Isolation and identification of the rare actinomycete, Amycolatopsis roodepoortensis strain EA7 from the agricultural soils of northern Iran and identification of their biological products | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Isolation and identification of the rare actinomycete, Amycolatopsis roodepoortensis strain EA7 from the agricultural soils of northern Iran and identification of their biological products Elham Amiri, Mirsasan Mirpour, Khosro Issazadeh, Behnam Rasti This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4644566/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract This paper delves into the antimicrobial activity and identification of bioactive compounds of Amycolatopsis roodepoortensis strain EA7. Biochemical and molecular methods were utilized for the identification of actinomycetes. One strain displaying superior antimicrobial activity was chosen for the identification of bioactive compounds. The antimicrobial activity was thoroughly investigated. The analysis of the 16S rRNA gene revealed that strain EA7 belonged to the Amycolatopsis roodepoortensis specie with 99.63% confidence. The ethyl acetate extract exhibited the largest zone of inhibition against gram-positive pathogenic bacteria (25mm) using the disc diffusion method. In the MIC method, the ethyl acetate extract displayed the lowest MIC values ranging from 312.5 µg/mL ( S. aureus PTCC 1112) to 1250 µg/mL ( P. aeruginosa clinical and standard strain). However, the methanolic extract showed lower antimicrobial activity. In the GC-MS analysis, compounds were identified based on their percentage of area, retention time, molecular formula, molecular weight, and quality in the strain EA7 extract, with acetic acid, 2-methylpropyl ester (15.8%) being the major compound. In the LC-MS analysis, nine major compounds with anticancer and antimicrobial activity were identified. Among these, tetrangomycin, amycolactam, dihydroxybenzamide, and dipyrimycin A are compounds with potential anticancer activity, while tetracycline exhibits potential antimicrobial activity. Amycolatopsis bioactive compounds antimicrobial GC-MS LC-MS Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction The rising challenges posed by antibiotic-resistant pathogens, the emergence of new diseases, and the toxicity associated with current bioactive compounds have led to a growing demand for antibiotics worldwide (Adamek et al., 2018 ; Jha et al., 2022 ). In particular, infections caused by multidrug-resistant (MDR) gram-negative pathogens present a significant global challenge, highlighting the urgent need for the discovery of novel antimicrobial compounds and treatment approaches. Nature has long served as a valuable source of bioactive compounds with diverse applications in pharmaceuticals, medicine, and biochemistry (Djebbah et al., 2021 ). Microorganisms, especially actinomycetes, have been instrumental in contributing to human health through the production of antibiotics. Among actinomycetes, the genus Streptomyces is a potential source of all secondary metabolites.Additionally, genera such as Amycolatopsis , Actinoplanes , Micromonospora , and Saccharopolyspora are vital producers of antibiotics (Singh, 2021 ). Amycolatopsis , a member of the Pseudonocardiaceae family, consists of nocardioform actinomycetes characterized by the absence of mycolic acids and the presence of aminopimelic acid, arabinose, and galactose mesodies. Notably, the cell wall peptidoglycan of Amycolatopsis is renowned for yielding antibiotic strains that produce ansamycin compounds, distinguishing them from other groups. Due to their versatility in producing antibiotics, anti-cancer agents, and other therapeutically important compounds, Amycolatopsis is considered to be among the key microorganisms of the 21st century (Adamek et al., 2018 ; Julianti et al., 2022 ). This study focuses on the exploration of the lesser-known group of non- streptomycete actinobacteria, which remain underutilized despite their vast chemical diversity. These rare actinomycetes are known to produce a wide array of unique, often complex compounds with potent bioactivity and low toxicity. While research on the biosynthesis of secondary metabolites in Amycolatopsis is currently limited (Alam & Jha, 2019 ). our study aims to isolate and identify a rare group of actinomycetes from soil samples collected in the Alborz Mountains of Northern Iran. Additionally, we assess the antimicrobial activity of the isolated strain against human pathogenic bacteria and identify bioactive compounds through LC-MS and GC-MS analyses. Materials and Methods Sample Collection and Isolation of actinomycetes A total of 15 soil samples were collected by removing the upper layer from a 15 cm depth using a shovel at 3 different locations in the southwest of Guilan province, nestled in the picturesque Alborz Mountains with the geographical coordinates of east 49.5292 0 and north 36.8767 0 . The gathered samples were air-dried at room temperature for one week. For the separation process, serial dilutions ranging from 10 − 1 to 10 − 7 were prepared from the soil samples. To achieve this, 1 gram of dried soil samples was mixed with 9 ml of sterile distilled water, then 1 ml of each dilution ranging from 10 − 3 to 10 − 7 was cultured on starch casein agar (SCA) medium. To prevent fungal and bacterial contaminations, Tetracycline (25 µg/ml) and Nystatin (50µg/ml) antibiotics were added. The plates were incubated at 28°C for 4 days. Upon incubation, suspected actinomycete colonies were purified on ISP2 agar medium (International Streptomyces Project Medium) at 28°C for another 4 days (Tan et al., 2019 ). Morphological, Biochemical, and Physiological Characteristics of actinomycetes The characteristics of the actinomycetes were thoroughly investigated. Morphological characteristics were examined using both macroscopic and microscopic methods. Biochemical analyses included oxidase and catalase tests, as well as assessments of starch, urea, casein, and gelatin hydrolysis, nitrate reduction, citrate utilization, and SIM tests. Furthermore, the fermentation of sugars such as glucose, galactose, fructose, sucrose, raffinose, mannitol, maltose, xylose, lactose, and arabinose was explored. The growth conditions of the isolates were studied under various culture conditions, including different concentrations of NaCl (1–7%, w/v), pH values ranging from 4 to 8, and temperatures between 27–45°C as part of confirmatory tests (Fahmy et al., 2021). Antibiotic susceptibility testing of actinomycetes An antibiotic sensitivity test of screened actinomycetes was conducted using 8 antibiotics (tetracycline 30 mg, vancomycin 30 mg, ampicillin10 mg, chloramphenicol 30 mg, ciprofloxacin 5 mg, imipenem 10 mg, piperacillin 100 mg, and ceftazidime 30 mg) according to the standard protocol (CLSI 2020) using the Kerby-Bauer disc diffusion method. Briefly, bacterial cultures (0.5 McFarland turbidity) were spread on Mueller-Hinton Agar (MHA) plates with sterile swap. Antibiotic discs were placed on inoculated plates with sterile forceps. The plates were incubated for 2 days at 28°C and the sensitivity of each antibiotic was determined by checking the zones of inhibition in mm(Oliveros et al., 2021 ; Lukežič et al.,2019 ). Isolation and identification of pathogenic bacteria The studied organisms for the antimicrobial assay of actinomycetes were collected from the infectious department of Rasht Hospital. Following the protocol outlined by Ansari et al. ( 2019 ), biochemical tests (including catalase, mannitol salt agar, and coagulase for Staphylococcus aureus and catalase, oxidase, Simon citrate agar, and TSI for Pseudomonas aeruginosa ), Gram-staining, and antibiotic sensitivity tests to four antibiotics (imipenem 10mg, ciprofloxacin 5mg, ceftazidime 30mg, and piperacillin 100mg) were conducted (Ansari et al., 2019 ). Additionally, standard strains, including P. aeruginosa PTCC 1565 and S. aureus PTCC 1112, were procured from the Iran Scientific and Industrial Research Organization. Antimicrobial activity of actinomycetes (primary screening) The antimicrobial effect of the isolated strains against clinical and standard strains of P. aeruginosa and S. aureus was assessed using the cross-streak method on ISP2 medium. Actinomycete isolates were vertically streaked (8 mm) in the center of plates containing ISP2 medium and were incubated for 7 days at 28°C. After the incubation period, pathogenic bacteria (adjusted to 0.5 McFarland's turbidity) were streaked perpendicular to the culture of actinomycete isolates on ISP2 medium. The plates were incubated for 24 h at 37°C. Based on the presence and absence of inhibition zones, actinomycete strain producing antimicrobial compounds were selected for further study (Fahmy et al., 2021; Singh, 2021 ). Genomic and phylogenetic analyses Genomic DNA extraction was performed prior to 16S rRNA sequencing. The 16S rRNA gene was amplified by PCR according to the protocol of Tan et al. ( 2019 ). Polymerase chain reaction (PCR) was conducted to amplify the 16S rRNA gene using universal primers, 27F (5'- AGAGTTTGATCCTGGCTCAG − 3') and 1492 R (5'- GGTTACCTTGTTACGACTT − 3'). The PCR program for the selected actinomycete isolate consisted of 35 cycles: Initial denaturation at 95°C for 2 min, followed by denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 45 seconds, and a final extension at 72°C for 5 min. Upon completion of the reaction steps and confirming the obtained bands by agarose gel electrophoresis, the reaction product was sequenced. Subsequently, the obtained results were compared with sequences in the NCBI database using the BLAST program ( www.ncbi.nlm.nih.gov/blst ). The phylogeny tree of this isolate was drawn by the neighbor-joining method using the NCBI database and the BLAST program. Fermentation and Determination of the antimicrobial activity of the fermentation broth A submerged fermentation culture was used to extract bioactive compounds according to the protocol of Kurnianto et al. ( 2021 ). Pure colonies of actinomycet grown on ISP2 agar medium were inoculated into 200 ml of ISP2 broth culture medium were inoculated in a 500 ml Erlenmeyer flask, maintaining a pH of 7, and incubated in a shaker incubator at 30 ± 2 0 C in the dark for one week at 120–150 rpm. To determine the optimal time for the production of bioactive compounds, the antimicrobial activity of the fermentation medium was measured from day 5 to day 7 at 24h intervals by the agar well diffusion method. First, a microbial suspension with 0.5 McFarland turbidity was prepared from pathogenic and standard P. aeruginosa and S. aureus bacteria and inoculated using a sterile swab on the surface of Mueller-Hinton agar. Next, wells with a diameter of 6 mm were punched in Muller-Hinton agar,and each well was filled with 50 µL of fermentation broth of amycolatopsis . After overnight incubation at 37°C, the diameter of the growth inhibition halo around the wells was measured (Kurnianto et al. 2021 ; Osama et al., 2022 ). Extraction of the extract with ethyl acetate and methanol To extract the bioactive compounds (crude extract), the entire volume of the fermentation medium was centrifuged at 4000 rpm for 20 min at 4°C. Then, for GC-MS and LC-MS analysis, the obtained supernatant liquid was mixed with ethyl acetate and methanol organic solvent at a volume ratio of 1:1 and stirred for 2 h on a magnetic stirrer at 140 rpm at room temperature, Finally, the aqueous and organic phases were separated using a decanter funnel (Bansal et al., 2021 ). Antibacterial activity of the ethyl acetate and methanol extract Agar disc diffusion method Antimicrobial effect of the extracted ethyl acetate and methanolic extract on clinical and standard strains of P. aeruginosa and S. aureus was evaluated using disk diffusion test. Microbial suspensions with a turbidity equal to 0.5 McFarland standard were prepared from pathogenic bacteria and standard strains of P. aeruginosa and S. aureus . then, cultured on the surface of Mueller-Hinton agar plates by using sterile swabs.100 µl of the crude extract was dissolved in 10 µl of DMSO as the extract solvent. Then, blank paper discs were loaded with 30 µl of the dissolved extract and allowed to absorb. Discs were placed on Mueller- Hinton agar plates. After 24 h of incubation at 37°C, the diameter of the growth inhibitory zone around the discs was measured (Kumaran et al.,2020). Determination of minimum inhibitory and minimum bactericidal concentration assay of extracts MIC of the extracts was determined by microdilution broth technique against Clinical samples and standard strains in 96-well plates, as recommended by CLSI (2021). Briefly, 100 µl of MHB culture medium was poured into 96-well plates, then 100 µl of extract solution (Dissolved in DMSO) was added to the first well, a series of dilutions ranging from 5000 ,2500, 1250, 625, 312.5, and 156.25 µg /mL of extract were prepared, and in the last step 100 µl of microbial suspensions with a concentration of 1.5x10 6 CFU/mL were added to each well. MHB and the bacterial suspension considered as a negative and positive control, respectively. 