypoxia, certain proinflammatory mediators (such as LTB₄ and 12S-HETE) temporarily increase, whereas the levels of anti-inflammatory mediators (such as EETs and PGD₁) decrease. This exacerbates inflammatory damage. In contrast, during chronic hypoxia, the levels of most proinflammatory mediators (e.g., PGE₂ and 20-HETE) decrease persistently, whereas the levels of proresolution mediators (e.g., MaR2 and 15S-HETE) remain deficient. This leads to delayed inflammatory resolution. These changes result in abnormal activation and delayed resolution of neuroinflammation. On the other hand, it may be related to its vascular regulatory function. EETs and HETEs are particularly important in this context, as they play a central role in vascular responses, regulating vascular tone under hypoxic conditions and promoting angiogenesis [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. In endothelial cells, EETs activate K\u003csup\u003e+\u003c/sup\u003e\u0026thinsp;\u003csub\u003eCa\u003c/sub\u003e channels, induce smooth muscle cell hyperpolarization, and inhibit L-type Ca\u003csup\u003e2+\u003c/sup\u003e channels. This process induces relaxation. Consequently, EETs act as endothelium-derived vasodilators, dilating blood vessels throughout the vascular system. This study found that exposure to high-altitude hypoxia reduced the biosynthesis of 8(9)-EET, 11(12)-EET, and 14(15)-EET in brain tissue during acute hypoxia. This may lead to cerebral vasoconstriction and reduced cerebral blood flow, thereby exacerbating the damage caused to the brain by hypoxia. HETEs reduce the probability of opening K\u003csup\u003e+\u003c/sup\u003e\u0026thinsp;\u003csub\u003eCa\u003c/sub\u003e channels and inhibit Na-K-ATPase. This leads to the depolarization of smooth muscle cell membranes and the activation of L-type Ca\u003csup\u003e2+\u003c/sup\u003e channels, inducing contraction. This study found that the biosynthesis of 20-HETE, which has a clear vasoconstrictive effect, decreased significantly with prolonged hypoxia, whereas the biosynthesis of 16S-HETE and 18-HETE increased significantly. While the precise vascular effects of these two metabolites remain unclear, given that other members of the HETE family generally exhibit vasoconstrictive properties, this abnormal increase may also intensify the vasoconstrictive response. Although reducing 20-HETE may alleviate hypoxia-induced vascular vasoconstriction, increasing 16-HETE/18-HETE suggests that there are more complex regulatory mechanisms in cerebral blood vessels under hypoxic conditions. Therefore, clarifying the functional contributions of each subtype using selective inhibitors or agonists will be an important area of future research.\u003c/p\u003e\u003cp\u003eCYP450s constitute the most important family of metabolic enzymes in the body. Previous studies have concentrated on its function in drug metabolism; however, recent research has revealed its correlation with cognition, memory, and learning in the brain. CYP450 is a crucial endogenous metabolic enzyme that significantly contributes to cholesterol homeostasis. Djelti et al. used adeno-associated viral vectors to reduce \u003cem\u003eCyp46a1\u003c/em\u003e expression in the hippocampi of C57BL/6 mice. This resulted in increased cholesterol concentrations and neuronal apoptosis, as well as cognitive deficits. These effects were more pronounced in the APP23 AD mouse model [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. Another study also found that female CYP46A1 transgenic mice showed improved spatial memory ability in the MWM test [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e], further confirming the correlation between CYP46A1 and learning and memory ability. In addition, CYP2E1, CYP2D1, and CYP7A1 are also associated with learning and cognition to a certain extent [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e, \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. In summary, these studies suggest that CYP450s are important for cognitive processes. Interestingly, research has shown that hypoxia significantly affects the expression levels of CYP450 in brain tissue. Jacob et al. exposed human cerebral microvascular endothelial cell lines to hypoxic conditions for 6 h and found that the expression of CYP1A1 and CYP1B1 was significantly reduced [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. Similarly, another study reported that, under hypoxic conditions, the activity of CYP19a1b, as well as the mRNA and protein expression levels of CYP19a1, decreased significantly in the hypothalamus of Atlantic croaker [\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]. These