Antibacterial, growth-promoting, and immunostimulatory effects of dietary caffeic acid in Asian seabass (Lates calcarifer) challenged with Streptococcus agalactiae | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Antibacterial, growth-promoting, and immunostimulatory effects of dietary caffeic acid in Asian seabass (Lates calcarifer) challenged with Streptococcus agalactiae Suwanna Wisetkaeo, Luu Tang Phuc Khang, Kritsada Phetduang, Sefti Heza Dwinanti, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8552784/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Caffeic acid (CA) has recently gained attention as a natural compound with antimicrobial and immunomodulatory potential relevant to aquaculture health management. However, its functional efficacy, optimal dietary inclusion level, and protective capacity against Streptococcus agalactiae infection in Asian seabass ( Lates calcarifer ) remain insufficiently characterized. This study evaluated the in vitro antibacterial activity of CA, assessed its short-term dietary safety, examined growth and immune responses during a 4-week feeding trial, and determined its protective effects against S. agalactiae . Antibacterial assays quantified dose-dependent inhibition of S. agalactiae , with a sigmoidal dose-response model estimating an EC₅₀ of 9.90 µg/mL. Acute toxicity testing showed no adverse effects at dietary concentrations up to 100 mg/kg. Feeding trials demonstrated that 25–50 mg/kg CA enhanced weight gain, specific growth rate, villus length, and immune-related gene expression. Following bacterial challenge, dietary CA significantly improved survival, with CA-50 yielding the highest survival rate (70.67%) and relative percent survival (47.62%), accompanied by attenuated hepatic degeneration, necrosis, and vascular congestion. Gene expression and histopathological analyses further confirmed enhanced immune activation and reduced lesion severity in fish treated with CA. These findings demonstrate that CA functions as an effective antimicrobial agent, growth promoter, and immuno-protective feed additive for Asian seabass. Caffeic acid growth performance immune response Lates calcarifer Streptococcus agalactiae Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Aquaculture has grown rapidly in recent decades, with a concurrent rise in the farming of high-value marine fish species. One such species, the Asian seabass ( Lates calcarifer ), also known as barramundi, is popular aquatic-farmed species whichfarmed extensively across the Indo-West Pacific region (Chenoweth and Hughes 1997 ; Yue et al 2001 ; Jerry 2013 ). Worldwide annual production of Asian seabass now exceeds 120,000 tons and is projected to grow about 5% per year in the near future (FAO 2025 ). This increasing production underlines the species’ economic and food security importance, but it also heightens concerns about disease outbreaks in intensive farming systems. Like other intensively cultured fish, Asian seabass is susceptible to a variety of infectious diseases at all life stages. In recent years, streptococcosis has emerged as one of the most serious bacterial threats to Asian seabass aquaculture (Winfield 2018 ; Piamsomboon et al 2020 ). Streptococcosis, primarily caused by Streptococcus agalactiae ( S. agalactiae ), can induce acute septicemia, neurological symptoms, and mass mortalities in farmed seabass (Piamsomboon et al 2020 ). Consequently, outbreaks of S. agalactiae in seabass now occur more frequently, mirroring the epizootic patterns seen in tilapia and underscoring the urgent need for effective control measures. Globally, streptococcal epidemics in aquaculture cause significant economic losses and threaten industry sustainability, highlighting a critical gap in disease management for Asian seabass and other susceptible species (Lan et al 2024 ). Traditional disease control in aquaculture has relied on antibiotics and, to a lesser extent, vaccines. However, excessive antibiotic use is unsustainable due to rising antimicrobial resistance and regulatory restrictions (Rathore and Madhusudana Rao 2025 ). Vaccination against S. agalactiae in fish can provide some protection (Guha et al 2025 ; Nandhakumar et al 2025 ; Rathore and Madhusudana Rao 2025 ), but vaccines are serotype-specific and may not fully prevent outbreaks under field conditions, especially where multiple Streptococcus serotypes or species co-circulate. These limitations have prompted exploration of alternative prophylactic strategies such as nutritional immunostimulant and phytotherapy. Functional feed additives derived from medicinal plants and natural compounds are increasingly studied as eco-friendly immunostimulants to enhance fish disease resistance (Rahul Sandeep et al 2025 ; Sumana et al 2025 ). Among various phytochemicals tested, phenolic compounds stand out for their broad bioactivity and safety profile in aquaculture (Beltrán and Esteban 2022 ; Naiel et al 2023 ; Dinh-Hung et al 2025 ). Caffeic acid (CA) is a naturally occurring phenolic acid (3,4-dihydroxycinnamic acid) abundant in many plants, fruits, and medicinal herbs (Birková et al 2020 ; Dinh-Hung et al 2025 ). It is broadly recognized as pharmacologically safe and exhibits diverse beneficial properties, including antioxidant, anti-inflammatory, antimicrobial, anti-carcinogenic, and immunomodulatory activities (Dinh-Hung et al 2025 ). Recent studies in aquaculture have indeed begun investigating CA as a natural immunostimulant and growth promoter. Dietary supplementation of CA has yielded promising results in several fish species like beluga sturgeon ( Huso huso ) (Ahmadifar et al 2022 ), common carp ( Cyprinus carpio ) (Alavinejad et al 2025 ), Nile tilapia ( Oreochromis niloticus ) (Yilmaz 2019 ). Using CA in feeds could thus help reduce antibiotic use and support fish health in a more natural and eco-friendly manner (Dinh-Hung et al 2025 ). However, despite this encouraging progress, knowledge gaps remain. The adoption of CA in aquafeeds is still limited by unresolved questions regarding optimal inclusion levels for different species, species-specific physiological responses, interactions of CA with other dietary components, and its effects on gut microbiota composition (Dinh-Hung et al 2025 ). Moreover, most published studies on dietary CA in fish have focused on species like tilapia or carp and on infections by Gram-negative bacteria (Yilmaz 2019 ; Alavinejad et al 2025 ); little attention has been given to marine/freshwater species such as Asian seabass or to Gram-positive pathogens like S. agalactiae . It is not yet clear whether the immune-boosting and disease-mitigating effects of CA observed in other fish will translate similarly in Asian seabass, especially under the threat of streptococcosis. This represents a critical research gap with both scientific and practical significance, as the culture of Asian seabass continues to expand and demand solutions for streptococcal disease management. Therefore, the present study aims to evaluate the effects of dietary CA supplementation on Asian seabass under conditions of streptococcosis. The investigation aims to determine whether this dietary additive can enhance growth performance, improve tissue integrity as assessed by histological evaluations, modulate immune-related gene expression, and increase resistance to Streptococcus agalactiae infection. 2. Materials and methods 2.1. Materials The CA were prepared following a modified protocol based on Lin et al ( 2019 ). The preparation method has been submitted for a patent application in Taiwan (application no. 114134921, filed on 11 September 2025). The bacterial pathogen S. agalactiae used in this study was isolated from diseased outbreak collected from a local aquaculture farm and was obtained from the Centex Shrimp Center, Faculty of Science, Mahidol University, Thailand. 550 one-month-old Asian seabass were supplied by a local fish farm in Chiang Mai, Thailand. The fish had an average body weight of 10.20 ± 0.10 g at the beginning of the experiment. Fish were acclimated under laboratory conditions prior to use in feeding trial and challenge test. 2.2. Antibacterial assay For the antimicrobial assay, the plate colony-counting method was employed to evaluate the in vitro toxicity of CA, following Reyes‐Becerril et al (2021) with minor modifications. CA powder was dissolved in absolute ethanol as stock at 20 mg/mL. Furthermore, working concentration made by mixed stock solution with sterilized water at 1, 10, 15, 20, and 40 µg/mL. S. agalactiae were cultured overnight in Brain-Heart Infusion Broth (BHIB, Himedia™, India) at 28°C with shaking at 150 rpm. After incubation, bacteria were washed twice with sodium phosphate buffer (PBS). The medium was removed by centrifugation at 6000 rpm for 3 min at 25°C. To test antibacterial activity, bacterial suspensions (1 × 10⁴ CFU/mL) were incubated with CA for 3 h with shaking. The samples were then diluted 10-fold, and 100 µL of the diluted solution was spread onto BHI agar plates. For each concentration, three biological replicates were conducted. After 48 h incubation at 28°C, colonies were counted and the EC₅₀ value (concentration producing 50% inhibition) was calculated to evaluate the antimicrobial activity of CA. 2.3. Experimental design for feeding trails Diet production and experimental feeding trial were carried out at the Department of Animal and Aquatic Sciences, Faculty of Agriculture, Chiang Mai University and Department of Agricultural Science and Technology, Faculty of Innovative Agriculture, Fisheries and Food, Prince of Songkla University, Surat Thani, Thailand. A commercial seabass feed (42% crude protein; Charoen Pokphand Foods PCL., Thailand) served as the basal diet. For the toxicity test, CA was incorporated into the basal feed at concentrations of 0, 50, 100, 1000, 2000 mg/kg to produce the CA-0, CA-50, CA-100, CA-1000, and CA-2000, respectively. For the feeding trial experiments, CA-diet were produced as the same method with 0, 25, 50, and 100 mg/kg as the CA-0, CA-25, CA-50, and CA-100 diets, respectively (the chosen concentration of dietary based on the results EC 50 of in vitro assays). The feed and CA were thoroughly mixed to ensure uniform distribution, after which a 6% cellulose binder was applied. The feed was then dried in a hot-air oven at 50–60°C for 2 h to facilitate gelatinization, and subsequently dried at 40°C for 24 h before storage at 4°C until use. For the toxicity test, three replicate aquaria for each treatment were prepared, each contains 10 fish were prepared. For the feeding trial, four replicate aquaria were prepared for these experiments, each tank stocked with 25 fish were assigned to each dietary treatment. Experimental diets were offered twice daily at 09:00 and 16:00 over a four-week feeding trial. Fish were observed for 30 min after each feeding to verify the absence of uneaten feed. Remaining feeds were collected and weighed at the end of each day to estimate the feed requirement for the subsequent day. Average feed intake for juvenile Asian seabass was expected to be approximately 4% of body weight throughout the experimental period. Water quality parameters were controlled throughout the study, with temperature maintained at 28 ± 2°C, pH at 7.05 ± 1.00, and a 12 h light/12 h dark photoperiod. Dissolved oxygen levels were kept between 5 and 7 mg/L during both the acclimation and experimental periods (Klongklaew et al 2025 ). 2.3. Growth performance analysis The fish were weighed every two weeks to determine their growth rate. Each treatment consisted of four tanks serving as biological replicates, with 25 fish stocked per tank. Any dead fish were removed and recorded. The survival rate was calculated on week 2 and 4 to obtain the final cumulative survival rate. The following indices were applied in this research to determine the growth performance of the fish (Khang et al 2025 ; Linh et al 2025b ): Weight gain (WG, %) = [(Final body weight – Initial weight)/Initial weight] × 100. Specific growth rate (SGR, %) = [ln (Final weight) – ln (Initial weight)]/days × 100. Feed conversion ratio (FCR) = [Feed consumed (g) / Weight gain (g)]. Average daily growth (ADG, g/day) = (Final body weight - Initial body weight)/ days. Periodic growth rate (PWG, g/day) = [(Final weight of period - Initial weight of the period) / period day]. 2.4. Bacterial challenge assay A single colony of S. agalactiae grown on BHIA (Himedia™, India) was be inoculated into 400 mL of BHIB (Himedia™, India) and incubated for 16 h at 28°C with shaking at 150 rpm. Bacterial cells were harvested by centrifugation (6,000 rpm, 10 min, 4°C), washed twice with PBS, and adjusted to the desired concentration using a SpectraMax QuickDrop Micro-Volume Spectrophotometer (Molecular Devices, USA) (Soontara et al 2024 ; Zhu et al 2024 ). A total of 150 Asian seabass was randomly assigned for a preliminary bacterial challenge to determine the median lethal concentration (LC₅₀) of S. agalactiae . Fish were challenged by immersion at concentrations of 0 (control), 10⁴, 10⁵, 10⁶, and 10⁷ CFU/mL. Each concentration was replicated in three tanks with 10 fish per tank (n = 30 fish per treatment). Based on the results of the LC₅₀ determination (Figure S1), all experimental fish in subsequent assays were challenged with S. agalactiae at 10⁶ CFU/mL. The challenge experiment consisted of the following treatments (1) negative control (CA-0, immersion with PBS), (2) positive control (CA-0), (3) CA-25, (4) CA-50, and (5) CA-100. Treatments (2)–(5) were immersed with S. agalactiae . Treatment (1) consisted of one tank with 25 fish, whereas treatments (2) to (5) consisted of three biological replicate tanks with 25 fish per tank (n = 75 fish per treatment). Fish were monitored daily till 14-day post immersion (dpi) to determine survival rates. Relative percent of survival (RPS) was calculated by Eq. (1) $$\:\text{R}\text{P}\text{S}\:\left(\text{%}\right)=\:\:\left(1-\:\frac{\text{M}\text{o}\text{r}\text{t}\text{a}\text{l}\text{i}\text{t}\text{y}\:\left(\text{%}\right)\:\text{i}\text{n}\:\text{t}\text{r}\text{e}\text{a}\text{t}\text{e}\text{d}\:\text{g}\text{r}\text{o}\text{u}\text{p}}{\text{M}\text{o}\text{r}\text{t}\text{a}\text{l}\text{i}\text{t}\text{y}\:\left(\text{%}\right)\:\text{i}\text{n}\:\text{p}\text{o}\text{s}\text{i}\text{t}\text{i}\text{v}\text{e}\:\text{c}\text{o}\text{n}\text{t}\text{r}\text{o}\text{l}\:\text{g}\text{r}\text{o}\text{u}\text{p}}\right)\times\:100\text{%}\:\left(1\right)$$ 2.5. Sample collection At the endpoint of the experiments, six fish from each treatment group were euthanized with clove oil (0.5 mL/L) (v/v) (Tola et al 2025 ), after which intestinal tissue (week 4) and hepatic tissue (7 dpi) were collected. Samples for gene expression analysis were preserved in TRIzol™ reagent (Thermo Fisher Scientific, USA), while tissues for histological examination were fixed in 10% neutral buffered formalin. 2.6. Gene expression analysis by qPCR Tissues (n = 6 per treatment) were homogenized using a Bullet Blender® Homogenizer (Next Advance, USA). The homogenates were incubated for 2–3 min at room temperature and mixed with 100 µL of chloroform. Phase separation was achieved by centrifugation at 16,000 rpm for 15 min at 4°C. The resulting aqueous phase was carefully collected and subjected to RNA purification using a Total RNA Extraction Kit (Omega Bio-tek, USA). RNA concentration and purity were assessed with a NanoDrop™ One/OneC spectrophotometer (Thermo Fisher Scientific, USA). For cDNA synthesis, 1 µg of total RNA from each sample was reverse transcribed using a commercial cDNA synthesis kit (Bio-Rad, USA) following the manufacturer’s instructions. Quantitative real-time PCR (qRT-PCR) was conducted using the CFX Connect™ Real-Time PCR Detection System (Bio-Rad, USA) in a 20-µL reaction mixture. Each reaction contained 1 µL of cDNA (100 ng), 0.2 µL of each gene-specific primer (10 µM), 5 µL of 2× iTaq™ Universal SYBR® Green Supermix (Bio-Rad, USA), and nuclease-free water to reach a final volume of 10 µL (Linh et al 2023 ; Sintuprom et al 2024 ). Beta-actin (β-actin) served as the housekeeping gene (Yang et al 2020 ). The thermal profile consisted of an initial denaturation at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 30 s and annealing at 60°C for 1 min. A melting curve was generated by increasing the temperature from 65°C to 95°C in 0.5°C increments. Complement component 3 ( C3 ), heat shock protein 70 ( HSP70 ), interleukin 10 ( IL-10 ), transforming growth factor beta 1 ( TGF-β ), tumor necrosis factor alpha ( TNF-α ), and interferon gamma 1 ( IFN-γ ) were selected for gene expression analysis in this study. The involvement of these genes, through their transcriptional and translational products, in directly and indirectly shaping immune function in fish has been substantiated across numerous investigations (Secombes et al 2001 ; Watts et al 2001 ; Basu et al 2002 ; Bird et al 2006 ). Relative gene expression was quantified using the 2 ⁻ΔΔCt method (Livak and Schmittgen 2001 ). Primer sequences are listed in Table 1 . Table 1 Primer of the immune-related genes in Lates calcarifer used in qPCR Gene Abbreviation Primer Sequence (5′–3′) Size (bp) Accession No. Complement component 3 F: AAATGCTGCCATCGTTCC R: CCAGTGACCTTCAGACCAAA 175 XM_018679796 Heat shock protein 70 F: CTGGAGTCCTACGCTTTCAA R: CTTGCTGATGATGGGGTTAC 204 HQ646109 Beta-actin F: AACCAAACGCCCAACAACT R: ATAACTGAAGCCATGCCAATG 112 XM_018667666 Interferon gamma 1 F: TACCAGGAGCAGGACAAGC R: TCGTCAGGCAGCGAACTT 134 NM_001360734 Interleukin 10 F: TGCTGCCGTTTTGTGGAG R: ACCGTGCTCAGGTAAAAGTCC 194 XM_018686737 Transforming growth factor beta 1 F: TACCTCGCTTCCCGTTTC R: CTGCTCATCCTCAGTCCCTC 105 XM_018665504 Tumor necrosis factor F: AAGGACTCCGCTGAGAAAAC R: TGAACGATGCCTGGCTGTA 241 XM_018699809 All primers were adopted from Yang et al ( 2020 ) study 2.6. Histological characteristics Tissue samples (n = 6 per treatment) were fixed, dehydrated through a graded ethanol series (10%, 20%, 30%, 50%, 70%, and 100%), and cleared twice in xylene for 60 min per immersion. Samples were then be infiltrated using a transitional solution (1:2 xylene: paraffin), followed by two stages of paraffin embedding. The embedded tissues were stored overnight in paraffin wax before block preparation. Paraffin blocks were sectioned at 5 µm thickness using a rotary microtome (Leica 2025, Wetzlar, Germany). Sections were stained with hematoxylin and eosin (H&E; Solarbio, G1120) to evaluate tissue and cellular morphology. Histological observations of the intestine were conducted using a CX43 light microscope (Olympus, Hachioji-shi, Tokyo, Japan) equipped with an E620 digital camera. Morphometric analyses were performed following the criteria described by Linh et al ( 2025a ). Histopathological alterations characteristic of S. agalactiae infection were identified by comparison with previously documented pathological features (Maharajan et al 2016 ; Laith et al 2017 ; Owatari et al 2020 ). 2.7. Statistical analysis Data analysis was performed by using SPSS (Version 29.0.2.0; IBM Corp., USA). The normality of data distribution was assessed using the Shapiro–Wilk test. Growth performance and immune parameters were expressed as mean ± standard deviation (SD). EC₅₀ and LC₅₀ values were calculated using OriginPro 2022 (OriginLab Corporation, USA). Differences among treatments were evaluated using one-way ANOVA followed by Tukey’s HSD test, with statistical significance set at p < 0.05. Survival rate differences in the challenge assay between treatment and control groups were analyzed using the Kaplan–Meier method, and pairwise comparisons were conducted using the Mantel–Cox test (p < 0.05). Graphical illustrations were generated using OriginPro 2022. 3. Results 3.1. Antibacterial activity of caffeic acid against Streptococcus agalactiae Total colony counts revealed that CA inhibits S. agalactiae growth in a clear, concentration-dependent manner (Fig. 1 A). In the PBS control, bacterial proliferation was robust. By contrast, the erythromycin control virtually abolished colony formation, confirming the assay’s sensitivity. Treatment with 1 µg/mL CA yielded 1,017 ± 111 colonies, while CA 5 µg/mL and 10 µg/mL resulted in reduced counts of 738 ± 93 and 546 ± 150 colonies, respectively. Exposure to 15 µg/mL further decreased colony formation to 72 ± 19 colonies. To quantify CA potency, colony counts were fitted to a sigmoidal dose–response model (Fig. 1 B). From this analysis, the EC 50 was calculated as 9.89838 µg/mL (log EC₅₀ = 0.995564) (Table S1-S3). 