Effects of dietary Bacillus velezensis LSG2-5 on digestion, intestinal morphology, microflora, and related gene expression in Rhynchocypris lagowskii Dybowski

Effects of dietary Bacillus velezensis LSG2-5 on digestion, intestinal morphology, microflora, and related gene expression in Rhynchocypris lagowskii Dybowski | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effects of dietary Bacillus velezensis LSG2-5 on digestion, intestinal morphology, microflora, and related gene expression in Rhynchocypris lagowskii Dybowski Shao-hua Li, Yu-rou Zhang, Li-li Lin, Dong-ming Zhang, Tian-yi Zhang, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4133761/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The study was to investigate at how Bacillus velezensis LSG2-5 from the host intestine affected the digestive function, intestinal morphology, intestinal microflora, and expression expression of tight junction protein genes in Rhynchocypris lagowskii Dybowski. Different doses of B. velezensis LSG2-5 were added to diets, namely control (0 CFU/g), B-6 (106 CFU/g), B-7 (107 CFU/g), B-8 (108 CFU/g) and B-9 (109 CFU/g) groups. Fish (mean weight: 9.98 ± 0.05 g) were fed for 56 days. The trypsin, lipase, amylase, γ-glutamyltransferase, Na+-K+-ATPase, and alkaline phosphatase activity in the liver and intestines of the treatment groups considerably increased in comparison to the control group (p<0.05), according to the results. Contrasted with the control group, the muscle layer thickness, lamina propria width, intestinal fold height, and fold breadth of the B-7, B-8, and B-9 groups increased considerably (p<0.05). Intestinal ZO-1, Claudin-3, and APN mRNA expression levels displayed significant up-regulation trends (p<0.05). The profusion of Proteobacteria, Bacteroidetes, Fusobacteria, and Cyanobacteria in intestines first increased and then decreased. In contrast, the abundance of Firmicutes showed an opposite trend. In summary, adding 107~109 CFU/g of B. velezensis LSG2-5 to feed can improve the intestinal health of R. lagowskii Dybowski. Bacillus velezensis Rhynchocypris lagowskii Dybowski intestinal health intestinal function intestinal microflora Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 1. Introduction An essential organ for fish digestion, absorption, and immune system performance is the gut. The growth and development of fish depend heavily on the health of their intestines. The lumen contains many antigens from ingested food, water, local microbes, or pathogens (Sundh et al., 2019 ). The intestine's main job is to consume down foods and absorb nutrition. Enzyme activity during digestion and absorption serves as a useful indicator directly reflecting the fish's growth rate and regulating metabolism(Ringø et al., 2020 , Yang et al., 2021 ). Simultaneously, the intestinal cavity and the body’s internal environment are separated by the intestinal barrier, which regulates and maintains the digestive system's function and the stability of intestinal environment (Beukema et al., 2020 ). The tangible obstacle of the enteric canal comprises intestinal epithelial cells in its majority. and tight junctions between cells (Yang et al., 2021 ). Absorbing cells, goblet cells, and paint cells make up the majority of intestinal epithelial cells. (Wang et al., 2020 ). Tight junction complexes are composed of tight junction, adhesion junction, and desmosome (Langlois et al., 2021 ), among which several proteins, including zonula occludens (ZO), junctional adhesion molecules (JAM), occludin, and claudins, make up tight junctions. (Langlois et al., 2021 ). Epithelial cells are essential in the mucosal immunity of fish, and their parclose effect is principally hinge on the degree of permeability of tight junctions between cells. So the role of tight junctions is crucial (Yang et al., 2019 ). Furthermore, the stability of intestinal morphology and important signals of intestine wellness include the balance of gut flora. (Jahan et al., 2021 ). The intestinal mucosa interacts with the flora to maintain a dynamic equilibrium in the intestine (Dawood et al., 2019 , Ringø et al., 2020 ). The bacterial community is disturbed when the infiltration of ions disrupts barrier functions, and small molecules increases or many pathogens enter, causing inflammation or infection in the gut and posing a threat to fish health (Kong et al., 2017 ). Probiotics added to feed bring health benefits to fish by providing nutrients, improving the way that digestive and absorbent enzymes function, controlling the intestinal flora's equilibrium, and the integrity of intestinal morphology (Langlois et al., 2021 ). Simultaneously, probiotics have the ability to stop harmful microorganisms from fixing in the fish's digestive system (Simon et al., 2021 ), promoting the secretion of mucus in the intestinal mucosa, improving the thickness and the intestinal mucosa's integrity (Wang et al., 2021 , Nimalan et al., 2022 ) and intestinal morphology (Islam et al., 2021 , Jahan et al., 2021 ). Studies have revealed that probiotics may enhance the expression of molecules known as tight junctions, thereby enhancing the completeness of the fish gut parclose (Yang et al., 2020 , Meng et al., 2021 ). Rhynchocypris lagowskii Dybowski is one of the primary commercial fish that has become popular in Northeast China in recent years (Yu et al., 2020 ). But the lack of feed technology restricts the yield improvement and quality of R. lagowskii Dybowski. Therefore, it is necessary to promote the healthy breeding of R. lagowskii Dybowski. Studies on R. lagowskii Dybowski mainly focus on nutritional requirements (Chen et al., 2019 , Zhang et al., 2019 , Li et al., 2020 , Yu et al., 2020 , Li et al., 2021 , Zhu et al., 2021 ). There has been still no research on probiotics' impact on gut health in vivo . The intestinal tract of R. lagowskii Dybowski contained a strain of LSG2-5 isolated and recognized as Bacillus velezensis by 16S rDNA sequence. The analysis to investigate whether probiotics Bacillus isolated from R. lagowskii Dybowski have positive effects on host intestinal function. In our laboratory, previous studies have proved that B. velezensis LSG2-5 boasts probiotic qualities in vitro (Mahmoud et al., 2023 ). It has proved that B. velezensis LSG2-5 promotes development, inoxidizability, and pathogen infection resistance of R. lagowskii Dybowski (Zhang et al., 2022 ). Different doses of B. velezensis LSG2-5 were added to the fodder for R. lagowskii Dybowski. This study aimed to investigate the influences of B. velezensis LSG2-5 on the intestinal health of R. lagowskii Dybowski through the changes the activity of enzymes for digestion and absorption, intestinal morphology, and associated expression of intestinal genes in the gut flora. This study provides data support for developing candidate probiotics of B. velezensis as a feed additive. 2. Material and methods 2.1 Strains origin and experimental diets B. velezensis LSG2-5 was separated from the intestine of R. lagowskii Dybowski, screened, and preserved in our laboratory from previous tests (Mahmoud et al., 2023 ). After activated in the, the preserved strains were set aside in phosphate-buffered saline (PBS) after centrifugation, and the dose was determined after dilution. The numbers of viable bacteria were 10 6 CFU/mL, 10 7 CFU/mL, 10 8 CFU/mL and 10 9 CFU/mL, respectively. Store at 4 ℃ for short-term use. Table 1 illustrates the elemental diets' nutritional composition and makeup. Feed ingredients that passed a 60-mesh screen was weigh and mixed according to the equation. After blending, the mixture was made into 1.5mm-thick particles by a feed extruder. The feeds were air-seasoning in a place of shady and conserved in a -20℃ ice locker until use. Four doses of B. velezensis LSG2-5 were added to the basal diets but not to the control group. Every diet that had strains added to it was sprayed, then airing at atmospheric temperature in a sterile environment, prepared for immediate use, and sprayed daily. Prior to the trial, diets were melted and tested to ensure the number of viable bacteria fed to the fish. 2.2 Laboratory fish and raising scheme R. lagowskii Dybowski was acquired from the cauf of Nian Nian You Yu (Tonghua, Jilin Province, China). The breeding experiment was carried out at the Aquaticulture Laboratory of Jilin Agricultural University (Changchun, Jilin Province, China). A total of 535 healthy fish without trauma were selected. Before the formal experiment, the basic diet of the fish was pre-fed for two weeks. Fish with a starting body weight average of 9.98 ± 0.05 g were separated into five sets of three duplicates each, and they were arbitrarily assigned to 15 barrels. The experiment performed manaul feeding twice daily (8am and 5pm) until satiation for 8 weeks. The temperature of water was 20 ± 1 ℃, and > 8.0 mg/L of dissolved oxygen was present. Daily, a third of the volume was switched, and the aquarium’s bottom was cleaned. 2.3 Sample collection Samples were collected at 56 days. After 24 h starvation, From each barrels, 12 fish were chosen at random and anesthetized with anestheticMS222. 75 percent alcohol was used to disinfect the fish's surface. Hepatopancreas, foregut, midgut, posterior gut of 6 fish were collected, frozen with liquid nitrogen and saved at -80℃ for the measure of digestive enzymatic activities and related gene expression levels. The foregut, midgut, posterior gut of 3 fish were collected. Normal saline was used to cleanse the intestines' inner and outer walls, and fixed in 4% paraformaldehyde solution for the tissue sections. The intestine contents of 3 fish were gathered in a septic setting, iced in liquid nitrogen, and kept at -80℃ to determine intestinal microbial diversity. 2.4 Sample measurement 2.4.1 Analysis of the activity of digestion and absorption enzymes Trypsin, lipase, amylase, γ glutamyltransferase (γ-GT), Na + -K + -ATPase, and alkaline phosphatase (AKP) were all determined by the relevant kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu Province, China). 2.4.2 Analysis of intestinal morphology The samples were prepared using the procedure outlined earlier (Zhu et al., 2021 ), including trimming, washing, dehydrating, treating transparently, and embedding in paraffin blocks. The samples were then divided into 5mm sections, and hematoxylin-eosin staining was applied. For measurement and photograph, a light microscope (Olympus, IX71, Japan) was employed. The lamina propria (LP), the thickness of the muscle layer (ML), and the height and breadth of the mucosal fold (MF) were all assessed. 2.4.3 Analysis of related gene expression levels TRIzol reagent (Takara) was used to extract total mRNA from the proximal, middle, and distal intestines of R. lagowskii Dybowski. The overall RNA quality was evaluated using gel electrophoresis. (Fig. 1.1 ~ 1.3). We utilized a NanoDrop2000 spectrophotometer to measure its purity and concentration (OD 260 /OD 280 ). The primers used in the experiment included β-actin , ZO-1 , Claudin-3 , and APN (Table 2 ). qRT-PCR was performed in StepOnePlus™ Real-Time PCR system (Thermo). Follow One Step TB Green® PrimeScript™ RT-PCR Kit Ⅱ(Takara) instructions. All operations on the electronic constant temperature sampling platform were carried out to prevent RNA degradation (GT20301). After the qRT-PCR reaction, the 2 −∆∆CT methodology was used for analysis. TABLE 1 Formulation and nutritional composition of basal diets (air-dry basis) Ingredients Groups (g/kg) CK B-6 B-7 B-8 B-9 Fish meal 200.0 200.00 200.00 200.00 200.00 Soybean meal 330.0 330.00 330.00 330.00 330.00 Fish oil 20.0 20.00 20.00 20.00 20.00 Corn oil 20.0 20.00 20.00 20.00 20.00 Wheat bran 60.0 60.00 60.00 60.00 60.00 Wheat flour 100.0 100.00 100.00 100.00 100.00 Dextrin 70.0 70.00 70.00 70.00 70.00 Corn protein flour 150.0 150.00 150.00 150.00 150.00 Calcium dihydrogen phosphate 30.0 30.00 30.00 30.00 30.00 Compound premix 1% a 10.0 10.00 10.00 10.00 10.00 Lysine 2.0 2.00 2.00 2.00 2.00 Methionine 5.0 5.00 5.00 5.00 5.00 Choline chloride 50% 3.0 3.00 3.00 3.00 3.00 Bacillus velezensis LSG2-5 (CFU/g) 0 10 6 10 7 10 8 10 9 Chemical composition Crude protein 370.0 370.0 370.0 370.0 370.0 Crude lipid 65.6 65.6 65.6 65.6 65.6 Moisture 45.9 45.9 45.9 45.9 45.9 Ash 77.5 77.5 77.5 77.5 77.5 a Compound premix 1%: vitamins and mineral included. Vitamin A (IU/kg) 3600; vitamin D3 (IU/kg) 1200; vitamin E (mg/kg) 20, vitamin K3 (mg/kg) 5; vitamin B1 (mg/kg) 5; vitamin B2 (mg/kg) 7; vitamin B6 (mg/kg) 6; vitamin B12 (ug/kg) 20; calcium pantothenate (mg/kg) 20; nicotinic acid (mg/kg) 30; folic acid (mg/kg) 1.7; biotin (mg/kg) 0.05; VC phosphate (mg/kg) 171.4; in-ositol (mg/kg) 90; Mg (mg/kg) 150; Fe (mg/kg) 120; Zn (mg/kg) 60; Mn (mg/kg) 30; Cu (mg/kg) 4; Co (mg/kg) 0.5; Se (mg/kg) 0.1; I (mg/kg) 1. Table 2 Primer sequences of target gene Target genes Sequences (5′-3′) GenBank number β-actin Forward CGGTATCCATGAGACCACCT AAB97964.1 Reverse CTTCTGCATCCTGTCAGCAA ZO-1 Forward GCGAAATGACACGGGCTAT KY290394 Reverse CTCTGTTGTGGTTGAGTGTAGGC Claudin-3 Forward GCACCAACTGTATCGAGGATG JQ767157.1 Reverse GGTTGTAGAAGTCCCGAATGG APN Forward GCCCAAAACTGTGCAAGAAAT JN088167.1 Reverse CTCTGATGCGTGTCTGGTTTAGT 2.4.4. Total DNA extraction of intestinal contents and 16S rRNA high-throughput sequencing According to the method previously described (Wang, 2017 ), the complete genetic material of the intestine in R. lagowskii Dybowski was removed in compliance with the guidelines of the genomic DNA Extraction Kit (PowerFecal, MOBIO, USA). By using 1% agarose gel electrophoresis, the isolated genomic DNA was found. 16S rRNA was employed to assess the variety of microbes of the contents of the intestine. The designated sequencing area (V3-V4) is used as a guide and the synthesized universal primer sequence with a barcode was 515F: 5'-GTGCCAGCMGCCGCGGTAA-3’; 806R: 5'-GGACTACHVGGGTWTCTAAT-3’. Then PCR amplification was performed. Gene order was performed on the Illumina MiSeq PE300 platform at Beijing Allvegene Gene Technology Co., LTD (Beijing, China). 2.5 Data statistics and analysis All data were expressed as Mean ± standard error (Mean ± SEM). SPSS 22.0 was used for statistical analysis. Tukey’s test was used if there was a remarkable discrepancy between groups, and p < 0.05 was considered a remarkable discrepancy. Intestinal flora was analyzed using the R Foundation for Statistical Computing (Australia) and QIIME 1.8.0 platform. 3. Results 3.1 Digestion and absorption enzymes activity The digestion and absorption enzymes activity in the hepatopancreas and intestines of R. lagowskii Dybowski are shown in Table 3 . In the hepatopancreas, trypsin, lipase, and Na + /K + -ATPase activities in B-7, B-8 and B-9 groups were greater than in the control group (p < 0.05). Relative to the group under control, the activity of amylase was noteworthy greater in the treatment groups (p 0.05), there was a remarkable improvement in γ-GT activity in the B-6 group as compared to the control (p < 0.05). In comparison to the B-6 and control groups, the AKP activity was considerably higher in the B-7, B-8, and control groups (p 0.05). Table 3 Effects of B velezensis LSG2-5 on digestion and absorption enzymes activity of R. lagowskii Dybowski Indexes Groups CK B−6 B−7 B−8 B−9 Trypsase (U/mgprot) H 48.62 ± 0.58 a 50.95 ± 1.43 a 56.32 ± 1.15 b 59.09 ± 0.33 b 57.39 ± 1.21 b PI 56.38 ± 0.37 a 58.09 ± 0.67 ab 59.76 ± 0.95 ab 60.79 ± 1.58 ab 61.85 ± 1.16 b MI 52.40 ± 0.61 a 52.83 ± 0.86 a 56.61 ± 1.24 ab 59.01 ± 1.23 b 58.05 ± 0.87 b DI 47.98 ± 0.67 a 53.18 ± 0.86 b 56.31 ± 1.25 bc 59.85 ± 1.28 c 55.25 ± 0.91 bc Lipase (U/mgprot) H 14.20 ± 0.47 a 14.40 ± 0.43 a 17.18 ± 0.53 b 17.28 ± 0.52 b 17.09 ± 0.27 b PI 22.48 ± 0.36 a 26.09 ± 1.04 b 25.98 ± 0.29 ab 27.74 ± 0.66 b 25.89 ± 1.04 ab MI 17.53 ± 0.48 18.29 ± 0.83 17.61 ± 1.03 20.24 ± 0.43 18.16 ± 0.55 DI 12.92 ± 0.69 a 16.05 ± 0.72 ab 15.89 ± 1.18 ab 16.61 ± 0.60 b 16.09 ± 0.36 ab Amylase (U/mgprot) H 0.68 ± 0.01 a 0.84 ± 0.03 b 0.83 ± 0.04 b 0.91 ± 0.01 b 0.91 ± 0.01 b PI 0.71 ± 0.04 a 0.81 ± 0.03 ab 0.91 ± 0.01 b 0.92 ± 0.02 b 0.91 ± 0.02 b MI 0.60 ± 0.01 0.60 ± 0.02 0.67 ± 0.02 0.66 ± 0.02 0.69 ± 0.02 DI 0.58 ± 0.01 a 0.59 ± 0.01 a 0.60 ± 0.01 a 0.61 ± 0.01 ab 0.65 ± 0.01 b γ-GT (U/gprot) H 17.08 ± 1.25 a 22.34 ± 1.06 b 19.81 ± 0.63 ab 20.88 ± 1.15 ab 18.87 ± 0.98 ab PI 28.30 ± 1.29 a 39.81 ± 1.64 b 40.09 ± 1.91 b 46.37 ± 0.91 b 45.61 ± 1.11 b MI 24.69 ± 2.26 a 33.14 ± 1.06 b 34.64 ± 2.19 b 37.25 ± 1.87 b 44.60 ± 0.63 c DI 18.87 ± 1.78 a 25.74 ± 2.01 b 24.34 ± 0.50 ab 30.50 ± 1.29 b 24.01 ± 0.89 ab Na + ,K + -ATPase (U/mgprot) H 0.38 ± 0.02 a 0.58 ± 0.07 ab 1.12 ± 0.09 c 0.79 ± 0.06 b 0.85 ± 0.07 bc PI 2.72 ± 0.13 a 2.78 ± 0.15 a 3.17 ± 0.09 ab 3.69 ± 0.18 b 2.90 ± 0.18 a MI 2.58 ± 0.09 a 2.70 ± 0.02 ab 4.47 ± 0.22 c 3.14 ± 0.13 ab 3.22 ± 0.11 b DI 1.72 ± 0.09 a 2.02 ± 0.09 a 2.08 ± 0.18 a 3.31 ± 0.23 b 3.33 ± 0.16 b AKP (U/gprot) H 6.58 ± 0.48 a 7.13 ± 0.11 a 9.46 ± 0.37 b 8.87 ± 0.32 b 7.87 ± 0.39 ab PI 26.70 ± 1.11 a 29.28 ± 0.42 a 39.85 ± 1.03 c 42.24 ± 1.10 c 35.26 ± 1.07 b MI 22.98 ± 0.89 a 30.56 ± 0.99 b 35.57 ± 0.41 c 37.66 ± 0.79 c 34.57 ± 0.69 c DI 9.53 ± 0.50 a 13.37 ± 0.75 b 15.06 ± 0.33 b 16.47 ± 1.33 b 21.69 ± 0.61 c While the other three treatment groups showed an increased trend but were not statistically distinguished from the control (p > 0.05), the B-9 group had considerably greater trypsin activity in the proximal intestine than the control (p < 0.05). In comparison with the group under control, a significant increase in lipase activity in B-6 and B-8 groups was found ( p < 0.05). Amylase activity was considerably higher in the B-7, B-8, and B-9 groups in comparison with the control (p 0.05). Treatment groups' γ-GT activity was greater than that of the control group's (p < 0.05). In comparison to the control, B-6, and B-9 groups, the Na+/K+ -ATPase activity was considerably higher in the B-8 group (p < 0.05). AKP activity in B-7, B-8, and B-9 groups was notably greater than that of the other two groups. ( p < 0.05). Trypsin activity in the mid-intestine was substantially higher in the B-8 and B-9 groups than in the control and B-6 group (p 0.05). The activities of γ-GT and AKP reached their greatest levels in the B-9 and B-8 groups, respectively, and were significantly greater in all treatment groups than both in the control group (p > 0.05). The Na + /K + -ATPase activity was considerably increased in the B-7 and B-9 groups in comparison with the control (p < 0.05). In the distal intestine, trypsin and AKP were remarkably elevated in treatment groups related to the control (p < 0.05) and reached the maximum values in B-8 and B-9 groups.The lipase activity in the B-8 group considerably increased (p 0.05). The amylase activity in the B-9 group was noteworthy greater than that in the control, B-6, and B-7 groups (p < 0.05). γ -GT activity in B-6 and B-8 groups was significantly elevated in comparison with the control (p 0.05), and the Na + /K + -ATPase activity in the B-8 and B-9 groups was greater in comparison to the other three groups.(p < 0.05). 