studies suggest that changes in the expression of CYP450 in the brain under hypoxic conditions may be related to changes in brain function under hypoxic conditions, particularly hypoxia-induced cognitive impairment, which has been reported in previous studies. Wan et al. exposed male C57BL/6 mice to an altitude of 4300 m for 6 months and analyzed the proteins in their hippocampal tissue quantitatively. The results showed that differentially expressed proteins were enriched in the 'drug metabolism-other enzymes' and 'drug metabolism-CYP450' pathways [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. This highlights the importance of CYP450 in hypoxia-induced cognitive impairment, a finding that was confirmed by our results. We found that the mRNA and protein expression of CYP450 was altered in the brains of rats with hypoxia-induced cognitive impairment and that CYP450 inhibition exacerbated the abnormal accumulation of inflammatory factors and cognition-related proteins under hypoxic conditions. These results provide new experimental evidence to help us understand the role of CYP450 in hypoxia-induced cognitive impairment and could inform the development of neuroprotective strategies targeting the CYP450 metabolic pathway.\u003c/p\u003e\u003cp\u003eOur research revealed a novel mechanism by which hypoxia induces specific methylation of the CYP2C11 promoter via DNMTs and MeCP2, thereby inhibiting its expression. These findings expand the current understanding of the regulatory mechanisms of CYP450 under hypoxic conditions. Previous studies have shown that nuclear receptors such as the pregnane X receptor (PXR), constitutive androstane receptor (CAR), aryl hydrocarbon receptor (AhR), and hepatocyte nuclear factor (HNF) are involved in regulating CYP450 expression at the transcriptional level under hypoxic conditions [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Moreover, multiple cytokines (such as HIF-1α, Nrf2, IL-1β, and IL-6) and gut microbiota metabolites participate in this regulatory network [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e, \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]. At the epigenetic level, although it has been confirmed that miRNAs regulate transporter function by modulating PXR under hypoxic conditions [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e], their direct regulation of CYP450 remains unclear. Similarly, although it has been demonstrated that DNA methylation is an important epigenetic mechanism that regulates CYP450 expression, the specifics of this regulation under hypoxic conditions and its molecular basis are still unclear. This study is the first to link the suppression of CYP450 expression to methylation at specific CpG sites, revealing a novel mechanism for the regulation of CYP450 under hypoxic conditions. Notably, this study, by identifying key CpG sites and conducting 5-Aza-dC intervention experiments, confirmed the importance of epigenetic modifications in regulating CYP450 expression under hypoxic conditions and offered a novel perspective on the role of epigenetic regulation of CYP450 in neurological diseases. Comprehensive studies indicate that DNA methylation facilitates early central nervous system development, contributes to neuronal growth and differentiation, is crucial for adult neurogenesis, and regulates genes vital to learning and memory-related cognitive functions [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]. Research has elucidated that DNA methylation alterations of the CYP450 gene may significantly contribute to the pathogenesis of neurodegenerative diseases such as AD [\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e], and our investigation confirms this conclusion.\u003c/p\u003e\u003cp\u003eThis study is the first to elucidate the regulatory axis involving DNA methylation-mediated CYP450, oxidized lipids, and neuroinflammation in the context of hypoxia. These findings provide a new theoretical basis for understanding the pathogenesis of cognitive impairment and neuroinflammation in high-altitude hypoxic environments. This research has significant scientific value. First, elucidating the association between metabolic characteristics and events of high-altitude hypoxic encephalopathy could provide new biomarkers for disease monitoring and diagnosis. Second, this study confirmed the critical function of CYP450 in hypoxic neuroprotection, offering a significant theoretical basis for the formulation of targeted pharmaceuticals. Finally, a novel mechanism of DNA methylation of CYP450 under hypoxic conditions in neural damage has been