96-well microtiter plates were incubated at 37°C for 24 h .The lowest concentration at which no turbidity observed was taken as minimum inhibitory concentration. To determine MBC, 100 µL of the contents of the turbidity-free wells obtained in the MIC test were cultured on Mueller-Hinton agar. After a 24h incubation period, the minimum concentration of the extract with no visible growth was taken as minimum bactericidal concentration (Kurnianto et al.,2021). Gas Chromatography-Mass Spectroscopic (GC-MS) analysis GC-MS analysis was performed using an Agilent 6890 Series gas chromatography system with an Agilent 5973 Network Mass Selective Detector mass spectrometer. A VARIAN cp-sil 8cb-ms column was used for gas chromatography, with a column length of 50m, an inner diameter of 0.25 mm, and a film thickness of 0.25 µm. For the analysis, 1 µL of the analyte was added in split mode at a ratio of 1:10. Helium was used as the carrier gas, with a constant flow rate through the column of 1 mL/min. The initial temperature was set to 60°C and held for 2 min, then the temperature was increased to 250°C and maintained for 20 min. Mass spectra analysis was performed as a quadrupole. Mass spectra data (MS) was obtained in full scan mode from 20 to 400 Da, with an impact mode energy of 70 eV. The temperature during mass spectra analysis was maintained at 230°C. The extracted components were identified by comparing the MS data with those from the NIST MS Spectral search program and Wiley mass spectral library data (Tistechok et al. 2021 ). Liquid Chromatography-Mass Spectroscopy (LC-MS) analysis LC-MS analysis was performed using an HPLC system (Waters Alliance 2695 liquid chromatography) coupled with a mass spectrometer (Micromass Quattro micro API). The analysis employed 0.1% formic acid in water as the aqueous phase and 0.1% formic acid as the mobile phase. A concentrated gradient was injected at a flow rate of 0.3 mL/min, and the chromatography column was maintained at a temperature of 35°C during operation. Nitrogen gas was utilized at a flow rate of 250 L per h, and a voltage of 30V was applied. Mass detection was carried out in positive mode, with detection in the range of m/z 200–2000 (Song et al., 2021 ). Results Isolation and Identification of actinomycetes In our study on actinomycetes , we identified 14 isolates with actinomycetes morphology. These isolates underwent screening for antimicrobial activity (primary screening). Among them, one sample, strain EA7, stood out due to its distinct antimicrobial activity and was therefore selected for further identification and investigation of bioactive compounds. Strain EA7 exhibited broad-spectrum antimicrobial activity and is considered a rare actinomycete . Morphological, Biochemical, and Physiological Characteristics of Strain EA7 The macroscopic appearance of the colonies on ISP2 solid medium showed a dry, chalky appearance (Figure 1a), while the microscopic observation revealed a filamentous structure for strain EA7 (Figure 1b). Biochemical analysis indicated that the strain is catalase-positive and capable of hydrolyzing gelatin and casein, but negative for the hydrolysis of starch and urea. The Simon citrate, oxidase, and SIM tests turned out negative. Strain EA7 can utilize various carbon sources, including glucose, xylose, mannitol, raffinose, and arabinose. It thrives within a temperature range of 27 to 37 °C, at a pH range of 7 to 8, and can tolerate up to 7% sodium chloride (Table 1). Antibiotic Susceptibility Testing of Strain EA7 Among the 14 actinomycete isolates, only strain EA7 displayed high resistance to eight antibiotics tested in this study, whereas the remaining isolates exhibited low resistance with a maximum halo diameter of 20 mm (Table 1, Figure 2). Isolation and Identification of Pathogenic Bacteria In total, six pathogenic bacteria were identified, including S. aureus , a Gram-positive, cocci-shaped bacterium that is catalase-positive, oxidase-negative, coagulase-positive, capable of growth on mannitol salt agar medium. Additionally, P. aeruginosa , a Gram-negative, rod-shaped bacterium was identified, which is catalase-positive, oxidase-positive, non-fermenting, motile, capable of citrate utilization, and grows at 42 °C. Clinical samples of P. aeruginosa, S. aureus, and standard strains were found to be resistant to all antibiotics. Antimicrobial Activity of Strain EA7 (Primary Screening) Strain EA7 exhibited a 20 mm diameter growth inhibition zone against S. aureus . However, no growth inhibition halo was observed against P. aeruginosa (Figure 3). Genomic and Phylogenetic Analyses of Strain EA7 The analysis of the 16S rRNA gene using BLAST software revealed a 99.63% sequence match with Amycolatopsis roodepoortensis . This sequence was deposited in GenBank as Amycolatopsis roodepoortensis strain EA7 (GenBank accession number: OR680714). The results of PCR and phylogenetic analysis of strain EA7 using the neighbor-joining method, compared to other species of Amycolatopsis are shown in Figures 4 and 5, respectively. Determination of Antimicrobial Activity of the Fermentation Broth of Strain EA7 The antimicrobial activity of strain EA7's fermentation broth was assessed using the agar well diffusion method (Figure 6). Notably, on the 7th day of fermentation, strain EA7 exhibited significant antimicrobial effects against S. aureus (halo diameter of 23mm) compared to P. aeruginosa. The broad-spectrum antimicrobial activity of strain EA7's fermentation culture indicated the production of active antibiotics and bioactive compounds in ISP2 broth nutrient medium. Antimicrobial Activity of Ethyl Acetate and Methanol Extracts Agar disc diffusion method The agar disc diffusion method was employed to assess the antimicrobial activity of ethyl acetate and methanol extracts. The highest inhibition zone diameters observed were 25mm and 11mm against Gram-positive bacteria ( S. aureus ) for ethyl acetate and methanol extracts, respectively, while the inhibitory effects on Gram-negative bacteria ( P. aeruginosa ) were relatively lower (Figure 7). Determination of Minimum Inhibitory and Minimum Bactericidal Concentration Assay The minimum inhibitory concentration (MIC) of ethyl acetate extract for S. aureus , P. aeruginosa clinical sample, S. aureus PTCC 1112, and P. aeruginosa PTCC 1565 strains was reported as follows: 625 μg/mL, 1250 μg/mL, 312.5 μg/mL, and 1250 μg/mL, respectively. The minimum bactericidal concentration (MBC) values of ethyl acetate extract for S. aureus and P. aeruginosa (both clinical and standard samples) were 2500 μg/mL and 5000 μg/mL. On the other hand, the minimum inhibitory concentration of methanolic extract for S. aureus , P. aeruginosa clinical sample, S. aureus PTCC 1112, and P . aeruginosa PTCC 1565 strain standard was reported as: 1250 μg/mL, 2500 μg/mL, 625 μg/mL, and 2500 μg/mL, respectively. Additionally, the MBC from the methanolic extract for S. aureus was obtained at 5000 µg/mL, while it was not detected for P. aeruginosa (Table 2). GC-MS Analysis of Ethyl Acetate Extract of Strain EA7 A total of 55 chemical compounds were identified by comparing their mass spectra with the Wiley Registry 8e library, based on the evaluation of retention time, molecular formula, molecular weight, percentages of area, and quality in the ethyl acetate extract of strain EA7 . The results of the GC-MS analysis revealed that the strain EA7 extract contains 24 compound with a quality of 70% or higher(Table 3). Acetic acid, 2-methylpropyl ester (15.8%) as the Major compound was identified in the strain EA7 extract. Other identified compounds included 7,9-di-tert-butyl-1-oxaspiro(4,5)deca-6,9-diene-2,8-dione (13.6%), isopropyl myristate (11.4%), 9-octadecenoic acid, ethyl ester (10.4%), and 2,3-Butanediol (8.2%). The GC-MS chromatogram displaying the biologically active compounds of strain EA7 is illustrated in figure 8. LC-MS analysis of the methanolic extract of Strain EA7 Tetracycline, Dihydroxybenzamide, Penipacid E, Valgamycin V, Dipyrimicin A, phenol, 2, 2'-methylenebis[6-(1,1-dimethylethyl)-4-methyl], Tetrangomycin, Amycolamycin A,and Amycolactam were identified in the methanolic extract of strain EA7. The secondary metabolites were known in the methanolic extract of strain EA7 with m/z values is shown in Table 4. Compound 1: appeared at a retention time of 2.15 min, The mass ion peak at m/z 323.091 [M +H]+with predicted MF C 19 H 14 O 5 was explained as a Tetrangomycin antibiotic. Compound 2: appeared at a retention time of 2.89 min, The mass ion peak at m/z 231.567 [M +H]+ with predicted MF C 12 H 10 N 2 O 3 was explained as a Penipacid E antibiotic. Compound 3: appeared at a retention time of 3.68 min, The mass ion peak at m/z 446.O55 [M +H]+ with predicted MF C 22 H 24 N 2 O 8 was explained as a tetracycline antibiotic. Compound 4: appeared at a retention time of 4.18 min, The mass ion peak at m/z 138.027 [M +H]+ with predicted MF C 7 H 7 NO 2 was explained as a Dihydroxybenzzamide compund. Compound 5: appeared at a retention time of 4.18 min, The mass ion peak at m/z 315.206 [M +H]+ with predicted MF C 18 H 22 N 2 O 3 was explained as a Amycolactam antibiotic. Compound 6: appeared at a retention time of 5.91 min, The mass ion peak at m/z 609.313 [M +H]+ with predicted MF C 29 H 48 N 4 O 8 was explained as a Valgamicin V antibiotic. Compound 7: appeared at a retention time of 8.23 min, The mass ion peak at m/z 246.956 [M +H]+ with predicted MF C 12 H 10 N 2 O 4 was explained as a Dipyrimicin A antibiotic.Compound 8: appeared at a retention time of 14.76 min, The mass ion peak at m/z 341.921 [M +H]+ with predicted MF C 23 H 32 O 2 was explained as a Phenol, 2,2′-methylenebis[6-(1,1-dimethyl ethyl)-4-methyl ] compound . Compound 9: appeared at a retention time of 14.83 min, The mass ion peak at m/z 783.164 [M +H]+ with predicted MF C 39 H 40 CINO 14 was explained as a Amycolamycin A antibiotic. The LC-MS chromatogram of bioactive compounds (secondary metabolites) in the methanolic extract of strain EA7 is shown in Figure 9. Discussion The isolation of new compounds from nature can be a solution to reduce the side effects of chemical therapy in the treatment of cancer and also increase the effectiveness of antibiotic resistance against clinical pathogens (Adamek et al., 2018 ). Ansari et al.'s ( 2019 ) studies showed that agricultural soils have a great variety of actinomycetes. In this research, the bacterium Amicolatopsis roodepoortensis strain EA7 was isolated from the southwestern