Experimental Infectious Pancreatic Necrosis Virus infection via egg microinjection: effects on survival, behaviour, and early immune response in brook trout (Salvelinus fontinalis) and brook trout × rainbow trout hybrids (S. fontinalis × Oncorhynchus mykiss)

Experimental Infectious Pancreatic Necrosis Virus infection via egg microinjection: effects on survival, behaviour, and early immune response in brook trout (Salvelinus fontinalis) and brook trout × rainbow trout hybrids (S. fontinalis × Oncorhynchus mykiss) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Experimental Infectious Pancreatic Necrosis Virus infection via egg microinjection: effects on survival, behaviour, and early immune response in brook trout (Salvelinus fontinalis) and brook trout × rainbow trout hybrids (S. fontinalis × Oncorhynchus mykiss) Karolina Duk, Patrycja Schulz, Joanna Pajdak-Czaus, Małgorzata Chmielewska-Krzesińska This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6550822/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Viral infections remain a persistent challenge in salmonid aquaculture, with infectious pancreatic necrosis virus (IPNV) causing substantial economic losses worldwide. Interspecific crossbreeding has been explored as a strategy to increase disease resistance, but its effectiveness remains uncertain. In this study, brook trout ( Salvelinus fontinalis ) and brook trout × rainbow trout hybrids ( S. fontinalis × Oncorhynchus mykiss ) were experimentally infected with IPNV via a microinjection method to compare species-specific responses. Survival was assessed via Kaplan-Meier curves and Cox models. Behavioural changes, including locomotion, spatial preference, and social interactions, were analysed via automated tracking software. Gene expression of selected immune markers (IL-1β, IL-6, IL-8, TNFα, IFN2, IFNγ, and lysozyme type II) was quantified via RT-qPCR. Growth and morphological abnormalities were also examined to evaluate the physiological effects of infection. The survival of hybrid embryos decreased during incubation, suggesting increased vulnerability to developmental stressors. IPNV infection significantly increased post-hatching mortality, particularly in brook trout. Infection also altered behaviour in a species-specific manner: infected brook trout demonstrated erratic movement, avoidance behaviours, and reduced social interaction, whereas hybrids maintained more stable but reactive patterns. Gene expression profiling revealed that hybrids presented earlier immune activation, notably of IL-6 and IFN2, without improved survival. These findings indicate that interspecific hybridization does not confer consistent resistance to viral pathogens. The behavioural alterations observed during infection may serve as early indicators of disease, supporting their potential for real-time health monitoring in aquaculture. This study highlights important trade-offs between developmental acceleration and immune adaptation, with implications for hybrid viability and fish welfare management. Fish egg microinjections Trout hybrids Infectious Pancreatic Necrosis Virus (IPNV) Survival analysis Behavioural response Viral susceptibility Salmonid hybridization Survival analysis Aquaculture pathology Non-invasive diagnostics Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Infectious pancreatic necrosis (IPN) is a highly contagious viral disease affecting both freshwater and marine fish, particularly salmonids [ 1 ]. The causative agent, infectious pancreatic necrosis virus (IPNV), is a member of the Birnaviridae family and continues to cause significant economic losses in global aquaculture. Although IPN is no longer classified as a notifiable disease by the World Organisation for Animal Health, the virus remains a persistent threat, inducing high mortality in young fish and compromising the sustainability of farmed salmonid populations [ 2 , 3 ]. IPNV spreads via both horizontal and vertical transmission. Surviving fish frequently become asymptomatic carriers, excreting the virus through faeces and reproductive fluids [ 4 , 5 ]. Horizontal transmission occurs through contaminated water and fish secretions, whereas vertical transmission primarily affects newly hatched fry, with mortality rates reaching up to 100% in highly susceptible populations. Despite ongoing research, key aspects of vertical transmission and early-stage pathogenesis remain insufficiently understood. To mitigate disease-related losses, salmonid species have undergone extensive domestication and selective breeding to improve production traits such as growth and resistance to infectious agents. Despite these improvements, viral infections continue to challenge the sustainability of aquaculture systems. One promising strategy to further enhance disease resistance is interspecific hybridization. Previous studies have demonstrated that hybrids between Arctic char ( Salvelinus alpinus ) and brook trout ( S. fontinalis ) exhibit increased resistance to viral haemorrhagic septicaemia (VHS) and infectious hematopoietic necrosis (IHN) [ 6 ]. Hybridization is known to modulate the immune response in salmonids by influencing the expression of key immune-related genes. Studies involving Atlantic salmon ( Salmo salar ) hybrids between wild and farmed strains have shown that these hybrids often display intermediate or enhanced expression of antiviral genes, depending on the genetic background of the parental lines [ 7 ]. These gene expression patterns may translate into improved innate antiviral responses. However, the immunological consequences of hybridization are not universally beneficial. In some cases, hybridization has been associated with substantial disruptions in immune gene expression, potentially impairing immune function and overall fitness. This complexity is further highlighted by studies on the hybridization of Saimaa landlocked salmon ( Salmo salar m. sebago ) and Atlantic salmon, where susceptibility to one parasite was reduced while susceptibility to another increased [ 8 ]. These contrasting outcomes indicate that hybridization can have both protective and detrimental effects on host health. Consequently, the health implications of hybridization must be carefully evaluated, as the effects are not simply additive but may vary depending on the traits inherited, resulting in immune responses that are intermediate, tempered, or dysregulated relative to the parental species. In addition to molecular responses, viral infections have been linked to changes in locomotion, spatial preferences, and social interactions, often resulting from neurological impairment or metabolic disturbances [ 9 – 11 ]. However, the extent and behind these alterations are still largely unexamined. Traditional fish disease diagnostics often rely on post-mortem analyses, histopathology, or molecular methods to confirm infections, but these approaches can be time-consuming and are usually applied during the fully symptomatic phase of the disease, potentially missing early subclinical stages. An alternative and increasingly recognized method is behaviour-based monitoring, which allows for the early identification of physiological distress before the onset of overt clinical symptoms. Changes in movement patterns, spatial preferences, or social interactions have been linked to stress, pathogen exposure, and metabolic imbalances in aquaculture settings [ 12 , 13 ]. Monitoring fish behaviour provides a real-time, non-invasive approach to welfare assessment and has been proposed as an early warning system for health deterioration in farmed fish [ 14 , 15 ]. Recent advancements in artificial intelligence (AI) and machine learning (ML) have further enhanced the potential of behavioural monitoring by enabling automated tracking, trajectory analysis, and pattern recognition [ 16 ]. By integrating behaviour-based diagnostics with conventional methods, aquaculture facilities could improve disease surveillance and response times, ultimately reducing losses associated with delayed treatment. This study aimed to compare the susceptibility and disease progression of brook trout and their interspecific hybrids with rainbow trout following experimental microinjection infection with IPNV. We hypothesized that hybrid larvae might exhibit different survival patterns and immune responses than pure brook trout do, potentially indicating species-specific differences in viral resistance. Additionally, we investigated whether IPNV infection induces measurable behavioural alterations in early developmental stages and whether these changes could serve as early indicators of infection. To comprehensively assess the impact of IPNV infection, a multimethod approach was applied, incorporating survival analysis, biometric measurements, advanced behavioural analysis, gene expression profiling of key immune markers, and histological evaluation. 2. Materials and methods 2.1. Eggs and rearing conditions At Dąbie Hatchery (Poland), oocytes were stripped from female brook trout ( S. fontinalis ) and rainbow trout ( O. mykiss ) and fertilized with brook trout sperm. A triploidization procedure was performed to obtain all-female triploids of brook trout and interspecific S. fontinalis × O. mykiss hybrids. Following fertilization, the eggs were transported under temperature-controlled conditions to the Laboratory of Fish Diseases (Department of Epizootiology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, Poland). At the laboratory, they were microinjected and placed in epizootically separated horizontal flow-through hatching tanks. Each species was assigned to one of three experimental groups: (1) control (untreated eggs), (2) placebo (virus-free vehicle-injected), or (3) IPNV-injected. Each group was replicated twice, yielding a total of 12 experimental subgroups. A total of N = 3 456 eggs were incubated throughout the experiment, with N = 288 eggs per incubation tray, and reared through the alevin and fry stages. Eggs were incubated in freshwater under controlled conditions via a flow-through system. The temperature was maintained between 10–13°C, the pH was 7.0 and the dissolved oxygen concentration was 6.0 mg O₂ L⁻¹. The photoperiod was set according to Leitritz & Lewis [ 17 ]: 0:24 LD (complete darkness) until hatching, followed by an 8:16 LD cycle for hatched larvae. 2.2. Virus microinjections The Sp (Spjarup) reference strain of IPNV was obtained from The National Veterinary Research Institute (NVRI), Poland (GenBank accession number: AM889221). The virus was propagated, quantified, and titrated via the 50% tissue culture infective dose (TCID₅₀) assay, yielding a concentration of 1 × 10⁸ TCID₅₀ mL⁻¹. The placebo solution consisted of a virus-free RPMI medium (Sigma-Aldrich, USA), supplemented with phenol red dye for optical monitoring during microinjections [ 18 ]. Microinjections were conducted within 7.5 hours post-fertilization, using 0.2 µL of either placebo solution or viral inoculum. The injected volume did not exceed 0.6% of the total egg volume. Injections were performed via a 10 µL borosilicate glass syringe with a repeating semiautomatic dispenser and a custom steel needle with increased wall thickness (26sG, 0.47 mm outer diameter, 0.13 mm inner diameter, 19.0 mm length, 30° angle) (Hamilton Company, Reno, USA). To stabilize the eggs during the procedure, they were placed in a 96-well plate partially filled with agar gel. Injection accuracy was monitored under a binocular stereoscopic microscope (Delta Optical, Mińsk Mazowiecki, Poland). The plate was positioned on a thermoelectric Peltier cooling module, ensuring stable water temperature during microinjections [ 18 ]. 2.3. Sampling and mortality analysis Alevins were sampled at six time points: 1, 3, 7, 10, 14, and 21 days post-hatching (dph). At each time point, six live alevins were randomly selected from each hatching tray, resulting in a total of N = 432 sampled alevins throughout the study. All six alevins underwent biometric measurements and behavioural assessment. Following these procedures, they were humanely euthanized using tricaine mesylate (MS-222, Sigma-Aldrich, USA) at a concentration of 250 mg L⁻¹ and were evenly divided into two groups, with three individuals dedicated to histopathological analysis and three to gene expression analysis. Daily mortality was recorded by removing and counting dead fertilized eggs, alevins, and fry from the hatching tanks at the same time each day of the experiment. Mortality data were used to assess survival dynamics across the entire experiment, as well as separately for pre-hatching (incubation) and post-hatching phases. 2.4. Biometric analysis Alevins selected for biometric analysis were weighed using an analytical balance (RADWAG WPS 110/C/2, Radom, Poland) and their total length was measured. Additionally, the yolk sac area was quantified from lateral-view images using the DanioVision advanced analysis system (Noldus, Wageningen, Netherlands) with dedicated DanioScope software (Noldus, Wageningen, Netherlands). Measurements were taken with micrometres precision, allowing for a detailed assessment of growth dynamics and yolk sac resorption over time. 2.5. Behaviour analysis The fish were subjected to a light-induced stress test via the DanioVision advanced analysis system (Noldus, Wageningen, Netherlands) with DanioScope software. The test protocol included a 7-minute observation period with two 30-second light stimuli, and the experimental arena was divided into central and peripheral zones to assess spatial preferences. The behavioural analysis encompassed five key aspects: (1) Activity and mobility, including total distance moved, distance variability, mean velocity, cumulative duration of movement, cumulative duration of immobility, and body mobility percentage. (2) Movement dynamics, characterized by minimum and maximum acceleration, mean turn angle, mean angular velocity, mean meandering, and total meandering. (3) Spatial behaviour and zone preferences, including cumulative duration in the central and outer zones, frequency of zone entries, and transition frequency between zones. (4) Rotation and orientation, assessed by clockwise and counterclockwise rotation frequency, mean heading direction, and zone alternation frequency. (5) Social interactions, measured as cumulative contact duration and no-contact duration, indicating proximity maintenance or avoidance behaviours. Consequential to the very early ontogenetic stage of brook trout, data from days 1, 3, and 7 post-hatching were excluded from further analyses, as larvae exhibited minimal movement, making meaningful behavioural comparisons infeasible. 2.6. Gene expression Immediately after euthanasia, the fish were ventrally incised and preserved in toto in RNAlater™ Stabilization Solution (Thermo Fisher Scientific GmbH, Karlsruhe, Germany). After 48 hours of stabilization, the carcasses were homogenized via a TissueLyzer system (Qiagen, Venlo, Netherlands). Total RNA was extracted and purified using the GeneMATRIX Universal RNA Purification Kit (EURx, Gdańsk, Poland). The RNA integrity and concentration were assessed before reverse transcription, which was performed using PrimeScript RT Master Mix (Perfect Real Time) (Takara Bio Europe, Saint-Germain-en-Laye, France) on a Biometra thermal cycler (Analytik Jena, Göttingen, Germany). Quantitative PCR (qPCR) was conducted using SYBR™ Select Master Mix for CFX (Thermo Fisher Scientific, Waltham, USA) with specific primers (Genomed, Warsaw, Poland) (Table 1 ) on a QuantStudio™ 5 system (Applied Biosystems™, Thermo Fisher, Waltham, USA). The relative gene expression of selected immune markers (IL-1β, IL-6, IL-8, TNFα, IFNγ, IFN2, and LyzII) was calculated via the 2^–ΔΔCt method, with β-actin serving as the reference gene. Table 1 Sequences of primers used for PCR analysis. Gene Accession number Primer sequence 5’-3’ Reference β-Actin NM_001124235.1 FW: GGACTTTGAGCAGGAGATGG RW: ATGATGGAGTTGTAGGTGGTCT Wang et al. [ 77 ] IL-1β AJ223954 FW: ACCGAGTTCAAGGACAAGGA RW: CATTCATCAGGACCCAGCAC Galeotti et al. [ 78 ] IL-6 DQ866150 FW: ACTCCCCTCTGTCACACACC RW: GGCAGACAGGTCCTCCACTA Galeotti et al. [ 78 ] IL-8 AJ279069 FW: CACAGACAGAGAAGGAAGGAAAG RW: TGCTCATCTTGGGGTTACAGA Wang et al. [ 77 ] TNFα NM_001124374.1 AJ278085.1 FW: CAAGAGTTTGAACCTCATTCAG RW: GCTGCTGCCGCACATAAG Castro et al. [ 79 ]; Yarahmadi et al. [ 80 ] IFNγ AJ616215.1 FW: CTGAAAGTCCACTATAAGATCTCCA RW: CCCTGGACTGTGGTGTCAC Castro et al. [ 79 ] IFN2 AJ582754.2 FW: AGTTCCTGTGTATCACCTGTCG RW: GATGCTCAGTACATCTGTCCA Castro et al. [ 79 ] LyzII X59491.1 FW: ACAGCCGCTACTGGTGTGACG RW: GCTGCTGCCGCACATAGAC Yarahmadi et al. [ 80 ] 2.7. Histology Immediately after euthanasia, the fish were ventrally incised and fixed in toto in Davidson’s solution for 48 hours [ 19 ]. Before fixation, each sample was randomly assigned a five-digit identification code, ensuring that all subsequent histological processing and analysis were conducted blindly, without knowledge of the experimental group. After fixation, the samples were rinsed three times in 70% ethanol and processed for standard histopathological examination. The tissues were dehydrated in a graded series of ethanol using an automatic tissue processor (Leica TP102, Leica Biosystems, Nussloch, Germany). After processing, the samples were embedded in paraffin and sectioned in the sagittal plane. Sections (4.5 µm thick) were cut using a rotary microtome (Leica RM2255, Leica Biosystems, Nussloch, Germany) and mounted on glass slides. The slides were stained with hematoxylin and eosin (HE) via a programmable stainer (Leica ST5010 Autostainer XL, Leica Biosystems, Nussloch, Germany), following the protocol described by Bancroft & Layton [ 20 ]. 2.8. Statistical analysis All statistical analyses were conducted via Python (Statsmodels and SciPy libraries) and R Statistical Software (version 4.3.3) [ 21 ] within RStudio Integrated Development Environment (version 2023.12.1.402) [ 22 ]. The following R packages were used: dplyr [ 23 ] for data wrangling, survminer [ 24 ] for survival analysis, ggstatsplot [ 25 ] for statistical visualization, ComplexHeatmap [ 26 ] for hierarchical clustering and heatmap generation, and multcomp [ 27 ] for post hoc multiple comparisons. Before performing the statistical analyses, the data distribution was assessed using the Shapiro-Wilk test for normality, and Levene’s test was applied to verify the homogeneity of variance. If assumptions of normality or homogeneity were violated, the data were transformed via log₂ or square-root transformations. The significance level for all statistical tests was set at α = 0.05. Survival analysis was conducted via the Kaplan-Meier method, with survival curves generated separately for species and treatment groups. Differences between survival curves were evaluated via the log-rank test (Mantel-Cox test), which compares entire survival distributions. A Cox proportional hazards model was applied to quantify the relative risk of mortality between species and treatment groups, with the results reported as hazard ratios (HR) and 95% confidence intervals (CIs). The Cox model was applied in two configurations: a univariate model, where the group was treated as a single factor, and a multivariate model, where the species and treatment were analysed as separate factors to assess their independent effects. Differences in biometric parameters, including larval weight, body length, and yolk sac area, were analysed via two-way ANOVA, to assess the main effects of species and treatment, as well as their interaction (species × treatment). To further examine how these effects varied over time, separate two-way ANOVA tests were conducted for each post-hatching day (dph), allowing for a focused comparison at each developmental stage. Interaction terms were included in the model to examine how treatment effects varied over time and between species. Following significant results (p < 0.05), Tukey’s Honest Significant Difference (HSD) test was applied for post hoc pairwise comparisons. Additionally, linear regression models were fitted to explore time-dependent trends in biometric parameters within each experimental group. Gene expression data were analysed via the Kruskal-Wallis test as a nonparametric alternative to ANOVA when normality assumptions were not met. One-way ANOVA was performed separately within each treatment group to assess species-specific effects, whereas two-way ANOVA was applied where sample sizes permitted, with species, treatment, and time as fixed factors. Significant interactions were further explored via Tukey’s HSD test for pairwise comparisons. To assess dynamic changes in gene expression over time, linear regression models were applied separately for each gene, species, and treatment group, with age as a continuous predictor. The behavioural data were analysed via three-way ANOVA, with species, treatment, and post-hatching day as factors. Significant main effects and interactions were followed by Tukey’s HSD test for pairwise comparisons. Levene’s test was used to confirm the homogeneity of variance across experimental groups, and data transformations were applied when necessary to meet model assumptions. Histological evaluation was performed in a blinded manner to ensure objectivity, with sample identity concealed during processing and analysis. Observations were qualitatively compared between the experimental groups, with a focus on structural changes indicative of infection, inflammation, and tissue integrity. Semiquantitative scoring was applied where applicable. 3. Results 3.1. Survival analysis The survival analysis for the entire experiment is shown in Fig. 1 . Survival patterns varied across developmental stages, with distinct trends observed during egg incubation and the post-hatching period. Significant differences were detected between groups at each stage of development ( p < 0.05 ). Brook trout hatched at 38 days post-fertilization (dpf), corresponding to an average of 406 degree-days (DD), whereas hybrids hatched 11 days earlier, at 27 dpf, reaching an average of 294 DD. Species-specific survival differences were dominant during incubation, whereas post-hatching mortality was driven primarily by treatment effects. Viral infection had the strongest negative impact on survival in both species, although hybrids experienced greater overall mortality rates across all developmental stages (Table 2 ). Additionally, the increased mortality risk observed in the placebo-treated groups suggests that handling stress plays a role in survival outcomes, warranting further investigation into experimental protocols to minimize procedural effects. Table 2 Median of survival and relative mortality during different stages of the experiment. Time Treatment Species N Median of survival (days) 0.95 LCL 0.95 UCL Relative mortality (%) Whole experiment Control Brook trout 576 22.0 18 23 69.8 Hybrid 576 15.0 13 18 67.7 Placebo Brook trout 576 20.0 18 21 77.6 Hybrid 576 11.0 9 14 75.5 IPNV Brook trout 576 21.0 18 22 77.6 Hybrid 576 14.5 12 16 78.3 Incubation Control Brook trout 370 12.0 11 12 64.2 Hybrid 368 7.0 6 9 63.9 Placebo Brook trout 409 12.0 11 14 71.0 Hybrid 412 2.0 2 2 71.5 IPNV Brook trout 389 11.0 11 12 67.5 Hybrid 368 9.0 7 10 74.0 Post-hatching Control Brook trout 206 NA NA NA 15.5 Hybrid 208 NA NA NA 10.6 Placebo Brook trout 167 NA NA NA 22.8 Hybrid 164 NA NA NA 14.0 IPNV Brook trout 187 NA NA NA 31.0 Hybrid 150 NA NA NA 16.7 For each group, the initial number of individuals (N), median survival in days, and corresponding 95% confidence intervals (LCL – lower confidence level, UCL – upper confidence level) are presented. During the post-hatching period, the median survival could not be estimated (NA) due to the limited number of events. Relative mortality (%) was calculated separately for each period, based on the number of individuals alive at the beginning of that period. 3.1.1. Survival during egg incubation Survival during the incubation period was significantly influenced by both species and treatment ( χ² = 239, df = 5, p < 2 × 10⁻¹⁶ ). The survival rates of hybrid embryos were lower than those of brook trout, with median survival times of 7 days (control), 9 days (IPNV-infected), and only 2 days (placebo). In contrast, brook trout embryos presented more uniform survival patterns, with median survival times of 11–12 days across all treatment groups. Compared with brook trout, hybrid embryos had a nearly twofold increase in mortality risk ( HR = 1.95, 95% CI: 1.67–2.23, p < 2 × 10⁻¹⁶ ). Interestingly, IPNV infection slightly reduced mortality risk during this phase ( HR = 0.89, 95% CI: 0.79–0.99, p = 0.027 ), although the effect size was small. The highest mortality risk was observed in placebo-treated hybrids ( HR = 2.06, 95% CI: 1.75–2.43, p < 2 × 10⁻¹⁶ ), suggesting that procedural stress contributes to early survival outcomes. 3.1.2. Survival after hatching Following hatching, survival patterns shifted, with treatment effects becoming more pronounced and species effects diminishing. Post-hatching survival was significantly affected by treatment but not by species ( χ² = 20.9, df = 5, p = 8 × 10⁻⁴ ). Due to censoring, median survival times could not be determined for this phase. Compared with control, IPNV-infected brook trout had a 2.33-fold greater mortality risk ( HR = 2.33, 95% CI: 1.45–3.21, p = 1.2 × 10⁻⁴ ). Similarly, hybrid larvae infected with IPNV presented an elevated risk ( HR = 2.07, 95% CI: 1.23–2.85, p = 0.007 ). Additionally, placebo-treated brook trout had a 1.64-fold greater mortality risk than the control brook trout did ( HR = 1.64, 95% CI: 1.01–2.55, p = 0.039 ), whereas the placebo effect on hybrids was weaker ( HR = 1.71, 95% CI: 1.00–2.64, p = 0.055 ). The analysis confirmed that IPNV infection significantly increased mortality risk across both species ( HR = 2.18, 95% CI: 1.51–3.02, p = 9.26 × 10⁻⁶ ), whereas placebo-treated larvae also exhibited increased mortality ( HR = 1.61, 95% CI: 1.12–2.32, p = 0.0105 ). However, no significant species effect was detected ( p = 0.93 ), indicating that species-specific survival disparities diminished after hatching. 3.1.3. Overall survival Survival analysis revealed significant differences in overall survival between the species and treatment groups ( χ² = 62.1, df = 5, p = 4 × 10⁻¹² ). Brook trout consistently presented higher survival rates than hybrid larvae did, with median survival times of 22 days (control), 21 days (IPNV-infected), and 20 days (placebo). In contrast, hybrids had significantly lower median survival times: 15 days (control), 14.5 days (IPNV-infected), and 11 days (placebo). Compared with brook trout, hybrid trout presented a significantly greater mortality risk ( HR = 1.30, 95% CI: 1.19–1.42, p = 6.99 × 10⁻¹¹ ). Treatment effects were also significant, with IPNV infection increasing mortality risk by 23% ( HR = 1.24, 95% CI: 1.13–1.37, p = 1.49 × 10⁻⁵ ), and placebo treatment led to a similar increase ( HR = 1.25, 95% CI: 1.14–1.38, p = 3.86 × 10⁻⁶ ). The strongest mortality effects were observed in hybrids, where IPNV-infected and placebo-treated larvae presented the highest hazard ratios ( HR = 1.56, 95% CI: 1.39–1.77, p = 8.93 × 10⁻¹¹ and HR = 1.61, 95% CI: 1.42–1.84, p = 8.36 × 10⁻¹² , respectively). These findings suggest that hybrid larvae are inherently more susceptible to mortality than brook trout, with viral infection and experimental handling further exacerbating survival disparities. A multivariate Cox regression model incorporating species and treatment confirmed these trends. Hybrids exhibited significantly greater mortality risk ( HR = 1.295, 95% CI: 1.19–1.40, p = 6.99 × 10⁻¹¹ ), and both IPNV infection ( HR = 1.235, 95% CI: 1.12–1.36, p = 1.49 × 10⁻⁵ ) and placebo treatment ( HR = 1.254, 95% CI: 1.14–1.38, p = 3.86 × 10⁻⁶ ) contributed to increased mortality risk. 3.2. Biometric analysis The average body weight, body length, and yolk sac area for all groups are presented in Supplementary Fig. 1, with corresponding regression plots in Supplementary Fig. 2. 3.2.1. Body weight analysis The effects of species (brook trout vs. hybrid) and treatment (control, IPNV-infected, and placebo) on body weight across all time points were assessed. A highly significant species effect was detected ( F(1, 311) = 156.27, p < 2.49 × 10⁻²⁹ ), with hybrid larvae consistently exhibiting greater body weights than brook trout. However, no significant effect of treatment was found ( p = 0.369 ), and the species‒treatment interaction was also non-significant ( p = 0.752 ). To evaluate the temporal effects of species and treatment, separate analyses were conducted for each post-hatching day (dph). Species differences remained significant across all time points, with hybrids being significantly heavier than brook trout from early larval stages onward ( p < 0.05 ). The treatment effects were significant only at later stages ( p < 0.05 at 14 and 21 dph), with IPNV-infected larvae exhibiting slightly lower weights than those of the controls. A significant positive effect of age on weight was found ( β = 0.52, p < 0.001 ), confirming that body weight increased over time. Species was a significant predictor ( β = 1.04, p 0.05 ). Post hoc tests confirmed that hybrid larvae were significantly heavier than brook trout on every post-hatching day ( p 0.05 ), which aligns with the ANOVA results. 