3.2. Acute dietary toxicity of caffeic acid in Asian seabass The acute toxicity of dietary CA was evaluated by exposing Asian seabass to graded inclusion levels ranging from 0 to 2000 mg/kg feed over a 7-day period (Fig. 2 ). Overall survival rates across all treatment groups were high, varying between 80.00% in CA-2000 and 96.67% in the control (CA-0) group. Statistical analysis revealed no significant differences among CA-0, CA-50, CA-100, and CA-1000 groups; however, the CA-2000 cohort exhibited a significantly lower survival rate compared to the CA-0 group (p < 0.05) (Supplementary Table S4). Importantly, throughout the entire experimental period, no abnormal clinical signs such as erratic swimming, surface gasping, cutaneous lesions, or discoloration were observed in any of the treatment groups, including those receiving the maximum CA dose. Consequently, although CA supplementation up to 100 mg/kg demonstrated a favorable safety profile, inclusion levels of 2000 mg/kg impaired survival without eliciting overt clinical pathology. 3.3. Experimental feeding trial 3.3.1 Growth performance analysis Growth performance outcomes differed among dietary CA treatments during the 4-week feeding period (Table 2 ). Initial body mass did not differ among groups, ranging from 10.13 ± 0.06 g to 10.26 ± 0.05 g (Table 2 ). At week 2, SR remained high across all treatments (96.67%- 98.89%) with no significant differences. FW at week 2 ranged from 11.00 ± 0.20 g in CA-0 to 12.10 ± 0.72 g in CA-25. WG increased from 0.87 ± 0.21 g in CA-0 to 1.90 ± 0.62 g in CA-25, corresponding to PWG values of 8.58 ± 2.11% and 18.64 ± 5.95%, respectively. SGR ranged from 0.59 ± 0.14%/day in CA-0 to 1.21 ± 0.36%/day in CA-25. ADG ranged from 0.06 ± 0.02 g/day to 0.14 ± 0.04 g/day, and FCR varied minimally among treatments (0.53–0.57). However, all growth indices have no significant differences. Table 2 Growth performance of Asian seabass ( Lates calcarifer ) fed diets containing graded levels of caffeic acid for 4 weeks. Parameter CA-0 CA-25 CA-50 CA-100 Initial weight (g) 10.13 ± 0.06 10.20 ± 0.10 10.26 ± 0.05 10.21 ± 0.10 Week 2 Survival rate (%) 98.89 ± 1.92 98.89 ± 1.92 96.67 ± 3.33 96.67 ± 3.33 Final weight (g) 11.00 ± 0.20 12.10 ± 0.72 11.95 ± 0.74 11.72 ± 0.37 Weight gain (g) 0.87 ± 0.21 1.90 ± 0.62 1.69 ± 0.78 1.51 ± 0.39 Percent weight gain (%) 8.58 ± 2.11 18.64 ± 5.95 16.53 ± 7.63 14.79 ± 3.81 Specific growth rate (%/day) 0.59 ± 0.14 1.21 ± 0.36 1.08 ± 0.48 0.98 ± 0.24 Average daily growth (g/day) 0.06 ± 0.02 0.14 ± 0.04 0.12 ± 0.06 0.11 ± 0.03 FCR 0.53 ± 0.02 0.56 ± 0.03 0.57 ± 0.05 0.55 ± 0.01 Week 4 Survival rate (%) 98.89 ± 1.92 97.78 ± 3.85 95.56 ± 5.09 97.78 ± 3.85 Final weight (g) 16.83 ± 0.22 b 18.75 ± 0.57 a 18.47 ± 0.93 a 18.07 ± 0.23 a Weight gain (g) 6.70 ± 0.27 b 8.55 ± 0.64 a 8.21 ± 0.92 a 7.86 ± 0.30 a Percent weight gain (%) 66.09 ± 3.02 b 83.85 ± 6.99 a 80.09 ± 8.88 a 77.03 ± 3.56 ab Specific growth rate (%/day) 1.69 ± 0.06 b 2.03 ± 0.13 a 1.96 ± 0.17 a 1.90 ± 0.07 ab Average daily growth (g/day) 0.48 ± 0.02 b 0.61 ± 0.05 a 0.59 ± 0.07 a 0.56 ± 0.02 a FCR 2.27 ± 0.62 2.32 ± 0.05 2.30 ± 0.03 2.57 ± 0.10 Values are presented as mean ± standard deviation. Values within the same row with different superscript letters indicate significant differences among treatments (one-way ANOVA followed by Tukey’s HSD test, p < 0.05). At week 4, SR showed no significant differences, ranging from 95.56% to 98.89% (Table 2 ). FW was significantly higher in CA-25 (18.75 ± 0.57 g), CA-50 (18.47 ± 0.93 g) and CA-100 (18.07 ± 0.23 g) than in CA-0 (16.83 ± 0.22 g). WG increased from 6.70 ± 0.27 g in CA-0 to 8.55 ± 0.64 g in CA-25, with CA-25 and CA-50 forming the highest statistical group. PWG ranged from 66.09 ± 3.02% in CA-0 to 83.85 ± 6.99% in CA-25, with CA-25 and CA-50 differing significantly from CA-0. SGR increased from 1.69 ± 0.06%/day in CA-0 to 2.03 ± 0.13%/day in CA-25, following the same statistical pattern as WG. ADG ranged from 0.48 ± 0.02 g/day in CA-0 to 0.61 ± 0.05 g/day in CA-25, and FCR showed no significant differences among treatments (2.27–2.57). 3.3.2. Immune-related gene expression Dietary CA significantly altered the transcription of immune-related genes in the midgut of Asian seabass (Fig. 3 ). IL-10 expression significantly increased from 1.03 in CA-0 to 2.13 in CA-50 and decreased to 1.37 in CA-100, with corresponding log₂-fold changes of 0.80, 1.03, and 0.29. TNF-α expression ranged from 0.85 in CA-50 to 1.10 in CA-0, and all CA-treated groups displayed negative log₂-fold changes between − 0.50 and − 0.38, but there were no significant differences observed. TGF-β expression rose from 1.08 in CA-0 to 2.17 in CA-50 and declined to 1.56 in CA-100, yielding log₂-fold changes of 0.88, 1.03, and 0.53. IFN-γ expression increased from 1.03 in CA-0 to 2.04 in CA-50 and decreased to 1.34 in CA-100, corresponding to log₂-fold changes of 0.66, 0.96, and 0.29. C3 expression ranged from 1.22 in CA-0 to 2.08 in CA-50, with CA-25 and CA-50 assigned to the highest statistical group and log₂-fold changes between 0.71 and 0.91. HSP70 expression decreased from 1.08 in CA-0 to 0.61 in CA-50 and increased to 0.85 in CA-100, producing log₂-fold changes ranging from − 0.49 to − 0.37. 3.3.3. Intestinal histology Dietary CA produced distinct morphological and quantitative changes in the intestinal mucosa (Fig. 4 ). Histological sections showed compact villi with shorter projections in CA-0, whereas CA-25 and CA-50 displayed visibly elongated and more slender villi, and CA-100 exhibited moderately developed villi. Villus length increased from 87.88 ± 19.24 µm in CA-0 to 177.01 ± 42.33 µm in CA-50, with CA-50 forming the highest statistical group and CA-0 the lowest. Villus width ranged from 33.73 ± 3.38 µm in CA-100 to 38.63 ± 3.67 µm in CA-50, and no significant differences were detected among treatments. Thickness of muscularis width varied between 7.76 ± 2.39 µm in CA-50 and 9.67 ± 1.95 µm in CA-100, and no treatment effect was detected. Muscularis thickness decreased from 26.63 ± 8.42 µm in CA-0 to 11.10 ± 3.92 µm in CA-50, with CA-0 forming the highest significance group and CA-50 the lowest (p < 0.05). 3.4. Challenge test 3.4.1. Clinical and pathological observations At 14 dpi with S. agalactiae , Asian seabass demonstrated a range of both external and internal pathological signs consistent with streptococcosis (Fig. 5 ). Behaviorally, infected seabass swam sluggishly and concentrated on hovering or resting at the bottom of the tank, often displaying a slight lateral tilt. Additionally, the affected fish exhibited reduced responses to external stimuli and delayed feeding responses, indicating systemic malaise. Externally, fish frequently display focal scale loss along the flanks and dorsal region (Fig. 5 A); mild hemorrhages often border these denuded areas. Moreover, ocular involvement was pronounced, with exophthalmia developing in several individuals (Fig. 5 B). In more severe cases, the protruded eyes show periorbital bleeding and corneal opacity, showing extensive vascular compromise (Fig. 5 C). Internally, necropsy revealed pronounced hepatomegaly (Fig. 5 C). Specifically, the liver was visibly swollen, smooth-edged, and pale, contrasting sharply with the darker hues of control fish. Furthermore, multiple petechial hemorrhages were observed on the liver surface and parenchyma, and upon sectioning, the tissue was friable with interspersed blood-tinged areas (Fig. 5 E). No significant lesions were noted in other visceral organs, although the hepatic changes occasionally accompanied mild congestion of the spleen. 3.4.2. Survival rate, relative percent survival Dietary CA significantly affected post-challenge survival of Asian seabass over the 14-day period. Survival in the control (+) group remained at 100% across all days, whereas survival in control (-) declined to 44.00% by day 14 (Fig. 6 A). Fish fed 25 mg/kg, 50 mg/kg, and 100 mg/kg CA exhibited final survival rates of 61.33%, 70.67%, and 52.00%, respectively. Statistical groupings indicated that CA-50 formed the highest surviving treatment group, followed by CA-25 and CA-100, which differed significantly from one another and from control (–) (Table S5). In addition, relative percent survival values, calculated against the control (–) group, were 30.95% for CA-25, 47.62% for CA-50, and 14.29% for CA-100 (Fig. 6 B). These values correspond to the observed survival patterns and the Kaplan–Meier outcomes. 3.4.3. Immune-related gene expression in the liver post challenge Dietary treatment also significantly modulated transcription of six immune-related genes (Fig. 6 C). IL-10 expression ranged from 0.71 in control (–) to 5.23 in CA-50, with intermediate values of 4.32 in CA-25 and 3.54 in CA-100 (p < 0.05). TNF-α expression significantly increased from 1.09 in control (+) to 4.36 in control (–) and ranged from 1.02 to 2.20 in CA-treated groups. TGF-β expression rose from 1.12 in control (+) to 5.84 in CA-50, with CA-25, CA-50, and CA-100 (p < 0.05). IFN-γ expression ranged from 1.00 in control (–) to 3.68 in CA-50, with CA-25 and CA-100 forming intermediate groups. C3 expression ranged from 0.90 in control (–) to 4.52 in CA-50, with CA-25 and CA-100 also clustering in the highest expression group (p < 0.05). HSP70 expression peaked at 5.63 in the control (–) and ranged from 2.13 to 3.60 among the CA treatments (p < 0.05). Log₂-fold change analysis supported these patterns (Fig. 6 D). IL-10 exhibited positive fold changes of 1.97, 2.18, and 1.66 in CA-25, CA-50, and CA-100. TGF-β showed positive fold changes, ranging from 2.09 to 2.51, across these treatments. IFN-γ showed log₂-fold changes ranging from 1.45 to 1.82. C3 exhibited increases of 1.69 to 2.06. TNF-α and HSP70 showed positive fold changes in all caffeic acid groups, ranging from 0.53 to 1.82. 3.4.4. Liver histopathology Liver morphology differed markedly among treatments following S. agalactiae challenge at 7 dpi (Fig. 7 ). PBS-injected fish showed intact hepatic cords, uniformly polygonal hepatocytes, and narrow sinusoids without evidence of degeneration or inflammation (Fig. 7 A). In contrast, infected fish receiving the CA-0 diet exhibited extensive cytoplasmic degeneration, diffuse vacuolization, and multifocal nuclear degeneration, accompanied by widespread cellular necrosis and marked sinusoidal dilation (Fig. 7 B & 7 C). Prominent vascular congestion and frequent melanomacrophage centers were also observed in this group. Dietary CA reduced lesion severity in a concentration-dependent manner. Fish fed 25 mg/kg CA displayed moderate hepatocellular degeneration with scattered necrotic foci and localized vascular congestion, while partial preservation of normal nuclei was evident (Fig. 7 D). Supplementation with 50 mg/kg CA resulted in the mildest pathological alterations, characterized by limited cytoplasmic degeneration, minimal sinusoidal dilation, and small, infrequent necrotic areas (Fig. 7 E). Fish fed 100 mg/kg CA showed intermediate hepatic injury, characterized by mild to moderate degeneration and occasional congestion, with varying lesion severity (Fig. 7 F). Melanomacrophage centers were found in all infected groups. 4. Discussion The present findings indicate that dietary CA enhances disease resistance in Asian seabass challenged with S. agalactiae , most likely through multiple complementary mechanisms. A primary mechanism involves the direct antibacterial activity of CA. In this study, in vitro assays confirmed that CA inhibits S. agalactiae proliferation in a clear dose-dependent manner, with an EC₅₀ of approximately 10 µg/mL. This observation aligns with previous reports demonstrating that phenolic acids such as CA can diffuse across the semi-permeable bacterial membrane, undergo intracellular decomposition, and thereby acidify the cytoplasmic environment (Kyselka et al 2017 ). The resulting pH reduction interferes with vital metabolic pathways, suppresses enzymatic activity, and disrupts essential cellular enzymes, ultimately culminating in bacterial cell death (Lima et al 2016 ; Khan et al 2021 ). Additionally, in silico analyses have revealed that CA can inhibit the efflux pump regulators TetR and TetM, which play central roles in tetracycline resistance, highlighting CA’s potential to counteract efflux-mediated antimicrobial resistance (Sivakumar et al 2020 ). Beyond its activity against S. agalactiae , CA exhibits a broad antimicrobial spectrum. Kot et al ( 2019 ) reported that CA exerted bacteriostatic effects against Aeromonas species with minimum inhibitory concentrations ranging from 1.56 to 3.12 mg/mL, while its derivative, caffeic acid phenethyl ester, has demonstrated potent inhibitory effects against Strpetococcus species (Meyuhas et al 2015 ; Veloz et al 2019 ). Dietary supplementation with CA produced a clear, dose-dependent improvement in growth performance in juvenile Asian seabass. After four weeks, fish receiving 25 and 50 mg/kg CA displayed significantly greater final weights and weight gains than controls, with corresponding increases in SGR. Uniformly high survival across treatments confirmed that CA did not negatively affect viability. These findings align closely with recent literature demonstrating that moderate supplementation with CA or related phenolic acids enhances growth in various aquaculture species, primarily through stimulation of digestive enzyme activity. In Beluga sturgeon, CA supplementation at 5–10 g/kg significantly increased weight gain and markedly enhanced amylase, lipase, and pepsin activities relative to controls (Ahmadifar et al 2022 ). Similar outcomes have been documented in Nile tilapia receiving 5 g/kg CA displayed significantly increased activities of SOD, CAT, and GPx, accompanied by improved blood biochemistry, enhanced intestinal morphology (Yilmaz 2019 ). Comparable enhancements in digestive function and growth have been reported in common carp (Bakhtiari et al 2024 ), grass carp (Yang et al 2024b ), loach ( Misgurnus anguillicaudatus ) (Liu et al 2023 ), allow pond turtle ( Mauremys mutica ) (Zhang et al 2025 ), Nile tilapia (Yu et al 2020 ), Pacific white shrimp ( Litopenaeus vannamei ) (Lu et al 2024 ), and yellow croaker ( Larimichthys polyactis ) (Xu et al 2022b ), suggesting that CA and its derivatives exert conserved digestive-enhancing effects across diverse taxa. Mechanistically, these improvements are widely attributed to the potent antioxidant and anti-inflammatory capacities of CA compounds. CA enhances endogenous antioxidant defenses by upregulating central enzymes such as SOD, CAT, and GPx, while concurrently activating cytoprotective signaling cascades including the Nrf2 pathway (Dinh-Hung et al 2025 ). In parallel, CA and its derivatives modulate inflammatory homeostasis by suppressing NF-κB- and MAPK-mediated signaling, thereby reducing inflammatory stress in the gastrointestinal tract. This dual action, promoting antioxidative protection while attenuating inflammation, likely fosters a more efficient digestive environment (Dinh-Hung et al 2025 ), enabling improved nutrient absorption and contributing to the elevated growth performance observed in CA-treated seabass. The intestinal morphology of CA-supplemented fish was markedly altered in ways that favor nutrient absorption. Control fish (CA-0) displayed relatively short, compact villi. In contrast, midgut sections from CA-25 and CA-50 groups exhibited dramatically longer, more slender villi – nearly doubling in length at 50 mg/kg. Villus length plateaued or slightly declined at the highest CA dose. Villus width and Thickness of the lamina propria did not differ significantly among treatments. Muscularis thickness, however, decreased significantly at CA-50. This shift toward taller, slimmer villi with a thinner muscularis may reflect a gut optimized for absorption over motility, consistent with enhanced digestive function (Wang et al 2025a ). Increased villus height effectively expands the absorptive surface area of the intestine, which likely underlies the improved growth performance. Thus, the present increase in villus length at moderate CA levels is consistent with the expected gut-boosting properties of organic acids. The reduction in muscularis thickness is less commonly reported but may indicate that as nutrient absorption becomes more efficient (via longer villi), less muscular effort is required for gut peristalsis. Alternatively, it could reflect a reallocation of energy toward epithelial growth rather than muscular maintenance. In any case, the pronounced villus elongation would increase the digestive surface and likely contribute to the higher weight gains observed. Dietary CA exerted pronounced immunomodulatory effects in the midgut, characterized by a coordinated upregulation of key regulatory and innate immune genes at moderate inclusion levels. Anti-inflammatory cytokines IL-10 and TGF-β were markedly elevated in the CA-25 and CA-50 groups, with IL-10 transcripts increasing nearly twofold at 50 mg/kg and TGF-β showing a comparable rise. IFN-γ , a Th1-associated cytokine, and complement component C3 similarly reached their highest expression in these treatments, indicating enhanced innate immune activation. Conversely, pro-inflammatory TNF-α exhibited a slight, non-significant downward trend across all CA treatments. The stress-inducible gene HSP70 showed lower expression in CA-supplemented groups compared with the control. As no inflammatory or pathogenic challenge was applied in this experiment, the relatively higher HSP70 expression observed in the CA-0 group likely reflects baseline cellular turnover and routine metabolic activity in the intestinal epithelium rather than excessive inflammation or pathological stress. Accordingly, the downregulation of HSP70 in CA-fed fish should be interpreted as an indication of improved cellular homeostasis and a reduced requirement for stress-response signaling under normal physiological conditions, rather than the alleviation of abnormal stress. This overall transcriptional pattern reflects a balanced immunostimulatory profile in which CA enhances regulatory and antimicrobial defenses without provoking excessive inflammation. The strong induction of IL-10 and TGF-β is particularly important, as these cytokines play central roles in controlling inflammatory reactivity in teleosts and may contribute to improved mucosal homeostasis (Zou and Secombes 2016 ; Dong et al 2022 ; Li et al 2023 ). Comparable responses have been reported in recent CA-feeding studies across aquaculture species. Nile tilapia receiving 5 g/kg CA showed elevated phagocytic activity, respiratory burst, serum lysozyme, MPO activity, and upregulation of genes including IL-1β , TNF-α , IL-8 , IFN-γ , and IgM ; beluga sturgeon fed 5–10 g/kg CA exhibited significantly enhanced lysozyme activity, total immunoglobulin, and serum protein levels (Yilmaz 2019 ); and several studies in rainbow trout and other species demonstrated that caffeic-acid-derived compounds such as chlorogenic acid enhance nonspecific immunity, complement activity, and resistance to infection (Xu et al 2022a ; Zhai et al 2022 ; Ghafarifarsani et al 2023 ; Liu et al 2023 ; Xia et al 2024 ; Yang et al 2024a ; Wang et al 2025b ). Beyond immune enhancement, CA derivatives consistently demonstrate anti-inflammatory properties by attenuating NF-κB-mediated cytokine production, as evidenced by CAPE-induced suppression of TNF-α and IL-1β , accompanied by an increase in IL-10 in zebrafish (Lin et al 2025 ). In the present study, the coordinated upregulation of regulatory cytokines ( IL-10 and TGF-β ), together with enhanced innate immune markers ( IFN-γ and C3 ) and reduced HSP70 expression, suggests that dietary CA supports a more stable intestinal environment that promotes immune readiness. Organic acids are known to modulate the intestinal microbiota by suppressing pathogenic taxa and promoting beneficial commensals such as Lactobacillus, which in turn influence host cytokine signaling and mucosal barrier integrity (Dittoe et al 2018 ; Busti et al 2020 ; Ebeid and Al-Homidan 2022 ). Thus, the enhanced expression of IL-10 , IFN-γ , and C3 in CA-supplemented seabass may reflect a more favorable gut milieu that fosters immune readiness while maintaining inflammatory balance. It should be noted that, in the absence of a disease or inflammatory challenge, changes in HSP70 expression should be regarded as indicators of cellular metabolic adjustment rather than direct evidence of stress severity. Although functional immune assays were not conducted here, the convergence of regulatory cytokine induction, innate immune enhancement, and moderated stress-response signaling strongly suggests that CA primes the mucosal immune system under normal physiological conditions in a manner consistent with the improved disease resilience reported in other aquaculture species (Yilmaz 2019 ; Ahmadifar et al 2022 ; Alavinejad et al 2025 ). CA significantly enhances disease resistance in Asian seabass challenged with S. agalactiae . Moderate CA doses (especially 50 mg/kg) yielded markedly higher survival and relative percent survival than the