The underlying mechanism of cardiac injury in exertional heat stroke rats based on the scRNA-seq analysis

The underlying mechanism of cardiac injury in exertional heat stroke rats based on the scRNA-seq analysis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The underlying mechanism of cardiac injury in exertional heat stroke rats based on the scRNA-seq analysis Zhenghan Luo, Zhi Li, Chengliang Tang, Jinhai Zhang, Leru Chen, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5268576/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Heat dissipation relies on an intact cardiovascular system to dilate cutaneous blood vessels and increase cardiac output. However, the heart becomes a vulnerable organ and is susceptible to cardiac arrhythmias, functional failure, and focal myocardial necrosis in a hyperthermic heat-damaged state. In particular, people with cardiovascular dysfunction are at a much higher risk of exertional heat stroke (EHS). This study aimed to investigate and validate the cell signaling pathways and key genes associated with EHS by analyzing single-cell RNA sequencing (scRNA-seq) data from cardiac apical tissue of EHS rats. The findings are intended to elucidate the mechanisms underlying cardiac injury and to provide a theoretical basis for the early identification of biomarkers for cardiac injury in EHS. Results After exertional heat radiation, the heart's functionality was compromised. Annotation analysis revealed that the cell type and quantity did not differ between the EHS and control (CTL) groups. Cellchat analysis showed that the signal of EHS cardiac apex cells was enhanced in chemokine signaling pathway. The cardiac apical cells of the EHS group had the highest number of enriched genes in the oxidative stress pathway, according to GO/KEGG analysis of endothelial cells with the biggest proportion of cells. A total of 310 genes with changes in expression between the two groups were evaluated based on the Seurat-FindAllMarkers tools for all cell types. Of these, 18 genes with substantial variability were chosen for further verification. By using RT-qPCR verification, the expression differences of 12 genes were confirmed to be consistent with the above bioinformation analysis. Finally, Additional immunohistochemistry tests verified that Hspa8 and Hspe1 were up-regulated once more, while Id1, Ndufa4, and Cd36 were down-regulated. Conclusions The gene expression levels of Id1, Ndufa4, Cd36 were significantly reduced, and Hspa8, Hspe1 were significantly increased. These screened hypervariable genes play different roles in heat stress-induced mitochondrial and myocardial mechanical damage, protein misfolding, and they may become potential biomarkers in the mechanism of cardiac injury or keep an important link in the functional pathway of action described above. Biological sciences/Biochemistry/Dna Health sciences/Biomarkers/Predictive markers Health sciences/Pathogenesis/Oncogenesis exertional heat stroke (EHS) single cell RNA sequencing (scRNA-seq) cardiac injury Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background The scorching heat has ravaged the world this summer, with record-breaking heat in several cities around the world. As the phenomenon of global warming intensifies, the frequency and intensity of heat wave attacks are on the rise around the world. The incidence of heat-related illnesses is on a continuous upward trend [1]. Heat stroke (HS), the most severe symptoms of heat-related illness, is caused by long-term exposure to high temperatures and an abnormal compensatory threshold for systemic heat accumulation, resulting in an imbalance between heat production and dissipation. which has become an urgent challenge in the current public health field. The rapid onset and progression of HS, as well as the complex mechanisms of pathophysiologic changes, have increased the difficulty for clinicians to assess the condition and provide effective treatment within a short period of time [2]. According to its pathogenesis and the characteristics of the patient group, HS is divided into classical heat stroke (CHS) and exertional heat stroke (EHS). CHS occurs in people with weak thermoregulatory ability, such as the elderly, children, or people with underlying diseases. While, EHS is more common in young and middle-aged people engaged in high-intensity physical activities under high-temperature environments, such as military personnel, athletes and outdoor laborers, etc. Its pathogenesis lies in the excessive metabolic heat production that exceeds the body's physiological heat dissipation capacity, which is mainly manifested as hyperthermia, body temperature above 40°C, dry and hot skin with no sweating, mental disorders and multiple organ dysfunctions. Without timely and appropriate treatment, the mortality rate ranges from 20–70%, and can be as high as 80% in patients over 50 years of age [3,4]. EHS accounts for a significant proportion of sudden sports deaths and had a lethality rate of 22.2% between 2009 and 2018 among high school students in Japan [5]. The rate of clinical diagnosis of EHS has remained at (2.7 ± 0.5)/10,000 from 1998 to 2017 in the U.S. military [6]. A statistic in the U.S. 2024 sports, it was shown that soccer has the highest incidence of EHS, particularly, linemen accounted for 97% of soccer EHS deaths [7]. The high mortality of EHS patients come from multiorgan dysfunction, in which abnormalities in thermoregulation, cardiovascular function and tissue perfusion are dependent on an intact cardiovascular system. During heat stress, the heart can redistribute blood by increasing blood flow through the skin, altering blood pressure and tissue perfusion levels. Therefore, regulation of the cardiovascular system plays a key role in the pathogenesis of EHS. However, in the state of thermal injury, the heart becomes a vulnerable organ and is prone to arrhythmias, functional failure and focal myocardial necrosis. Individuals with cardiovascular dysfunction, in particular, are at a much higher risk of EHS. Because they are unable to adequately increase cardiac output and cutaneous blood flow [8,9]. In a meta-analysis, underlying cardiovascular disease significantly increased the risk of death in heat stroke patients by nearly 2.5 times [10]. The high fatality rate of EHS is largely due to the inability to identify early and misdiagnosis for the best treatment time. In this study, EHS rat model was constructed and their apical heart tissues were dissociated for scRNA-seq. By analyzing the expression difference and the correlation function pathway of genes, the hypervariable genes between EHS and normal rats were screened. These genes may be involved in the pathogenesis of the mechanism of cardiac injury, or become a biodiagnostic factor for early identification in EHS rats, which provided a theoretical basis for the pathogenesis, identification and diagnosis. Methods Animal model building The rats were reared adaptively for 4 days under an environment of normal temperature (25 ± 2°C) and normal humidity (50 ± 5%). Then gradually increase the speed and time of the treadmill (5 min-10 rpm, 10 min-15 rpm, 15 min-17 rpm, 20 min-19 rpm, 25 min-21 rpm) for the screening of robust rats. To simulate a high temperature (37 ± 2℃) and high humidity (70 ± 5%) environment, 20 rats were randomly divided into CTL and the EHS group. The parameters of the treadmill were set to 12 rpm, 1.5 mA click. Body temperature was measured every 5 min until the rectal temperature reached 42°C. Rats were euthanized by cervical dislocation after anesthesia with intraperitoneal injection of sodium pentobarbital (150–200 mg/kg). Apical tissue anatomical extraction The rats were anesthetized by intraperitoneal injection of 2% sodium pentobarbital. The abdominal skin and muscles were cut to expose the abdominal and thoracic cavities. The left ventricle was punctured with a hypodermic needle. If the fluid had not leaked out, then the right auricle was clipped to bleed out the blood. Finally, the saline was slowly pushed in until the fluid from the right auricle was essentially bloodless. The apical tissue was taken and immersed in 4% paraformaldehyde fixative and set aside. Apical tissue single-cell suspensions preparation The apical tissues were minced into small pieces of approximately 2 mm, total 200 mg weight. The minced tissues were transferred to EP tubes containing digestion buffer and digested with agitation in a 37°C water bath for 15 min, removing them every 5 min and gently shaking them by hand. After digestion, the EP tube was placed on ice and blown up and down 5–10 times with a 5 mL pipette. The solution was filtered through a 100 µm cell filter and the filter was washed with 8.5 mL of DMEM to a final volume of 10 mL of cell suspension. Cell suspension was centrifuged at 300 g 4°C for 5 min. The supernatant was discarded, and the precipitate was washed with DPBS and 2% FBS liquid. Percoll solution was added to make a 27%Percoll-cell solution, and the solution was centrifuged at 15,000 g 4°C for 20 min. Then the cells were washed and resuspended in DPBS and 0.04% BSA liquid. cell viability was assessed by AO/PI. Single-cell sequencing Single-cell suspensions with PBS were loaded onto microwell chip using the Singleron Matrix® Single Cell Processing System. Barcoding Beads are subsequently collected from the microwell chip, followed by reverse transcription of the mRNA captured to obtain cDNA. The amplified cDNA is then fragmented and ligated with sequencing adapters. The scRNA-seq libraries were constructed according to the protocol of the GEXSCOPE® Single Cell RNA Library Kits. Individual libraries were diluted to 4 nM, pooled, and sequenced on Illumina novaseq 6000 with 150 bp paired end reads. Bioinformatics analysis R (version 4.3.2), the Seurat package creates Seurat objects, dimensionality reduction and cluster analysis for UMAP visualization. The findMarkers function is used to find highly differentially expressed genes between EHS and control groups. The Garnett package cell classifiers annotate cell types based on marker genes in subpopulations within rat databases. The Celcall package constructs Ligand-Receptor-Transcription Factor (L-R-TF) axis dataset to mine intercellular communication networks and internal regulatory mechanisms. ClusterProfiler package clusters differential genes for GO function annotation and KEGG