3.2.2. Body length analysis Body length analysis revealed a highly significant species effect ( F(1, 354) = 535.61, p < 7.97 × 10⁻⁷³ ), with hybrid larvae consistently exhibiting greater body length than brook trout. However, treatment had no significant effect on body length ( p = 0.761 ), and the interaction effect between species and treatment was also non-significant ( p = 0.609 ). When analysis was conducted separately for each post-hatching day, significant species effects persisted at every time point ( p < 0.05 ). However, the treatment effects remained non-significant across all days. The results revealed a significant positive effect of age on body length ( β = 0.88, p < 0.001 ), confirming that larval length increased with time. The species effect remained highly significant ( p < 0.001 ), with hybrid larvae consistently longer than brook trout at every stage. Treatment had no significant effect on body length ( p = 0.761 ), and no interaction effects were detected ( p = 0.609 ). Post hoc tests confirmed that hybrids were significantly longer than brook trout at all time points ( p 0.05 ). 3.2.3. Yolk sac area analysis Yolk sac area analysis revealed significant effects of both species and treatment ( p < 0.05 ). Brook trout presented significantly larger yolk sacs at early developmental stages and showed slower yolk sac resorption than hybrids did. The effect of treatment was also significant ( p 0.05 ), indicating that the treatment effects were consistent across species. Temporal analysis at each post-hatching day revealed that species differences were highly significant at 3, 7, and 10 dph ( p < 0.001 ), with brook trout retaining significantly larger yolk sacs. The treatment effects became significant at later stages (14 and 21 dph, p < 0.05 ), with IPNV-infected individuals exhibiting delayed yolk sac resorption. A significant negative effect of age on the yolk sac area ( β = -0.45, p < 0.001 ) was observed, confirming that yolk sacs resorbed progressively with time. Species had a significant effect ( p < 0.001 ), with brook trout displaying slower yolk sac resorption than hybrids. Additionally, treatment had a significant effect ( p < 0.05 ), indicating that IPNV infection slowed yolk sac resorption. Post hoc analysis confirmed that the yolk sac area was significantly larger in brook trout than in hybrids at all time points ( p < 0.001 ). Compared with those in the control and placebo groups, the yolk sacs in the IPNV-infected individuals were significantly larger at 14 and 21 dph ( p < 0.05 ), supporting the hypothesis that viral infection delays yolk sac resorption. A larger yolk sac area at early time points was significantly associated with increased mortality risk ( HR = 1.18, 95% CI: 1.04–1.34, p = 0.005 ). Brook trout presented a significantly greater hazard ratio than hybrids did ( HR = 1.30, 95% CI: 1.15–1.46, p < 0.001 ), suggesting that delayed yolk sac resorption contributed to increased mortality. The highest mortality risk was detected in the IPNV-infected groups, particularly in brook trout. 3.3. Gene expression The analysis confirmed species-specific differences in gene regulation. Significant differences in gene expression were also observed between the treatment groups, and time points (Fig. 2 ). The hierarchical clustering of the gene expression profiles is shown in Supplementary Fig. 3. 3.3.1. IL-1β expression No significant differences in IL-1β expression were detected between treatments, species, or their interaction throughout the study period. Linear regression analysis revealed no significant temporal trends in gene expression. 3.3.2. IL-6 expression IL-6 expression was significantly greater in hybrids than in brook trout across all treatment groups and time points ( F(1, 311) = 7.86, p = 0.0055 ). The largest differences were detected at 10 dph and 14 dph when IL-6 expression was significantly elevated in the hybrids ( p < 0.01 ). A time-dependent trend was observed in both species, with IL-6 expression peaking at 14 dph before slightly decreasing at 21 dph ( R² = 0.12, p = 0.003 ). 3.3.3. IL-8 expression No significant treatment, species, or interaction effects were found for IL-8 expression. Expression levels remained relatively stable across all experimental groups and sampling days. 3.3.4. TNFα expression A significant increase in TNFα expression was observed in brook trout infected with IPNV ( χ²(2) = 8.62, p = 0.013; F(2, 153) = 3.89, p = 0.022 ). No significant interaction between species and treatment was detected. Linear regression showed progressive upregulation over time in the infected brook trout ( R² = 0.10, p = 0.015 ). 3.3.5. IFNy expression IFNy expression was not detected at early time points for either species. However, at 21 dph, a significant increase in IFNy expression was observed only in the IPNV-infected hybrids ( χ²(2) = 9.14, p = 0.010 ). No IFNy expression was detected in the control or placebo groups, or brook trout samples at any stage. 3.3.6. IFN2 expression IFN2 expression in brook trout groups was detected exclusively in IPNV-infected fish at 7 dph ( χ²(2) = 10.31, p = 0.0057 ). In hybrids, low-level IFN2 expression was observed across all treatment groups at early time points, with no significant differences between control, placebo, and infected individuals. By 14 dph, compared with the control and placebo groups, the IPNV-infected hybrids presented significantly increased IFN2 expression (Tukey's HSD, p < 0.01 ). 3.3.7. Lysozyme type II expression Lysozyme type II expression was not detected from 1 dph to 14 dph in any group. At 21 dph, lysozyme type II expression was measurable across all species and treatment groups. However, no significant differences were detected between species or treatments. 3.4. Behaviour analysis Behavioural parameters were assessed at multiple post-hatching time points, with significant differences observed between species, treatment groups, and time points (Table 3 ). Table 3 Summary of three-way ANOVA significant results for behavioural parameters assessed in brook trout and hybrid larvae across different treatments and post-hatching days. Behaviour category Parameter Effect F df p-value Significance Activity and mobility Total distance moved Species 38.29 1 3.43×10⁻⁹ *** Day 95.18 2 1.09×10⁻²⁹ *** Species × Day 11.27 2 2.31×10⁻⁵ *** Treatment × Day 5.06 4 6.70×10⁻⁴ *** Species × Treatment × Day 11.06 4 4.08×10⁻⁸ *** Mean velocity Species 40.87 1 1.14×10⁻⁹ *** Day 100.21 2 8.63×10⁻³¹ *** Species × Day 11.96 2 1.25×10⁻⁵ *** Treatment × Day 6.17 4 1.06×10⁻⁴ *** Species × Treatment × Day 12.57 4 3.93×10⁻⁹ *** Movement duration Species 27.43 1 4.14×10⁻⁷ *** Day 63.46 2 5.05×10⁻²² *** Species × Day 9.04 2 1.75×10⁻⁴ *** Treatment × Day 7.98 4 5.50×10⁻⁶ *** Species × Treatment × Day 10.80 4 6.08×10⁻⁸ *** Immobility duration Species 13.77 1 2.68×10⁻⁴ *** Day 34.20 2 1.74×10⁻¹³ *** Species × Day 6.13 2 2.62×10⁻³ ** Treatment × Day 8.12 4 4.41×10⁻⁶ *** Species × Treatment × Day 10.38 4 1.19×10⁻⁷ *** Movement dynamics Minimum acceleration Day 23.01 2 1.04×10⁻⁹ *** Species × Day 4.79 2 9.29×10⁻³ ** Treatment × Day 2.90 4 0.023 * Maximum acceleration Day 10.78 2 3.61×10⁻⁵ *** Species × Treatment 3.44 2 0.0338 * Turn angle Day 8.18 2 3.86×10⁻⁴ *** Species × Day 3.82 2 0.0235 * Treatment × Day 2.43 4 0.0488 * Angular velocity Day 8.18 2 3.86×10⁻⁴ *** Species × Day 3.82 2 0.0235 * Treatment × Day 2.43 4 0.0488 * Meandering (mean) Treatment × Day 2.54 4 0.0412 * Meandering (total) Day 3.78 2 0.0246 * Species × Day 3.48 2 0.0327 * Spatial behaviour Center zone occupancy (duration) Day 24.14 2 4.16×10⁻¹⁰ *** Species × Treatment × Day 4.60 4 0.00143 ** Outer zone occupancy (duration) Day 28.96 2 9.25×10⁻¹² *** Species × Treatment × Day 5.02 4 0.00071 *** Center zone transitions Species 4.09 1 0.0445 * Day 4.67 2 0.0104 * Rotation and orientation Clockwise rotations Species 10.16 1 0.00166 ** Day 67.22 2 5.25×10⁻²³ *** Species × Day 14.49 2 1.34×10⁻⁶ *** Counterclockwise rotations Species 5.85 1 0.0165 * Day 7.53 2 0.000704 *** Species × Day 3.15 2 0.0450 * Heading (Intercept) 4.10 1 0.0444 * Zone alternations Alternation frequency Species 4.85 1 0.0288 * Day 4.70 2 0.0101 * Species × Day 3.46 2 0.0335 * Social interactions Contact duration Day 14.12 2 1.85×10⁻⁶ *** Species × Day 6.26 2 0.00231 ** No-contact duration Day 14.09 2 1.91×10⁻⁶ *** Species × Treatment 3.09 2 0.0475 * Species × Day 5.53 2 0.00460 ** The main effects of species, treatment, time , and their interactions (species × day, species × treatment, treatment × day, species × treatment × day) were evaluated individually for each behavioural trait. The F-statistic, degrees of freedom (df), p-values, and significance levels are provided. Significance levels are indicated as follows: p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***). Behavioural categories include activity and mobility (total distance moved, velocity, movement duration, mobility percentage), movement dynamics (acceleration, turn angle, angular velocity, meandering), spatial behaviour (time spent in centre, zone transitions), rotation and orientation (rotation frequencies and heading variability), and social interactions (cumulative contact and no-contact times). Significant findings were followed by post hoc analyses where appropriate. Only statistically significant effects are reported for clarity. These results highlight species-specific and treatment-specific alterations in behaviour dynamics in response to IPNV exposure. 3.4.1. Activity and mobility Brook trout in the control group moved significantly greater distances at 10 dph than at 21 dph (time main effect: F(2, 210) = 95.18, p < 0.001 ; species × time interaction: F(2, 210) = 11.27, p < 0.001 ). A similar decline in movement with time was observed in IPNV-infected and placebo-treated brook trout. In hybrids, the total distance moved was shorter than that in brook trout across most time points (species main effect: F(1, 210) = 38.29, p < 0.001 ), particularly in the control and placebo groups. The mean velocity followed the same trend, with higher values in brook trout compared to hybrids (species main effect: F(1, 210) = 40.87, p < 0.001 ), especially in the IPNV-infected and placebo groups (species × treatment interaction: F(4, 210) = 12.57, p < 0.001 ). The cumulative movement duration was longer in the IPNV-infected fish than in the placebo group at multiple time points (treatment × time interaction: F(4, 210) = 7.98, p < 0.001 ), whereas the immobility duration was generally greater in the placebo-treated hybrids (species × treatment interaction: F(4, 210) = 10.38, p < 0.001 ). The percentage of body mobility varied over time (time main effect: F(2, 210) = 43.40, p < 0.001 ), with brook trout in the control group exhibiting greater mobility at 10 dph than at 21 dph. Descriptive statistics of the activity and mobility parameters are presented in Fig. 3 . 3.4.2. Movement dynamics Minimum (treatment × time interaction: F(4, 210) = 2.90, p = 0.023 ) and maximum acceleration (time main effect: F(2, 210) = 10.78, p < 0.001 ) were greater in the IPNV-infected hybrids than in the control and placebo groups at later time points. The turn angle and angular velocity were also significantly greater in the IPNV-infected brook trout than in the control group at 21 dph (species × time interaction: F(2, 210) = 3.82, p < 0.05 for both parameters), indicating alterations in movement patterns under viral exposure. Meandering, both in mean and total trajectory deviations was more pronounced in IPNV-infected hybrids at later time points (treatment × time interaction: F(4, 210) = 2.54, p = 0.041 for mean; species × time interaction: F(2, 210) = 3.48, p = 0.033 for total), whereas control brook trout displayed more linear movement patterns across all time points (species effect: F(1, 210) = 11.34, p = 0.001 ). Descriptive statistics of the movement dynamics parameters are presented in Fig. 4 . 3.4.3. Spatial behaviour and zone preferences Brook trout in the control group spent more time in the centre zone at 10 dph than at 21 dph (time effect: F(2, 210) = 24.14, p < 0.001 ). IPNV-infected individuals presented lower centre occupancy at later time points (species × treatment × time interaction: F(4, 210) = 4.60, p = 0.001 ). Compared with the control hybrids, the placebo group at 14 dph spent less time in the centre zone (treatment main effect: F(2, 210) = 5.79, p = 0.004 ). The frequency of transitions between the centre and outer zones was greater in brook trout than in hybrids (species main effect: F(1, 210) = 10.65, p = 0.001 ), with the largest differences in the placebo and control groups. IPNV-infected fish had fewer transitions into the centre zone, particularly at later time points (treatment × time interaction: F(2, 210) = 6.11, p = 0.003 ), indicating a potential avoidance response. Descriptive statistics of spatial behaviour and zone preference parameters are presented in Fig. 5 , whereas the arena heatmap is presented in Fig. 6 . 3.4.4. Rotation and orientation Clockwise and counterclockwise rotation frequencies were more frequent in the IPNV-infected brook trout than in the control at later time points (species × time interaction: F(2, 210) = 14.49, p < 0.001 for CW; F(2, 210) = 3.15, p = 0.045 for CCW). The mean heading direction was more variable in infected hybrids at 21 dph (species × treatment × time interaction: F(2, 210) = 7.02, p = 0.001 ), indicating greater deviation than in the control and placebo groups. The zone alternation frequency was lower in the IPNV-infected hybrids than in the control hybrids, particularly at 21 dph (species × treatment interaction: F(2, 210) = 5.88, p = 0.004 ), suggesting reduced exploratory behaviour. 3.4.5. Social interactions The cumulative contact time was lower in the placebo-treated hybrids than in the controls (treatment main effect: F(2, 210) = 8.01, p < 0.001 ), whereas the time spent without contact was greater in the IPNV-infected fish (treatment main effect: F(2, 210) = 9.72, p < 0.001 ). Brook trout in the control group exhibited more social contact than hybrids did, especially in the later stages of the study (species main effect: F(1, 210) = 6.56, p = 0.011 ). Descriptive statistics of the rotation, orientation and social interaction parameters are presented in Fig. 7 . 3.5. Histology Histological evaluation was conducted to assess tissue changes in response to IPNV infection. No pathological abnormalities were observed in the control groups at any time point. At 1 dph and 3 dph, no significant differences in melanomacrophage or melanocyte-like cell counts were observed between the groups. At 14 dph, an increased number of melanomacrophages and melanocyte-like cells was detected in the IPNV-infected groups across both species ( p < 0.05 ). No other significant histopathological differences were found. 4. Discussion 4.1. Survival analysis and species-specific differences in mortality The survival analysis revealed clear species-specific differences in mortality patterns across developmental stages. During egg incubation, hybrid embryos presented significantly lower survival rates than brook trout did, with the shortest median survival observed in placebo-treated hybrids. This suggests increased vulnerability of hybrids during early development, potentially due to fertilization and hybridization procedures. Additionally, the effect of microinjection cannot be ruled out, as the lowest survival was observed in placebo-treated hybrids. The higher mortality in the placebo groups may be related to handling stress or vehicle effects rather than viral infection itself. After hatching, the mortality patterns changed significantly, with IPNV infection emerging as the dominant factor affecting survival. While species-specific differences in survival were less pronounced in the post-hatching stage, IPNV-infected brook trout presented the highest mortality risk, which is consistent with their well-documented susceptibility to IPNV. However, hybrids also showed increased mortality when infected, particularly at later time points, suggesting that while their developmental trajectory differs from that of brook trout, they do not exhibit increased resistance to IPNV. The multivariate Cox model further confirmed that infection, rather than species identity, was the primary driver of mortality after hatching. Over the entire experimental period, brook trout exhibited greater overall survival than hybrids did, particularly in the control and placebo groups. The strong negative impact of IPNV and placebo treatment on hybrid survival suggests that hybrids may be more vulnerable to environmental stressors and immune challenges, despite their faster development. The observed delayed impact of infection in hybrids compared with brook trout suggests a shift in the timing of immune activation. This pattern indicates that the immune response in hybrids may be more closely aligned with the developmental schedule inherited from rainbow trout but still follows the same underlying immune pathways as those in brook trout. Our hatching time results align with those reported in the literature. Brook trout hatched at 406 DD, which falls within the 235–444 DD range described for this species, whereas hybrid trout hatched at 294 DD, slightly earlier than the 337 DD previously reported [ 28 ]. This developmental timing suggests that hybrids follow a more accelerated trajectory, resembling their maternal species, rainbow trout (310 DD) [ 28 , 29 ]. The negative effect of hybridization on survival during incubation observed in our study contrasts with findings from research on other viral infections, such as viral haemorrhagic septicaemia virus (VHS) and infectious hematopoietic necrosis virus (IHN). In those cases, hybrid fish exhibited increased survival compared with their parental species [ 6 , 30 – 33 ]. However, our Cox proportional hazards model, which was conducted separately for the incubation and post-hatching periods, confirmed that hybridization had a significant negative effect on survival during incubation but no significant effect after hatching. This trend has been observed in other hybrid fish species, such as tiger trout ( S. fontinalis × Salmo trutta ), where early-stage survival was lower compared to parental species [ 34 , 35 ]. However, the hybrids in our study presented faster growth rates and yolk sac resorption, further confirming their closer resemblance to their maternal species [ 28 , 36 ]. In contrast to hybridization, the microinjection procedure itself did not affect survival during incubation but significantly reduced survival during the post-hatching period. This finding differs from those of Metcalfe and Sonstegard [ 37 ], who reported a negative impact of microinjections on both incubation and post-hatching survival. The improved survival of microinjected eggs in our study likely resulted from modifications in the injection method, as described by Duk et al. [ 18 ], which minimized handling stress and mechanical damage. Interestingly, the higher survival rates of the IPNV-infected groups during egg incubation suggest that the virus remained in a latent state during early development. Bootland et al. [ 4 ] reported that vertical transmission of IPNV can be highly unpredictable in laboratory settings, with infected progeny sometimes displaying low mortality rates during incubation. Our study is the first attempt to replicate the vertical transmission of IPNV in a standardized manner, ensuring that each egg received the same viral dose. This controlled approach eliminates variability in natural transmission, making our results more predictable and reproducible than those of previous studies on vertical transmission under hatchery conditions. This methodological advancement provides a more accurate assessment of infection dynamics and early immune responses, allowing for better comparisons between species and treatment groups. By administering precise doses of the virus directly into each fertilized egg, we could isolate the effects of viral exposure from other environmental or parental transmission factors, which are often confounding variables in natural outbreaks. Our results demonstrate that IPNV exposure at the embryonic stage does not immediately trigger high mortality, suggesting that the virus may persist in a latent state until host immune defences mature or external stressors trigger activation. This delayed onset of disease symptoms has also been reported in other fish species infected with IPNV, where early-stage infection often results in asymptomatic carriers rather than acute mortality [ 4 , 38 ]. These findings confirm that the incubation period was the most critical for overall survival, particularly from fertilization to the eyed stage when the highest mortality occurred. While IPNV infection was the primary driver of mortality after hatching, hybridization significantly affected early-stage survival, reinforcing the idea that hybridization itself may come at a cost to early survival in hybrids. The greater vulnerability of hybrids during incubation, coupled with their faster yolk sac resorption and accelerated development, suggests that hybridization itself may underlie species-specific survival differences. 4.2. Biometric differences and developmental trajectories The biometric analysis revealed significant differences in growth rate and yolk sac resorption between brook trout and hybrids. Compared with brook trout, hybrids grew faster, gained more weight and increased in length at a greater rate. This pattern aligns with their accelerated ontogenetic development, resembling the growth trajectory of rainbow trout, the maternal donor species. At early developmental stages (10 and 14 dph), hybrids displayed larger yolk sacs compared to brook trout, reflecting their initial metabolic strategy. However, by 21 dph, hybrids had completely depleted their yolk reserves, whereas brook trout, particularly those in the placebo and IPNV-infected groups, still retained visible yolk sacs. The delayed yolk sac absorption in IPNV-infected brook trout indicates that viral infection interferes with normal metabolic processes. Compared with controls, infected brook trout had significantly larger yolk sac areas at 14 and 21 dph, whereas hybrids presented no significant differences in yolk sac size between the infected and uninfected groups at later stages. This species-specific response suggests that infection disrupts metabolic resource utilization in brook trout, whereas hybrids, consequently due to their faster metabolic rate and earlier transition to exogenous feeding, may avoid prolonged metabolic interference. Neither microinjection nor IPNV infection significantly affected overall larval growth, as no differences in mean weight or length were observed between the experimental groups, corroborating previous findings by Bootland et al. [ 4 ]. However, morphological abnormalities, including spinal cord torsion, delayed yolk sac resorption, prognathism, and bicephaly were observed in the placebo and IPNV-infected groups. These developmental malformations are commonly associated with environmental stressors, viral infections, or reduced egg quality [ 39 , 40 ], and in our experimental setting, they may be related to the microinjection procedure. The absence of significant differences in overall biometric parameters suggests that infection primarily impacts energy metabolism and early development rather than directly altering somatic growth. Histopathological analysis confirmed that there were no major structural abnormalities in tissues across the experimental groups. At 1 dph and 3 dph, a similar number of melanomacrophages and melanocyte-like cells was observed in the yolk sac region in all the groups, suggesting that there were no early infection-driven histological alterations. However, from 14 dph onwards, there was a notable increase in melanomacrophages and melanocyte-like cells in IPNV-infected groups, irrespective of species. This increase may indicate a localized immune response or pigment deposition as a reaction to viral infection, a phenomenon observed in other viral infections in fish [ 41 – 43 ]. No further histopathological differences were detected, implying that the primary effects of IPNV infection were metabolic rather than structural during early development. The results of the biometric and histopathological analyses collectively indicate that hybrids exhibit a distinct metabolic and developmental trajectory compared with brook trout, characterized by faster yolk sac resorption, higher growth rates, and earlier transitions to exogenous feeding. While brook trout displayed prolonged reliance on yolk sac reserves, this strategy may provide a buffer against environmental stressors but also increase vulnerability to metabolic disruptions, such as those induced by IPNV infection. The presence of developmental malformations in the placebo and IPNV-infected groups suggests that both viral exposure and microinjection may contribute to embryonic stress, potentially impacting early survival. The histopathological response in the IPNV-infected groups, marked by increased melanomacrophages activity, suggests that the timing of immune activation differs between species, which may have implications for how each species responds to viral infections at later developmental stages. 4.3. Gene expression and immune response timing The gene expression analysis revealed species-specific differences in immune activation timing, with hybrids exhibiting a generally faster and more sustained immune response than brook trout do. These differences appear to be driven by differences in developmental pace, as both species followed similar immune activation trends but at different time points. IL-6 expression was consistently greater in hybrids across all treatment groups and time points, suggesting earlier immune system maturation. This pattern aligns with the faster ontogenetic development of hybrids, reflecting a metabolic and immunological profile closer to that of their maternal donor species, rainbow trout. As IL-6 plays a key role in inflammatory regulation and immune system activation, its early and sustained upregulation in hybrids suggests greater baseline immune readiness than in brook trout. IFN2 expression patterns further supported this hypothesis, as brook trout presented no detectable IFN2 expression before 7 dph, whereas hybrids presented low but continuous levels across all groups from the earliest time points. These findings suggest that hybrids may have an inherently more active antiviral defence system, enabling a quicker response to viral exposure. Despite this earlier immune activation, hybrids did not exhibit improved survival under IPNV infection, suggesting that earlier IFN2 presence alone does not necessarily translate into increased resistance. IFNy expression was exclusive to IPNV-infected hybrids at 21 dph and was not detected in brook trout at any time point. This pattern suggests that the hybrid immune response may occur earlier, potentially reflecting differences in viral recognition or immune system maturity. The absence of IFNy in brook trout indicates a longer time to activate this mid-phase antiviral response. The late-stage expression of lysozyme type II at 21 dph in both species, regardless of treatment, suggests that this antimicrobial defence mechanism is linked to the developmental stage rather than infection status. This pattern indicates that a secondary immune response emerges as alevins transition to exogenous feeding, which may be essential for protection against bacterial infections in later developmental stages. The high variation in immune-related gene expression across different time points observed in this study is consistent with previous research, which has shown that inoculation route, target tissue, developmental stage, and clinical form of infection significantly affect immune response variability [ 3 , 5 , 44 – 47 ]. Additionally, fish exhibit substantial individual immune variation, further influencing gene expression patterns. Innate immunity is considered the first line of defence against viral infections in fish, with the interferon (IFN) system playing a central role in antiviral responses [ 48 ]. IPNV is known to interfere with IFN signalling, potentially suppressing early immune responses and facilitating viral persistence in infected fish [ 49 , 50 ]. The delayed IFN2 response in brook trout compared with that in hybrids aligns with previous findings demonstrating viral immune evasion mechanisms. Our results indicate that hybrids exhibit greater variability in immune responses than brook trout do, which is likely due to their faster immune system maturation. The consistently increased IL-6 expression in the hybrids supports this hypothesis, as IL-6 plays a key role in immune activation and inflammatory signalling. The earlier and broader presence of IFN2 in hybrids, compared with its delayed detection at 7 dph in brook trout, further suggests a more rapid immune activation process. However, the absence of clear survival benefits in hybrids suggests that the timing of immune activation alone is insufficient to increase resistance to IPNV. IL-8 is critical for neutrophil recruitment, whereas TNFα is essential for initiating inflammatory defence mechanisms. The observed increase of TNFα expression in IPNV-infected brook trout suggests that viral infection may initially trigger proinflammatory responses, which could subsequently be dysregulated or suppressed at later stages, potentially compromising effective pathogen clearance. This suppression could contribute to reduced survival and increased disease susceptibility, as effective early inflammation is crucial for pathogen clearance. Our findings suggest that hybrids may be better equipped to mount an earlier immune response because of their faster immune system development, which could have implications for disease resistance and aquaculture management strategies. The progressive increase in IFN2 and IFNy expression over time, similar to findings in other studies [ 3 , 5 , 44 – 47 ], confirms that immune activation is closely linked to developmental progression. Given the significantly higher expression levels of these genes in hybrids, we conclude that the observed immune differences are largely due to their more advanced developmental stage. Future studies should investigate whether adjusting vaccination or infection timing in hybrid aquaculture could leverage their earlier immune maturation to enhance disease resistance. Our findings, showing species-specific differences in survival and the immune response to IPNV, complement previous genetic studies in salmonids. Rodríguez et al. [ 51 ] identified several candidate genes associated with IPNV resistance in rainbow trout, including those involved in immune regulation, such as IRF4, IL-8, and integrin beta-1. The differential expression of IL-6 and IFN2 observed in hybrid fish compared with brook trout suggests that early activation of certain immune pathways may not translate into increased survival—a notion consistent with the complex genetic architecture of resistance highlighted by Rodríguez et al. Furthermore, the variability in survival and response observed in our hybrids underscores the findings of Moen et al. [ 52 ], who reported a strong QTL in Atlantic salmon but noted its absence or reduced effect in rainbow trout. This finding reinforces the idea that resistance to IPNV is influenced by multiple loci and may be highly species-specific, thus complicating the use of interspecific hybridization as a universal strategy for enhancing resistance. Together, these results underscore the necessity for species- and context-specific approaches when considering genetic tools for disease resistance in aquaculture. 