un-supplemented, infected control, whereas the highest dose (100 mg/kg) conferred less benefit. The dose-dependent survival pattern suggests an optimal CA level for protection. The observed clinical signs in infected fish including lethargy, exophthalmia, hemorrhages, pallor and enlargement of the liver (hepatomegaly), and occasional splenic congestion which match classical streptococcosis pathology described in other studies of S. agalactiae (e.g., erratic behavior, eye opacity, skin petechiae, and darkened liver) (Deng et al 2024 ; Jia et al 2025 ; Sharon et al 2025 ). Importantly, CA markedly reduced these lesions by fish fed CA had less severe hepatic necrosis and hemorrhage, and only mild focal vacuolization and congestion at moderate doses, whereas CA-free infected fish showed extensive necrosis and sinusoidal dilation. These findings indicate that CA protects internal organs during bacterial infection. In addition, CA likely mitigates S. agalactiae -induced systemic damage through multiple actions. Several complementary mechanisms may underlie the protective effect of CA. CA itself has direct antibacterial activity against fish pathogens, as has been proven in an in vitro assay. Beyond direct antimicrobial effects, CA exerts potent immunomodulatory actions in fish. In the present study, moderate dietary CA markedly upregulated regulatory and innate immunity genes in the liver. Anti-inflammatory cytokines IL-10 and TGF-β were strongly elevated (especially at 50 mg/kg), while the pro-inflammatory TNF-α transcript showed a non-significant decline. The stress-inducible HSP70 was significantly downregulated in CA-fed fish, suggesting lower cellular stress. In tandem, transcripts for innate effectors ( IFN-γ , C3 ) were elevated at moderate CA levels. This pattern, which includes increased regulatory/antimicrobial signaling with dampened stress and unchecked inflammation, is indicative of a balanced immunostimulation that enhances defense without provoking pathology. Functionally, increased IL-10/TGF-β may help control inflammation (Li et al 2023 ), while systemically, higher IFN-γ levels suggest stronger antimicrobial readiness (Meadows et al 1989 ; Yue et al 2021 ). The net effect is improved pathogen clearance with less collateral damage, which likely contributes to the higher survival observed. CA is also a well-known antioxidant, and its benefits may include the reduction of oxidative stress during infection. For example, in trout exposed to toxins or infection, CA compounds activate the Nrf2 pathway and antioxidant enzymes (SOD, CAT, GPx) to scavenge free radicals (Chung et al 2006 ). In this study, although antioxidant enzymes were not directly measured, the lower HSP70 expression and milder tissue lesions in CA-fed fish imply that oxidative damage was mitigated. By scavenging reactive oxygen species and stabilizing cellular redox state, CA likely helped preserve intestinal and hepatic cell integrity during the bacterial challenge. Interestingly, survival and immune enhancement were greatest at intermediate CA doses (50 mg/kg) and declined at the highest dose (100 mg/kg). This suggests a threshold beyond which additional CA confers no extra benefit or may even exert counterproductive effects. In our seabass, the 50 mg/kg dose provided the best balance of immune stimulation and low pathology. The intermediate dose likely optimized the antioxidant and anti-inflammatory effects without potential toxicity or pro-oxidant action at very high levels. 5. Conclusion The present study demonstrates that CA offers multifaceted benefits to Asian seabass, functioning as both an effective antimicrobial agent against S. agalactiae and a potent dietary immunomodulatory compound. CA inhibited S. agalactiae proliferation in vitro with an EC₅₀ of 9.90 µg/mL. When administered through feed, concentrations up to 100 mg/kg exhibited no acute toxicity and supported normal behavior and survival. Dietary inclusion of CA at 25–50 mg/kg significantly enhanced growth performance, intestinal morphology, and immune gene activation under non-challenged conditions. Following bacterial challenge, CA-supplemented fish, particularly those receiving 50 mg/kg, exhibited higher survival rates, enhanced immune transcriptional responses, and markedly reduced hepatic lesions, including lower degeneration, congestion, and necrosis. Collectively, these results establish CA as a promising functional feed additive capable of strengthening systemic immunity, improving gut integrity, and mitigating streptococcal pathology in Asian seabass aquaculture. Declarations Animal ethics All procedures performed in studies involving animals were in strict accordance with the institutional and national guidelines for the care and use of laboratory animals. The experimental protocol was reviewed and approved by the Prince of Songkla University (Approval No. Ref.AQ105/2025). Acknowledgments This research was partially supported by Chiang Mai University. CRediT authorship contribution statement Suwana Witsetkaew: Roles/Writing - Original draft, Formal analysis, Data curation, Methodology, Investigation, Writing, Review & Editing. Luu Tang Phuc Khang : Roles/Writing - Original draft, Formal analysis, Data curation, Methodology, Investigation, Writing, Review & Editing. Kritsada Phetduang: Roles/Writing - Original draft, Investigation, Methodology. Sefti Heza Dwinanti: Roles/Writing - Original draft, Investigation, Methodology. Phatthanaphong Therdtatha: Investigation, Methodology. Lee Po-Tsang: Conceptualization, Investigation, Methodology. Papungkorn Sangsawad: Roles/Writing - Original draft, Writing, Review & Editing, Investigation, Methodology, Conceptualization. Mintra Seel-audom: Roles/Writing - Original draft, Investigation, Methodology. Patima Permpoonpatana: Roles/Writing - Original draft, Investigation, Methodology. Nguyen Vu Linh: Roles/Writing - Original draft, Formal analysis, Data curation, Methodology, Investigation, Writing, Review & Editing, Resources, Conceptualization, Funding acquisition, and Project administration. Data availability Datasets used and analyzed during the current study available from the corresponding author on reasonable request. Declaration of competing interest The authors declare no conflict of interest. References Ahmadifar E, Mohammadzadeh S, Kalhor N, Salehi F, Eslami M, Zaretabar A, Moghadam MS, Hoseinifar SH, Van Doan H (2022) Effects of caffeic acid on the growth performance, growth genes, digestive enzyme activity, and serum immune parameters of beluga (Huso huso). J Experimental Zool Part A: Ecol Integr Physiol 337(7):715–723 Alavinejad SS, Soltani M, saeed Mirzargar S, Shohreh P, Taherimirghaed A (2025) Influence of caffeic acid and Bacillus coagulans supplementation on growth, digestive enzymes, immune response, and antioxidant gene expression in common carp (Cyprinus carpio) and its resistance to Aeromonas hydrophila infection. Aquaculture Rep 40:102515 Bakhtiari F, Ahmadifar E, Moghadam MS, Mohammadzadeh S, Mahboub HH (2024) Dual effects of dietary Lactobacillus helveticus and chlorogenic acid on growth performance, digestibility, immune-antioxidant capacity and resistance against heat stress of juvenile common carp. Aquacult Int 32(6):7911–7927 Basu N, Todgham A, Ackerman P, Bibeau M, Nakano K, Schulte P, Iwama GK (2002) Heat shock protein genes and their functional significance in fish. Gene 295(2):173–183 Beltrán JMG, Esteban MÁ (2022) Nature-identical compounds as feed additives in aquaculture. Fish Shellfish Immunol 123:409–416 Bird S, Zou J, Secombes CJ (2006) Advances in fish cytokine biology give clues to the evolution of a complex network. Curr Pharm Design 12(24):3051–3069 Birková A, Hubková B, Bolerázska B, Mareková M, Čižmárová B (2020) Caffeic acid: A brief overview of its presence, metabolism, and bioactivity. Bioactive Compounds in Health and Disease-Online ISSN: 2574 – 0334; Print ISSN: 2769 – 2426. 3(4):74–81 Busti S, Rossi B, Volpe E, Ciulli S, Piva A, D’Amico F, Soverini M, Candela M, Gatta PP, Bonaldo A (2020) Effects of dietary organic acids and nature identical compounds on growth, immune parameters and gut microbiota of European sea bass. Sci Rep 10(1):21321 Chenoweth S, Hughes J (1997) Genetic population structure of the catadromous Perciform: Macquaria novemaculeata (Percichthyidae). J Fish Biol 50(4):721–733 Chung MJ, Walker PA, Hogstrand C (2006) Dietary phenolic antioxidants, caffeic acid and Trolox, protect rainbow trout gill cells from nitric oxide-induced apoptosis. Aquat Toxicol 80(4):321–328 Deng Y, Lin Z, Xu L, Jiang J, Cheng C, Ma H, Feng J (2024) A first report of Streptococcus iniae infection of the spotted sea bass (Lateolabrax maculates). Front Veterinary Sci 11:1404054 Dinh-Hung N, Khang LTP, Wisetkaeo S, Tran NT, Po-Tsang L, Brown CL, Sangsawad P, Dwinanti SH, Permpoonpattana P, Linh NV (2025) Caffeic Acid as a Promising Natural Feed Additive: Advancing Sustainable Aquaculture. Biology 14(9):1160 Dittoe DK, Ricke SC, Kiess AS (2018) Organic acids and potential for modifying the avian gastrointestinal tract and reducing pathogens and disease. Front veterinary Sci 5:216 Dong Y-W, Jiang W-D, Wu P, Liu Y, Kuang S-Y, Tang L, Tang W-N, Zhou X-Q, Feng L (2022) Novel insight into nutritional regulation in enhancement of immune status and mediation of inflammation dynamics integrated study in vivo and in vitro of teleost grass carp (Ctenopharyngodon idella): administration of threonine. Front Immunol 13:770969 Ebeid TA, Al-Homidan IH (2022) Organic acids and their potential role for modulating the gastrointestinal tract, antioxidative status, immune response, and performance in poultry. World's Poult Sci J 78(1):83–101 FAO (2025) Lates calcarifer Bloch,1790 . https://www.fao.org/fishery/en/aqspecies/3068/en Ghafarifarsani H, Nedaei S, Hoseinifar SH, Van Doan H (2023) Effect of different levels of chlorogenic acid on growth performance, immunological responses, antioxidant defense, and disease resistance of rainbow trout (Oncorhynchus mykiss) juveniles. 2023(1):3679002Aquaculture nutrition Guha R, Nandhakumar K, Byadgi OV, Chen SC, Elumalai P (2025) Immune Response and Protective Efficacy of β-Glucan and Alkoxyglycerol as Adjuvant in Streptococcus agalactiae Formalin‐Inactivated Vaccine in Nile Tilapia (Oreochromis niloticus). J Fish Dis : e14141 Jerry DR (2013) Biology and culture of Asian seabass Lates calcarifer. CRC Jia R, Hou Y, Zhou L, Zhang C, Li B, Zhu J (2025) Combined effects of high-fat diet feeding and Streptococcus agalactiae infection on lipid metabolism, antioxidant status, and immune response in tilapia (Oreochromis niloticus). Toxicology & Pharmacology, Comparative Biochemistry and Physiology Part C, p 110321 Khan F, Bamunuarachchi NI, Tabassum N, Kim Y-M (2021) Caffeic acid and its derivatives: antimicrobial drugs toward microbial pathogens. J Agric Food Chem 69(10):2979–3004 Khang LTP, Linh NV, Wisetkaeo S, Therdtatha P, Dinh-Hung N, Phimolsiripol Y, Seesuriyachan P, Sangsawad P, Permpoonpatana P, Van Doan H (2025) Fermented corn stover (Zea mays L.) enhances growth, immune response, histology, gut microbiome, and gene expression in Cyprinus carpio var. koi in biofloc system. Italian J Anim Sci 24(1):2359–2375 Klongklaew N, Tansutaphanit S, Tiewpair P, Buncharoen W, Phaksopa J, Srisapoome P, Uchuwittayakul A (2025) Fish Health Enhancement and Intestinal Microbiota Benefits of Asian Seabass (Lates calcarifer Bloch, 1790) on Dietary Sea Lettuce (Ulva rigida C. Agardh, 1823) Extract Supplementation. Animals 15(12):1714 Kot B, Kwiatek K, Janiuk J, Witeska M, Pękala-Safińska A (2019) Antibacterial activity of commercial phytochemicals against Aeromonas species isolated from fish. Pathogens 8(3):142 Kyselka J, Rabiej D, Dragoun M, Kreps F, Burčová Z, Němečková I, Smolová J, Bjelková M, Szydłowska-Czerniak A, Schmidt Š (2017) Antioxidant and antimicrobial activity of linseed lignans and phenolic acids. Eur Food Res Technol 243:1633–1644 Laith A, Ambak MA, Hassan M, Sheriff SM, Nadirah M, Draman AS, Wahab W, Ibrahim WNW, Aznan AS, Jabar A (2017) Molecular identification and histopathological study of natural Streptococcus agalactiae infection in hybrid tilapia (Oreochromis niloticus). Veterinary World 10(1):101 Lan NGT, Dong HT, Shinn AP, Vinh NT, Senapin S, Salin KR, Rodkhum C (2024) Review of current perspectives and future outlook on bacterial disease prevention through vaccination in Asian seabass (Lates calcarifer). J Fish Dis 47(8):e13964 Li K, Wei X, Yang J (2023) Cytokine networks that suppress fish cellular immunity. Dev Comp Immunol 147:104769 Lima VN, Oliveira-Tintino CD, Santos ES, Morais LP, Tintino SR, Freitas TS, Geraldo YS, Pereira RL, Cruz RP, Menezes IR (2016) Antimicrobial and enhancement of the antibiotic activity by phenolic compounds: Gallic acid, caffeic acid and pyrogallol. Microb Pathog 99:56–61 Lin CJ, Chang L, Chu HW, Lin HJ, Chang PC, Wang RY, Unnikrishnan B, Mao JY, Chen SY, Huang CC (2019) High amplification of the antiviral activity of curcumin through transformation into carbon quantum dots. Small 15(41):1902641 Lin M, Guo X, Xu X, Chang C, Le TN, Cai H, Zhao M (2025) Caffeic Acid Phenethyl Ester Alleviates Alcohol-Induced Inflammation Associated with Pancreatic Secretion and Gut Microbiota in Zebrafish. Biomolecules 15(7):918 Linh NV, Khang LTP, Dinh-Hung N, Wisetkaeo S, Therdtatha P, Sangsawad P, Wannavijit S, Jitjumnong J, Permpoonpattana P, Van Doan H (2025a) Effects of dietary corn silk (Zea mays L.) on growth, immune and antioxidant pathways, histological morphology, gut microbiome, and sensitivity to acute ammonia exposure in the koi carp (Cyprinus carpio var. koi). Comp Biochem Physiol B: Biochem Mol Biol 279:111127 Linh NV, Khang LTP, Dinh-Hung N, Wisetkaeo S, Wannavijit S, Phimolsiripol Y, Seesuriyachan P, Sangsawad P, Permpoonpattana P, Van Doan H (2025b) Effect of fermented corn cob (Z ea mays L.) on growth performance, immunological response, and expression of immune-antioxidant genes in koi carp (Cyprinus carpio var. koi) reared in a low water exchange rearing system. Vet Res Commun 49(6):355 Linh NV, Khongcharoen N, Nguyen D-H, Dien LT, Rungrueng N, Jhunkeaw C, Sangpo P, Senapin S, Uttarotai T, Panphut W, St-Hilaire S, Van Doan H, Dong HT (2023) Effects of hyperoxia during oxygen nanobubble treatment on innate immunity, growth performance, gill histology, and gut microbiome in Nile tilapia, Oreochromis niloticus. Fish Shellfish Immunol 143:109191. https://doi.org/https://doi.org/10.1016/j.fsi.2023.109191 Liu X-r, Ma X, Zhang N, Li M, Li K, Jiao S-q, Wang G-q, Kong Y-d (2023) Effects of chlorogenic acid in feed on the growth performance, digestive enzyme activity, immune function, and antioxidant capacity of loach (Misgurnus anguillicaudatus). J Fisheries China 47(10):99–112 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2 – ∆∆CT method. methods 25(4): 402–408 Lu M, Jing F, Liu R, Chen Z, Tong R, Li Y, Pan L (2024) The effects and mechanisms of dietary ferulic acid (FA) and dihydromyricetin (DMY) on growth and physiological responses of the shrimp (Litopenaeus vannamei). Aquaculture 589:740967 Maharajan A, Kitto MR, Paruruckumani P, Ganapiriya V (2016) Histopathology biomarker responses in Asian sea bass, Lates calcarifer (Bloch) exposed to copper. J Basic Appl Zool 77:21–30 Meadows GG, Blank SE, Duncan DD (1989) Influence of ethanol consumption on natural killer cell activity in mice. Alcoholism: Clin Experimental Res 13(4):476–479 Meyuhas S, Assali M, Huleihil M, Huleihel M (2015) Antimicrobial activities of caffeic acid phenethyl ester. J Mol Biochem 4(2) Naiel MA, El-Kholy AI, Negm SS, Ghazanfar S, Shukry M, Zhang Z, Ahmadifar E, Abdel-Latif HM (2023) A mini-review on plant-derived phenolic compounds with particular emphasis on their possible applications and beneficial uses in aquaculture. Annals Anim Sci 23(4):971–977 Nandhakumar K, Guha R, Lakshmi S, Elumalai P (2025) Immunogenicity and protective efficacy of chitosan/β-glucan nanoparticle encapsulated inactivated Streptococcus agalactiae oral vaccine for Nile tilapia (Oreochromis niloticus). Comp Immunol Rep 9:200254. https://doi.org/https://doi.org/10.1016/j.cirep.2025.200254 Owatari MS, Jesus GFA, Cardoso L, Lehmann NB, Martins ML, Mouriño JLP (2020) Can histology and haematology explain inapparent Streptococcus agalactiae infections and asymptomatic mortalities on Nile tilapia farms? Res Vet Sci 129:13–20 Piamsomboon P, Thanasaksiri K, Murakami A, Fukuda K, Takano R, Jantrakajorn S, Wongtavatchai J (2020) Streptococcosis in freshwater farmed seabass Lates calcarifer and its virulence in Nile tilapia Oreochromis niloticus. Aquaculture 523:735189 Rahul Sandeep T, Sravya M, Simhachalam G (2025) Phytobiotics in finfish and shellfish: A systematic review. Discover Anim 2(1):1–36 Rathore G, Madhusudana Rao B (2025) Antimicrobial Usage in Aquaculture: Potential Implications. Aquatic Animal Health Management. Springer, pp 665–684 Reyes-Becerril M, Angulo C, Silva‐Jara J (2021) Antibacterial and immunomodulatory activity of moringa (Moringa oleifera) seed extract in Longfin yellowtail (Seriola rivoliana) peripheral blood leukocytes. Aquac Res 52(9):4076–4085 Secombes C, Wang T, Hong S, Peddie S, Crampe M, Laing K, Cunningham C, Zou J (2001) Cytokines and innate immunity of fish. Dev Comp Immunol 25(8–9):713–723 Sharon J, Abraham TJ, Sen A, Das R, Sinha P, Boda S, Uma A, Patil PK (2025) Effects of Streptococcus agalactiae infection and oral florfenicol administration on the hemato-biochemistry, erythrocyte morphology and histopathology of Oreochromis niloticus. J Fisheries 13(1):131209–131209 Sintuprom C, Nuchchanart W, Dokkaew S, Aranyakanont C, Ploypan R, Shinn AP, Wongwaradechkul R, Dinh-Hung N, Dong HT, Chatchaiphan S (2024) Effects of clove oil concentrations on blood chemistry and stress-related gene expression in Siamese fighting fish (Betta splendens) during transportation [Original Research]. Front Veterinary Sci 11. https://doi.org/10.3389/fvets.2024.1392413 Sivakumar S, Girija AS, Priyadharsini JV (2020) Evaluation of the inhibitory effect of caffeic acid and gallic acid on tetR and tetM efflux pumps mediating tetracycline resistance in Streptococcus sp., using computational approach. J King Saud University-Science 32(1):904–909 Soontara C, Uchuwittayakul A, Kayansamruaj P, Amparyup P, Wongpanya R, Srisapoome P (2024) Adjuvant Effects of a CC Chemokine for Enhancing the Efficacy of an Inactivated Streptococcus agalactiae Vaccine in Nile Tilapia (Oreochromis niloticus). Vaccines 12(6): 641 Sumana SL, Xue T, Hu H, Abdullateef MM, Shui Y, Ayana GU, Kayiira JC, Zhang C, Samwel BJ, Zhu J (2025) Medicinal Plants as Ecological Solutions for Fish Growth and Immunostimulatory Effects in Aquaculture. Aquac Res 2025(1):9778623 Tola S, Adepoju M-SK, Yuangsoi B, Charoenwattanasak S, Jatuwong K, Seel-audom M (2025) Effects of partial and complete replacement of fish oil with perilla oil on growth performance, feed efficiency, health status, and fatty acid accumulation in flesh of Asian seabass (Lates calcarifer) reared in freshwater. Anim Feed Sci Technol 323:116277 Veloz JJ, Alvear M, Salazar LA (2019) Antimicrobial and antibiofilm activity against Streptococcus mutans of individual and mixtures of the main polyphenolic compounds found in Chilean propolis. Biomed Res Int 2019(1):7602343 Wang J, Wu Y, Zhou T, Feng Y, Li L-a (2025a) Common factors and nutrients affecting intestinal villus height-A review. Anim Bioscience 38(8):1557 Wang Y, Meng S, Li D, Liu S, Li L, Wu L (2025b) Dietary chlorogenic acid supplementation protects against lipopolysaccharide-induced oxidative stress, inflammation and apoptosis in intestine of amur ide (Leuciscus waleckii). Aquat Toxicol 279:107223 Watts M, Munday B, Burke C (2001) Immune responses of teleost fish. Aust Vet J 79(8):570–574 Winfield IJ (2018) Sea bass and sea bream: a practical approach to disease control and health management. J Fish Biol 93(2):434–434 Xia Z, Mi H, Ren M, Huang D, Aboseif AM, Liang H, Zhang L (2024) Chlorogenic acid plays an important role in improving the growth and antioxidant status and weakening the inflammatory response of largemouth bass (Micropterus salmoides). Animals: Open Access J MDPI 14(19):2871 Xu G, Xing W, Yu H, Jiang N, Ma Z, Luo L, Li T (2022a) Evaluation of chlorogenic acid supplementation in koi (cyprinus carpio) diet: growth performance, body color, antioxidant activity, serum biochemical parameters, and immune response. Aquacult Nutr 2022(1):2717003 Xu W, Huang W, Yao C, Liu Y, Yin Z, Mai K, Ai Q (2022b) Effects of supplemental ferulic acid (FA) on survival, growth performance, digestive enzyme activities, antioxidant capacity and lipid metabolism of large yellow croaker (Larimichthys crocea) larvae. Fish Physiol Biochem 48(6):1635–1648 Yang H, Wu C, Yuan Q, Lv W, Qiu J, Li M, Zhang Q, Zhou W (2024a) Effects of Dietary Chlorogenic Acid on the Growth, Lipid Metabolism, Antioxidant Capacity, and Non-Specific Immunity of Asian Swamp Eel (Monopterus albus). Fishes 9(12):496 Yang H, Xu Z, Li X, Leng X (2024b) Individual and combined effects of dietary chlorogenic acid and quercetin supplementation on the growth, lipid metabolism and flesh quality of grass carp, Ctenopharyngodon idellus. Anim Feed Sci Technol 318:116129 Yang R, Han M, Fu Z, Wang Y, Zhao W, Yu G, Ma Z (2020) Immune responses of Asian seabass Lates calcarifer to dietary Glycyrrhiza uralensis. Animals 10(9):1629 Yilmaz S (2019) Effects of dietary caffeic acid supplement on antioxidant, immunological and liver gene expression responses, and resistance of Nile tilapia, Oreochromis niloticus to Aeromonas veronii. Fish Shellfish Immunol 86:384–392 Yu L, Wen H, Jiang M, Wu F, Tian J, Lu X, Xiao J, Liu W (2020) Effects of ferulic acid on intestinal enzyme activities, morphology, microbiome composition of genetically improved farmed tilapia (Oreochromis niloticus) fed oxidized fish oil. Aquaculture 528:735543 Yue G, Li Y, Orban L (2001) Characterization of microsatellites in the IGF-2 and GH genes of Asian seabass (Lates calcarifer). Mar Biotechnol 3(1):1–3 Yue R, Wei X, Zhao J, Zhou Z, Zhong W (2021) Essential role of IFN-γ in regulating gut antimicrobial peptides and microbiota to protect against alcohol-induced bacterial translocation and hepatic inflammation in mice. Front Physiol 11:629141 Zhai Q, Chang Z, Li J, Li J (2022) Effects of combined florfenicol and chlorogenic acid to treat acute hepatopancreatic necrosis disease in Litopenaeus vannamei caused by Vibrio parahaemolyticus. Aquaculture 547:737462 Zhang H, Shi J, Yan Z, Gao M, Lin K, Zhan Y, Li Y, Liang J, Han S (2025) Effects of chlorogenic acid on growth performance, immunity, antioxidant capacity, intestinal microbiota, and liver transcriptome in Mauremys mutica. Aquaculture Rep 42:102851 Zhu J, Li D, Xiao W, Yu J, Chen B, Zou Z, Yang H (2024) Survival, serum biochemical parameters, hepatic antioxidant status, and gene expression of three Nile tilapia strains under pathogenic Streptococcus agalactiae challenge. Fish Shellfish Immunol 155:110030 Zou J, Secombes CJ (2016) The function of fish cytokines. Biology 5(2):23 Additional Declarations No competing interests reported. Supplementary Files GA.png GRAPHICAL ABSTRACT Supplementarytablesandfigs.