pathway enrichment. STRINGdb package constructs protein-interaction network relationships. Pathological section HE staining The tissue blocks were fixed, embedded in paraffin, and sectioned at 4 µm slicer. Sections were dewaxed with xylene and washed with ethanol and purified water. Hematoxylin staining was performed for 5 minutes and rinsed with tap water. Differentiate with hydrochloric acid and ethanol for 30 seconds, soak in tap water for 15 min, soak in eosin solution for 2 min, routinely dehydrate with ethanol and xylene, and seal with neutral resin. RT-qPCR The Coding Sequences of the genes were obtained from the NCBI database. F&R primers for 18 genes fragments were designed with β-actin as the internal reference gene. 30 g of rat apical tissue together with 1800 ul PBS and then put into a tissue grinder for 10 min.Grinding fluid was centrifuged at 12 000 rpm 4℃ for 1 min, and then tissue RNA was extracted according to the instructions of the RNAfast200 Total RNA Extraction Kit. Mix 2ul of RNA, 1ul of PrimeScript, 1ul of Step Enzyme Mix, 1 ul of F&R Primers, 12.5ul of 2X one Step Buffer, 7.5ul of ddH2O, and then perform RT-qPCR at 42℃ for 5 min, 95℃ for 10 sec, 1 cycle, 95℃ for 5 s, 60℃ for 30 sec, and 40 cycles. The relative quantitative analysis was performed by the 2 −ΔΔCt method. Statistical analysis GraphPad Prism 8 and R software were used for statistical analysis. Measurements that conformed to normal distribution were expressed as mean ± standard deviation ( x̅ ±s), and comparisons between groups were made using the student t-test. p < 0.05 was considered a statistically significant difference. Results The general flow of the study is shown below (Fig. 1 ). Five screened highly variable genes have the potential to influence EHS heart injury by participating in functions such as mitochondrial damage, myocardial mechanical damage, and protein misfolding. The solid arrows in the figure represent the clearly known and the dashed arrows represent the unknown and conjecture. EHS causes damage to heart function An EHS model was built with success. The blood levels of creatine kinase (CK) and lactate dehydrogenase (LDH) were aberrant, and the quantities reached a maximum at 2 hours after the successful modeling (Fig. 2 A), suggesting an early recognition of myocardial injury in cardiac enzyme profiles. EHS rats exhibited disordered myofibrillar organization, hypertrophy with significant structural rupture, inflammatory cell infiltration, and cardiac lesions that grew worse over time as compared to CTL rats only with high temperature and humidity(Fig. 2 B). Annotation and classification of apical tissue cells in EHS Effective cell density and viability were obtained in both CTL and EHS groups after dissociation of apical tissues, 2.91x10^6, 88.3% and 42.35x10^6, 86.7%, respectively (Fig. 3 A ). Following library construction and sequencing, the cells were classified into 13 different cell types: endothelial cells, smooth muscle cells, NKT cells, NK cells, T cells, and B cells, Monocytes, Granulocytes, Dendritic cells, Macrophages, Glial cells, Pericytes and Fibroblasts. There were no significant differences in cell types and cell counts between the two groups of samples (Fig. 3 B). Screening of EHS apical tissue-associated signaling pathways and key genes at the level of bioinformatic analysis By constructing a ligand-receptor-transcription factor dataset in frequency and intensity of cell-cell interactions, a significant increase in intercellular network connectivity among cells in the EHS group was observed (Fig. 4 A). Notably, there was a marked enhancement in intercellular communication between granulocytes and NKT cells, particularly within the signaling pathways associated with chemokines and focal adhesion formation (Fig. 4 B, 4 C). Further gene enrichment analysis of endothelial cells, which constituted the largest cell population, revealed that the most enriched genes were associated with oxidative stress biological processes, lipid raft structures, ubiquitin-like protein ligases, and the functions of unfolded protein-binding molecules (Fig. 4 D). Meanwhile, protein network interaction analysis indicated that the majority of cellular functions were link to members of the heat shock protein family (Fig. 4 E). When considering all cells within each group as a subpopulation, 310 differentially expressed genes were identified using the FindMarkers function to compare the CTL and EHS groups, with 18 highly variable genes selected for subsequent validation. The results of the bioinformatic analysis demonstrated that the expression levels of the Id1, Clec2g, Timp4, Ndufa4, Depp1, Ptma, Cd36, and Cxcl12 genes were down-regulated, while the expression levels of the Eef1a1, Hspb1, Hspa8, Dnajb1, Hspe1, Ubc, Bag3, Hmox1, Dusp1, and Klf2 genes were up-regulated (Fig. 4 F). Validation of key genes in the apical tissue-associated signaling pathway at the genetic level Next, the changes in the expression of the above 18 genes were verified by RT-qPCR, and primers were designed as shown in Table 1 . The mRNA transcript levels of the genes Id1, Ndufa4, Depp1, Ptma, Bags, Cd36, and Hmox1 were significantly lower than those of CTL, while the genes Eef1a1, Hspb1, and Klf2 showed significantly higher levels. Except for Bags and Hmox1, the changes in expression of other genes were consistent with the results of the above bioinformatic analysis (Fig. 5 ). Table 1 Gene design primers Num. Genes Forward primers Reverse primers 1 Id1 CGAAGTGGTGCTTGGTCT TCTGAGGCAGGGTAGGC 2 Clec2g TCCCCCGAATCTCCTGCTAA CCTACCTGAACGACATCGGG 3 Timp4 TTCTCTGTTGCCTTCTGTTGGT CATAGTTGGTCCCCTCCCAC 4 Ndufa4 GTGTCCTAATCTTCTCTCTGCGTG AGTGGAAAATTGTGCGGATGG 5 Depp1 TAGACTTCCTGCCACCCTGA AGGAGAGAGAAGCTGGGGAG 6 Ptma CACCCCACCAAAACCACAAC TTTCACACATACATCAAACAGGC 7 Eef1a1 TTTTTCGCAACGGGTTTGCC GAGGCTTGTCAGTTGGACGA 8 Hspb1 GTGGAGATCACTGGCAAGCA GGAGGGAGCGTGTATTTCCG 9 Hspa8 GTGGTCTCGTCATCAGCACA GGAAGACACCCACACAGGAG 10 Dnajb1 ACTCTTGCCCTCTGTTGTCC AACAGAGTCGAAGGACTGCTC 11 Hspe1 CCGCCTTCTCTCACGCTAA TCACAGTTTCAGCGGCACTC 12 Ubc ACACCAAGAAGGTCAAACAGGA CACCTCCCCATCAAACCCAA 13 Bag3 ACATTCCCATTCCCGTCCAC TGTTTTCGGGTTGGGTGACA 14 Hmox1 TTCACCTTCCCGAGCAT GCCTCTTCTGTCACCCTGT 15 Dusp1 CTGTTTCCATCCCCGTCCAC ACTGAAAGCTACAAACCTACACT 16 Cd36 TATTGGGAAAGTTATTGCG CTGGGTTCTGGAGTGGG 17 Klf2 TATCTTGCCGTCCTTTGCCA ACAGGATGAAGTCCAGCACG 18 Cxcl12 TCAGAAATGGGAACAAGA GTAGTTCAAGACCGTAGAGG Validation of key genes in the apical tissue-associated signaling pathway at the Immunohistochemical level Immunohistochemical tests were then performed on genes whose differences in expression were statistically significant and consistent with the findings of the bioinformatic analysis. The results demonstrated a significant increase in the protein expression levels of Hspa8 and Hspe1, while a significant decrease in the levels of Id1, Ndufa4, and Cd36 (Fig. 6 ). Discussion The prevalence of heat stroke is rising annually due to the trend of global warming. Rapid disease progression and particularly severe clinical symptoms lead to a higher disability and fatality rates. Based on clinical epidemiological studies, the cardiovascular system plays a key role in the process of heat stroke, not only responsible for the blood perfusion of organs, but also involved in the whole body heat dissipation process. According to the statistics, about 20%-65% of heat stroke patients will experience circulatory shock, and 85% will experience electrocardiographic abnormalities [11,12]. Therefore, the heart becomes one of the first priority and most vulnerable target organs among the multiple organ dysfunctions caused by heat stroke, and it is particularly important to conduct an in-depth study on the mechanism of myocardial injury in EHS. In this study, we screened the signaling pathways and key genes related to EHS through scRNA-seq analysis of rat apical tissues. We next confirmed the changes in the expression of the highly variable genes using RT-qPCR and immunohistochemistry. It can further confirm the reliability of the scRNA-seq data and also broaden the scope of the highly variable gene expression screening test to include functional studies of related genes. Heat stroke has a complicated etiology that can be brought on by numerous variables. A malfunction in the body's heat regulating system can lead to heat stroke. Multi-organ damage is eventually caused by the interplay of cytotoxicity, inflammation, and coagulation by heat exposure [13–15]. The pathological modifications of the body's inability to heat stimulation and the associated mechanisms of systemic inflammation and multi-organ failure are the key areas of current study on the cause of heat stroke. The high temperatures might cause damage to cells by directly causing necrosis or apoptosis [16]. On the other hand, the systemic inflammatory response syndrome occurs and then develops into “like-sepsis”, due to hyperthermia damage, ischemia and reperfusion, and inflammatory cell recruitment [17]. In this study, we found that the cellular functions, which were significantly increased between the rat apical cell interactions after exertional exercise, were mainly in the areas of cellular structural stabilization, protein misfolding, oxidative stress, inflammatory response, and chemotactic response, as revealed by the bioinformatic analysis of scRNA-seq. And the research findings showed the expression levels of Id1, Ndufa4 and Cd36 genes were significantly reduced, while the expression levels of Hspa8 and Hspe1 genes were significantly increased. Inhibitors of differentiation 1 (Id1), a member of the helix-loop-helix (HLH) family of transcription factors, plays a role in the formation and stabilization of cellular structures, cardiogenic and protective processes, and the generation of oxidative stress. In Id1 knockout mice, the researchers found that Id1 prevented hyperglycemia-induced microvascular damage and promoted angiogenesis [18]. Vascular endothelial growth factor signaling and endothelial cell angiogenic activity can be enhanced in lung cancers by up-regulated Id1 gene expression [19]. Hypoxia, vascular endothelial growth factor, TNF-α, NAD(P)H oxidase, and other plaque-forming factors upregulate Id1 molecular expression [20]. Key response mechanisms of β-cells to reactive oxygen species (ROS) stress caused by iron overload are determined by Hmox1, Id1, and Id3 in the pancreas [21]. NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 4 (Ndufa4) is a member of the mitochondrial electron transport chain complexes. It is expressed in various human tissues and cells, especially in heart, skeletal muscle and brain. Its function is associated with oxidative stress due to impaired mitochondrial, and plays an important role in the oxidative phosphorylation process as well as in the maintenance of the cytochrome C oxidase structural [22]. MiR-210-3p promotes cardiomyocyte apoptosis and mitochondrial dysfunction by targeting Ndufa4. Ndufa4 can protect the activity of mitochondrial NADH-ubiquinone oxidoreductase and reduce myocardial I/R induced oxidative stress damage [23]. Ca2 + activation can lead to the transfer of Ndufa4 from NADH-ubiquinone redox-active monomer to cytochrome C oxidase, with concomitant increase in ROS formation [24]. Cluster of differentiation 36 (Cd36) is a member of the scavenger receptor family of type 2 scavenger receptors that are widely distributed in myocardial, and skeletal muscle tissues. More and more research indicate that Cd36 is actively involved in the pathology of cardiovascular diseases such as myocarditis, cardiac hypertrophy and ischemia/reperfusion (I/R). In cardiovascular diseases, environmental stimuli such as hyperglycemia, hyperlipidemia, and hyperinsulinemia cause up-regulation of myocardial and vascular Cd36 expression, and disrupt the glucose-lipid metabolism balance in the heart, thus causing cardiac and vascular pathological changes [25]. Overexpression of Cd36 increases the uptake of long-chain fatty acids in cardiomyocytes, which can generate a large amount of reactive oxygen species (ROS) and further induce the occurrence of inflammation [26]. Cardiomyocyte-specific miR-100 overexpression leads to the downregulation of CD36 expression, and protects against heart failure under pressure overload in mice through reducing fatty acid uptake and ROS production [27]. Heat shock proteins (Hsp), also known as molecular chaperone proteins or stress proteins, are proteins produced by cells exposed to biotic and abiotic stresses, including heat shock, heat stress and infection. Many studies have demonstrated that heat shock proteins can be involved in regulating immune and inflammatory responses under heat stress, including HSP27, HSP70 and HSP90 [28]. When a heat wave strikes, the human body activates the expression of heat shock proteins answering to heat stress, which recognize misfolded proteins and help them to refold to their usual conformation, and protects the cell structure and function[3]. Our study found that the expression levels of Hspa8 (Hsp70) and Hspe1 (Hsp10) genes were significantly elevated in apical tissues of EHS. Hsp70 is most popularly studied in cardiovascular diseases. Cardioprotection in the inflammatory response to myocardial ischemia-reperfusion injury, Hsp70 can activate extracellular regulated protein kinases (ERK)1/2 and p38 mitogen-activated protein kinase (MAPK) signaling pathways by Toll-like receptor 4 (TLR4). In response to reactive oxygen species accumulation, Hsp70 induces a decrease in the expression of manganese superoxidedismutase (Mn-SOD), which attenuates oxidative stress and inhibits ROS-induced cardiac mitochondrial dysfunction [29]. HSP10, as a member of the family of small-molecule shock proteins, also plays an important role in intracellular regulation of protein folding and degradation [30]. Whether heat shock proteins play an important function in cardiovascular injury in heat stroke through interactions with protein folding degradation as well as cellular oxidative stress provides a new research direction to further elucidate the molecular mechanism of myocardial injury in exertional heat stroke. Whether the screened molecules of Id1, Ndufa4, Cd36, Hspa8 and Hspe1 genes are involved in the process of heat and oxidative stress, and whether they can be biomolecular markers for the pathogenesis and diagnosis of EHS, and what roles they play in the pathogenesis of EHS need further exploration. Conclusion In our study, we screened the apical tissues of EHS rats for highly variable signaling pathways associated with chemokines and focal adhesion formation, highly variable cellular function in roles-oxidative stress, membrane structure formation, ubiquitination junctions, and highly variable genes with Id1, Ndufa4, Cd36, Hspa8, Hspe1 by scRNA-seq bioanalysis. Against these highly variable genes expression changes, we have validated. The available studies shows that these screened hypervariable genes play different roles in heat stress-induced mitochondrial and myocardial mechanical damage, protein misfolding. But what role these genes play in the pathways and cellular functional roles of the above is the main direction of our subsequent research. Perhaps they may become potential biomarkers or keep an important link in the mechanism of cardiac injury. Declarations Animal Ethics approval statement The rats were purchased from Nantong University. The quality testing was done by the Institute of Health and Environmental Technology, Soochow University. The laboratory Animal License was No. SCXK(Su)2019-0001. The study was approved by the Animal Ethics Committee of Huadong Research Institute for Medicine and Biotechniques. The study protocol was approved by Huadong Research Institute for Medicine and Biotechniques, National Clinical Research Center for Kidney Diseases Jinling Hospital and Department of Disease Control and Prevention Donghai Hospital. All methods were carried out in accordance with relevant guidelines and regulations. All procedures were conducted in full compliance with the ARRIVE guidelines. Consent for publication Not applicable. Availability of data and materials All data generated or analysed during this study are included in this published article. Competing interests The authors declare that they have no competing interests. Funding This work was supported by the Center for Disease Control and Prevention “Yiqi” Independent Innovation Incubation Fund (2023YQFH09) Authors’ contributions ZHL : Conceptualization; Experiment Design; Experiment Development; Data curation; Formal analysis; Writing-original draft; ZL: Sample Collection; Data curation; CLT : Experiment Development; JHZ : Experiment Instruction; L R C: Experiment Instruction; QYF : Sample Collection; Data curation; QZ : Experiment Instruction; Experiment Development; HY: Experiment Development; Formal analysis; ZY: Formal analysis; CHW: Supervision; Writing - review & editing; FZ : Supervision; Writing - review & editing; Funding acquisition. All authors read and approved the final manuscript. Acknowledgements Not applicable. References Y Desai, H Khraishah, and B Alahmad. Heat and the Heart. Yale J Biol Med. 2023;96(2):197–203. Y Epstein, and R Yanovich. Heatstroke. N Engl J Med. 2019;380(25):2449-59. A Bouchama, B Abuyassin, C Lehe, O Laitano, O Jay, FG O'Connor, and LR Leon. Classic and exertional heatstroke. Nat Rev Dis Primers. 2022;8(1):8. SY Liu, JC Song, HD Mao, JB Zhao, and Q Song. Expert consensus on the diagnosis and treatment of heat stroke in China. Mil Med Res. 2020;7(1):1. MS Yamanaka, Y Hosokawa, M Ayusawa, N Hirose, and K Kaneoka. Epidemiology of sports-related fatalities during organized school sports in Japanese high schools between 2009 and 2018. PLoS One. 2021;16(8):e0256383. JD Périard, D DeGroot, and O Jay. Exertional heat stroke in sport and the military: epidemiology and mitigation. Exp Physiol. 2022;107(10):1111-21. SA Anderson, ER Eichner, S Bennett, BP Boden, B Colgate, R Courson, JK Davis, GA Elkins, LW Judge, M Krueger, KL Kucera, K Niehoff, Y Rooks, JB Tucker, and WO Roberts. Preventing Exertional Heat Stroke in Football: Time for a Paradigm Shift. Sports Health. 2024:19417381241260045. CM Chao, LY Wang, CC Huang, WT Chang, LY Tang, MT Lin, and CP Chang. Myocardial structure and functional alterations in a preclinical model of exertional heat stroke. Life Sci. 2023;323:121640. R Xia, M Sun, Y Li, J Yin, H Liu, J Yang, J Liu, Y He, B Wu, G Yang, and J Li. The pathogenesis and therapeutic strategies of heat stroke-induced myocardial injury. Front Pharmacol. 2023;14:1286556. MJ Douma, T Aves, KS Allan, JC Bendall, DC Berry, WT Chang, J Epstein, N Hood, EM Singletary, D Zideman, and S Lin. First aid cooling techniques for heat stroke and exertional hyperthermia: A systematic review and meta-analysis. Resuscitation. 2020;148:173 − 90. IGY Asmara. Diagnosis and Management of Heatstroke. Acta Med Indones. 2020;52(1):90–97. MG Austin, and JW Berry. Observations on one hundred cases of heatstroke. J Am Med Assoc. 1956;161(16):1525-9. LR Leon, and BG Helwig. Heat stroke: role of the systemic inflammatory response. J Appl Physiol (1985). 2010;109(6):1980-8. L Du, L Zhu, X Lu, Y Yu, P Liu, and J Pan. Inhibition of the MLCK/MLC2 pathway protects against intestinal heat stroke-induced injury in rats. J Therm Biol. 2023;116:103655. Q Luo, XY Ji, L Zhang, X Huang, XQ Wang, and B Zhang. Shikonin prevents mice from heat stroke-induced death via suppressing a trigger IL-17A on the inflammatory and oxidative pathways. Biomed Pharmacother. 2023;166:115346. PC Ikwegbue, P Masamba, BE Oyinloye, and AP Kappo. Roles of Heat Shock Proteins in Apoptosis, Oxidative Stress, Human Inflammatory Diseases, and Cancer. Pharmaceuticals (Basel). 2017;11(1). CL Lim. Heat Sepsis Precedes Heat Toxicity in the Pathophysiology of Heat Stroke-A New Paradigm on an Ancient Disease. Antioxidants (Basel). 2018;7(11). S Sharma, and M Plotkin. Id1 expression in kidney endothelial cells protects against diabetes-induced microvascular injury. FEBS Open Bio. 2020;10(8):1447-62. C Cheng, G Zhu, Y Li, H Wang, S Wang, C Li, J Feng, Z Wang, and W Li. Single-cell transcriptome analysis reveals cellular and molecular alterations in small cell lung cancer tumors following chemotherapy. Int J Cancer. 2023;153(6):1273-86. HJ Kim, H Chung, YG Yoo, H Kim, JY Lee, MO Lee, and G Kong. Inhibitor of DNA binding 1 activates vascular endothelial growth factor through enhancing the stability and activity of hypoxia-inducible factor-1alpha. Mol Cancer Res. 2007;5(4):321-9. M Hamad, AK Mohammed, MY Hachim, D Mukhopadhy, A Khalique, A Laham, S Dhaiban, K Bajbouj, and J Taneera. Heme Oxygenase-1 (HMOX-1) and inhibitor of differentiation proteins (ID1, ID3) are key response mechanisms against iron-overload in pancreatic β-cells. Mol Cell Endocrinol. 