soils of Guilan (Alborz range) and identified by morphological, biochemical, and molecular methods. Out of 14 actinomycete isolates, only strain EA7 was highly resistant to eight commercial antibiotics (including ampicillin, penicillin, chloramphenicol, tetracycline, piperacillin, imipenem, ceftazidime, and ciprofloxacin). While other isolates showed the lowest resistance with a maximum halo diameter of 20 mm. Other research (Alam & Jha, 2019 ) showed the antibiotic resistance of soil actinomycetes, Amycolatopsis balhimycina , and Amycolatopsis orientalis against four antibiotics (ampicillin, penicillin, chloramphenicol, and tetracycline), as well as antimicrobial activity. Significant differences in antibiotic susceptibility patterns and nutritional resource utilization within and among Actinomycetes species may be related to local adaptations (Kisil et al., 2021 ). In our research, significant antibacterial activity was obtained on the 7th day of fermentation. In research on actinomycetes (Osama et al., 2022 ) and in another study (Alam & Jha, 2019 ) on Amycolatopsis sp. ST-28, under good aeration, the optimal incubation time was reported as 7 and 11 days under shaking conditions. The gradual decrease in antimicrobial activity is associated with a further increase in incubation time (Bansal et al., 2021 ). In this research, the antimicrobial effect of the desired strain in the primary and secondary screening had the greatest effect on Gram-positive bacteria ( Staphylococcus aureus ), while no significant effect was observed in relation to Pseudomonas aeruginosa . In another study, gram-negative bacteria had more resistance to the antimicrobial effect produced by actinomycetes compared to gram-positive bacteria, which can be attributed to the different structure of the outer membrane in gram-negative bacteria that have lipopolysaccharide compounds. This structure in gram-negative bacteria leads to their impenetrability against antimicrobial substances (Fahmy et al., 2021). It is consistent with our research results. Methanol and ethyl acetate were taken as solvents for extracting bioactive compounds. Methanol high polarity enables it to extract polar chemicals. The current research indicated that ethyl acetate extract the highest antimicrobial activities against all microorganisms. which is in agreement with the finding of the previous study done by Kebede et al. (2022). But, the methanolic extract showed less antimicrobial activity.This could be due to the concentration of the higher number of secondary metabolites in the ethyl acetate extract than methanolic extract and the difference in cell surface structure between Gram-positive and Gram-negative bacteria (Ansari et al., 2019 ;Oliveros et al., 2021 ). The variationin types and concentration of bioactive compunds and percent of extract yield is because of the difference in substance solubility among solvents. The difference in solubility of a substance might be based on the physical and chemical properties of solvents and phytochemical constituents. Types, quantity and interactions of secondary metabolites present in extracts are determinant s of antimicrobial activities (Kurnianto et al. 2021 ). The GC-MS and LC-MS methods were used in this research to identify bioactive compounds. All compounds identified in GC-MS and LC-MS analysis from several microbial sources such as Streptomyces , Nocardia , and, Aspergillus , with their antimicrobial, anticancer, and antifungal properties confirmed (Lukežič et al.,2019; Fahmy et al., 2021; Velez & Pass, 2020 ). In GC-MS analysis, Acetic acid, 2-methylpropyl ester (15.8%) as the major compound was identified in the strain EA7 extract. Its antimicrobial effect on some Gram-positive and Gram-negative pathogens has been confirmed. This compound has fungicidal, antibacterial, anti-salmonella, and anti-vaginitis properties. Other compounds identified in GC MS analysis have anticancer, antioxidant, antimicrobial and antifungal properties (Fayad et al., 2021). Tetracycline antibiotic detected in LC-MS analysis is an antibiotic with potential antimicrobial activity that prevents bacterial growth by inhibiting protein synthesis (Lukežič et al., 2019 ). Tetrangomycin (an antibiotic from the group of polyphenols), Amycolamycin A(An antibiotic from the group of aminoglycosides, which are effective in inducing apoptosis in cells), amycolactam (as indole alkaloids), dihydroxybenzamide (from the group of benzenes), dipyrimycin A (a derivative of the amide group), Valgamicin V(From the group of cyclic peptide antibiotics), Penipacid E(An antibiotic of anthranilic acid derivatives; an aromatic acid) ), and a Phenol, 2,2′-methylenebis[6-(1,1-dimethyl ethyl)-4-methyl ] (Phenolic compounds from the group of phenols) are the compounds with potential anticancer activity(song et al.,2021; Alqahtani et al., 2022 ). The production and release of secondary metabolites depend on several factors, such as nutritional, biological, and environmental conditions. The production of microbial metabolites can be substantially increased by optimizing the nutritional conditions, physical parameters, and genetics (Abdel-Motaal et al., 2022 ). The nature and concentration of some components of the fermentation medium also have a marked effect on secondary metabolite production. The environmental structure, along with the metabolic capacity of the producing organisms, strongly affects antibiotic biosynthesis(Elgorban et al., 2019 ; Kawuri et al.,2019). In general, most of the bioactive compounds identified in this study by GC-MS and LC-MS are known for their antioxidant, anticancer, and antimicrobial activities. These findings indicate that these bioactive compounds can contribute to the antioxidant capacity, cytotoxic, and antibacterial effect of Amycolatopsis roodepoortensis strain EA7. Therefore, we suggest that these bioactive compounds, either alone or in combination, maybe the main contributing factors for antimicrobial, antioxidant, and cytotoxic properties found in extract strain EA7. Conclusions The study revealed that the extract from strain EA7, obtained through varying concentrations of ethyl acetate and methanol, effectively inhibited the growth of the tested bacteria. It also successfully identified bioactive compounds and antibiotics produced by Actinomycete isolate strain EA7, originating from lush green environments in northern Iran, representing previously unexplored locations for such research. Moreover, Amycolatopsis roodepoortensis strain EA7 was identified as a novel and uncommon species of actinomycetes. The bioactive compounds synthesized by this actinomycete species underscore the significance of investigating the soils in this region. This research offers promising opportunities for future pharmaceutical applications and for addressing the challenge of multidrug resistance. Declarations Ethical standards compliance Conflict of interest: The authors affirm that there are no conflicts of interest related to the data in the paper. Funding I affirm that this paper was created without receiving any formal funding. No financial support from any organization, institution, or individual was utilized in the making of this work. Competing Interests The authors have no relevant financial or non-financial interests to disclose. Author Contributions The authors' contributions are as follows: - EA and MM contributed to the concept and design of the experiment and wrote the main manuscript text. - EA conducted the isolation and identification of the bacterial strain, and biochemical analyses. - MM supervised the research projectand experiments related to the evaluation of antimicrobial activities of extract extracted. - KI conducted the 16S rRNA gene analysis to confirm the specie of the actinomycete isolate . - BR Corrected the text of the article and Helped in the selection of magazines. Ethical approval This study does not involve any experiments on humans or animals. Data availability Most of the data supporting the conclusions of this research were provided in the paper. Furthermore, the extra data can be obtained from the corresponding author upon a reasonable request. References Abdel-Motaal F, Maher Z, Ibrahim S, Mleeh A, Behery M, Asmaa M (2022) Comparative Studies on the Antioxidant, Antifungal, and Wound Healing Activities of Solenostemma arghel Ethyl Acetate and Methanolic Extracts. Appl. Sci. 12(1):1-22. https://doi.org/10.3390/app12094121 Alqahtani S, Moni S, Sultan M, Bakkari M, Madkhali O, Alshahrani S, Makeen H, Menachery S, Rehman Z, Alam S, Mohan S, Elmobarak M, Banji D, Sayed-Ahmad M (2022) Potential bioactive secondary metabolites of Actinomycetes sp. isolated from rocky soil of the heritage village Rijal Alma, Saudi Arabia. Arabian J. Chem. 5(2) :1-15. https://doi.org/10.1016/j.arabjc.2022.103793 Kawuri R, Darmayasa I (2019) Bioactive Compound from Extract Filtrat Streptomyces sp. Sp1. as Biocontrol of Vibriosis on Larvae of Macrobrachium rosenbergii shrimps. J. Biosci. 26(10):15-25. https://doi.org/10.4308/hjb.26.1.15 Ansari M, Alkubaisi N, Vijayaragavan P, Murugan P (2019) Antimicrobial Potential of Streptomyces sp. To The Gram positive and Gram - negative Pathogens. J Infect Public Health. 12(1):861-866. https://doi.org/10.1016/j.jiph.2019.05.016 Fahmy NM, Abdel-Tawab AM (2021) Isolation and characterization of marine sponge–associated Streptomyces sp. NMF6 strain producing secondary metabolite(s) possessing antimicrobial, antioxidant, anticancer, and antiviral activities. J Genet Eng Biotechnol. 19(102):1-14. https://doi.org/10.1186/s43141-021-00203-5 Djebbah FZ, Belyagoubi L, Abdelouahid DE, Kherbouche F, Al-Dhabi NA, Arasu MV, Ravindran B (2021) Isolation and characterization of novel Streptomyces strain from Algeria and its in-vitro antimicrobial properties against microbial pathogens. J Infect Public Health. 14(10):1671 -1678. https://doi.org/10.1016/j.jiph.2021.09.019 Alam M, Jha D (2019) Optimization of culture conditions for antimetabolite production by a rare tea garden actinobacterial isolate, Amycolatopsis sp. ST-28. African Journal of Clinical and Experimental Microbiology. 20 (3): 209-220. https://doi.org/10.4314/ajcem.v20i3.6 Velez G, Pass H (2020) A Review of Exhaled Volatile Organic Compounds as Biomarkers for Thoracic Malignancies. Am. J. Biomed. Life Sci. 8(6):231-247. https://doi.org/10.11648/j.ajbls.20200806.17 Kisil OV, Efimenko TA, Efremenkova OV (2021) Looking Back to Amycolatopsis : History of the Antibiotic Discovery and Future Prospects. Antibiotics. 10(125):1-25. https://doi.org/10.3390%2Fantibiotics10101254 Osama N, Bakeer W, Raslan M, Soliman HA, Abdelmohsen UR, Sebak M (2022) Anti-cancer and antimicrobial potential of five soil Streptomycetes : a metabolomics-based study.R Soc Open Sci. 9(2):1-17. https://doi.org/10.1098%2Frsos.211509 Tan LT-H, Chan K-G, Pusparajah P, Yin W-F, Khan T-M, Lee L-H (2019) Mangrove derived Streptomyces sp. MUM265 as a potential source of antioxidant and anticolon-cancer agents. BMC microbiology.19(1):1-16. https://doi.org/10.1186/s12866-019-1409-7 Elgorban AM, Bahkali AH, Farraji AI, Abdei-Wahab M(2019) Natural Products of Alternaria sp ., an endophytic fungus isolated from Salvadora persica from Saudi Arabia. Saudi Journal of Biological Sciences. 26(1):1068-1077. Jha V, Jain T, Nikumb D, Gharat Y, Koli J, Jadhav N, Gaikwad J, Pratiksha D, Dhopeshwarkar D, Narvekar S, Bhargava A (2022) Streptomyces peucetius M1 and Streptomyces lavendulae M3 Soil Isolates as a Promising Source for Antimicrobials Discovery. J. Pharm. Res. Int. 34(50B):7-19.https://doi.org/10.9734/jpri/2022/v34i50B36438 Bansal H, Singla RK, Behzad S,Chopra H, Ajmer S, Shen GB (2021) Unleashing the Potential of Microbial Natural Products in Drug Discovery:Focusing on Streptomyces as Antimicrobials Goldmine. Curr. Top. Med. Chem.35(1):1-23. https://doi.org/10.2174/1568026621666210916170110 Kurnianto MA, Kusumaningrum HD, Lioe HN, Chasanah E (2021) Antibacterial and antioxidant potential of ethyl acetate extract from Streptomyces AIA12 and AIA17 isolated from gut of Chanos chanos. Biodiversitas Journal of Biological Diversity. 