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8552784","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":576307478,"identity":"b6cc7407-cb24-4f2f-a7ea-db6b4e47c5e9","order_by":0,"name":"Suwanna Wisetkaeo","email":"","orcid":"","institution":"Chiang Mai University","correspondingAuthor":false,"prefix":"","firstName":"Suwanna","middleName":"","lastName":"Wisetkaeo","suffix":""},{"id":576307479,"identity":"09fb2fab-a47b-4c92-b490-a9640b319585","order_by":1,"name":"Luu Tang Phuc Khang","email":"","orcid":"","institution":"Chiang Mai University","correspondingAuthor":false,"prefix":"","firstName":"Luu","middleName":"Tang Phuc","lastName":"Khang","suffix":""},{"id":576307480,"identity":"7df39a3f-0985-46b2-9dd6-34efe9d921e7","order_by":2,"name":"Kritsada Phetduang","email":"","orcid":"","institution":"Chiang Mai University","correspondingAuthor":false,"prefix":"","firstName":"Kritsada","middleName":"","lastName":"Phetduang","suffix":""},{"id":576307481,"identity":"79608d7d-3927-4520-83ab-104d4a925bed","order_by":3,"name":"Sefti Heza Dwinanti","email":"","orcid":"","institution":"Sriwijaya University","correspondingAuthor":false,"prefix":"","firstName":"Sefti","middleName":"Heza","lastName":"Dwinanti","suffix":""},{"id":576307482,"identity":"a535bce2-46b7-4feb-9f29-94274c11672d","order_by":4,"name":"Phatthanaphong Therdtatha","email":"","orcid":"","institution":"Chiang Mai University","correspondingAuthor":false,"prefix":"","firstName":"Phatthanaphong","middleName":"","lastName":"Therdtatha","suffix":""},{"id":576307485,"identity":"8dfbbf61-3c35-47b2-9587-e88ce26f3d85","order_by":5,"name":"Lee Po-Tsang","email":"","orcid":"","institution":"National Taiwan Ocean University","correspondingAuthor":false,"prefix":"","firstName":"Lee","middleName":"","lastName":"Po-Tsang","suffix":""},{"id":576307486,"identity":"1f8c913d-1caa-4134-9269-2e5f23a79088","order_by":6,"name":"Papungkorn Sangsawad","email":"","orcid":"","institution":"Suranaree University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Papungkorn","middleName":"","lastName":"Sangsawad","suffix":""},{"id":576307487,"identity":"6b3cdc44-4311-4d9a-bb84-b8830eaaf893","order_by":7,"name":"Mintra Seel-audom","email":"","orcid":"","institution":"Chiang Mai University","correspondingAuthor":false,"prefix":"","firstName":"Mintra","middleName":"","lastName":"Seel-audom","suffix":""},{"id":576307488,"identity":"fa42ef97-b171-44a0-9c5b-51cdc2d51f48","order_by":8,"name":"Patima Permpoonpattana","email":"","orcid":"","institution":"Prince of Songkla University","correspondingAuthor":false,"prefix":"","firstName":"Patima","middleName":"","lastName":"Permpoonpattana","suffix":""},{"id":576307489,"identity":"bc6d12ed-954e-417c-bc90-e7427d381a72","order_by":9,"name":"Won-Kyo Jung","email":"","orcid":"","institution":"Pukyong National University","correspondingAuthor":false,"prefix":"","firstName":"Won-Kyo","middleName":"","lastName":"Jung","suffix":""},{"id":576307490,"identity":"e518d3b5-0eab-41ea-a9e7-00153cf1f237","order_by":10,"name":"Nguyen Vu Linh","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvklEQVRIiWNgGAWjYBACPmYGNjCDHy4kQUALG0yLZANUhIegFgaoFoMDRGth5z32mLeNIc/4+Ok0CYYaOwZ76QYCWpj50o2BWorNzuRuk2A4lszAI3OAkBYeM8mZbQyJ227wArWwHQA6LIFILZtngLT8I1KLxEeglg0SQC2MbcRq+XBOInHGmdzNFol9yTw8Nwho4ec/YyaRUGaT2N9+duOND9/s5NhnENACBdC4ACrmIUr9KBgFo2AUjAL8AACLETIr1ukE0QAAAABJRU5ErkJggg==","orcid":"","institution":"Chiang Mai University","correspondingAuthor":true,"prefix":"","firstName":"Nguyen","middleName":"Vu","lastName":"Linh","suffix":""}],"badges":[],"createdAt":"2026-01-08 14:53:41","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8552784/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8552784/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":101753394,"identity":"81182259-fa95-4a0a-853c-529a43f0fd0c","added_by":"auto","created_at":"2026-02-03 10:39:57","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":109310,"visible":true,"origin":"","legend":"\u003cp\u003eAntibacterial activity of caffeic acid against \u003cem\u003eStreptococcus agalactiae\u003c/em\u003e: (A) total colony counts following 24-h exposure to CA at 1–40 µg/mL, with PBS as a negative control and Erythromycin (50 µg/mL) as a positive control; (B) dose–response curve and EC₅₀ determination.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-8552784/v1/3983578e5744e656c11a1871.png"},{"id":101753178,"identity":"5c97872c-743e-4894-a886-e014c66c806c","added_by":"auto","created_at":"2026-02-03 10:39:18","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":90767,"visible":true,"origin":"","legend":"\u003cp\u003eKaplan–Meier survival curves of Asian seabass (\u003cem\u003eLates calcarifer\u003c/em\u003e) in toxicity test in different concentration of caffeic acid. Different asterisks indicate significant differences among groups based on Log-rank test (p \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-8552784/v1/83b2dd640fb4bdce238cd00d.png"},{"id":101753195,"identity":"62e17b70-1861-48ca-89d7-45699ba2a4af","added_by":"auto","created_at":"2026-02-03 10:39:21","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":127976,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of immune-related genes in the midgut of Asian seabass (\u003cem\u003eLates calcarifer\u003c/em\u003e) fed dietary caffeic acid. (A) Heatmap of normalized mRNA transcript levels for six targeted genes across dietary treatments. Different letters indicate significant differences among treatments. (B) Log₂-fold changes of the same genes relative to CA-0. Values are derived from normalized expression data.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-8552784/v1/90a50e6a5e849a36e3b1020b.png"},{"id":101753884,"identity":"8cd8ad7f-d3ed-4deb-9026-e6ba7e801432","added_by":"auto","created_at":"2026-02-03 10:41:06","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":674556,"visible":true,"origin":"","legend":"\u003cp\u003eIntestinal morphology and morphometric indices of Asian seabass (\u003cem\u003eLates calcarifer\u003c/em\u003e) fed diets containing 0–100 mg/kg caffeic acid. (A) Representative H\u0026amp;E-stained transverse midgut sections. (B) Villus length. (C) Villus width. (D) Thickness of the lamina propria. (E) Muscularis thickness. Different letters indicate significant differences among treatments.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-8552784/v1/4280419f06048373b2c39a30.png"},{"id":101754239,"identity":"5e2af693-1893-4f2f-80e9-42410a981a8e","added_by":"auto","created_at":"2026-02-03 10:42:07","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":730104,"visible":true,"origin":"","legend":"\u003cp\u003eExternal and internal pathological signs in Asian seabass (\u003cem\u003eLates calcarifer\u003c/em\u003e) at 14 days post-infection with \u003cem\u003eStreptococcus agalactiae.\u003c/em\u003e (A) Focal scale loss along the lateral body surface (yellow box), (B) Exophthalmia with protrusion of the ocular globe (yellow arrow), (C) Ocular hemorrhage characterized by bleeding around the corneal and periorbital region (yellow arrow), (D) Enlarged, pale liver indicative of hepatomegaly (yellow box), (E) Petechial and surface hemorrhages on the liver parenchyma following necropsy (yellow arrow).\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-8552784/v1/a9543a44f3349a2a430aa7a5.png"},{"id":101753366,"identity":"a45533b3-a9b6-4a2e-a163-3707b9561452","added_by":"auto","created_at":"2026-02-03 10:39:52","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":203249,"visible":true,"origin":"","legend":"\u003cp\u003eSurvival outcomes and immune gene expression of Asian seabass (\u003cem\u003eLates calcarifer\u003c/em\u003e) following \u003cem\u003eStreptococcus agalactiae\u003c/em\u003e challenge under different dietary caffeic acid treatments.\u003c/p\u003e\n\u003cp\u003e(A) Kaplan–Meier survival curves. Different letters indicate significant differences among treatments; (B) Relative percent survival (%); (C) Heatmap of normalized mRNA transcript levels. Different letters denote significant differences; (D) Log₂-fold change values for the same immune-related genes relative to control - (CA-0, PBS).\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-8552784/v1/9ab064428bd47f43fcffeea6.png"},{"id":101652463,"identity":"8e3ae1a3-ae78-4b5d-b4cb-d8984017a941","added_by":"auto","created_at":"2026-02-02 09:32:15","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":433173,"visible":true,"origin":"","legend":"\u003cp\u003eHepatic histopathology of Asian seabass (\u003cem\u003eLates calcarifer\u003c/em\u003e) at 7 days post-infection with \u003cem\u003eStreptococcus agalactiae \u003c/em\u003eand dietary caffeic acid supplementation. (A) control + (CA-0, PBS); (B, C) control – (CA-0,\u003cem\u003e S. agalactiae\u003c/em\u003e), (D) CA-25, (E) CA-50, (F) CA-100. Cytoplasmic degeneration (blue arrow), nuclear degeneration (orange rectangle), cellular necrosis (blue rectangle), blood congestion (red rectangle); melanomacrophages (red arrow), and hepatocytes retaining normal nuclei (yellow arrow). Scale bars = 20 µm.\u003c/p\u003e","description":"","filename":"image8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8552784/v1/c14c2d93367399668b161459.jpeg"},{"id":104403283,"identity":"25600b49-756b-4e06-b6f2-b6b4600b83a3","added_by":"auto","created_at":"2026-03-11 12:17:56","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3742838,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8552784/v1/5ddf2223-44b2-416b-b48e-9b8692146751.pdf"},{"id":101652456,"identity":"3b937ea4-8fcc-4b4f-8ed0-a619c90c6fd8","added_by":"auto","created_at":"2026-02-02 09:32:14","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":278058,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGRAPHICAL ABSTRACT\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"GA.png","url":"https://assets-eu.researchsquare.com/files/rs-8552784/v1/ffe74ceb14ad7339570eb579.png"},{"id":101753677,"identity":"916b1d8e-3432-4660-a5ef-b8c8e13e7279","added_by":"auto","created_at":"2026-02-03 10:40:31","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":141978,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarytablesandfigs.docx","url":"https://assets-eu.researchsquare.com/files/rs-8552784/v1/f57dc190938b3683c50650bd.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Antibacterial, growth-promoting, and immunostimulatory effects of dietary caffeic acid in Asian seabass (Lates calcarifer) challenged with Streptococcus agalactiae","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAquaculture has grown rapidly in recent decades, with a concurrent rise in the farming of high-value marine fish species. One such species, the Asian seabass (\u003cem\u003eLates calcarifer\u003c/em\u003e), also known as barramundi, is popular aquatic-farmed species whichfarmed extensively across the Indo-West Pacific region (Chenoweth and Hughes \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Yue et al \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Jerry \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Worldwide annual production of Asian seabass now exceeds 120,000 tons and is projected to grow about 5% per year in the near future (FAO \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). This increasing production underlines the species\u0026rsquo; economic and food security importance, but it also heightens concerns about disease outbreaks in intensive farming systems. Like other intensively cultured fish, Asian seabass is susceptible to a variety of infectious diseases at all life stages.\u003c/p\u003e \u003cp\u003eIn recent years, streptococcosis has emerged as one of the most serious bacterial threats to Asian seabass aquaculture (Winfield \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Piamsomboon et al \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Streptococcosis, primarily caused by \u003cem\u003eStreptococcus agalactiae\u003c/em\u003e (\u003cem\u003eS. agalactiae\u003c/em\u003e), can induce acute septicemia, neurological symptoms, and mass mortalities in farmed seabass (Piamsomboon et al \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Consequently, outbreaks of S. \u003cem\u003eagalactiae\u003c/em\u003e in seabass now occur more frequently, mirroring the epizootic patterns seen in tilapia and underscoring the urgent need for effective control measures. Globally, streptococcal epidemics in aquaculture cause significant economic losses and threaten industry sustainability, highlighting a critical gap in disease management for Asian seabass and other susceptible species (Lan et al \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTraditional disease control in aquaculture has relied on antibiotics and, to a lesser extent, vaccines. However, excessive antibiotic use is unsustainable due to rising antimicrobial resistance and regulatory restrictions (Rathore and Madhusudana Rao \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Vaccination against \u003cem\u003eS. agalactiae\u003c/em\u003e in fish can provide some protection (Guha et al \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Nandhakumar et al \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Rathore and Madhusudana Rao \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2025\u003c/span\u003e), but vaccines are serotype-specific and may not fully prevent outbreaks under field conditions, especially where multiple \u003cem\u003eStreptococcus\u003c/em\u003e serotypes or species co-circulate. These limitations have prompted exploration of alternative prophylactic strategies such as nutritional immunostimulant and phytotherapy. Functional feed additives derived from medicinal plants and natural compounds are increasingly studied as eco-friendly immunostimulants to enhance fish disease resistance (Rahul Sandeep et al \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Sumana et al \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2025\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAmong various phytochemicals tested, phenolic compounds stand out for their broad bioactivity and safety profile in aquaculture (Beltr\u0026aacute;n and Esteban \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Naiel et al \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Dinh-Hung et al \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Caffeic acid (CA) is a naturally occurring phenolic acid (3,4-dihydroxycinnamic acid) abundant in many plants, fruits, and medicinal herbs (Birkov\u0026aacute; et al \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Dinh-Hung et al \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). It is broadly recognized as pharmacologically safe and exhibits diverse beneficial properties, including antioxidant, anti-inflammatory, antimicrobial, anti-carcinogenic, and immunomodulatory activities (Dinh-Hung et al \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Recent studies in aquaculture have indeed begun investigating CA as a natural immunostimulant and growth promoter. Dietary supplementation of CA has yielded promising results in several fish species like beluga sturgeon (\u003cem\u003eHuso huso\u003c/em\u003e) (Ahmadifar et al \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), common carp (\u003cem\u003eCyprinus carpio\u003c/em\u003e) (Alavinejad et al \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2025\u003c/span\u003e), Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) (Yilmaz \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Using CA in feeds could thus help reduce antibiotic use and support fish health in a more natural and eco-friendly manner (Dinh-Hung et al \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). However, despite this encouraging progress, knowledge gaps remain. The adoption of CA in aquafeeds is still limited by unresolved questions regarding optimal inclusion levels for different species, species-specific physiological responses, interactions of CA with other dietary components, and its effects on gut microbiota composition (Dinh-Hung et al \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Moreover, most published studies on dietary CA in fish have focused on species like tilapia or carp and on infections by Gram-negative bacteria (Yilmaz \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Alavinejad et al \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2025\u003c/span\u003e); little attention has been given to marine/freshwater species such as Asian seabass or to Gram-positive pathogens like \u003cem\u003eS. agalactiae\u003c/em\u003e. It is not yet clear whether the immune-boosting and disease-mitigating effects of CA observed in other fish will translate similarly in Asian seabass, especially under the threat of streptococcosis. This represents a critical research gap with both scientific and practical significance, as the culture of Asian seabass continues to expand and demand solutions for streptococcal disease management. Therefore, the present study aims to evaluate the effects of dietary CA supplementation on Asian seabass under conditions of streptococcosis. The investigation aims to determine whether this dietary additive can enhance growth performance, improve tissue integrity as assessed by histological evaluations, modulate immune-related gene expression, and increase resistance to \u003cem\u003eStreptococcus agalactiae\u003c/em\u003e infection.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Materials\u003c/h2\u003e \u003cp\u003eThe CA were prepared following a modified protocol based on Lin et al (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The preparation method has been submitted for a patent application in Taiwan (application no. 114134921, filed on 11 September 2025).\u003c/p\u003e \u003cp\u003eThe bacterial pathogen \u003cem\u003eS. agalactiae\u003c/em\u003e used in this study was isolated from diseased outbreak collected from a local aquaculture farm and was obtained from the Centex Shrimp Center, Faculty of Science, Mahidol University, Thailand.\u003c/p\u003e \u003cp\u003e550 one-month-old Asian seabass were supplied by a local fish farm in Chiang Mai, Thailand. The fish had an average body weight of 10.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10 g at the beginning of the experiment. Fish were acclimated under laboratory conditions prior to use in feeding trial and challenge test.