4.4. Behavioural alterations The behavioural analysis revealed significant differences in movement patterns, spatial preferences, and social interactions between brook trout and hybrids. These differences were further influenced by IPNV infection, suggesting a complex interplay between species-specific developmental trajectories, stress responses, and pathogen-induced behavioural alterations. 4.4.1. Activity and mobility Brook trout exhibited greater overall movement, covering longer distances with higher mean velocities than hybrids did, which may be the result of less domestication than hybrids, which aligns with the findings of Bellinger et al. [ 53 ]. Moreover, early-stage larvae rely on increased spontaneous movements to stimulate neuromuscular development and distribute energy reserves. In contrast, hybrids exhibited significantly reduced movement across most time points, particularly in the control and placebo groups. This may reflect an adaptive strategy linked to faster yolk sac resorption and earlier transition to exogenous feeding, reducing unnecessary energy expenditure during the yolk-dependent phase. IPNV infection significantly altered locomotor behaviour, particularly in brook trout. Infected individuals exhibited increased turn angles, angular velocity, and meandering, particularly at later time points. These disruptions in coordinated movement may indicate neurological impairment or metabolic stress induced by viral infection. The observed increase in angular velocity and erratic movement patterns in infected brook trout is consistent with studies showing that viral infection stressors can disrupt motor function in fish, leading to altered swimming trajectories and reduced control over movement [ 54 ]. In contrast, infected hybrids presented greater acceleration, which may suggest a more reactive stress response, possibly linked to differences in immune activation timing or metabolic adjustments associated with viral exposure. The observed species-specific differences in locomotor activity suggest that hybrids may be more energy-conserving, whereas brook trout rely on greater movement as part of their developmental strategy. These findings are in line with studies demonstrating that species with distinct metabolic and growth rates exhibit different locomotor responses to environmental and physiological stressors [ 10 , 55 ]. 4.4.2. Spatial behaviour and zone preferences Significant differences in spatial preferences were observed, with control and placebo-treated brook trout spending more time in the centre zone at earlier time points, whereas hybrids exhibited stronger peripheral zone preference. This difference in spatial occupation suggests a species-specific variation in thigmotaxis, which refers to an organism’s tendency to stay close to the periphery of an environment rather than exploring open areas. Infected brook trout exhibited a significant decrease in centre zone occupancy over time, indicating a shift toward increased avoidance behaviour, a pattern commonly associated with heightened anxiety or stress sensitivity in fish [ 56 – 58 ]. Thigmotaxis is a well-documented behavioural marker of anxiety and stress responses in fish [ 56 , 58 , 59 ]. The increased periphery occupancy in infected brook trout is in line with studies showing that viral infections can induce stress-related avoidance behaviour, which may have implications for their survival in natural or farmed environments. Reduced exploratory behaviour in infected individuals can decrease foraging efficiency and limit their ability to locate suitable habitats, ultimately impacting fitness and growth [ 60 , 61 ]. In contrast, hybrids, which already exhibited a stronger periphery preference, presented fewer changes in spatial behaviour after infection, suggesting that their response to environmental stressors is inherently different. The results suggest that brook trout, which are more exploratory under normal conditions, exhibit a stronger behavioural shift under viral stress, whereas hybrids, which already show reduced centre occupancy, may have a more stable behavioural strategy that is less influenced by infection. These findings align with previous research demonstrating that stressors, including infection, alter fish exploratory behaviour, often leading to increased risk aversion and decreased movement into open spaces [ 62 ]. 4.4.3. Rotation and orientation IPNV-infected brook trout presented significantly increased clockwise and counterclockwise rotation frequencies at later time points. This finding suggests potential neurological impairments, as erratic rotational behaviour has been observed in fish experiencing viral-induced neuromuscular dysfunction. The observed rotational disruptions are consistent with findings in virus-infected fish exhibiting impaired vestibular and motor control [ 63 – 65 ]. Interestingly, this effect was not observed in hybrids, indicating potential species-specific resilience to IPNV-induced neurological dysfunctions. The impact of viral infections on neuromuscular coordination has been studied in various fish species, with reports of increased turning frequency and erratic swimming in pathogen-exposed individuals [ 63 – 65 ]. These behaviours are often linked to impairments in motor coordination and sensory processing, possibly due to viral interference with central nervous system function. The lack of rotational changes in hybrids suggests either a reduced neurological impact of the virus or compensatory mechanisms that mitigate its effects. 4.4.4. Social interactions and group cohesion The analysis of social interactions revealed significant differences in contact duration and avoidance behaviour between the species and treatment groups. Compared with brook trout, Infected and placebo hybrids presented significantly shorter cumulative contact times and increased time spent without contact. This suggests that hybrids may be inherently less social or that their stress response includes an avoidance strategy, potentially linked to their developmental differences. Brook trout in the control groups presented significantly greater levels of social engagement, maintaining closer contact with conspecifics. However, infection led to a decrease in social interactions, a response commonly associated with stress-induced changes in behaviour. Similar trends have been observed in studies investigating the effects of environmental stressors on fish sociality, where increased stress levels correlate with reduced social cohesion and heightened avoidance behaviours [ 61 , 66 ]. The observed decrease in social interactions in infected groups has potential ecological implications, particularly in aquaculture settings where group cohesion can influence foraging efficiency, predator avoidance, and overall fitness. Studies suggest that maintaining stable social groups can buffer against stress and improve overall welfare in farmed fish [ 67 – 74 ]. The differences in social engagement between species further highlight their contrasting behavioural strategies, with brook trout exhibiting stronger social tendencies that are disrupted under infection stress, while hybrids appear to be more socially reserved overall. 4.4.5. Behavioural implications The observed behavioural changes induced by IPNV infection may have significant ecological and aquaculture-related implications. The decrease in locomotor stability, increased avoidance behaviour, and reduced social interactions in infected brook trout suggest heightened vulnerability to environmental challenges, potentially reducing survival rates in natural and farmed settings. The greater behavioural stability observed in hybrids, despite their overall reduced movement, suggests potential advantages in terms of energy conservation and resistance to pathogen-induced stress. These findings align with research demonstrating that stress-induced behavioural changes in fish can affect their foraging success, competitive interactions, and predation risk [ 75 , 76 ]. Reduced movement and increased risk aversion may hinder infected fish from efficiently utilizing available resources, whereas disrupted social cohesion could impact their ability to maintain group-based anti-predator strategies. 5. Conclusions This study provides a comprehensive analysis of experimental IPNV infection in the earliest developmental stages of brook trout and brook trout × rainbow trout hybrids, allowing for a direct comparison of their survival, growth, immune response, and behavioural adaptations. We confirmed that modifications in the microinjection method improved egg survival during incubation, demonstrating its potential as a standardized approach for controlled viral exposure in experimental settings. However, the procedure also had long-term consequences for post-hatching development, contributing to morphological abnormalities. This highlights the need for careful evaluation of microinjection protocols in future studies to minimize unintended developmental disruptions. Hybridization was found to have a negative impact on early survival, with hybrid embryos exhibiting significantly higher mortality rates than brook trout during incubation. These findings suggest that hybridization itself imposes physiological stress during early ontogeny, likely due to differences in developmental timing inherited from the maternal species. However, after hatching, the hybrid survival rates did not significantly differ from those of brook trout, indicating that the vulnerability of hybrids is primarily restricted to the incubation period. The immune gene expression analysis revealed that hybrids presented earlier immune activation, with higher IL-6 expression levels and sustained IFN2 presence across developmental stages. However, this accelerated immune response did not translate into increased resistance to IPNV infection, as infected hybrids still presented high mortality rates, particularly at later time points. These findings suggest that while hybrids exhibit earlier immune maturation, their immune response efficiency may not be superior to that of brook trout. Instead, immune activation appears to be temporally shifted rather than fundamentally different, reinforcing the idea that the developmental pace plays a crucial role in infection dynamics. In terms of growth and metabolism, hybrids demonstrated faster yolk sac resorption and higher growth rates, resembling their maternal rainbow trout lineage. However, brook trout retained yolk sac reserves longer, particularly in the placebo and IPNV-infected groups, suggesting a more conservative energy utilization strategy. The presence of morphological abnormalities, such as spinal cord torsion and delayed yolk sac resorption in the infected groups further highlights the potential developmental trade-offs associated with early viral exposure and microinjection. The behavioural analysis revealed species-specific differences in locomotor activity, spatial behaviour, and social interactions, with brook trout exhibiting greater overall movement and exploratory tendencies, whereas hybrids presented reduced activity and stronger peripheral zone preferences. Infection with IPNV led to disruptions in motor coordination, increased avoidance behaviour, and reduced social interactions, particularly in brook trout, indicating an increased stress sensitivity to infection. In contrast, hybrids presented a more reactive stress response, with increased acceleration under infection stress, suggesting potential differences in how species perceive and respond to viral challenges. Our findings have several important implications for aquaculture and disease management strategies. The high early mortality of hybrids suggests that breeding programs involving interspecific crosses should carefully evaluate incubation conditions and egg-handling procedures to maximize survival rates. The observed delayed immune activation in brook trout and earlier immune response in hybrids indicate that vaccination timing or infection management strategies should be tailored to the developmental schedule of each species to increase disease resistance. Furthermore, the species-specific behavioural responses to infection suggest that brook trout may be more vulnerable to pathogen-induced stress, whereas hybrids might have a different stress-coping mechanism. This has potential implications for stocking density, environmental enrichment, and welfare monitoring in hatchery environments. Overall, this study highlights the complex interactions among hybridization, developmental timing, immune responses, and behaviour in the context of viral infection. While hybridization leads to faster ontogenetic development, it does not necessarily confer enhanced resistance to IPNV and may impose greater early-life vulnerability. Future research should explore strategies for optimizing hybrid survival and immune response timing, particularly in the context of aquaculture production and disease prevention programs. Abbreviations AI artificial intelligence ANOVA analysis of variance CIs confidence intervals DD degree-days dpf days post-fertilization dph days post-hatching HE haematoxylin-eosin HR hazard ratios IFN interferon IHN Infectious Hematopoietic Necrosis IPNV Infectious Pancreatic Necrosis Virus ML machine learning TCID₅₀ tissue culture infective dose Tukey’s HSD Tukey's Honestly Significant Difference VHS Viral Haemorrhagic Septicaemia Declarations Ethics approval and consent to participate The study was approved by the Local Ethics Committee for Animal Experiments in Olsztyn, Certificate No. 61/2018, 31.07.2018, and was compliant with Directive 2010/63/EU and recommendations of the Federation of European Laboratory Animal Science Associations. Consent for publication Not applicable Availability of data and materials The datasets generated and analysed during the current study are available in the Repository for Open Data: Duk, Karolina, 2025, "Induction of Infectious Pancreatic Necrosis (IPN) in brook trout ( Salvelinus fontinalis ) and rainbow brook trout ( Salvelinus fontinalis x Oncorhynchus mykiss ) using microinjection challenge with infectious pancreatic necrosis virus (IPNV)", https://doi.org/10.18150/ZN2W47, RepOD, V1, CC BY 4.0 Competing interests The authors declare that they have no known competing interests or personal relationships that could have appeared to influence the work reported in this paper Funding This research was funded in whole by the National Science Centre, Poland, grant number 2017/25/N/NZ9/00267: “Induction of Infectious Pancreatic Necrosis (IPN) in brook trout ( Salvelinus fontinalis ) and rainbow brook trout ( Salvelinus fontinalis x Oncorhynchus mykiss ) using microinjection challenge with infectious pancreatic necrosis virus (IPNV)” and conducted at the Department of Pathophysiology, Forensic Veterinary Medicine and Administration, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, Poland. Publication was funded by the Minister of Science under the Regional Initiative of Excellence Program. Authors' contributions KD: funding acquisition, conceptualization, methodology, investigation, formal analysis, writing - original draft. PS: investigation, writing - review & editing. JPC: investigation, writing - review & editing. MCK: methodology, resources, writing - review & editing. All authors have read and agreed to the published version of the manuscript. Acknowledgements The authors wish to thank prof. Michał Reichert and National Veterinary Research Institute – State Research Institute for providing the viruses used in the fish challenge; Jacek Juchniewicz and all the staff from the Dabie hatchery for providing the experimental eggs; dr Anna Wiśniewska for professional transport of eggs and prof. Krzysztof Wąsowicz from Department of Pathophysiology, Forensic Veterinary Medicine and Administration, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, for enabling the facilities used in the challenge. Declaration of Generative AI and AI-Assisted Technologies in the Writing Process During the preparation of this work, the authors used Curie’s AI for language editing and ChatGPT (OpenAI) in order to assist with language refinement, structural organization, and consistency checks of the manuscript. The tool was also utilized for summarizing and synthesizing relevant literature, ensuring clarity, and improving the readability of the text. After using this tool, the authors thoroughly reviewed and edited the content as needed and take full responsibility for the accuracy, originality, and integrity of the published article. References Munro ES, Midtlyng PJ. Infectious pancreatic necrosis and associated aquatic birnaviruses. In: Woo PTK, Bruno DW, editors. Fish Diseases and Disorders, Vol. 3: Viral, Bacterial, and Fungal Infections. London: CABI International; 2011. p. 1–65. Barrera-Mejía M, Martínez S, Ortega C, Ulloa-Arvizu R. Genotyping of infectious pancreatic necrosis virus isolates from Mexico state. J Aquat Anim Health. 2011;23:200–6. Tapia D, Kuznar J, Farlora R, Yáñez JM. Differential transcriptomic response of rainbow trout to infection with two strains of IPNV. Viruses. 2021;14:21. Bootland L, Dobos P, Stevenson R. The IPNV carrier state and demonstration of vertical transmission in experimentally infected brook trout. Dis Aquat Organ. 1991;10:13–21. Reyes-Cerpa S, Reyes-López F, Toro-Ascuy D, Montero R, Maisey K, Acuña-Castillo C, et al. Induction of anti-inflammatory cytokine expression by IPNV in persistent infection. Fish Shellfish Immunol. 2014;41. Dorson M, Chevassus B, Torhy C. Comparative susceptibility of three species of char and of rainbow trout x char triploid hybrids to several pathogenic salmonid viruses. Dis Aquat Organ. 1991;11:217–24. Dove S. Innate antiviral-like immune responses differ among divergent European and North American farmed and wild Atlantic salmon ( Salmo salar ) and their hybrids. Master thesis. Memorial University of Newfoundland; 2022. Klemme I, Hendrikx L, Ashrafi R, Sundberg L-R, Räihä V, Piironen J, et al. Opposing health effects of hybridization for conservation. Conserv Sci Pract. 2021;3:e379. Mateus AP, Power DM, Canário AVM. Chapter 8 - Stress and disease in fish. In: Jeney G, editor. Fish Diseases. Academic Press; 2017. p. 187–220. Petitjean Q, Jean S, Gandar A, Côte J, Laffaille P, Jacquin L. Stress responses in fish: from molecular to evolutionary processes. Sci Total Environ. 2019;684:371–80. Vargas-Chacoff L, Muñoz JLP, Saravia J, Oyarzún R, Pontigo JP, González MP, et al. Neuroendocrine stress response in Atlantic salmon ( Salmo salar ) and coho salmon ( Oncorynchus kisutch ) during sea lice infestation. Aquaculture. 2019;507:329–40. Nygård TA, Jahren JH, Schellewald C, Stahl A. Motion trajectory estimation of salmon using stereo vision. IFAC-Pap. 2022;55:363–8. Cui M, Liu X, Liu H, Zhao J, Li D, Wang W. Fish tracking, counting, and behaviour analysis in digital aquaculture: a comprehensive survey. Rev Aquac. 2025;17:e13001. Kawamura G, Bagarinao TU, Seng LL. Fish behaviour and aquaculture. In: Aquaculture Ecosystems. 1st edition. John Wiley & Sons, Ltd; 2015. p. 68–106. Wiese TR, Rey Planellas S, Betancor M, Haskell M, Jarvis S, Davie A, et al. Qualitative behavioural assessment as a welfare indicator for farmed Atlantic salmon ( Salmo salar ) in response to a stressful challenge. Front Vet Sci. 2023;10. Li D, Li X, Wang Q, Hao Y. Advanced techniques for the intelligent diagnosis of fish diseases: a review. Animals. 2022;12:2938. Leitritz E, Lewis RC. Trout and salmon culture (hatchery methods). rev. ed. o.O: Univ. of California; 1980. Duk K, Schulz P, Podlasz P, Siwicki AK. Egg microinjections – method experimental viral infections in brook trout Salvelinus fontinalis (Mitchill, 1815) and rainbow brook trout Salvelinus fontinalis ♂ × Oncorhynchus mykiss ♀. Fish Aquat Life. 2022;30:169–74. Fournie JW, Krol RM, Hawkins WE. Fixation of fish tissues. In: Ostrander GK, editor. The Laboratory Fish. New York: Academic Press; 2000. p. 569–78. Bancroft JD, Layton C. The hematoxylins and eosin. In: Suvarna SK, Layton C, Bancroft JD, editors. Bancroft’s Theory and Practice of Histological Techniques. Elsevier; 2019. p. 126–38. R Core Team. R: a language and environment for statistical computing. 2024. Posit team. RStudio: integrated development environment for R. 2024. Wickham H, François R, Henry L, Müller K, Vaughan D. dplyr: a grammar of data manipulation. https://CRAN.R-project.org/package=dplyr. 2023. Kassambara A, Kosinski M, Biecek P. survminer: drawing survival curves using “ggplot2.” https://rpkgs.datanovia.com/survminer/index.html. 2021. Patil I. Visualizations with statistical details: the “ggstatsplot” approach. J Open Source Softw. 2021;6:3167. Gu Z, Eils R, Schlesner M. Complex heatmaps reveal patterns and correlations in multidimensional genomic data. Bioinformatics. 2016;32:2847–9. Hothorn T, Bretz F, Westfall P. Simultaneous inference in general parametric models. Biom J Biom Z. 2008;50:346–63. Blanc JM, Chevassus B. Interspecific hybridization of salmonid fish. Aquaculture. 1979;18:21–34. Hoitsy G, Woynárovich A, Moth-Poulsen T. Guide to the small scale artificial propagation of trout. Budapest; 2012. Chevassus B, Dorson M. Genetics of resistance to disease in fishes. Aquaculture. 1990;85:83–107. LaPatra SE, Lauda KA, Jones GR, Shewmaker WD, Groff JM, Routledge D. Susceptibility and humoral response of brown trout x lake trout hybrids to infectious hematopoietic necrosis virus: a model for examining disease resistance mechanisms. Aquaculture. 1996;146:179–88. Ogut H, Altuntas C. Virulence of Viral Haemorrhagic Septicaemia Virus (VHSV) genotype Ie on fry of three trout species: black sea trout ( Salmo trutta labrax ), rainbow trout ( Oncorhynchus mykiss ) and brook trout ( Salvelinus fontinalis ). Bull Eur Assoc Fish Pathol. 2011;31:139–46. Parsons JE, Busch RA, Thorgaard GH, Scheerer PD. Increased resistance of triploid rainbow trout × coho salmon hybrids to infectious hematopoietic necrosis virus. Aquaculture. 1986;57:337–43. McKay LR, Ihssen PE, McMillan I. Early mortality of tiger trout ( Salvelinus fontinalis × Salmo trutta ) and the effects of triploidy. Aquaculture. 1992;102:43–54. McKay LR, Ihssen PE, McMillan I. Growth and mortality of diploid and triploid tiger trout ( Salmo trutta × Salvelinus fontinalis ). Aquaculture. 1992;106:239–51. Blanc JM, Chevassus B. Interspecific hybridization of salmonid fish: II. Survival and growth up to the 4th month after hatching in F1 generation hybrids. Aquaculture. 1982;29:383–7. Metcalfe CD, Sonstegard RA. Microinjection of carcinogens into rainbow trout embryos: an In vivo carcinogenesis Assay2. JNCI J Natl Cancer Inst. 1984;73:1125–32. Roberts RJ, Pearson MD. Infectious pancreatic necrosis in Atlantic salmon, Salmo salar L. J Fish Dis. 2005;28:383–90. Aegerter S, Jalabert B, Bobe J. Large scale real-time PCR analysis of mRNA abundance in rainbow trout eggs in relationship with egg quality and post-ovulatory ageing. Mol Reprod Dev. 2005;72:377–85. Valenzuela AE, Silva VM, Klempau AE. Qualitative and quantitative effects of constant light photoperiod on rainbow trout ( Oncorhynchus mykiss ) peripheral blood erythrocytes. Aquaculture. 2006;251:596–602. Kittilsen S, Schjolden J, Beitnes-Johansen I, Shaw JC, Pottinger TG, Sørensen C, et al. Melanin-based skin spots reflect stress responsiveness in salmonid fish. Horm Behav. 2009;56:292–8. Svitačová K, Slavík O, Horký P. Pigmentation potentially influences fish welfare in aquaculture. Appl Anim Behav Sci. 2023;262:105903. Vissio PG, Darias MJ, Di Yorio MP, Pérez Sirkin DI, Delgadin TH. Fish skin pigmentation in aquaculture: the influence of rearing conditions and its neuroendocrine regulation. Gen Comp Endocrinol. 2021;301:113662. Ingerslev H-C, Rønneseth A, Pettersen EF, Wergeland HI. Differential expression of immune genes in Atlantic salmon ( Salmo salar L.) challenged intraperitoneally or by cohabitation with IPNV. Scand J Immunol. 2009;69:90–8. McBeath AJA, Snow M, Secombes CJ, Ellis AE, Collet B. Expression kinetics of interferon and interferon-induced genes in Atlantic salmon ( Salmo salar ) following infection with Infectious Pancreatic Necrosis Virus and Infectious Salmon Anaemia Virus. Fish Shellfish Immunol. 2007;22:230–41. Reyes-Cerpa S, Reyes-López FE, Toro-Ascuy D, Ibañez J, Maisey K, Sandino AM, et al. IPNV modulation of pro and anti-inflammatory cytokine expression in Atlantic salmon might help the establishment of infection and persistence. Fish Shellfish Immunol. 2012;32:291–300. Reyes-López FE, Romeo JS, Vallejos-Vidal E, Reyes-Cerpa S, Sandino AM, Tort L, et al. Differential immune gene expression profiles in susceptible and resistant full-sibling families of Atlantic salmon ( Salmo salar ) challenged with Infectious Pancreatic Necrosis Virus (IPNV). Dev Comp Immunol. 2015;53:210–21. Robertsen B. The interferon system of teleost fish. Fish Shellfish Immunol. 2006;20:172–91. Lauksund S, Greiner-Tollersrud L, Chang CJ, Robertsen B. Infectious pancreatic necrosis virus proteins VP2, VP3, VP4 and VP5 antagonize IFNa1 promoter activation while VP1 induces IFNa1. Virus Res. 2015;196:113–21. Skjesol A, Aamo T, Hegseth MN, Robertsen B, Jørgensen JB. The interplay between infectious pancreatic necrosis virus (IPNV) and the IFN system: IFN signaling is inhibited by IPNV infection. Virus Res. 2009;143:53–60. Rodríguez FH, Flores-Mara R, Yoshida GM, Barría A, Jedlicki AM, Lhorente JP, et al. Genome-Wide Association Analysis for Resistance to Infectious Pancreatic Necrosis Virus Identifies Candidate Genes Involved in Viral Replication and Immune Response in Rainbow Trout ( Oncorhynchus mykiss ). G3 Bethesda Md. 2019;9:2897–904. Moen T, Baranski M, Sonesson AK, Kjøglum S. Confirmation and fine-mapping of a major QTL for resistance to infectious pancreatic necrosis in Atlantic salmon ( Salmo salar ): population-level associations between markers and trait. BMC Genomics. 2009;10:368. Bellinger KL, Thorgaard GH, Carter PA. Domestication is associated with reduced burst swimming performance and increased body size in clonal rainbow trout lines. Aquaculture. 2014;420–421:154–9. Fu C-W, Horng J-L, Chou M-Y. Fish behavior as a neural proxy to reveal physiological states. Front Physiol. 2022;13:937432. Madaro A, Olsen RE, Kristiansen TS, Ebbesson LOE, Flik G, Gorissen M. A comparative study of the response to repeated chasing stress in Atlantic salmon ( Salmo salar L.) parr and post-smolts. Comp Biochem Physiol A Mol Integr Physiol. 2016;192:7–16. Blaser RE, Chadwick L, McGinnis GC. Behavioral measures of anxiety in zebrafish ( Danio rerio ). Behav Brain Res. 2010;208:56–62. Collier AD, Kalueff AV, Echevarria DJ. Zebrafish models of anxiety-like behaviors. In: Kalueff AV, editor. The Rights and Wrongs of Zebrafish: Behavioral Phenotyping of Zebrafish. Cham: Springer International Publishing; 2017. p. 45–72. Schnörr SJ, Steenbergen PJ, Richardson MK, Champagne DL. Measuring thigmotaxis in larval zebrafish. Behav Brain Res. 2012;228:367–74. Egan RJ, Bergner CL, Hart PC, Cachat JM, Canavello PR, Elegante MF, et al. Understanding behavioral and physiological phenotypes of stress and anxiety in zebrafish. Behav Brain Res. 2009;205:38–44. Ahmad F, Richardson MK. Exploratory behaviour in the open field test adapted for larval zebrafish: impact of environmental complexity. Behav Processes. 