22(8):3196-3206. http://dx.doi.org/10.13057/biodiv/d220813 Oliveros KM, Rosana AR, Montecillo AD, Opulencia RB, Jacildo AJ, Zulaybar TO, Raymundo AK (2021) Genomic Insights into the Antimicrobial and Anticancer Potential of Streptomyces sp. A1-08 Isolated from Volcanic Soils of Mount Mayon, Philippines. Philipp. J. Sci. 150 (6A):1351-1377. https://doi.org/10.56899/150.6A.01 Singh A, Singh P (2021) Production of bioactive compounds by Streptomyces sp. and their antimicrobial potential against selected MDR uropathogens. J. Appl. Biol. Biotechnol. 9(6):71-79. http://dx.doi.org/10.7324/JABB.2021.9609 Adamek M, Alanjary M, Sales-Ortells H, Goodfellow M, Bull A, Winkler A, Wibberg D, Kalinowski J, Ziemert N (2018) Comparative genomics reveals phylogenetic distribution patterns of secondary metabolites in Amycolatopsis species. BMC Genomics. 19(426):1-15. https://doi.org/10.1186/s12864-018-4809-4 Song Z, Xu T, Wang J, Hou Y, Liu C, Liu S, Wu S (2021) Secondary Metabolites of the Genus Amycolatopsis : Structures, Bioactivities, and Biosynthesis. Molecules. 26(18):1-35.https://doi.org/10.3390/molecules26071884 Tistechok SI,Tymchuk IV, korniychuk OP, Fedorenko VO, Luzhetskyy MA,Gromyko OM (2021) Genetic Identification and Antimicrobial Activity of Streptomyces sp. Strain Je 1-6 Isolated from Rhizosphere Soil of Juniperus excelsa Bieb. Genetic Identification and Antimicrobial Activity.55(1):28-35. https://doi.org/10.3103/S0095452721010138 Julianti E, Abrian IA, Wibowo MS, Azhari M, Tsurayya N, Izzati F (2022) Secondary Metabolites from Marine-Derived Fungi and Actinobacteria as Potential Sources of Novel Colorectal Cancer Drugs. Marine Drugs. 20(1):67-79. https://doi.org/10.3390/md20010067 Lukežič T, Fayad A, Bader C, Harmrolfs K, Bartuli J,Groß S, Lešnik U, Hennessen F, Herrmann J, Pikl S, Petković H, Müller R (2019) Engineering Atypical Tetracycline Formation in Amycolatopsis sulphurea for the Production of Modified Chelocardin Antibiotics. ACS Chem. Biol. 10(5):1-11.https://doi.org/10.1021/acschembio.8b01125 Fayyad R, Lefta S, Nuaman RS, Abboodi AK (2021) Exploration of the Impact of Moringa Oleifera leaves as anti-bacterial and tumor inhibitor and Phytochemical profiling by GC-Mass analysis. Pakistan Journal of Medical and Health Sciences. 15(1):343-347. Kumaran S , Bharathi S, Uttra V, Thirunavukkarasu R, Nainangu P, Krishnan V, Renuga P, Wilson A, Balaraman D (2020) Bioactive metabolites produced from Streptomyces enissocaesilis SSASC10 against fish pathogens. Biocatalysis and Agricultural Biotechnology. 29(1):1-6. https://doi.org/10.1016/j.bcab.2020.101802 Kebede B, Shibeshi W(2022) In vitro antibacterial and antifungal activities of extracts and fractions of leaves of Ricinus communis Linn against selected pathogens.Veterinary Medicine and Science. 8:1802–1815. https://doi.org/10.1002/vms3.772 Tables Tables 1-4 are available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files Tables.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4644566","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":328820220,"identity":"17d57ee3-bec6-49f3-b33b-98e4cd97422e","order_by":0,"name":"Elham Amiri","email":"","orcid":"","institution":"Islamic Azad University, Lahijan Branch","correspondingAuthor":false,"prefix":"","firstName":"Elham","middleName":"","lastName":"Amiri","suffix":""},{"id":328820221,"identity":"40731988-d4d3-4826-ab9b-d937bb0c20bb","order_by":1,"name":"Mirsasan Mirpour","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDklEQVRIiWNgGAWjYBACg8MwlkRiA5jmZ4YKsOHQYgnXIvMQokWymYAW+wMwlvwDqL0HsCpEALPjvI8//Phjl8cgndz2uaDicL7xceZnEgw1dgx80tg1mx1mN5PsbUsuZpBObJ4948xhy22H2cwkGI4lM7DxJeDQwsbGwNvAnNgA1MLM23bYwOwwA1AL2wEGNh7sDjM4zMb88c+f+sQGCagW42b2bxIM//BqYZDmYTuM0GLAzGMmwdiGVwubtGzb8cQ2kJYZZ9INJA7zFFsk9iXz4NRy/hjzxzd/qhP7JdIfMxdUWBvw9x/feOPDNzs5+R7sWuAAFHHMcF4CAwMOO9AAM2Elo2AUjIJRMBIBACakUgsQoB8JAAAAAElFTkSuQmCC","orcid":"","institution":"Islamic Azad University, Lahijan Branch","correspondingAuthor":true,"prefix":"","firstName":"Mirsasan","middleName":"","lastName":"Mirpour","suffix":""},{"id":328820222,"identity":"280a0b56-f05b-49ba-aaa9-d97dc67716c8","order_by":2,"name":"Khosro Issazadeh","email":"","orcid":"","institution":"Islamic Azad University, Lahijan Branch","correspondingAuthor":false,"prefix":"","firstName":"Khosro","middleName":"","lastName":"Issazadeh","suffix":""},{"id":328820223,"identity":"a3c4980f-6358-41ed-a979-b2aeb9b9caad","order_by":3,"name":"Behnam Rasti","email":"","orcid":"","institution":"Islamic Azad University, Lahijan Branch","correspondingAuthor":false,"prefix":"","firstName":"Behnam","middleName":"","lastName":"Rasti","suffix":""}],"badges":[],"createdAt":"2024-06-26 19:06:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4644566/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4644566/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":60695034,"identity":"39f95717-5321-4363-8116-7d21680942f4","added_by":"auto","created_at":"2024-07-19 16:02:22","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":10690,"visible":true,"origin":"","legend":"\u003cp\u003eMacroscopic shape (a) and Microscopic shape strain EA7 (b)\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4644566/v1/636b97df80ee5d2bd7e60227.jpg"},{"id":60694504,"identity":"f73713bc-a926-4d71-b7d5-48893566a72a","added_by":"auto","created_at":"2024-07-19 15:54:22","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":8217,"visible":true,"origin":"","legend":"\u003cp\u003eAntibiotic sensitivity test of strain EA7\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4644566/v1/9f11291b023d197d35bea18a.jpg"},{"id":60694506,"identity":"e787023e-3d27-4bd7-b225-e46f13a46b66","added_by":"auto","created_at":"2024-07-19 15:54:22","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":7124,"visible":true,"origin":"","legend":"\u003cp\u003eAntimicrobial effect of strain EA7 in the Primary screening\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4644566/v1/06d25970dde4091d85f1db9a.jpg"},{"id":60695035,"identity":"b9d89554-e6af-4d91-91c9-cad5e9adea6d","added_by":"auto","created_at":"2024-07-19 16:02:22","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":6198,"visible":true,"origin":"","legend":"\u003cp\u003ePCR product electrophoresis \u0026nbsp;results on agarose gel\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4644566/v1/2c7fa56873f25b250397d069.jpg"},{"id":60694514,"identity":"a9e582cc-476b-4f05-8747-1c73fa57e7e4","added_by":"auto","created_at":"2024-07-19 15:54:22","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":24262,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree of strain EA7 based on \u003cem\u003e16SrRNA\u003c/em\u003e gene sequences with other \u003cem\u003eAmycolatopsis\u003c/em\u003especies using Neighbor-joining method\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4644566/v1/db14dba498b08f935935970a.jpg"},{"id":60694512,"identity":"a6bd5ced-898f-4670-b882-4c0ac6e72a41","added_by":"auto","created_at":"2024-07-19 15:54:22","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":5471,"visible":true,"origin":"","legend":"\u003cp\u003eAntimicrobial effect of the fermentation broth of strain EA7\u003c/p\u003e","description":"","filename":"6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4644566/v1/6a84fda7fb0d5820f239c8ad.jpg"},{"id":60694510,"identity":"3db40da7-69d9-49b2-bc6e-a90ed82667ea","added_by":"auto","created_at":"2024-07-19 15:54:22","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":21290,"visible":true,"origin":"","legend":"\u003cp\u003eAntimicrobial effect of strain EA7 by Agar disc diffusion method, methanolic extract \u0026nbsp;(a) and ethyl acetate extract(b)\u003c/p\u003e","description":"","filename":"7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4644566/v1/1be8ddef23ba67024b530cc4.jpg"},{"id":60694511,"identity":"159a8a5a-0c12-45eb-ac72-069c88cb870d","added_by":"auto","created_at":"2024-07-19 15:54:22","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":13076,"visible":true,"origin":"","legend":"\u003cp\u003eGC-MS chromatogram of strain EA7 ethyl acetate extract\u003c/p\u003e","description":"","filename":"8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4644566/v1/30cf30c859515c107dc6de34.jpg"},{"id":60695399,"identity":"7fba95c1-ed55-4858-9fcc-69c05e47f16b","added_by":"auto","created_at":"2024-07-19 16:10:22","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":24799,"visible":true,"origin":"","legend":"\u003cp\u003eLC–MS chromatogram of strain EA methanolic extract\u003c/p\u003e","description":"","filename":"9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4644566/v1/97f912ce995703fd3083070b.jpg"},{"id":86703416,"identity":"cf42913b-5bb0-4fd8-9934-801f82d6d67c","added_by":"auto","created_at":"2025-07-14 16:46:39","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1278359,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4644566/v1/4b7d35ed-b574-44d1-a8d1-9d477891bcd8.pdf"},{"id":60694505,"identity":"5001a16a-eca8-4797-a481-edf0a94486e3","added_by":"auto","created_at":"2024-07-19 15:54:22","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":21986,"visible":true,"origin":"","legend":"","description":"","filename":"Tables.docx","url":"https://assets-eu.researchsquare.com/files/rs-4644566/v1/b1155aa694c6f3dcf1eb8ba6.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Isolation and identification of the rare actinomycete, Amycolatopsis roodepoortensis strain EA7 from the agricultural soils of northern Iran and identification of their biological products","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe rising challenges posed by antibiotic-resistant pathogens, the emergence of new diseases, and the toxicity associated with current bioactive compounds have led to a growing demand for antibiotics worldwide (Adamek et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Jha et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In particular, infections caused by multidrug-resistant (MDR) gram-negative pathogens present a significant global challenge, highlighting the urgent need for the discovery of novel antimicrobial compounds and treatment approaches. Nature has long served as a valuable source of bioactive compounds with diverse applications in pharmaceuticals, medicine, and biochemistry (Djebbah et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Microorganisms, especially actinomycetes, have been instrumental in contributing to human health through the production of antibiotics. Among actinomycetes, the genus Streptomyces is a potential source of all secondary metabolites.Additionally, genera such as \u003cem\u003eAmycolatopsis\u003c/em\u003e, \u003cem\u003eActinoplanes\u003c/em\u003e, \u003cem\u003eMicromonospora\u003c/em\u003e, and \u003cem\u003eSaccharopolyspora\u003c/em\u003e are vital producers of antibiotics (Singh, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). \u003cem\u003eAmycolatopsis\u003c/em\u003e, a member of the \u003cem\u003ePseudonocardiaceae\u003c/em\u003e family, consists of \u003cem\u003enocardioform\u003c/em\u003e actinomycetes characterized by the absence of mycolic acids and the presence of aminopimelic acid, arabinose, and galactose mesodies. Notably, the cell wall peptidoglycan of \u003cem\u003eAmycolatopsis\u003c/em\u003e is renowned for yielding antibiotic strains that produce ansamycin compounds, distinguishing them from other groups. Due to their versatility in producing antibiotics, anti-cancer agents, and other therapeutically important compounds, \u003cem\u003eAmycolatopsis\u003c/em\u003e is considered to be among the key microorganisms of the 21st century (Adamek et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Julianti et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). This study focuses on the exploration of the lesser-known group of non-\u003cem\u003estreptomycete\u003c/em\u003e actinobacteria, which remain underutilized despite their vast chemical diversity. These rare actinomycetes are known to produce a wide array of unique, often complex compounds with potent bioactivity and low toxicity. While research on the biosynthesis of secondary metabolites in \u003cem\u003eAmycolatopsis\u003c/em\u003e is currently limited (Alam \u0026amp; Jha, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). our study aims to isolate and identify a rare group of actinomycetes from soil samples collected in the Alborz Mountains of Northern Iran. Additionally, we assess the antimicrobial activity of the isolated strain against human pathogenic bacteria and identify bioactive compounds through LC-MS and GC-MS analyses.