identified, offering a fresh perspective for the research and treatment of hypoxic brain injury disorders. However, this study has several limitations. First, although the use of SD rats and primary astrocytes provided consistency within the experimental framework, the conclusions necessitate additional validation through primate models or human samples to ascertain whether the correlation between CYP450 and neural damage under hypoxic conditions is species independent. Second, although our study identified CYP450 and oxidized lipid metabolites as crucial targets in the onset of inflammation and cognitive decline under hypoxic conditions, the molecular interactions between oxidized lipid metabolites and Aβ/p-Tau proteins remain ambiguous. Additional confirmation is necessary using in vitro co-incubation experiments and protein interaction analysis methods. Third, the main focus of this study was the methylation regulatory mechanism of CYP2C11. However, the reduced expression of other CYP450 subtypes under hypoxic conditions suggests the existence of additional regulatory pathways. Future research could combine gene-editing techniques, such as CRISPR-Cas9, with multiomics integrated analysis strategies to systematically elucidate the expression regulatory network of the CYP450 family under hypoxic conditions. This would provide valuable insight into the molecular mechanisms underlying high-altitude adaptive responses.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eAA\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003earachidonic acid\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eAhR\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003earyl hydrocarbon receptor\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eAMS\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eacute mountain sickness\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eAβ\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eamyloid-β\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eBSP\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ebisulfite-sequencing PCR\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eCAR\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003econstitutive androstane receptor\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eCOX\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ecyclooxygenase\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eCYP450\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ecytochrome P450\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eEETs\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eeicosapentaenoic acids\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eELISA\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eenzyme-linked immunosorbent assay\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eGFAP\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eglial fibrillary acidic protein\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eHACE\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ehigh-altitude cerebral edema\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eHAH\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ehigh-altitude headache\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eHE\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ehematoxylin-eosin\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eHETEs\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eeicosatetraenoic acids\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eHIF-1α\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ehypoxia-inducible factor-1α\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eHNF\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ehepatocyte nuclear factor\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eIBA1\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eionophore-binding protein 1\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eLOX\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003elipoxygenase\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003ep-Tau\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ephospho-Tau\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003ePUFAs\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003epolyunsaturated fatty acids\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003ePXR\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003epregnane X receptor\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eROS\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ereactive oxygen species\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eRT‒qPCR\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003equantitative