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Antibacterial assay\u003c/h2\u003e \u003cp\u003eFor the antimicrobial assay, the plate colony-counting method was employed to evaluate the \u003cem\u003ein vitro\u003c/em\u003e toxicity of CA, following Reyes‐Becerril et al (2021) with minor modifications. CA powder was dissolved in absolute ethanol as stock at 20 mg/mL. Furthermore, working concentration made by mixed stock solution with sterilized water at 1, 10, 15, 20, and 40 \u0026micro;g/mL. \u003cem\u003eS. agalactiae\u003c/em\u003e were cultured overnight in Brain-Heart Infusion Broth (BHIB, Himedia\u0026trade;, India) at 28\u0026deg;C with shaking at 150 rpm. After incubation, bacteria were washed twice with sodium phosphate buffer (PBS). The medium was removed by centrifugation at 6000 rpm for 3 min at 25\u0026deg;C. To test antibacterial activity, bacterial suspensions (1 \u0026times; 10⁴ CFU/mL) were incubated with CA for 3 h with shaking. The samples were then diluted 10-fold, and 100 \u0026micro;L of the diluted solution was spread onto BHI agar plates. For each concentration, three biological replicates were conducted. After 48 h incubation at 28\u0026deg;C, colonies were counted and the EC₅₀ value (concentration producing 50% inhibition) was calculated to evaluate the antimicrobial activity of CA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Experimental design for feeding trails\u003c/h2\u003e \u003cp\u003eDiet production and experimental feeding trial were carried out at the Department of Animal and Aquatic Sciences, Faculty of Agriculture, Chiang Mai University and Department of Agricultural Science and Technology, Faculty of Innovative Agriculture, Fisheries and Food, Prince of Songkla University, Surat Thani, Thailand. A commercial seabass feed (42% crude protein; Charoen Pokphand Foods PCL., Thailand) served as the basal diet. For the toxicity test, CA was incorporated into the basal feed at concentrations of 0, 50, 100, 1000, 2000 mg/kg to produce the CA-0, CA-50, CA-100, CA-1000, and CA-2000, respectively. For the feeding trial experiments, CA-diet were produced as the same method with 0, 25, 50, and 100 mg/kg as the CA-0, CA-25, CA-50, and CA-100 diets, respectively (the chosen concentration of dietary based on the results EC\u003csub\u003e50\u003c/sub\u003e of \u003cem\u003ein vitro\u003c/em\u003e assays). The feed and CA were thoroughly mixed to ensure uniform distribution, after which a 6% cellulose binder was applied. The feed was then dried in a hot-air oven at 50\u0026ndash;60\u0026deg;C for 2 h to facilitate gelatinization, and subsequently dried at 40\u0026deg;C for 24 h before storage at 4\u0026deg;C until use.\u003c/p\u003e \u003cp\u003eFor the toxicity test, three replicate aquaria for each treatment were prepared, each contains 10 fish were prepared. For the feeding trial, four replicate aquaria were prepared for these experiments, each tank stocked with 25 fish were assigned to each dietary treatment. Experimental diets were offered twice daily at 09:00 and 16:00 over a four-week feeding trial. Fish were observed for 30 min after each feeding to verify the absence of uneaten feed. Remaining feeds were collected and weighed at the end of each day to estimate the feed requirement for the subsequent day. Average feed intake for juvenile Asian seabass was expected to be approximately 4% of body weight throughout the experimental period. Water quality parameters were controlled throughout the study, with temperature maintained at 28\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C, pH at 7.05\u0026thinsp;\u0026plusmn;\u0026thinsp;1.00, and a 12 h light/12 h dark photoperiod. Dissolved oxygen levels were kept between 5 and 7 mg/L during both the acclimation and experimental periods (Klongklaew et al \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2025\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Growth performance analysis\u003c/h2\u003e \u003cp\u003eThe fish were weighed every two weeks to determine their growth rate. Each treatment consisted of four tanks serving as biological replicates, with 25 fish stocked per tank. Any dead fish were removed and recorded. The survival rate was calculated on week 2 and 4 to obtain the final cumulative survival rate. The following indices were applied in this research to determine the growth performance of the fish (Khang et al \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Linh et al \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2025b\u003c/span\u003e):\u003c/p\u003e \u003cp\u003e \u003cul\u003e \u003cli\u003e \u003cp\u003eWeight gain (WG, %) = [(Final body weight \u0026ndash; Initial weight)/Initial weight] \u0026times; 100.\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eSpecific growth rate (SGR, %) = [ln (Final weight) \u0026ndash; ln (Initial weight)]/days \u0026times; 100.\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eFeed conversion ratio (FCR) = [Feed consumed (g) / Weight gain (g)].\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eAverage daily growth (ADG, g/day) = (Final body weight - Initial body weight)/ days.\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003ePeriodic growth rate (PWG, g/day) = [(Final weight of period - Initial weight of the period) / period day].\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Bacterial challenge assay\u003c/h2\u003e \u003cp\u003eA single colony of \u003cem\u003eS. agalactiae\u003c/em\u003e grown on BHIA (Himedia\u0026trade;, India) was be inoculated into 400 mL of BHIB (Himedia\u0026trade;, India) and incubated for 16 h at 28\u0026deg;C with shaking at 150 rpm. Bacterial cells were harvested by centrifugation (6,000 rpm, 10 min, 4\u0026deg;C), washed twice with PBS, and adjusted to the desired concentration using a SpectraMax QuickDrop Micro-Volume Spectrophotometer (Molecular Devices, USA) (Soontara et al \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Zhu et al \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eA total of 150 Asian seabass was randomly assigned for a preliminary bacterial challenge to determine the median lethal concentration (LC₅₀) of \u003cem\u003eS. agalactiae\u003c/em\u003e. Fish were challenged by immersion at concentrations of 0 (control), 10⁴, 10⁵, 10⁶, and 10⁷ CFU/mL. Each concentration was replicated in three tanks with 10 fish per tank (n\u0026thinsp;=\u0026thinsp;30 fish per treatment). Based on the results of the LC₅₀ determination (Figure S1), all experimental fish in subsequent assays were challenged with \u003cem\u003eS. agalactiae\u003c/em\u003e at 10⁶ CFU/mL.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe challenge experiment consisted of the following treatments (1) negative control (CA-0, immersion with PBS), (2) positive control (CA-0), (3) CA-25, (4) CA-50, and (5) CA-100. Treatments (2)\u0026ndash;(5) were immersed with \u003cem\u003eS. agalactiae\u003c/em\u003e. Treatment (1) consisted of one tank with 25 fish, whereas treatments (2) to (5) consisted of three biological replicate tanks with 25 fish per tank (n\u0026thinsp;=\u0026thinsp;75 fish per treatment). Fish were monitored daily till 14-day post immersion (dpi) to determine survival rates.\u003c/p\u003e \u003cp\u003eRelative percent of survival (RPS) was calculated by Eq.\u0026nbsp;(1)\u003cdiv id=\"Equa\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e\n$$\\:\\text{R}\\text{P}\\text{S}\\:\\left(\\text{%}\\right)=\\:\\:\\left(1-\\:\\frac{\\text{M}\\text{o}\\text{r}\\text{t}\\text{a}\\text{l}\\text{i}\\text{t}\\text{y}\\:\\left(\\text{%}\\right)\\:\\text{i}\\text{n}\\:\\text{t}\\text{r}\\text{e}\\text{a}\\text{t}\\text{e}\\text{d}\\:\\text{g}\\text{r}\\text{o}\\text{u}\\text{p}}{\\text{M}\\text{o}\\text{r}\\text{t}\\text{a}\\text{l}\\text{i}\\text{t}\\text{y}\\:\\left(\\text{%}\\right)\\:\\text{i}\\text{n}\\:\\text{p}\\text{o}\\text{s}\\text{i}\\text{t}\\text{i}\\text{v}\\text{e}\\:\\text{c}\\text{o}\\text{n}\\text{t}\\text{r}\\text{o}\\text{l}\\:\\text{g}\\text{r}\\text{o}\\text{u}\\text{p}}\\right)\\times\\:100\\text{%}\\:\\left(1\\right)$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Sample collection\u003c/h2\u003e \u003cp\u003eAt the endpoint of the experiments, six fish from each treatment group were euthanized with clove oil (0.5 mL/L) (v/v) (Tola et al \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2025\u003c/span\u003e), after which intestinal tissue (week 4) and hepatic tissue (7 dpi) were collected. Samples for gene expression analysis were preserved in TRIzol\u0026trade; reagent (Thermo Fisher Scientific, USA), while tissues for histological examination were fixed in 10% neutral buffered formalin.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Gene expression analysis by qPCR\u003c/h2\u003e \u003cp\u003eTissues (n\u0026thinsp;=\u0026thinsp;6 per treatment) were homogenized using a Bullet Blender\u0026reg; Homogenizer (Next Advance, USA). The homogenates were incubated for 2\u0026ndash;3 min at room temperature and mixed with 100 \u0026micro;L of chloroform. Phase separation was achieved by centrifugation at 16,000 rpm for 15 min at 4\u0026deg;C. The resulting aqueous phase was carefully collected and subjected to RNA purification using a Total RNA Extraction Kit (Omega Bio-tek, USA). RNA concentration and purity were assessed with a NanoDrop\u0026trade; One/OneC spectrophotometer (Thermo Fisher Scientific, USA). For cDNA synthesis, 1 \u0026micro;g of total RNA from each sample was reverse transcribed using a commercial cDNA synthesis kit (Bio-Rad, USA) following the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003cp\u003eQuantitative real-time PCR (qRT-PCR) was conducted using the CFX Connect\u0026trade; Real-Time PCR Detection System (Bio-Rad, USA) in a 20-\u0026micro;L reaction mixture. Each reaction contained 1 \u0026micro;L of cDNA (100 ng), 0.2 \u0026micro;L of each gene-specific primer (10 \u0026micro;M), 5 \u0026micro;L of 2\u0026times; iTaq\u0026trade; Universal SYBR\u0026reg; Green Supermix (Bio-Rad, USA), and nuclease-free water to reach a final volume of 10 \u0026micro;L (Linh et al \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Sintuprom et al \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Beta-actin (β-actin) served as the housekeeping gene (Yang et al \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The thermal profile consisted of an initial denaturation at 95\u0026deg;C for 5 min, followed by 40 cycles of denaturation at 95\u0026deg;C for 30 s and annealing at 60\u0026deg;C for 1 min. A melting curve was generated by increasing the temperature from 65\u0026deg;C to 95\u0026deg;C in 0.5\u0026deg;C increments.\u003c/p\u003e \u003cp\u003eComplement component 3 (\u003cem\u003eC3\u003c/em\u003e), heat shock protein 70 (\u003cem\u003eHSP70\u003c/em\u003e), interleukin 10 (\u003cem\u003eIL-10\u003c/em\u003e), transforming growth factor beta 1 (\u003cem\u003eTGF-β\u003c/em\u003e), tumor necrosis factor alpha (\u003cem\u003eTNF-α\u003c/em\u003e), and interferon gamma 1 (\u003cem\u003eIFN-γ\u003c/em\u003e) were selected for gene expression analysis in this study. The involvement of these genes, through their transcriptional and translational products, in directly and indirectly shaping immune function in fish has been substantiated across numerous investigations (Secombes et al \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Watts et al \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Basu et al \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Bird et al \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Relative gene expression was quantified using the 2\u003csup\u003e⁻ΔΔCt\u003c/sup\u003e method (Livak and Schmittgen \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer of the immune-related genes in \u003cem\u003eLates calcarifer\u003c/em\u003e used in qPCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003cp\u003eAbbreviation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Sequence (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSize (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAccession No.\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eComplement component 3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AAATGCTGCCATCGTTCC\u003c/p\u003e \u003cp\u003eR: CCAGTGACCTTCAGACCAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e175\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_018679796\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eHeat shock protein 70\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CTGGAGTCCTACGCTTTCAA\u003c/p\u003e \u003cp\u003eR: CTTGCTGATGATGGGGTTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e204\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHQ646109\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBeta-actin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AACCAAACGCCCAACAACT\u003c/p\u003e \u003cp\u003eR: ATAACTGAAGCCATGCCAATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e112\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_018667666\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eInterferon gamma 1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TACCAGGAGCAGGACAAGC\u003c/p\u003e \u003cp\u003eR: TCGTCAGGCAGCGAACTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e134\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_001360734\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eInterleukin 10\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TGCTGCCGTTTTGTGGAG\u003c/p\u003e \u003cp\u003eR: ACCGTGCTCAGGTAAAAGTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e194\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_018686737\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTransforming growth factor beta 1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TACCTCGCTTCCCGTTTC\u003c/p\u003e \u003cp\u003eR: CTGCTCATCCTCAGTCCCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e105\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_018665504\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTumor necrosis factor\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AAGGACTCCGCTGAGAAAAC\u003c/p\u003e \u003cp\u003eR: TGAACGATGCCTGGCTGTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e241\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_018699809\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003cem\u003eAll primers were adopted from\u003c/em\u003e Yang et al (\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) \u003cem\u003estudy\u003c/em\u003e\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Histological characteristics\u003c/h2\u003e \u003cp\u003eTissue samples (n\u0026thinsp;=\u0026thinsp;6 per treatment) were fixed, dehydrated through a graded ethanol series (10%, 20%, 30%, 50%, 70%, and 100%), and cleared twice in xylene for 60 min per immersion. Samples were then be infiltrated using a transitional solution (1:2 xylene: paraffin), followed by two stages of paraffin embedding. The embedded tissues were stored overnight in paraffin wax before block preparation.\u003c/p\u003e \u003cp\u003eParaffin blocks were sectioned at 5 \u0026micro;m thickness using a rotary microtome (Leica 2025, Wetzlar, Germany). Sections were stained with hematoxylin and eosin (H\u0026amp;E; Solarbio, G1120) to evaluate tissue and cellular morphology. Histological observations of the intestine were conducted using a CX43 light microscope (Olympus, Hachioji-shi, Tokyo, Japan) equipped with an E620 digital camera. Morphometric analyses were performed following the criteria described by Linh et al (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2025a\u003c/span\u003e). Histopathological alterations characteristic of \u003cem\u003eS. agalactiae\u003c/em\u003e infection were identified by comparison with previously documented pathological features (Maharajan et al \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Laith et al \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Owatari et al \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Statistical analysis\u003c/h2\u003e \u003cp\u003eData analysis was performed by using SPSS (Version 29.0.2.0; IBM Corp., USA). The normality of data distribution was assessed using the Shapiro\u0026ndash;Wilk test. Growth performance and immune parameters were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). EC₅₀ and LC₅₀ values were calculated using OriginPro 2022 (OriginLab Corporation, USA). Differences among treatments were evaluated using one-way ANOVA followed by Tukey\u0026rsquo;s HSD test, with statistical significance set at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Survival rate differences in the challenge assay between treatment and control groups were analyzed using the Kaplan\u0026ndash;Meier method, and pairwise comparisons were conducted using the Mantel\u0026ndash;Cox test (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Graphical illustrations were generated using OriginPro 2022.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Antibacterial activity of caffeic acid against \u003cem\u003eStreptococcus agalactiae\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eTotal colony counts revealed that CA inhibits \u003cem\u003eS. agalactiae\u003c/em\u003e growth in a clear, concentration-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). In the PBS control, bacterial proliferation was robust. By contrast, the erythromycin control virtually abolished colony formation, confirming the assay\u0026rsquo;s sensitivity. Treatment with 1 \u0026micro;g/mL CA yielded 1,017\u0026thinsp;\u0026plusmn;\u0026thinsp;111 colonies, while CA 5 \u0026micro;g/mL and 10 \u0026micro;g/mL resulted in reduced counts of 738\u0026thinsp;\u0026plusmn;\u0026thinsp;93 and 546\u0026thinsp;\u0026plusmn;\u0026thinsp;150 colonies, respectively. Exposure to 15 \u0026micro;g/mL further decreased colony formation to 72\u0026thinsp;\u0026plusmn;\u0026thinsp;19 colonies. To quantify CA potency, colony counts were fitted to a sigmoidal dose\u0026ndash;response model (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). From this analysis, the EC\u003csub\u003e50\u003c/sub\u003e was calculated as 9.89838 \u0026micro;g/mL (log EC₅₀ = 0.995564) (Table S1-S3).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Acute dietary toxicity of caffeic acid in Asian seabass\u003c/h2\u003e \u003cp\u003eThe acute toxicity of dietary CA was evaluated by exposing Asian seabass to graded inclusion levels ranging from 0 to 2000 mg/kg feed over a 7-day period (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Overall survival rates across all treatment groups were high, varying between 80.00% in CA-2000 and 96.67% in the control (CA-0) group. Statistical analysis revealed no significant differences among CA-0, CA-50, CA-100, and CA-1000 groups; however, the CA-2000 cohort exhibited a significantly lower survival rate compared to the CA-0 group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Supplementary Table S4). Importantly, throughout the entire experimental period, no abnormal clinical signs such as erratic swimming, surface gasping, cutaneous lesions, or discoloration were observed in any of the treatment groups, including those receiving the maximum CA dose. Consequently, although CA supplementation up to 100 mg/kg demonstrated a favorable safety profile, inclusion levels of 2000 mg/kg impaired survival without eliciting overt clinical pathology.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Experimental feeding trial\u003c/h2\u003e \u003cdiv id=\"Sec16\" class=\"Section3\"\u003e \u003ch2\u003e3.3.1 Growth performance analysis\u003c/h2\u003e \u003cp\u003eGrowth performance outcomes differed among dietary CA treatments during the 4-week feeding period (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Initial body mass did not differ among groups, ranging from 10.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06 g to 10.26\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05 g (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). At week 2, SR remained high across all treatments (96.67%- 98.89%) with no significant differences. FW at week 2 ranged from 11.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20 g in CA-0 to 12.10\u0026thinsp;\u0026plusmn;\u0026thinsp;0.72 g in CA-25. WG increased from 0.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.21 g in CA-0 to 1.90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.62 g in CA-25, corresponding to PWG values of 8.58\u0026thinsp;\u0026plusmn;\u0026thinsp;2.11% and 18.64\u0026thinsp;\u0026plusmn;\u0026thinsp;5.95%, respectively. SGR ranged from 0.59\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14%/day in CA-0 to 1.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36%/day in CA-25. ADG ranged from 0.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02 g/day to 0.14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04 g/day, and FCR varied minimally among treatments (0.53\u0026ndash;0.57). However, all growth indices have no significant differences.