2021;538:111462. S Zong, M Wu, J Gu, T Liu, R Guo, and M Yang. Structure of the intact 14-subunit human cytochrome c oxidase. Cell Res. 2018;28(10):1026-34. TT Zhou, XY Wang, J Huang, YZ Deng, LJ Qiu, HY Liu, XW Xu, ZX Ma, L Tang, and HP Chen. Mitochondrial Translocation of DJ-1 Is Mediated by Grp75: Implication in Cardioprotection of Resveratrol Against Hypoxia/Reoxygenation-Induced Oxidative Stress. J Cardiovasc Pharmacol. 2020;75(4):305 − 13. B Kadenbach. Complex IV - The regulatory center of mitochondrial oxidative phosphorylation. Mitochondrion. 2021;58:296–302. H Shu, Y Peng, W Hang, J Nie, N Zhou, and DW Wang. The role of CD36 in cardiovascular disease. Cardiovasc Res. 2022;118(1):115 − 29. JW Hao, J Wang, H Guo, YY Zhao, HH Sun, YF Li, XY Lai, N Zhao, X Wang, C Xie, L Hong, X Huang, HR Wang, CB Li, B Liang, S Chen, and TJ Zhao. CD36 facilitates fatty acid uptake by dynamic palmitoylation-regulated endocytosis. Nat Commun. 2020;11(1):4765. C Smolka, D Schlösser, C Koentges, A Tarkhnishvili, O Gorka, D Pfeifer, X Bemtgen, A Asmussen, O Groß, P Diehl, M Moser, C Bode, H Bugger, S Grundmann, and F Pankratz. Cardiomyocyte-specific miR-100 overexpression preserves heart function under pressure overload in mice and diminishes fatty acid uptake as well as ROS production by direct suppression of Nox4 and CD36. Faseb j. 2021;35(11):e21956. J Spierings, and W van Eden. Heat shock proteins and their immunomodulatory role in inflammatory arthritis. Rheumatology (Oxford). 2017;56(2):198–208. KH Lee, J Jeong, and CG Yoo. Positive feedback regulation of heat shock protein 70 (Hsp70) is mediated through Toll-like receptor 4-PI3K/Akt-glycogen synthase kinase-3β pathway. Exp Cell Res. 2013;319(1):88–95. AS Bie, C Cömert, R Körner, TJ Corydon, J Palmfeldt, MS Hipp, FU Hartl, and P Bross. An inventory of interactors of the human HSP60/HSP10 chaperonin in the mitochondrial matrix space. Cell Stress Chaperones. 2020;25(3):407 − 16. Additional Declarations No competing interests reported. Supplementary Files RawData.zip Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5268576","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":379373302,"identity":"95edd9c7-6834-4c2c-ac54-6f54856ce470","order_by":0,"name":"Zhenghan Luo","email":"","orcid":"","institution":"Huadong Research Institute for Medicine and Biotechniques","correspondingAuthor":false,"prefix":"","firstName":"Zhenghan","middleName":"","lastName":"Luo","suffix":""},{"id":379373303,"identity":"24353583-f75c-4356-8032-9f786d902672","order_by":1,"name":"Zhi Li","email":"","orcid":"","institution":"National Clinical Research Center for Kidney Diseases Jinling Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zhi","middleName":"","lastName":"Li","suffix":""},{"id":379373306,"identity":"4cc8b4f0-ec8b-4859-866f-95043da53017","order_by":2,"name":"Chengliang Tang","email":"","orcid":"","institution":"Huadong Research Institute for Medicine and Biotechniques","correspondingAuthor":false,"prefix":"","firstName":"Chengliang","middleName":"","lastName":"Tang","suffix":""},{"id":379373307,"identity":"750eec7a-eede-4094-8699-efd7a83022ec","order_by":3,"name":"Jinhai Zhang","email":"","orcid":"","institution":"Huadong Research Institute for Medicine and Biotechniques","correspondingAuthor":false,"prefix":"","firstName":"Jinhai","middleName":"","lastName":"Zhang","suffix":""},{"id":379373310,"identity":"374f5f6e-a062-426e-8040-60da950f406a","order_by":4,"name":"Leru Chen","email":"","orcid":"","institution":"Huadong Research Institute for Medicine and Biotechniques","correspondingAuthor":false,"prefix":"","firstName":"Leru","middleName":"","lastName":"Chen","suffix":""},{"id":379373311,"identity":"d107c59f-6fe8-49ee-a527-dc78a047f51c","order_by":5,"name":"Qianyun Fu","email":"","orcid":"","institution":"Department of Disease Control and Prevention Donghai Hospital","correspondingAuthor":false,"prefix":"","firstName":"Qianyun","middleName":"","lastName":"Fu","suffix":""},{"id":379373313,"identity":"772258e0-d14a-4447-bc18-0e708b699b12","order_by":6,"name":"Qi Zhang","email":"","orcid":"","institution":"Huadong Research Institute for Medicine and Biotechniques","correspondingAuthor":false,"prefix":"","firstName":"Qi","middleName":"","lastName":"Zhang","suffix":""},{"id":379373314,"identity":"c9008261-ea3e-4108-8def-848f752b9f88","order_by":7,"name":"Han Yan","email":"","orcid":"","institution":"Huadong Research Institute for Medicine and Biotechniques","correspondingAuthor":false,"prefix":"","firstName":"Han","middleName":"","lastName":"Yan","suffix":""},{"id":379373315,"identity":"8b995ee6-e080-4dda-a7fa-8fced960557a","order_by":8,"name":"Zhan Yang","email":"","orcid":"","institution":"Huadong Research Institute for Medicine and Biotechniques","correspondingAuthor":false,"prefix":"","firstName":"Zhan","middleName":"","lastName":"Yang","suffix":""},{"id":379373316,"identity":"6dbec7d2-9c1e-4d79-9752-a0eea77ba922","order_by":9,"name":"Chunhui Wang","email":"","orcid":"","institution":"Huadong Research Institute for Medicine and Biotechniques","correspondingAuthor":false,"prefix":"","firstName":"Chunhui","middleName":"","lastName":"Wang","suffix":""},{"id":379373318,"identity":"82bd6456-cb68-41b1-92d4-f60046f57966","order_by":10,"name":"Feng Zheng","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwElEQVRIiWNgGAWjYDACCRBhwyDHxt58gBQtaQzGfDzHEkjTkjhPIkeBOB3ys5uPPfyScDi9jSGHgeFHxTbCWhjnHEs3lkk4nNvGcPYAY8+Z24S1MEvkmElL/kjLbWPsS2BmbCNCC5tE/jdpiYS0dDZmHgPitPBI5LBJfkiwSWBjI1aLhESamTRDgo1hGw9bwkGi/CI/I/mZ5I8ECXn5+Y8PPvhRQYQWEGDmgTIOEKceCBh/EK10FIyCUTAKRiQAALPMNUc7klNFAAAAAElFTkSuQmCC","orcid":"","institution":"Huadong Research Institute for Medicine and Biotechniques","correspondingAuthor":true,"prefix":"","firstName":"Feng","middleName":"","lastName":"Zheng","suffix":""}],"badges":[],"createdAt":"2024-10-15 12:08:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5268576/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5268576/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":69351211,"identity":"b127e1ef-2b52-4c75-bcc9-eded0f4d7c47","added_by":"auto","created_at":"2024-11-19 13:07:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":322845,"visible":true,"origin":"","legend":"\u003cp\u003eResearch overview chart\u003c/p\u003e","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5268576/v1/4e4a5278ca5ab2a384010a2c.png"},{"id":69353283,"identity":"c730f8b7-3f1b-4eef-8b96-3005713de6a9","added_by":"auto","created_at":"2024-11-19 13:23:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2300952,"visible":true,"origin":"","legend":"\u003cp\u003eBlood indexes and pathological sections of EHS rats. (A) Changes of CK and LDH of cardiac function in blood indexes. (B) Pathological changes of apical tissue in 0, 2, 4 hours after EHS rats modeling.\u003c/p\u003e","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5268576/v1/d169e1c3324ebd534fd86dd6.png"},{"id":69351215,"identity":"c40f68fd-8cac-4263-a43b-90ba2897ca0a","added_by":"auto","created_at":"2024-11-19 13:07:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":776804,"visible":true,"origin":"","legend":"\u003cp\u003eAnnotation and Classification of cells in EHS apical tissue. (A)The cell concentration and viability in both CTL and EHS group. (B) There were 13 different types of cells discovered, and there were no appreciable variations in the types or quantities of cells between the two groups.\u003c/p\u003e","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5268576/v1/3bf6768c28a0a6aad9dcc96b.png"},{"id":69352498,"identity":"38e8e24e-696f-45ea-bf31-8a7de85a81ff","added_by":"auto","created_at":"2024-11-19 13:15:56","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":104141,"visible":true,"origin":"","legend":"\u003cp\u003eScreening of EHS apical tissue-associated signaling pathways and key genes at the bioinformatic analysis level. (A) Circos diagram of the ligand-receptor interaction. There were differences in the cell communication between the two groups, with the EHS group exhibiting much more interaction. (B, C) Point diagram of cells interaction pathway. Screening was done for adhesion plaque formation signaling pathways, chemokines, with the exception of cancer and osteoclast differentiation pathway. (D) Analysis of gene function enrichment. The oxidative stress bioprocesses, lipid raft structures, ubiquitin-like protein ligases, and functions of unfolded protein-binding molecules were found to have the most enriched genes. (E) Protein interaction network diagram.The heat shock protein family was linked to the majority of cellular functions. (F) Out of 310 differentially expressed genes, 18 highly variable genes were selected.\u003c/p\u003e","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-5268576/v1/b57c3addde356b66cdcc2ca9.png"},{"id":69352499,"identity":"7f06e4df-4a54-449c-8d9d-a6f6239c3e4b","added_by":"auto","created_at":"2024-11-19 13:15:56","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":160625,"visible":true,"origin":"","legend":"\u003cp\u003eRT-qPCR validation diagram. The changes in the expression of the 18 genes were verified by RT-qPCR.\u003c/p\u003e","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-5268576/v1/6abcdc023e79ddada16d5bf6.png"},{"id":69351208,"identity":"39c0dfc2-eb2e-4f3c-92c5-d1d64878bdd2","added_by":"auto","created_at":"2024-11-19 13:07:56","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":605129,"visible":true,"origin":"","legend":"\u003cp\u003eImmunohistochemical validation diagram. The protein expression levels of Id1, Ndufa4 and Cd36 were significantly reduced, and the protein expression levels of Hspa8 and Hspe1 were significantly increased.\u003c/p\u003e","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-5268576/v1/ac1e4e8bae4a40bbb63c413f.png"},{"id":72309421,"identity":"1f592183-4fab-42be-9d0a-60c35f469894","added_by":"auto","created_at":"2024-12-25 05:32:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6097051,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5268576/v1/2e2efebe-939b-4104-af9a-94036d6efa57.pdf"},{"id":69351216,"identity":"33a2d7ea-f7bc-4371-a9c9-caa38b34088b","added_by":"auto","created_at":"2024-11-19 13:07:57","extension":"zip","order_by":12,"title":"","display":"","copyAsset":false,"role":"supplement","size":29333270,"visible":true,"origin":"","legend":"","description":"","filename":"RawData.zip","url":"https://assets-eu.researchsquare.com/files/rs-5268576/v1/d77d2cc60f2de4f3e739cac7.