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e \u003cb\u003eSample Collection and Isolation of\u003c/b\u003e \u003cb\u003eactinomycetes\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA total of 15 soil samples were collected by removing the upper layer from a 15 cm depth using a shovel at 3 different locations in the southwest of Guilan province, nestled in the picturesque Alborz Mountains with the geographical coordinates of east 49.5292\u003csup\u003e0\u003c/sup\u003e and north 36.8767\u003csup\u003e0\u003c/sup\u003e. The gathered samples were air-dried at room temperature for one week. For the separation process, serial dilutions ranging from 10\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e to 10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e were prepared from the soil samples. To achieve this, 1 gram of dried soil samples was mixed with 9 ml of sterile distilled water, then 1 ml of each dilution ranging from 10\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e to 10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e was cultured on starch casein agar (SCA) medium. To prevent fungal and bacterial contaminations, Tetracycline (25 \u0026micro;g/ml) and Nystatin (50\u0026micro;g/ml) antibiotics were added. The plates were incubated at 28\u0026deg;C for 4 days. Upon incubation, suspected actinomycete colonies were purified on ISP2 agar medium (International \u003cem\u003eStreptomyces\u003c/em\u003e Project Medium) at 28\u0026deg;C for another 4 days (Tan et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eMorphological, Biochemical, and Physiological Characteristics of\u003c/b\u003e \u003cb\u003eactinomycetes\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe characteristics of the actinomycetes were thoroughly investigated. Morphological characteristics were examined using both macroscopic and microscopic methods. Biochemical analyses included oxidase and catalase tests, as well as assessments of starch, urea, casein, and gelatin hydrolysis, nitrate reduction, citrate utilization, and SIM tests. Furthermore, the fermentation of sugars such as glucose, galactose, fructose, sucrose, raffinose, mannitol, maltose, xylose, lactose, and arabinose was explored. The growth conditions of the isolates were studied under various culture conditions, including different concentrations of NaCl (1\u0026ndash;7%, w/v), pH values ranging from 4 to 8, and temperatures between 27\u0026ndash;45\u0026deg;C as part of confirmatory tests (Fahmy et al., 2021).\u003c/p\u003e \u003cp\u003e \u003cb\u003eAntibiotic susceptibility testing of\u003c/b\u003e \u003cb\u003eactinomycetes\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAn antibiotic sensitivity test of screened actinomycetes was conducted using 8 antibiotics (tetracycline 30 mg, vancomycin 30 mg, ampicillin10 mg, chloramphenicol 30 mg, ciprofloxacin 5 mg, imipenem 10 mg, piperacillin 100 mg, and ceftazidime 30 mg) according to the standard protocol (CLSI 2020) using the Kerby-Bauer disc diffusion method. Briefly, bacterial cultures (0.5 McFarland turbidity) were spread on Mueller-Hinton Agar (MHA) plates with sterile swap. Antibiotic discs were placed on inoculated plates with sterile forceps. The plates were incubated for 2 days at 28\u0026deg;C and the sensitivity of each antibiotic was determined by checking the zones of inhibition in mm(Oliveros et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Lukežič et al.,2019 ).\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eIsolation and identification of pathogenic bacteria\u003c/h2\u003e \u003cp\u003eThe studied organisms for the antimicrobial assay of \u003cem\u003eactinomycetes\u003c/em\u003e were collected from the infectious department of Rasht Hospital. Following the protocol outlined by Ansari et al. (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), biochemical tests (including catalase, mannitol salt agar, and coagulase for \u003cem\u003eStaphylococcus aureus\u003c/em\u003e and catalase, oxidase, Simon citrate agar, and TSI for \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e), Gram-staining, and antibiotic sensitivity tests to four antibiotics (imipenem 10mg, ciprofloxacin 5mg, ceftazidime 30mg, and piperacillin 100mg) were conducted (Ansari et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Additionally, standard strains, including \u003cem\u003eP. aeruginosa\u003c/em\u003e PTCC 1565 and \u003cem\u003eS. aureus\u003c/em\u003e PTCC 1112, were procured from the Iran Scientific and Industrial Research Organization.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAntimicrobial activity of\u003c/b\u003e \u003cb\u003eactinomycetes\u003c/b\u003e \u003cb\u003e(primary screening)\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe antimicrobial effect of the isolated strains against clinical and standard strains of P. aeruginosa and S. aureus was assessed using the cross-streak method on ISP2 medium. Actinomycete isolates were vertically streaked (8 mm) in the center of plates containing ISP2 medium and were incubated for 7 days at 28\u0026deg;C. After the incubation period, pathogenic bacteria (adjusted to 0.5 McFarland's turbidity) were streaked perpendicular to the culture of actinomycete isolates on ISP2 medium. The plates were incubated for 24 h at 37\u0026deg;C. Based on the presence and absence of inhibition zones, actinomycete strain producing antimicrobial compounds were selected for further study (Fahmy et al., 2021; Singh, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eGenomic and phylogenetic analyses\u003c/h2\u003e \u003cp\u003eGenomic DNA extraction was performed prior to \u003cem\u003e16S rRNA\u003c/em\u003e sequencing. The \u003cem\u003e16S rRNA\u003c/em\u003e gene was amplified by PCR according to the protocol of Tan et al. (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Polymerase chain reaction (PCR) was conducted to amplify the \u003cem\u003e16S rRNA\u003c/em\u003e gene using universal primers, 27F (5'- AGAGTTTGATCCTGGCTCAG \u0026minus;\u0026thinsp;3') and 1492 R (5'- GGTTACCTTGTTACGACTT \u0026minus;\u0026thinsp;3'). The PCR program for the selected actinomycete isolate consisted of 35 cycles: Initial denaturation at 95\u0026deg;C for 2 min, followed by denaturation at 95\u0026deg;C for 30 seconds, annealing at 55\u0026deg;C for 30 seconds, extension at 72\u0026deg;C for 45 seconds, and a final extension at 72\u0026deg;C for 5 min. Upon completion of the reaction steps and confirming the obtained bands by agarose gel electrophoresis, the reaction product was sequenced. Subsequently, the obtained results were compared with sequences in the NCBI database using the BLAST program (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003ca href=\"http://www.ncbi.nlm.nih.gov/blst\" target=\"_blank\"\u003ewww.ncbi.nlm.nih.gov/blst\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/blst\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The phylogeny tree of this isolate was drawn by the neighbor-joining method using the NCBI database and the BLAST program.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eFermentation and Determination of the antimicrobial activity of the fermentation broth\u003c/h2\u003e \u003cp\u003eA submerged fermentation culture was used to extract bioactive compounds according to the protocol of Kurnianto et al. (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Pure colonies of \u003cem\u003eactinomycet\u003c/em\u003e grown on ISP2 agar medium were inoculated into 200 ml of ISP2 broth culture medium were inoculated in a 500 ml Erlenmeyer flask, maintaining a pH of 7, and incubated in a shaker incubator at 30\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u003csup\u003e0\u003c/sup\u003eC in the dark for one week at 120\u0026ndash;150 rpm. To determine the optimal time for the production of bioactive compounds, the antimicrobial activity of the fermentation medium was measured from day 5 to day 7 at 24h intervals by the agar well diffusion method. First, a microbial suspension with 0.5 McFarland turbidity was prepared from pathogenic and standard \u003cem\u003eP. aeruginosa\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e bacteria and inoculated using a sterile swab on the surface of Mueller-Hinton agar. Next, wells with a diameter of 6 mm were punched in Muller-Hinton agar,and each well was filled with 50 \u0026micro;L of fermentation broth of \u003cem\u003eamycolatopsis\u003c/em\u003e. After overnight incubation at 37\u0026deg;C, the diameter of the growth inhibition halo around the wells was measured (Kurnianto et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Osama et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eExtraction of the extract with ethyl acetate and methanol\u003c/h2\u003e \u003cp\u003eTo extract the bioactive compounds (crude extract), the entire volume of the fermentation medium was centrifuged at 4000 rpm for 20 min at 4\u0026deg;C. Then, for GC-MS and LC-MS analysis, the obtained supernatant liquid was mixed with ethyl acetate and methanol organic solvent at a volume ratio of 1:1 and stirred for 2 h on a magnetic stirrer at 140 rpm at room temperature, Finally, the aqueous and organic phases were separated using a decanter funnel (Bansal et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eAntibacterial activity of the ethyl acetate and methanol extract\u003c/h2\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003eAgar disc diffusion method\u003c/h2\u003e \u003cp\u003eAntimicrobial effect of the extracted ethyl acetate and methanolic extract on clinical and standard strains of \u003cem\u003eP. aeruginosa\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e was evaluated using disk diffusion test. Microbial suspensions with a turbidity equal to 0.5 McFarland standard were prepared from pathogenic bacteria and standard strains of \u003cem\u003eP. aeruginosa\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e. then, cultured on the surface of Mueller-Hinton agar plates by using sterile swabs.100 \u0026micro;l of the crude extract was dissolved in 10 \u0026micro;l of DMSO as the extract solvent. Then, blank paper discs were loaded with 30 \u0026micro;l of the dissolved extract and allowed to absorb. Discs were placed on Mueller- Hinton agar plates. After 24 h of incubation at 37\u0026deg;C, the diameter of the growth inhibitory zone around the discs was measured (Kumaran et al.,2020).