3.2 Intestinal morphology In Table 4 . MF height and ML thickness of PI in B-8 and B-9 groups were remarkably increased compared to the control(p 0.05). The ML thickness of PI in B-6 and B-7 groups had an increasing trend but was not significant (p > 0.05). MF width of PI in treatment groups was noteworthy increased (p < 0.05). The LP width of PI in B-6 and B-7 groups, the LP width of MI in the B-7, MI’s MF height and ML thickness in B-7, B-8, and B-9 groups (p < 0.05), and the MF width of MI in B-7 and B-8 groups were conspicuously increased (p 0.05). The MF height of DI in the B-7, B-8, and B-9 groups was significantly increased(p 0.05). The MF width and LP width of DI in the B-8 group were remarkably increased (p 0.05). ML thickness in B-6 and B-7 groups was significantly increased(p 0.05). The mucosal folds of the treated groups were clear and complete in structure, with a thick muscle layer and well-developed mucosal folds without morphological damage (Fig. 2 ). The effects of B. velezensis LSG2-5 on intestinal development indices of R. lagowskii Dybowski. Table 4 Effects of B. velezensis LSG2-5 on Intestinal morphology indexes of R. lagowskii Dybowski Indexes Groups (µm) CK B−6 B−7 B−8 B−9 MF height PI 1099.44 ± 13.45 a 1108.29 ± 7.80 a 1188.78 ± 4.19 a 1178.74 ± 4.97 b 1122.41 ± 3.31 b MI 647.24 ± 9.55 a 695.68 ± 11.58 ab 716.70 ± 8.91 bc 763.80 ± 14.38 c 726.43 ± 7.09 bc DI 640.69 ± 13.99 a 666.73 ± 13.33 a 775.80 ± 8.68 b 786.79 ± 5.12 b 770.59 ± 8.34 b MF width PI 108.81 ± 0.64 a 121.03 ± 0.96 b 120.96 ± 0.84 b 125.72 ± 0.38 c 123.96 ± 1.08 bc MI 113.38 ± 0.98 ab 112.87 ± 0.99 ab 117.32 ± 0.55 bc 121.33 ± 1.37 c 112.25 ± 0.68 a DI 114.55 ± 1.56 a 115.43 ± 1.07 a 116.62 ± 0.90 a 121.57 ± 0.84 b 117.44 ± 0.62 ab LP width PI 21.10 ± 0.71 a 26.34 ± 0.75 b 25.57 ± 1.11 b 22.81 ± 1.06 ab 22.62 ± 0.71 ab MI 13.43 ± 0.60 a 13.58 ± 0.13 a 17.01 ± 0.22 b 15.49 ± 0.81 ab 14.05 ± 0.19 a DI 14.54 ± 0.66 a 13.98 ± 0.56 a 14.72 ± 0.46 a 17.99 ± 0.36 b 13.68 ± 0.72 a ML thickness PI 33.49 ± 0.85 a 34.83 ± 1.35 ab 37.71 ± 0.72 abc 38.29 ± 1.31 bc 40.87 ± 0.52 c MI 24.05 ± 0.41 a 25.44 ± 0.66 a 28.71 ± 0.53 b 32.19 ± 0.22 c 32.14 ± 0.44 c DI 24.94 ± 0.97 a 32.91 ± 0.91 b 30.42 ± 1.20 b 24.66 ± 0.90 a 22.02 ± 1.13 a 3.3 Gene expression The influences of B. velezensis LSG2-5 on the relative expression levels of ZO-1 mRNA, Claudin3 mRNA, APN mRNA, and TOR mRNA in the intestine of R. lagowskii Dybowski are shown in Fig. 3 ~ 5. According to Fig. 3 , the relative expression level of ZO-1 mRNA in the proximal intestine of the B-7, B-8, and B-9 groups was remarkably increased compared with the control group (p 0.05). In the mid and distal intestine of the treatment groups, ZO-1 mRNA expression levels were considerably higher (p < 0.05). Figure 4 shows that the relative expression level of Claudin3 mRNA in the proximal and mid intestine of treatment groups was substantially higher (p < 0.05) in comparison with the control. The relative expression of Claudin3 mRNA in the distal intestine of B-7, B-8, and B-9 groups was conspicuous increased (p < 0.05). According to Fig. 5 , the relative expression level of APN mRNA in the intestine of all treatment groups was remarkably greater in comparison to the control (p 0.05). The relative expression of APN mRNA in the mid intestine showed a growing tendency. The relative expression of APN mRNA in the distal intestine increase initially and decrease afterwards, reaching the peak value in the B-8 group. 3.4 Intestinal flora Alpha diversity is the analysis of species diversity in a single sample. Among them, the Chao1 index and Observed species reflect the richness of the community, and the Shannon index and Phylogenetic diversity (PD) of the whole tree reflect the community’s diversity. The results are shown in Table 5 . In comparison with the control, there were no noteworthy differences in Chao1 index, observed species, PD whole tree, and Shannon index(p > 0.05). However, the Alpha index of intestine microbes revealed a pattern of first increase followed by decrease with the increase of doses of B. velezensis LSG2-5 added to the diet. Table 5 Alpha diversity index of intestinal microbes of R. lagowskii Dybowski Groups Chao1 Observed species PD whole tree Shannon CK 692.17 ± 68.74 497.32 ± 30.72 52.90 ± 4.12 5.08 ± 0.79 B-6 831.18 ± 46.45 685.03 ± 56.17 55.53 ± 3.86 6.05 ± 0.55 B-7 938.57 ± 90.24 575.21 ± 49.57 41.73 ± 5.27 6.18 ± 0.40 B-8 677.04 ± 52.52 473.3 ± 67.31 49.06 ± 5.09 5.37 ± 0.46 B-9 691.42 ± 59.58 453.13 ± 50.02 41.06 ± 5.02 3.92 ± 0.39 The effects of B. velezensis LSG2-5 on microbial community structure in intestinal contents of R. lagowskii Dybowski are shown in Figs. 6 and 7 . At the phylum level (Fig. 6 ), a total of 49 phylum microbes were detected, and the information of the top 10 species with a relative abundance of more than 1% in each OTUs was selected as the representative plot (Others refer to bacteria with a combined abundance of less than 1%). The dominant groups were the Proteobacteria, Firmicutes, Bacteroidetes, Fusobacteria, and Cyanobacteria. In experimental groups, the proportion of Proteobacteria and Firmicutes reached 79.42% ~ 90.24% and Proteobacteria was the absolute dominant group, accounting for 44.36%. In comparison with the control group, a large amount of Proteobacteria increased and then decreased with the increased doses of B. velezensis LSG2-5. The relative abundance of Bacteroidetes, Fusobacteria, Cyanobacteria, and Proteobacteria showed the same trend, while Firmicutes showed the opposite. At the genus level (Fig. 7 ), every treatment group's major bacteria were the same, mainly including Gemmobacter , Bacillus , Flavobacterium , and Aeromonas . The relative abundance of Bacillus was gradually increased with the increasing doses of B. velezensis LSG2-5. The relative abundance of the B-9 group, on the other hand, marginally increased while that of Flavobacterium and Aeromonas gradually dropped. 4. Discussion The development and upgrowth of fish are closely correlation between the ability of gut digestion and assimilation. Bacillus can improve fish digestive enzyme activity in the fish body, promote the production of vitamins and organic acids, and promote fish appetite (Kuebutornye et al., 2019 ). Researches have revealed that adding probiotics to feed is more effective than adding them to water (Ziaei-Nejad et al., 2006 ). The hepatopancreas and intestine both play an essential part in digestion and absorption of fish. Hence, the explore of changes in activities of digestive enzymes in the liver and intestines is an important indicator to verify the promoting or inhibiting role of Bacillus on the digestion and assimilation of fish. Trypsin, amylase, and lipase can enhance the digestion of fish by promoting the catabolism of proteins, lipids, and carbohydrates (Assan et al., 2022 ). γ-GT, Na + -K + -ATPase, and AKP are widely distributed in the brush edge membrane (BBM) of fish’s proximal, mid and distal intestines, enhancing the uptake of nutrients within the fish's intestinal system (Chen, 2019 ). Gomez and Shen (Gómez and Shen, 2008 ) proved that Bacillus could promote protease and amylase activities in Litopenaeus vannamei , and Liu et al. (Liu et al. found similar results. Gao et al. (Gao et al., 2016 ) claimed that B. subtilis can escalate the amylase, lipase, and protease activities of Pampus argenteus . Daboor et al. (Daboor et al., 2010 ) found that the mixture of B. subtilis and Laobacillus Plantarum can promote the actions of amylase, protease, and lipase in Nile tilapia ( Oreochromis niloticus ). In our laboratory, it has proved that B. velezensis LSG2-5 can produce trypsin, amylase, and lipase in vitro (Mahmoud et al., 2023 ). This study verified the outcomes of the above experiments in vivo . The result was that B. velezensis LSG2-5 promoted the digestive and absorption enzyme activities in the hepatopancreas, proximal, mid, and distal intestine of R. lagowskii Dybowski. However, the activity of some enzymes showed a decreasing trend when the dose reached 10 9 CFU/g, which may be due to the high dose destroyed the balance of the flora in the digestive tract of R. lagowskii Dybowski and reduced the ability to secrete digestive and absorbing enzymes. B. velezensis LSG2-5 can secrete exogenous enzymes. Therefore, this study could not determine whether the increased digestive enzyme activity was caused by the host’s increase of endogenous enzyme secretion or the supplement of exogenous enzyme secreted by Bacillus . Future research should delve deeper into this process. In addition to the activity of digestion and absorption enzymes, intestinal tissue integrity is also one of the factors impacting the digestive capabilities of fish. It is also crucial to maintain the growth and wellbeing of fish intestines. Research has revealed that Bacillus can promote intestinal mucosa development in animals (Ruiz Sella et al., 2021 ). The intestinal mucosa is essential to enable fish to process and assimilate nutrients and for intestinal microorganisms to adhere to it (Yang et al., 2021 ). Simultaneously, the muscular layer of the intestinal tract powers peristalsis and promotes the intestinal absorption of nutrients (He et al., 2022 ). Therefore, the changes in the mucosal and muscular layers of fish intestines can directly demonstrate the role of probiotic Bacillus subtilis in the intestines. Bacillus plays a role in R. lagowskii Dybowski's intestinal. Research has revealed the presence of lactic acid bacteria could improve the intestinal muscle thickness and mucosal fold height width of Channa argus (Kong et al., 2021 ). The research indicated that B. velezensis LSG2-5 supplementation increased the mucosal fold height, mucosal fold width, lamina propria width, and muscle layer thickness of the intestinal tract of R. lagowskii Dybowski. The findings imply that B. velezensis can promote the intestinal development and health of R. lagowskii Dybowski. Echoing the findings of this research, B. licheniformis can improve intestinal villi height and accelerate the development of intestinal villi in typical carp ( Cyprinus carpio L.) (Zhang et al., 2021 ). The addition of B. licheniformis and mixed bacteria can enhance the villus height of C. auratus var. Pengze, while the addition of B. coagulans alone, does not change the villus height of C. auratus var. Pengze (Luo et al., 2021 ). It could be brought on by various bacterial species, different dosages, different types of fish, and different body weights. The permeability of tight connections between cells primarily determines the protective role played by intestinal epithelial cells in fish, controlled by multiple tight junctions (Yang et al., 2021 ). Therefore, tight junction protein expression can reflect the role of the intestinal barrier, and tight junction protein expression has increased, suggesting gut barrier permeability has decreased. (Jiang et al., 2020 ). Zonula occludens (ZO) are the basis of a tight junction supporting structure. Claudins are a part of the paracellular diffusion barriers and represent the tight junction family. It was found that B. licheniformis increased the intestinal ZO-1 mRNA expression levels and increased the intestinal barrier function of grass carp ( Ctenopharyngodon Idella ) (Qin et al., 2020 ). Reports have also surfaced stating that B. cereus and B. subtilis significantly upregulated the expression level of ZO-1 mRNA in the mid intestine of grass carp (Xue et al., 2020 ). Kong et al. (Kong et al., 2021 ) found that Lactococcus lactis, Lactobacillus Plantarum, and Enterococcus faecalis significantly upregulated the intestinal ZO-1 and Claudin-3 mRNA expression levels of C. argus. The findings of this research align closely with the outcomes of previous studies, B. velezensis LSG2-5 has the potential to elevate the comparative expression levels of ZO-1 and Claudin-3 mRNA in the intestine of R. lagowskii Dybowski. The findings indicate that B. velezensis , extracted from R. lagowskii Dybowski's intestinal tract, has the ability to control intestinal barrier activity through the modulation of tight junction protein gene expression. Aminopeptidase N (APN), belonging to the M1 peptidase family, is crucial for the digestion of proteins. APN is an enzyme found extensively in extracellular environments across various tissues, organs, and cells. Studies have shown that the expression levels of APN in grass carp are different day and night, possibly owing to the varying degrees of thyrotropin-releasing hormone (Tang et al., 2016 ). This study showed that B. velezensis LSG2-5 upregulated the relative expression of APN mRNA in the intestine of R. lagowskii Dybowski and then regulated the digestive function of R. lagowskii Dybowski. Fish's substantial intestinal microbial population is crucial for the function of intestinal barriers, nutrient processing, and immune response. This is intimately connected to the health of the host (Chen et al., 2021 , Zhang et al., 2021 ). Generally, the microflora in the fish intestine is in a dynamic equilibrium state of mutual restriction and interdependence, maintaining the normal physiological functions of the host (Liu et al., 2021 ). Intestinal flora may be affected by ambient environment and nutrition, and it forms a symbiotic relationship with the host, providing nutrition while regulating the intestinal micro ecological balance and promoting the host’s metabolism (Liu et al., 2021 ). This study covered almost all the microbes in the intestinal tract of R. lagowskii Dybowski, and the diversity of the microbial community remained largely unchanged. Studies have shown that Proteobacteria, Bacteroidetes, Firmicutes, Actinobacteria, and Fusobacteria are the dominant phyla in the intestinal flora of R. lagowskii Dybowski (Zhao et al., 2020 ). The results showed that at the phylum level, Proteobacteria, Firmicutes, Bacteroidetes, Fusobacteria, and Cyanobacteria were the dominant phyla in the intestinal microflora of R. lagowskii Dybowski at the phylum level. Concurrently, the discovery of Actinobacteria, albeit in small quantities, aligned with findings from earlier research. The above dominant flora has been detected in different degrees in Salmo salar (Wang, 2017 ), C. auratus gibelio (Wu et al., 2013 ), Siniperca chuatsi (Chen et al., 2021 ), C. idellus (Han et al., 2010 )d niloticus (Adeoye et al., 2016 ). Proteobacteria generally exist in the intestine of fish. A small amount of Proteobacteria cannot impact the intestinal microecological balance; however, a large amount of Proteobacteria affects the dynamic balance of microbes in the intestinE, increasing the risk of fish disease (Shin et al., 2015 ). As a vital role in fish digestion and absorption, Firmicutes provide a variety of enzymes to facilitate cellulose breakdown and polysaccharide fermentation (Zhao et al., 2020 , Zhang et al., 2021 ). Bacteroidetes and Fusobacteria are common bacteria in the intestine of fish as the primary bacteria in the intestine and they possess a mutualistic bond with the fish's intestinal tract (Burgos et al., 2018 , Tran et al., 2018 ). Throughout this research, the abundance of Proteobacteria, Bacteroides, and Fusobacteria in the intestine of R. lagowskii Dybowski increased first and then decreased with the augment of the dosages of B. velezensis LSG2-5. The abundance of Proteobacteria, Bacteroides, and Fusobacteria in the intestine of R. lagowskii Dybowski was the highest at 10 6 CFU/g and gradually decreased. Concurrently, there was an initial decline in the relative prevalence of Firmicutes, followed by a steady rise. These outcomes suggested that B. velezensis LSG2-5 decreased the abundance of Proteobacteria, Bacteroides, and Fusobacteria in the intestine of R. lagowskii Dybowski, and increased the abundance of Firmicutes. Cyanobacteria, rich in protein, carotenoids, and vitamins, are the dominant flora in the intestinal tract of fish and play a certain part in supplementing host nutrition and improving host immunity (Wang, 2017 ). In the study of Litopenaeus vannamei , Bacillus can decompose organic matter into inorganic matter, while the inorganic matter is easier to be utilized by microalgae. This process promotes the reproduction of microalgae in the aquatic environment (de Paiva-Maia et al., 2013 ). Cyanobacteria in the intestine of R. lagowskii Dybowski proves that the addition of Bacillus to the diet can promote the growth of microalgae in water and make Cyanobacteria the dominant flora. In Aeromonas , strains with virulence factors are pathogenic to fish (Muduli et al., 2021 ). Flavobacterium is related to bacterial rotten gill disease in fish (Good et al., 2015 ). At the genus level, Aeromonas and Flavobacterium decreased firstly and then increased with the increase of B. velezensis LSG2-5, suggesting that the decrease in the abundance of pathogenic bacteria in the intestine was related to the dose of B. velezensis LSG2-5. The diet supplemented with 10 8 CFU/g B. velezensis LSG2-5 had the lowest abundance in Aeromonas and Flavobacterium . The abundance of Bacillus increased and then decreased, reaching the maximum value in the B-8 group. It can be inferred that Bacillus had a better colonization ability in the intestine of R. lagowskii Dybowski when the dose of B. velezensis LSG2-5 reached 10 8 CFU. Zhang et al. (Zhang et al., 2019 ) found that dietary supplementation of 10 9 CFU/g B. velezensis had no significant effect on the diversity of intestinal microflora of O. niloticus but reduced the abundance of opportunistic pathogens, which paralleled the findings of this research. This research suggests that B. velezensis may regulate the microecological balance of the intestinal flora of R. lagowskii Dybowski. However, whether B. velezensis LSG2-5 can stabilize the intestinal flora of freshwater fish and the mechanism governing it requires additional investigation. 5. Conclusion In conclusion, dietary supplementation with 10 7 ~10 9 CFU/g of B. velezensis LSG2-5 can promote the activity of digestive and absorbing enzymes and regulate the relative expression level of APN mRNA in the intestine and hepatopancreas of R. lagowskii Dybowski. In addition, it can improve intestinal morphology, regulate the mRNA relative expression of intestinal tight connection protein ZO-1 and Claudin-3 , and improve the dynamic balance of intestinal flora to regulate the intestinal health of R. lagowskii Dybowski. Declarations Ethical approval All the experimental animals used in the study were performed following the National Institutes of Health Guide for the Care and Use of Laboratory Animals and approved by the Institutional Animal Care and Use Committee of Jilin Agricultural University (Organization number: 20200919007). Competing interests The authors report no declarations of interest. Authors' contributions Shaohua Li, Yu-rou Zhang and Li-li Lin contributed methods, investigation, validation, formal analysis and writing of the study. Zhi-xin Guo and Yuke Chen funded and designed the study, and revised the manuscript. Wen-li Zhu, Dan Jiang, Yuxin Li and Sibu Wang contributed significantly to analysis. Qiuju Wang and Yu-ke Chen performed supervision and verification of the study. Dong-ming Zhang, Tian-yi Zhang and Zhixin Guo helped perform the analysis with constructive discussions. Funding This work was supported by the Jilin Provincial Science and Technology Department (20220202065NC and 20210404024NC) . Availability of data and materials The data that support the findings of this study are openly available. References Adeoye, A.A., Jaramillo-Torres, A., Fox, S.W., Merrifield, D.L. & Davies, S.J. (2016) Supplementation of formulated diets for tilapia ( Oreochromis niloticus ) with selected exogenous enzymes: Overall performance and effects on intestinal histology and microbiota. Animal Feed Science & Technology, 215, 133-143. Assan, D., Kuebutornye, F.K.A., Hlordzi, V., Chen, H., Mraz, J., Mustapha, UF & Abarike, E.D. (2022) Effects of probiotics on digestive enzymes of fish (finfish and shellfish); status and prospects: a mini review. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 257, 110653. Beukema, M., Faas, M.M. & de Vos, P. (2020) The effects of different dietary fiber pectin structures on the gastrointestinal immune barrier: impact via gut microbiota and direct effects on immune cells. Experimental & Molecular Medicine, 52 (9), 1364-1376. Burgos, M.J.G., Romero, J.L., Pulido, R.P., Molinos, A.C., Gálvez, A. & Lucas, R. (2018) Analysis of potential risks from the bacterial communities associated with air-contact surfaces from tilapia ( Oreochromis niloticus ) fish farming. Environmental research, 160, 385-390. Chen, X., Wang, Q., Guo, Z., Zhao, Y., Gao, Y., Yu, T., Chen, Y., Zhang, D. & Wang, G. (2019) Effects of dietary oxidized fish oil on growth performance and antioxidant defense mechanism of juvenile Rhynchocypris lagowski Dybowski. Aquaculture, 512, 734368. Chen, X., Yi, H., Liu, S., Zhang, Y., Su, Y., Liu, X., Bi, S., Lai, H., Zeng, Z. & Li, G. (2021) Promotion of pellet-feed feeding in mandarin fish ( Siniperca chuatsi ) by Bdellovibrio bacteriovorus is influenced by immune and intestinal flora. Aquaculture, 542, 736864. Chen, Y. K. (2019) The study on regulation of L-carnitine supplementation on fatty acid metabolism by AMPKα-ACC-CPT signaling pathways in fish. Ph.D., Jilin Agricultural University. Daboor, M., Esmael, N.A. & Lall, S.P. (2010) Effect of different dietary probiotics on growth, feed utilization and digestive enzymes activities of Nile Tilapia, Oreochromis niloticus Mohamed A Essa1, Sabry S EL-Serafy2, Magda M El-Ezabi2, Said. Dawood, M.A., Koshio, S., Abdel Daim, MM & Van Doan, H. (2019) Probiotic application for sustainable aquaculture. Reviews in Aquaculture, 11 (3), 907-924. de Paiva-Maia, E., Alves-Modesto, G., Otavio-Brito, L., Olivera, A. & Vasconcelos-Gesteira, T.C. (2013) Efecto de un probiótico comercial sobre la concentración de bacterias y fitoplancton en cultivo de camarón ( Litopenaeus vannamei ) con sistemas de recirculación. Latin american journal of aquatic research, 41 (1), 126-137. Gao, Q., Xiao, C., Min, M., Zhang, C., Peng, S. & Shi, Z. (2016) Effects of probiotics dietary supplementation on growth performance, innate immunity and digestive enzymes of silver pomfret, Pampus argenteus . Indian Journal of Animal Research, 50 (6), 936-941. Gómez, R.G.D. & Shen, M.A. (2008) Influence of probiotics on the growth and digestive enzyme activity of white Pacific shrimp ( Litopenaeus vannamei ). Journal of Ocean University of China, 7 (2), 215-218. Good, C., Davidson, J., Wiens, G.D., Welch, T.J. & Summerfelt, S. (2015) Flavobacterium branchiophilum and F. succinicans associated with bacterial gill disease in rainbow trout Oncorhynchus mykiss (Walbaum) in water recirculation aquaculture systems. Journal of fish diseases, 38 (4), 409. Han, S., Liu, Y., Zhou, Z., He, S., Cao, Y., Shi, P., Yao, B. & E, R. (2010) Analysis of bacterial diversity in the intestine of grass carp ( Ctenopharyngodon idellus ) based on 16S rDNA gene sequences. Aquaculture Research, 42 (1), 47-56. He, G., Sun, H., Liao, R., Wei, Y., Zhang, T., Chen, Y. & Lin, S. (2022) Effects of herbal extracts ( Foeniculum vulgare and Artemisia annua ) on growth, liver antioxidant capacity, intestinal morphology and microorganism of juvenile largemouth bass, Micropterus salmoides . Aquaculture Reports, 23, 101081. Islam, S.M., Rohani, MF & Shahjahan, M. (2021) Probiotic yeast enhances growth performance of Nile tilapia ( Oreochromis niloticus ) through morphological modifications of intestine. Aquaculture Reports, 21, 100800. Jahan, N., Islam, S.M., Rohani, M.F., Hossain, M.T. & Shahjahan, M. (2021) Probiotic yeast enhances growth performance of rohu ( Labeo rohita ) through upgrading hematology, and intestinal microbiota and morphology. Aquaculture, 545, 737243. Jiang, Y., Zhou, S., Sarkodie, EK & Chu, W. (2020) The effects of Bacillus cereus QSI-1 on intestinal barrier function and mucosal gene transcription in Crucian carp ( Carassius auratus gibelio ). Aquaculture Reports, 17, 100356. Kong, W., Huang, C., Tang, Y., Zhang, D., Wu, Z. & Chen, X. (2017) Effect of Bacillus subtilis on Aeromonas hydrophila-induced intestinal mucosal barrier function damage and inflammation in grass carp ( Ctenopharyngodon idella ). Scientific Reports , 7(1), 1-11. Kong, Y., Li, M., Chu, G., Liu, H., Shan, X., Wang, G. & Han, G. (2021) The positive effects of single or conjoint administration of lactic acid bacteria on Channa argus : digestive enzyme activity, antioxidant capacity, intestinal microbiota and morphology. Aquaculture, 531, 735852. Kong, Y., Tian, J. & Wang, G. (2021) Effects of three kinds of lactic acid bacteria on growth, antioxidant and immune functions of Channa argus. Journal of Fisheries of China, 45, 1764-1774. Kuebutornye, F.K.A., Abarike, E.D. & Lu, Y. (2019) A review on the application of Bacillus as probiotics in aquaculture. Fish & Shellfish Immunology, 87, 820-828. Langlois, L., Akhtar, N., Tam, K.C., Dixon, B. & Reid, G. (2021) Fishing for the right probiotic: Host-microbe interactions at the interface of effective aquaculture strategies. FEMS Microbiology Reviews , 45(6), fuab030. Li, L., Zhu, R. & Li, M. (2020) Effects of β-conglycinin on growth performance, antioxidant capacity and Immunity in Rhynchocypris lagowski Dybowski. Aquaculture Nutrition, 26 (6), 2059-2073. Li, M., Kong, YD, Li, L., Zhu, R. & Wu, L.F. (2021) Effects of dietary carbohydrate sources on growth performance, immunity and glycometabolic enzyme activity of Rhynchocypris lagowskii Dybowski. Aquaculture Research, 52 (1), 323-333. Liu, C., Zhao, L. & Shen, Y. (2021) A systematic review of advances in intestinal microflora of fish. Fish Physiology and Biochemistry, 47 (6), 2041-2053. Liu, C.H., Chiu, C.S., Ho, PL & Wang, S.W. (2009) Improvement in the growth performance of white shrimp, Litopenaeus vannamei, by a protease-producing probiotic, Bacillus subtilis E20, from natto. Journal of applied microbiology, 107 (3), 1031-1041. Luo, S., Jiang, Y., Zhao, Y., Zhang, H. & Zhang, X. (2021) Effects of different Bacillus sp. on growth performance, muscle nutrient composition, intestinal structure and digestive enzyme activities of Pengze. China Feed, 13, 73-79. Meng, X., Wu, S., Hu, W., Zhu, Z., Yang, G., Zhang, Y., Qin, C., Yang, L. & Nie, G. (2021) Clostridium butyricum improves immune responses and remodels the intestinal microbiota of common carp ( Cyprinus carpio L.). Aquaculture, 530, 735753. Muduli, C., Tripathi, G., Paniprasad, K., Kumar, K., Singh, R.K. & Rathore, G. (2021) Virulence potential of Aeromonas hydrophila isolated from apparently healthy freshwater food fish. Biologia, 76 (3), 1005-1015. Nimalan, N., Sørensen, S.L., Fečkaninová, A., Koščová, J., Mudroňová, D., Gancarčíková, S., Vatsos, I.N., Bisa, S., Kiron, V. & Sørensen, M. (2022) Mucosal barrier status in Atlantic salmon fed marine or plant-based diets supplemented with probiotics. Aquaculture, 547, 737516. Qin, L., Xiang, J., Xiong, F., Wang, G., Zou, H., Li, W., Li, M. & Wu, S. (2020) Effects of Bacillus licheniformis on the growth, antioxidant capacity, intestinal barrier and disease resistance of grass carp ( Ctenopharyngodon idella ). Fish & shellfish immunology, 97, 344-350. Ringø, E., Van Doan, H., Lee, S.H., Soltani, M., Hoseinifar, S.H., Harikrishnan, R. & Song, SK (2020) Probiotics, lactic acid bacteria and bacilli: interesting supplementation for aquaculture. Journal of applied microbiology, 129 (1), 116-136. Ruiz Sella, S.R., Bueno, T., de Oliveira, A.A., Karp, S.G. & Soccol, C.R. (2021) Bacillus subtilis natto as a potential probiotic in animal nutrition. Critical Reviews in Biotechnology, 41 (3), 355-369. Shin, N.R., Whon, T.W. & Bae, J.W. (2015) Proteobacteria: microbial signature of dysbiosis in gut microbiota. Trends in Biotechnology, 33(9), 496-503. Simon, R., Docando, F., Nuñez-Ortiz, N., Tafalla, C. & Díaz-Rosales, P. (2021) Mechanisms used by probiotics to confer pathogen resistance to teleost fish. Frontiers in Immunology, 12. Sundh, H., Finne-Fridell, F., Ellis, T., Taranger, G.L., Niklasson, L., Pettersen, E.F., Wergeland, H.I. & Sundell, K. (2019) Reduced water quality associated with higher stocking density disturbs the intestinal barrier functions of Atlantic salmon ( Salmo salar L.). Aquaculture, 512, 734356. Tang, J., Qu, F., Tang, X., Zhao, Q., Wang, Y., Zhou, Y., Feng, J., Lu, S., Hou, D. & Liu, Z. (2016) Molecular characterization and dietary regulation of aminopeptidase N (APN) in the grass carp ( Ctenopharyngodon idella ). Gene, 582 (1), 77-84. Tran, N.T., Xiong, F., Hao, Y., Zhang, J., Wu, S. & Wang, G. (2018) Starvation influences the microbiota assembly and expression of immunity-related genes in the intestine of grass carp ( Ctenopharyngodon idellus ). Aquaculture, 489, 121-129. Wang, C. (2017) Effects of Bacillus velezensis V4 and Rhodotorula mucilaginosa on the growth, immune response and gut microbiota of Salmons and Trouts. Ph.D., Institute of Oceanology, Chinese Academy of Sciences. Wang, C., Chuprom, J., Wang, Y. & Fu, L. (2020) Beneficial bacteria for aquaculture: nutrition, bacteriostasis and immunoregulation. Journal of Applied Microbiology, 128 (1), 28-40. Wang, X., Zhang, P. & Zhang, X. (2021) Probiotics regulate gut microbiota: an effective method to improve immunity. Molecules, 26 (19), 6076. Wu, S.G., Tian, J.Y., Gatesoupe, F.J., Li, W.X., Zou, H., Yang, B.J. & Wang, G.T. (2013) Intestinal microbiota of gibel carp ( Carassius auratus gibelio ) and its origin as revealed by 454 pyrosequencing. World J Microbiol Biotechnol, 29 (9), 1585-1595. Mahmoud M. Elsadek, Wang, S. B. & Wu, Z. C. (2023) Characterization of Bacillus spp. isolated from the intestines of Rhynchocypris lagowskii as a potential probiotic and their effects on fish pathogens. Microbial Pathogenesis, 180,106163 Xue, J., Shen, K., Hu, Y., Hu, Y., Kumar, V., Yang, G. & Wen, C. (2020) Effects of dietary Bacillus cereus , B. subtilis , Paracoccus marcusii , and Lactobacillus plantarum supplementation on the growth, immune response, antioxidant capacity, and intestinal health of juvenile grass carp ( Ctenopharyngodon idellus ). Aquaculture Reports, 17, 100387. Yang, E.J., Zhang, J.D., Yang, L.T., Amenyogbe, E., Wang, W.Z., Huang, J.S. & Chen, G. (2021) Effects of hypoxia stress on digestive enzyme activities, intestinal structure and the expression of tight junction proteins coding genes in juvenile cobia ( Rachycentron canadum ). Aquaculture Research, 52, 5630-5641. Yang, G., Shen, K., Yu, R., Wu, Q., Yan, Q., Chen, W., Ding, L., Kumar, V., Wen, C. & Peng, M. (2020) Probiotic ( Bacillus cereus ) enhanced growth of Pengze crucian carp concurrent with modulating the antioxidant defense response and exerting beneficial impacts on inflammatory response via Nrf2 activation. Aquaculture, 529, 735691. Yang, P., Hu, H., Li, Y., Ai, Q., Zhang, W., Zhang, Y. & Mai, K. (2019) Effect of dietary xylan on immune response, tight junction protein expression and bacterial community in the intestine of juvenile turbot ( Scophthalmus maximus L.). Aquaculture, 512, 734361. Yu, T., Chen, Y., Chen, X., Abdallah, G., Guo, Z., Zhao, Y., Wang, Q. & Zhang, D. (2020) The effect of oxidized fish oil on lipid metabolism in Rhynchocypris lagowski Dybowski. Aquaculture Reports, 17, 100388. Yu, T., Wang, Q.J., Chen, X.M., Chen, Y.K., Ghonimy, A., Zhang, D.M. & Wang, G.Q. (2020) Effect of dietary L-carnitine supplementation on growth performance and lipid metabolism in Rhynchocypris lagowski Dybowski fed oxidized fish oil. Aquaculture Research, 51, 3698-3710. Zhang, D., Gao, Y., Ke, X., Yi, M., Liu, Z., Han, X., Shi, C. & Lu, M. (2019) Bacillus velezensis LF01: in vitro antimicrobial activity against fish pathogens, growth performance enhancement, and disease resistance against streptococcosis in Nile tilapia ( Oreochromis niloticus ). Applied Microbiology and Biotechnology, 103 (21), 9023-9035. Zhang, D., Guo, Z., Zhao, Y., Wang, Q. & Gao, Y. (2019) L-carnitine regulated Nrf2/Keap1 activation in vitro and in vivo and protected oxidized fish oil-induced inflammation response by inhibiting the NF-κB signaling pathway in Rhynchocypris lagowski Dybowski. Fish & shellfish immunology, 93, 1100-1110. Zhang, J., Huang, M., Feng, J., Chen, Y., Li, M. & Chang, X. (2021) Effects of dietary Bacillus licheniformis on growth performance, intestinal morphology, intestinal microbiome, and disease resistance in common carp ( Cyprinus carpio L.). Aquaculture International, 29 (3), 1343-1358. Zhang, W., Tan, B., Deng, J., Dong, X., Yang, Q., Chi, S., Liu, H., Zhang, S., Xie, S. & Zhang, H. (2021) Effects of high level of fermented soybean meal substitution for fish meal on the growth, enzyme activity, intestinal structure protein and immune-related gene expression and intestinal flora in juvenile pearl gentian grouper. Aquaculture Nutrition, 27(5), 1433-1447. Zhang, Y., Yu, M., Lin, L., Wang, J., Zhang, D., Wang, Q., Elsadek, M.M., Wang, G., Yao, Q. & Chen, Y. (2022) Effects of Dietary Bacillus velezensis LSG2-5 on Growth, Immunity, Antioxidant Capacity, and Disease Resistance of Amur minnow ( Rhynchocypris lagowskii Dybowski). Aquaculture Nutrition, 2022. Zhao, Y., Ye, H., Wang, J., Yu, T. & Zhang, D., (2020) Effects of fermented feed on growth, immunity, antioxidant capacity and intestinal microflora of Phoxinus lagowskii Dybowski. Chinese Journal of Animal Science, 56, 172-176. Zhu, R., Li, L., Li, M., Yu, Z., Wang, H., Quan, Y. & Wu, L. (2021) Effects of dietary glycinin on the growth performance, immunity, hepatopancreas and intestinal health of juvenile Rhynchocypris lagowskii Dybowski. Aquaculture, 544, 737030. Ziaei-Nejad, S., Rezaei, M.H., Takami, G.A., Lovett, D.L., Mirvaghefi, A. & Shakouri, M. (2006) The effect of Bacillus spp. bacteria used as probiotics on digestive enzyme activity, survival and growth in the Indian white shrimp Fenneropenaeus indicus . Aquaculture, 252, 516-524. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4133761","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":283249497,"identity":"8dc61b34-bea6-44f1-ac26-3923931a9651","order_by":0,"name":"Shao-hua Li","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Shao-hua","middleName":"","lastName":"Li","suffix":""},{"id":283249498,"identity":"81e4906c-733b-422e-bc3d-714d04a6caca","order_by":1,"name":"Yu-rou Zhang","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yu-rou","middleName":"","lastName":"Zhang","suffix":""},{"id":283249499,"identity":"ff3fd405-65db-42df-ace9-c1968a120d8e","order_by":2,"name":"Li-li Lin","email":"","orcid":"","institution":"Fisheries Technology Promotion Station of Jilin Province","correspondingAuthor":false,"prefix":"","firstName":"Li-li","middleName":"","lastName":"Lin","suffix":""},{"id":283249500,"identity":"4b9a47bf-3090-4010-9908-e592cb47aab2","order_by":3,"name":"Dong-ming Zhang","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Dong-ming","middleName":"","lastName":"Zhang","suffix":""},{"id":283249501,"identity":"68ee95c6-b4f0-4fbd-b2ee-b4a00f60925a","order_by":4,"name":"Tian-yi Zhang","email":"","orcid":"","institution":"Jilin Provincial Water Conservancy Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Tian-yi","middleName":"","lastName":"Zhang","suffix":""},{"id":283249502,"identity":"4e694899-45ad-45f8-94b5-d93d4c2c10e8","order_by":5,"name":"Wen-li Zhu","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Wen-li","middleName":"","lastName":"Zhu","suffix":""},{"id":283249503,"identity":"4fcad157-7105-4986-a3a3-aa7ecd503bed","order_by":6,"name":"Dan Jiang","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Dan","middleName":"","lastName":"Jiang","suffix":""},{"id":283249504,"identity":"42e239d1-1270-471d-ba92-e7a8a9580596","order_by":7,"name":"Yuxin Li","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yuxin","middleName":"","lastName":"Li","suffix":""},{"id":283249505,"identity":"cc7adadd-7b12-4836-9939-7fb9bbc3edf1","order_by":8,"name":"Sibu Wang","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Sibu","middleName":"","lastName":"Wang","suffix":""},{"id":283249506,"identity":"69e5f90f-c22c-49cd-b4c2-57800c3ffb51","order_by":9,"name":"Xin Wang","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Wang","suffix":""},{"id":283249507,"identity":"2fa27618-9948-4ab6-b732-5b6c6814ede2","order_by":10,"name":"Qiu-ju Wang","email":"","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Qiu-ju","middleName":"","lastName":"Wang","suffix":""},{"id":283249508,"identity":"6a6e2e21-ffcb-4cdd-bb01-486987b012cb","order_by":11,"name":"Yu-ke Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAx0lEQVRIiWNgGAWjYFACNiCuYJMBs3mI13KGjYdELYxtDCRoMbiRlvjg5zw+Hv4ZCYwP3rYxyJsToeWwYe82Nh6JGwnMhnPbGAx3NhDUkt4mzQjUwnAjgU2at40hweAAYS3tvxnnsPHI30hg/02klrRjzIwNbDwGQFuYidIieeZZsmTPMTYewzMPmyXnnJMw3EBIC9/xNMMPP2qOyckdTz744U2ZjTxBWxQgCo4BMWMDkJAgoB4I5BvAVA1hlaNgFIyCUTByAQCOQT0mgMqm2gAAAABJRU5ErkJggg==","orcid":"","institution":"Jilin Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Yu-ke","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2024-03-20 03:14:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4133761/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4133761/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":53458315,"identity":"420a31f3-7b3d-45b9-90a7-e81f210436bd","added_by":"auto","created_at":"2024-03-26 08:30:49","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":201873,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFIGURE 1.1\u003c/strong\u003e The total RNA of proximal intestine\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4133761/v1/3a3e5074c1da3aae22965eb7.png"},{"id":53458321,"identity":"af99a59c-83f9-4c56-931d-d9a861692541","added_by":"auto","created_at":"2024-03-26 08:30:51","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":108961,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFIGURE 1.2\u003c/strong\u003e The total RNA of mid intestine\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4133761/v1/fa33db98b851d9edbda8e5d5.png"},{"id":53458320,"identity":"f65a35d4-9828-4ac7-a2f4-f2d81632e811","added_by":"auto","created_at":"2024-03-26 08:30:50","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":133319,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFIGURE 1.3\u003c/strong\u003e The total RNA of distal intestine\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4133761/v1/0e04f4ac1eef345e2ee6e8af.png"},{"id":53458316,"identity":"f803618a-8ebe-4016-b3c6-1eab9923b1d5","added_by":"auto","created_at":"2024-03-26 08:30:49","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1749224,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFIGURE 2 \u003c/strong\u003e\u0026nbsp;Mid intestinal morphology of \u003cem\u003eR. lagowskii \u003c/em\u003eDybowski\u003cem\u003e \u003c/em\u003efed \u003cem\u003eB. velezensis \u003c/em\u003eLSG2-5 \u003cem\u003eNote\u003c/em\u003e: A: control group; B: B-6 group; C: B-7 group; D: B-8 group; E: B-9 group.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-4133761/v1/5ba10f2b4cfe19c92ad72cfe.png"},{"id":53458317,"identity":"1443333b-2f6e-4c0d-b51d-c183968f3646","added_by":"auto","created_at":"2024-03-26 08:30:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":156844,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFIGURE 3\u003c/strong\u003e Effects of \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 on the relative expression of ZO-1 mRNA in intestine of \u003cem\u003eR. lagowskii \u003c/em\u003eDybowski\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eNote\u003c/em\u003e: (a): proximal intestine; (b): mid intestine; (c): distal intestine. Different letters indicate significant difference (\u003cem\u003ep \u0026lt;\u003c/em\u003e .05). The picture below is the same.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-4133761/v1/571505316314e74d7f1ce7df.png"},{"id":53458318,"identity":"8b8bb56a-c1d1-4636-83d6-47f0ae33b8e4","added_by":"auto","created_at":"2024-03-26 08:30:49","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":153365,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFIGURE 4\u003c/strong\u003e Effects of \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 on the relative expression of Claudin3 mRNA in intestine of \u003cem\u003eR. lagowskii \u003c/em\u003eDybowski\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-4133761/v1/4fd427453dca3028a3bdc0ee.png"},{"id":53458297,"identity":"18bab0d5-dac0-4d9c-b255-be46795e1cae","added_by":"auto","created_at":"2024-03-26 08:30:46","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":351981,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFIGURE 5\u003c/strong\u003e Effects of \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 on the relative expression of APN mRNA in intestine of \u003cem\u003eR. lagowskii \u003c/em\u003eDybowski\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-4133761/v1/91a7e2177de0aeb1e684b1e7.png"},{"id":53458298,"identity":"42943d8f-c1a0-45a3-ace6-7ca3099992f6","added_by":"auto","created_at":"2024-03-26 08:30:46","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":113084,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFIGURE 6\u003c/strong\u003e Relative abundance of gut microbial community composition of \u003cem\u003eR. lagowskii \u003c/em\u003eDybowski at phylum level\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-4133761/v1/c516592fe92ba69aefa4343e.png"},{"id":53458314,"identity":"e17a2993-04f5-4a46-be2f-51b138500415","added_by":"auto","created_at":"2024-03-26 08:30:48","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":122978,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFIGURE 7\u003c/strong\u003e Relative abundance of gut microbial community composition of \u003cem\u003eR. lagowskii \u003c/em\u003eDybowski at genus level\u003c/p\u003e","description":"","filename":"floatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-4133761/v1/f6661e698c28d88a3cd2caa4.png"},{"id":54782257,"identity":"99d6c451-cc9a-43d0-8256-05dd9e35b970","added_by":"auto","created_at":"2024-04-16 17:08:00","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2800195,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4133761/v1/0dfff46a-3732-44c2-a199-7be04a01638d.