2013;92:88–98. Graham C, von Keyserlingk MAG, Franks B. Free-choice exploration increases affiliative behaviour in zebrafish. Appl Anim Behav Sci. 2018;203:103–10. Buenhombre J, Daza-Cardona EA, Sousa P, Gouveia A. Different influences of anxiety models, environmental enrichment, standard conditions and intraspecies variation (sex, personality and strain) on stress and quality of life in adult and juvenile zebrafish: a systematic review. Neurosci Biobehav Rev. 2021;131:765–91. Chapman JM, Kelly LA, Teffer AK, Miller KM, Cooke SJ. Disease ecology of wild fish: opportunities and challenges for linking infection metrics with behaviour, condition, and survival. Can J Fish Aquat Sci. 2021;78:995–1007. Mojzesz M, Widziolek M, Adamek M, Orzechowska U, Podlasz P, Prajsnar TK, et al. Tilapia lake virus-induced neuroinflammation in zebrafish: microglia activation and sickness behavior. Front Immunol. 2021;12. Muñoz D, Fuentes R, Carnicero B, Aguilar A, Sanhueza N, San-Martin S, et al. Viral Infection Drives the Regulation of Feeding Behavior Related Genes in Salmo salar . Int J Mol Sci. 2021;22:11391. Engeszer RE, Ryan MJ, Parichy DM. Learned social preference in zebrafish. Curr Biol. 2004;14:881–4. Castanheira MF, Conceição LEC, Millot S, Rey S, Bégout M-L, Damsgård B, et al. Coping styles in farmed fish: consequences for aquaculture. Rev Aquac. 2017;9:23–41. Cavallino L, Rincón L, Scaia MF. Social behaviors as welfare indicators in teleost fish. Front Vet Sci. 2023;10. Gilmour KM, DiBattista JD, Thomas JB. Physiological causes and consequences of social status in salmonid fish. Integr Comp Biol. 2005;45:263–73. Korzan WJ, Summers CH. Evolution of stress responses refine mechanisms of social rank. Neurobiol Stress. 2021;14:100328. Krause J, Butlin RK, Peuhkuri N, Pritchard VL. The social organization of fish shoals: a test of the predictive power of laboratory experiments for the field. Biol Rev Camb Philos Soc. 2000;75:477–501. Øverli Ø, Korzan WJ, Höglund E, Winberg S, Bollig H, Watt M, et al. Stress coping style predicts aggression and social dominance in rainbow trout. Horm Behav. 2004;45:235–41. Ruiz-Gomez M de L, Kittilsen S, Höglund E, Huntingford FA, Sørensen C, Pottinger TG, et al. Behavioral plasticity in rainbow trout ( Oncorhynchus mykiss ) with divergent coping styles: when doves become hawks. Horm Behav. 2008;54:534–8. Schjolden J, Backström T, Pulman KGT, Pottinger TG, Winberg S. Divergence in behavioural responses to stress in two strains of rainbow trout ( Oncorhynchus mykiss ) with contrasting stress responsiveness. Horm Behav. 2005;48:537–44. Archard GA, Earley RL, Hanninen AF, Braithwaite VA. Correlated behaviour and stress physiology in fish exposed to different levels of predation pressure. Funct Ecol. 2012;26:637–45. Roberts LJ, Taylor J, Garcia de Leaniz C. Environmental enrichment reduces maladaptive risk-taking behavior in salmon reared for conservation. Biol Conserv. 2011;144:1972–9. Wang C, Su B, Lu S, Han S, Jiang H, Li Z, et al. Effects of glutathione on growth, intestinal antioxidant capacity, histology, gene expression, and microbiota of juvenile triploid Oncorhynchus mykiss . Front Physiol. 2021;12:784852. Galeotti M, Orioles M, Saccà E, Byadgi O, Pesaro S, Di Cerbo A, et al. Understanding the pathogenesis of red mark syndrome in rainbow trout ( Oncorhynchus mykiss ) through an integrated morphological and molecular approach. Anim Open Access J MDPI. 2023;13. Castro R, Zou J, Secombes CJ, Martin SAM. Cortisol modulates the induction of inflammatory gene expression in a rainbow trout macrophage cell line. Fish Shellfish Immunol. 2011;30:215–23. Yarahmadi P, Miandare HK, Fayaz S, Caipang CMA. Increased stocking density causes changes in expression of selected stress- and immune-related genes, humoral innate immune parameters and stress responses of rainbow trout ( Oncorhynchus mykiss ). Fish Shellfish Immunol. 2016;48:43–53. Supplementary Files SupplementaryFigure1.png Supplementary Figure 1 (A-C) Descriptive statistics of biometric measurements in brook trout and hybrid larvae over time The panels present boxplots showing changes in selected biometric parameters of larvae at consecutive time points post-hatching (measured in days). Data are grouped by species (brook trout and brook trout × rainbow trout hybrid) and experimental treatment (control, placebo, and IPNV-infected). Panel A displays larval body weight (g), panel B shows larval body length (mm), and panel C presents the yolk sac area (mm²). Each box represents the interquartile range (IQR), with the median indicated by a horizontal line inside the box. Whiskers extend to 1.5 times the IQR, and individual data points outside this range are plotted as outliers. The division into facets enables the simultaneous assessment of temporal trends in weight gain, somatic growth, and yolk sac resorption processes in brook trout and hybrids exposed to different experimental conditions. SupplementaryFigure2.png Supplementary Figure 2 (A-C) Linear regression analysis of biometric parameters in brook trout and hybrid larvae The figure presents linear regression models describing the changes in larval weight (A), body length (B), and yolk-sac area (C) over time, measured as days post-hatching (dph). Each panel illustrates the relationship between the biometric parameter and age across different experimental groups (control, placebo, IPNV-infected) and two species (brook trout and brook trout × rainbow trout hybrids). Individual data points are shown, coloured according to larval age. A fitted linear regression line with a 95% confidence interval (shaded area) is plotted for each group to visualize trends and estimate the strength and direction of changes over time. The analysis highlights the temporal dynamics of larval growth and yolk-sac resorption under different experimental conditions. Data are separated by species and treatment to facilitate direct comparisons between the responses of brook trout and hybrid larvae to viral exposure and experimental handling. SupplementaryFigure3.png Supplementary Figure 3 Brook trout and hybrid larvae gene expression heatmap matrix split by k-means clustering with dendrograms The heatmap illustrates the expression patterns of selected immune-related genes in brook trout and brook trout × rainbow trout hybrid larvae exposed to three experimental treatments (control, placebo, IPNV infection). Gene expression levels are represented by the 2^–ΔΔCt values and are visualized in columns across all individuals in the dataset. Samples are grouped according to species and treatment (split annotation), facilitating comparisons between experimental groups. The intensity of colour reflects gene expression levels: lower expression is indicated by darker shades, while higher expression is shown by lighter colours. Additional bar plots and annotations alongside the axes summarize supplementary features for rows and columns, such as aggregate expression profiles. The heatmap includes hierarchical clustering of rows based on expression similarities to reveal potential patterns across groups. This visualization enables the overall assessment of immune gene activation patterns in response to IPNV exposure and across different genetic backgrounds (brook trout vs. hybrids). Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6550822","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":450203041,"identity":"d1326e3d-a563-49b9-9b78-0e50715a2c72","order_by":0,"name":"Karolina Duk","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAu0lEQVRIiWNgGAWjYDCCA2xgSg7MfkCCFgNjMDuBFC2JDSCKKC18N9ISmHkq/qTPDzv8EGiLnZxuAwEtkjfSDjDznDHI3Xg7zQCoJdnY7AABLQY30hsYZ7YBtcxOAGk5kLiNOC3/DNINZ6d/IFZL2gGGjw0GCfLSOUTaInnmWcKBD8eMDTdI5xQcSDAgwi98x9MMHyTUyMnLz07f/OFDhZ0cQS0gAFZjACGJUA4H8g2kqB4Fo2AUjIIRBQBuKkiXdZUQvQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-5314-3000","institution":"University of Warmia and Mazury in Olsztyn: Uniwersytet Warminsko-Mazurski w Olsztynie","correspondingAuthor":true,"prefix":"","firstName":"Karolina","middleName":"","lastName":"Duk","suffix":""},{"id":450203042,"identity":"83ce2e0d-d153-4bfe-bbd2-2907f2a5d6e2","order_by":1,"name":"Patrycja Schulz","email":"","orcid":"","institution":"National Inland Fisheries Institute","correspondingAuthor":false,"prefix":"","firstName":"Patrycja","middleName":"","lastName":"Schulz","suffix":""},{"id":450203043,"identity":"13fb9bd4-15c1-43fc-acc2-921403beb56e","order_by":2,"name":"Joanna Pajdak-Czaus","email":"","orcid":"","institution":"University of Warmia and Mazury in Olsztyn: Uniwersytet Warminsko-Mazurski w Olsztynie","correspondingAuthor":false,"prefix":"","firstName":"Joanna","middleName":"","lastName":"Pajdak-Czaus","suffix":""},{"id":450203044,"identity":"b50864c1-769f-4d90-af52-c9a052380574","order_by":3,"name":"Małgorzata Chmielewska-Krzesińska","email":"","orcid":"","institution":"University of Warmia and Mazury in Olsztyn: Uniwersytet Warminsko-Mazurski w Olsztynie","correspondingAuthor":false,"prefix":"","firstName":"Małgorzata","middleName":"","lastName":"Chmielewska-Krzesińska","suffix":""}],"badges":[],"createdAt":"2025-04-28 21:12:52","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6550822/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6550822/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":82043782,"identity":"aafae3e4-6654-4b86-8bf5-9a5bf67c39ad","added_by":"auto","created_at":"2025-05-06 09:26:10","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":63172,"visible":true,"origin":"","legend":"\u003cp\u003eSurvival analysis based on the Kaplan-Meier estimator with the results of the log-rank test and the median time to death for the entire experiment\u003c/p\u003e\n\u003cp\u003eThe figure shows Kaplan–Meier survival curves for brook trout and brook trout × rainbow trout hybrids subjected to control, placebo, or IPNV-infected treatments. The survival probability is plotted over the entire experimental period, including incubation, hatching, and larval stages. The curves display confidence intervals and censored observations. Risk tables below the plots indicate the number of individuals at risk over time. Median survival times with 95% confidence intervals are provided for each group. The results of the log-rank test and Cox proportional hazards models are indicated on the plot.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-6550822/v1/c7bb64c3d0807f174b7da5ac.png"},{"id":82047409,"identity":"eda45015-de3e-43ec-8228-4565ce8190a6","added_by":"auto","created_at":"2025-05-06 09:42:10","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":47328,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of immune-related genes: IL-1β, IL-6, IL-8, TNFα, IFN2, LyzII, and IFNy\u003c/p\u003e\n\u003cp\u003eGene expression profiles were assessed at 1, 3, 7, 10, 14, and 21 days post-hatching (dph) in brook trout and brook trout × rainbow trout hybrids, subjected to control conditions, placebo treatment or IPNV infection. Relative gene expression levels were determined using the 2^–ΔΔCt method, with β-actin serving as the reference gene and are presented as boxplots, separated by species and treatment groups. Each panel represents the expression of a distinct immune-related gene: IL-1β, IL-6, IL-8, TNFα, IFN2, LyzII, and IFNy.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-6550822/v1/81b9d783933d67a1371234e7.png"},{"id":82043783,"identity":"f6f9d67c-8fb1-4022-8bdb-2af0f0fd170b","added_by":"auto","created_at":"2025-05-06 09:26:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":66563,"visible":true,"origin":"","legend":"\u003cp\u003eDescriptive statistics of behaviour - activity and mobility parameters\u003c/p\u003e\n\u003cp\u003eAnalysis of larval activity and mobility parameters at 10, 14, and 21 days post-hatching (dph) in brook trout and brook trout × rainbow trout hybrid groups across three treatments (control, placebo, IPNV-infected). Data are presented as boxplots stratified by species and treatment. Each subfigure shows a different aspect of locomotor behaviour. \u003cem\u003eTotal Distance Moved (mm)\u003c/em\u003e: total distance travelled by larvae during the observation period. \u003cem\u003eStandard Deviation of Distance Moved (mm):\u003c/em\u003e variability of movement distances between time intervals. \u003cem\u003eMean Velocity (mm/s):\u003c/em\u003e average speed of movement\u003cem\u003e. Cumulative Movement Duration (s): \u003c/em\u003etotal time spent moving. \u003cem\u003eCumulative Immobility Duration (s):\u003c/em\u003e total time spent stationary. \u003cem\u003eMean Body Mobility (%):\u003c/em\u003e proportion of time with body movement activity relative to total observation time.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-6550822/v1/8bf76b507ed688c1ee798cda.png"},{"id":82043791,"identity":"1cbd0b90-6981-4c07-ba4e-e1de3bfaad68","added_by":"auto","created_at":"2025-05-06 09:26:10","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":61771,"visible":true,"origin":"","legend":"\u003cp\u003eDescriptive statistics of behaviour - movement dynamics parameters\u003c/p\u003e\n\u003cp\u003eAnalysis of dynamics of larval movement parameters at 10, 14, and 21 days post-hatching (dph) in brook trout and brook trout × rainbow trout hybrid groups across three treatments (control, placebo, IPNV-infected). Data are presented as boxplots stratified by species and treatment. Each subfigure shows a different aspect of movement dynamic behaviour. \u003cem\u003eMinimum Acceleration (mm/s²):\u003c/em\u003e lowest acceleration values recorded during the trial. \u003cem\u003eMaximum Acceleration (mm/s²):\u003c/em\u003ehighest acceleration values recorded during the trial. \u003cem\u003eMean Turn Angle (°):\u003c/em\u003eaverage angle of directional changes during movement, indicating path linearity. \u003cem\u003eMean Angular Velocity (°/s):\u003c/em\u003e average rate of angular change over time, reflecting turning frequency. \u003cem\u003eMean Meandering (°/mm):\u003c/em\u003e mean amount of turning per unit of distance travelled. \u003cem\u003eTotal Meandering (°/mm):\u003c/em\u003e total cumulative turning per distance moved during the observation.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-6550822/v1/6d7ac5b3acb7586fa94cce85.png"},{"id":82043789,"identity":"89e2df82-50ba-4a5d-a752-a37dd9dcc9ac","added_by":"auto","created_at":"2025-05-06 09:26:10","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":63724,"visible":true,"origin":"","legend":"\u003cp\u003eDescriptive statistics of behaviour - spatial behaviour and zone preferences parameters\u003c/p\u003e\n\u003cp\u003eAnalysis of larval spatial occupancy and transitions between centre and outer zones parameters at 10, 14, and 21 days post-hatching (dph) in brook trout and brook trout × rainbow trout hybrid groups across three treatments (control, placebo, IPNV-infected). Data are presented as boxplots stratified by species and treatment. Each subfigure shows a different aspect of spatial behaviour. \u003cem\u003eTime in Center (s):\u003c/em\u003e cumulative time spent in the central zone of the arena. \u003cem\u003eTime Out of Center (s):\u003c/em\u003e cumulative time spent in the peripheral zone\u003cem\u003e. Entries to Center:\u003c/em\u003e number of times individuals entered the central zone. \u003cem\u003eEntries to Outer Zone:\u003c/em\u003e number of entries into the peripheral area. \u003cem\u003eTransitions to Center:\u003c/em\u003e frequency of movements into the centre from the periphery. \u003cem\u003eTransitions Out of Center:\u003c/em\u003e frequency of movements from the centre to the periphery.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-6550822/v1/398420b4ae91e2f1392fb5d7.png"},{"id":82043806,"identity":"4b2ad7dc-518c-4b31-a62f-5d95c14bad4a","added_by":"auto","created_at":"2025-05-06 09:26:10","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":22695311,"visible":true,"origin":"","legend":"\u003cp\u003eHeatmap of arena zone occupation in brook trout and hybrids across treatments\u003c/p\u003e\n\u003cp\u003eSpatial behaviour of larval brook trout and brook trout × rainbow trout hybrids was assessed across three treatment groups: control, placebo-treated, and IPNV-infected at 10, 14, and 21 days post-hatching. Heatmaps illustrate cumulative occupancy patterns within the experimental arena, divided into two zones: the centre and the periphery (out of centre). Colour intensity reflects the relative time spent in each area, with a blue–green–yellow gradient, where yellow denotes the highest occupancy. The heatmaps provide a visual summary of spatial preferences and highlight treatment- and species-specific differences in larval behaviour.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-6550822/v1/8e17580eda3bdb93c85f3ad6.png"},{"id":82045271,"identity":"326b88f0-69ab-4a5f-8f82-84141881a019","added_by":"auto","created_at":"2025-05-06 09:34:10","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":63148,"visible":true,"origin":"","legend":"\u003cp\u003eDescriptive statistics of behaviour - rotation, orientation and social parameters\u003c/p\u003e\n\u003cp\u003eAnalysis of larval rotation frequency, heading variability and social interactions parameters at 10, 14, and 21 days post-hatching (dph) in brook trout and brook trout × rainbow trout hybrid groups across three treatments (control, placebo, IPNV-infected). Data are presented as boxplots stratified by species and treatment. Each subfigure shows a different aspect of locomotor and social behaviour. \u003cem\u003eClockwise Rotations\u003c/em\u003e: frequency of clockwise turns during locomotion. \u003cem\u003eCounterclockwise Rotations:\u003c/em\u003e frequency of counterclockwise turns. \u003cem\u003eMean Heading Direction (°):\u003c/em\u003e average angular heading relative to the starting point. \u003cem\u003eZone Alternations\u003c/em\u003e: number of transitions between centre and outer zones. \u003cem\u003eTime in Contact (s):\u003c/em\u003e cumulative time spent in direct body contact with other individuals. \u003cem\u003eTime Without Contact (s):\u003c/em\u003e cumulative time without direct body contact with other fish larvae.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-6550822/v1/6a0bd70a2d101cb21ecbb7fe.png"},{"id":94257972,"identity":"71dfdc8d-8eeb-44ae-aa20-3d3e6044649a","added_by":"auto","created_at":"2025-10-24 08:22:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9631585,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6550822/v1/fd497e13-6791-47a3-a479-bda3dc9e31c6.pdf"},{"id":82043788,"identity":"50454fc1-f866-4b4b-ba79-b8c88539c3c3","added_by":"auto","created_at":"2025-05-06 09:26:10","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":87834,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary Figure 1 (A-C) Descriptive statistics of biometric measurements in brook trout and hybrid larvae over time\u003c/p\u003e\n\u003cp\u003eThe panels present boxplots showing changes in selected biometric parameters of larvae at consecutive time points post-hatching (measured in days). Data are grouped by species (brook trout and brook trout × rainbow trout hybrid) and experimental treatment (control, placebo, and IPNV-infected). \u003cem\u003ePanel A\u003c/em\u003e displays larval body weight (g), \u003cem\u003epanel B\u003c/em\u003e shows larval body length (mm), and \u003cem\u003epanel C\u003c/em\u003epresents the yolk sac area (mm²). Each box represents the interquartile range (IQR), with the median indicated by a horizontal line inside the box. Whiskers extend to 1.5 times the IQR, and individual data points outside this range are plotted as outliers. The division into facets enables the simultaneous assessment of temporal trends in weight gain, somatic growth, and yolk sac resorption processes in brook trout and hybrids exposed to different experimental conditions.\u003c/p\u003e","description":"","filename":"SupplementaryFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-6550822/v1/5208c176e635bb4ebfb56fea.png"},{"id":82045270,"identity":"f6bec12a-d05e-41fa-921d-10cd14056b42","added_by":"auto","created_at":"2025-05-06 09:34:10","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":98775,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary Figure 2 (A-C) Linear regression analysis of biometric parameters in brook trout and hybrid larvae\u003c/p\u003e\n\u003cp\u003eThe figure presents linear regression models describing the changes in larval weight (A), body length (B), and yolk-sac area (C) over time, measured as days post-hatching (dph). Each panel illustrates the relationship between the biometric parameter and age across different experimental groups (control, placebo, IPNV-infected) and two species (brook trout and brook trout × rainbow trout hybrids). Individual data points are shown, coloured according to larval age. A fitted linear regression line with a 95% confidence interval (shaded area) is plotted for each group to visualize trends and estimate the strength and direction of changes over time. The analysis highlights the temporal dynamics of larval growth and yolk-sac resorption under different experimental conditions. Data are separated by species and treatment to facilitate direct comparisons between the responses of brook trout and hybrid larvae to viral exposure and experimental handling.\u003c/p\u003e","description":"","filename":"SupplementaryFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-6550822/v1/05053300d8d111ba0a496330.png"},{"id":82047408,"identity":"cd5a16f8-6d1b-4149-912f-28e7aa86421d","added_by":"auto","created_at":"2025-05-06 09:42:10","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":36523,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary Figure 3 Brook trout and hybrid larvae gene expression heatmap matrix split by k-means clustering with dendrograms\u003c/p\u003e\n\u003cp\u003eThe heatmap illustrates the expression patterns of selected immune-related genes in brook trout and brook trout × rainbow trout hybrid larvae exposed to three experimental treatments (control, placebo, IPNV infection). Gene expression levels are represented by the 2^–ΔΔCt values and are visualized in columns across all individuals in the dataset. Samples are grouped according to species and treatment (split annotation), facilitating comparisons between experimental groups. The intensity of colour reflects gene expression levels: lower expression is indicated by darker shades, while higher expression is shown by lighter colours. Additional bar plots and annotations alongside the axes summarize supplementary features for rows and columns, such as aggregate expression profiles. The heatmap includes hierarchical clustering of rows based on expression similarities to reveal potential patterns across groups. This visualization enables the overall assessment of immune gene activation patterns in response to IPNV exposure and across different genetic backgrounds (brook trout vs. hybrids).\u003c/p\u003e","description":"","filename":"SupplementaryFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-6550822/v1/1bb79a55ef518c2eec15b4a3.png"}],"financialInterests":"","formattedTitle":"Experimental Infectious Pancreatic Necrosis Virus infection via egg microinjection: effects on survival, behaviour, and early immune response in brook trout (Salvelinus fontinalis) and brook trout × rainbow trout hybrids (S. fontinalis × Oncorhynchus mykiss)","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eInfectious pancreatic necrosis (IPN) is a highly contagious viral disease affecting both freshwater and marine fish, particularly salmonids [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The causative agent, infectious pancreatic necrosis virus (IPNV), is a member of the \u003cem\u003eBirnaviridae\u003c/em\u003e family and continues to cause significant economic losses in global aquaculture. Although IPN is no longer classified as a notifiable disease by the World Organisation for Animal Health, the virus remains a persistent threat, inducing high mortality in young fish and compromising the sustainability of farmed salmonid populations [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIPNV spreads via both horizontal and vertical transmission. Surviving fish frequently become asymptomatic carriers, excreting the virus through faeces and reproductive fluids [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Horizontal transmission occurs through contaminated water and fish secretions, whereas vertical transmission primarily affects newly hatched fry, with mortality rates reaching up to 100% in highly susceptible populations. Despite ongoing research, key aspects of vertical transmission and early-stage pathogenesis remain insufficiently understood.\u003c/p\u003e \u003cp\u003eTo mitigate disease-related losses, salmonid species have undergone extensive domestication and selective breeding to improve production traits such as growth and resistance to infectious agents. Despite these improvements, viral infections continue to challenge the sustainability of aquaculture systems. One promising strategy to further enhance disease resistance is interspecific hybridization. Previous studies have demonstrated that hybrids between Arctic char (\u003cem\u003eSalvelinus alpinus\u003c/em\u003e) and brook trout (\u003cem\u003eS. fontinalis\u003c/em\u003e) exhibit increased resistance to viral haemorrhagic septicaemia (VHS) and infectious hematopoietic necrosis (IHN) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHybridization is known to modulate the immune response in salmonids by influencing the expression of key immune-related genes. Studies involving Atlantic salmon (\u003cem\u003eSalmo salar\u003c/em\u003e) hybrids between wild and farmed strains have shown that these hybrids often display intermediate or enhanced expression of antiviral genes, depending on the genetic background of the parental lines [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. These gene expression patterns may translate into improved innate antiviral responses. However, the immunological consequences of hybridization are not universally beneficial. In some cases, hybridization has been associated with substantial disruptions in immune gene expression, potentially impairing immune function and overall fitness. This complexity is further highlighted by studies on the hybridization of Saimaa landlocked salmon (\u003cem\u003eSalmo salar\u003c/em\u003e m. \u003cem\u003esebago\u003c/em\u003e) and Atlantic salmon, where susceptibility to one parasite was reduced while susceptibility to another increased [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. These contrasting outcomes indicate that hybridization can have both protective and detrimental effects on host health. Consequently, the health implications of hybridization must be carefully evaluated, as the effects are not simply additive but may vary depending on the traits inherited, resulting in immune responses that are intermediate, tempered, or dysregulated relative to the parental species.\u003c/p\u003e \u003cp\u003eIn addition to molecular responses, viral infections have been linked to changes in locomotion, spatial preferences, and social interactions, often resulting from neurological impairment or metabolic disturbances [\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. However, the extent and behind these alterations are still largely unexamined. Traditional fish disease diagnostics often rely on post-mortem analyses, histopathology, or molecular methods to confirm infections, but these approaches can be time-consuming and are usually applied during the fully symptomatic phase of the disease, potentially missing early subclinical stages. An alternative and increasingly recognized method is behaviour-based monitoring, which allows for the early identification of physiological distress before the onset of overt clinical symptoms. Changes in movement patterns, spatial preferences, or social interactions have been linked to stress, pathogen exposure, and metabolic imbalances in aquaculture settings [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Monitoring fish behaviour provides a real-time, non-invasive approach to welfare assessment and has been proposed as an early warning system for health deterioration in farmed fish [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Recent advancements in artificial intelligence (AI) and machine learning (ML) have further enhanced the potential of behavioural monitoring by enabling automated tracking, trajectory analysis, and pattern recognition [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. By integrating behaviour-based diagnostics with conventional methods, aquaculture facilities could improve disease surveillance and response times, ultimately reducing losses associated with delayed treatment.