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"The underlying mechanism of cardiac injury in exertional heat stroke rats based on the scRNA-seq analysis","fulltext":[{"header":"Background","content":"\u003cp\u003eThe scorching heat has ravaged the world this summer, with record-breaking heat in several cities around the world. As the phenomenon of global warming intensifies, the frequency and intensity of heat wave attacks are on the rise around the world. The incidence of heat-related illnesses is on a continuous upward trend [1]. Heat stroke (HS), the most severe symptoms of heat-related illness, is caused by long-term exposure to high temperatures and an abnormal compensatory threshold for systemic heat accumulation, resulting in an imbalance between heat production and dissipation. which has become an urgent challenge in the current public health field. The rapid onset and progression of HS, as well as the complex mechanisms of pathophysiologic changes, have increased the difficulty for clinicians to assess the condition and provide effective treatment within a short period of time [2].\u003c/p\u003e \u003cp\u003eAccording to its pathogenesis and the characteristics of the patient group, HS is divided into classical heat stroke (CHS) and exertional heat stroke (EHS). CHS occurs in people with weak thermoregulatory ability, such as the elderly, children, or people with underlying diseases. While, EHS is more common in young and middle-aged people engaged in high-intensity physical activities under high-temperature environments, such as military personnel, athletes and outdoor laborers, etc. Its pathogenesis lies in the excessive metabolic heat production that exceeds the body's physiological heat dissipation capacity, which is mainly manifested as hyperthermia, body temperature above 40\u0026deg;C, dry and hot skin with no sweating, mental disorders and multiple organ dysfunctions. Without timely and appropriate treatment, the mortality rate ranges from 20\u0026ndash;70%, and can be as high as 80% in patients over 50 years of age [3,4]. EHS accounts for a significant proportion of sudden sports deaths and had a lethality rate of 22.2% between 2009 and 2018 among high school students in Japan [5]. The rate of clinical diagnosis of EHS has remained at (2.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5)/10,000 from 1998 to 2017 in the U.S. military [6]. A statistic in the U.S. 2024 sports, it was shown that soccer has the highest incidence of EHS, particularly, linemen accounted for 97% of soccer EHS deaths [7].\u003c/p\u003e \u003cp\u003eThe high mortality of EHS patients come from multiorgan dysfunction, in which abnormalities in thermoregulation, cardiovascular function and tissue perfusion are dependent on an intact cardiovascular system. During heat stress, the heart can redistribute blood by increasing blood flow through the skin, altering blood pressure and tissue perfusion levels. Therefore, regulation of the cardiovascular system plays a key role in the pathogenesis of EHS. However, in the state of thermal injury, the heart becomes a vulnerable organ and is prone to arrhythmias, functional failure and focal myocardial necrosis. Individuals with cardiovascular dysfunction, in particular, are at a much higher risk of EHS. Because they are unable to adequately increase cardiac output and cutaneous blood flow [8,9]. In a meta-analysis, underlying cardiovascular disease significantly increased the risk of death in heat stroke patients by nearly 2.5 times [10].\u003c/p\u003e \u003cp\u003eThe high fatality rate of EHS is largely due to the inability to identify early and misdiagnosis for the best treatment time. In this study, EHS rat model was constructed and their apical heart tissues were dissociated for scRNA-seq.\u0026nbsp;By analyzing the expression difference and the correlation function pathway of genes, the hypervariable genes between EHS and normal rats were screened. These genes may be involved in the pathogenesis of the mechanism of cardiac injury, or become a biodiagnostic factor for early identification in EHS rats, which provided a theoretical basis for the pathogenesis, identification and diagnosis.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimal model building\u003c/h2\u003e \u003cp\u003eThe rats were reared adaptively for 4 days under an environment of normal temperature (25\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C) and normal humidity (50\u0026thinsp;\u0026plusmn;\u0026thinsp;5%). Then gradually increase the speed and time of the treadmill (5 min-10 rpm, 10 min-15 rpm, 15 min-17 rpm, 20 min-19 rpm, 25 min-21 rpm) for the screening of robust rats. To simulate a high temperature (37\u0026thinsp;\u0026plusmn;\u0026thinsp;2℃) and high humidity (70\u0026thinsp;\u0026plusmn;\u0026thinsp;5%) environment, 20 rats were randomly divided into CTL and the EHS group. The parameters of the treadmill were set to 12 rpm, 1.5 mA click. Body temperature was measured every 5 min until the rectal temperature reached 42\u0026deg;C. Rats were euthanized by cervical dislocation after anesthesia with intraperitoneal injection of sodium pentobarbital (150\u0026ndash;200 mg/kg).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eApical tissue anatomical extraction\u003c/h3\u003e\n\u003cp\u003eThe rats were anesthetized by intraperitoneal injection of 2% sodium pentobarbital. The abdominal skin and muscles were cut to expose the abdominal and thoracic cavities. The left ventricle was punctured with a hypodermic needle. If the fluid had not leaked out, then the right auricle was clipped to bleed out the blood. Finally, the saline was slowly pushed in until the fluid from the right auricle was essentially bloodless. The apical tissue was taken and immersed in 4% paraformaldehyde fixative and set aside.\u003c/p\u003e\n\u003ch3\u003eApical tissue single-cell suspensions preparation\u003c/h3\u003e\n\u003cp\u003eThe apical tissues were minced into small pieces of approximately 2 mm, total 200 mg weight. The minced tissues were transferred to EP tubes containing digestion buffer and digested with agitation in a 37\u0026deg;C water bath for 15 min, removing them every 5 min and gently shaking them by hand. After digestion, the EP tube was placed on ice and blown up and down 5\u0026ndash;10 times with a 5 mL pipette. The solution was filtered through a 100 \u0026micro;m cell filter and the filter was washed with 8.5 mL of DMEM to a final volume of 10 mL of cell suspension. Cell suspension was centrifuged at 300 g 4\u0026deg;C for 5 min. The supernatant was discarded, and the precipitate was washed with DPBS and 2% FBS liquid. Percoll solution was added to make a 27%Percoll-cell solution, and the solution was centrifuged at 15,000 g 4\u0026deg;C for 20 min. Then the cells were washed and resuspended in DPBS and 0.04% BSA liquid. cell viability was assessed by AO/PI.\u003c/p\u003e\n\u003ch3\u003eSingle-cell sequencing\u003c/h3\u003e\n\u003cp\u003eSingle-cell suspensions with PBS were loaded onto microwell chip using the Singleron Matrix\u0026reg; Single Cell Processing System. Barcoding Beads are subsequently collected from the microwell chip, followed by reverse transcription of the mRNA captured to obtain cDNA. The amplified cDNA is then fragmented and ligated with sequencing adapters. The scRNA-seq libraries were constructed according to the protocol of the GEXSCOPE\u0026reg; Single Cell RNA Library Kits. Individual libraries were diluted to 4 nM, pooled, and sequenced on Illumina novaseq 6000 with 150 bp paired end reads.\u003c/p\u003e\n\u003ch3\u003eBioinformatics analysis\u003c/h3\u003e\n\u003cp\u003eR (version 4.3.2), the Seurat package creates Seurat objects, dimensionality reduction and cluster analysis for UMAP visualization. The findMarkers function is used to find highly differentially expressed genes between EHS and control groups. The Garnett package cell classifiers annotate cell types based on marker genes in subpopulations within rat databases. The Celcall package constructs Ligand-Receptor-Transcription Factor (L-R-TF) axis dataset to mine intercellular communication networks and internal regulatory mechanisms. ClusterProfiler package clusters differential genes for GO function annotation and KEGG pathway enrichment. STRINGdb package constructs protein-interaction network relationships.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003ePathological section HE staining\u003c/h2\u003e \u003cp\u003eThe tissue blocks were fixed, embedded in paraffin, and sectioned at 4 \u0026micro;m slicer. Sections were dewaxed with xylene and washed with ethanol and purified water. Hematoxylin staining was performed for 5 minutes and rinsed with tap water. Differentiate with hydrochloric acid and ethanol for 30 seconds, soak in tap water for 15 min, soak in eosin solution for 2 min, routinely dehydrate with ethanol and xylene, and seal with neutral resin.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eRT-qPCR\u003c/h3\u003e\n\u003cp\u003eThe Coding Sequences of the genes were obtained from the NCBI database. F\u0026amp;R primers for 18 genes fragments were designed with β-actin as the internal reference gene. 30 g of rat apical tissue together with 1800 ul PBS and then put into a tissue grinder for 10 min.Grinding fluid was centrifuged at 12 000 rpm 4℃ for 1 min, and then tissue RNA was extracted according to the instructions of the RNAfast200 Total RNA Extraction Kit. Mix 2ul of RNA, 1ul of PrimeScript, 1ul of Step Enzyme Mix, 1 ul of F\u0026amp;R Primers, 12.5ul of 2X one Step Buffer, 7.5ul of ddH2O, and then perform RT-qPCR at 42℃ for 5 min, 95℃ for 10 sec, 1 cycle, 95℃ for 5 s, 60℃ for 30 sec, and 40 cycles. The relative quantitative analysis was performed by the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method.\u003c/p\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eGraphPad Prism 8 and R software were used for statistical analysis. Measurements that conformed to normal distribution were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (\u003cem\u003ex̅\u003c/em\u003e\u0026plusmn;s), and comparisons between groups were made using the student t-test. \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered a statistically significant difference.