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Effects of dietary Bacillus velezensis LSG2-5 on digestion, intestinal morphology, microflora, and related gene expression in Rhynchocypris lagowskii Dybowski","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAn essential organ for fish digestion, absorption, and immune system performance is the gut. The growth and development of fish depend heavily on the health of their intestines. The lumen contains many antigens from ingested food, water, local microbes, or pathogens (Sundh et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The intestine's main job is to consume down foods and absorb nutrition. Enzyme activity during digestion and absorption serves as a useful indicator directly reflecting the fish's growth rate and regulating metabolism(Ring\u0026oslash; et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Yang et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Simultaneously, the intestinal cavity and the body\u0026rsquo;s internal environment are separated by the intestinal barrier, which regulates and maintains the digestive system's function and the stability of intestinal environment (Beukema et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The tangible obstacle of the enteric canal comprises intestinal epithelial cells in its majority. and tight junctions between cells (Yang et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Absorbing cells, goblet cells, and paint cells make up the majority of intestinal epithelial cells. (Wang et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Tight junction complexes are composed of tight junction, adhesion junction, and desmosome (Langlois et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), among which several proteins, including zonula occludens (ZO), junctional adhesion molecules (JAM), occludin, and claudins, make up tight junctions. (Langlois et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Epithelial cells are essential in the mucosal immunity of fish, and their parclose effect is principally hinge on the degree of permeability of tight junctions between cells. So the role of tight junctions is crucial (Yang et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Furthermore, the stability of intestinal morphology and important signals of intestine wellness include the balance of gut flora. (Jahan et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The intestinal mucosa interacts with the flora to maintain a dynamic equilibrium in the intestine (Dawood et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Ring\u0026oslash; et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The bacterial community is disturbed when the infiltration of ions disrupts barrier functions, and small molecules increases or many pathogens enter, causing inflammation or infection in the gut and posing a threat to fish health (Kong et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Probiotics added to feed bring health benefits to fish by providing nutrients, improving the way that digestive and absorbent enzymes function, controlling the intestinal flora's equilibrium, and the integrity of intestinal morphology (Langlois et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Simultaneously, probiotics have the ability to stop harmful microorganisms from fixing in the fish's digestive system (Simon et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), promoting the secretion of mucus in the intestinal mucosa, improving the thickness and the intestinal mucosa's integrity (Wang et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Nimalan et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) and intestinal morphology (Islam et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Jahan et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Studies have revealed that probiotics may enhance the expression of molecules known as tight junctions, thereby enhancing the completeness of the fish gut parclose (Yang et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Meng et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cem\u003eRhynchocypris lagowskii\u003c/em\u003e Dybowski is one of the primary commercial fish that has become popular in Northeast China in recent years (Yu et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). But the lack of feed technology restricts the yield improvement and quality of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski. Therefore, it is necessary to promote the healthy breeding of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski. Studies on \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski mainly focus on nutritional requirements (Chen et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Zhang et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Li et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Yu et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Li et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Zhu et al., \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). There has been still no research on probiotics' impact on gut health \u003cem\u003ein vivo\u003c/em\u003e. The intestinal tract of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski contained a strain of LSG2-5 isolated and recognized as \u003cem\u003eBacillus velezensis\u003c/em\u003e by 16S rDNA sequence. The analysis to investigate whether probiotics \u003cem\u003eBacillus\u003c/em\u003e isolated from \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski have positive effects on host intestinal function. In our laboratory, previous studies have proved that \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 boasts probiotic qualities \u003cem\u003ein vitro\u003c/em\u003e (Mahmoud et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). It has proved that \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 promotes development, inoxidizability, and pathogen infection resistance of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski (Zhang et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Different doses of \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 were added to the fodder for \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski. This study aimed to investigate the influences of \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 on the intestinal health of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski through the changes the activity of enzymes for digestion and absorption, intestinal morphology, and associated expression of intestinal genes in the gut flora. This study provides data support for developing candidate probiotics of \u003cem\u003eB. velezensis\u003c/em\u003e as a feed additive.\u003c/p\u003e"},{"header":"2. Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003e2.1 Strains origin and experimental diets\u003c/h2\u003e\n \u003cp\u003e\u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 was separated from the intestine of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski, screened, and preserved in our laboratory from previous tests (Mahmoud et al., \u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e). After activated in the, the preserved strains were set aside in phosphate-buffered saline (PBS) after centrifugation, and the dose was determined after dilution. The numbers of viable bacteria were 10\u003csup\u003e6\u003c/sup\u003e CFU/mL, 10\u003csup\u003e7\u003c/sup\u003e CFU/mL, 10\u003csup\u003e8\u003c/sup\u003e CFU/mL and 10\u003csup\u003e9\u003c/sup\u003e CFU/mL, respectively. Store at 4 ℃ for short-term use.\u003c/p\u003e\n \u003cp\u003eTable\u0026nbsp;1 illustrates the elemental diets\u0026apos; nutritional composition and makeup. Feed ingredients that passed a 60-mesh screen was weigh and mixed according to the equation. After blending, the mixture was made into 1.5mm-thick particles by a feed extruder. The feeds were air-seasoning in a place of shady and conserved in a -20℃ ice locker until use. Four doses of \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 were added to the basal diets but not to the control group. Every diet that had strains added to it was sprayed, then airing at atmospheric temperature in a sterile environment, prepared for immediate use, and sprayed daily. Prior to the trial, diets were melted and tested to ensure the number of viable bacteria fed to the fish.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003e2.2 Laboratory fish and raising scheme\u003c/h2\u003e\n \u003cp\u003e\u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski was acquired from the cauf of Nian Nian You Yu (Tonghua, Jilin Province, China). The breeding experiment was carried out at the Aquaticulture Laboratory of Jilin Agricultural University (Changchun, Jilin Province, China). A total of 535 healthy fish without trauma were selected. Before the formal experiment, the basic diet of the fish was pre-fed for two weeks. Fish with a starting body weight average of 9.98\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05 g were separated into five sets of three duplicates each, and they were arbitrarily assigned to 15 barrels. The experiment performed manaul feeding twice daily (8am and 5pm) until satiation for 8 weeks. The temperature of water was 20\u0026thinsp;\u0026plusmn;\u0026thinsp;1 ℃, and \u0026gt;\u0026thinsp;8.0 mg/L of dissolved oxygen was present. Daily, a third of the volume was switched, and the aquarium\u0026rsquo;s bottom was cleaned.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003e2.3 Sample collection\u003c/h2\u003e\n \u003cp\u003eSamples were collected at 56 days. After 24 h starvation, From each barrels, 12 fish were chosen at random and anesthetized with anestheticMS222. 75 percent alcohol was used to disinfect the fish\u0026apos;s surface. Hepatopancreas, foregut, midgut, posterior gut of 6 fish were collected, frozen with liquid nitrogen and saved at -80℃ for the measure of digestive enzymatic activities and related gene expression levels. The foregut, midgut, posterior gut of 3 fish were collected. Normal saline was used to cleanse the intestines\u0026apos; inner and outer walls, and fixed in 4% paraformaldehyde solution for the tissue sections. The intestine contents of 3 fish were gathered in a septic setting, iced in liquid nitrogen, and kept at -80℃ to determine intestinal microbial diversity.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003e2.4 Sample measurement\u003c/h2\u003e\n \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e\n \u003ch2\u003e2.4.1 Analysis of the activity of digestion and absorption enzymes\u003c/h2\u003e\n \u003cp\u003eTrypsin, lipase, amylase, \u0026gamma; glutamyltransferase (\u0026gamma;-GT), Na\u003csup\u003e+\u003c/sup\u003e-K\u003csup\u003e+\u003c/sup\u003e-ATPase, and alkaline phosphatase (AKP) were all determined by the relevant kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu Province, China).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e\n \u003ch2\u003e2.4.2 Analysis of intestinal morphology\u003c/h2\u003e\n \u003cp\u003eThe samples were prepared using the procedure outlined earlier (Zhu et al., \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e), including trimming, washing, dehydrating, treating transparently, and embedding in paraffin blocks. The samples were then divided into 5mm sections, and hematoxylin-eosin staining was applied. For measurement and photograph, a light microscope (Olympus, IX71, Japan) was employed. The lamina propria (LP), the thickness of the muscle layer (ML), and the height and breadth of the mucosal fold (MF) were all assessed.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e\n \u003ch2\u003e2.4.3 Analysis of related gene expression levels\u003c/h2\u003e\n \u003cp\u003eTRIzol reagent (Takara) was used to extract total mRNA from the proximal, middle, and distal intestines of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski. The overall RNA quality was evaluated using gel electrophoresis. (Fig. \u003cspan class=\"InternalRef\"\u003e1.1\u003c/span\u003e\u0026thinsp;~\u0026thinsp;1.3). We utilized a NanoDrop2000 spectrophotometer to measure its purity and concentration (OD\u003csub\u003e260\u003c/sub\u003e/OD\u003csub\u003e280\u003c/sub\u003e). The primers used in the experiment included \u003cem\u003e\u0026beta;-actin\u003c/em\u003e, \u003cem\u003eZO-1\u003c/em\u003e, \u003cem\u003eClaudin-3\u003c/em\u003e, and \u003cem\u003eAPN\u003c/em\u003e (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). qRT-PCR was performed in StepOnePlus\u0026trade; Real-Time PCR system (Thermo). Follow One Step TB Green\u0026reg; PrimeScript\u0026trade; RT-PCR Kit Ⅱ(Takara) instructions. All operations on the electronic constant temperature sampling platform were carried out to prevent RNA degradation (GT20301). After the qRT-PCR reaction, the 2\u003csup\u003e\u0026minus;∆∆CT\u003c/sup\u003e methodology was used for analysis.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eTABLE 1\u0026nbsp;\u003c/strong\u003e Formulation and nutritional composition of\u0026nbsp;basal\u0026nbsp;diets (air-dry basis)\u0026nbsp;\u003c/p\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.282229965156795%\" rowspan=\"2\"\u003e\n \u003cp\u003eIngredients\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.717770034843205%\" colspan=\"9\"\u003e\n \u003cp\u003eGroups (g/kg)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.22222222222222%\"\u003e\n \u003cp\u003eCK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.444444444444443%\" colspan=\"2\"\u003e\n \u003cp\u003eB-6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.444444444444443%\" colspan=\"2\"\u003e\n \u003cp\u003eB-7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.444444444444443%\" colspan=\"2\"\u003e\n \u003cp\u003eB-8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.444444444444443%\" colspan=\"2\"\u003e\n \u003cp\u003eB-9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.282229965156795%\"\u003e\n \u003cp\u003eFish meal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.937282229965156%\"\u003e\n \u003cp\u003e200.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e200.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e200.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e200.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e200.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.282229965156795%\"\u003e\n \u003cp\u003eSoybean meal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.937282229965156%\"\u003e\n \u003cp\u003e330.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e330.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e330.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e330.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e330.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.282229965156795%\"\u003e\n \u003cp\u003eFish oil\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.937282229965156%\"\u003e\n \u003cp\u003e20.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e20.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e20.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e20.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e20.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.282229965156795%\"\u003e\n \u003cp\u003eCorn oil\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.937282229965156%\"\u003e\n \u003cp\u003e20.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e20.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e20.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e20.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e20.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.282229965156795%\"\u003e\n \u003cp\u003eWheat bran\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.937282229965156%\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e60.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e60.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e60.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e60.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.282229965156795%\"\u003e\n \u003cp\u003eWheat flour\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.937282229965156%\"\u003e\n \u003cp\u003e100.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e100.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e100.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e100.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e100.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.282229965156795%\"\u003e\n \u003cp\u003eDextrin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.937282229965156%\"\u003e\n \u003cp\u003e70.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e70.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e70.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e70.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e70.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.282229965156795%\"\u003e\n \u003cp\u003eCorn protein flour\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.937282229965156%\"\u003e\n \u003cp\u003e150.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e150.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e150.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e150.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e150.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.282229965156795%\"\u003e\n \u003cp\u003eCalcium dihydrogen phosphate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.937282229965156%\"\u003e\n \u003cp\u003e30.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e30.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e30.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e30.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e30.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.282229965156795%\"\u003e\n \u003cp\u003eCompound premix 1%\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.937282229965156%\"\u003e\n \u003cp\u003e10.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e10.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e10.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e10.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e10.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.282229965156795%\"\u003e\n \u003cp\u003eLysine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.937282229965156%\"\u003e\n \u003cp\u003e2.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.282229965156795%\"\u003e\n \u003cp\u003eMethionine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.937282229965156%\"\u003e\n \u003cp\u003e5.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e5.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e5.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e5.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e5.