\u003c/p\u003e \n\u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Tab3\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eGrowth performance of Asian seabass (\u003cem\u003eLates calcarifer\u003c/em\u003e) fed diets containing graded levels of caffeic acid for 4 weeks.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eParameter\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCA-0\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCA-25\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCA-50\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCA-100\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eInitial weight (g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10.26\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"5\"\u003e\n \u003cp\u003e\u003cstrong\u003eWeek 2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSurvival rate (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e98.89 \u0026plusmn; 1.92\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e98.89 \u0026plusmn; 1.92\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e96.67 \u0026plusmn; 3.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e96.67 \u0026plusmn; 3.33\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFinal weight (g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12.10\u0026thinsp;\u0026plusmn;\u0026thinsp;0.72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.74\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11.72\u0026thinsp;\u0026plusmn;\u0026thinsp;0.37\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWeight gain (g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.78\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.51\u0026thinsp;\u0026plusmn;\u0026thinsp;0.39\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePercent weight gain (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8.58\u0026thinsp;\u0026plusmn;\u0026thinsp;2.11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e18.64\u0026thinsp;\u0026plusmn;\u0026thinsp;5.95\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e16.53\u0026thinsp;\u0026plusmn;\u0026thinsp;7.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14.79\u0026thinsp;\u0026plusmn;\u0026thinsp;3.81\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecific growth rate (%/day)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.59\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.98\u0026thinsp;\u0026plusmn;\u0026thinsp;0.24\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAverage daily growth (g/day)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.53\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.55\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"5\"\u003e\n \u003cp\u003e\u003cstrong\u003eWeek 4\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSurvival rate (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e98.89\u0026thinsp;\u0026plusmn;\u0026thinsp;1.92\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e97.78\u0026thinsp;\u0026plusmn;\u0026thinsp;3.85\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e95.56\u0026thinsp;\u0026plusmn;\u0026thinsp;5.09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e97.78\u0026thinsp;\u0026plusmn;\u0026thinsp;3.85\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFinal weight (g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e16.83 \u0026plusmn; 0.22\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e18.75 \u0026plusmn; 0.57\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e18.47 \u0026plusmn; 0.93\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e18.07 \u0026plusmn; 0.23\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWeight gain (g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.70 \u0026plusmn; 0.27\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8.55 \u0026plusmn; 0.64\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8.21 \u0026plusmn; 0.92\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.86 \u0026plusmn; 0.30\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePercent weight gain (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e66.09 \u0026plusmn; 3.02\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e83.85 \u0026plusmn; 6.99\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e80.09 \u0026plusmn; 8.88\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e77.03 \u0026plusmn; 3.56\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecific growth rate (%/day)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.69 \u0026plusmn; 0.06\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.03 \u0026plusmn; 0.13\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.96 \u0026plusmn; 0.17\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.90 \u0026plusmn; 0.07\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAverage daily growth (g/day)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.48 \u0026plusmn; 0.02\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.61 \u0026plusmn; 0.05\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.59 \u0026plusmn; 0.07\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.56 \u0026plusmn; 0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.27 \u0026plusmn; 0.62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.32 \u0026plusmn; 0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.30 \u0026plusmn; 0.03\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.57 \u0026plusmn; 0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"5\"\u003eValues are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. Values within the same row with different superscript letters indicate significant differences among treatments (one-way ANOVA followed by Tukey\u0026rsquo;s HSD test, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003eAt week 4, SR showed no significant differences, ranging from 95.56% to 98.89% (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). FW was significantly higher in CA-25 (18.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57 g), CA-50 (18.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.93 g) and CA-100 (18.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23 g) than in CA-0 (16.83\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22 g). WG increased from 6.70\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27 g in CA-0 to 8.55\u0026thinsp;\u0026plusmn;\u0026thinsp;0.64 g in CA-25, with CA-25 and CA-50 forming the highest statistical group. PWG ranged from 66.09\u0026thinsp;\u0026plusmn;\u0026thinsp;3.02% in CA-0 to 83.85\u0026thinsp;\u0026plusmn;\u0026thinsp;6.99% in CA-25, with CA-25 and CA-50 differing significantly from CA-0. SGR increased from 1.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06%/day in CA-0 to 2.03\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13%/day in CA-25, following the same statistical pattern as WG. ADG ranged from 0.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02 g/day in CA-0 to 0.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05 g/day in CA-25, and FCR showed no significant differences among treatments (2.27\u0026ndash;2.57).\u003c/p\u003e\n\u003cdiv id=\"Sec17\" class=\"Section3\"\u003e\n \u003ch2\u003e3.3.2. Immune-related gene expression\u003c/h2\u003e\n \u003cp\u003eDietary CA significantly altered the transcription of immune-related genes in the midgut of Asian seabass (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). \u003cem\u003eIL-10\u003c/em\u003e expression significantly increased from 1.03 in CA-0 to 2.13 in CA-50 and decreased to 1.37 in CA-100, with corresponding log₂-fold changes of 0.80, 1.03, and 0.29. \u003cem\u003eTNF-\u0026alpha;\u003c/em\u003e expression ranged from 0.85 in CA-50 to 1.10 in CA-0, and all CA-treated groups displayed negative log₂-fold changes between \u0026minus;\u0026thinsp;0.50 and \u0026minus;\u0026thinsp;0.38, but there were no significant differences observed. \u003cem\u003eTGF-\u0026beta;\u003c/em\u003e expression rose from 1.08 in CA-0 to 2.17 in CA-50 and declined to 1.56 in CA-100, yielding log₂-fold changes of 0.88, 1.03, and 0.53. \u003cem\u003eIFN-\u0026gamma;\u003c/em\u003e expression increased from 1.03 in CA-0 to 2.04 in CA-50 and decreased to 1.34 in CA-100, corresponding to log₂-fold changes of 0.66, 0.96, and 0.29. \u003cem\u003eC3\u003c/em\u003e expression ranged from 1.22 in CA-0 to 2.08 in CA-50, with CA-25 and CA-50 assigned to the highest statistical group and log₂-fold changes between 0.71 and 0.91. \u003cem\u003eHSP70\u003c/em\u003e expression decreased from 1.08 in CA-0 to 0.61 in CA-50 and increased to 0.85 in CA-100, producing log₂-fold changes ranging from \u0026minus;\u0026thinsp;0.49 to \u0026minus;\u0026thinsp;0.37.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section3\"\u003e\n \u003ch2\u003e3.3.3. Intestinal histology\u003c/h2\u003e\n \u003cp\u003eDietary CA produced distinct morphological and quantitative changes in the intestinal mucosa (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e). Histological sections showed compact villi with shorter projections in CA-0, whereas CA-25 and CA-50 displayed visibly elongated and more slender villi, and CA-100 exhibited moderately developed villi. Villus length increased from 87.88\u0026thinsp;\u0026plusmn;\u0026thinsp;19.24 \u0026micro;m in CA-0 to 177.01\u0026thinsp;\u0026plusmn;\u0026thinsp;42.33 \u0026micro;m in CA-50, with CA-50 forming the highest statistical group and CA-0 the lowest. Villus width ranged from 33.73\u0026thinsp;\u0026plusmn;\u0026thinsp;3.38 \u0026micro;m in CA-100 to 38.63\u0026thinsp;\u0026plusmn;\u0026thinsp;3.67 \u0026micro;m in CA-50, and no significant differences were detected among treatments. Thickness of muscularis width varied between 7.76\u0026thinsp;\u0026plusmn;\u0026thinsp;2.39 \u0026micro;m in CA-50 and 9.67\u0026thinsp;\u0026plusmn;\u0026thinsp;1.95 \u0026micro;m in CA-100, and no treatment effect was detected. Muscularis thickness decreased from 26.63\u0026thinsp;\u0026plusmn;\u0026thinsp;8.42 \u0026micro;m in CA-0 to 11.10\u0026thinsp;\u0026plusmn;\u0026thinsp;3.92 \u0026micro;m in CA-50, with CA-0 forming the highest significance group and CA-50 the lowest (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n \u003ch2\u003e3.4. Challenge test\u003c/h2\u003e\n \u003cdiv id=\"Sec20\" class=\"Section3\"\u003e\n \u003ch2\u003e3.4.1. Clinical and pathological observations\u003c/h2\u003e\n \u003cp\u003eAt 14 dpi with \u003cem\u003eS. agalactiae\u003c/em\u003e, Asian seabass demonstrated a range of both external and internal pathological signs consistent with streptococcosis (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). Behaviorally, infected seabass swam sluggishly and concentrated on hovering or resting at the bottom of the tank, often displaying a slight lateral tilt. Additionally, the affected fish exhibited reduced responses to external stimuli and delayed feeding responses, indicating systemic malaise. Externally, fish frequently display focal scale loss along the flanks and dorsal region (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA); mild hemorrhages often border these denuded areas. Moreover, ocular involvement was pronounced, with exophthalmia developing in several individuals (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eB). In more severe cases, the protruded eyes show periorbital bleeding and corneal opacity, showing extensive vascular compromise (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eC). Internally, necropsy revealed pronounced hepatomegaly (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eC). Specifically, the liver was visibly swollen, smooth-edged, and pale, contrasting sharply with the darker hues of control fish. Furthermore, multiple petechial hemorrhages were observed on the liver surface and parenchyma, and upon sectioning, the tissue was friable with interspersed blood-tinged areas (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eE). No significant lesions were noted in other visceral organs, although the hepatic changes occasionally accompanied mild congestion of the spleen.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec21\" class=\"Section3\"\u003e\n \u003ch2\u003e3.4.2. Survival rate, relative percent survival\u003c/h2\u003e\n \u003cp\u003eDietary CA significantly affected post-challenge survival of Asian seabass over the 14-day period. Survival in the control (+) group remained at 100% across all days, whereas survival in control (-) declined to 44.00% by day 14 (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA). Fish fed 25 mg/kg, 50 mg/kg, and 100 mg/kg CA exhibited final survival rates of 61.33%, 70.67%, and 52.00%, respectively. Statistical groupings indicated that CA-50 formed the highest surviving treatment group, followed by CA-25 and CA-100, which differed significantly from one another and from control (\u0026ndash;) (Table S5). In addition, relative percent survival values, calculated against the control (\u0026ndash;) group, were 30.95% for CA-25, 47.62% for CA-50, and 14.29% for CA-100 (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eB). These values correspond to the observed survival patterns and the Kaplan\u0026ndash;Meier outcomes.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec22\" class=\"Section3\"\u003e\n \u003ch2\u003e3.4.3. Immune-related gene expression in the liver post challenge\u003c/h2\u003e\n \u003cp\u003eDietary treatment also significantly modulated transcription of six immune-related genes (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eC). \u003cem\u003eIL-10\u003c/em\u003e expression ranged from 0.71 in control (\u0026ndash;) to 5.23 in CA-50, with intermediate values of 4.32 in CA-25 and 3.54 in CA-100 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). \u003cem\u003eTNF-\u0026alpha;\u003c/em\u003e expression significantly increased from 1.09 in control (+) to 4.36 in control (\u0026ndash;) and ranged from 1.02 to 2.20 in CA-treated groups. \u003cem\u003eTGF-\u0026beta;\u003c/em\u003e expression rose from 1.12 in control (+) to 5.84 in CA-50, with CA-25, CA-50, and CA-100 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). \u003cem\u003eIFN-\u0026gamma;\u003c/em\u003e expression ranged from 1.00 in control (\u0026ndash;) to 3.68 in CA-50, with CA-25 and CA-100 forming intermediate groups. \u003cem\u003eC3\u003c/em\u003e expression ranged from 0.90 in control (\u0026ndash;) to 4.52 in CA-50, with CA-25 and CA-100 also clustering in the highest expression group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). \u003cem\u003eHSP70\u003c/em\u003e expression peaked at 5.63 in the control (\u0026ndash;) and ranged from 2.13 to 3.60 among the CA treatments (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Log₂-fold change analysis supported these patterns (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eD). \u003cem\u003eIL-10\u003c/em\u003e exhibited positive fold changes of 1.97, 2.18, and 1.66 in CA-25, CA-50, and CA-100. \u003cem\u003eTGF-\u0026beta;\u003c/em\u003e showed positive fold changes, ranging from 2.09 to 2.51, across these treatments. \u003cem\u003eIFN-\u0026gamma;\u003c/em\u003e showed log₂-fold changes ranging from 1.45 to 1.82. \u003cem\u003eC3\u003c/em\u003e exhibited increases of 1.69 to 2.06. \u003cem\u003eTNF-\u0026alpha;\u003c/em\u003e and \u003cem\u003eHSP70\u003c/em\u003e showed positive fold changes in all caffeic acid groups, ranging from 0.53 to 1.82.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\n \u003ch2\u003e3.4.4. Liver histopathology\u003c/h2\u003e\n \u003cp\u003eLiver morphology differed markedly among treatments following \u003cem\u003eS. agalactiae\u003c/em\u003e challenge at 7 dpi (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e). PBS-injected fish showed intact hepatic cords, uniformly polygonal hepatocytes, and narrow sinusoids without evidence of degeneration or inflammation (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eA). In contrast, infected fish receiving the CA-0 diet exhibited extensive cytoplasmic degeneration, diffuse vacuolization, and multifocal nuclear degeneration, accompanied by widespread cellular necrosis and marked sinusoidal dilation (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eB \u0026amp; \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eC). Prominent vascular congestion and frequent melanomacrophage centers were also observed in this group.\u003c/p\u003e\n \u003cp\u003eDietary CA reduced lesion severity in a concentration-dependent manner. Fish fed 25 mg/kg CA displayed moderate hepatocellular degeneration with scattered necrotic foci and localized vascular congestion, while partial preservation of normal nuclei was evident (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eD). Supplementation with 50 mg/kg CA resulted in the mildest pathological alterations, characterized by limited cytoplasmic degeneration, minimal sinusoidal dilation, and small, infrequent necrotic areas (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eE). Fish fed 100 mg/kg CA showed intermediate hepatic injury, characterized by mild to moderate degeneration and occasional congestion, with varying lesion severity (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eF). Melanomacrophage centers were found in all infected groups.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe present findings indicate that dietary CA enhances disease resistance in Asian seabass challenged with \u003cem\u003eS. agalactiae\u003c/em\u003e, most likely through multiple complementary mechanisms. A primary mechanism involves the direct antibacterial activity of CA. In this study, \u003cem\u003ein vitro\u003c/em\u003e assays confirmed that CA inhibits \u003cem\u003eS. agalactiae\u003c/em\u003e proliferation in a clear dose-dependent manner, with an EC₅₀ of approximately 10 \u0026micro;g/mL. This observation aligns with previous reports demonstrating that phenolic acids such as CA can diffuse across the semi-permeable bacterial membrane, undergo intracellular decomposition, and thereby acidify the cytoplasmic environment (Kyselka et al \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The resulting pH reduction interferes with vital metabolic pathways, suppresses enzymatic activity, and disrupts essential cellular enzymes, ultimately culminating in bacterial cell death (Lima et al \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Khan et al \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Additionally, in silico analyses have revealed that CA can inhibit the efflux pump regulators TetR and TetM, which play central roles in tetracycline resistance, highlighting CA\u0026rsquo;s potential to counteract efflux-mediated antimicrobial resistance (Sivakumar et al \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Beyond its activity against \u003cem\u003eS. agalactiae\u003c/em\u003e, CA exhibits a broad antimicrobial spectrum. Kot et al (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) reported that CA exerted bacteriostatic effects against \u003cem\u003eAeromonas\u003c/em\u003e species with minimum inhibitory concentrations ranging from 1.56 to 3.12 mg/mL, while its derivative, caffeic acid phenethyl ester, has demonstrated potent inhibitory effects against \u003cem\u003eStrpetococcus\u003c/em\u003e species (Meyuhas et al \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Veloz et al \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDietary supplementation with CA produced a clear, dose-dependent improvement in growth performance in juvenile Asian seabass. After four weeks, fish receiving 25 and 50 mg/kg CA displayed significantly greater final weights and weight gains than controls, with corresponding increases in SGR. Uniformly high survival across treatments confirmed that CA did not negatively affect viability. These findings align closely with recent literature demonstrating that moderate supplementation with CA or related phenolic acids enhances growth in various aquaculture species, primarily through stimulation of digestive enzyme activity. In Beluga sturgeon, CA supplementation at 5\u0026ndash;10 g/kg significantly increased weight gain and markedly enhanced amylase, lipase, and pepsin activities relative to controls (Ahmadifar et al \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Similar outcomes have been documented in Nile tilapia receiving 5 g/kg CA displayed significantly increased activities of SOD, CAT, and GPx, accompanied by improved blood biochemistry, enhanced intestinal morphology (Yilmaz \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Comparable enhancements in digestive function and growth have been reported in common carp (Bakhtiari et al \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), grass carp (Yang et al \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2024b\u003c/span\u003e), loach (\u003cem\u003eMisgurnus anguillicaudatus\u003c/em\u003e) (Liu et al \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), allow pond turtle (\u003cem\u003eMauremys mutica\u003c/em\u003e) (Zhang et al \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2025\u003c/span\u003e), Nile tilapia (Yu et al \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), Pacific white shrimp (\u003cem\u003eLitopenaeus vannamei\u003c/em\u003e) (Lu et al \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), and yellow croaker (\u003cem\u003eLarimichthys polyactis\u003c/em\u003e) (Xu et al \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2022b\u003c/span\u003e), suggesting that CA and its derivatives exert conserved digestive-enhancing effects across diverse taxa. Mechanistically, these improvements are widely attributed to the potent antioxidant and anti-inflammatory capacities of CA compounds. CA enhances endogenous antioxidant defenses by upregulating central enzymes such as SOD, CAT, and GPx, while concurrently activating cytoprotective signaling cascades including the Nrf2 pathway (Dinh-Hung et al \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). In parallel, CA and its derivatives modulate inflammatory homeostasis by suppressing NF-κB- and MAPK-mediated signaling, thereby reducing inflammatory stress in the gastrointestinal tract. This dual action, promoting antioxidative protection while attenuating inflammation, likely fosters a more efficient digestive environment (Dinh-Hung et al \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2025\u003c/span\u003e), enabling improved nutrient absorption and contributing to the elevated growth performance observed in CA-treated seabass.