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eThe general flow of the study is shown below (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Five screened highly variable genes have the potential to influence EHS heart injury by participating in functions such as mitochondrial damage, myocardial mechanical damage, and protein misfolding. The solid arrows in the figure represent the clearly known and the dashed arrows represent the unknown and conjecture.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eEHS causes damage to heart function\u003c/h2\u003e \u003cp\u003eAn EHS model was built with success. The blood levels of creatine kinase (CK) and lactate dehydrogenase (LDH) were aberrant, and the quantities reached a maximum at 2 hours after the successful modeling (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), suggesting an early recognition of myocardial injury in cardiac enzyme profiles. EHS rats exhibited disordered myofibrillar organization, hypertrophy with significant structural rupture, inflammatory cell infiltration, and cardiac lesions that grew worse over time as compared to CTL rats only with high temperature and humidity(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eAnnotation and classification of apical tissue cells in EHS\u003c/h2\u003e \u003cp\u003eEffective cell density and viability were obtained in both CTL and EHS groups after dissociation of apical tissues, 2.91x10^6, 88.3% and 42.35x10^6, 86.7%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA ). Following library construction and sequencing, the cells were classified into 13 different cell types: endothelial cells, smooth muscle cells, NKT cells, NK cells, T cells, and B cells, Monocytes, Granulocytes, Dendritic cells, Macrophages, Glial cells, Pericytes and Fibroblasts. There were no significant differences in cell types and cell counts between the two groups of samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eScreening of EHS apical tissue-associated signaling pathways and key genes at the level of bioinformatic analysis\u003c/b\u003e \u003c/p\u003e \u003cp\u003eBy constructing a ligand-receptor-transcription factor dataset in frequency and intensity of cell-cell interactions, a significant increase in intercellular network connectivity among cells in the EHS group was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Notably, there was a marked enhancement in intercellular communication between granulocytes and NKT cells, particularly within the signaling pathways associated with chemokines and focal adhesion formation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB,\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Further gene enrichment analysis of endothelial cells, which constituted the largest cell population, revealed that the most enriched genes were associated with oxidative stress biological processes, lipid raft structures, ubiquitin-like protein ligases, and the functions of unfolded protein-binding molecules (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Meanwhile, protein network interaction analysis indicated that the majority of cellular functions were link to members of the heat shock protein family (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). When considering all cells within each group as a subpopulation, 310 differentially expressed genes were identified using the FindMarkers function to compare the CTL and EHS groups, with 18 highly variable genes selected for subsequent validation. The results of the bioinformatic analysis demonstrated that the expression levels of the Id1, Clec2g, Timp4, Ndufa4, Depp1, Ptma, Cd36, and Cxcl12 genes were down-regulated, while the expression levels of the Eef1a1, Hspb1, Hspa8, Dnajb1, Hspe1, Ubc, Bag3, Hmox1, Dusp1, and Klf2 genes were up-regulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eValidation of key genes in the apical tissue-associated signaling pathway at the genetic level\u003c/h2\u003e \u003cp\u003eNext, the changes in the expression of the above 18 genes were verified by RT-qPCR, and primers were designed as shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The mRNA transcript levels of the genes Id1, Ndufa4, Depp1, Ptma, Bags, Cd36, and Hmox1 were significantly lower than those of CTL, while the genes Eef1a1, Hspb1, and Klf2 showed significantly higher levels. Except for Bags and Hmox1, the changes in expression of other genes were consistent with the results of the above bioinformatic analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGene design primers\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNum.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward primers\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReverse primers\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eId1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGAAGTGGTGCTTGGTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTCTGAGGCAGGGTAGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eClec2g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCCCCGAATCTCCTGCTAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCTACCTGAACGACATCGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTimp4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTCTGTTGCCTTCTGTTGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCATAGTTGGTCCCCTCCCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNdufa4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGTCCTAATCTTCTCTCTGCGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGTGGAAAATTGTGCGGATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDepp1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAGACTTCCTGCCACCCTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGGAGAGAGAAGCTGGGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePtma\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACCCCACCAAAACCACAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTTTCACACATACATCAAACAGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEef1a1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTTTCGCAACGGGTTTGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGAGGCTTGTCAGTTGGACGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHspb1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGGAGATCACTGGCAAGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGAGGGAGCGTGTATTTCCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHspa8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGGTCTCGTCATCAGCACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGAAGACACCCACACAGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDnajb1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACTCTTGCCCTCTGTTGTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAACAGAGTCGAAGGACTGCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHspe1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCGCCTTCTCTCACGCTAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTCACAGTTTCAGCGGCACTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eUbc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACACCAAGAAGGTCAAACAGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCACCTCCCCATCAAACCCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBag3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACATTCCCATTCCCGTCCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGTTTTCGGGTTGGGTGACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHmox1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCACCTTCCCGAGCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCCTCTTCTGTCACCCTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDusp1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGTTTCCATCCCCGTCCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eACTGAAAGCTACAAACCTACACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCd36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTATTGGGAAAGTTATTGCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTGGGTTCTGGAGTGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKlf2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTATCTTGCCGTCCTTTGCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eACAGGATGAAGTCCAGCACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCxcl12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCAGAAATGGGAACAAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGTAGTTCAAGACCGTAGAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eValidation of key genes in the apical tissue-associated signaling pathway at the Immunohistochemical level\u003c/h2\u003e \u003cp\u003eImmunohistochemical tests were then performed on genes whose differences in expression were statistically significant and consistent with the findings of the bioinformatic analysis. The results demonstrated a significant increase in the protein expression levels of Hspa8 and Hspe1, while a significant decrease in the levels of Id1, Ndufa4, and Cd36 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe prevalence of heat stroke is rising annually due to the trend of global warming. Rapid disease progression and particularly severe clinical symptoms lead to a higher disability and fatality rates. Based on clinical epidemiological studies, the cardiovascular system plays a key role in the process of heat stroke, not only responsible for the blood perfusion of organs, but also involved in the whole body heat dissipation process. According to the statistics, about 20%-65% of heat stroke patients will experience circulatory shock, and 85% will experience electrocardiographic abnormalities [11,12]. Therefore, the heart becomes one of the first priority and most vulnerable target organs among the multiple organ dysfunctions caused by heat stroke, and it is particularly important to conduct an in-depth study on the mechanism of myocardial injury in EHS. In this study, we screened the signaling pathways and key genes related to EHS through scRNA-seq analysis of rat apical tissues. We next confirmed the changes in the expression of the highly variable genes using RT-qPCR and immunohistochemistry. It can further confirm the reliability of the scRNA-seq data and also broaden the scope of the highly variable gene expression screening test to include functional studies of related genes.