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.282229965156795%\"\u003e\n \u003cp\u003eCholine chloride 50%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.937282229965156%\"\u003e\n \u003cp\u003e3.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e3.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e3.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e3.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e3.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.282229965156795%\"\u003e\n \u003cp\u003e\u003cem\u003eBacillus velezensis\u0026nbsp;\u003c/em\u003eLSG2-5\u0026nbsp;(CFU/g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.937282229965156%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e10\u003csup\u003e6\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e10\u003csup\u003e7\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e10\u003csup\u003e8\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.195121951219512%\" colspan=\"2\"\u003e\n \u003cp\u003e10\u003csup\u003e9\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.282229965156795%\"\u003e\n \u003cp\u003eChemical composition\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"62.717770034843205%\" colspan=\"9\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.347294938917976%\"\u003e\n \u003cp\u003eCrude protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.57940663176265%\" colspan=\"2\"\u003e\n \u003cp\u003e370.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.518324607329843%\" colspan=\"2\"\u003e\n \u003cp\u003e370.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.518324607329843%\" colspan=\"2\"\u003e\n \u003cp\u003e370.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.518324607329843%\" colspan=\"2\"\u003e\n \u003cp\u003e370.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.518324607329843%\"\u003e\n \u003cp\u003e370.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.347294938917976%\"\u003e\n \u003cp\u003eCrude lipid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.57940663176265%\" colspan=\"2\"\u003e\n \u003cp\u003e65.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.518324607329843%\" colspan=\"2\"\u003e\n \u003cp\u003e65.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.518324607329843%\" colspan=\"2\"\u003e\n \u003cp\u003e65.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.518324607329843%\" colspan=\"2\"\u003e\n \u003cp\u003e65.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.518324607329843%\"\u003e\n \u003cp\u003e65.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.347294938917976%\"\u003e\n \u003cp\u003eMoisture\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.57940663176265%\" colspan=\"2\"\u003e\n \u003cp\u003e45.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.518324607329843%\" colspan=\"2\"\u003e\n \u003cp\u003e45.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.518324607329843%\" colspan=\"2\"\u003e\n \u003cp\u003e45.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.518324607329843%\" colspan=\"2\"\u003e\n \u003cp\u003e45.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.518324607329843%\"\u003e\n \u003cp\u003e45.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.347294938917976%\"\u003e\n \u003cp\u003eAsh\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.57940663176265%\" colspan=\"2\"\u003e\n \u003cp\u003e77.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.518324607329843%\" colspan=\"2\"\u003e\n \u003cp\u003e77.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.518324607329843%\" colspan=\"2\"\u003e\n \u003cp\u003e77.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.518324607329843%\" colspan=\"2\"\u003e\n \u003cp\u003e77.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.518324607329843%\"\u003e\n \u003cp\u003e77.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"37.282229965156795%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"13.937282229965156%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"2.6132404181184667%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"9.581881533101045%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"1.916376306620209%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"10.278745644599303%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"1.3937282229965158%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"10.801393728222996%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"0.6968641114982579%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"11.498257839721255%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003csup\u003ea\u0026nbsp;\u003c/sup\u003eCompound premix 1%: vitamins and mineral included. Vitamin A (IU/kg) 3600; vitamin D3 (IU/kg) 1200; vitamin E (mg/kg) 20, vitamin K3 (mg/kg) 5; vitamin B1 (mg/kg) 5; vitamin B2 (mg/kg) 7; vitamin B6 (mg/kg) 6; vitamin B12 (ug/kg) 20; calcium pantothenate (mg/kg) 20; nicotinic acid (mg/kg) 30; folic acid (mg/kg) 1.7; biotin (mg/kg) 0.05; VC phosphate (mg/kg) 171.4; in-ositol (mg/kg) 90; Mg (mg/kg) 150; Fe (mg/kg) 120; Zn (mg/kg) 60; Mn (mg/kg) 30; Cu (mg/kg) 4; Co (mg/kg) 0.5; Se (mg/kg) 0.1; I (mg/kg) 1.\u003c/p\u003e\n \u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003ePrimer sequences of target gene\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTarget genes\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eSequences (5\u0026prime;-3\u0026prime;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGenBank number\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u0026beta;-actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGGTATCCATGAGACCACCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eAAB97964.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTTCTGCATCCTGTCAGCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eZO-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCGAAATGACACGGGCTAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eKY290394\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTCTGTTGTGGTTGAGTGTAGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eClaudin-3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCACCAACTGTATCGAGGATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eJQ767157.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGTTGTAGAAGTCCCGAATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eAPN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCCCAAAACTGTGCAAGAAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eJN088167.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTCTGATGCGTGTCTGGTTTAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e\n \u003ch2\u003e2.4.4. Total DNA extraction of intestinal contents and 16S rRNA high-throughput sequencing\u003c/h2\u003e\n \u003cp\u003eAccording to the method previously described (Wang, \u003cspan class=\"CitationRef\"\u003e2017\u003c/span\u003e), the complete genetic material of the intestine in \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski was removed in compliance with the guidelines of the genomic DNA Extraction Kit (PowerFecal, MOBIO, USA). By using 1% agarose gel electrophoresis, the isolated genomic DNA was found. 16S rRNA was employed to assess the variety of microbes of the contents of the intestine. The designated sequencing area (V3-V4) is used as a guide and the synthesized universal primer sequence with a barcode was 515F: 5\u0026apos;-GTGCCAGCMGCCGCGGTAA-3\u0026rsquo;; 806R: 5\u0026apos;-GGACTACHVGGGTWTCTAAT-3\u0026rsquo;. Then PCR amplification was performed. Gene order was performed on the Illumina MiSeq PE300 platform at Beijing Allvegene Gene Technology Co., LTD (Beijing, China).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003e2.5 Data statistics and analysis\u003c/h2\u003e\n \u003cp\u003eAll data were expressed as Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM). SPSS 22.0 was used for statistical analysis. Tukey\u0026rsquo;s test was used if there was a remarkable discrepancy between groups, and p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered a remarkable discrepancy. Intestinal flora was analyzed using the R Foundation for Statistical Computing (Australia) and QIIME 1.8.0 platform.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Digestion and absorption enzymes activity\u003c/h2\u003e \u003cp\u003eThe digestion and absorption enzymes activity in the hepatopancreas and intestines of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski are shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e3\u003c/span\u003e. In the hepatopancreas, trypsin, lipase, and Na\u003csup\u003e+\u003c/sup\u003e/K\u003csup\u003e+\u003c/sup\u003e -ATPase activities in B-7, B-8 and B-9 groups were greater than in the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Relative to the group under control, the activity of amylase was noteworthy greater in the treatment groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). While none of the other three groups substantially varied from the control (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), there was a remarkable improvement in γ-GT activity in the B-6 group as compared to the control (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In comparison to the B-6 and control groups, the AKP activity was considerably higher in the B-7, B-8, and control groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). And AKP activity in the B-9 group also had an increasing trend but was not significant (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of \u003cem\u003eB velezensis\u003c/em\u003e LSG2-5 on digestion and absorption enzymes activity of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c2\" namest=\"c1\" rowspan=\"2\"\u003e \u003cp\u003eIndexes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c7\" namest=\"c3\"\u003e \u003cp\u003eGroups\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eB\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eB\u0026minus;7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eB\u0026minus;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eB\u0026minus;9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eTrypsase\u003c/p\u003e \u003cp\u003e(U/mgprot)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e48.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e50.95\u0026thinsp;\u0026plusmn;\u0026thinsp;1.43\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e56.32\u0026thinsp;\u0026plusmn;\u0026thinsp;1.15\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e59.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e57.39\u0026thinsp;\u0026plusmn;\u0026thinsp;1.21\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e56.38\u0026thinsp;\u0026plusmn;\u0026thinsp;0.37\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e58.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.67\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e59.76\u0026thinsp;\u0026plusmn;\u0026thinsp;0.95\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e60.79\u0026thinsp;\u0026plusmn;\u0026thinsp;1.58\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e61.85\u0026thinsp;\u0026plusmn;\u0026thinsp;1.16\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e52.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.61\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e52.83\u0026thinsp;\u0026plusmn;\u0026thinsp;0.86\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e56.61\u0026thinsp;\u0026plusmn;\u0026thinsp;1.24\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e59.01\u0026thinsp;\u0026plusmn;\u0026thinsp;1.23\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e58.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.87\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e47.98\u0026thinsp;\u0026plusmn;\u0026thinsp;0.67\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e53.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.86\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e56.31\u0026thinsp;\u0026plusmn;\u0026thinsp;1.25\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e59.85\u0026thinsp;\u0026plusmn;\u0026thinsp;1.28\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e55.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.91\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eLipase\u003c/p\u003e \u003cp\u003e(U/mgprot)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.47\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e17.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.53\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e17.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.52\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e17.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e26.09\u0026thinsp;\u0026plusmn;\u0026thinsp;1.04\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e25.98\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e27.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.66\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e25.89\u0026thinsp;\u0026plusmn;\u0026thinsp;1.04\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17.53\u0026thinsp;\u0026plusmn;\u0026thinsp;0.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e18.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e17.61\u0026thinsp;\u0026plusmn;\u0026thinsp;1.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e20.24\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e18.16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.69\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e16.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.72\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15.89\u0026thinsp;\u0026plusmn;\u0026thinsp;1.18\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e16.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.60\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e16.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eAmylase\u003c/p\u003e \u003cp\u003e(U/mgprot)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.84\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.83\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.66\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.59\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.65\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eγ-GT\u003c/p\u003e \u003cp\u003e(U/gprot)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17.08\u0026thinsp;\u0026plusmn;\u0026thinsp;1.25\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e22.34\u0026thinsp;\u0026plusmn;\u0026thinsp;1.06\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e19.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.63\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e20.88\u0026thinsp;\u0026plusmn;\u0026thinsp;1.15\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e18.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.98\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28.30\u0026thinsp;\u0026plusmn;\u0026thinsp;1.29\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e39.81\u0026thinsp;\u0026plusmn;\u0026thinsp;1.64\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e40.09\u0026thinsp;\u0026plusmn;\u0026thinsp;1.91\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e46.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.91\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e45.61\u0026thinsp;\u0026plusmn;\u0026thinsp;1.11\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e24.69\u0026thinsp;\u0026plusmn;\u0026thinsp;2.26\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e33.14\u0026thinsp;\u0026plusmn;\u0026thinsp;1.06\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e34.64\u0026thinsp;\u0026plusmn;\u0026thinsp;2.19\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e37.25\u0026thinsp;\u0026plusmn;\u0026thinsp;1.87\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e44.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.63\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18.87\u0026thinsp;\u0026plusmn;\u0026thinsp;1.78\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e25.74\u0026thinsp;\u0026plusmn;\u0026thinsp;2.01\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e24.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.50\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e30.50\u0026thinsp;\u0026plusmn;\u0026thinsp;1.29\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e24.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.89\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eNa\u003csup\u003e+\u003c/sup\u003e,K\u003csup\u003e+\u003c/sup\u003e-ATPase\u003c/p\u003e \u003cp\u003e(U/mgprot)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.38\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.79\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.85\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.72\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.78\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.70\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3.14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.22\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.72\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eAKP\u003c/p\u003e \u003cp\u003e(U/gprot)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.48\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9.46\u0026thinsp;\u0026plusmn;\u0026thinsp;0.37\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e8.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.32\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.39\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e26.70\u0026thinsp;\u0026plusmn;\u0026thinsp;1.11\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e29.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.42\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e39.85\u0026thinsp;\u0026plusmn;\u0026thinsp;1.03\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e42.24\u0026thinsp;\u0026plusmn;\u0026thinsp;1.10\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e35.26\u0026thinsp;\u0026plusmn;\u0026thinsp;1.07\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22.98\u0026thinsp;\u0026plusmn;\u0026thinsp;0.89\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.99\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e35.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.41\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e37.66\u0026thinsp;\u0026plusmn;\u0026thinsp;0.79\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e34.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.69\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9.53\u0026thinsp;\u0026plusmn;\u0026thinsp;0.50\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.75\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e16.47\u0026thinsp;\u0026plusmn;\u0026thinsp;1.33\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e21.