\u003c/p\u003e \u003cp\u003eThis study aimed to compare the susceptibility and disease progression of brook trout and their interspecific hybrids with rainbow trout following experimental microinjection infection with IPNV. We hypothesized that hybrid larvae might exhibit different survival patterns and immune responses than pure brook trout do, potentially indicating species-specific differences in viral resistance. Additionally, we investigated whether IPNV infection induces measurable behavioural alterations in early developmental stages and whether these changes could serve as early indicators of infection. To comprehensively assess the impact of IPNV infection, a multimethod approach was applied, incorporating survival analysis, biometric measurements, advanced behavioural analysis, gene expression profiling of key immune markers, and histological evaluation.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Eggs and rearing conditions\u003c/h2\u003e \u003cp\u003eAt Dąbie Hatchery (Poland), oocytes were stripped from female brook trout (\u003cem\u003eS. fontinalis\u003c/em\u003e) and rainbow trout (\u003cem\u003eO. mykiss\u003c/em\u003e) and fertilized with brook trout sperm. A triploidization procedure was performed to obtain all-female triploids of brook trout and interspecific \u003cem\u003eS. fontinalis \u0026times; O. mykiss\u003c/em\u003e hybrids. Following fertilization, the eggs were transported under temperature-controlled conditions to the Laboratory of Fish Diseases (Department of Epizootiology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, Poland). At the laboratory, they were microinjected and placed in epizootically separated horizontal flow-through hatching tanks.\u003c/p\u003e \u003cp\u003eEach species was assigned to one of three experimental groups: (1) control (untreated eggs), (2) placebo (virus-free vehicle-injected), or (3) IPNV-injected. Each group was replicated twice, yielding a total of 12 experimental subgroups. A total of N\u0026thinsp;=\u0026thinsp;3 456 eggs were incubated throughout the experiment, with N\u0026thinsp;=\u0026thinsp;288 eggs per incubation tray, and reared through the alevin and fry stages.\u003c/p\u003e \u003cp\u003eEggs were incubated in freshwater under controlled conditions via a flow-through system. The temperature was maintained between 10\u0026ndash;13\u0026deg;C, the pH was 7.0 and the dissolved oxygen concentration was 6.0 mg O₂ L⁻\u0026sup1;. The photoperiod was set according to Leitritz \u0026amp; Lewis [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]: 0:24 LD (complete darkness) until hatching, followed by an 8:16 LD cycle for hatched larvae.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Virus microinjections\u003c/h2\u003e \u003cp\u003eThe Sp (Spjarup) reference strain of IPNV was obtained from The National Veterinary Research Institute (NVRI), Poland (GenBank accession number: AM889221). The virus was propagated, quantified, and titrated via the 50% tissue culture infective dose (TCID₅₀) assay, yielding a concentration of 1 \u0026times; 10⁸ TCID₅₀ mL⁻\u0026sup1;. The placebo solution consisted of a virus-free RPMI medium (Sigma-Aldrich, USA), supplemented with phenol red dye for optical monitoring during microinjections [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMicroinjections were conducted within 7.5 hours post-fertilization, using 0.2 \u0026micro;L of either placebo solution or viral inoculum. The injected volume did not exceed 0.6% of the total egg volume. Injections were performed via a 10 \u0026micro;L borosilicate glass syringe with a repeating semiautomatic dispenser and a custom steel needle with increased wall thickness (26sG, 0.47 mm outer diameter, 0.13 mm inner diameter, 19.0 mm length, 30\u0026deg; angle) (Hamilton Company, Reno, USA).\u003c/p\u003e \u003cp\u003eTo stabilize the eggs during the procedure, they were placed in a 96-well plate partially filled with agar gel. Injection accuracy was monitored under a binocular stereoscopic microscope (Delta Optical, Mińsk Mazowiecki, Poland). The plate was positioned on a thermoelectric Peltier cooling module, ensuring stable water temperature during microinjections [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Sampling and mortality analysis\u003c/h2\u003e \u003cp\u003eAlevins were sampled at six time points: 1, 3, 7, 10, 14, and 21 days post-hatching (dph). At each time point, six live alevins were randomly selected from each hatching tray, resulting in a total of N\u0026thinsp;=\u0026thinsp;432 sampled alevins throughout the study. All six alevins underwent biometric measurements and behavioural assessment. Following these procedures, they were humanely euthanized using tricaine mesylate (MS-222, Sigma-Aldrich, USA) at a concentration of 250 mg L⁻\u0026sup1; and were evenly divided into two groups, with three individuals dedicated to histopathological analysis and three to gene expression analysis.\u003c/p\u003e \u003cp\u003eDaily mortality was recorded by removing and counting dead fertilized eggs, alevins, and fry from the hatching tanks at the same time each day of the experiment. Mortality data were used to assess survival dynamics across the entire experiment, as well as separately for pre-hatching (incubation) and post-hatching phases.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Biometric analysis\u003c/h2\u003e \u003cp\u003eAlevins selected for biometric analysis were weighed using an analytical balance (RADWAG WPS 110/C/2, Radom, Poland) and their total length was measured. Additionally, the yolk sac area was quantified from lateral-view images using the DanioVision advanced analysis system (Noldus, Wageningen, Netherlands) with dedicated DanioScope software (Noldus, Wageningen, Netherlands). Measurements were taken with micrometres precision, allowing for a detailed assessment of growth dynamics and yolk sac resorption over time.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Behaviour analysis\u003c/h2\u003e \u003cp\u003eThe fish were subjected to a light-induced stress test via the DanioVision advanced analysis system (Noldus, Wageningen, Netherlands) with DanioScope software. The test protocol included a 7-minute observation period with two 30-second light stimuli, and the experimental arena was divided into central and peripheral zones to assess spatial preferences.\u003c/p\u003e \u003cp\u003eThe behavioural analysis encompassed five key aspects:\u003c/p\u003e \u003cp\u003e(1) Activity and mobility, including total distance moved, distance variability, mean velocity, cumulative duration of movement, cumulative duration of immobility, and body mobility percentage.\u003c/p\u003e \u003cp\u003e(2) Movement dynamics, characterized by minimum and maximum acceleration, mean turn angle, mean angular velocity, mean meandering, and total meandering.\u003c/p\u003e \u003cp\u003e(3) Spatial behaviour and zone preferences, including cumulative duration in the central and outer zones, frequency of zone entries, and transition frequency between zones.\u003c/p\u003e \u003cp\u003e(4) Rotation and orientation, assessed by clockwise and counterclockwise rotation frequency, mean heading direction, and zone alternation frequency.\u003c/p\u003e \u003cp\u003e(5) Social interactions, measured as cumulative contact duration and no-contact duration, indicating proximity maintenance or avoidance behaviours.\u003c/p\u003e \u003cp\u003eConsequential to the very early ontogenetic stage of brook trout, data from days 1, 3, and 7 post-hatching were excluded from further analyses, as larvae exhibited minimal movement, making meaningful behavioural comparisons infeasible.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Gene expression\u003c/h2\u003e \u003cp\u003eImmediately after euthanasia, the fish were ventrally incised and preserved \u003cem\u003ein toto\u003c/em\u003e in RNAlater\u0026trade; Stabilization Solution (Thermo Fisher Scientific GmbH, Karlsruhe, Germany). After 48 hours of stabilization, the carcasses were homogenized via a TissueLyzer system (Qiagen, Venlo, Netherlands). Total RNA was extracted and purified using the GeneMATRIX Universal RNA Purification Kit (EURx, Gdańsk, Poland). The RNA integrity and concentration were assessed before reverse transcription, which was performed using PrimeScript RT Master Mix (Perfect Real Time) (Takara Bio Europe, Saint-Germain-en-Laye, France) on a Biometra thermal cycler (Analytik Jena, G\u0026ouml;ttingen, Germany). Quantitative PCR (qPCR) was conducted using SYBR\u0026trade; Select Master Mix for CFX (Thermo Fisher Scientific, Waltham, USA) with specific primers (Genomed, Warsaw, Poland) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) on a QuantStudio\u0026trade; 5 system (Applied Biosystems\u0026trade;, Thermo Fisher, Waltham, USA). The relative gene expression of selected immune markers (IL-1β, IL-6, IL-8, TNFα, IFNγ, IFN2, and LyzII) was calculated via the 2^\u0026ndash;ΔΔCt method, with β-actin serving as the reference gene.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequences of primers used for PCR analysis.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAccession number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer sequence 5\u0026rsquo;-3\u0026rsquo;\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eβ-Actin\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_001124235.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFW: GGACTTTGAGCAGGAGATGG\u003c/p\u003e \u003cp\u003eRW: ATGATGGAGTTGTAGGTGGTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eWang et al. [\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIL-1β\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAJ223954\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFW: ACCGAGTTCAAGGACAAGGA\u003c/p\u003e \u003cp\u003eRW: CATTCATCAGGACCCAGCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGaleotti et al. [\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIL-6\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDQ866150\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFW: ACTCCCCTCTGTCACACACC\u003c/p\u003e \u003cp\u003eRW: GGCAGACAGGTCCTCCACTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGaleotti et al. [\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIL-8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAJ279069\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFW: CACAGACAGAGAAGGAAGGAAAG\u003c/p\u003e \u003cp\u003eRW: TGCTCATCTTGGGGTTACAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eWang et al. [\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTNFα\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_001124374.1\u003c/p\u003e \u003cp\u003eAJ278085.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFW: CAAGAGTTTGAACCTCATTCAG\u003c/p\u003e \u003cp\u003eRW: GCTGCTGCCGCACATAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCastro et al. [\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e]; Yarahmadi et al. [\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIFNγ\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAJ616215.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFW: CTGAAAGTCCACTATAAGATCTCCA\u003c/p\u003e \u003cp\u003eRW: CCCTGGACTGTGGTGTCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCastro et al. [\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIFN2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAJ582754.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFW: AGTTCCTGTGTATCACCTGTCG\u003c/p\u003e \u003cp\u003eRW: GATGCTCAGTACATCTGTCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCastro et al. [\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLyzII\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX59491.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFW: ACAGCCGCTACTGGTGTGACG\u003c/p\u003e \u003cp\u003eRW: GCTGCTGCCGCACATAGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eYarahmadi et al. [\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Histology\u003c/h2\u003e \u003cp\u003eImmediately after euthanasia, the fish were ventrally incised and fixed \u003cem\u003ein toto\u003c/em\u003e in Davidson\u0026rsquo;s solution for 48 hours [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Before fixation, each sample was randomly assigned a five-digit identification code, ensuring that all subsequent histological processing and analysis were conducted blindly, without knowledge of the experimental group. After fixation, the samples were rinsed three times in 70% ethanol and processed for standard histopathological examination. The tissues were dehydrated in a graded series of ethanol using an automatic tissue processor (Leica TP102, Leica Biosystems, Nussloch, Germany). After processing, the samples were embedded in paraffin and sectioned in the sagittal plane. Sections (4.5 \u0026micro;m thick) were cut using a rotary microtome (Leica RM2255, Leica Biosystems, Nussloch, Germany) and mounted on glass slides. The slides were stained with hematoxylin and eosin (HE) via a programmable stainer (Leica ST5010 Autostainer XL, Leica Biosystems, Nussloch, Germany), following the protocol described by Bancroft \u0026amp; Layton [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Statistical analysis\u003c/h2\u003e \u003cp\u003eAll statistical analyses were conducted via Python (Statsmodels and SciPy libraries) and R Statistical Software (version 4.3.3) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] within RStudio Integrated Development Environment (version 2023.12.1.402) [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The following R packages were used: dplyr [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e] for data wrangling, survminer [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] for survival analysis, ggstatsplot [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] for statistical visualization, ComplexHeatmap [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] for hierarchical clustering and heatmap generation, and multcomp [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] for post hoc multiple comparisons. Before performing the statistical analyses, the data distribution was assessed using the Shapiro-Wilk test for normality, and Levene\u0026rsquo;s test was applied to verify the homogeneity of variance. If assumptions of normality or homogeneity were violated, the data were transformed via log₂ or square-root transformations. The significance level for all statistical tests was set at α\u0026thinsp;=\u0026thinsp;0.05.\u003c/p\u003e \u003cp\u003eSurvival analysis was conducted via the Kaplan-Meier method, with survival curves generated separately for species and treatment groups. Differences between survival curves were evaluated via the log-rank test (Mantel-Cox test), which compares entire survival distributions. A Cox proportional hazards model was applied to quantify the relative risk of mortality between species and treatment groups, with the results reported as hazard ratios (HR) and 95% confidence intervals (CIs). The Cox model was applied in two configurations: a univariate model, where the group was treated as a single factor, and a multivariate model, where the species and treatment were analysed as separate factors to assess their independent effects.\u003c/p\u003e \u003cp\u003eDifferences in biometric parameters, including larval weight, body length, and yolk sac area, were analysed via two-way ANOVA, to assess the main effects of species and treatment, as well as their interaction (species \u0026times; treatment). To further examine how these effects varied over time, separate two-way ANOVA tests were conducted for each post-hatching day (dph), allowing for a focused comparison at each developmental stage. Interaction terms were included in the model to examine how treatment effects varied over time and between species. Following significant results (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), Tukey\u0026rsquo;s Honest Significant Difference (HSD) test was applied for post hoc pairwise comparisons. Additionally, linear regression models were fitted to explore time-dependent trends in biometric parameters within each experimental group.\u003c/p\u003e \u003cp\u003eGene expression data were analysed via the Kruskal-Wallis test as a nonparametric alternative to ANOVA when normality assumptions were not met. One-way ANOVA was performed separately within each treatment group to assess species-specific effects, whereas two-way ANOVA was applied where sample sizes permitted, with species, treatment, and time as fixed factors. Significant interactions were further explored via Tukey\u0026rsquo;s HSD test for pairwise comparisons. To assess dynamic changes in gene expression over time, linear regression models were applied separately for each gene, species, and treatment group, with age as a continuous predictor.\u003c/p\u003e \u003cp\u003eThe behavioural data were analysed via three-way ANOVA, with species, treatment, and post-hatching day as factors. Significant main effects and interactions were followed by Tukey\u0026rsquo;s HSD test for pairwise comparisons. Levene\u0026rsquo;s test was used to confirm the homogeneity of variance across experimental groups, and data transformations were applied when necessary to meet model assumptions.\u003c/p\u003e \u003cp\u003eHistological evaluation was performed in a blinded manner to ensure objectivity, with sample identity concealed during processing and analysis. Observations were qualitatively compared between the experimental groups, with a focus on structural changes indicative of infection, inflammation, and tissue integrity. Semiquantitative scoring was applied where applicable.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003e3.1. Survival analysis\u003c/h2\u003e\n \u003cp\u003eThe survival analysis for the entire experiment is shown in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. Survival patterns varied across developmental stages, with distinct trends observed during egg incubation and the post-hatching period. Significant differences were detected between groups at each stage of development (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). Brook trout hatched at 38 days post-fertilization (dpf), corresponding to an average of 406 degree-days (DD), whereas hybrids hatched 11 days earlier, at 27 dpf, reaching an average of 294 DD. Species-specific survival differences were dominant during incubation, whereas post-hatching mortality was driven primarily by treatment effects. Viral infection had the strongest negative impact on survival in both species, although hybrids experienced greater overall mortality rates across all developmental stages (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Additionally, the increased mortality risk observed in the placebo-treated groups suggests that handling stress plays a role in survival outcomes, warranting further investigation into experimental protocols to minimize procedural effects.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eMedian of survival and relative mortality during different stages of the experiment.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTime\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTreatment\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSpecies\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eMedian of survival (days)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e0.95 LCL\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e0.95 UCL\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eRelative mortality (%)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"6\"\u003e\n \u003cp\u003e\u003cstrong\u003eWhole experiment\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eControl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBrook trout\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e576\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e22.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e69.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHybrid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e576\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e15.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e67.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003ePlacebo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBrook trout\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e576\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e77.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHybrid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e576\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e75.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eIPNV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBrook trout\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e576\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e21.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e77.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHybrid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e576\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e78.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"6\"\u003e\n \u003cp\u003e\u003cstrong\u003eIncubation\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eControl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBrook trout\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e370\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e64.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHybrid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e368\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e63.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003ePlacebo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBrook trout\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e409\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e71.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHybrid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e412\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e71.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eIPNV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBrook trout\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e389\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e67.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHybrid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e368\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e74.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"6\"\u003e\n \u003cp\u003e\u003cstrong\u003ePost-hatching\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eControl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBrook trout\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e206\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e15.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHybrid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e208\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e10.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003ePlacebo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBrook trout\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e167\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e22.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHybrid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e164\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e14.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eIPNV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBrook trout\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e187\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e31.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHybrid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e150\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e16.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"8\"\u003eFor each group, the initial number of individuals (N), median survival in days, and corresponding 95% confidence intervals (LCL \u0026ndash; lower confidence level, UCL \u0026ndash; upper confidence level) are presented. During the post-hatching period, the median survival could not be estimated (NA) due to the limited number of events. Relative mortality (%) was calculated separately for each period, based on the number of individuals alive at the beginning of that period.\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e\n \u003ch2\u003e3.1.1. Survival during egg incubation\u003c/h2\u003e\n \u003cp\u003eSurvival during the incubation period was significantly influenced by both species and treatment (\u003cem\u003e\u0026chi;\u0026sup2; = 239, df\u0026thinsp;=\u0026thinsp;5, p\u0026thinsp;\u0026lt;\u0026thinsp;2 \u0026times; 10⁻\u0026sup1;⁶\u003c/em\u003e). The survival rates of hybrid embryos were lower than those of brook trout, with median survival times of 7 days (control), 9 days (IPNV-infected), and only 2 days (placebo). In contrast, brook trout embryos presented more uniform survival patterns, with median survival times of 11\u0026ndash;12 days across all treatment groups.\u003c/p\u003e\n \u003cp\u003eCompared with brook trout, hybrid embryos had a nearly twofold increase in mortality risk (\u003cem\u003eHR\u0026thinsp;=\u0026thinsp;1.95, 95% CI: 1.67\u0026ndash;2.23, p\u0026thinsp;\u0026lt;\u0026thinsp;2 \u0026times; 10⁻\u0026sup1;⁶\u003c/em\u003e). Interestingly, IPNV infection slightly reduced mortality risk during this phase (\u003cem\u003eHR\u0026thinsp;=\u0026thinsp;0.89, 95% CI: 0.79\u0026ndash;0.99, p\u0026thinsp;=\u0026thinsp;0.027\u003c/em\u003e), although the effect size was small. The highest mortality risk was observed in placebo-treated hybrids (\u003cem\u003eHR\u0026thinsp;=\u0026thinsp;2.06, 95% CI: 1.75\u0026ndash;2.43, p\u0026thinsp;\u0026lt;\u0026thinsp;2 \u0026times; 10⁻\u0026sup1;⁶\u003c/em\u003e), suggesting that procedural stress contributes to early survival outcomes.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e\n \u003ch2\u003e3.1.2. Survival after hatching\u003c/h2\u003e\n \u003cp\u003eFollowing hatching, survival patterns shifted, with treatment effects becoming more pronounced and species effects diminishing. Post-hatching survival was significantly affected by treatment but not by species (\u003cem\u003e\u0026chi;\u0026sup2; = 20.9, df\u0026thinsp;=\u0026thinsp;5, p\u0026thinsp;=\u0026thinsp;8 \u0026times; 10⁻⁴\u003c/em\u003e). Due to censoring, median survival times could not be determined for this phase.\u003c/p\u003e\n \u003cp\u003eCompared with control, IPNV-infected brook trout had a 2.33-fold greater mortality risk (\u003cem\u003eHR\u0026thinsp;=\u0026thinsp;2.33, 95% CI: 1.45\u0026ndash;3.21, p\u0026thinsp;=\u0026thinsp;1.2 \u0026times; 10⁻⁴\u003c/em\u003e). Similarly, hybrid larvae infected with IPNV presented an elevated risk (\u003cem\u003eHR\u0026thinsp;=\u0026thinsp;2.07, 95% CI: 1.23\u0026ndash;2.85, p\u0026thinsp;=\u0026thinsp;0.007\u003c/em\u003e). Additionally, placebo-treated brook trout had a 1.64-fold greater mortality risk than the control brook trout did (\u003cem\u003eHR\u0026thinsp;=\u0026thinsp;1.64, 95% CI: 1.01\u0026ndash;2.55, p\u0026thinsp;=\u0026thinsp;0.039\u003c/em\u003e), whereas the placebo effect on hybrids was weaker (\u003cem\u003eHR\u0026thinsp;=\u0026thinsp;1.71, 95% CI: 1.00\u0026ndash;2.64, p\u0026thinsp;=\u0026thinsp;0.055\u003c/em\u003e).\u003c/p\u003e\n \u003cp\u003eThe analysis confirmed that IPNV infection significantly increased mortality risk across both species (\u003cem\u003eHR\u0026thinsp;=\u0026thinsp;2.18, 95% CI: 1.51\u0026ndash;3.02, p\u0026thinsp;=\u0026thinsp;9.26 \u0026times; 10⁻⁶\u003c/em\u003e), whereas placebo-treated larvae also exhibited increased mortality (\u003cem\u003eHR\u0026thinsp;=\u0026thinsp;1.61, 95% CI: 1.12\u0026ndash;2.32, p\u0026thinsp;=\u0026thinsp;0.0105\u003c/em\u003e). However, no significant species effect was detected (\u003cem\u003ep\u0026thinsp;=\u0026thinsp;0.93\u003c/em\u003e), indicating that species-specific survival disparities diminished after hatching.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e\n \u003ch2\u003e3.1.3. Overall survival\u003c/h2\u003e\n \u003cp\u003eSurvival analysis revealed significant differences in overall survival between the species and treatment groups (\u003cem\u003e\u0026chi;\u0026sup2; = 62.1, df\u0026thinsp;=\u0026thinsp;5, p\u0026thinsp;=\u0026thinsp;4 \u0026times; 10⁻\u0026sup1;\u0026sup2;\u003c/em\u003e). Brook trout consistently presented higher survival rates than hybrid larvae did, with median survival times of 22 days (control), 21 days (IPNV-infected), and 20 days (placebo). In contrast, hybrids had significantly lower median survival times: 15 days (control), 14.5 days (IPNV-infected), and 11 days (placebo).\u003c/p\u003e\n \u003cp\u003eCompared with brook trout, hybrid trout presented a significantly greater mortality risk (\u003cem\u003eHR\u0026thinsp;=\u0026thinsp;1.30, 95% CI: 1.19\u0026ndash;1.42, p\u0026thinsp;=\u0026thinsp;6.99 \u0026times; 10⁻\u0026sup1;\u0026sup1;\u003c/em\u003e). Treatment effects were also significant, with IPNV infection increasing mortality risk by 23% (\u003cem\u003eHR\u0026thinsp;=\u0026thinsp;1.24, 95% CI: 1.13\u0026ndash;1.37, p\u0026thinsp;=\u0026thinsp;1.49 \u0026times; 10⁻⁵\u003c/em\u003e), and placebo treatment led to a similar increase (\u003cem\u003eHR\u0026thinsp;=\u0026thinsp;1.25, 95% CI: 1.14\u0026ndash;1.38, p\u0026thinsp;=\u0026thinsp;3.86 \u0026times; 10⁻⁶\u003c/em\u003e).