\u003c/p\u003e \u003cp\u003eHeat stroke has a complicated etiology that can be brought on by numerous variables. A malfunction in the body's heat regulating system can lead to heat stroke. Multi-organ damage is eventually caused by the interplay of cytotoxicity, inflammation, and coagulation by heat exposure [13\u0026ndash;15]. The pathological modifications of the body's inability to heat stimulation and the associated mechanisms of systemic inflammation and multi-organ failure are the key areas of current study on the cause of heat stroke. The high temperatures might cause damage to cells by directly causing necrosis or apoptosis [16]. On the other hand, the systemic inflammatory response syndrome occurs and then develops into \u0026ldquo;like-sepsis\u0026rdquo;, due to hyperthermia damage, ischemia and reperfusion, and inflammatory cell recruitment [17]. In this study, we found that the cellular functions, which were significantly increased between the rat apical cell interactions after exertional exercise, were mainly in the areas of cellular structural stabilization, protein misfolding, oxidative stress, inflammatory response, and chemotactic response, as revealed by the bioinformatic analysis of scRNA-seq.\u0026nbsp;And the research findings showed the expression levels of Id1, Ndufa4 and Cd36 genes were significantly reduced, while the expression levels of Hspa8 and Hspe1 genes were significantly increased.\u003c/p\u003e \u003cp\u003eInhibitors of differentiation 1 (Id1), a member of the helix-loop-helix (HLH) family of transcription factors, plays a role in the formation and stabilization of cellular structures, cardiogenic and protective processes, and the generation of oxidative stress. In Id1 knockout mice, the researchers found that Id1 prevented hyperglycemia-induced microvascular damage and promoted angiogenesis [18]. Vascular endothelial growth factor signaling and endothelial cell angiogenic activity can be enhanced in lung cancers by up-regulated Id1 gene expression [19]. Hypoxia, vascular endothelial growth factor, TNF-α, NAD(P)H oxidase, and other plaque-forming factors upregulate Id1 molecular expression [20]. Key response mechanisms of β-cells to reactive oxygen species (ROS) stress caused by iron overload are determined by Hmox1, Id1, and Id3 in the pancreas [21].\u003c/p\u003e \u003cp\u003eNADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 4 (Ndufa4) is a member of the mitochondrial electron transport chain complexes. It is expressed in various human tissues and cells, especially in heart, skeletal muscle and brain. Its function is associated with oxidative stress due to impaired mitochondrial, and plays an important role in the oxidative phosphorylation process as well as in the maintenance of the cytochrome C oxidase structural [22]. MiR-210-3p promotes cardiomyocyte apoptosis and mitochondrial dysfunction by targeting Ndufa4. Ndufa4 can protect the activity of mitochondrial NADH-ubiquinone oxidoreductase and reduce myocardial I/R induced oxidative stress damage [23]. Ca2\u0026thinsp;+\u0026thinsp;activation can lead to the transfer of Ndufa4 from NADH-ubiquinone redox-active monomer to cytochrome C oxidase, with concomitant increase in ROS formation [24].\u003c/p\u003e \u003cp\u003eCluster of differentiation 36 (Cd36) is a member of the scavenger receptor family of type 2 scavenger receptors that are widely distributed in myocardial, and skeletal muscle tissues. More and more research indicate that Cd36 is actively involved in the pathology of cardiovascular diseases such as myocarditis, cardiac hypertrophy and ischemia/reperfusion (I/R). In cardiovascular diseases, environmental stimuli such as hyperglycemia, hyperlipidemia, and hyperinsulinemia cause up-regulation of myocardial and vascular Cd36 expression, and disrupt the glucose-lipid metabolism balance in the heart, thus causing cardiac and vascular pathological changes [25]. Overexpression of Cd36 increases the uptake of long-chain fatty acids in cardiomyocytes, which can generate a large amount of reactive oxygen species (ROS) and further induce the occurrence of inflammation [26]. Cardiomyocyte-specific miR-100 overexpression leads to the downregulation of CD36 expression, and protects against heart failure under pressure overload in mice through reducing fatty acid uptake and ROS production [27].\u003c/p\u003e \u003cp\u003eHeat shock proteins (Hsp), also known as molecular chaperone proteins or stress proteins, are proteins produced by cells exposed to biotic and abiotic stresses, including heat shock, heat stress and infection. Many studies have demonstrated that heat shock proteins can be involved in regulating immune and inflammatory responses under heat stress, including HSP27, HSP70 and HSP90 [28]. When a heat wave strikes, the human body activates the expression of heat shock proteins answering to heat stress, which recognize misfolded proteins and help them to refold to their usual conformation, and protects the cell structure and function[3]. Our study found that the expression levels of Hspa8 (Hsp70) and Hspe1 (Hsp10) genes were significantly elevated in apical tissues of EHS. Hsp70 is most popularly studied in cardiovascular diseases. Cardioprotection in the inflammatory response to myocardial ischemia-reperfusion injury, Hsp70 can activate extracellular regulated protein kinases (ERK)1/2 and p38 mitogen-activated protein kinase (MAPK) signaling pathways by Toll-like receptor 4 (TLR4). In response to reactive oxygen species accumulation, Hsp70 induces a decrease in the expression of manganese superoxidedismutase (Mn-SOD), which attenuates oxidative stress and inhibits ROS-induced cardiac mitochondrial dysfunction [29]. HSP10, as a member of the family of small-molecule shock proteins, also plays an important role in intracellular regulation of protein folding and degradation [30]. Whether heat shock proteins play an important function in cardiovascular injury in heat stroke through interactions with protein folding degradation as well as cellular oxidative stress provides a new research direction to further elucidate the molecular mechanism of myocardial injury in exertional heat stroke.\u003c/p\u003e \u003cp\u003eWhether the screened molecules of Id1, Ndufa4, Cd36, Hspa8 and Hspe1 genes are involved in the process of heat and oxidative stress, and whether they can be biomolecular markers for the pathogenesis and diagnosis of EHS, and what roles they play in the pathogenesis of EHS need further exploration.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn our study, we screened the apical tissues of EHS rats for highly variable signaling pathways associated with chemokines and focal adhesion formation, highly variable cellular function in roles-oxidative stress, membrane structure formation, ubiquitination junctions, and highly variable genes with Id1, Ndufa4, Cd36, Hspa8, Hspe1 by scRNA-seq bioanalysis. Against these highly variable genes expression changes, we have validated.\u003c/p\u003e \u003cp\u003eThe available studies shows that these screened hypervariable genes play different roles in heat stress-induced mitochondrial and myocardial mechanical damage, protein misfolding. But what role these genes play in the pathways and cellular functional roles of the above is the main direction of our subsequent research. Perhaps they may become potential biomarkers or keep an important link in the mechanism of cardiac injury.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAnimal Ethics approval statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe rats were purchased from Nantong University. The quality testing was done by the Institute of Health and Environmental Technology, Soochow University. The laboratory Animal License was No. SCXK(Su)2019-0001. The study was approved by the Animal \u0026nbsp;Ethics Committee of Huadong Research Institute for Medicine and Biotechniques.\u0026nbsp;The study protocol was approved by\u0026nbsp;Huadong Research Institute for Medicine and Biotechniques, National Clinical Research Center for Kidney Diseases Jinling Hospital and Department of Disease Control and Prevention Donghai Hospital. All methods were carried out in accordance with relevant guidelines and regulations. All procedures were conducted in full compliance with the ARRIVE guidelines.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analysed during this study are included in this published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Center for Disease Control and Prevention \u0026ldquo;Yiqi\u0026rdquo; Independent Innovation Incubation Fund (2023YQFH09)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eZHL\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e Conceptualization;\u0026nbsp;Experiment\u0026nbsp;Design;\u0026nbsp;Experiment\u0026nbsp;Development;\u0026nbsp;Data curation; Formal analysis; Writing-original draft;\u0026nbsp;\u003cstrong\u003eZL:\u003c/strong\u003e Sample\u0026nbsp;Collection; Data curation;\u0026nbsp;\u003cstrong\u003eCLT\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e Experiment\u0026nbsp;Development;\u0026nbsp;\u003cstrong\u003eJHZ\u003c/strong\u003e:\u0026nbsp;Experiment\u0026nbsp;Instruction;\u0026nbsp;\u003cstrong\u003eL\u003c/strong\u003e\u003cstrong\u003eR\u003c/strong\u003e\u003cstrong\u003eC:\u003c/strong\u003e Experiment\u0026nbsp;Instruction;\u0026nbsp;\u003cstrong\u003eQYF\u003c/strong\u003e\u003cstrong\u003e:\u0026nbsp;\u003c/strong\u003eSample\u0026nbsp;Collection; Data curation;\u0026nbsp;\u003cstrong\u003eQZ\u003c/strong\u003e\u003cstrong\u003e:\u0026nbsp;\u003c/strong\u003eExperiment\u0026nbsp;Instruction;\u0026nbsp;Experiment\u0026nbsp;Development;\u0026nbsp;\u003cstrong\u003eHY:\u003c/strong\u003e Experiment\u0026nbsp;Development;\u0026nbsp;Formal analysis;\u0026nbsp;\u003cstrong\u003eZY:\u0026nbsp;\u003c/strong\u003eFormal analysis;\u0026nbsp;\u003cstrong\u003eCHW:\u0026nbsp;\u003c/strong\u003eSupervision; Writing - review \u0026amp; editing;\u0026nbsp;\u003cstrong\u003eFZ\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e Supervision; Writing - review \u0026amp; editing; Funding acquisition. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eY Desai, H Khraishah, and B Alahmad. Heat and the Heart. Yale J Biol Med. 2023;96(2):197\u0026ndash;203.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eY Epstein, and R Yanovich. Heatstroke. N Engl J Med. 2019;380(25):2449-59.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eA Bouchama, B Abuyassin, C Lehe, O Laitano, O Jay, FG O'Connor, and LR Leon. Classic and exertional heatstroke. Nat Rev Dis Primers. 2022;8(1):8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSY Liu, JC Song, HD Mao, JB Zhao, and Q Song. Expert consensus on the diagnosis and treatment of heat stroke in China. Mil Med Res. 2020;7(1):1.