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.61\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eWhile the other three treatment groups showed an increased trend but were not statistically distinguished from the control (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), the B-9 group had considerably greater trypsin activity in the proximal intestine than the control (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In comparison with the group under control, a significant increase in lipase activity in B-6 and B-8 groups was found (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Amylase activity was considerably higher in the B-7, B-8, and B-9 groups in comparison with the control (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The B-6 group, however, had an increasing tendency but did not vary significantly from the control group (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Treatment groups' γ-GT activity was greater than that of the control group's (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In comparison to the control, B-6, and B-9 groups, the Na+/K+ -ATPase activity was considerably higher in the B-8 group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). AKP activity in B-7, B-8, and B-9 groups was notably greater than that of the other two groups. (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003eTrypsin activity in the mid-intestine was substantially higher in the B-8 and B-9 groups than in the control and B-6 group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The lipase and amylase activity of all experimental group did not differ appreciably from one another (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). The activities of γ-GT and AKP reached their greatest levels in the B-9 and B-8 groups, respectively, and were significantly greater in all treatment groups than both in the control group (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). The Na\u003csup\u003e+\u003c/sup\u003e/K\u003csup\u003e+\u003c/sup\u003e -ATPase activity was considerably increased in the B-7 and B-9 groups in comparison with the control (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003eIn the distal intestine, trypsin and AKP were remarkably elevated in treatment groups related to the control (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and reached the maximum values in B-8 and B-9 groups.The lipase activity in the B-8 group considerably increased (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in comparison with the control. And the other three groups also had an increasing trend but no noticeable difference (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). The amylase activity in the B-9 group was noteworthy greater than that in the control, B-6, and B-7 groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). γ -GT activity in B-6 and B-8 groups was significantly elevated in comparison with the control (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). There was no remarkably variation between the three groups (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), and the Na\u003csup\u003e+\u003c/sup\u003e/K\u003csup\u003e+\u003c/sup\u003e -ATPase activity in the B-8 and B-9 groups was greater in comparison to the other three groups.(p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Intestinal morphology\u003c/h2\u003e \u003cp\u003eIn Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e4\u003c/span\u003e. MF height and ML thickness of PI in B-8 and B-9 groups were remarkably increased compared to the control(p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The MF height of PI in B-6 and B-7 groups had no significant difference (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). The ML thickness of PI in B-6 and B-7 groups had an increasing trend but was not significant (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). MF width of PI in treatment groups was noteworthy increased (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The LP width of PI in B-6 and B-7 groups, the LP width of MI in the B-7, MI\u0026rsquo;s MF height and ML thickness in B-7, B-8, and B-9 groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the MF width of MI in B-7 and B-8 groups were conspicuously increased (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), respectively. The LP width of MI in the B-8 group had an increasing trend, still, the difference was insignificant (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). The MF height of DI in the B-7, B-8, and B-9 groups was significantly increased(p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), but there was no arresting difference in the B-6 group compared with the control (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). The MF width and LP width of DI in the B-8 group were remarkably increased (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), but the MF width and LP width of DI in the other treatment groups had no conspicuous difference in comparison with the control (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). ML thickness in B-6 and B-7 groups was significantly increased(p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), but there was no conspicuous difference in the other two groups compared to the control (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). The mucosal folds of the treated groups were clear and complete in structure, with a thick muscle layer and well-developed mucosal folds without morphological damage (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The effects of \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 on intestinal development indices of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 on Intestinal morphology indexes of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c2\" namest=\"c1\" rowspan=\"2\"\u003e \u003cp\u003eIndexes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c7\" namest=\"c3\"\u003e \u003cp\u003eGroups (\u0026micro;m)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eB\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eB\u0026minus;7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eB\u0026minus;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eB\u0026minus;9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eMF height\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1099.44\u0026thinsp;\u0026plusmn;\u0026thinsp;13.45\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1108.29\u0026thinsp;\u0026plusmn;\u0026thinsp;7.80\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1188.78\u0026thinsp;\u0026plusmn;\u0026thinsp;4.19\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1178.74\u0026thinsp;\u0026plusmn;\u0026thinsp;4.97\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1122.41\u0026thinsp;\u0026plusmn;\u0026thinsp;3.31\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e647.24\u0026thinsp;\u0026plusmn;\u0026thinsp;9.55\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e695.68\u0026thinsp;\u0026plusmn;\u0026thinsp;11.58\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e716.70\u0026thinsp;\u0026plusmn;\u0026thinsp;8.91\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e763.80\u0026thinsp;\u0026plusmn;\u0026thinsp;14.38\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e726.43\u0026thinsp;\u0026plusmn;\u0026thinsp;7.09\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e640.69\u0026thinsp;\u0026plusmn;\u0026thinsp;13.99\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e666.73\u0026thinsp;\u0026plusmn;\u0026thinsp;13.33\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e775.80\u0026thinsp;\u0026plusmn;\u0026thinsp;8.68\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e786.79\u0026thinsp;\u0026plusmn;\u0026thinsp;5.12\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e770.59\u0026thinsp;\u0026plusmn;\u0026thinsp;8.34\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eMF width\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e108.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.64\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e121.03\u0026thinsp;\u0026plusmn;\u0026thinsp;0.96\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e120.96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.84\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e125.72\u0026thinsp;\u0026plusmn;\u0026thinsp;0.38\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e123.96\u0026thinsp;\u0026plusmn;\u0026thinsp;1.08\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e113.38\u0026thinsp;\u0026plusmn;\u0026thinsp;0.98\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e112.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.99\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e117.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.55\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e121.33\u0026thinsp;\u0026plusmn;\u0026thinsp;1.37\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e112.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.68\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e114.55\u0026thinsp;\u0026plusmn;\u0026thinsp;1.56\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e115.43\u0026thinsp;\u0026plusmn;\u0026thinsp;1.07\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e116.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.90\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e121.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.84\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e117.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.62\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eLP width\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21.10\u0026thinsp;\u0026plusmn;\u0026thinsp;0.71\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e26.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.75\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e25.57\u0026thinsp;\u0026plusmn;\u0026thinsp;1.11\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e22.81\u0026thinsp;\u0026plusmn;\u0026thinsp;1.06\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e22.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.71\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.60\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e17.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e15.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.81\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e14.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14.54\u0026thinsp;\u0026plusmn;\u0026thinsp;0.66\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13.98\u0026thinsp;\u0026plusmn;\u0026thinsp;0.56\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e14.72\u0026thinsp;\u0026plusmn;\u0026thinsp;0.46\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e17.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e13.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.72\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eML thickness\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e33.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.85\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e34.83\u0026thinsp;\u0026plusmn;\u0026thinsp;1.35\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e37.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.72\u003csup\u003eabc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e38.29\u0026thinsp;\u0026plusmn;\u0026thinsp;1.31\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e40.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.52\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e24.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.41\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e25.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.66\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e28.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.53\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e32.19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e32.14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.44\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e24.94\u0026thinsp;\u0026plusmn;\u0026thinsp;0.97\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e32.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.91\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e30.42\u0026thinsp;\u0026plusmn;\u0026thinsp;1.20\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e24.66\u0026thinsp;\u0026plusmn;\u0026thinsp;0.90\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e22.02\u0026thinsp;\u0026plusmn;\u0026thinsp;1.13\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Gene expression\u003c/h2\u003e \u003cp\u003eThe influences of \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 on the relative expression levels of \u003cem\u003eZO-1\u003c/em\u003e mRNA, \u003cem\u003eClaudin3\u003c/em\u003e mRNA, \u003cem\u003eAPN\u003c/em\u003e mRNA, and \u003cem\u003eTOR\u003c/em\u003e mRNA in the intestine of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u0026thinsp;~\u0026thinsp;5. According to Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003e, the relative expression level of \u003cem\u003eZO-1\u003c/em\u003e mRNA in the proximal intestine of the B-7, B-8, and B-9 groups was remarkably increased compared with the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Simultaneously, there was no discernible variation in the comparative expression level of \u003cem\u003eZO-1\u003c/em\u003e mRNA in the proximal intestine of the B-6 group (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). In the mid and distal intestine of the treatment groups, \u003cem\u003eZO-1\u003c/em\u003e mRNA expression levels were considerably higher (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Figure\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003e shows that the relative expression level of \u003cem\u003eClaudin3\u003c/em\u003e mRNA in the proximal and mid intestine of treatment groups was substantially higher (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in comparison with the control. The relative expression of \u003cem\u003eClaudin3\u003c/em\u003e mRNA in the distal intestine of B-7, B-8, and B-9 groups was conspicuous increased (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). According to Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003e, the relative expression level of \u003cem\u003eAPN\u003c/em\u003e mRNA in the intestine of all treatment groups was remarkably greater in comparison to the control (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Among them, there was no striking variation in the relative expression of \u003cem\u003eAPN\u003c/em\u003e mRNA in the proximal intestine of the four treatment groups (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). The relative expression of \u003cem\u003eAPN\u003c/em\u003e mRNA in the mid intestine showed a growing tendency. The relative expression of \u003cem\u003eAPN\u003c/em\u003e mRNA in the distal intestine increase initially and decrease afterwards, reaching the peak value in the B-8 group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Intestinal flora\u003c/h2\u003e \u003cp\u003eAlpha diversity is the analysis of species diversity in a single sample. Among them, the Chao1 index and Observed species reflect the richness of the community, and the Shannon index and Phylogenetic diversity (PD) of the whole tree reflect the community\u0026rsquo;s diversity. The results are shown in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e5\u003c/span\u003e. In comparison with the control, there were no noteworthy differences in Chao1 index, observed species, PD whole tree, and Shannon index(p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). However, the Alpha index of intestine microbes revealed a pattern of first increase followed by decrease with the increase of doses of \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 added to the diet.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAlpha diversity index of intestinal microbes of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eChao1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eObserved species\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePD whole tree\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eShannon\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e692.17\u0026thinsp;\u0026plusmn;\u0026thinsp;68.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e497.32\u0026thinsp;\u0026plusmn;\u0026thinsp;30.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e52.90\u0026thinsp;\u0026plusmn;\u0026thinsp;4.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.79\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e831.18\u0026thinsp;\u0026plusmn;\u0026thinsp;46.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e685.03\u0026thinsp;\u0026plusmn;\u0026thinsp;56.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e55.53\u0026thinsp;\u0026plusmn;\u0026thinsp;3.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e938.57\u0026thinsp;\u0026plusmn;\u0026thinsp;90.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e575.21\u0026thinsp;\u0026plusmn;\u0026thinsp;49.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e41.73\u0026thinsp;\u0026plusmn;\u0026thinsp;5.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e677.04\u0026thinsp;\u0026plusmn;\u0026thinsp;52.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e473.3\u0026thinsp;\u0026plusmn;\u0026thinsp;67.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e49.06\u0026thinsp;\u0026plusmn;\u0026thinsp;5.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.46\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB-9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e691.42\u0026thinsp;\u0026plusmn;\u0026thinsp;59.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e453.13\u0026thinsp;\u0026plusmn;\u0026thinsp;50.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e41.06\u0026thinsp;\u0026plusmn;\u0026thinsp;5.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.39\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe effects of \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 on microbial community structure in intestinal contents of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski are shown in Figs.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003e and \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003e. At the phylum level (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003e), a total of 49 phylum microbes were detected, and the information of the top 10 species with a relative abundance of more than 1% in each OTUs was selected as the representative plot (Others refer to bacteria with a combined abundance of less than 1%). The dominant groups were the Proteobacteria, Firmicutes, Bacteroidetes, Fusobacteria, and Cyanobacteria. In experimental groups, the proportion of Proteobacteria and Firmicutes reached 79.42% ~ 90.24% and Proteobacteria was the absolute dominant group, accounting for 44.36%. In comparison with the control group, a large amount of Proteobacteria increased and then decreased with the increased doses of \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5. The relative abundance of Bacteroidetes, Fusobacteria, Cyanobacteria, and Proteobacteria showed the same trend, while Firmicutes showed the opposite. At the genus level (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003e), every treatment group's major bacteria were the same, mainly including \u003cem\u003eGemmobacter\u003c/em\u003e, \u003cem\u003eBacillus\u003c/em\u003e, \u003cem\u003eFlavobacterium\u003c/em\u003e, and \u003cem\u003eAeromonas\u003c/em\u003e. The relative abundance of \u003cem\u003eBacillus\u003c/em\u003e was gradually increased with the increasing doses of \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5. The relative abundance of the B-9 group, on the other hand, marginally increased while that of Flavobacterium and Aeromonas gradually dropped.