real-time polymerase chain reaction\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eTEM\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003etransmission electron microscopy\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eUHPLC-MS/MS\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eultrahigh-performance liquid chromatography-tandem mass spectrometry\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the National Natural Science Foundation of China (No. 82260731, China), Qinghai University Research Ability Enhancement Project (2025KTST08, China), and Qinghai Provincial Department of Science and Technology (2024-ZJ-724, China).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eQian Wang: Conceptualisation, Methodology, Investigation, Validation, Formal analysis, and Writing\u0026ndash;original draft. Junjun Han: Methodology and Data curation. Guiqin Liu and Yabin Duan: Investigation and writing-review. Delong Duo and Junbo Zhu: Data curation, Software, and Formal analysis. Yue Lin and Yawen Xin: Resources, Visualization, and Investigation. Xiangyang Li: Writing-review \u0026amp; editing, Resources, Supervision, Project administration, and Funding acquisition. Ting Li: Writing-review, Supervision, and Project administration. All authors contributed to the article, agreed to be accountable for all aspects of the work, and approved the submitted version.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eErecińska M, Silver IA. Tissue oxygen tension and brain sensitivity to hypoxia. Respir Physiol 2001;128(3).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen X, Zhang J, Lin Y, Li Y, Wang H, Wang Z et al. Mechanism, prevention and treatment of cognitive impairment caused by high altitude exposure. Front Physiol 2023;14.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAboouf MA, Thiersch M, Soliz J, Gassmann M, Schneider Gasser EM. The brain at high altitude: from molecular signaling to cognitive performance. Int J Mol Sci 2023;24(12).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDhillon VS, Thomas P, Lee SL, Deo P, Fenech M. Red blood cell fatty acid profiles are significantly altered in south australian mild cognitive impairment and alzheimer's disease cases compared to matched controls. Int J Mol Sci 2023;24(18).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChauhan G, Roy K, Kumar G, Kumari P, Alam S, Kishore K et al. Distinct influence of COX-1 and COX-2 on neuroinflammatory response and associated cognitive deficits during high altitude hypoxia. Neuropharmacology 2019;146.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFunk CD. Prostaglandins and leukotrienes: advances in eicosanoid biology. Science 2001;294(5548).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang G, Kodani S, Hammock BD. Stabilized epoxygenated fatty acids regulate inflammation, pain, angiogenesis and cancer. Prog Lipid Res 2014;53.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWelty FK. Omega-3 fatty acids and cognitive function. Curr Opin Lipidol 2023;34(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBazinet RP, Lay\u0026eacute; S. Polyunsaturated fatty acids and their metabolites in brain function and disease. Nat Rev Neurosci 2014;15(12).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang Q, Liu G, Duan Y, Duo D, Zhu J, Li X. Exploring cytochrome P450 under hypoxia: potential pharmacological significance in drug metabolism and protection against high-altitude diseases. Drug Metab Dispos 2025;53(2).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHalder SK, Milner R. The impact of chronic mild hypoxia on cerebrovascular remodelling; uncoupling of angiogenesis and vascular breakdown. Fluids Barriers CNS 2021;18(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePenaloza CG, Cruz M, Germain G, Jabeen S, Javdan M, Lockshin RA et al. Higher sensitivity of female cells to ethanol: methylation of DNA lowers Cyp2e1, generating more ROS. Cell Commun Signal 2020;18(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSukmawan R, Hoetama E, Suridanda Danny S, Giantini A, Listiyaningsih E, Gilang Rejeki V et al. Increase in the risk of clopidogrel resistance and consequent TIMI flow impairment by DNA hypomethylation of CYP2C19 gene in STEMI patients undergoing primary percutaneous coronary intervention (PPCI). Pharmacol Res Perspect 2021;9(2).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJiang W, Wu H, Yu X, Wang Y, Gu W, Wei W et al. Third-hand smoke exposure is associated with abnormal serum melatonin level via hypomethylation of CYP1A2 promoter: Evidence from human and animal studies. Environ Pollut 2021;277.