\u003c/p\u003e\n \u003cp\u003eThe strongest mortality effects were observed in hybrids, where IPNV-infected and placebo-treated larvae presented the highest hazard ratios (\u003cem\u003eHR\u0026thinsp;=\u0026thinsp;1.56, 95% CI: 1.39\u0026ndash;1.77, p\u0026thinsp;=\u0026thinsp;8.93 \u0026times; 10⁻\u0026sup1;\u0026sup1;\u003c/em\u003e and \u003cem\u003eHR\u0026thinsp;=\u0026thinsp;1.61, 95% CI: 1.42\u0026ndash;1.84, p\u0026thinsp;=\u0026thinsp;8.36 \u0026times; 10⁻\u0026sup1;\u0026sup2;\u003c/em\u003e, respectively). These findings suggest that hybrid larvae are inherently more susceptible to mortality than brook trout, with viral infection and experimental handling further exacerbating survival disparities.\u003c/p\u003e\n \u003cp\u003eA multivariate Cox regression model incorporating species and treatment confirmed these trends. Hybrids exhibited significantly greater mortality risk (\u003cem\u003eHR\u0026thinsp;=\u0026thinsp;1.295, 95% CI: 1.19\u0026ndash;1.40, p\u0026thinsp;=\u0026thinsp;6.99 \u0026times; 10⁻\u0026sup1;\u0026sup1;\u003c/em\u003e), and both IPNV infection (\u003cem\u003eHR\u0026thinsp;=\u0026thinsp;1.235, 95% CI: 1.12\u0026ndash;1.36, p\u0026thinsp;=\u0026thinsp;1.49 \u0026times; 10⁻⁵\u003c/em\u003e) and placebo treatment (\u003cem\u003eHR\u0026thinsp;=\u0026thinsp;1.254, 95% CI: 1.14\u0026ndash;1.38, p\u0026thinsp;=\u0026thinsp;3.86 \u0026times; 10⁻⁶\u003c/em\u003e) contributed to increased mortality risk.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003e3.2. Biometric analysis\u003c/h2\u003e\n \u003cp\u003eThe average body weight, body length, and yolk sac area for all groups are presented in Supplementary Fig.\u0026nbsp;1, with corresponding regression plots in Supplementary Fig.\u0026nbsp;2.\u003c/p\u003e\n \u003cdiv id=\"Sec17\" class=\"Section3\"\u003e\n \u003ch2\u003e3.2.1. Body weight analysis\u003c/h2\u003e\n \u003cp\u003eThe effects of species (brook trout vs. hybrid) and treatment (control, IPNV-infected, and placebo) on body weight across all time points were assessed. A highly significant species effect was detected (\u003cem\u003eF(1, 311)\u0026thinsp;=\u0026thinsp;156.27, p\u0026thinsp;\u0026lt;\u0026thinsp;2.49 \u0026times; 10⁻\u0026sup2;⁹\u003c/em\u003e), with hybrid larvae consistently exhibiting greater body weights than brook trout. However, no significant effect of treatment was found (\u003cem\u003ep\u0026thinsp;=\u0026thinsp;0.369\u003c/em\u003e), and the species‒treatment interaction was also non-significant (\u003cem\u003ep\u0026thinsp;=\u0026thinsp;0.752\u003c/em\u003e).\u003c/p\u003e\n \u003cp\u003eTo evaluate the temporal effects of species and treatment, separate analyses were conducted for each post-hatching day (dph). Species differences remained significant across all time points, with hybrids being significantly heavier than brook trout from early larval stages onward (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). The treatment effects were significant only at later stages (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e at 14 and 21 dph), with IPNV-infected larvae exhibiting slightly lower weights than those of the controls.\u003c/p\u003e\n \u003cp\u003eA significant positive effect of age on weight was found (\u003cem\u003e\u0026beta;\u0026thinsp;=\u0026thinsp;0.52, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e), confirming that body weight increased over time. Species was a significant predictor (\u003cem\u003e\u0026beta;\u0026thinsp;=\u0026thinsp;1.04, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e), suggesting that hybrid larvae remained heavier than brook trout throughout development. Treatment did not significantly influence body weight progression over time (\u003cem\u003ep\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/em\u003e).\u003c/p\u003e\n \u003cp\u003ePost hoc tests confirmed that hybrid larvae were significantly heavier than brook trout on every post-hatching day (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e). However, no significant pairwise differences were detected among the treatment groups within each species (\u003cem\u003ep\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/em\u003e), which aligns with the ANOVA results.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec18\" class=\"Section3\"\u003e\n \u003ch2\u003e3.2.2. Body length analysis\u003c/h2\u003e\n \u003cp\u003eBody length analysis revealed a highly significant species effect (\u003cem\u003eF(1, 354)\u0026thinsp;=\u0026thinsp;535.61, p\u0026thinsp;\u0026lt;\u0026thinsp;7.97 \u0026times; 10⁻⁷\u0026sup3;\u003c/em\u003e), with hybrid larvae consistently exhibiting greater body length than brook trout. However, treatment had no significant effect on body length (\u003cem\u003ep\u0026thinsp;=\u0026thinsp;0.761\u003c/em\u003e), and the interaction effect between species and treatment was also non-significant (\u003cem\u003ep\u0026thinsp;=\u0026thinsp;0.609\u003c/em\u003e).\u003c/p\u003e\n \u003cp\u003eWhen analysis was conducted separately for each post-hatching day, significant species effects persisted at every time point (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). However, the treatment effects remained non-significant across all days.\u003c/p\u003e\n \u003cp\u003eThe results revealed a significant positive effect of age on body length (\u003cem\u003e\u0026beta;\u0026thinsp;=\u0026thinsp;0.88, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e), confirming that larval length increased with time. The species effect remained highly significant (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e), with hybrid larvae consistently longer than brook trout at every stage. Treatment had no significant effect on body length (\u003cem\u003ep\u0026thinsp;=\u0026thinsp;0.761\u003c/em\u003e), and no interaction effects were detected (\u003cem\u003ep\u0026thinsp;=\u0026thinsp;0.609\u003c/em\u003e).\u003c/p\u003e\n \u003cp\u003ePost hoc tests confirmed that hybrids were significantly longer than brook trout at all time points (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e). No significant differences were detected between the treatment groups within each species (\u003cem\u003ep\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/em\u003e).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec19\" class=\"Section3\"\u003e\n \u003ch2\u003e3.2.3. Yolk sac area analysis\u003c/h2\u003e\n \u003cp\u003eYolk sac area analysis revealed significant effects of both species and treatment (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). Brook trout presented significantly larger yolk sacs at early developmental stages and showed slower yolk sac resorption than hybrids did. The effect of treatment was also significant (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), suggesting that IPNV infection influenced yolk sac resorption rates. However, the interaction term (species \u0026times; treatment) was not significant (\u003cem\u003ep\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/em\u003e), indicating that the treatment effects were consistent across species.\u003c/p\u003e\n \u003cp\u003eTemporal analysis at each post-hatching day revealed that species differences were highly significant at 3, 7, and 10 dph (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e), with brook trout retaining significantly larger yolk sacs. The treatment effects became significant at later stages (14 and 21 dph, \u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), with IPNV-infected individuals exhibiting delayed yolk sac resorption.\u003c/p\u003e\n \u003cp\u003eA significant negative effect of age on the yolk sac area (\u003cem\u003e\u0026beta; = -0.45, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e) was observed, confirming that yolk sacs resorbed progressively with time. Species had a significant effect (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e), with brook trout displaying slower yolk sac resorption than hybrids. Additionally, treatment had a significant effect (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), indicating that IPNV infection slowed yolk sac resorption.\u003c/p\u003e\n \u003cp\u003ePost hoc analysis confirmed that the yolk sac area was significantly larger in brook trout than in hybrids at all time points (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e). Compared with those in the control and placebo groups, the yolk sacs in the IPNV-infected individuals were significantly larger at 14 and 21 dph (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), supporting the hypothesis that viral infection delays yolk sac resorption.\u003c/p\u003e\n \u003cp\u003eA larger yolk sac area at early time points was significantly associated with increased mortality risk (\u003cem\u003eHR\u0026thinsp;=\u0026thinsp;1.18, 95% CI: 1.04\u0026ndash;1.34, p\u0026thinsp;=\u0026thinsp;0.005\u003c/em\u003e). Brook trout presented a significantly greater hazard ratio than hybrids did (\u003cem\u003eHR\u0026thinsp;=\u0026thinsp;1.30, 95% CI: 1.15\u0026ndash;1.46, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e), suggesting that delayed yolk sac resorption contributed to increased mortality. The highest mortality risk was detected in the IPNV-infected groups, particularly in brook trout.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n \u003ch2\u003e3.3. Gene expression\u003c/h2\u003e\n \u003cp\u003eThe analysis confirmed species-specific differences in gene regulation. Significant differences in gene expression were also observed between the treatment groups, and time points (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). The hierarchical clustering of the gene expression profiles is shown in Supplementary Fig. 3.\u003c/p\u003e\n \u003cdiv id=\"Sec21\" class=\"Section3\"\u003e\n \u003ch2\u003e3.3.1. IL-1\u0026beta; expression\u003c/h2\u003e\n \u003cp\u003eNo significant differences in IL-1\u0026beta; expression were detected between treatments, species, or their interaction throughout the study period. Linear regression analysis revealed no significant temporal trends in gene expression.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec22\" class=\"Section3\"\u003e\n \u003ch2\u003e3.3.2. IL-6 expression\u003c/h2\u003e\n \u003cp\u003eIL-6 expression was significantly greater in hybrids than in brook trout across all treatment groups and time points (\u003cem\u003eF(1, 311)\u0026thinsp;=\u0026thinsp;7.86, p\u0026thinsp;=\u0026thinsp;0.0055\u003c/em\u003e). The largest differences were detected at 10 dph and 14 dph when IL-6 expression was significantly elevated in the hybrids (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/em\u003e). A time-dependent trend was observed in both species, with IL-6 expression peaking at 14 dph before slightly decreasing at 21 dph (\u003cem\u003eR\u0026sup2; = 0.12, p\u0026thinsp;=\u0026thinsp;0.003\u003c/em\u003e).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\n \u003ch2\u003e3.3.3. IL-8 expression\u003c/h2\u003e\n \u003cp\u003eNo significant treatment, species, or interaction effects were found for IL-8 expression. Expression levels remained relatively stable across all experimental groups and sampling days.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec24\" class=\"Section3\"\u003e\n \u003ch2\u003e3.3.4. TNF\u0026alpha; expression\u003c/h2\u003e\n \u003cp\u003eA significant increase in TNF\u0026alpha; expression was observed in brook trout infected with IPNV (\u003cem\u003e\u0026chi;\u0026sup2;(2)\u0026thinsp;=\u0026thinsp;8.62, p\u0026thinsp;=\u0026thinsp;0.013; F(2, 153)\u0026thinsp;=\u0026thinsp;3.89, p\u0026thinsp;=\u0026thinsp;0.022\u003c/em\u003e). No significant interaction between species and treatment was detected. Linear regression showed progressive upregulation over time in the infected brook trout (\u003cem\u003eR\u0026sup2; = 0.10, p\u0026thinsp;=\u0026thinsp;0.015\u003c/em\u003e).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e\n \u003ch2\u003e3.3.5. IFNy expression\u003c/h2\u003e\n \u003cp\u003eIFNy expression was not detected at early time points for either species. However, at 21 dph, a significant increase in IFNy expression was observed only in the IPNV-infected hybrids (\u003cem\u003e\u0026chi;\u0026sup2;(2)\u0026thinsp;=\u0026thinsp;9.14, p\u0026thinsp;=\u0026thinsp;0.010\u003c/em\u003e). No IFNy expression was detected in the control or placebo groups, or brook trout samples at any stage.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e\n \u003ch2\u003e3.3.6. IFN2 expression\u003c/h2\u003e\n \u003cp\u003eIFN2 expression in brook trout groups was detected exclusively in IPNV-infected fish at 7 dph (\u003cem\u003e\u0026chi;\u0026sup2;(2)\u0026thinsp;=\u0026thinsp;10.31, p\u0026thinsp;=\u0026thinsp;0.0057\u003c/em\u003e). In hybrids, low-level IFN2 expression was observed across all treatment groups at early time points, with no significant differences between control, placebo, and infected individuals. By 14 dph, compared with the control and placebo groups, the IPNV-infected hybrids presented significantly increased IFN2 expression (Tukey\u0026apos;s HSD, \u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/em\u003e).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e\n \u003ch2\u003e3.3.7. Lysozyme type II expression\u003c/h2\u003e\n \u003cp\u003eLysozyme type II expression was not detected from 1 dph to 14 dph in any group. At 21 dph, lysozyme type II expression was measurable across all species and treatment groups. However, no significant differences were detected between species or treatments.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec28\" class=\"Section2\"\u003e\n \u003ch2\u003e3.4. Behaviour analysis\u003c/h2\u003e\n \u003cp\u003eBehavioural parameters were assessed at multiple post-hatching time points, with significant differences observed between species, treatment groups, and time points (Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab3\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eSummary of three-way ANOVA significant results for behavioural parameters assessed in brook trout and hybrid larvae across different treatments and post-hatching days.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eBehaviour category\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eParameter\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eEffect\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003edf\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ep-value\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSignificance\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"20\"\u003e\n \u003cp\u003eActivity and mobility\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"5\"\u003e\n \u003cp\u003eTotal distance moved\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e38.29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.43\u0026times;10⁻⁹\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e95.18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.09\u0026times;10⁻\u0026sup2;⁹\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e11.27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.31\u0026times;10⁻⁵\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTreatment \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e5.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.70\u0026times;10⁻⁴\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Treatment \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e11.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.08\u0026times;10⁻⁸\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"5\"\u003e\n \u003cp\u003eMean velocity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e40.87\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.14\u0026times;10⁻⁹\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e100.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8.63\u0026times;10⁻\u0026sup3;\u0026sup1;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e11.96\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.25\u0026times;10⁻⁵\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTreatment \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e6.17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.06\u0026times;10⁻⁴\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Treatment \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e12.57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.93\u0026times;10⁻⁹\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"5\"\u003e\n \u003cp\u003eMovement duration\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e27.43\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.14\u0026times;10⁻⁷\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e63.46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.05\u0026times;10⁻\u0026sup2;\u0026sup2;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e9.04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.75\u0026times;10⁻⁴\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTreatment \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e7.98\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.50\u0026times;10⁻⁶\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Treatment \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e10.80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.08\u0026times;10⁻⁸\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"5\"\u003e\n \u003cp\u003eImmobility duration\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e13.77\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.68\u0026times;10⁻⁴\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e34.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.74\u0026times;10⁻\u0026sup1;\u0026sup3;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e6.13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.62\u0026times;10⁻\u0026sup3;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTreatment \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e8.12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.41\u0026times;10⁻⁶\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Treatment \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e10.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.19\u0026times;10⁻⁷\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"14\"\u003e\n \u003cp\u003eMovement dynamics\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003eMinimum acceleration\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.04\u0026times;10⁻⁹\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4.79\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9.29\u0026times;10⁻\u0026sup3;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTreatment \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2.90\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eMaximum acceleration\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e10.78\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.61\u0026times;10⁻⁵\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Treatment\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3.44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0338\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003eTurn angle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e8.18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.86\u0026times;10⁻⁴\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3.82\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0235\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTreatment \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2.43\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0488\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003eAngular velocity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e8.18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.86\u0026times;10⁻⁴\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3.82\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0235\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTreatment \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2.43\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0488\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMeandering (mean)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTreatment \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2.54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0412\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eMeandering (total)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3.78\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0246\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3.48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0327\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"6\"\u003e\n \u003cp\u003eSpatial behaviour\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eCenter zone occupancy (duration)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e24.14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.16\u0026times;10⁻\u0026sup1;⁰\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Treatment \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4.60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.00143\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eOuter zone occupancy (duration)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e28.96\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9.25\u0026times;10⁻\u0026sup1;\u0026sup2;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Treatment \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e5.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.00071\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eCenter zone transitions\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4.09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0445\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0104\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"7\"\u003e\n \u003cp\u003eRotation and orientation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003eClockwise rotations\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e10.16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.00166\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e67.22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.25\u0026times;10⁻\u0026sup2;\u0026sup3;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e14.49\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.34\u0026times;10⁻⁶\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003eCounterclockwise rotations\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e5.85\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0165\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e7.53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.000704\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0450\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeading\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(Intercept)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0444\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003eZone alternations\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003eAlternation frequency\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4.85\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0288\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0101\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3.46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0335\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"5\"\u003e\n \u003cp\u003eSocial interactions\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eContact duration\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e14.12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.85\u0026times;10⁻⁶\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e6.26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.00231\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003eNo-contact duration\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e14.09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.91\u0026times;10⁻⁶\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e***\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Treatment\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3.09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0475\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSpecies \u0026times; Day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e5.53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.00460\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec29\" class=\"Section3\"\u003e\n \u003cp\u003eThe main effects of species, treatment, time , and their interactions (species \u0026times; day, species \u0026times; treatment, treatment \u0026times; day, species \u0026times; treatment \u0026times; day) were evaluated individually for each behavioural trait. The F-statistic, degrees of freedom (df), p-values, and significance levels are provided. Significance levels are indicated as follows: p \u0026lt; 0.05 (*), p \u0026lt; 0.01 (**), and p \u0026lt; 0.001 (***). Behavioural categories include activity and mobility (total distance moved, velocity, movement duration, mobility percentage), movement dynamics (acceleration, turn angle, angular velocity, meandering), spatial behaviour (time spent in centre, zone transitions), rotation and orientation (rotation frequencies and heading variability), and social interactions (cumulative contact and no-contact times). Significant findings were followed by post hoc analyses where appropriate. Only statistically significant effects are reported for clarity. These results highlight species-specific and treatment-specific alterations in behaviour dynamics in response to IPNV exposure.\u003c/p\u003e\n \u003ch2\u003e3.4.1. Activity and mobility\u003c/h2\u003e\n \u003cp\u003eBrook trout in the control group moved significantly greater distances at 10 dph than at 21 dph (time main effect: \u003cem\u003eF(2, 210)\u0026thinsp;=\u0026thinsp;95.18, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e; species \u0026times; time interaction: \u003cem\u003eF(2, 210)\u0026thinsp;=\u0026thinsp;11.27, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e). A similar decline in movement with time was observed in IPNV-infected and placebo-treated brook trout. In hybrids, the total distance moved was shorter than that in brook trout across most time points (species main effect: \u003cem\u003eF(1, 210)\u0026thinsp;=\u0026thinsp;38.29, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e), particularly in the control and placebo groups. The mean velocity followed the same trend, with higher values in brook trout compared to hybrids (species main effect: \u003cem\u003eF(1, 210)\u0026thinsp;=\u0026thinsp;40.87, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e), especially in the IPNV-infected and placebo groups (species \u0026times; treatment interaction: \u003cem\u003eF(4, 210)\u0026thinsp;=\u0026thinsp;12.57, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e). The cumulative movement duration was longer in the IPNV-infected fish than in the placebo group at multiple time points (treatment \u0026times; time interaction: \u003cem\u003eF(4, 210)\u0026thinsp;=\u0026thinsp;7.98, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e), whereas the immobility duration was generally greater in the placebo-treated hybrids (species \u0026times; treatment interaction: \u003cem\u003eF(4, 210)\u0026thinsp;=\u0026thinsp;10.38, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e). The percentage of body mobility varied over time (time main effect: \u003cem\u003eF(2, 210)\u0026thinsp;=\u0026thinsp;43.40, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e), with brook trout in the control group exhibiting greater mobility at 10 dph than at 21 dph. Descriptive statistics of the activity and mobility parameters are presented in Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec30\" class=\"Section3\"\u003e\n \u003ch2\u003e3.4.2. Movement dynamics\u003c/h2\u003e\n \u003cp\u003eMinimum (treatment \u0026times; time interaction: \u003cem\u003eF(4, 210)\u0026thinsp;=\u0026thinsp;2.90, p\u0026thinsp;=\u0026thinsp;0.023\u003c/em\u003e) and maximum acceleration (time main effect: \u003cem\u003eF(2, 210)\u0026thinsp;=\u0026thinsp;10.78, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e) were greater in the IPNV-infected hybrids than in the control and placebo groups at later time points. The turn angle and angular velocity were also significantly greater in the IPNV-infected brook trout than in the control group at 21 dph (species \u0026times; time interaction: \u003cem\u003eF(2, 210)\u0026thinsp;=\u0026thinsp;3.82, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e for both parameters), indicating alterations in movement patterns under viral exposure. Meandering, both in mean and total trajectory deviations was more pronounced in IPNV-infected hybrids at later time points (treatment \u0026times; time interaction: \u003cem\u003eF(4, 210)\u0026thinsp;=\u0026thinsp;2.54, p\u0026thinsp;=\u0026thinsp;0.041\u003c/em\u003e for mean; species \u0026times; time interaction: \u003cem\u003eF(2, 210)\u0026thinsp;=\u0026thinsp;3.48, p\u0026thinsp;=\u0026thinsp;0.033\u003c/em\u003e for total), whereas control brook trout displayed more linear movement patterns across all time points (species effect: \u003cem\u003eF(1, 210)\u0026thinsp;=\u0026thinsp;11.34, p\u0026thinsp;=\u0026thinsp;0.001\u003c/em\u003e). Descriptive statistics of the movement dynamics parameters are presented in Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec31\" class=\"Section3\"\u003e\n \u003ch2\u003e3.4.3. Spatial behaviour and zone preferences\u003c/h2\u003e\n \u003cp\u003eBrook trout in the control group spent more time in the centre zone at 10 dph than at 21 dph (time effect: \u003cem\u003eF(2, 210)\u0026thinsp;=\u0026thinsp;24.14, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e). IPNV-infected individuals presented lower centre occupancy at later time points (species \u0026times; treatment \u0026times; time interaction: \u003cem\u003eF(4, 210)\u0026thinsp;=\u0026thinsp;4.60, p\u0026thinsp;=\u0026thinsp;0.001\u003c/em\u003e). Compared with the control hybrids, the placebo group at 14 dph spent less time in the centre zone (treatment main effect: \u003cem\u003eF(2, 210)\u0026thinsp;=\u0026thinsp;5.79, p\u0026thinsp;=\u0026thinsp;0.004\u003c/em\u003e). The frequency of transitions between the centre and outer zones was greater in brook trout than in hybrids (species main effect: \u003cem\u003eF(1, 210)\u0026thinsp;=\u0026thinsp;10.65, p\u0026thinsp;=\u0026thinsp;0.001\u003c/em\u003e), with the largest differences in the placebo and control groups. IPNV-infected fish had fewer transitions into the centre zone, particularly at later time points (treatment \u0026times; time interaction: \u003cem\u003eF(2, 210)\u0026thinsp;=\u0026thinsp;6.11, p\u0026thinsp;=\u0026thinsp;0.003\u003c/em\u003e), indicating a potential avoidance response. Descriptive statistics of spatial behaviour and zone preference parameters are presented in Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e, whereas the arena heatmap is presented in Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec32\" class=\"Section3\"\u003e\n \u003ch2\u003e3.4.4. Rotation and orientation\u003c/h2\u003e\n \u003cp\u003eClockwise and counterclockwise rotation frequencies were more frequent in the IPNV-infected brook trout than in the control at later time points (species \u0026times; time interaction: \u003cem\u003eF(2, 210)\u0026thinsp;=\u0026thinsp;14.49, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e for CW; \u003cem\u003eF(2, 210)\u0026thinsp;=\u0026thinsp;3.15, p\u0026thinsp;=\u0026thinsp;0.045\u003c/em\u003e for CCW). The mean heading direction was more variable in infected hybrids at 21 dph (species \u0026times; treatment \u0026times; time interaction: \u003cem\u003eF(2, 210)\u0026thinsp;=\u0026thinsp;7.02, p\u0026thinsp;=\u0026thinsp;0.001\u003c/em\u003e), indicating greater deviation than in the control and placebo groups. The zone alternation frequency was lower in the IPNV-infected hybrids than in the control hybrids, particularly at 21 dph (species \u0026times; treatment interaction: \u003cem\u003eF(2, 210)\u0026thinsp;=\u0026thinsp;5.88, p\u0026thinsp;=\u0026thinsp;0.004\u003c/em\u003e), suggesting reduced exploratory behaviour.