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e\u003cb\u003eDetermination of minimum inhibitory and minimum bactericidal concentration assay of extracts\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eMIC of the extracts was determined by microdilution broth technique against Clinical samples and standard strains in 96-well plates, as recommended by CLSI (2021). Briefly, 100 \u0026micro;l of MHB culture medium was poured into 96-well plates, then 100 \u0026micro;l of extract solution (Dissolved in DMSO) was added to the first well, a series of dilutions ranging from 5000 ,2500, 1250, 625, 312.5, and 156.25 \u0026micro;g /mL of extract were prepared, and in the last step 100 \u0026micro;l of microbial suspensions with a concentration of 1.5x10\u003csup\u003e6\u003c/sup\u003e CFU/mL were added to each well. MHB and the bacterial suspension considered as a negative and positive control, respectively. 96-well microtiter plates were incubated at 37\u0026deg;C for 24 h .The lowest concentration at which no turbidity observed was taken as minimum inhibitory concentration. To determine MBC, 100 \u0026micro;L of the contents of the turbidity-free wells obtained in the MIC test were cultured on Mueller-Hinton agar. After a 24h incubation period, the minimum concentration of the extract with no visible growth was taken as minimum bactericidal concentration (Kurnianto et al.,2021).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003eGas Chromatography-Mass Spectroscopic (GC-MS) analysis\u003c/h2\u003e \u003cp\u003eGC-MS analysis was performed using an Agilent 6890 Series gas chromatography system with an Agilent 5973 Network Mass Selective Detector mass spectrometer. A VARIAN cp-sil 8cb-ms column was used for gas chromatography, with a column length of 50m, an inner diameter of 0.25 mm, and a film thickness of 0.25 \u0026micro;m. For the analysis, 1 \u0026micro;L of the analyte was added in split mode at a ratio of 1:10. Helium was used as the carrier gas, with a constant flow rate through the column of 1 mL/min. The initial temperature was set to 60\u0026deg;C and held for 2 min, then the temperature was increased to 250\u0026deg;C and maintained for 20 min. Mass spectra analysis was performed as a quadrupole. Mass spectra data (MS) was obtained in full scan mode from 20 to 400 Da, with an impact mode energy of 70 eV. The temperature during mass spectra analysis was maintained at 230\u0026deg;C. The extracted components were identified by comparing the MS data with those from the NIST MS Spectral search program and Wiley mass spectral library data (Tistechok et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003eLiquid Chromatography-Mass Spectroscopy (LC-MS) analysis\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eLC-MS analysis was performed using an HPLC system (Waters Alliance 2695 liquid chromatography) coupled with a mass spectrometer (Micromass Quattro micro API). The analysis employed 0.1% formic acid in water as the aqueous phase and 0.1% formic acid as the mobile phase. A concentrated gradient was injected at a flow rate of 0.3 mL/min, and the chromatography column was maintained at a temperature of 35\u0026deg;C during operation. Nitrogen gas was utilized at a flow rate of 250 L per h, and a voltage of 30V was applied. Mass detection was carried out in positive mode, with detection in the range of m/z 200\u0026ndash;2000 (Song et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eIsolation and Identification of \u003cem\u003eactinomycetes\u003c/em\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn our study on \u003cem\u003eactinomycetes\u003c/em\u003e, we identified 14 isolates with \u003cem\u003eactinomycetes\u003c/em\u003e morphology. These isolates underwent screening for antimicrobial activity (primary screening). Among them, one sample, strain EA7, stood out due to its distinct antimicrobial activity and was therefore selected for further identification and investigation of bioactive compounds. Strain EA7 exhibited broad-spectrum antimicrobial activity and is considered a rare \u003cem\u003eactinomycete\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMorphological, Biochemical, and Physiological Characteristics of Strain EA7\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe macroscopic appearance of the colonies on ISP2 solid medium showed a dry, chalky appearance (Figure 1a), while the microscopic observation revealed a filamentous structure for strain EA7 (Figure 1b). Biochemical analysis indicated that the strain is catalase-positive and capable of hydrolyzing gelatin and casein, but negative for the hydrolysis of starch and urea. The Simon citrate, oxidase, and SIM tests turned out negative. Strain EA7 can utilize various carbon sources, including glucose, xylose, mannitol, raffinose, and arabinose. It thrives within a temperature range of 27 to 37 \u0026deg;C, at a pH range of 7 to 8, and can tolerate up to 7% sodium chloride (Table 1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntibiotic Susceptibility Testing of Strain EA7\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAmong the 14 actinomycete isolates, only strain EA7 displayed high resistance to eight antibiotics tested in this study, whereas the remaining isolates exhibited low resistance with a maximum halo diameter of 20 mm (Table 1, Figure 2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation and Identification of Pathogenic Bacteria\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn total, six pathogenic bacteria were identified, including \u003cem\u003eS. aureus\u003c/em\u003e, a Gram-positive, cocci-shaped bacterium that is catalase-positive, oxidase-negative, coagulase-positive, capable of growth on mannitol salt agar medium. Additionally, \u003cem\u003eP. aeruginosa\u003c/em\u003e, a Gram-negative, rod-shaped bacterium was identified, which is catalase-positive, oxidase-positive, non-fermenting, motile, capable of citrate utilization, and grows at 42 \u0026deg;C. Clinical samples of P. aeruginosa, S. aureus, and standard strains were found to be resistant to all antibiotics.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntimicrobial Activity of Strain EA7 (Primary Screening)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStrain EA7 exhibited a 20 mm diameter growth inhibition zone against \u003cem\u003eS. aureus\u003c/em\u003e. However, no growth inhibition halo was observed against \u003cem\u003eP. aeruginosa\u003c/em\u003e (Figure 3).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGenomic and Phylogenetic Analyses of Strain EA7\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe analysis of the \u003cem\u003e16S rRNA\u003c/em\u003e gene using BLAST software revealed a 99.63% sequence match with \u003cem\u003eAmycolatopsis roodepoortensis\u003c/em\u003e. This sequence was deposited in GenBank as \u003cem\u003eAmycolatopsis roodepoortensis\u003c/em\u003e strain EA7 (GenBank accession number: OR680714). The results of PCR and phylogenetic analysis of \u0026nbsp;strain \u0026nbsp;EA7 \u0026nbsp;using the neighbor-joining method, compared to other species of \u003cem\u003eAmycolatopsis\u003c/em\u003e are shown in Figures 4 and 5, respectively.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetermination of Antimicrobial Activity of the Fermentation Broth of Strain EA7\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe antimicrobial activity of strain EA7\u0026apos;s fermentation broth was assessed using the agar well diffusion method (Figure 6). Notably, on the 7th day of fermentation, strain EA7 exhibited significant antimicrobial effects against \u003cem\u003eS. aureus\u003c/em\u003e (halo diameter of 23mm) compared to P. aeruginosa. The broad-spectrum antimicrobial activity of strain EA7\u0026apos;s fermentation culture indicated the production of active antibiotics and bioactive compounds in ISP2 broth nutrient medium.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntimicrobial Activity of Ethyl Acetate and Methanol Extracts\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAgar disc diffusion method\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe agar disc diffusion method was employed to assess the antimicrobial activity of ethyl acetate and methanol extracts. The highest inhibition zone diameters observed were 25mm and 11mm against Gram-positive bacteria (\u003cem\u003eS. aureus\u003c/em\u003e) for ethyl acetate and methanol extracts, respectively, while the inhibitory effects on Gram-negative bacteria (\u003cem\u003eP. aeruginosa\u003c/em\u003e) were relatively lower (Figure 7).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetermination of Minimum Inhibitory and Minimum Bactericidal Concentration Assay\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe minimum inhibitory concentration (MIC) of ethyl acetate extract for \u003cem\u003eS. aureus\u003c/em\u003e, \u003cem\u003eP. aeruginosa\u003c/em\u003e clinical sample, \u003cem\u003eS. aureus\u003c/em\u003e PTCC 1112, and \u003cem\u003eP. aeruginosa\u003c/em\u003e PTCC 1565 strains was reported as follows: 625 \u0026mu;g/mL, 1250 \u0026mu;g/mL, 312.5 \u0026mu;g/mL, and 1250 \u0026mu;g/mL, respectively. The minimum bactericidal concentration (MBC) values of ethyl acetate extract for \u003cem\u003eS. aureus\u003c/em\u003e and \u003cem\u003eP. aeruginosa\u003c/em\u003e (both clinical and standard samples) were 2500 \u0026mu;g/mL and 5000 \u0026mu;g/mL. On the other hand, the minimum inhibitory concentration of methanolic extract for \u003cem\u003eS. aureus\u003c/em\u003e, \u003cem\u003eP. aeruginosa\u003c/em\u003e clinical sample, \u003cem\u003eS. aureus\u003c/em\u003e PTCC 1112, and P\u003cem\u003e. aeruginosa\u003c/em\u003e PTCC 1565 strain standard was reported as: 1250 \u0026mu;g/mL, 2500 \u0026mu;g/mL, 625 \u0026mu;g/mL, and 2500 \u0026mu;g/mL, respectively. Additionally, the MBC from the methanolic extract for \u003cem\u003eS. aureus\u003c/em\u003e was obtained at 5000 \u0026micro;g/mL, while it was not detected for \u003cem\u003eP. aeruginosa\u003c/em\u003e (Table 2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGC-MS Analysis of Ethyl Acetate Extract of Strain EA7\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 55 chemical compounds were identified by comparing their mass spectra with the Wiley Registry 8e library, based on the evaluation of retention time, molecular formula, molecular weight, percentages of area, and quality in the ethyl acetate extract of strain EA7 . The results of the GC-MS analysis revealed that the strain EA7 extract contains 24 compound with a quality of 70% or higher(Table 3). Acetic acid, 2-methylpropyl ester (15.8%) as the Major compound was identified in the strain EA7 extract. Other identified compounds included 7,9-di-tert-butyl-1-oxaspiro(4,5)deca-6,9-diene-2,8-dione (13.6%), isopropyl myristate (11.4%), 9-octadecenoic acid, ethyl ester (10.4%), and 2,3-Butanediol (8.2%). The GC-MS chromatogram displaying the biologically active compounds of strain EA7 is illustrated in figure 8.