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLin Z, Lu Y, Yu G, Teng H, Wang B, Yang Y et al. Genome-wide DNA methylation landscape of four Chinese populations and epigenetic variation linked to Tibetan high-altitude adaptation. Sci China Life Sci 2023;66(10).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang S, Fu W, Jia X, Bade R, Liu X, Xie Y et al. Hypoxic preconditioning modulates BDNF and its signaling through DNA methylation to promote learning and memory in mice. ACS Chem Neurosci 2023;14(12).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJin T, Lu H, Zhang Z, Wang Y, Yang W, Wang Y et al. CYP2S1 gene methylation among High-altitude pulmonary edema. Gene 2022;834.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVillafuerte FC, Simonson TS, Bermudez D, Le\u0026oacute;n-Velarde F. High-altitude erythrocytosis: mechanisms of adaptive and maladaptive responses. Physiol (Bethesda) 2022;37(4).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYan C, Tian D, Zhang C, Zhang Q, Sun Y. Evaluation of blood cellular and biochemical parameters in rats under a chronic hypoxic environment at high altitude. Ann Med 2023;55(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhu J, Duan Y, Duo D, Yang J, Bai X, Liu G et al. High-altitude hypoxia influences the activities of the drug-metabolizing enzyme CYP3A1 and the pharmacokinetics of four cardiovascular system drugs. Pharmaceuticals (Basel) 2022;15(10).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHartmann G, Tsch\u0026ouml;p M, Fischer R, Bidlingmaier C, Riepl R, Tsch\u0026ouml;p K et al. High altitude increases circulating interleukin-6, interleukin-1 receptor antagonist and C-reactive protein. Cytokine 2000;12(3).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJiang S, Fan F, Yang L, Chen K, Sun Z, Zhang Y et al. Salidroside attenuates high altitude hypobaric hypoxia-induced brain injury in mice via inhibiting NF-κB/NLRP3 pathway. Eur J Pharmacol 2022;925.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXie N, Fan F, Jiang S, Hou Y, Zhang Y, Cairang N et al. Rhodiola crenulate alleviates hypobaric hypoxia-induced brain injury via adjusting NF-κB/NLRP3-mediated inflammation. Phytomedicine 2022;103.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTian L, Liu G, Zhao Q, Han J, Lin Y, Wang Q et al. Pharmacokinetics of midazolam in plasma and brain tissue of rats after exposure to acute and chronic high altitude hypoxia. High Alt Med Biol 2025;26(3).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKarve IP, Taylor JM, Crack PJ. The contribution of astrocytes and microglia to traumatic brain injury. Br J Pharmacol 2016;173(4).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChristie IN, Theparambil SM, Braga A, Doronin M, Hosford PS, Brazhe A et al. Astrocytes produce nitric oxide via nitrite reduction in mitochondria to regulate cerebral blood flow during brain hypoxia. Cell Rep 2023;42(12).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCheng J, Sun Y, He J, Wang Z, Li W, Wang R. The mechanism of colon tissue damage mediated by HIF-1α/NF-κB/STAT1 in high-altitude environment. Front Physiol 2022;13.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJuan H, Qijun W, Yuanheng H, Yangfang L. A study of high-altitude hypoxia-induced cell stress in murine model. Cell Biochem Biophys 2012;64(2).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ede Lemos ML, de la Torre AV, Petrov D, Brox S, Folch J, Pall\u0026agrave;s M et al. Evaluation of hypoxia inducible factor expression in inflammatory and neurodegenerative brain models. Int J Biochem Cell Biol 2013;45(7).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang D, Wang M, Sun S, Zhang C, Song Y, Li J et al. Hypoxia-induced NLRP3 inflammasome activation via the HIF-1α/NF-κB signaling pathway in human dental pulp fibroblasts. BMC Oral Health 2024;24(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJiang Y, Zhu Y, Wang X, Gong J, Hu C, Guo B et al. Temporal regulation of HIF-1 and NF-κB in hypoxic hepatocarcinoma cells Oncotarget. 2015;6(11).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHirai K, Furusho H, Hirota K, Sasaki H. Activation of hypoxia-inducible factor 1 attenuates periapical inflammation and bone loss. Int J Oral Sci 2018;10(2).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Y, Yan M, Yue Y, Cheng Y. Hypoxia-inducible factor-1α modulates the toll-like receptor 4/nuclear factor kappa b signaling pathway in experimental necrotizing enterocolitis. Mediators Inflamm. 2024;2024.