\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe development and upgrowth of fish are closely correlation between the ability of gut digestion and assimilation. \u003cem\u003eBacillus\u003c/em\u003e can improve fish digestive enzyme activity in the fish body, promote the production of vitamins and organic acids, and promote fish appetite (Kuebutornye et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Researches have revealed that adding probiotics to feed is more effective than adding them to water (Ziaei-Nejad et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). The hepatopancreas and intestine both play an essential part in digestion and absorption of fish. Hence, the explore of changes in activities of digestive enzymes in the liver and intestines is an important indicator to verify the promoting or inhibiting role of \u003cem\u003eBacillus\u003c/em\u003e on the digestion and assimilation of fish. Trypsin, amylase, and lipase can enhance the digestion of fish by promoting the catabolism of proteins, lipids, and carbohydrates (Assan et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). γ-GT, Na\u003csup\u003e+\u003c/sup\u003e-K\u003csup\u003e+\u003c/sup\u003e -ATPase, and AKP are widely distributed in the brush edge membrane (BBM) of fish\u0026rsquo;s proximal, mid and distal intestines, enhancing the uptake of nutrients within the fish's intestinal system (Chen, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Gomez and Shen (G\u0026oacute;mez and Shen, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2008\u003c/span\u003e) proved that \u003cem\u003eBacillus\u003c/em\u003e could promote protease and amylase activities in \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e, and Liu et al. (Liu et al. found similar results. Gao et al. (Gao et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) claimed that \u003cem\u003eB. subtilis\u003c/em\u003e can escalate the amylase, lipase, and protease activities of \u003cem\u003ePampus argenteus\u003c/em\u003e. Daboor et al. (Daboor et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) found that the mixture of \u003cem\u003eB. subtilis\u003c/em\u003e and \u003cem\u003eLaobacillus Plantarum\u003c/em\u003e can promote the actions of amylase, protease, and lipase in Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e). In our laboratory, it has proved that \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 can produce trypsin, amylase, and lipase \u003cem\u003ein vitro\u003c/em\u003e (Mahmoud et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). This study verified the outcomes of the above experiments \u003cem\u003ein vivo\u003c/em\u003e. The result was that \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 promoted the digestive and absorption enzyme activities in the hepatopancreas, proximal, mid, and distal intestine of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski. However, the activity of some enzymes showed a decreasing trend when the dose reached 10\u003csup\u003e9\u003c/sup\u003e CFU/g, which may be due to the high dose destroyed the balance of the flora in the digestive tract of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski and reduced the ability to secrete digestive and absorbing enzymes. \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 can secrete exogenous enzymes. Therefore, this study could not determine whether the increased digestive enzyme activity was caused by the host\u0026rsquo;s increase of endogenous enzyme secretion or the supplement of exogenous enzyme secreted by \u003cem\u003eBacillus\u003c/em\u003e. Future research should delve deeper into this process.\u003c/p\u003e \u003cp\u003eIn addition to the activity of digestion and absorption enzymes, intestinal tissue integrity is also one of the factors impacting the digestive capabilities of fish. It is also crucial to maintain the growth and wellbeing of fish intestines. Research has revealed that \u003cem\u003eBacillus\u003c/em\u003e can promote intestinal mucosa development in animals (Ruiz Sella et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The intestinal mucosa is essential to enable fish to process and assimilate nutrients and for intestinal microorganisms to adhere to it (Yang et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Simultaneously, the muscular layer of the intestinal tract powers peristalsis and promotes the intestinal absorption of nutrients (He et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Therefore, the changes in the mucosal and muscular layers of fish intestines can directly demonstrate the role of probiotic \u003cem\u003eBacillus\u003c/em\u003e subtilis in the intestines. \u003cem\u003eBacillus\u003c/em\u003e plays a role in \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski's intestinal. Research has revealed the presence of lactic acid bacteria could improve the intestinal muscle thickness and mucosal fold height width of \u003cem\u003eChanna argus\u003c/em\u003e (Kong et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The research indicated that \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 supplementation increased the mucosal fold height, mucosal fold width, lamina propria width, and muscle layer thickness of the intestinal tract of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski. The findings imply that \u003cem\u003eB. velezensis\u003c/em\u003e can promote the intestinal development and health of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski. Echoing the findings of this research, \u003cem\u003eB. licheniformis\u003c/em\u003e can improve intestinal villi height and accelerate the development of intestinal villi in typical carp (\u003cem\u003eCyprinus carpio\u003c/em\u003e L.) (Zhang et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The addition of \u003cem\u003eB. licheniformis\u003c/em\u003e and mixed bacteria can enhance the villus height of \u003cem\u003eC. auratus\u003c/em\u003e var. Pengze, while the addition of \u003cem\u003eB. coagulans\u003c/em\u003e alone, does not change the villus height of \u003cem\u003eC. auratus\u003c/em\u003e var. Pengze (Luo et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). It could be brought on by various bacterial species, different dosages, different types of fish, and different body weights.\u003c/p\u003e \u003cp\u003eThe permeability of tight connections between cells primarily determines the protective role played by intestinal epithelial cells in fish, controlled by multiple tight junctions (Yang et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Therefore, tight junction protein expression can reflect the role of the intestinal barrier, and tight junction protein expression has increased, suggesting gut barrier permeability has decreased. (Jiang et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Zonula occludens (ZO) are the basis of a tight junction supporting structure. Claudins are a part of the paracellular diffusion barriers and represent the tight junction family. It was found that \u003cem\u003eB. licheniformis\u003c/em\u003e increased the intestinal \u003cem\u003eZO-1\u003c/em\u003e mRNA expression levels and increased the intestinal barrier function of grass carp (\u003cem\u003eCtenopharyngodon Idella\u003c/em\u003e) (Qin et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Reports have also surfaced stating that \u003cem\u003eB. cereus\u003c/em\u003e and \u003cem\u003eB. subtilis\u003c/em\u003e significantly upregulated the expression level of \u003cem\u003eZO-1\u003c/em\u003e mRNA in the mid intestine of grass carp (Xue et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Kong et al. (Kong et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) found that Lactococcus lactis, Lactobacillus Plantarum, and Enterococcus faecalis significantly upregulated the intestinal \u003cem\u003eZO-1\u003c/em\u003e and \u003cem\u003eClaudin-3\u003c/em\u003e mRNA expression levels of \u003cem\u003eC. argus.\u003c/em\u003e The findings of this research align closely with the outcomes of previous studies, \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 has the potential to elevate the comparative expression levels of \u003cem\u003eZO-1\u003c/em\u003e and \u003cem\u003eClaudin-3\u003c/em\u003e mRNA in the intestine of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski. The findings indicate that \u003cem\u003eB. velezensis\u003c/em\u003e, extracted from \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski's intestinal tract, has the ability to control intestinal barrier activity through the modulation of tight junction protein gene expression. Aminopeptidase N (APN), belonging to the M1 peptidase family, is crucial for the digestion of proteins. \u003cem\u003eAPN\u003c/em\u003e is an enzyme found extensively in extracellular environments across various tissues, organs, and cells. Studies have shown that the expression levels of \u003cem\u003eAPN\u003c/em\u003e in grass carp are different day and night, possibly owing to the varying degrees of thyrotropin-releasing hormone (Tang et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). This study showed that \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 upregulated the relative expression of \u003cem\u003eAPN\u003c/em\u003e mRNA in the intestine of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski and then regulated the digestive function of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski.\u003c/p\u003e \u003cp\u003eFish's substantial intestinal microbial population is crucial for the function of intestinal barriers, nutrient processing, and immune response. This is intimately connected to the health of the host (Chen et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Zhang et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Generally, the microflora in the fish intestine is in a dynamic equilibrium state of mutual restriction and interdependence, maintaining the normal physiological functions of the host (Liu et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Intestinal flora may be affected by ambient environment and nutrition, and it forms a symbiotic relationship with the host, providing nutrition while regulating the intestinal micro ecological balance and promoting the host\u0026rsquo;s metabolism (Liu et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). This study covered almost all the microbes in the intestinal tract of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski, and the diversity of the microbial community remained largely unchanged. Studies have shown that Proteobacteria, Bacteroidetes, Firmicutes, Actinobacteria, and Fusobacteria are the dominant phyla in the intestinal flora of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski (Zhao et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The results showed that at the phylum level, Proteobacteria, Firmicutes, Bacteroidetes, Fusobacteria, and Cyanobacteria were the dominant phyla in the intestinal microflora of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski at the phylum level. Concurrently, the discovery of Actinobacteria, albeit in small quantities, aligned with findings from earlier research. The above dominant flora has been detected in different degrees in \u003cem\u003eSalmo salar\u003c/em\u003e (Wang, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), \u003cem\u003eC. auratus gibelio\u003c/em\u003e (Wu et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), \u003cem\u003eSiniperca chuatsi\u003c/em\u003e (Chen et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), C. \u003cem\u003eidellus\u003c/em\u003e (Han et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2010\u003c/span\u003e)d \u003cem\u003eniloticus\u003c/em\u003e (Adeoye et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Proteobacteria generally exist in the intestine of fish. A small amount of Proteobacteria cannot impact the intestinal microecological balance; however, a large amount of Proteobacteria affects the dynamic balance of microbes in the intestinE, increasing the risk of fish disease (Shin et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). As a vital role in fish digestion and absorption, Firmicutes provide a variety of enzymes to facilitate cellulose breakdown and polysaccharide fermentation (Zhao et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Zhang et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Bacteroidetes and Fusobacteria are common bacteria in the intestine of fish as the primary bacteria in the intestine and they possess a mutualistic bond with the fish's intestinal tract (Burgos et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, Tran et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Throughout this research, the abundance of Proteobacteria, Bacteroides, and Fusobacteria in the intestine of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski increased first and then decreased with the augment of the dosages of \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5. The abundance of Proteobacteria, Bacteroides, and Fusobacteria in the intestine of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski was the highest at 10\u003csup\u003e6\u003c/sup\u003e CFU/g and gradually decreased. Concurrently, there was an initial decline in the relative prevalence of Firmicutes, followed by a steady rise. These outcomes suggested that \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 decreased the abundance of Proteobacteria, Bacteroides, and Fusobacteria in the intestine of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski, and increased the abundance of Firmicutes. Cyanobacteria, rich in protein, carotenoids, and vitamins, are the dominant flora in the intestinal tract of fish and play a certain part in supplementing host nutrition and improving host immunity (Wang, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In the study of \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e, \u003cem\u003eBacillus\u003c/em\u003e can decompose organic matter into inorganic matter, while the inorganic matter is easier to be utilized by microalgae. This process promotes the reproduction of microalgae in the aquatic environment (de Paiva-Maia et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Cyanobacteria in the intestine of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski proves that the addition of \u003cem\u003eBacillus\u003c/em\u003e to the diet can promote the growth of microalgae in water and make Cyanobacteria the dominant flora. In \u003cem\u003eAeromonas\u003c/em\u003e, strains with virulence factors are pathogenic to fish (Muduli et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). \u003cem\u003eFlavobacterium\u003c/em\u003e is related to bacterial rotten gill disease in fish (Good et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). At the genus level, \u003cem\u003eAeromonas\u003c/em\u003e and \u003cem\u003eFlavobacterium\u003c/em\u003e decreased firstly and then increased with the increase of \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5, suggesting that the decrease in the abundance of pathogenic bacteria in the intestine was related to the dose of \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5. The diet supplemented with 10\u003csup\u003e8\u003c/sup\u003e CFU/g \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 had the lowest abundance in \u003cem\u003eAeromonas\u003c/em\u003e and \u003cem\u003eFlavobacterium\u003c/em\u003e. The abundance of \u003cem\u003eBacillus\u003c/em\u003e increased and then decreased, reaching the maximum value in the B-8 group. It can be inferred that \u003cem\u003eBacillus\u003c/em\u003e had a better colonization ability in the intestine of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski when the dose of \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 reached 10\u003csup\u003e8\u003c/sup\u003e CFU. Zhang et al. (Zhang et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) found that dietary supplementation of 10\u003csup\u003e9\u003c/sup\u003e CFU/g \u003cem\u003eB. velezensis\u003c/em\u003e had no significant effect on the diversity of intestinal microflora of \u003cem\u003eO. niloticus\u003c/em\u003e but reduced the abundance of opportunistic pathogens, which paralleled the findings of this research. This research suggests that \u003cem\u003eB. velezensis\u003c/em\u003e may regulate the microecological balance of the intestinal flora of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski. However, whether \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 can stabilize the intestinal flora of freshwater fish and the mechanism governing it requires additional investigation.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn conclusion, dietary supplementation with 10\u003csup\u003e7\u003c/sup\u003e~10\u003csup\u003e9\u003c/sup\u003e CFU/g of \u003cem\u003eB. velezensis\u003c/em\u003e LSG2-5 can promote the activity of digestive and absorbing enzymes and regulate the relative expression level of \u003cem\u003eAPN\u003c/em\u003e mRNA in the intestine and hepatopancreas of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski. In addition, it can improve intestinal morphology, regulate the mRNA relative expression of intestinal tight connection protein \u003cem\u003eZO-1\u003c/em\u003e and \u003cem\u003eClaudin-3\u003c/em\u003e, and improve the dynamic balance of intestinal flora to regulate the intestinal health of \u003cem\u003eR. lagowskii\u003c/em\u003e Dybowski.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical approval\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the experimental animals used in the study were performed following the National Institutes of Health Guide for the Care and Use of Laboratory Animals and approved by the Institutional Animal Care and Use Committee of Jilin Agricultural University (Organization number: 20200919007).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors report no declarations of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eShaohua Li, Yu-rou Zhang and Li-li Lin contributed methods, investigation, validation, formal analysis and writing of the study. Zhi-xin Guo and Yuke Chen funded and designed the study, and revised the manuscript. Wen-li Zhu, Dan Jiang, Yuxin Li and Sibu Wang contributed significantly to analysis. Qiuju Wang and Yu-ke Chen performed supervision and verification of the study. Dong-ming Zhang, Tian-yi Zhang and Zhixin Guo helped perform the analysis with constructive discussions.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Jilin Provincial Science and Technology Department (20220202065NC and 20210404024NC) .\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are openly available.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAdeoye, A.A., Jaramillo-Torres, A., Fox, S.W., Merrifield, D.L. \u0026amp; Davies, S.J. (2016) Supplementation of formulated diets for tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) with selected exogenous enzymes: Overall performance and effects on intestinal histology and microbiota. \u003cem\u003eAnimal Feed Science \u0026amp; Technology,\u003c/em\u003e 215, 133-143.\u003c/li\u003e\n\u003cli\u003eAssan, D., Kuebutornye, F.K.A., Hlordzi, V., Chen, H., Mraz, J., Mustapha, UF \u0026amp; Abarike, E.D. (2022) Effects of probiotics on digestive enzymes of fish (finfish and shellfish); status and prospects: a mini review. \u003cem\u003eComparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology,\u003c/em\u003e 257, 110653.\u003c/li\u003e\n\u003cli\u003eBeukema, M., Faas, M.M. \u0026amp; de Vos, P. (2020) The effects of different dietary fiber pectin structures on the gastrointestinal immune barrier: impact via gut microbiota and direct effects on immune cells. \u003cem\u003eExperimental \u0026amp; Molecular Medicine,\u003c/em\u003e 52 (9), 1364-1376.\u003c/li\u003e\n\u003cli\u003eBurgos, M.J.G., Romero, J.L., Pulido, R.P., Molinos, A.C., G\u0026aacute;lvez, A. \u0026amp; Lucas, R. (2018) Analysis of potential risks from the bacterial communities associated with air-contact surfaces from tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) fish farming. \u003cem\u003eEnvironmental research,\u003c/em\u003e 160, 385-390.\u003c/li\u003e\n\u003cli\u003eChen, X., Wang, Q., Guo, Z., Zhao, Y., Gao, Y., Yu, T., Chen, Y., Zhang, D. \u0026amp; Wang, G. (2019) Effects of dietary oxidized fish oil on growth performance and antioxidant defense mechanism of juvenile \u003cem\u003eRhynchocypris lagowski\u003c/em\u003e Dybowski. \u003cem\u003eAquaculture,\u003c/em\u003e 512, 734368.\u003c/li\u003e\n\u003cli\u003eChen, X., Yi, H., Liu, S., Zhang, Y., Su, Y., Liu, X., Bi, S., Lai, H., Zeng, Z. \u0026amp; Li, G. (2021) Promotion of pellet-feed feeding in mandarin fish (\u003cem\u003eSiniperca chuatsi\u003c/em\u003e) by \u003cem\u003eBdellovibrio bacteriovorus\u003c/em\u003e is influenced by immune and intestinal flora. \u003cem\u003eAquaculture,\u003c/em\u003e 542, 736864.\u003c/li\u003e\n\u003cli\u003eChen, Y. K. (2019) The study on regulation of L-carnitine supplementation on fatty acid metabolism by AMPK\u0026alpha;-ACC-CPT signaling pathways in fish. Ph.D., Jilin Agricultural University. \u003c/li\u003e\n\u003cli\u003eDaboor, M., Esmael, N.A. \u0026amp; Lall, S.P. (2010) Effect of different dietary probiotics on growth, feed utilization and digestive enzymes activities of Nile Tilapia, \u003cem\u003eOreochromis niloticus\u003c/em\u003e Mohamed A Essa1, Sabry S EL-Serafy2, Magda M El-Ezabi2, Said.