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLC-MS analysis\u003c/strong\u003e \u003cstrong\u003eof the methanolic extract\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eof Strain EA7\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTetracycline, Dihydroxybenzamide, Penipacid E, Valgamycin V, Dipyrimicin A, phenol, 2, 2\u0026apos;-methylenebis[6-(1,1-dimethylethyl)-4-methyl], Tetrangomycin, Amycolamycin A,and Amycolactam were identified in the methanolic\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003eextract of strain EA7. The secondary metabolites were known in the methanolic extract of strain EA7 with m/z values is shown in Table 4. \u0026nbsp;Compound 1: appeared at a retention time of 2.15 min, The mass ion peak at m/z \u0026nbsp;323.091 [M +H]+with predicted MF C\u003csub\u003e19\u003c/sub\u003eH\u003csub\u003e14\u003c/sub\u003eO\u003csub\u003e5\u003c/sub\u003e was explained as a Tetrangomycin antibiotic. Compound 2: appeared at a retention time of 2.89 min, The mass ion peak at m/z \u0026nbsp;231.567 [M +H]+ with predicted MF C\u003csub\u003e12\u003c/sub\u003eH\u003csub\u003e10\u003c/sub\u003eN\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e3\u003c/sub\u003e\u0026nbsp; was explained as a Penipacid E antibiotic. \u0026nbsp;Compound 3: appeared at a retention time of 3.68 min, The mass ion peak at m/z \u0026nbsp; 446.O55 [M +H]+ with predicted MF C\u003csub\u003e22\u003c/sub\u003eH\u003csub\u003e24\u003c/sub\u003eN\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e8\u003c/sub\u003e\u0026nbsp; \u0026nbsp;was explained as a tetracycline antibiotic. Compound 4: appeared at a retention time of 4.18 min, The mass ion peak at m/z \u0026nbsp;138.027 [M +H]+ with predicted MF C\u003csub\u003e7\u003c/sub\u003eH\u003csub\u003e7\u003c/sub\u003eNO\u003csub\u003e2\u0026nbsp;\u003c/sub\u003e\u0026nbsp; was explained as a Dihydroxybenzzamide compund. Compound 5: appeared at a retention time of 4.18 min, The mass ion peak at m/z \u0026nbsp;315.206 [M +H]+ with predicted MF C\u003csub\u003e18\u003c/sub\u003eH\u003csub\u003e22\u003c/sub\u003eN\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e3\u003c/sub\u003e\u0026nbsp; \u0026nbsp;was explained \u0026nbsp; as a Amycolactam antibiotic. \u0026nbsp;Compound 6: appeared at a retention time of 5.91 min, The mass ion peak at m/z \u0026nbsp;609.313 [M +H]+ with predicted MF C\u003csub\u003e29\u003c/sub\u003eH\u003csub\u003e48\u003c/sub\u003eN\u003csub\u003e4\u003c/sub\u003eO\u003csub\u003e8\u003c/sub\u003e\u0026nbsp; was explained \u0026nbsp; as a Valgamicin V antibiotic. Compound 7: appeared at a retention time of 8.23 min, The mass ion peak at m/z \u0026nbsp;246.956 [M +H]+ with predicted MF C\u003csub\u003e12\u003c/sub\u003eH\u003csub\u003e10\u003c/sub\u003eN\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e\u0026nbsp; was explained as a Dipyrimicin \u0026nbsp;A antibiotic.Compound 8: appeared at a retention time of 14.76 min, The mass ion peak at m/z \u0026nbsp;341.921 \u0026nbsp; [M +H]+ with predicted MF C\u003csub\u003e23\u003c/sub\u003eH\u003csub\u003e32\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e\u0026nbsp; \u0026nbsp;was explained \u0026nbsp; as a Phenol, 2,2\u0026prime;-methylenebis[6-(1,1-dimethyl ethyl)-4-methyl ] \u0026nbsp;compound . Compound 9: appeared at a retention time of 14.83 min, The mass ion peak at m/z \u0026nbsp;783.164 [M +H]+ with predicted MF C\u003csub\u003e39\u003c/sub\u003eH\u003csub\u003e40\u003c/sub\u003eCINO\u003csub\u003e14\u003c/sub\u003e\u0026nbsp; was explained \u0026nbsp; as a Amycolamycin \u0026nbsp;A antibiotic. The LC-MS chromatogram of bioactive compounds (secondary metabolites) in the methanolic extract of strain EA7 is shown in Figure 9.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe isolation of new compounds from nature can be a solution to reduce the side effects of chemical therapy in the treatment of cancer and also increase the effectiveness of antibiotic resistance against clinical pathogens (Adamek et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Ansari et al.'s (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) studies showed that agricultural soils have a great variety of actinomycetes. In this research, the bacterium \u003cem\u003eAmicolatopsis roodepoortensis\u003c/em\u003e strain EA7 was isolated from the southwestern soils of Guilan (Alborz range) and identified by morphological, biochemical, and molecular methods. Out of 14 actinomycete isolates, only strain EA7 was highly resistant to eight commercial antibiotics (including ampicillin, penicillin, chloramphenicol, tetracycline, piperacillin, imipenem, ceftazidime, and ciprofloxacin). While other isolates showed the lowest resistance with a maximum halo diameter of 20 mm. Other research (Alam \u0026amp; Jha, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) showed the antibiotic resistance of soil actinomycetes, \u003cem\u003eAmycolatopsis balhimycina\u003c/em\u003e, and \u003cem\u003eAmycolatopsis orientalis\u003c/em\u003e against four antibiotics (ampicillin, penicillin, chloramphenicol, and tetracycline), as well as antimicrobial activity. Significant differences in antibiotic susceptibility patterns and nutritional resource utilization within and among Actinomycetes species may be related to local adaptations (Kisil et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In our research, significant antibacterial activity was obtained on the 7th day of fermentation. In research on actinomycetes (Osama et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) and in another study (Alam \u0026amp; Jha, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) on \u003cem\u003eAmycolatopsis\u003c/em\u003e sp. ST-28, under good aeration, the optimal incubation time was reported as 7 and 11 days under shaking conditions. The gradual decrease in antimicrobial activity is associated with a further increase in incubation time (Bansal et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In this research, the antimicrobial effect of the desired strain in the primary and secondary screening had the greatest effect on Gram-positive bacteria (\u003cem\u003eStaphylococcus aureus\u003c/em\u003e), while no significant effect was observed in relation to \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. In another study, gram-negative bacteria had more resistance to the antimicrobial effect produced by actinomycetes compared to gram-positive bacteria, which can be attributed to the different structure of the outer membrane in gram-negative bacteria that have lipopolysaccharide compounds. This structure in gram-negative bacteria leads to their impenetrability against antimicrobial substances (Fahmy et al., 2021). It is consistent with our research results. Methanol and ethyl acetate were taken as solvents for extracting bioactive compounds.\u003c/p\u003e \u003cp\u003eMethanol high polarity enables it to extract polar chemicals. The current research indicated that ethyl acetate extract the highest antimicrobial activities against all microorganisms. which is in agreement with the finding of the previous study done by Kebede et al. (2022). But, the methanolic extract showed less antimicrobial activity.This could be due to the concentration of the higher number of secondary metabolites in the ethyl acetate extract than methanolic extract and the difference in cell surface structure between Gram-positive and Gram-negative bacteria (Ansari et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2019\u003c/span\u003e;Oliveros et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The variationin types and concentration of bioactive compunds and percent of extract yield is because of the difference in substance solubility among solvents. The difference in solubility of a substance might be based on the physical and chemical properties of solvents and phytochemical constituents. Types, quantity and interactions of secondary metabolites present in extracts are determinant s of antimicrobial activities (Kurnianto et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The GC-MS and LC-MS methods were used in this research to identify bioactive compounds. All compounds identified in GC-MS and LC-MS analysis from several microbial sources such as \u003cem\u003eStreptomyces\u003c/em\u003e, \u003cem\u003eNocardia\u003c/em\u003e, and, \u003cem\u003eAspergillus\u003c/em\u003e, with their antimicrobial, anticancer, and antifungal properties confirmed (Lukežič et al.,2019; Fahmy et al., 2021; Velez \u0026amp; Pass, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In GC-MS analysis, Acetic acid, 2-methylpropyl ester (15.8%) as the major compound was identified in the strain EA7 extract. Its antimicrobial effect on some Gram-positive and Gram-negative pathogens has been confirmed. This compound has fungicidal, antibacterial, anti-salmonella, and anti-vaginitis properties. Other compounds identified in GC MS analysis have anticancer, antioxidant, antimicrobial and antifungal properties (Fayad et al., 2021). Tetracycline antibiotic detected in LC-MS analysis is an antibiotic with potential antimicrobial activity that prevents bacterial growth by inhibiting protein synthesis (Lukežič et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Tetrangomycin (an antibiotic from the group of polyphenols), Amycolamycin A(An antibiotic from the group of aminoglycosides, which are effective in inducing apoptosis in cells), amycolactam (as indole alkaloids), dihydroxybenzamide (from the group of benzenes), dipyrimycin A (a derivative of the amide group), Valgamicin V(From the group of cyclic peptide antibiotics), Penipacid E(An antibiotic of anthranilic acid derivatives; an aromatic acid) ), and a Phenol, 2,2\u0026prime;-methylenebis[6-(1,1-dimethyl ethyl)-4-methyl ] (Phenolic compounds from the group of phenols) are the compounds with potential anticancer activity(song et al.,2021; Alqahtani et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe production and release of secondary metabolites depend on several factors, such as nutritional, biological, and environmental conditions. The production of microbial metabolites can be substantially increased by optimizing the nutritional conditions, physical parameters, and genetics (Abdel-Motaal et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The nature and concentration of some components of the fermentation medium also have a marked effect on secondary metabolite production. The environmental structure, along with the metabolic capacity of the producing organisms, strongly affects antibiotic biosynthesis(Elgorban et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Kawuri et al.,2019). In general, most of the bioactive compounds identified in this study by GC-MS and LC-MS are known for their antioxidant, anticancer, and antimicrobial activities. These findings indicate that these bioactive compounds can contribute to the antioxidant capacity, cytotoxic, and antibacterial effect of \u003cem\u003eAmycolatopsis roodepoortensis\u003c/em\u003e strain EA7. Therefore, we suggest that these bioactive compounds, either alone or in combination, maybe the main contributing factors for antimicrobial, antioxidant, and cytotoxic properties found in extract strain EA7.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThe study revealed that the extract from strain EA7, obtained through varying concentrations of ethyl acetate and methanol, effectively inhibited the growth of the tested bacteria. It also successfully identified bioactive compounds and antibiotics produced by Actinomycete isolate strain EA7, originating from lush green environments in northern Iran, representing previously unexplored locations for such research. Moreover, \u003cem\u003eAmycolatopsis roodepoortensis\u003c/em\u003e strain EA7 was identified as a novel and uncommon species of actinomycetes. The bioactive compounds synthesized by this actinomycete species underscore the significance of investigating the soils in this region. This research offers promising opportunities for future pharmaceutical applications and for addressing the challenge of multidrug resistance.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical standards compliance\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConflict of interest: The authors affirm that there are no conflicts of interest related to the data in the paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eI affirm that this paper was created without receiving any formal funding. No financial support from any organization, institution, or individual was utilized in the making of this work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors' contributions are as follows:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e- \u0026nbsp; EA and MM contributed to the concept and design of the experiment and wrote the main manuscript text.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e- \u0026nbsp; EA conducted the isolation and identification of the bacterial strain, \u0026nbsp;and biochemical analyses.