\u003c/p\u003e \u003cp\u003eThe intestinal morphology of CA-supplemented fish was markedly altered in ways that favor nutrient absorption. Control fish (CA-0) displayed relatively short, compact villi. In contrast, midgut sections from CA-25 and CA-50 groups exhibited dramatically longer, more slender villi \u0026ndash; nearly doubling in length at 50 mg/kg. Villus length plateaued or slightly declined at the highest CA dose. Villus width and Thickness of the lamina propria did not differ significantly among treatments. Muscularis thickness, however, decreased significantly at CA-50. This shift toward taller, slimmer villi with a thinner muscularis may reflect a gut optimized for absorption over motility, consistent with enhanced digestive function (Wang et al \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2025a\u003c/span\u003e). Increased villus height effectively expands the absorptive surface area of the intestine, which likely underlies the improved growth performance. Thus, the present increase in villus length at moderate CA levels is consistent with the expected gut-boosting properties of organic acids. The reduction in muscularis thickness is less commonly reported but may indicate that as nutrient absorption becomes more efficient (via longer villi), less muscular effort is required for gut peristalsis. Alternatively, it could reflect a reallocation of energy toward epithelial growth rather than muscular maintenance. In any case, the pronounced villus elongation would increase the digestive surface and likely contribute to the higher weight gains observed.\u003c/p\u003e \u003cp\u003eDietary CA exerted pronounced immunomodulatory effects in the midgut, characterized by a coordinated upregulation of key regulatory and innate immune genes at moderate inclusion levels. Anti-inflammatory cytokines \u003cem\u003eIL-10\u003c/em\u003e and \u003cem\u003eTGF-β\u003c/em\u003e were markedly elevated in the CA-25 and CA-50 groups, with \u003cem\u003eIL-10\u003c/em\u003e transcripts increasing nearly twofold at 50 mg/kg and \u003cem\u003eTGF-β\u003c/em\u003e showing a comparable rise. \u003cem\u003eIFN-γ\u003c/em\u003e, a Th1-associated cytokine, and complement component \u003cem\u003eC3\u003c/em\u003e similarly reached their highest expression in these treatments, indicating enhanced innate immune activation. Conversely, pro-inflammatory \u003cem\u003eTNF-α\u003c/em\u003e exhibited a slight, non-significant downward trend across all CA treatments. The stress-inducible gene \u003cem\u003eHSP70\u003c/em\u003e showed lower expression in CA-supplemented groups compared with the control. As no inflammatory or pathogenic challenge was applied in this experiment, the relatively higher \u003cem\u003eHSP70\u003c/em\u003e expression observed in the CA-0 group likely reflects baseline cellular turnover and routine metabolic activity in the intestinal epithelium rather than excessive inflammation or pathological stress. Accordingly, the downregulation of \u003cem\u003eHSP70\u003c/em\u003e in CA-fed fish should be interpreted as an indication of improved cellular homeostasis and a reduced requirement for stress-response signaling under normal physiological conditions, rather than the alleviation of abnormal stress.\u003c/p\u003e \u003cp\u003eThis overall transcriptional pattern reflects a balanced immunostimulatory profile in which CA enhances regulatory and antimicrobial defenses without provoking excessive inflammation. The strong induction of \u003cem\u003eIL-10\u003c/em\u003e and \u003cem\u003eTGF-β\u003c/em\u003e is particularly important, as these cytokines play central roles in controlling inflammatory reactivity in teleosts and may contribute to improved mucosal homeostasis (Zou and Secombes \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Dong et al \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Li et al \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Comparable responses have been reported in recent CA-feeding studies across aquaculture species. Nile tilapia receiving 5 g/kg CA showed elevated phagocytic activity, respiratory burst, serum lysozyme, MPO activity, and upregulation of genes including \u003cem\u003eIL-1β\u003c/em\u003e, \u003cem\u003eTNF-α\u003c/em\u003e, \u003cem\u003eIL-8\u003c/em\u003e, \u003cem\u003eIFN-γ\u003c/em\u003e, and \u003cem\u003eIgM\u003c/em\u003e; beluga sturgeon fed 5\u0026ndash;10 g/kg CA exhibited significantly enhanced lysozyme activity, total immunoglobulin, and serum protein levels (Yilmaz \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2019\u003c/span\u003e); and several studies in rainbow trout and other species demonstrated that caffeic-acid-derived compounds such as chlorogenic acid enhance nonspecific immunity, complement activity, and resistance to infection (Xu et al \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2022a\u003c/span\u003e; Zhai et al \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Ghafarifarsani et al \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Liu et al \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Xia et al \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Yang et al \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2024a\u003c/span\u003e; Wang et al \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2025b\u003c/span\u003e). Beyond immune enhancement, CA derivatives consistently demonstrate anti-inflammatory properties by attenuating NF-κB-mediated cytokine production, as evidenced by CAPE-induced suppression of \u003cem\u003eTNF-α\u003c/em\u003e and \u003cem\u003eIL-1β\u003c/em\u003e, accompanied by an increase in \u003cem\u003eIL-10\u003c/em\u003e in zebrafish (Lin et al \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). In the present study, the coordinated upregulation of regulatory cytokines (\u003cem\u003eIL-10\u003c/em\u003e and \u003cem\u003eTGF-β\u003c/em\u003e), together with enhanced innate immune markers (\u003cem\u003eIFN-γ\u003c/em\u003e and \u003cem\u003eC3\u003c/em\u003e) and reduced \u003cem\u003eHSP70\u003c/em\u003e expression, suggests that dietary CA supports a more stable intestinal environment that promotes immune readiness. Organic acids are known to modulate the intestinal microbiota by suppressing pathogenic taxa and promoting beneficial commensals such as Lactobacillus, which in turn influence host cytokine signaling and mucosal barrier integrity (Dittoe et al \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Busti et al \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Ebeid and Al-Homidan \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Thus, the enhanced expression of \u003cem\u003eIL-10\u003c/em\u003e, \u003cem\u003eIFN-γ\u003c/em\u003e, and \u003cem\u003eC3\u003c/em\u003e in CA-supplemented seabass may reflect a more favorable gut milieu that fosters immune readiness while maintaining inflammatory balance. It should be noted that, in the absence of a disease or inflammatory challenge, changes in \u003cem\u003eHSP70\u003c/em\u003e expression should be regarded as indicators of cellular metabolic adjustment rather than direct evidence of stress severity. Although functional immune assays were not conducted here, the convergence of regulatory cytokine induction, innate immune enhancement, and moderated stress-response signaling strongly suggests that CA primes the mucosal immune system under normal physiological conditions in a manner consistent with the improved disease resilience reported in other aquaculture species (Yilmaz \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Ahmadifar et al \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Alavinejad et al \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2025\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCA significantly enhances disease resistance in Asian seabass challenged with \u003cem\u003eS. agalactiae\u003c/em\u003e. Moderate CA doses (especially 50 mg/kg) yielded markedly higher survival and relative percent survival than the un-supplemented, infected control, whereas the highest dose (100 mg/kg) conferred less benefit. The dose-dependent survival pattern suggests an optimal CA level for protection. The observed clinical signs in infected fish including lethargy, exophthalmia, hemorrhages, pallor and enlargement of the liver (hepatomegaly), and occasional splenic congestion which match classical streptococcosis pathology described in other studies of \u003cem\u003eS. agalactiae\u003c/em\u003e (e.g., erratic behavior, eye opacity, skin petechiae, and darkened liver) (Deng et al \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Jia et al \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Sharon et al \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Importantly, CA markedly reduced these lesions by fish fed CA had less severe hepatic necrosis and hemorrhage, and only mild focal vacuolization and congestion at moderate doses, whereas CA-free infected fish showed extensive necrosis and sinusoidal dilation. These findings indicate that CA protects internal organs during bacterial infection. In addition, CA likely mitigates \u003cem\u003eS. agalactiae\u003c/em\u003e-induced systemic damage through multiple actions. Several complementary mechanisms may underlie the protective effect of CA. CA itself has direct antibacterial activity against fish pathogens, as has been proven in an \u003cem\u003ein vitro\u003c/em\u003e assay. Beyond direct antimicrobial effects, CA exerts potent immunomodulatory actions in fish. In the present study, moderate dietary CA markedly upregulated regulatory and innate immunity genes in the liver. Anti-inflammatory cytokines \u003cem\u003eIL-10\u003c/em\u003e and \u003cem\u003eTGF-β\u003c/em\u003e were strongly elevated (especially at 50 mg/kg), while the pro-inflammatory \u003cem\u003eTNF-α\u003c/em\u003e transcript showed a non-significant decline. The stress-inducible \u003cem\u003eHSP70\u003c/em\u003e was significantly downregulated in CA-fed fish, suggesting lower cellular stress. In tandem, transcripts for innate effectors (\u003cem\u003eIFN-γ\u003c/em\u003e, \u003cem\u003eC3\u003c/em\u003e) were elevated at moderate CA levels. This pattern, which includes increased regulatory/antimicrobial signaling with dampened stress and unchecked inflammation, is indicative of a balanced immunostimulation that enhances defense without provoking pathology. Functionally, increased \u003cem\u003eIL-10/TGF-β\u003c/em\u003e may help control inflammation (Li et al \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), while systemically, higher \u003cem\u003eIFN-γ\u003c/em\u003e levels suggest stronger antimicrobial readiness (Meadows et al \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e1989\u003c/span\u003e; Yue et al \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The net effect is improved pathogen clearance with less collateral damage, which likely contributes to the higher survival observed. CA is also a well-known antioxidant, and its benefits may include the reduction of oxidative stress during infection. For example, in trout exposed to toxins or infection, CA compounds activate the Nrf2 pathway and antioxidant enzymes (SOD, CAT, GPx) to scavenge free radicals (Chung et al \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). In this study, although antioxidant enzymes were not directly measured, the lower \u003cem\u003eHSP70\u003c/em\u003e expression and milder tissue lesions in CA-fed fish imply that oxidative damage was mitigated. By scavenging reactive oxygen species and stabilizing cellular redox state, CA likely helped preserve intestinal and hepatic cell integrity during the bacterial challenge. Interestingly, survival and immune enhancement were greatest at intermediate CA doses (50 mg/kg) and declined at the highest dose (100 mg/kg). This suggests a threshold beyond which additional CA confers no extra benefit or may even exert counterproductive effects. In our seabass, the 50 mg/kg dose provided the best balance of immune stimulation and low pathology. The intermediate dose likely optimized the antioxidant and anti-inflammatory effects without potential toxicity or pro-oxidant action at very high levels.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThe present study demonstrates that CA offers multifaceted benefits to Asian seabass, functioning as both an effective antimicrobial agent against \u003cem\u003eS. agalactiae\u003c/em\u003e and a potent dietary immunomodulatory compound. CA inhibited \u003cem\u003eS. agalactiae\u003c/em\u003e proliferation \u003cem\u003ein vitro\u003c/em\u003e with an EC₅₀ of 9.90 \u0026micro;g/mL. When administered through feed, concentrations up to 100 mg/kg exhibited no acute toxicity and supported normal behavior and survival. Dietary inclusion of CA at 25\u0026ndash;50 mg/kg significantly enhanced growth performance, intestinal morphology, and immune gene activation under non-challenged conditions. Following bacterial challenge, CA-supplemented fish, particularly those receiving 50 mg/kg, exhibited higher survival rates, enhanced immune transcriptional responses, and markedly reduced hepatic lesions, including lower degeneration, congestion, and necrosis. Collectively, these results establish CA as a promising functional feed additive capable of strengthening systemic immunity, improving gut integrity, and mitigating streptococcal pathology in Asian seabass aquaculture.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAnimal ethics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll procedures performed in studies involving animals were in strict accordance with the institutional and national guidelines for the care and use of laboratory animals. The experimental protocol was reviewed and approved by the Prince of Songkla University (Approval No. Ref.AQ105/2025).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was partially supported by\u0026nbsp;Chiang Mai University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCRediT authorship contribution statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSuwana Witsetkaew:\u0026nbsp;\u003c/strong\u003eRoles/Writing - Original draft, Formal analysis, Data curation, Methodology, Investigation, Writing, Review \u0026amp; Editing.\u0026nbsp;\u003cstrong\u003eLuu Tang Phuc Khang\u003c/strong\u003e: Roles/Writing - Original draft, Formal analysis, Data curation, Methodology, Investigation, Writing, Review \u0026amp; Editing.\u0026nbsp;\u003cstrong\u003eKritsada Phetduang:\u003c/strong\u003e Roles/Writing - Original draft, Investigation, Methodology.\u003cstrong\u003e\u0026nbsp;Sefti Heza Dwinanti:\u0026nbsp;\u003c/strong\u003eRoles/Writing - Original draft, Investigation, Methodology.\u003cstrong\u003e\u0026nbsp;Phatthanaphong Therdtatha:\u0026nbsp;\u003c/strong\u003eInvestigation, Methodology. \u003cstrong\u003eLee Po-Tsang:\u0026nbsp;\u003c/strong\u003eConceptualization, Investigation, Methodology.\u003cstrong\u003e\u0026nbsp;Papungkorn Sangsawad:\u0026nbsp;\u003c/strong\u003eRoles/Writing - Original draft, Writing, Review \u0026amp; Editing, Investigation, Methodology, Conceptualization.\u003cstrong\u003e\u0026nbsp;Mintra Seel-audom:\u003c/strong\u003e Roles/Writing - Original draft, Investigation, Methodology.\u003cstrong\u003e\u0026nbsp;Patima Permpoonpatana:\u0026nbsp;\u003c/strong\u003eRoles/Writing - Original draft, Investigation, Methodology.\u003cstrong\u003e\u0026nbsp;Nguyen Vu Linh:\u003c/strong\u003e Roles/Writing - Original draft, Formal analysis, Data curation, Methodology, Investigation, Writing, Review \u0026amp; Editing, Resources, Conceptualization, Funding acquisition, and Project administration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDatasets used and analyzed during the current study available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAhmadifar E, Mohammadzadeh S, Kalhor N, Salehi F, Eslami M, Zaretabar A, Moghadam MS, Hoseinifar SH, Van Doan H (2022) Effects of caffeic acid on the growth performance, growth genes, digestive enzyme activity, and serum immune parameters of beluga (Huso huso). J Experimental Zool Part A: Ecol Integr Physiol 337(7):715\u0026ndash;723\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlavinejad SS, Soltani M, saeed Mirzargar S, Shohreh P, Taherimirghaed A (2025) Influence of caffeic acid and Bacillus coagulans supplementation on growth, digestive enzymes, immune response, and antioxidant gene expression in common carp (Cyprinus carpio) and its resistance to Aeromonas hydrophila infection. Aquaculture Rep 40:102515\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBakhtiari F, Ahmadifar E, Moghadam MS, Mohammadzadeh S, Mahboub HH (2024) Dual effects of dietary Lactobacillus helveticus and chlorogenic acid on growth performance, digestibility, immune-antioxidant capacity and resistance against heat stress of juvenile common carp. Aquacult Int 32(6):7911\u0026ndash;7927\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBasu N, Todgham A, Ackerman P, Bibeau M, Nakano K, Schulte P, Iwama GK (2002) Heat shock protein genes and their functional significance in fish. Gene 295(2):173\u0026ndash;183\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeltr\u0026aacute;n JMG, Esteban M\u0026Aacute; (2022) Nature-identical compounds as feed additives in aquaculture. Fish Shellfish Immunol 123:409\u0026ndash;416\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBird S, Zou J, Secombes CJ (2006) Advances in fish cytokine biology give clues to the evolution of a complex network. Curr Pharm Design 12(24):3051\u0026ndash;3069\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBirkov\u0026aacute; A, Hubkov\u0026aacute; B, Boler\u0026aacute;zska B, Marekov\u0026aacute; M, Čižm\u0026aacute;rov\u0026aacute; B (2020) Caffeic acid: A brief overview of its presence, metabolism, and bioactivity. Bioactive Compounds in Health and Disease-Online ISSN: 2574\u0026thinsp;\u0026ndash;\u0026thinsp;0334; Print ISSN: 2769\u0026thinsp;\u0026ndash;\u0026thinsp;2426. 