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec33\" class=\"Section3\"\u003e\n \u003ch2\u003e3.4.5. Social interactions\u003c/h2\u003e\n \u003cp\u003eThe cumulative contact time was lower in the placebo-treated hybrids than in the controls (treatment main effect: \u003cem\u003eF(2, 210)\u0026thinsp;=\u0026thinsp;8.01, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e), whereas the time spent without contact was greater in the IPNV-infected fish (treatment main effect: \u003cem\u003eF(2, 210)\u0026thinsp;=\u0026thinsp;9.72, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e). Brook trout in the control group exhibited more social contact than hybrids did, especially in the later stages of the study (species main effect: \u003cem\u003eF(1, 210)\u0026thinsp;=\u0026thinsp;6.56, p\u0026thinsp;=\u0026thinsp;0.011\u003c/em\u003e). Descriptive statistics of the rotation, orientation and social interaction parameters are presented in Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec34\" class=\"Section2\"\u003e\n \u003ch2\u003e3.5. Histology\u003c/h2\u003e\n \u003cp\u003eHistological evaluation was conducted to assess tissue changes in response to IPNV infection. No pathological abnormalities were observed in the control groups at any time point. At 1 dph and 3 dph, no significant differences in melanomacrophage or melanocyte-like cell counts were observed between the groups. At 14 dph, an increased number of melanomacrophages and melanocyte-like cells was detected in the IPNV-infected groups across both species (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). No other significant histopathological differences were found.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cdiv id=\"Sec36\" class=\"Section2\"\u003e \u003ch2\u003e4.1. Survival analysis and species-specific differences in mortality\u003c/h2\u003e \u003cp\u003eThe survival analysis revealed clear species-specific differences in mortality patterns across developmental stages. During egg incubation, hybrid embryos presented significantly lower survival rates than brook trout did, with the shortest median survival observed in placebo-treated hybrids. This suggests increased vulnerability of hybrids during early development, potentially due to fertilization and hybridization procedures. Additionally, the effect of microinjection cannot be ruled out, as the lowest survival was observed in placebo-treated hybrids. The higher mortality in the placebo groups may be related to handling stress or vehicle effects rather than viral infection itself.\u003c/p\u003e \u003cp\u003eAfter hatching, the mortality patterns changed significantly, with IPNV infection emerging as the dominant factor affecting survival. While species-specific differences in survival were less pronounced in the post-hatching stage, IPNV-infected brook trout presented the highest mortality risk, which is consistent with their well-documented susceptibility to IPNV. However, hybrids also showed increased mortality when infected, particularly at later time points, suggesting that while their developmental trajectory differs from that of brook trout, they do not exhibit increased resistance to IPNV. The multivariate Cox model further confirmed that infection, rather than species identity, was the primary driver of mortality after hatching.\u003c/p\u003e \u003cp\u003eOver the entire experimental period, brook trout exhibited greater overall survival than hybrids did, particularly in the control and placebo groups. The strong negative impact of IPNV and placebo treatment on hybrid survival suggests that hybrids may be more vulnerable to environmental stressors and immune challenges, despite their faster development. The observed delayed impact of infection in hybrids compared with brook trout suggests a shift in the timing of immune activation. This pattern indicates that the immune response in hybrids may be more closely aligned with the developmental schedule inherited from rainbow trout but still follows the same underlying immune pathways as those in brook trout.\u003c/p\u003e \u003cp\u003eOur hatching time results align with those reported in the literature. Brook trout hatched at 406 DD, which falls within the 235\u0026ndash;444 DD range described for this species, whereas hybrid trout hatched at 294 DD, slightly earlier than the 337 DD previously reported [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. This developmental timing suggests that hybrids follow a more accelerated trajectory, resembling their maternal species, rainbow trout (310 DD) [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe negative effect of hybridization on survival during incubation observed in our study contrasts with findings from research on other viral infections, such as viral haemorrhagic septicaemia virus (VHS) and infectious hematopoietic necrosis virus (IHN). In those cases, hybrid fish exhibited increased survival compared with their parental species [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan additionalcitationids=\"CR31 CR32\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. However, our Cox proportional hazards model, which was conducted separately for the incubation and post-hatching periods, confirmed that hybridization had a significant negative effect on survival during incubation but no significant effect after hatching. This trend has been observed in other hybrid fish species, such as tiger trout (\u003cem\u003eS. fontinalis\u003c/em\u003e \u0026times; \u003cem\u003eSalmo trutta\u003c/em\u003e), where early-stage survival was lower compared to parental species [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. However, the hybrids in our study presented faster growth rates and yolk sac resorption, further confirming their closer resemblance to their maternal species [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn contrast to hybridization, the microinjection procedure itself did not affect survival during incubation but significantly reduced survival during the post-hatching period. This finding differs from those of Metcalfe and Sonstegard [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], who reported a negative impact of microinjections on both incubation and post-hatching survival. The improved survival of microinjected eggs in our study likely resulted from modifications in the injection method, as described by Duk et al. [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], which minimized handling stress and mechanical damage.\u003c/p\u003e \u003cp\u003eInterestingly, the higher survival rates of the IPNV-infected groups during egg incubation suggest that the virus remained in a latent state during early development. Bootland et al. [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] reported that vertical transmission of IPNV can be highly unpredictable in laboratory settings, with infected progeny sometimes displaying low mortality rates during incubation.\u003c/p\u003e \u003cp\u003eOur study is the first attempt to replicate the vertical transmission of IPNV in a standardized manner, ensuring that each egg received the same viral dose. This controlled approach eliminates variability in natural transmission, making our results more predictable and reproducible than those of previous studies on vertical transmission under hatchery conditions. This methodological advancement provides a more accurate assessment of infection dynamics and early immune responses, allowing for better comparisons between species and treatment groups.\u003c/p\u003e \u003cp\u003eBy administering precise doses of the virus directly into each fertilized egg, we could isolate the effects of viral exposure from other environmental or parental transmission factors, which are often confounding variables in natural outbreaks. Our results demonstrate that IPNV exposure at the embryonic stage does not immediately trigger high mortality, suggesting that the virus may persist in a latent state until host immune defences mature or external stressors trigger activation. This delayed onset of disease symptoms has also been reported in other fish species infected with IPNV, where early-stage infection often results in asymptomatic carriers rather than acute mortality [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThese findings confirm that the incubation period was the most critical for overall survival, particularly from fertilization to the eyed stage when the highest mortality occurred. While IPNV infection was the primary driver of mortality after hatching, hybridization significantly affected early-stage survival, reinforcing the idea that hybridization itself may come at a cost to early survival in hybrids. The greater vulnerability of hybrids during incubation, coupled with their faster yolk sac resorption and accelerated development, suggests that hybridization itself may underlie species-specific survival differences.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec37\" class=\"Section2\"\u003e \u003ch2\u003e4.2. Biometric differences and developmental trajectories\u003c/h2\u003e \u003cp\u003eThe biometric analysis revealed significant differences in growth rate and yolk sac resorption between brook trout and hybrids. Compared with brook trout, hybrids grew faster, gained more weight and increased in length at a greater rate. This pattern aligns with their accelerated ontogenetic development, resembling the growth trajectory of rainbow trout, the maternal donor species. At early developmental stages (10 and 14 dph), hybrids displayed larger yolk sacs compared to brook trout, reflecting their initial metabolic strategy. However, by 21 dph, hybrids had completely depleted their yolk reserves, whereas brook trout, particularly those in the placebo and IPNV-infected groups, still retained visible yolk sacs.\u003c/p\u003e \u003cp\u003eThe delayed yolk sac absorption in IPNV-infected brook trout indicates that viral infection interferes with normal metabolic processes. Compared with controls, infected brook trout had significantly larger yolk sac areas at 14 and 21 dph, whereas hybrids presented no significant differences in yolk sac size between the infected and uninfected groups at later stages. This species-specific response suggests that infection disrupts metabolic resource utilization in brook trout, whereas hybrids, consequently due to their faster metabolic rate and earlier transition to exogenous feeding, may avoid prolonged metabolic interference.\u003c/p\u003e \u003cp\u003eNeither microinjection nor IPNV infection significantly affected overall larval growth, as no differences in mean weight or length were observed between the experimental groups, corroborating previous findings by Bootland et al. [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. However, morphological abnormalities, including spinal cord torsion, delayed yolk sac resorption, prognathism, and bicephaly were observed in the placebo and IPNV-infected groups. These developmental malformations are commonly associated with environmental stressors, viral infections, or reduced egg quality [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], and in our experimental setting, they may be related to the microinjection procedure. The absence of significant differences in overall biometric parameters suggests that infection primarily impacts energy metabolism and early development rather than directly altering somatic growth.\u003c/p\u003e \u003cp\u003eHistopathological analysis confirmed that there were no major structural abnormalities in tissues across the experimental groups. At 1 dph and 3 dph, a similar number of melanomacrophages and melanocyte-like cells was observed in the yolk sac region in all the groups, suggesting that there were no early infection-driven histological alterations. However, from 14 dph onwards, there was a notable increase in melanomacrophages and melanocyte-like cells in IPNV-infected groups, irrespective of species. This increase may indicate a localized immune response or pigment deposition as a reaction to viral infection, a phenomenon observed in other viral infections in fish [\u003cspan additionalcitationids=\"CR42\" citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. No further histopathological differences were detected, implying that the primary effects of IPNV infection were metabolic rather than structural during early development.\u003c/p\u003e \u003cp\u003eThe results of the biometric and histopathological analyses collectively indicate that hybrids exhibit a distinct metabolic and developmental trajectory compared with brook trout, characterized by faster yolk sac resorption, higher growth rates, and earlier transitions to exogenous feeding. While brook trout displayed prolonged reliance on yolk sac reserves, this strategy may provide a buffer against environmental stressors but also increase vulnerability to metabolic disruptions, such as those induced by IPNV infection. The presence of developmental malformations in the placebo and IPNV-infected groups suggests that both viral exposure and microinjection may contribute to embryonic stress, potentially impacting early survival. The histopathological response in the IPNV-infected groups, marked by increased melanomacrophages activity, suggests that the timing of immune activation differs between species, which may have implications for how each species responds to viral infections at later developmental stages.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec38\" class=\"Section2\"\u003e \u003ch2\u003e4.3. Gene expression and immune response timing\u003c/h2\u003e \u003cp\u003eThe gene expression analysis revealed species-specific differences in immune activation timing, with hybrids exhibiting a generally faster and more sustained immune response than brook trout do. These differences appear to be driven by differences in developmental pace, as both species followed similar immune activation trends but at different time points.\u003c/p\u003e \u003cp\u003eIL-6 expression was consistently greater in hybrids across all treatment groups and time points, suggesting earlier immune system maturation. This pattern aligns with the faster ontogenetic development of hybrids, reflecting a metabolic and immunological profile closer to that of their maternal donor species, rainbow trout. As IL-6 plays a key role in inflammatory regulation and immune system activation, its early and sustained upregulation in hybrids suggests greater baseline immune readiness than in brook trout.\u003c/p\u003e \u003cp\u003eIFN2 expression patterns further supported this hypothesis, as brook trout presented no detectable IFN2 expression before 7 dph, whereas hybrids presented low but continuous levels across all groups from the earliest time points. These findings suggest that hybrids may have an inherently more active antiviral defence system, enabling a quicker response to viral exposure. Despite this earlier immune activation, hybrids did not exhibit improved survival under IPNV infection, suggesting that earlier IFN2 presence alone does not necessarily translate into increased resistance.\u003c/p\u003e \u003cp\u003eIFNy expression was exclusive to IPNV-infected hybrids at 21 dph and was not detected in brook trout at any time point. This pattern suggests that the hybrid immune response may occur earlier, potentially reflecting differences in viral recognition or immune system maturity. The absence of IFNy in brook trout indicates a longer time to activate this mid-phase antiviral response.\u003c/p\u003e \u003cp\u003eThe late-stage expression of lysozyme type II at 21 dph in both species, regardless of treatment, suggests that this antimicrobial defence mechanism is linked to the developmental stage rather than infection status. This pattern indicates that a secondary immune response emerges as alevins transition to exogenous feeding, which may be essential for protection against bacterial infections in later developmental stages.\u003c/p\u003e \u003cp\u003eThe high variation in immune-related gene expression across different time points observed in this study is consistent with previous research, which has shown that inoculation route, target tissue, developmental stage, and clinical form of infection significantly affect immune response variability [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan additionalcitationids=\"CR45 CR46\" citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Additionally, fish exhibit substantial individual immune variation, further influencing gene expression patterns.\u003c/p\u003e \u003cp\u003eInnate immunity is considered the first line of defence against viral infections in fish, with the interferon (IFN) system playing a central role in antiviral responses [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. IPNV is known to interfere with IFN signalling, potentially suppressing early immune responses and facilitating viral persistence in infected fish [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. The delayed IFN2 response in brook trout compared with that in hybrids aligns with previous findings demonstrating viral immune evasion mechanisms.\u003c/p\u003e \u003cp\u003eOur results indicate that hybrids exhibit greater variability in immune responses than brook trout do, which is likely due to their faster immune system maturation. The consistently increased IL-6 expression in the hybrids supports this hypothesis, as IL-6 plays a key role in immune activation and inflammatory signalling. The earlier and broader presence of IFN2 in hybrids, compared with its delayed detection at 7 dph in brook trout, further suggests a more rapid immune activation process. However, the absence of clear survival benefits in hybrids suggests that the timing of immune activation alone is insufficient to increase resistance to IPNV.\u003c/p\u003e \u003cp\u003eIL-8 is critical for neutrophil recruitment, whereas TNFα is essential for initiating inflammatory defence mechanisms. The observed increase of TNFα expression in IPNV-infected brook trout suggests that viral infection may initially trigger proinflammatory responses, which could subsequently be dysregulated or suppressed at later stages, potentially compromising effective pathogen clearance. This suppression could contribute to reduced survival and increased disease susceptibility, as effective early inflammation is crucial for pathogen clearance.\u003c/p\u003e \u003cp\u003eOur findings suggest that hybrids may be better equipped to mount an earlier immune response because of their faster immune system development, which could have implications for disease resistance and aquaculture management strategies. The progressive increase in IFN2 and IFNy expression over time, similar to findings in other studies [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan additionalcitationids=\"CR45 CR46\" citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e], confirms that immune activation is closely linked to developmental progression. Given the significantly higher expression levels of these genes in hybrids, we conclude that the observed immune differences are largely due to their more advanced developmental stage. Future studies should investigate whether adjusting vaccination or infection timing in hybrid aquaculture could leverage their earlier immune maturation to enhance disease resistance.\u003c/p\u003e \u003cp\u003eOur findings, showing species-specific differences in survival and the immune response to IPNV, complement previous genetic studies in salmonids. Rodr\u0026iacute;guez et al. [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e] identified several candidate genes associated with IPNV resistance in rainbow trout, including those involved in immune regulation, such as IRF4, IL-8, and integrin beta-1. The differential expression of IL-6 and IFN2 observed in hybrid fish compared with brook trout suggests that early activation of certain immune pathways may not translate into increased survival\u0026mdash;a notion consistent with the complex genetic architecture of resistance highlighted by Rodr\u0026iacute;guez et al. Furthermore, the variability in survival and response observed in our hybrids underscores the findings of Moen et al. [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e], who reported a strong QTL in Atlantic salmon but noted its absence or reduced effect in rainbow trout. This finding reinforces the idea that resistance to IPNV is influenced by multiple loci and may be highly species-specific, thus complicating the use of interspecific hybridization as a universal strategy for enhancing resistance. Together, these results underscore the necessity for species- and context-specific approaches when considering genetic tools for disease resistance in aquaculture.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec39\" class=\"Section2\"\u003e \u003ch2\u003e4.4. Behavioural alterations\u003c/h2\u003e \u003cp\u003eThe behavioural analysis revealed significant differences in movement patterns, spatial preferences, and social interactions between brook trout and hybrids. These differences were further influenced by IPNV infection, suggesting a complex interplay between species-specific developmental trajectories, stress responses, and pathogen-induced behavioural alterations.\u003c/p\u003e \u003cdiv id=\"Sec40\" class=\"Section3\"\u003e \u003ch2\u003e4.4.1. Activity and mobility\u003c/h2\u003e \u003cp\u003eBrook trout exhibited greater overall movement, covering longer distances with higher mean velocities than hybrids did, which may be the result of less domestication than hybrids, which aligns with the findings of Bellinger et al. [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Moreover, early-stage larvae rely on increased spontaneous movements to stimulate neuromuscular development and distribute energy reserves. In contrast, hybrids exhibited significantly reduced movement across most time points, particularly in the control and placebo groups. This may reflect an adaptive strategy linked to faster yolk sac resorption and earlier transition to exogenous feeding, reducing unnecessary energy expenditure during the yolk-dependent phase.\u003c/p\u003e \u003cp\u003eIPNV infection significantly altered locomotor behaviour, particularly in brook trout. Infected individuals exhibited increased turn angles, angular velocity, and meandering, particularly at later time points. These disruptions in coordinated movement may indicate neurological impairment or metabolic stress induced by viral infection. The observed increase in angular velocity and erratic movement patterns in infected brook trout is consistent with studies showing that viral infection stressors can disrupt motor function in fish, leading to altered swimming trajectories and reduced control over movement [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. In contrast, infected hybrids presented greater acceleration, which may suggest a more reactive stress response, possibly linked to differences in immune activation timing or metabolic adjustments associated with viral exposure.\u003c/p\u003e \u003cp\u003eThe observed species-specific differences in locomotor activity suggest that hybrids may be more energy-conserving, whereas brook trout rely on greater movement as part of their developmental strategy. These findings are in line with studies demonstrating that species with distinct metabolic and growth rates exhibit different locomotor responses to environmental and physiological stressors [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec41\" class=\"Section3\"\u003e \u003ch2\u003e4.4.2. Spatial behaviour and zone preferences\u003c/h2\u003e \u003cp\u003eSignificant differences in spatial preferences were observed, with control and placebo-treated brook trout spending more time in the centre zone at earlier time points, whereas hybrids exhibited stronger peripheral zone preference. This difference in spatial occupation suggests a species-specific variation in thigmotaxis, which refers to an organism\u0026rsquo;s tendency to stay close to the periphery of an environment rather than exploring open areas. Infected brook trout exhibited a significant decrease in centre zone occupancy over time, indicating a shift toward increased avoidance behaviour, a pattern commonly associated with heightened anxiety or stress sensitivity in fish [\u003cspan additionalcitationids=\"CR57\" citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThigmotaxis is a well-documented behavioural marker of anxiety and stress responses in fish [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. The increased periphery occupancy in infected brook trout is in line with studies showing that viral infections can induce stress-related avoidance behaviour, which may have implications for their survival in natural or farmed environments. Reduced exploratory behaviour in infected individuals can decrease foraging efficiency and limit their ability to locate suitable habitats, ultimately impacting fitness and growth [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e, \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. In contrast, hybrids, which already exhibited a stronger periphery preference, presented fewer changes in spatial behaviour after infection, suggesting that their response to environmental stressors is inherently different. The results suggest that brook trout, which are more exploratory under normal conditions, exhibit a stronger behavioural shift under viral stress, whereas hybrids, which already show reduced centre occupancy, may have a more stable behavioural strategy that is less influenced by infection. These findings align with previous research demonstrating that stressors, including infection, alter fish exploratory behaviour, often leading to increased risk aversion and decreased movement into open spaces [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec42\" class=\"Section3\"\u003e \u003ch2\u003e4.4.3. Rotation and orientation\u003c/h2\u003e \u003cp\u003eIPNV-infected brook trout presented significantly increased clockwise and counterclockwise rotation frequencies at later time points. This finding suggests potential neurological impairments, as erratic rotational behaviour has been observed in fish experiencing viral-induced neuromuscular dysfunction. The observed rotational disruptions are consistent with findings in virus-infected fish exhibiting impaired vestibular and motor control [\u003cspan additionalcitationids=\"CR64\" citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. Interestingly, this effect was not observed in hybrids, indicating potential species-specific resilience to IPNV-induced neurological dysfunctions.