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e- \u0026nbsp; MM \u0026nbsp;supervised the research projectand experiments related to the evaluation of antimicrobial activities of \u0026nbsp;extract extracted.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e- KI conducted the 16S rRNA gene analysis to confirm the specie of the actinomycete isolate .\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e- BR Corrected the text of the article and Helped in the selection of magazines.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study does not involve any experiments on humans or animals.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMost of the data supporting the conclusions of this research were provided in the paper. Furthermore, the extra data can be obtained from the corresponding author upon a reasonable request.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbdel-Motaal F, Maher Z, Ibrahim S, Mleeh A, Behery M, Asmaa M (2022) Comparative Studies on the Antioxidant, Antifungal, and Wound Healing Activities of \u003cem\u003eSolenostemma arghel\u003c/em\u003e \u003cspan dir=\"RTL\"\u003e \u003c/span\u003eEthyl Acetate and Methanolic Extracts. Appl. Sci. 12(1):1-22. https://doi.org/10.3390/app12094121\u003c/li\u003e\n\u003cli\u003eAlqahtani S, Moni S, Sultan M, Bakkari M, Madkhali O, Alshahrani S, Makeen H, Menachery S, Rehman Z, Alam S, Mohan S, Elmobarak M, Banji D, Sayed-Ahmad M (2022) Potential bioactive secondary metabolites of \u003cem\u003eActinomycetes\u003c/em\u003e sp. isolated from rocky soil of the heritage village Rijal Alma, Saudi Arabia. Arabian J. Chem. 5(2) :1-15. https://doi.org/10.1016/j.arabjc.2022.103793\u003c/li\u003e\n\u003cli\u003eKawuri R, Darmayasa I (2019) Bioactive Compound from Extract Filtrat \u003cem\u003eStreptomyces\u003c/em\u003e sp. Sp1. as Biocontrol of Vibriosis on Larvae of \u003cem\u003eMacrobrachium rosenbergii\u003c/em\u003e shrimps. J. Biosci. 26(10):15-25. https://doi.org/10.4308/hjb.26.1.15\u003c/li\u003e\n\u003cli\u003eAnsari M, Alkubaisi N, Vijayaragavan P, Murugan P (2019) Antimicrobial Potential of \u003cem\u003eStreptomyces\u003c/em\u003e sp. To The Gram positive and Gram - negative Pathogens. J Infect Public Health. 12(1):861-866. https://doi.org/10.1016/j.jiph.2019.05.016\u003c/li\u003e\n\u003cli\u003eFahmy NM, Abdel-Tawab AM (2021) Isolation and characterization of marine sponge\u0026ndash;associated \u003cem\u003eStreptomyces \u003c/em\u003esp. NMF6 strain producing secondary metabolite(s) possessing antimicrobial, antioxidant, anticancer, and antiviral activities. J Genet Eng Biotechnol. 19(102):1-14. https://doi.org/10.1186/s43141-021-00203-5\u003c/li\u003e\n\u003cli\u003eDjebbah FZ, Belyagoubi L, Abdelouahid DE, Kherbouche F, Al-Dhabi NA, Arasu MV, Ravindran B (2021) Isolation and characterization of novel \u003cem\u003eStreptomyces\u003c/em\u003e strain from Algeria and its in-vitro antimicrobial properties against microbial pathogens. J Infect Public Health. 14(10):1671 -1678. https://doi.org/10.1016/j.jiph.2021.09.019\u003c/li\u003e\n\u003cli\u003eAlam M, Jha D (2019) Optimization of culture conditions for antimetabolite production by a rare tea garden actinobacterial isolate, \u003cem\u003eAmycolatopsis\u003c/em\u003e sp. ST-28. African Journal of Clinical and Experimental Microbiology. 20 (3): 209-220. https://doi.org/10.4314/ajcem.v20i3.6\u003c/li\u003e\n\u003cli\u003eVelez G, Pass H (2020) A Review of Exhaled Volatile Organic Compounds as Biomarkers for Thoracic Malignancies. Am. J. Biomed. Life Sci. 8(6):231-247. https://doi.org/10.11648/j.ajbls.20200806.17\u003c/li\u003e\n\u003cli\u003eKisil OV, Efimenko TA, Efremenkova OV (2021) Looking Back to \u003cem\u003eAmycolatopsis\u003c/em\u003e: History of the Antibiotic Discovery and Future Prospects. Antibiotics. 10(125):1-25. https://doi.org/10.3390%2Fantibiotics10101254\u003c/li\u003e\n\u003cli\u003eOsama N, Bakeer W, Raslan M, Soliman HA, Abdelmohsen UR, Sebak M (2022) Anti-cancer and antimicrobial potential of five soil \u003cem\u003eStreptomycetes\u003c/em\u003e: a metabolomics-based study.R Soc Open Sci. 9(2):1-17. https://doi.org/10.1098%2Frsos.211509\u003c/li\u003e\n\u003cli\u003eTan LT-H, Chan K-G, Pusparajah P, Yin W-F, Khan T-M, Lee L-H (2019) Mangrove derived \u003cem\u003eStreptomyces\u003c/em\u003e sp. MUM265 as a potential source of antioxidant and anticolon-cancer agents. BMC microbiology.19(1):1-16. https://doi.org/10.1186/s12866-019-1409-7\u003c/li\u003e\n\u003cli\u003eElgorban AM, Bahkali AH, Farraji AI, Abdei-Wahab M(2019) Natural Products of \u003cem\u003eAlternaria \u003c/em\u003esp ., an endophytic fungus isolated from Salvadora persica from Saudi Arabia. Saudi Journal of Biological Sciences. 26(1):1068-1077.\u003c/li\u003e\n\u003cli\u003eJha V, Jain T, Nikumb D, Gharat Y, Koli J, Jadhav N, Gaikwad J, Pratiksha D, Dhopeshwarkar D, Narvekar S, Bhargava A (2022) Streptomyces peucetius M1 and \u003cem\u003eStreptomyces lavendulae\u003c/em\u003e M3 Soil Isolates as a Promising Source for Antimicrobials Discovery. J. Pharm. Res. Int. 34(50B):7-19.https://doi.org/10.9734/jpri/2022/v34i50B36438\u003c/li\u003e\n\u003cli\u003eBansal H, Singla RK, Behzad S,Chopra H, Ajmer S, Shen GB (2021) Unleashing the Potential of Microbial Natural Products in Drug Discovery:Focusing on \u003cem\u003eStreptomyces\u003c/em\u003e as Antimicrobials Goldmine. Curr. Top. Med. Chem.35(1):1-23. https://doi.org/10.2174/1568026621666210916170110\u003c/li\u003e\n\u003cli\u003eKurnianto MA, Kusumaningrum HD, Lioe HN, Chasanah E (2021) Antibacterial and antioxidant potential of ethyl acetate extract from \u003cem\u003eStreptomyces \u003c/em\u003eAIA12 and AIA17 isolated from gut of Chanos chanos. Biodiversitas Journal of Biological Diversity. 22(8):3196-3206. http://dx.doi.org/10.13057/biodiv/d220813\u003c/li\u003e\n\u003cli\u003eOliveros KM, Rosana AR, Montecillo AD, Opulencia RB, Jacildo AJ, Zulaybar TO, Raymundo AK (2021) Genomic Insights into the Antimicrobial and Anticancer Potential of \u003cem\u003eStreptomyces\u003c/em\u003e sp. A1-08 Isolated from Volcanic Soils of Mount Mayon, Philippines. Philipp. J. Sci. 150 (6A):1351-1377. https://doi.org/10.56899/150.6A.01\u003c/li\u003e\n\u003cli\u003eSingh A, Singh P (2021) Production of bioactive compounds by \u003cem\u003eStreptomyces\u003c/em\u003e sp. and their antimicrobial potential against selected MDR uropathogens. J. Appl. Biol. Biotechnol. 9(6):71-79. http://dx.doi.org/10.7324/JABB.2021.9609\u003c/li\u003e\n\u003cli\u003eAdamek M, Alanjary M, Sales-Ortells H, Goodfellow M, Bull A, Winkler A, Wibberg D, Kalinowski J, Ziemert N (2018) Comparative genomics reveals phylogenetic distribution patterns of secondary metabolites in \u003cem\u003eAmycolatopsis \u003c/em\u003especies. BMC Genomics. 19(426):1-15. https://doi.org/10.1186/s12864-018-4809-4\u003c/li\u003e\n\u003cli\u003eSong Z, Xu T, Wang J, Hou Y, Liu C, Liu S, Wu S (2021) Secondary Metabolites of the Genus \u003cem\u003eAmycolatopsis\u003c/em\u003e: Structures, Bioactivities, and Biosynthesis. Molecules. 26(18):1-35.https://doi.org/10.3390/molecules26071884\u003c/li\u003e\n\u003cli\u003eTistechok SI,Tymchuk IV, korniychuk OP, Fedorenko VO, Luzhetskyy MA,Gromyko OM (2021) Genetic Identification and Antimicrobial Activity of \u003cem\u003eStreptomyces\u003c/em\u003e sp. Strain Je 1-6 Isolated from Rhizosphere Soil of Juniperus excelsa Bieb. Genetic Identification and Antimicrobial Activity.55(1):28-35. https://doi.org/10.3103/S0095452721010138\u003c/li\u003e\n\u003cli\u003eJulianti E, Abrian IA, Wibowo MS, Azhari M, Tsurayya N, Izzati F (2022) Secondary Metabolites from Marine-Derived Fungi and Actinobacteria as Potential Sources of Novel Colorectal Cancer Drugs. Marine Drugs. 20(1):67-79. https://doi.org/10.3390/md20010067\u003c/li\u003e\n\u003cli\u003eLukežič T, Fayad A, Bader C, Harmrolfs K, Bartuli J,Gro\u0026szlig; S, Lešnik U, Hennessen F, Herrmann J, Pikl S, Petković H, Müller R (2019) Engineering Atypical Tetracycline Formation in \u003cem\u003eAmycolatopsis sulphurea\u003c/em\u003e for the Production of Modified Chelocardin Antibiotics. ACS Chem. Biol. 10(5):1-11.https://doi.org/10.1021/acschembio.8b01125\u003c/li\u003e\n\u003cli\u003eFayyad R, Lefta S, Nuaman RS, Abboodi AK (2021) Exploration of the Impact of Moringa Oleifera leaves as anti-bacterial and tumor inhibitor and Phytochemical profiling by GC-Mass analysis. Pakistan Journal of Medical and Health Sciences. 15(1):343-347. \u003c/li\u003e\n\u003cli\u003eKumaran S , Bharathi S, Uttra V, Thirunavukkarasu R, Nainangu P, Krishnan V, Renuga P, Wilson A, Balaraman D (2020) Bioactive metabolites produced from \u003cem\u003eStreptomyces enissocaesilis\u003c/em\u003e SSASC10 against fish pathogens. Biocatalysis and Agricultural Biotechnology. 29(1):1-6. https://doi.org/10.1016/j.bcab.2020.101802\u003c/li\u003e\n\u003cli\u003eKebede B, Shibeshi W(2022) In vitro antibacterial and antifungal activities of extracts and fractions of leaves of Ricinus communis Linn against selected pathogens.Veterinary Medicine and Science. 8:1802\u0026ndash;1815. https://doi.org/10.1002/vms3.772\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTables 1-4 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Amycolatopsis, bioactive compounds, antimicrobial, GC-MS, LC-MS","lastPublishedDoi":"10.21203/rs.3.rs-4644566/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4644566/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis paper delves into the antimicrobial activity and identification of bioactive compounds of \u003cem\u003eAmycolatopsis roodepoortensis\u003c/em\u003e strain EA7. Biochemical and molecular methods were utilized for the identification of actinomycetes. One strain displaying superior antimicrobial activity was chosen for the identification of bioactive compounds. The antimicrobial activity was thoroughly investigated. The analysis of the \u003cem\u003e16S rRNA\u003c/em\u003e gene revealed that strain EA7 belonged to the \u003cem\u003eAmycolatopsis roodepoortensis\u003c/em\u003e specie with 99.63% confidence. The ethyl acetate extract exhibited the largest zone of inhibition against gram-positive pathogenic bacteria (25mm) using the disc diffusion method. In the MIC method, the ethyl acetate extract displayed the lowest MIC values ranging from 312.5 \u0026micro;g/mL (\u003cem\u003eS. aureus\u003c/em\u003e PTCC 1112) to 1250 \u0026micro;g/mL (\u003cem\u003eP. aeruginosa\u003c/em\u003e clinical and standard strain). However, the methanolic extract showed lower antimicrobial activity. In the GC-MS analysis, compounds were identified based on their percentage of area, retention time, molecular formula, molecular weight, and quality in the strain EA7 extract, with acetic acid, 2-methylpropyl ester (15.8%) being the major compound. In the LC-MS analysis, nine major compounds with anticancer and antimicrobial activity were identified. Among these, tetrangomycin, amycolactam, dihydroxybenzamide, and dipyrimycin A are compounds with potential anticancer activity, while tetracycline exhibits potential antimicrobial activity.\u003c/p\u003e","manuscriptTitle":"Isolation and identification of the rare actinomycete, Amycolatopsis roodepoortensis strain EA7 from the agricultural soils of northern Iran and identification of their biological products","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-19 15:54:17","doi":"10.21203/rs.3.rs-4644566/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6706aeff-5382-428f-8c6e-690c153294c2","owner":[],"postedDate":"July 19th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-07-14T16:38:25+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-19 15:54:17","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4644566","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4644566","identity":"rs-4644566","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.