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMS Yamanaka, Y Hosokawa, M Ayusawa, N Hirose, and K Kaneoka. Epidemiology of sports-related fatalities during organized school sports in Japanese high schools between 2009 and 2018. PLoS One. 2021;16(8):e0256383.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJD P\u0026eacute;riard, D DeGroot, and O Jay. Exertional heat stroke in sport and the military: epidemiology and mitigation. Exp Physiol. 2022;107(10):1111-21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSA Anderson, ER Eichner, S Bennett, BP Boden, B Colgate, R Courson, JK Davis, GA Elkins, LW Judge, M Krueger, KL Kucera, K Niehoff, Y Rooks, JB Tucker, and WO Roberts. Preventing Exertional Heat Stroke in Football: Time for a Paradigm Shift. Sports Health. 2024:19417381241260045.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCM Chao, LY Wang, CC Huang, WT Chang, LY Tang, MT Lin, and CP Chang. Myocardial structure and functional alterations in a preclinical model of exertional heat stroke. Life Sci. 2023;323:121640.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR Xia, M Sun, Y Li, J Yin, H Liu, J Yang, J Liu, Y He, B Wu, G Yang, and J Li. The pathogenesis and therapeutic strategies of heat stroke-induced myocardial injury. Front Pharmacol. 2023;14:1286556.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMJ Douma, T Aves, KS Allan, JC Bendall, DC Berry, WT Chang, J Epstein, N Hood, EM Singletary, D Zideman, and S Lin. First aid cooling techniques for heat stroke and exertional hyperthermia: A systematic review and meta-analysis. Resuscitation. 2020;148:173\u0026thinsp;\u0026minus;\u0026thinsp;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIGY Asmara. Diagnosis and Management of Heatstroke. Acta Med Indones. 2020;52(1):90\u0026ndash;97.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMG Austin, and JW Berry. Observations on one hundred cases of heatstroke. J Am Med Assoc. 1956;161(16):1525-9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLR Leon, and BG Helwig. Heat stroke: role of the systemic inflammatory response. J Appl Physiol (1985). 2010;109(6):1980-8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL Du, L Zhu, X Lu, Y Yu, P Liu, and J Pan. Inhibition of the MLCK/MLC2 pathway protects against intestinal heat stroke-induced injury in rats. J Therm Biol. 2023;116:103655.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQ Luo, XY Ji, L Zhang, X Huang, XQ Wang, and B Zhang. Shikonin prevents mice from heat stroke-induced death via suppressing a trigger IL-17A on the inflammatory and oxidative pathways. Biomed Pharmacother. 2023;166:115346.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePC Ikwegbue, P Masamba, BE Oyinloye, and AP Kappo. Roles of Heat Shock Proteins in Apoptosis, Oxidative Stress, Human Inflammatory Diseases, and Cancer. Pharmaceuticals (Basel). 2017;11(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCL Lim. Heat Sepsis Precedes Heat Toxicity in the Pathophysiology of Heat Stroke-A New Paradigm on an Ancient Disease. Antioxidants (Basel). 2018;7(11).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS Sharma, and M Plotkin. Id1 expression in kidney endothelial cells protects against diabetes-induced microvascular injury. FEBS Open Bio. 2020;10(8):1447-62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eC Cheng, G Zhu, Y Li, H Wang, S Wang, C Li, J Feng, Z Wang, and W Li. Single-cell transcriptome analysis reveals cellular and molecular alterations in small cell lung cancer tumors following chemotherapy. Int J Cancer. 2023;153(6):1273-86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHJ Kim, H Chung, YG Yoo, H Kim, JY Lee, MO Lee, and G Kong. Inhibitor of DNA binding 1 activates vascular endothelial growth factor through enhancing the stability and activity of hypoxia-inducible factor-1alpha. Mol Cancer Res. 2007;5(4):321-9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM Hamad, AK Mohammed, MY Hachim, D Mukhopadhy, A Khalique, A Laham, S Dhaiban, K Bajbouj, and J Taneera. Heme Oxygenase-1 (HMOX-1) and inhibitor of differentiation proteins (ID1, ID3) are key response mechanisms against iron-overload in pancreatic β-cells. Mol Cell Endocrinol. 2021;538:111462.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS Zong, M Wu, J Gu, T Liu, R Guo, and M Yang. Structure of the intact 14-subunit human cytochrome c oxidase. Cell Res. 2018;28(10):1026-34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTT Zhou, XY Wang, J Huang, YZ Deng, LJ Qiu, HY Liu, XW Xu, ZX Ma, L Tang, and HP Chen. Mitochondrial Translocation of DJ-1 Is Mediated by Grp75: Implication in Cardioprotection of Resveratrol Against Hypoxia/Reoxygenation-Induced Oxidative Stress. J Cardiovasc Pharmacol. 2020;75(4):305\u0026thinsp;\u0026minus;\u0026thinsp;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eB Kadenbach. Complex IV - The regulatory center of mitochondrial oxidative phosphorylation. Mitochondrion. 2021;58:296\u0026ndash;302.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eH Shu, Y Peng, W Hang, J Nie, N Zhou, and DW Wang. The role of CD36 in cardiovascular disease. Cardiovasc Res. 2022;118(1):115\u0026thinsp;\u0026minus;\u0026thinsp;29.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJW Hao, J Wang, H Guo, YY Zhao, HH Sun, YF Li, XY Lai, N Zhao, X Wang, C Xie, L Hong, X Huang, HR Wang, CB Li, B Liang, S Chen, and TJ Zhao. CD36 facilitates fatty acid uptake by dynamic palmitoylation-regulated endocytosis. Nat Commun. 2020;11(1):4765.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eC Smolka, D Schl\u0026ouml;sser, C Koentges, A Tarkhnishvili, O Gorka, D Pfeifer, X Bemtgen, A Asmussen, O Gro\u0026szlig;, P Diehl, M Moser, C Bode, H Bugger, S Grundmann, and F Pankratz. Cardiomyocyte-specific miR-100 overexpression preserves heart function under pressure overload in mice and diminishes fatty acid uptake as well as ROS production by direct suppression of Nox4 and CD36. Faseb j. 2021;35(11):e21956.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJ Spierings, and W van Eden. Heat shock proteins and their immunomodulatory role in inflammatory arthritis. Rheumatology (Oxford). 2017;56(2):198\u0026ndash;208.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKH Lee, J Jeong, and CG Yoo. Positive feedback regulation of heat shock protein 70 (Hsp70) is mediated through Toll-like receptor 4-PI3K/Akt-glycogen synthase kinase-3β pathway. Exp Cell Res. 2013;319(1):88\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAS Bie, C C\u0026ouml;mert, R K\u0026ouml;rner, TJ Corydon, J Palmfeldt, MS Hipp, FU Hartl, and P Bross. An inventory of interactors of the human HSP60/HSP10 chaperonin in the mitochondrial matrix space. Cell Stress Chaperones. 2020;25(3):407\u0026thinsp;\u0026minus;\u0026thinsp;16.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"exertional heat stroke (EHS), single cell RNA sequencing (scRNA-seq), cardiac injury","lastPublishedDoi":"10.21203/rs.3.rs-5268576/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5268576/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eHeat dissipation relies on an intact cardiovascular system to dilate cutaneous blood vessels and increase cardiac output. However, the heart becomes a vulnerable organ and is susceptible to cardiac arrhythmias, functional failure, and focal myocardial necrosis in a hyperthermic heat-damaged state. In particular, people with cardiovascular dysfunction are at a much higher risk of exertional heat stroke (EHS). This study aimed to investigate and validate the cell signaling pathways and key genes associated with EHS by analyzing single-cell RNA sequencing (scRNA-seq) data from cardiac apical tissue of EHS rats. The findings are intended to elucidate the mechanisms underlying cardiac injury and to provide a theoretical basis for the early identification of biomarkers for cardiac injury in EHS.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eAfter exertional heat radiation, the heart's functionality was compromised. Annotation analysis revealed that the cell type and quantity did not differ between the EHS and control (CTL) groups. Cellchat analysis showed that the signal of EHS cardiac apex cells was enhanced in chemokine signaling pathway. The cardiac apical cells of the EHS group had the highest number of enriched genes in the oxidative stress pathway, according to GO/KEGG analysis of endothelial cells with the biggest proportion of cells. A total of 310 genes with changes in expression between the two groups were evaluated based on the Seurat-FindAllMarkers tools for all cell types. Of these, 18 genes with substantial variability were chosen for further verification. By using RT-qPCR verification, the expression differences of 12 genes were confirmed to be consistent with the above bioinformation analysis. Finally, Additional immunohistochemistry tests verified that Hspa8 and Hspe1 were up-regulated once more, while Id1, Ndufa4, and Cd36 were down-regulated.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThe gene expression levels of Id1, Ndufa4, Cd36 were significantly reduced, and Hspa8, Hspe1 were significantly increased. These screened hypervariable genes play different roles in heat stress-induced mitochondrial and myocardial mechanical damage, protein misfolding, and they may become potential biomarkers in the mechanism of cardiac injury or keep an important link in the functional pathway of action described above.\u003c/p\u003e","manuscriptTitle":"The underlying mechanism of cardiac injury in exertional heat stroke rats based on the scRNA-seq analysis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-19 13:07:51","doi":"10.21203/rs.3.rs-5268576/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5fb538ee-562e-4db5-bb59-8b6f42c9ed11","owner":[],"postedDate":"November 19th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":40394166,"name":"Biological sciences/Biochemistry/Dna"},{"id":40394167,"name":"Health sciences/Biomarkers/Predictive markers"},{"id":40394168,"name":"Health sciences/Pathogenesis/Oncogenesis"}],"tags":[],"updatedAt":"2024-12-25T05:08:17+00:00","versionOfRecord":[],"versionCreatedAt":"2024-11-19 13:07:51","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5268576","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5268576","identity":"rs-5268576","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}