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHan S, Xu W, Wang Z, Qi X, Wang Y, Ni Y et al. Crosstalk between the HIF-1 and Toll-like receptor/nuclear factor-κB pathways in the oral squamous cell carcinoma microenvironment. Oncotarget 2016;7(25).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlgaze I, Phillips L, Inglis P, Lathrop G, Gadbois J, Rizzolo K et al. Incidence of mild cognitive impairment with ascending altitude. High Alt Med Biol 2020;21(2).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang YQ, Zhang WJ, Liu JH, Ji WZ. Effects of chronic hypoxic environment on cognitive function and neuroimaging measures in a high-altitude population. Front Aging Neurosci 2022;14.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBhattacharjee M, Manoharan S, Deshetty UM, Perumal E. Acute hypobaric hypoxia exposure causes neurobehavioral impairments in rats: role of brain catecholamines and tetrahydrobiopterin alterations. Neurochem Res 2023;48(2).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang L, Sang L, Cui Y, Li P, Qiao L, Wang Q et al. Effects of acute high-altitude exposure on working memory: A functional near-infrared spectroscopy study. Brain Behav 2022;12(12).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMa YY, Li X, Yu ZY, Luo T, Tan CR, Bai YD et al. Oral antioxidant edaravone protects against cognitive deficits induced by chronic hypobaric hypoxia at high altitudes. Transl Psychiatry 2024;14(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJi W, Zhang Y, Ge RL, Wan Y, Liu J. NMDA receptor-mediated excitotoxicity is involved in neuronal apoptosis and cognitive impairment induced by chronic hypobaric hypoxia exposure at high altitude. High Alt Med Biol 2021;22(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJi W, Zhang Y, Luo J, Wan Y, Liu J, Ge RL. Memantine ameliorates cognitive impairment induced by exposure to chronic hypoxia environment at high altitude by inhibiting excitotoxicity. Life Sci 2021;270.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eUrrunaga-Pastor D, Chambergo-Michilot D, Runzer-Colmenares FM, Pacheco-Mendoza J, Benites-Zapata VA. Prevalence of cognitive impairment and dementia in older adults living at high altitude: a systematic review and meta-analysis. Dement Geriatr Cogn Disord 2021;50(2).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRimoldi SF, Rexhaj E, Duplain H, Urben S, Billieux J, Allemann Y et al. Acute and chronic altitude-induced cognitive dysfunction in children and adolescents. J Pediatr 2016;169.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang H, Zhang X, Liu Z, Mei Y, Liu Y, Wei X et al. Time-course effects and mechanisms of hypobaric hypoxia on nervous system in mice. Neurosci Lett 2023;801.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu S, Zheng ZY, Zhao GC, Lu ZH, Nie H, Wang XJ et al. The study on effects of acute exposure to high altitude hypoxia on cognitive function in lowlander. Behav Brain Res 2025;484.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGao L, Tian S, Gao H, Xu Y. Hypoxia increases Aβ-induced tau phosphorylation by calpain and promotes behavioral consequences in AD transgenic mice. J Mol Neurosci 2013;51(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang F, Zhong R, Qi H, Li S, Cheng C, Liu X et al. Impacts of acute hypoxia on Alzheimer's disease-like pathologies in APP(swe)/PS1(dE9) mice and their wild type littermates. Front Neurosci 2018;12.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang X, Zhou K, Wang R, Cui J, Lipton SA, Liao FF et al. Hypoxia-inducible factor 1alpha (HIF-1alpha)-mediated hypoxia increases BACE1 expression and beta-amyloid generation. J Biol Chem 2007;282(15).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuglielmotto M, Aragno M, Autelli R, Giliberto L, Novo E, Colombatto S et al. The up-regulation of BACE1 mediated by hypoxia and ischemic injury: role of oxidative stress and HIF1alpha. J Neurochem 2009;108(4).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLei L, Feng J, Wu G, Wei Z, Wang JZ, Zhang B et al. HIF-1α causes LCMT1/PP2A deficiency and mediates tau hyperphosphorylation and cognitive dysfunction during chronic hypoxia. Int J Mol Sci 2022;23(24).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWest NA, Kullo IJ, Morris MC, Mosley TH. Sex-specific associations of inflammation markers with cognitive decline. Exp Gerontol 2020;138.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBelarbi K, Jopson T, Tweedie D, Arellano C, Luo W, Greig NH et al. TNF-α protein synthesis inhibitor restores neuronal function and reverses cognitive deficits induced by chronic neuroinflammation. J Neuroinflammation. 