\u003c/li\u003e\n\u003cli\u003eDawood, M.A., Koshio, S., Abdel Daim, MM \u0026amp; Van Doan, H. (2019) Probiotic application for sustainable aquaculture. \u003cem\u003eReviews in Aquaculture,\u003c/em\u003e 11 (3), 907-924.\u003c/li\u003e\n\u003cli\u003ede Paiva-Maia, E., Alves-Modesto, G., Otavio-Brito, L., Olivera, A. \u0026amp; Vasconcelos-Gesteira, T.C. (2013) Efecto de un probi\u0026oacute;tico comercial sobre la concentraci\u0026oacute;n de bacterias y fitoplancton en cultivo de camar\u0026oacute;n (\u003cem\u003eLitopenaeus vannamei\u003c/em\u003e) con sistemas de recirculaci\u0026oacute;n. \u003cem\u003eLatin american journal of aquatic research,\u003c/em\u003e 41 (1), 126-137.\u003c/li\u003e\n\u003cli\u003eGao, Q., Xiao, C., Min, M., Zhang, C., Peng, S. \u0026amp; Shi, Z. (2016) Effects of probiotics dietary supplementation on growth performance, innate immunity and digestive enzymes of silver pomfret, \u003cem\u003ePampus argenteus\u003c/em\u003e. \u003cem\u003eIndian Journal of Animal Research,\u003c/em\u003e 50 (6), 936-941.\u003c/li\u003e\n\u003cli\u003eG\u0026oacute;mez, R.G.D. \u0026amp; Shen, M.A. (2008) Influence of probiotics on the growth and digestive enzyme activity of white Pacific shrimp (\u003cem\u003eLitopenaeus vannamei\u003c/em\u003e). \u003cem\u003eJournal of Ocean University of China,\u003c/em\u003e 7 (2), 215-218.\u003c/li\u003e\n\u003cli\u003eGood, C., Davidson, J., Wiens, G.D., Welch, T.J. \u0026amp; Summerfelt, S. (2015) Flavobacterium branchiophilum and F. succinicans associated with bacterial gill disease in rainbow trout \u003cem\u003eOncorhynchus mykiss\u003c/em\u003e (Walbaum) in water recirculation aquaculture systems. \u003cem\u003eJournal of fish diseases,\u003c/em\u003e 38 (4), 409.\u003c/li\u003e\n\u003cli\u003eHan, S., Liu, Y., Zhou, Z., He, S., Cao, Y., Shi, P., Yao, B. \u0026amp; E, R. (2010) Analysis of bacterial diversity in the intestine of grass carp (\u003cem\u003eCtenopharyngodon idellus\u003c/em\u003e) based on 16S rDNA gene sequences. \u003cem\u003eAquaculture Research,\u003c/em\u003e 42 (1), 47-56.\u003c/li\u003e\n\u003cli\u003eHe, G., Sun, H., Liao, R., Wei, Y., Zhang, T., Chen, Y. \u0026amp; Lin, S. (2022) Effects of herbal extracts (\u003cem\u003eFoeniculum vulgare \u003c/em\u003eand\u003cem\u003e Artemisia annua\u003c/em\u003e) on growth, liver antioxidant capacity, intestinal morphology and microorganism of juvenile largemouth bass, \u003cem\u003eMicropterus salmoides\u003c/em\u003e. \u003cem\u003eAquaculture Reports,\u003c/em\u003e 23, 101081.\u003c/li\u003e\n\u003cli\u003eIslam, S.M., Rohani, MF \u0026amp; Shahjahan, M. (2021) Probiotic yeast enhances growth performance of Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) through morphological modifications of intestine. \u003cem\u003eAquaculture Reports,\u003c/em\u003e 21, 100800.\u003c/li\u003e\n\u003cli\u003eJahan, N., Islam, S.M., Rohani, M.F., Hossain, M.T. \u0026amp; Shahjahan, M. (2021) Probiotic yeast enhances growth performance of rohu (\u003cem\u003eLabeo rohita\u003c/em\u003e) through upgrading hematology, and intestinal microbiota and morphology. \u003cem\u003eAquaculture,\u003c/em\u003e 545, 737243.\u003c/li\u003e\n\u003cli\u003eJiang, Y., Zhou, S., Sarkodie, EK \u0026amp; Chu, W. (2020) The effects of \u003cem\u003eBacillus cereus\u003c/em\u003e QSI-1 on intestinal barrier function and mucosal gene transcription in Crucian carp (\u003cem\u003eCarassius auratus gibelio\u003c/em\u003e). \u003cem\u003eAquaculture Reports,\u003c/em\u003e 17, 100356.\u003c/li\u003e\n\u003cli\u003eKong, W., Huang, C., Tang, Y., Zhang, D., Wu, Z. \u0026amp; Chen, X. (2017) Effect of \u003cem\u003eBacillus subtilis\u003c/em\u003e on Aeromonas hydrophila-induced intestinal mucosal barrier function damage and inflammation in grass carp (\u003cem\u003eCtenopharyngodon idella\u003c/em\u003e). \u003cem\u003eScientific Reports\u003c/em\u003e, 7(1), 1-11.\u003c/li\u003e\n\u003cli\u003eKong, Y., Li, M., Chu, G., Liu, H., Shan, X., Wang, G. \u0026amp; Han, G. (2021) The positive effects of single or conjoint administration of lactic acid bacteria on \u003cem\u003eChanna argus\u003c/em\u003e: digestive enzyme activity, antioxidant capacity, intestinal microbiota and morphology. \u003cem\u003eAquaculture,\u003c/em\u003e 531, 735852.\u003c/li\u003e\n\u003cli\u003eKong, Y., Tian, J. \u0026amp; Wang, G. (2021) Effects of three kinds of lactic acid bacteria on growth, antioxidant and immune functions of \u003cem\u003eChanna argus. Journal of Fisheries of China, \u003c/em\u003e45, 1764-1774.\u003c/li\u003e\n\u003cli\u003eKuebutornye, F.K.A., Abarike, E.D. \u0026amp; Lu, Y. (2019) A review on the application of \u003cem\u003eBacillus\u003c/em\u003e as probiotics in aquaculture. \u003cem\u003eFish \u0026amp; Shellfish Immunology,\u003c/em\u003e 87, 820-828.\u003c/li\u003e\n\u003cli\u003eLanglois, L., Akhtar, N., Tam, K.C., Dixon, B. \u0026amp; Reid, G. (2021) Fishing for the right probiotic: Host-microbe interactions at the interface of effective aquaculture strategies. \u003cem\u003eFEMS Microbiology Reviews\u003c/em\u003e, 45(6), fuab030.\u003c/li\u003e\n\u003cli\u003eLi, L., Zhu, R. \u0026amp; Li, M. (2020) Effects of \u0026beta;-conglycinin on growth performance, antioxidant capacity and Immunity in \u003cem\u003eRhynchocypris lagowski\u003c/em\u003e Dybowski. \u003cem\u003eAquaculture Nutrition,\u003c/em\u003e 26 (6), 2059-2073.\u003c/li\u003e\n\u003cli\u003eLi, M., Kong, YD, Li, L., Zhu, R. \u0026amp; Wu, L.F. (2021) Effects of dietary carbohydrate sources on growth performance, immunity and glycometabolic enzyme activity of \u003cem\u003eRhynchocypris lagowskii\u003c/em\u003e Dybowski. \u003cem\u003eAquaculture Research,\u003c/em\u003e 52 (1), 323-333.\u003c/li\u003e\n\u003cli\u003eLiu, C., Zhao, L. \u0026amp; Shen, Y. (2021) A systematic review of advances in intestinal microflora of fish. \u003cem\u003eFish Physiology and Biochemistry,\u003c/em\u003e 47 (6), 2041-2053.\u003c/li\u003e\n\u003cli\u003eLiu, C.H., Chiu, C.S., Ho, PL \u0026amp; Wang, S.W. (2009) Improvement in the growth performance of white shrimp, Litopenaeus vannamei, by a protease-producing probiotic, \u003cem\u003eBacillus subtilis\u003c/em\u003e E20, from natto. \u003cem\u003eJournal of applied microbiology,\u003c/em\u003e 107 (3), 1031-1041.\u003c/li\u003e\n\u003cli\u003eLuo, S., Jiang, Y., Zhao, Y., Zhang, H. \u0026amp; Zhang, X. (2021) Effects of different \u003cem\u003eBacillus\u003c/em\u003e sp. on growth performance, muscle nutrient composition, intestinal structure and digestive enzyme activities of Pengze. \u003cem\u003eChina Feed, \u003c/em\u003e13, 73-79.\u003c/li\u003e\n\u003cli\u003eMeng, X., Wu, S., Hu, W., Zhu, Z., Yang, G., Zhang, Y., Qin, C., Yang, L. \u0026amp; Nie, G. (2021) \u003cem\u003eClostridium butyricum\u003c/em\u003e improves immune responses and remodels the intestinal microbiota of common carp (\u003cem\u003eCyprinus carpio\u003c/em\u003e L.). \u003cem\u003eAquaculture,\u003c/em\u003e 530, 735753.\u003c/li\u003e\n\u003cli\u003eMuduli, C., Tripathi, G., Paniprasad, K., Kumar, K., Singh, R.K. \u0026amp; Rathore, G. (2021) Virulence potential of \u003cem\u003eAeromonas hydrophila\u003c/em\u003e isolated from apparently healthy freshwater food fish. \u003cem\u003eBiologia,\u003c/em\u003e 76 (3), 1005-1015.\u003c/li\u003e\n\u003cli\u003eNimalan, N., S\u0026oslash;rensen, S.L., Fečkaninov\u0026aacute;, A., Ko\u0026scaron;čov\u0026aacute;, J., Mudroňov\u0026aacute;, D., Gancarč\u0026iacute;kov\u0026aacute;, S., Vatsos, I.N., Bisa, S., Kiron, V. \u0026amp; S\u0026oslash;rensen, M. (2022) Mucosal barrier status in Atlantic salmon fed marine or plant-based diets supplemented with probiotics. \u003cem\u003eAquaculture,\u003c/em\u003e 547, 737516.\u003c/li\u003e\n\u003cli\u003eQin, L., Xiang, J., Xiong, F., Wang, G., Zou, H., Li, W., Li, M. \u0026amp; Wu, S. (2020) Effects of \u003cem\u003eBacillus licheniformis \u003c/em\u003eon the growth, antioxidant capacity, intestinal barrier and disease resistance of grass carp (\u003cem\u003eCtenopharyngodon idella\u003c/em\u003e). \u003cem\u003eFish \u0026amp; shellfish immunology,\u003c/em\u003e 97, 344-350.\u003c/li\u003e\n\u003cli\u003eRing\u0026oslash;, E., Van Doan, H., Lee, S.H., Soltani, M., Hoseinifar, S.H., Harikrishnan, R. \u0026amp; Song, SK (2020) Probiotics, lactic acid bacteria and bacilli: interesting supplementation for aquaculture. \u003cem\u003eJournal of applied microbiology,\u003c/em\u003e 129 (1), 116-136.\u003c/li\u003e\n\u003cli\u003eRuiz Sella, S.R., Bueno, T., de Oliveira, A.A., Karp, S.G. \u0026amp; Soccol, C.R. (2021) \u003cem\u003eBacillus subtilis\u003c/em\u003e natto as a potential probiotic in animal nutrition. \u003cem\u003eCritical Reviews in Biotechnology,\u003c/em\u003e 41 (3), 355-369.\u003c/li\u003e\n\u003cli\u003eShin, N.R., Whon, T.W. \u0026amp; Bae, J.W. (2015) Proteobacteria: microbial signature of dysbiosis in gut microbiota. \u003cem\u003eTrends in Biotechnology,\u003c/em\u003e\u003cem\u003e \u003c/em\u003e33(9), 496-503.\u003c/li\u003e\n\u003cli\u003eSimon, R., Docando, F., Nu\u0026ntilde;ez-Ortiz, N., Tafalla, C. \u0026amp; D\u0026iacute;az-Rosales, P. (2021) Mechanisms used by probiotics to confer pathogen resistance to teleost fish. \u003cem\u003eFrontiers in Immunology,\u003c/em\u003e 12.\u003c/li\u003e\n\u003cli\u003eSundh, H., Finne-Fridell, F., Ellis, T., Taranger, G.L., Niklasson, L., Pettersen, E.F., Wergeland, H.I. \u0026amp; Sundell, K. (2019) Reduced water quality associated with higher stocking density disturbs the intestinal barrier functions of Atlantic salmon (\u003cem\u003eSalmo salar\u003c/em\u003e L.). \u003cem\u003eAquaculture,\u003c/em\u003e 512, 734356.\u003c/li\u003e\n\u003cli\u003eTang, J., Qu, F., Tang, X., Zhao, Q., Wang, Y., Zhou, Y., Feng, J., Lu, S., Hou, D. \u0026amp; Liu, Z. (2016) Molecular characterization and dietary regulation of aminopeptidase N (APN) in the grass carp (\u003cem\u003eCtenopharyngodon idella\u003c/em\u003e). \u003cem\u003eGene,\u003c/em\u003e 582 (1), 77-84.\u003c/li\u003e\n\u003cli\u003eTran, N.T., Xiong, F., Hao, Y., Zhang, J., Wu, S. \u0026amp; Wang, G. (2018) Starvation influences the microbiota assembly and expression of immunity-related genes in the intestine of grass carp (\u003cem\u003eCtenopharyngodon idellus\u003c/em\u003e). \u003cem\u003eAquaculture,\u003c/em\u003e 489, 121-129.\u003c/li\u003e\n\u003cli\u003eWang, C. (2017) Effects of \u003cem\u003eBacillus velezensis\u003c/em\u003e V4 and Rhodotorula mucilaginosa on the growth, immune response and gut microbiota of Salmons and Trouts. Ph.D., Institute of Oceanology, Chinese Academy of Sciences.\u003c/li\u003e\n\u003cli\u003eWang, C., Chuprom, J., Wang, Y. \u0026amp; Fu, L. (2020) Beneficial bacteria for aquaculture: nutrition, bacteriostasis and immunoregulation. \u003cem\u003eJournal of Applied Microbiology,\u003c/em\u003e 128 (1), 28-40.\u003c/li\u003e\n\u003cli\u003eWang, X., Zhang, P. \u0026amp; Zhang, X. (2021) Probiotics regulate gut microbiota: an effective method to improve immunity. \u003cem\u003eMolecules,\u003c/em\u003e 26 (19), 6076.\u003c/li\u003e\n\u003cli\u003eWu, S.G., Tian, J.Y., Gatesoupe, F.J., Li, W.X., Zou, H., Yang, B.J. \u0026amp; Wang, G.T. (2013) Intestinal microbiota of gibel carp (\u003cem\u003eCarassius auratus gibelio\u003c/em\u003e) and its origin as revealed by 454 pyrosequencing. \u003cem\u003eWorld J Microbiol Biotechnol,\u003c/em\u003e 29 (9), 1585-1595.\u003c/li\u003e\n\u003cli\u003eMahmoud M. Elsadek, Wang, S. B. \u0026amp; Wu, Z. C. (2023) Characterization of Bacillus spp. isolated from the intestines of Rhynchocypris lagowskii as a potential probiotic and their effects on fish pathogens. \u003cem\u003eMicrobial Pathogenesis, \u003c/em\u003e180,106163\u003c/li\u003e\n\u003cli\u003eXue, J., Shen, K., Hu, Y., Hu, Y., Kumar, V., Yang, G. \u0026amp; Wen, C. (2020) Effects of dietary \u003cem\u003eBacillus cereus\u003c/em\u003e, \u003cem\u003eB. subtilis\u003c/em\u003e, \u003cem\u003eParacoccus marcusii\u003c/em\u003e, and \u003cem\u003eLactobacillus plantarum\u003c/em\u003e supplementation on the growth, immune response, antioxidant capacity, and intestinal health of juvenile grass carp (\u003cem\u003eCtenopharyngodon idellus\u003c/em\u003e). \u003cem\u003eAquaculture Reports,\u003c/em\u003e 17, 100387.\u003c/li\u003e\n\u003cli\u003eYang, E.J., Zhang, J.D., Yang, L.T., Amenyogbe, E., Wang, W.Z., Huang, J.S. \u0026amp; Chen, G. (2021) Effects of hypoxia stress on digestive enzyme activities, intestinal structure and the expression of tight junction proteins coding genes in juvenile cobia (\u003cem\u003eRachycentron canadum\u003c/em\u003e). \u003cem\u003eAquaculture Research,\u003c/em\u003e 52, 5630-5641.\u003c/li\u003e\n\u003cli\u003eYang, G., Shen, K., Yu, R., Wu, Q., Yan, Q., Chen, W., Ding, L., Kumar, V., Wen, C. \u0026amp; Peng, M. (2020) Probiotic (\u003cem\u003eBacillus cereus\u003c/em\u003e) enhanced growth of Pengze crucian carp concurrent with modulating the antioxidant defense response and exerting beneficial impacts on inflammatory response via Nrf2 activation. \u003cem\u003eAquaculture,\u003c/em\u003e 529, 735691.\u003c/li\u003e\n\u003cli\u003eYang, P., Hu, H., Li, Y., Ai, Q., Zhang, W., Zhang, Y. \u0026amp; Mai, K. (2019) Effect of dietary xylan on immune response, tight junction protein expression and bacterial community in the intestine of juvenile turbot (\u003cem\u003eScophthalmus maximus\u003c/em\u003e L.). \u003cem\u003eAquaculture,\u003c/em\u003e 512, 734361.\u003c/li\u003e\n\u003cli\u003eYu, T., Chen, Y., Chen, X., Abdallah, G., Guo, Z., Zhao, Y., Wang, Q. \u0026amp; Zhang, D. (2020) The effect of oxidized fish oil on lipid metabolism in \u003cem\u003eRhynchocypris lagowski\u003c/em\u003e Dybowski. \u003cem\u003eAquaculture Reports,\u003c/em\u003e 17, 100388.\u003c/li\u003e\n\u003cli\u003eYu, T., Wang, Q.J., Chen, X.M., Chen, Y.K., Ghonimy, A., Zhang, D.M. \u0026amp; Wang, G.Q. (2020) Effect of dietary L-carnitine supplementation on growth performance and lipid metabolism in \u003cem\u003eRhynchocypris lagowski \u003c/em\u003eDybowski fed oxidized fish oil. \u003cem\u003eAquaculture Research,\u003c/em\u003e 51, 3698-3710.\u003c/li\u003e\n\u003cli\u003eZhang, D., Gao, Y., Ke, X., Yi, M., Liu, Z., Han, X., Shi, C. \u0026amp; Lu, M. (2019) \u003cem\u003eBacillus velezensis\u003c/em\u003e LF01: in vitro antimicrobial activity against fish pathogens, growth performance enhancement, and disease resistance against streptococcosis in Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e). \u003cem\u003eApplied Microbiology and Biotechnology,\u003c/em\u003e 103 (21), 9023-9035.\u003c/li\u003e\n\u003cli\u003eZhang, D., Guo, Z., Zhao, Y., Wang, Q. \u0026amp; Gao, Y. (2019) L-carnitine regulated Nrf2/Keap1 activation in vitro and in vivo and protected oxidized fish oil-induced inflammation response by inhibiting the NF-\u0026kappa;B signaling pathway in \u003cem\u003eRhynchocypris lagowski \u003c/em\u003eDybowski. \u003cem\u003eFish \u0026amp; shellfish immunology,\u003c/em\u003e 93, 1100-1110.\u003c/li\u003e\n\u003cli\u003eZhang, J., Huang, M., Feng, J., Chen, Y., Li, M. \u0026amp; Chang, X. (2021) Effects of dietary \u003cem\u003eBacillus licheniformis\u003c/em\u003e on growth performance, intestinal morphology, intestinal microbiome, and disease resistance in common carp (\u003cem\u003eCyprinus carpio\u003c/em\u003e L.). \u003cem\u003eAquaculture International,\u003c/em\u003e 29 (3), 1343-1358.\u003c/li\u003e\n\u003cli\u003eZhang, W., Tan, B., Deng, J., Dong, X., Yang, Q., Chi, S., Liu, H., Zhang, S., Xie, S. \u0026amp; Zhang, H. (2021) Effects of high level of fermented soybean meal substitution for fish meal on the growth, enzyme activity, intestinal structure protein and immune-related gene expression and intestinal flora in juvenile pearl gentian grouper. \u003cem\u003eAquaculture Nutrition, \u003c/em\u003e27(5), 1433-1447.\u003c/li\u003e\n\u003cli\u003eZhang, Y., Yu, M., Lin, L., Wang, J., Zhang, D., Wang, Q., Elsadek, M.M., Wang, G., Yao, Q. \u0026amp; Chen, Y. (2022) Effects of Dietary \u003cem\u003eBacillus velezensis\u003c/em\u003e LSG2-5 on Growth, Immunity, Antioxidant Capacity, and Disease Resistance of Amur minnow (\u003cem\u003eRhynchocypris lagowskii \u003c/em\u003eDybowski). \u003cem\u003eAquaculture Nutrition,\u003c/em\u003e 2022.\u003c/li\u003e\n\u003cli\u003eZhao, Y., Ye, H., Wang, J., Yu, T. \u0026amp; Zhang, D., (2020) Effects of fermented feed on growth, immunity, antioxidant capacity and intestinal microflora of \u003cem\u003ePhoxinus lagowskii\u003c/em\u003e Dybowski. \u003cem\u003eChinese Journal of Animal Science,\u003c/em\u003e 56, 172-176.\u003c/li\u003e\n\u003cli\u003eZhu, R., Li, L., Li, M., Yu, Z., Wang, H., Quan, Y. \u0026amp; Wu, L. (2021) Effects of dietary glycinin on the growth performance, immunity, hepatopancreas and intestinal health of juvenile \u003cem\u003eRhynchocypris lagowskii\u003c/em\u003e Dybowski. \u003cem\u003eAquaculture,\u003c/em\u003e\u003cem\u003e \u003c/em\u003e544, 737030.\u003c/li\u003e\n\u003cli\u003eZiaei-Nejad, S., Rezaei, M.H., Takami, G.A., Lovett, D.L., Mirvaghefi, A. \u0026amp; Shakouri, M. (2006) The effect of \u003cem\u003eBacillus\u003c/em\u003e spp. bacteria used as probiotics on digestive enzyme activity, survival and growth in the Indian white shrimp \u003cem\u003eFenneropenaeus indicus\u003c/em\u003e. \u003cem\u003eAquaculture,\u003c/em\u003e 252, 516-524.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Bacillus velezensis, Rhynchocypris lagowskii Dybowski, intestinal health, intestinal function, intestinal microflora","lastPublishedDoi":"10.21203/rs.3.rs-4133761/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4133761/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"The study was to investigate at how Bacillus velezensis LSG2-5 from the host intestine affected the\ndigestive function, intestinal morphology, intestinal microflora, and expression expression of tight junction protein genes in Rhynchocypris lagowskii Dybowski. Different doses of B. velezensis LSG2-5 were added to diets, namely control (0 CFU/g), B-6 (106 CFU/g), B-7 (107 CFU/g), B-8 (108 CFU/g) and B-9 (109 CFU/g) groups. Fish (mean weight: 9.98 ± 0.05 g) were fed for 56 days. The trypsin, lipase, amylase, γ-glutamyltransferase, Na+-K+-ATPase, and alkaline phosphatase activity in the liver and intestines of the treatment groups considerably increased in comparison to the control group (p\u003c0.05), according to the results. Contrasted with the control group, the muscle layer thickness, lamina propria width, intestinal fold height, and fold breadth of the B-7, B-8, and B-9 groups increased considerably (p\u003c0.05). Intestinal ZO-1, Claudin-3, and APN mRNA expression levels displayed significant up-regulation trends (p\u003c0.05). The profusion of Proteobacteria, Bacteroidetes, Fusobacteria, and Cyanobacteria in intestines first increased and then decreased. In contrast, the abundance of Firmicutes showed an opposite trend. In summary, adding 107~109 CFU/g of B. velezensis LSG2-5 to feed can improve the intestinal health of R. lagowskii Dybowski.","manuscriptTitle":"Effects of dietary Bacillus velezensis LSG2-5 on digestion, intestinal morphology, microflora, and related gene expression in Rhynchocypris lagowskii Dybowski","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-26 08:30:33","doi":"10.21203/rs.3.rs-4133761/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ccf2ebc8-2927-4ad7-b77e-d0b916d70e03","owner":[],"postedDate":"March 26th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-16T16:59:50+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-26 08:30:33","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4133761","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4133761","identity":"rs-4133761","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}