3(4):74\u0026ndash;81\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBusti S, Rossi B, Volpe E, Ciulli S, Piva A, D\u0026rsquo;Amico F, Soverini M, Candela M, Gatta PP, Bonaldo A (2020) Effects of dietary organic acids and nature identical compounds on growth, immune parameters and gut microbiota of European sea bass. Sci Rep 10(1):21321\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChenoweth S, Hughes J (1997) Genetic population structure of the catadromous Perciform: Macquaria novemaculeata (Percichthyidae). J Fish Biol 50(4):721\u0026ndash;733\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChung MJ, Walker PA, Hogstrand C (2006) Dietary phenolic antioxidants, caffeic acid and Trolox, protect rainbow trout gill cells from nitric oxide-induced apoptosis. Aquat Toxicol 80(4):321\u0026ndash;328\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng Y, Lin Z, Xu L, Jiang J, Cheng C, Ma H, Feng J (2024) A first report of Streptococcus iniae infection of the spotted sea bass (Lateolabrax maculates). Front Veterinary Sci 11:1404054\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDinh-Hung N, Khang LTP, Wisetkaeo S, Tran NT, Po-Tsang L, Brown CL, Sangsawad P, Dwinanti SH, Permpoonpattana P, Linh NV (2025) Caffeic Acid as a Promising Natural Feed Additive: Advancing Sustainable Aquaculture. Biology 14(9):1160\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDittoe DK, Ricke SC, Kiess AS (2018) Organic acids and potential for modifying the avian gastrointestinal tract and reducing pathogens and disease. Front veterinary Sci 5:216\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong Y-W, Jiang W-D, Wu P, Liu Y, Kuang S-Y, Tang L, Tang W-N, Zhou X-Q, Feng L (2022) Novel insight into nutritional regulation in enhancement of immune status and mediation of inflammation dynamics integrated study in vivo and in vitro of teleost grass carp (Ctenopharyngodon idella): administration of threonine. Front Immunol 13:770969\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEbeid TA, Al-Homidan IH (2022) Organic acids and their potential role for modulating the gastrointestinal tract, antioxidative status, immune response, and performance in poultry. World's Poult Sci J 78(1):83\u0026ndash;101\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFAO (2025) \u003cem\u003eLates calcarifer Bloch,1790\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.fao.org/fishery/en/aqspecies/3068/en\u003c/span\u003e\u003cspan address=\"https://www.fao.org/fishery/en/aqspecies/3068/en\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhafarifarsani H, Nedaei S, Hoseinifar SH, Van Doan H (2023) Effect of different levels of chlorogenic acid on growth performance, immunological responses, antioxidant defense, and disease resistance of rainbow trout (Oncorhynchus mykiss) juveniles. 2023(1):3679002Aquaculture nutrition\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuha R, Nandhakumar K, Byadgi OV, Chen SC, Elumalai P (2025) Immune Response and Protective Efficacy of β-Glucan and Alkoxyglycerol as Adjuvant in Streptococcus agalactiae Formalin‐Inactivated Vaccine in Nile Tilapia (Oreochromis niloticus). J Fish Dis : e14141\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJerry DR (2013) Biology and culture of Asian seabass Lates calcarifer. CRC\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJia R, Hou Y, Zhou L, Zhang C, Li B, Zhu J (2025) Combined effects of high-fat diet feeding and Streptococcus agalactiae infection on lipid metabolism, antioxidant status, and immune response in tilapia (Oreochromis niloticus). Toxicology \u0026amp; Pharmacology, Comparative Biochemistry and Physiology Part C, p 110321\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhan F, Bamunuarachchi NI, Tabassum N, Kim Y-M (2021) Caffeic acid and its derivatives: antimicrobial drugs toward microbial pathogens. J Agric Food Chem 69(10):2979\u0026ndash;3004\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhang LTP, Linh NV, Wisetkaeo S, Therdtatha P, Dinh-Hung N, Phimolsiripol Y, Seesuriyachan P, Sangsawad P, Permpoonpatana P, Van Doan H (2025) Fermented corn stover (Zea mays L.) enhances growth, immune response, histology, gut microbiome, and gene expression in Cyprinus carpio var. koi in biofloc system. Italian J Anim Sci 24(1):2359\u0026ndash;2375\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKlongklaew N, Tansutaphanit S, Tiewpair P, Buncharoen W, Phaksopa J, Srisapoome P, Uchuwittayakul A (2025) Fish Health Enhancement and Intestinal Microbiota Benefits of Asian Seabass (Lates calcarifer Bloch, 1790) on Dietary Sea Lettuce (Ulva rigida C. Agardh, 1823) Extract Supplementation. Animals 15(12):1714\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKot B, Kwiatek K, Janiuk J, Witeska M, Pękala-Safińska A (2019) Antibacterial activity of commercial phytochemicals against Aeromonas species isolated from fish. Pathogens 8(3):142\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKyselka J, Rabiej D, Dragoun M, Kreps F, Burčov\u0026aacute; Z, Němečkov\u0026aacute; I, Smolov\u0026aacute; J, Bjelkov\u0026aacute; M, Szydłowska-Czerniak A, Schmidt Š (2017) Antioxidant and antimicrobial activity of linseed lignans and phenolic acids. Eur Food Res Technol 243:1633\u0026ndash;1644\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLaith A, Ambak MA, Hassan M, Sheriff SM, Nadirah M, Draman AS, Wahab W, Ibrahim WNW, Aznan AS, Jabar A (2017) Molecular identification and histopathological study of natural Streptococcus agalactiae infection in hybrid tilapia (Oreochromis niloticus). Veterinary World 10(1):101\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLan NGT, Dong HT, Shinn AP, Vinh NT, Senapin S, Salin KR, Rodkhum C (2024) Review of current perspectives and future outlook on bacterial disease prevention through vaccination in Asian seabass (Lates calcarifer). J Fish Dis 47(8):e13964\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi K, Wei X, Yang J (2023) Cytokine networks that suppress fish cellular immunity. Dev Comp Immunol 147:104769\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLima VN, Oliveira-Tintino CD, Santos ES, Morais LP, Tintino SR, Freitas TS, Geraldo YS, Pereira RL, Cruz RP, Menezes IR (2016) Antimicrobial and enhancement of the antibiotic activity by phenolic compounds: Gallic acid, caffeic acid and pyrogallol. Microb Pathog 99:56\u0026ndash;61\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin CJ, Chang L, Chu HW, Lin HJ, Chang PC, Wang RY, Unnikrishnan B, Mao JY, Chen SY, Huang CC (2019) High amplification of the antiviral activity of curcumin through transformation into carbon quantum dots. Small 15(41):1902641\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin M, Guo X, Xu X, Chang C, Le TN, Cai H, Zhao M (2025) Caffeic Acid Phenethyl Ester Alleviates Alcohol-Induced Inflammation Associated with Pancreatic Secretion and Gut Microbiota in Zebrafish. Biomolecules 15(7):918\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLinh NV, Khang LTP, Dinh-Hung N, Wisetkaeo S, Therdtatha P, Sangsawad P, Wannavijit S, Jitjumnong J, Permpoonpattana P, Van Doan H (2025a) Effects of dietary corn silk (Zea mays L.) on growth, immune and antioxidant pathways, histological morphology, gut microbiome, and sensitivity to acute ammonia exposure in the koi carp (Cyprinus carpio var. koi). Comp Biochem Physiol B: Biochem Mol Biol 279:111127\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLinh NV, Khang LTP, Dinh-Hung N, Wisetkaeo S, Wannavijit S, Phimolsiripol Y, Seesuriyachan P, Sangsawad P, Permpoonpattana P, Van Doan H (2025b) Effect of fermented corn cob (Z ea mays L.) on growth performance, immunological response, and expression of immune-antioxidant genes in koi carp (Cyprinus carpio var. koi) reared in a low water exchange rearing system. Vet Res Commun 49(6):355\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLinh NV, Khongcharoen N, Nguyen D-H, Dien LT, Rungrueng N, Jhunkeaw C, Sangpo P, Senapin S, Uttarotai T, Panphut W, St-Hilaire S, Van Doan H, Dong HT (2023) Effects of hyperoxia during oxygen nanobubble treatment on innate immunity, growth performance, gill histology, and gut microbiome in Nile tilapia, Oreochromis niloticus. Fish Shellfish Immunol 143:109191. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.fsi.2023.109191\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2023.109191\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu X-r, Ma X, Zhang N, Li M, Li K, Jiao S-q, Wang G-q, Kong Y-d (2023) Effects of chlorogenic acid in feed on the growth performance, digestive enzyme activity, immune function, and antioxidant capacity of loach (Misgurnus anguillicaudatus). J Fisheries China 47(10):99\u0026ndash;112\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2\u0026thinsp;\u0026ndash;\u0026thinsp;∆∆CT method. methods 25(4): 402\u0026ndash;408\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu M, Jing F, Liu R, Chen Z, Tong R, Li Y, Pan L (2024) The effects and mechanisms of dietary ferulic acid (FA) and dihydromyricetin (DMY) on growth and physiological responses of the shrimp (Litopenaeus vannamei). Aquaculture 589:740967\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaharajan A, Kitto MR, Paruruckumani P, Ganapiriya V (2016) Histopathology biomarker responses in Asian sea bass, Lates calcarifer (Bloch) exposed to copper. J Basic Appl Zool 77:21\u0026ndash;30\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeadows GG, Blank SE, Duncan DD (1989) Influence of ethanol consumption on natural killer cell activity in mice. Alcoholism: Clin Experimental Res 13(4):476\u0026ndash;479\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeyuhas S, Assali M, Huleihil M, Huleihel M (2015) Antimicrobial activities of caffeic acid phenethyl ester. J Mol Biochem 4(2)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNaiel MA, El-Kholy AI, Negm SS, Ghazanfar S, Shukry M, Zhang Z, Ahmadifar E, Abdel-Latif HM (2023) A mini-review on plant-derived phenolic compounds with particular emphasis on their possible applications and beneficial uses in aquaculture. Annals Anim Sci 23(4):971\u0026ndash;977\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNandhakumar K, Guha R, Lakshmi S, Elumalai P (2025) Immunogenicity and protective efficacy of chitosan/β-glucan nanoparticle encapsulated inactivated Streptococcus agalactiae oral vaccine for Nile tilapia (Oreochromis niloticus). Comp Immunol Rep 9:200254. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.cirep.2025.200254\u003c/span\u003e\u003cspan address=\"10.1016/j.cirep.2025.200254\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOwatari MS, Jesus GFA, Cardoso L, Lehmann NB, Martins ML, Mouri\u0026ntilde;o JLP (2020) Can histology and haematology explain inapparent Streptococcus agalactiae infections and asymptomatic mortalities on Nile tilapia farms? Res Vet Sci 129:13\u0026ndash;20\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePiamsomboon P, Thanasaksiri K, Murakami A, Fukuda K, Takano R, Jantrakajorn S, Wongtavatchai J (2020) Streptococcosis in freshwater farmed seabass Lates calcarifer and its virulence in Nile tilapia Oreochromis niloticus. Aquaculture 523:735189\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRahul Sandeep T, Sravya M, Simhachalam G (2025) Phytobiotics in finfish and shellfish: A systematic review. Discover Anim 2(1):1\u0026ndash;36\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRathore G, Madhusudana Rao B (2025) Antimicrobial Usage in Aquaculture: Potential Implications. Aquatic Animal Health Management. Springer, pp 665\u0026ndash;684\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReyes-Becerril M, Angulo C, Silva‐Jara J (2021) Antibacterial and immunomodulatory activity of moringa (Moringa oleifera) seed extract in Longfin yellowtail (Seriola rivoliana) peripheral blood leukocytes. Aquac Res 52(9):4076\u0026ndash;4085\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSecombes C, Wang T, Hong S, Peddie S, Crampe M, Laing K, Cunningham C, Zou J (2001) Cytokines and innate immunity of fish. Dev Comp Immunol 25(8\u0026ndash;9):713\u0026ndash;723\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharon J, Abraham TJ, Sen A, Das R, Sinha P, Boda S, Uma A, Patil PK (2025) Effects of Streptococcus agalactiae infection and oral florfenicol administration on the hemato-biochemistry, erythrocyte morphology and histopathology of Oreochromis niloticus. J Fisheries 13(1):131209\u0026ndash;131209\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSintuprom C, Nuchchanart W, Dokkaew S, Aranyakanont C, Ploypan R, Shinn AP, Wongwaradechkul R, Dinh-Hung N, Dong HT, Chatchaiphan S (2024) Effects of clove oil concentrations on blood chemistry and stress-related gene expression in Siamese fighting fish (Betta splendens) during transportation [Original Research]. Front Veterinary Sci 11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fvets.2024.1392413\u003c/span\u003e\u003cspan address=\"10.3389/fvets.2024.1392413\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSivakumar S, Girija AS, Priyadharsini JV (2020) Evaluation of the inhibitory effect of caffeic acid and gallic acid on tetR and tetM efflux pumps mediating tetracycline resistance in Streptococcus sp., using computational approach. J King Saud University-Science 32(1):904\u0026ndash;909\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoontara C, Uchuwittayakul A, Kayansamruaj P, Amparyup P, Wongpanya R, Srisapoome P (2024) Adjuvant Effects of a CC Chemokine for Enhancing the Efficacy of an Inactivated Streptococcus agalactiae Vaccine in Nile Tilapia (Oreochromis niloticus). Vaccines 12(6): 641\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSumana SL, Xue T, Hu H, Abdullateef MM, Shui Y, Ayana GU, Kayiira JC, Zhang C, Samwel BJ, Zhu J (2025) Medicinal Plants as Ecological Solutions for Fish Growth and Immunostimulatory Effects in Aquaculture. Aquac Res 2025(1):9778623\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTola S, Adepoju M-SK, Yuangsoi B, Charoenwattanasak S, Jatuwong K, Seel-audom M (2025) Effects of partial and complete replacement of fish oil with perilla oil on growth performance, feed efficiency, health status, and fatty acid accumulation in flesh of Asian seabass (Lates calcarifer) reared in freshwater. Anim Feed Sci Technol 323:116277\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVeloz JJ, Alvear M, Salazar LA (2019) Antimicrobial and antibiofilm activity against Streptococcus mutans of individual and mixtures of the main polyphenolic compounds found in Chilean propolis. Biomed Res Int 2019(1):7602343\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang J, Wu Y, Zhou T, Feng Y, Li L-a (2025a) Common factors and nutrients affecting intestinal villus height-A review. Anim Bioscience 38(8):1557\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Meng S, Li D, Liu S, Li L, Wu L (2025b) Dietary chlorogenic acid supplementation protects against lipopolysaccharide-induced oxidative stress, inflammation and apoptosis in intestine of amur ide (Leuciscus waleckii). Aquat Toxicol 279:107223\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWatts M, Munday B, Burke C (2001) Immune responses of teleost fish. Aust Vet J 79(8):570\u0026ndash;574\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWinfield IJ (2018) Sea bass and sea bream: a practical approach to disease control and health management. J Fish Biol 93(2):434\u0026ndash;434\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia Z, Mi H, Ren M, Huang D, Aboseif AM, Liang H, Zhang L (2024) Chlorogenic acid plays an important role in improving the growth and antioxidant status and weakening the inflammatory response of largemouth bass (Micropterus salmoides). Animals: Open Access J MDPI 14(19):2871\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu G, Xing W, Yu H, Jiang N, Ma Z, Luo L, Li T (2022a) Evaluation of chlorogenic acid supplementation in koi (cyprinus carpio) diet: growth performance, body color, antioxidant activity, serum biochemical parameters, and immune response. Aquacult Nutr 2022(1):2717003\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu W, Huang W, Yao C, Liu Y, Yin Z, Mai K, Ai Q (2022b) Effects of supplemental ferulic acid (FA) on survival, growth performance, digestive enzyme activities, antioxidant capacity and lipid metabolism of large yellow croaker (Larimichthys crocea) larvae. Fish Physiol Biochem 48(6):1635\u0026ndash;1648\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang H, Wu C, Yuan Q, Lv W, Qiu J, Li M, Zhang Q, Zhou W (2024a) Effects of Dietary Chlorogenic Acid on the Growth, Lipid Metabolism, Antioxidant Capacity, and Non-Specific Immunity of Asian Swamp Eel (Monopterus albus). Fishes 9(12):496\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang H, Xu Z, Li X, Leng X (2024b) Individual and combined effects of dietary chlorogenic acid and quercetin supplementation on the growth, lipid metabolism and flesh quality of grass carp, Ctenopharyngodon idellus. Anim Feed Sci Technol 318:116129\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang R, Han M, Fu Z, Wang Y, Zhao W, Yu G, Ma Z (2020) Immune responses of Asian seabass Lates calcarifer to dietary Glycyrrhiza uralensis. Animals 10(9):1629\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYilmaz S (2019) Effects of dietary caffeic acid supplement on antioxidant, immunological and liver gene expression responses, and resistance of Nile tilapia, Oreochromis niloticus to Aeromonas veronii. Fish Shellfish Immunol 86:384\u0026ndash;392\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu L, Wen H, Jiang M, Wu F, Tian J, Lu X, Xiao J, Liu W (2020) Effects of ferulic acid on intestinal enzyme activities, morphology, microbiome composition of genetically improved farmed tilapia (Oreochromis niloticus) fed oxidized fish oil. Aquaculture 528:735543\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYue G, Li Y, Orban L (2001) Characterization of microsatellites in the IGF-2 and GH genes of Asian seabass (Lates calcarifer). Mar Biotechnol 3(1):1\u0026ndash;3\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYue R, Wei X, Zhao J, Zhou Z, Zhong W (2021) Essential role of IFN-γ in regulating gut antimicrobial peptides and microbiota to protect against alcohol-induced bacterial translocation and hepatic inflammation in mice. Front Physiol 11:629141\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhai Q, Chang Z, Li J, Li J (2022) Effects of combined florfenicol and chlorogenic acid to treat acute hepatopancreatic necrosis disease in Litopenaeus vannamei caused by Vibrio parahaemolyticus. Aquaculture 547:737462\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang H, Shi J, Yan Z, Gao M, Lin K, Zhan Y, Li Y, Liang J, Han S (2025) Effects of chlorogenic acid on growth performance, immunity, antioxidant capacity, intestinal microbiota, and liver transcriptome in Mauremys mutica. Aquaculture Rep 42:102851\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu J, Li D, Xiao W, Yu J, Chen B, Zou Z, Yang H (2024) Survival, serum biochemical parameters, hepatic antioxidant status, and gene expression of three Nile tilapia strains under pathogenic Streptococcus agalactiae challenge. Fish Shellfish Immunol 155:110030\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZou J, Secombes CJ (2016) The function of fish cytokines. Biology 5(2):23\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Caffeic acid, growth performance, immune response, Lates calcarifer, Streptococcus agalactiae","lastPublishedDoi":"10.21203/rs.3.rs-8552784/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8552784/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCaffeic acid (CA) has recently gained attention as a natural compound with antimicrobial and immunomodulatory potential relevant to aquaculture health management. However, its functional efficacy, optimal dietary inclusion level, and protective capacity against \u003cem\u003eStreptococcus agalactiae\u003c/em\u003e infection in Asian seabass (\u003cem\u003eLates calcarifer\u003c/em\u003e) remain insufficiently characterized. This study evaluated the \u003cem\u003ein vitro\u003c/em\u003eantibacterial activity of CA, assessed its short-term dietary safety, examined growth and immune responses during a 4-week feeding trial, and determined its protective effects against \u003cem\u003eS. agalactiae\u003c/em\u003e. Antibacterial assays quantified dose-dependent inhibition of \u003cem\u003eS. agalactiae\u003c/em\u003e, with a sigmoidal dose-response model estimating an EC₅₀ of 9.90 µg/mL. Acute toxicity testing showed no adverse effects at dietary concentrations up to 100 mg/kg. Feeding trials demonstrated that 25–50 mg/kg CA enhanced weight gain, specific growth rate, villus length, and immune-related gene expression. Following bacterial challenge, dietary CA significantly improved survival, with CA-50 yielding the highest survival rate (70.67%) and relative percent survival (47.62%), accompanied by attenuated hepatic degeneration, necrosis, and vascular congestion. Gene expression and histopathological analyses further confirmed enhanced immune activation and reduced lesion severity in fish treated with CA. These findings demonstrate that CA functions as an effective antimicrobial agent, growth promoter, and immuno-protective feed additive for Asian seabass.\u003c/p\u003e","manuscriptTitle":"Antibacterial, growth-promoting, and immunostimulatory effects of dietary caffeic acid in Asian seabass (Lates calcarifer) challenged with Streptococcus agalactiae","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-02 09:32:09","doi":"10.21203/rs.3.rs-8552784/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"908a84b1-6b70-4a94-8787-1a45ea891565","owner":[],"postedDate":"February 2nd, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-03-07T07:25:29+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-02 09:32:09","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8552784","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8552784","identity":"rs-8552784","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.