2012;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQuintanilla RA, Orellana DI, Gonz\u0026aacute;lez-Billault C, Maccioni RB. Interleukin-6 induces Alzheimer-type phosphorylation of tau protein by deregulating the cdk5/p35 pathway. Exp Cell Res 2004;295(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKrstic D, Madhusudan A, Doehner J, Vogel P, Notter T, Imhof C et al. Systemic immune challenges trigger and drive Alzheimer-like neuropathology in mice. J Neuroinflammation 2012;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNasaruddin ML, Pan X, McGuinness B, Passmore P, Kehoe PG, H\u0026ouml;lscher C et al. Evidence that parietal lobe fatty acids may be more profoundly affected in moderate Alzheimer's Disease (AD) pathology than in severe AD pathology. Metabolites 2018;8(4).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShen Y, Wei C, Taishi Y, Zhang G, Su Z, Zhao P et al. Association between the circulating very long-chain saturated fatty acid and cognitive function in older adults: findings from the NHANES. BMC Public Health 2024;24(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMichaelis UR, Xia N, Barbosa-Sicard E, Falck JR, Fleming I. Role of cytochrome P450 2C epoxygenases in hypoxia-induced cell migration and angiogenesis in retinal endothelial cells. Invest Ophthalmol Vis Sci 2008;49(3).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXia Y, Xia L, Jin Z, Jin R, Paudel O, Sham JSK. Cytochrome P450 epoxygenase-dependent activation of TRPV4 channel participates in enhanced serotonin-induced pulmonary vasoconstriction in chronic hypoxic pulmonary hypertension. Anal Cell Pathol (Amst) 2020;2020.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDjelti F, Braudeau J, Hudry E, Dhenain M, Varin J, Bi\u0026egrave;che I et al. CYP46A1 inhibition, brain cholesterol accumulation and neurodegeneration pave the way for Alzheimer's disease. Brain 2015;138(Pt 8).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMaioli S, B\u0026aring;vner A, Ali Z, Heverin M, Ismail MA, Puerta E et al. Is it possible to improve memory function by upregulation of the cholesterol 24S-hydroxylase (CYP46A1) in the brain? PLoS ONE 2013;8(7).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGjota-Ergin S, G\u0026ouml;k\u0026ccedil;ek-Sara\u0026ccedil; \u0026Ccedil;, Adalı O, Jakubowska-Doğru E. Relationship between the hippocampal expression of selected cytochrome P450 isoforms and the animal performance in the hippocampus-dependent learning task. Neurosci Lett 2018;673.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang F, Li J, Na S, Wu J, Yang Z, Xie X et al. The involvement of PPARs in the selective regulation of brain CYP2D by growth hormone. Neuroscience 2018;379.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJacob A, Potin S, Saubam\u0026eacute;a B, Crete D, Scherrmann JM, Curis E et al. Hypoxia interferes with aryl hydrocarbon receptor pathway in hCMEC/D3 human cerebral microvascular endothelial cells. J Neurochem 2015;132(4).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRahman MS, Thomas P. Molecular characterization and expression of cytochrome P450 aromatase in atlantic croaker brain: regulation by antioxidant status and nitric oxide synthase during hypoxia stress. Front Physiol 2021;12.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWan Y, Ge RL, Cao Y, Luo L, Ji W. Chronic hypobaric hypoxia stimulates differential expression of cognitive proteins in hippocampal tissue. High Alt Med Biol 2025;26(2).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu M, Alkayed NJ. Hypoxic preconditioning and tolerance via hypoxia inducible factor (HIF) 1alpha-linked induction of P450 2C11 epoxygenase in astrocytes. J Cereb Blood Flow Metab 2005;25(8).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBai X, Yang J, Liu G, Zhu J, Wang Q, Gu W et al. Regulation of CYP450 and drug transporter mediated by gut microbiota under high-altitude hypoxia. Front Pharmacol 2022;13.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDuan Y, Bai X, Yang J, Zhou Y, Gu W, Liu G et al. Exposure to high-altitude environment is associated with drug transporters change: microRNA-873-5p-mediated alteration of function and expression levels of drug transporters under hypoxia. Drug Metab Dispos 2022;50(2).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCui D, Xu X. DNA methyltransferases, DNA methylation, and age-associated cognitive function. Int J Mol Sci 2018;19(5).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBahado-Singh RO, Vishweswaraiah S, Turkoglu O, Graham SF, Radhakrishna U. Alzheimer's precision neurology: epigenetics of cytochrome P450 genes in circulating cell-free dna for disease prediction and mechanism. Int J Mol Sci 2023;24(3).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-neuroinflammation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jneu","sideBox":"Learn more about [Journal of Neuroinflammation](http://jneuroinflammation.biomedcentral.com)","snPcode":"12974","submissionUrl":"https://submission.nature.com/new-submission/12974/3","title":"Journal of Neuroinflammation","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Cognitive impairment, neuroinflammation, oxidized lipid, high-altitude hypoxia, cytochrome P450, DNA methylation","lastPublishedDoi":"10.21203/rs.3.rs-7565540/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7565540/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eUnder high-altitude hypoxia, neuroinflammation contributes to cognitive impairment, though the underlying mechanisms remain unclear. In this study, we established rat and astrocyte models of hypoxic exposure. We found that hypoxia induced significant alterations in blood biochemistry, widespread neuronal and glial damage, and impaired spatial learning and memory in rats, which were associated with the abnormal accumulation of p-Tau and Aβ. Hypoxia also triggered neuroinflammation, increasing the levels of inflammatory mediators and activating microglia and astrocytes. Targeted metabolomics and molecular analyses revealed disrupted oxidized lipid metabolism, including reduced synthesis of key metabolites such as arachidonic acid derivatives, accompanied by downregulation of cytochrome P450 (CYP450) expression. In vitro, hypoxia enhanced astrocyte inflammation, promoted Aβ/p-Tau accumulation, increased apoptosis, and suppressed CYP450. Inhibiting CYP450, especially epoxygenase, exacerbated hypoxia-induced inflammation and protein aggregation. Furthermore, CYP450 downregulation was associated with DNA methylation changes. These findings highlight the role of DNA methylation-mediated CYP450 and oxidative lipid metabolic dysregulation in hypoxia-induced neuroinflammation and cognitive deficits, offering new insights for the development of neuroprotective strategies targeting the CYP450-oxidized lipid axis.\u003c/p\u003e","manuscriptTitle":"DNA methylation regulation of CYP450-lipid metabolism by high-altitude hypoxia: linking neuroinflammation to cognitive impairment","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-19 10:52:52","doi":"10.21203/rs.3.rs-7565540/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-11-02T21:57:09+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-02T21:41:40+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-01T09:53:05+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"313068155898410489528222429815915682565","date":"2025-10-06T14:31:53+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"205680482814448853003390624303247748368","date":"2025-10-06T12:39:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"241399572382971386134151589020781302080","date":"2025-09-14T13:37:49+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"196140193477034881214768091756647382039","date":"2025-09-12T12:58:57+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-12T10:26:35+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-12T05:34:14+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-12T02:38:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Neuroinflammation","date":"2025-09-08T14:42:29+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-neuroinflammation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jneu","sideBox":"Learn more about [Journal of Neuroinflammation](http://jneuroinflammation.biomedcentral.com)","snPcode":"12974","submissionUrl":"https://submission.nature.com/new-submission/12974/3","title":"Journal of Neuroinflammation","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5cfdbc23-e802-4214-a505-841360de3fb8","owner":[],"postedDate":"September 19th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-23T16:00:07+00:00","versionOfRecord":{"articleIdentity":"rs-7565540","link":"https://doi.org/10.1186/s12974-026-03775-6","journal":{"identity":"journal-of-neuroinflammation","isVorOnly":false,"title":"Journal of Neuroinflammation"},"publishedOn":"2026-03-20 15:57:32","publishedOnDateReadable":"March 20th, 2026"},"versionCreatedAt":"2025-09-19 10:52:52","video":"","vorDoi":"10.1186/s12974-026-03775-6","vorDoiUrl":"https://doi.org/10.1186/s12974-026-03775-6","workflowStages":[]},"version":"v1","identity":"rs-7565540","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7565540","identity":"rs-7565540","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}