\u003c/p\u003e \u003cp\u003eThe impact of viral infections on neuromuscular coordination has been studied in various fish species, with reports of increased turning frequency and erratic swimming in pathogen-exposed individuals [\u003cspan additionalcitationids=\"CR64\" citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. These behaviours are often linked to impairments in motor coordination and sensory processing, possibly due to viral interference with central nervous system function. The lack of rotational changes in hybrids suggests either a reduced neurological impact of the virus or compensatory mechanisms that mitigate its effects.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec43\" class=\"Section3\"\u003e \u003ch2\u003e4.4.4. Social interactions and group cohesion\u003c/h2\u003e \u003cp\u003eThe analysis of social interactions revealed significant differences in contact duration and avoidance behaviour between the species and treatment groups. Compared with brook trout, Infected and placebo hybrids presented significantly shorter cumulative contact times and increased time spent without contact. This suggests that hybrids may be inherently less social or that their stress response includes an avoidance strategy, potentially linked to their developmental differences.\u003c/p\u003e \u003cp\u003eBrook trout in the control groups presented significantly greater levels of social engagement, maintaining closer contact with conspecifics. However, infection led to a decrease in social interactions, a response commonly associated with stress-induced changes in behaviour. Similar trends have been observed in studies investigating the effects of environmental stressors on fish sociality, where increased stress levels correlate with reduced social cohesion and heightened avoidance behaviours [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe observed decrease in social interactions in infected groups has potential ecological implications, particularly in aquaculture settings where group cohesion can influence foraging efficiency, predator avoidance, and overall fitness. Studies suggest that maintaining stable social groups can buffer against stress and improve overall welfare in farmed fish [\u003cspan additionalcitationids=\"CR68 CR69 CR70 CR71 CR72 CR73\" citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e]. The differences in social engagement between species further highlight their contrasting behavioural strategies, with brook trout exhibiting stronger social tendencies that are disrupted under infection stress, while hybrids appear to be more socially reserved overall.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec44\" class=\"Section3\"\u003e \u003ch2\u003e4.4.5. Behavioural implications\u003c/h2\u003e \u003cp\u003eThe observed behavioural changes induced by IPNV infection may have significant ecological and aquaculture-related implications. The decrease in locomotor stability, increased avoidance behaviour, and reduced social interactions in infected brook trout suggest heightened vulnerability to environmental challenges, potentially reducing survival rates in natural and farmed settings. The greater behavioural stability observed in hybrids, despite their overall reduced movement, suggests potential advantages in terms of energy conservation and resistance to pathogen-induced stress.\u003c/p\u003e \u003cp\u003eThese findings align with research demonstrating that stress-induced behavioural changes in fish can affect their foraging success, competitive interactions, and predation risk [\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e, \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e]. Reduced movement and increased risk aversion may hinder infected fish from efficiently utilizing available resources, whereas disrupted social cohesion could impact their ability to maintain group-based anti-predator strategies.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eThis study provides a comprehensive analysis of experimental IPNV infection in the earliest developmental stages of brook trout and brook trout \u0026times; rainbow trout hybrids, allowing for a direct comparison of their survival, growth, immune response, and behavioural adaptations.\u003c/p\u003e \u003cp\u003eWe confirmed that modifications in the microinjection method improved egg survival during incubation, demonstrating its potential as a standardized approach for controlled viral exposure in experimental settings. However, the procedure also had long-term consequences for post-hatching development, contributing to morphological abnormalities. This highlights the need for careful evaluation of microinjection protocols in future studies to minimize unintended developmental disruptions.\u003c/p\u003e \u003cp\u003eHybridization was found to have a negative impact on early survival, with hybrid embryos exhibiting significantly higher mortality rates than brook trout during incubation. These findings suggest that hybridization itself imposes physiological stress during early ontogeny, likely due to differences in developmental timing inherited from the maternal species. However, after hatching, the hybrid survival rates did not significantly differ from those of brook trout, indicating that the vulnerability of hybrids is primarily restricted to the incubation period.\u003c/p\u003e \u003cp\u003eThe immune gene expression analysis revealed that hybrids presented earlier immune activation, with higher IL-6 expression levels and sustained IFN2 presence across developmental stages. However, this accelerated immune response did not translate into increased resistance to IPNV infection, as infected hybrids still presented high mortality rates, particularly at later time points. These findings suggest that while hybrids exhibit earlier immune maturation, their immune response efficiency may not be superior to that of brook trout. Instead, immune activation appears to be temporally shifted rather than fundamentally different, reinforcing the idea that the developmental pace plays a crucial role in infection dynamics.\u003c/p\u003e \u003cp\u003eIn terms of growth and metabolism, hybrids demonstrated faster yolk sac resorption and higher growth rates, resembling their maternal rainbow trout lineage. However, brook trout retained yolk sac reserves longer, particularly in the placebo and IPNV-infected groups, suggesting a more conservative energy utilization strategy. The presence of morphological abnormalities, such as spinal cord torsion and delayed yolk sac resorption in the infected groups further highlights the potential developmental trade-offs associated with early viral exposure and microinjection.\u003c/p\u003e \u003cp\u003eThe behavioural analysis revealed species-specific differences in locomotor activity, spatial behaviour, and social interactions, with brook trout exhibiting greater overall movement and exploratory tendencies, whereas hybrids presented reduced activity and stronger peripheral zone preferences. Infection with IPNV led to disruptions in motor coordination, increased avoidance behaviour, and reduced social interactions, particularly in brook trout, indicating an increased stress sensitivity to infection. In contrast, hybrids presented a more reactive stress response, with increased acceleration under infection stress, suggesting potential differences in how species perceive and respond to viral challenges.\u003c/p\u003e \u003cp\u003eOur findings have several important implications for aquaculture and disease management strategies. The high early mortality of hybrids suggests that breeding programs involving interspecific crosses should carefully evaluate incubation conditions and egg-handling procedures to maximize survival rates. The observed delayed immune activation in brook trout and earlier immune response in hybrids indicate that vaccination timing or infection management strategies should be tailored to the developmental schedule of each species to increase disease resistance.\u003c/p\u003e \u003cp\u003eFurthermore, the species-specific behavioural responses to infection suggest that brook trout may be more vulnerable to pathogen-induced stress, whereas hybrids might have a different stress-coping mechanism. This has potential implications for stocking density, environmental enrichment, and welfare monitoring in hatchery environments.\u003c/p\u003e \u003cp\u003eOverall, this study highlights the complex interactions among hybridization, developmental timing, immune responses, and behaviour in the context of viral infection. While hybridization leads to faster ontogenetic development, it does not necessarily confer enhanced resistance to IPNV and may impose greater early-life vulnerability. Future research should explore strategies for optimizing hybrid survival and immune response timing, particularly in the context of aquaculture production and disease prevention programs.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eAI\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eartificial intelligence\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eANOVA\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eanalysis of variance\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eCIs\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003econfidence intervals\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eDD\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003edegree-days\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003edpf\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003edays post-fertilization\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003edph\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003edays post-hatching\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eHE\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ehaematoxylin-eosin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eHR\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ehazard ratios\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eIFN\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003einterferon\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eIHN\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eInfectious Hematopoietic Necrosis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eIPNV\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eInfectious Pancreatic Necrosis Virus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eML\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003emachine learning\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eTCID₅₀\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003etissue culture infective dose\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eTukey\u0026rsquo;s HSD\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTukey's Honestly Significant Difference\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eVHS\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eViral Haemorrhagic Septicaemia\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved by the Local Ethics Committee for Animal Experiments in Olsztyn, Certificate No. 61/2018, 31.07.2018, and was compliant with Directive 2010/63/EU and recommendations of the Federation of European Laboratory Animal Science Associations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated and analysed during the current study are available in the Repository for Open Data: Duk, Karolina, 2025, \"Induction of Infectious Pancreatic Necrosis (IPN) in brook trout (\u003cem\u003eSalvelinus fontinalis\u003c/em\u003e) and rainbow brook trout (\u003cem\u003eSalvelinus fontinalis\u003c/em\u003e x \u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) using microinjection challenge with infectious pancreatic necrosis virus (IPNV)\", https://doi.org/10.18150/ZN2W47, RepOD, V1, CC BY 4.0\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing interests or personal relationships that could have appeared to influence the work reported in this paper\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded in whole by the National Science Centre, Poland, grant number 2017/25/N/NZ9/00267: “Induction of Infectious Pancreatic Necrosis (IPN) in brook trout (\u003cem\u003eSalvelinus fontinalis\u003c/em\u003e) and rainbow brook trout (\u003cem\u003eSalvelinus fontinalis\u003c/em\u003e x \u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) using microinjection challenge with infectious pancreatic necrosis virus (IPNV)” and conducted at the Department of Pathophysiology, Forensic Veterinary Medicine and Administration, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, Poland. Publication was funded by the Minister of Science under the Regional Initiative of Excellence Program.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eKD: funding acquisition, conceptualization, methodology, investigation, formal analysis, writing - original draft. PS: investigation, writing - review \u0026amp; editing. JPC: investigation, writing - review \u0026amp; editing. MCK: methodology, resources, writing - review \u0026amp; editing. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors wish to thank prof. Michał Reichert and National Veterinary Research Institute – State Research Institute for providing the viruses used in the fish challenge; Jacek Juchniewicz and all the staff from the Dabie hatchery for providing the experimental eggs; dr Anna Wiśniewska for professional transport of eggs and prof. Krzysztof Wąsowicz from Department of Pathophysiology, Forensic Veterinary Medicine and Administration, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, for enabling the facilities used in the challenge.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Generative AI and AI-Assisted Technologies in the Writing Process\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDuring the preparation of this work, the authors used \u003cem\u003eCurie’s AI\u003c/em\u003e for language editing and \u003cem\u003eChatGPT (OpenAI)\u003c/em\u003e in order to assist with language refinement, structural organization, and consistency checks of the manuscript. The tool was also utilized for summarizing and synthesizing relevant literature, ensuring clarity, and improving the readability of the text. After using this tool, the authors thoroughly reviewed and edited the content as needed and take full responsibility for the accuracy, originality, and integrity of the published article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eMunro ES, Midtlyng PJ. Infectious pancreatic necrosis and associated aquatic birnaviruses. In: Woo PTK, Bruno DW, editors. Fish Diseases and Disorders, Vol. 3: Viral, Bacterial, and Fungal Infections. London: CABI International; 2011. p. 1\u0026ndash;65.\u003c/li\u003e\n \u003cli\u003eBarrera-Mej\u0026iacute;a M, Mart\u0026iacute;nez S, Ortega C, Ulloa-Arvizu R. Genotyping of infectious pancreatic necrosis virus isolates from Mexico state. J Aquat Anim Health. 2011;23:200\u0026ndash;6.\u003c/li\u003e\n \u003cli\u003eTapia D, Kuznar J, Farlora R, Y\u0026aacute;\u0026ntilde;ez JM. Differential transcriptomic response of rainbow trout to infection with two strains of IPNV. Viruses. 2021;14:21.\u003c/li\u003e\n \u003cli\u003eBootland L, Dobos P, Stevenson R. The IPNV carrier state and demonstration of vertical transmission in experimentally infected brook trout. Dis Aquat Organ. 1991;10:13\u0026ndash;21.\u003c/li\u003e\n \u003cli\u003eReyes-Cerpa S, Reyes-L\u0026oacute;pez F, Toro-Ascuy D, Montero R, Maisey K, Acu\u0026ntilde;a-Castillo C, et al. Induction of anti-inflammatory cytokine expression by IPNV in persistent infection. Fish Shellfish Immunol. 2014;41.\u003c/li\u003e\n \u003cli\u003eDorson M, Chevassus B, Torhy C. Comparative susceptibility of three species of char and of rainbow trout x char triploid hybrids to several pathogenic salmonid viruses. Dis Aquat Organ. 1991;11:217\u0026ndash;24.\u003c/li\u003e\n \u003cli\u003eDove S. Innate antiviral-like immune responses differ among divergent European and North American farmed and wild Atlantic salmon (\u003cem\u003eSalmo salar\u003c/em\u003e) and their hybrids. Master thesis. Memorial University of Newfoundland; 2022.\u003c/li\u003e\n \u003cli\u003eKlemme I, Hendrikx L, Ashrafi R, Sundberg L-R, R\u0026auml;ih\u0026auml; V, Piironen J, et al. Opposing health effects of hybridization for conservation. Conserv Sci Pract. 2021;3:e379.\u003c/li\u003e\n \u003cli\u003eMateus AP, Power DM, Can\u0026aacute;rio AVM. Chapter 8 - Stress and disease in fish. In: Jeney G, editor. Fish Diseases. Academic Press; 2017. p. 187\u0026ndash;220.\u003c/li\u003e\n \u003cli\u003ePetitjean Q, Jean S, Gandar A, C\u0026ocirc;te J, Laffaille P, Jacquin L. Stress responses in fish: from molecular to evolutionary processes. Sci Total Environ. 2019;684:371\u0026ndash;80.\u003c/li\u003e\n \u003cli\u003eVargas-Chacoff L, Mu\u0026ntilde;oz JLP, Saravia J, Oyarz\u0026uacute;n R, Pontigo JP, Gonz\u0026aacute;lez MP, et al. Neuroendocrine stress response in Atlantic salmon (\u003cem\u003eSalmo salar\u003c/em\u003e) and coho salmon (\u003cem\u003eOncorynchus kisutch\u003c/em\u003e) during sea lice infestation. Aquaculture. 2019;507:329\u0026ndash;40.\u003c/li\u003e\n \u003cli\u003eNyg\u0026aring;rd TA, Jahren JH, Schellewald C, Stahl A. Motion trajectory estimation of salmon using stereo vision. IFAC-Pap. 2022;55:363\u0026ndash;8.\u003c/li\u003e\n \u003cli\u003eCui M, Liu X, Liu H, Zhao J, Li D, Wang W. Fish tracking, counting, and behaviour analysis in digital aquaculture: a comprehensive survey. Rev Aquac. 2025;17:e13001.\u003c/li\u003e\n \u003cli\u003eKawamura G, Bagarinao TU, Seng LL. Fish behaviour and aquaculture. In: Aquaculture Ecosystems. 1st edition. John Wiley \u0026amp; Sons, Ltd; 2015. p. 68\u0026ndash;106.\u003c/li\u003e\n \u003cli\u003eWiese TR, Rey Planellas S, Betancor M, Haskell M, Jarvis S, Davie A, et al. Qualitative behavioural assessment as a welfare indicator for farmed Atlantic salmon (\u003cem\u003eSalmo salar\u003c/em\u003e) in response to a stressful challenge. Front Vet Sci. 2023;10.\u003c/li\u003e\n \u003cli\u003eLi D, Li X, Wang Q, Hao Y. Advanced techniques for the intelligent diagnosis of fish diseases: a review. Animals. 2022;12:2938.\u003c/li\u003e\n \u003cli\u003eLeitritz E, Lewis RC. Trout and salmon culture (hatchery methods). rev. ed. o.O: Univ. of California; 1980.\u003c/li\u003e\n \u003cli\u003eDuk K, Schulz P, Podlasz P, Siwicki AK. Egg microinjections \u0026ndash; method experimental viral infections in brook trout \u003cem\u003eSalvelinus fontinalis\u003c/em\u003e (Mitchill, 1815) and rainbow brook trout \u003cem\u003eSalvelinus fontinalis\u003c/em\u003e ♂ \u0026times; \u003cem\u003eOncorhynchus mykiss\u003c/em\u003e ♀. Fish Aquat Life. 2022;30:169\u0026ndash;74.\u003c/li\u003e\n \u003cli\u003eFournie JW, Krol RM, Hawkins WE. Fixation of fish tissues. In: Ostrander GK, editor. The Laboratory Fish. New York: Academic Press; 2000. p. 569\u0026ndash;78.\u003c/li\u003e\n \u003cli\u003eBancroft JD, Layton C. The hematoxylins and eosin. In: Suvarna SK, Layton C, Bancroft JD, editors. Bancroft\u0026rsquo;s Theory and Practice of Histological Techniques. Elsevier; 2019. p. 126\u0026ndash;38.\u003c/li\u003e\n \u003cli\u003eR Core Team. R: a language and environment for statistical computing. 2024.\u003c/li\u003e\n \u003cli\u003ePosit team. RStudio: integrated development environment for R. 2024.\u003c/li\u003e\n \u003cli\u003eWickham H, Fran\u0026ccedil;ois R, Henry L, M\u0026uuml;ller K, Vaughan D. dplyr: a grammar of data manipulation. https://CRAN.R-project.org/package=dplyr. 2023.\u003c/li\u003e\n \u003cli\u003eKassambara A, Kosinski M, Biecek P. survminer: drawing survival curves using \u0026ldquo;ggplot2.\u0026rdquo; https://rpkgs.datanovia.com/survminer/index.html. 2021.\u003c/li\u003e\n \u003cli\u003ePatil I. Visualizations with statistical details: the \u0026ldquo;ggstatsplot\u0026rdquo; approach. J Open Source Softw. 2021;6:3167.\u003c/li\u003e\n \u003cli\u003eGu Z, Eils R, Schlesner M. Complex heatmaps reveal patterns and correlations in multidimensional genomic data. Bioinformatics. 2016;32:2847\u0026ndash;9.\u003c/li\u003e\n \u003cli\u003eHothorn T, Bretz F, Westfall P. Simultaneous inference in general parametric models. Biom J Biom Z. 2008;50:346\u0026ndash;63.\u003c/li\u003e\n \u003cli\u003eBlanc JM, Chevassus B. Interspecific hybridization of salmonid fish. Aquaculture. 1979;18:21\u0026ndash;34.\u003c/li\u003e\n \u003cli\u003eHoitsy G, Woyn\u0026aacute;rovich A, Moth-Poulsen T. Guide to the small scale artificial propagation of trout. Budapest; 2012.\u003c/li\u003e\n \u003cli\u003eChevassus B, Dorson M. Genetics of resistance to disease in fishes. Aquaculture. 1990;85:83\u0026ndash;107.\u003c/li\u003e\n \u003cli\u003eLaPatra SE, Lauda KA, Jones GR, Shewmaker WD, Groff JM, Routledge D. Susceptibility and humoral response of brown trout x lake trout hybrids to infectious hematopoietic necrosis virus: a model for examining disease resistance mechanisms. Aquaculture. 1996;146:179\u0026ndash;88.\u003c/li\u003e\n \u003cli\u003eOgut H, Altuntas C. Virulence of Viral Haemorrhagic Septicaemia Virus (VHSV) genotype Ie on fry of three trout species: black sea trout (\u003cem\u003eSalmo trutta labrax\u003c/em\u003e), rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) and brook trout (\u003cem\u003eSalvelinus fontinalis\u003c/em\u003e). Bull Eur Assoc Fish Pathol. 2011;31:139\u0026ndash;46.\u003c/li\u003e\n \u003cli\u003eParsons JE, Busch RA, Thorgaard GH, Scheerer PD. Increased resistance of triploid rainbow trout \u0026times; coho salmon hybrids to infectious hematopoietic necrosis virus. Aquaculture. 1986;57:337\u0026ndash;43.\u003c/li\u003e\n \u003cli\u003eMcKay LR, Ihssen PE, McMillan I. Early mortality of tiger trout (\u003cem\u003eSalvelinus fontinalis\u003c/em\u003e \u0026times; \u003cem\u003eSalmo trutta\u003c/em\u003e) and the effects of triploidy. Aquaculture. 1992;102:43\u0026ndash;54.\u003c/li\u003e\n \u003cli\u003eMcKay LR, Ihssen PE, McMillan I. Growth and mortality of diploid and triploid tiger trout (\u003cem\u003eSalmo trutta\u003c/em\u003e \u0026times; \u003cem\u003eSalvelinus fontinalis\u003c/em\u003e). Aquaculture. 1992;106:239\u0026ndash;51.\u003c/li\u003e\n \u003cli\u003eBlanc JM, Chevassus B. Interspecific hybridization of salmonid fish: II. Survival and growth up to the 4th month after hatching in F1 generation hybrids. Aquaculture. 1982;29:383\u0026ndash;7.\u003c/li\u003e\n \u003cli\u003eMetcalfe CD, Sonstegard RA. Microinjection of carcinogens into rainbow trout embryos: an In vivo carcinogenesis Assay2. JNCI J Natl Cancer Inst. 1984;73:1125\u0026ndash;32.\u003c/li\u003e\n \u003cli\u003eRoberts RJ, Pearson MD. Infectious pancreatic necrosis in Atlantic salmon, \u003cem\u003eSalmo salar\u003c/em\u003e L. J Fish Dis. 2005;28:383\u0026ndash;90.\u003c/li\u003e\n \u003cli\u003eAegerter S, Jalabert B, Bobe J. Large scale real-time PCR analysis of mRNA abundance in rainbow trout eggs in relationship with egg quality and post-ovulatory ageing. Mol Reprod Dev. 2005;72:377\u0026ndash;85.\u003c/li\u003e\n \u003cli\u003eValenzuela AE, Silva VM, Klempau AE. Qualitative and quantitative effects of constant light photoperiod on rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) peripheral blood erythrocytes. Aquaculture. 2006;251:596\u0026ndash;602.\u003c/li\u003e\n \u003cli\u003eKittilsen S, Schjolden J, Beitnes-Johansen I, Shaw JC, Pottinger TG, S\u0026oslash;rensen C, et al. Melanin-based skin spots reflect stress responsiveness in salmonid fish. Horm Behav. 2009;56:292\u0026ndash;8.\u003c/li\u003e\n \u003cli\u003eSvitačov\u0026aacute; K, Slav\u0026iacute;k O, Hork\u0026yacute; P. Pigmentation potentially influences fish welfare in aquaculture. Appl Anim Behav Sci. 2023;262:105903.\u003c/li\u003e\n \u003cli\u003eVissio PG, Darias MJ, Di Yorio MP, P\u0026eacute;rez Sirkin DI, Delgadin TH. Fish skin pigmentation in aquaculture: the influence of rearing conditions and its neuroendocrine regulation. Gen Comp Endocrinol. 2021;301:113662.\u003c/li\u003e\n \u003cli\u003eIngerslev H-C, R\u0026oslash;nneseth A, Pettersen EF, Wergeland HI. Differential expression of immune genes in Atlantic salmon (\u003cem\u003eSalmo salar\u0026nbsp;\u003c/em\u003eL.) challenged intraperitoneally or by cohabitation with IPNV. Scand J Immunol. 2009;69:90\u0026ndash;8.\u003c/li\u003e\n \u003cli\u003eMcBeath AJA, Snow M, Secombes CJ, Ellis AE, Collet B. Expression kinetics of interferon and interferon-induced genes in Atlantic salmon (\u003cem\u003eSalmo salar\u003c/em\u003e) following infection with Infectious Pancreatic Necrosis Virus and Infectious Salmon Anaemia Virus. Fish Shellfish Immunol. 2007;22:230\u0026ndash;41.\u003c/li\u003e\n \u003cli\u003eReyes-Cerpa S, Reyes-L\u0026oacute;pez FE, Toro-Ascuy D, Iba\u0026ntilde;ez J, Maisey K, Sandino AM, et al. IPNV modulation of pro and anti-inflammatory cytokine expression in Atlantic salmon might help the establishment of infection and persistence. Fish Shellfish Immunol. 2012;32:291\u0026ndash;300.\u003c/li\u003e\n \u003cli\u003eReyes-L\u0026oacute;pez FE, Romeo JS, Vallejos-Vidal E, Reyes-Cerpa S, Sandino AM, Tort L, et al. Differential immune gene expression profiles in susceptible and resistant full-sibling families of Atlantic salmon (\u003cem\u003eSalmo salar\u003c/em\u003e) challenged with Infectious Pancreatic Necrosis Virus (IPNV). Dev Comp Immunol. 2015;53:210\u0026ndash;21.\u003c/li\u003e\n \u003cli\u003eRobertsen B. The interferon system of teleost fish. Fish Shellfish Immunol. 2006;20:172\u0026ndash;91.\u003c/li\u003e\n \u003cli\u003eLauksund S, Greiner-Tollersrud L, Chang CJ, Robertsen B. Infectious pancreatic necrosis virus proteins VP2, VP3, VP4 and VP5 antagonize IFNa1 promoter activation while VP1 induces IFNa1. Virus Res. 2015;196:113\u0026ndash;21.\u003c/li\u003e\n \u003cli\u003eSkjesol A, Aamo T, Hegseth MN, Robertsen B, J\u0026oslash;rgensen JB. The interplay between infectious pancreatic necrosis virus (IPNV) and the IFN system: IFN signaling is inhibited by IPNV infection. Virus Res. 2009;143:53\u0026ndash;60.\u003c/li\u003e\n \u003cli\u003eRodr\u0026iacute;guez FH, Flores-Mara R, Yoshida GM, Barr\u0026iacute;a A, Jedlicki AM, Lhorente JP, et al. Genome-Wide Association Analysis for Resistance to Infectious Pancreatic Necrosis Virus Identifies Candidate Genes Involved in Viral Replication and Immune Response in Rainbow Trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e). G3 Bethesda Md. 2019;9:2897\u0026ndash;904.\u003c/li\u003e\n \u003cli\u003eMoen T, Baranski M, Sonesson AK, Kj\u0026oslash;glum S. Confirmation and fine-mapping of a major QTL for resistance to infectious pancreatic necrosis in Atlantic salmon (\u003cem\u003eSalmo salar\u003c/em\u003e): population-level associations between markers and trait. BMC Genomics. 2009;10:368.\u003c/li\u003e\n \u003cli\u003eBellinger KL, Thorgaard GH, Carter PA. Domestication is associated with reduced burst swimming performance and increased body size in clonal rainbow trout lines. Aquaculture. 2014;420\u0026ndash;421:154\u0026ndash;9.\u003c/li\u003e\n \u003cli\u003eFu C-W, Horng J-L, Chou M-Y. Fish behavior as a neural proxy to reveal physiological states. Front Physiol. 2022;13:937432.\u003c/li\u003e\n \u003cli\u003eMadaro A, Olsen RE, Kristiansen TS, Ebbesson LOE, Flik G, Gorissen M. A comparative study of the response to repeated chasing stress in Atlantic salmon (\u003cem\u003eSalmo salar\u003c/em\u003e L.) parr and post-smolts. Comp Biochem Physiol A Mol Integr Physiol. 2016;192:7\u0026ndash;16.\u003c/li\u003e\n \u003cli\u003eBlaser RE, Chadwick L, McGinnis GC. Behavioral measures of anxiety in zebrafish (\u003cem\u003eDanio rerio\u003c/em\u003e). Behav Brain Res. 2010;208:56\u0026ndash;62.\u003c/li\u003e\n \u003cli\u003eCollier AD, Kalueff AV, Echevarria DJ. Zebrafish models of anxiety-like behaviors. In: Kalueff AV, editor. The Rights and Wrongs of Zebrafish: Behavioral Phenotyping of Zebrafish. Cham: Springer International Publishing; 2017. p. 45\u0026ndash;72.\u003c/li\u003e\n \u003cli\u003eSchn\u0026ouml;rr SJ, Steenbergen PJ, Richardson MK, Champagne DL. Measuring thigmotaxis in larval zebrafish. Behav Brain Res. 2012;228:367\u0026ndash;74.\u003c/li\u003e\n \u003cli\u003eEgan RJ, Bergner CL, Hart PC, Cachat JM, Canavello PR, Elegante MF, et al. Understanding behavioral and physiological phenotypes of stress and anxiety in zebrafish. Behav Brain Res. 2009;205:38\u0026ndash;44.\u003c/li\u003e\n \u003cli\u003eAhmad F, Richardson MK. Exploratory behaviour in the open field test adapted for larval zebrafish: impact of environmental complexity. Behav Processes. 2013;92:88\u0026ndash;98.\u003c/li\u003e\n \u003cli\u003eGraham C, von Keyserlingk MAG, Franks B. Free-choice exploration increases affiliative behaviour in zebrafish. Appl Anim Behav Sci. 2018;203:103\u0026ndash;10.\u003c/li\u003e\n \u003cli\u003eBuenhombre J, Daza-Cardona EA, Sousa P, Gouveia A. Different influences of anxiety models, environmental enrichment, standard conditions and intraspecies variation (sex, personality and strain) on stress and quality of life in adult and juvenile zebrafish: a systematic review. Neurosci Biobehav Rev. 2021;131:765\u0026ndash;91.\u003c/li\u003e\n \u003cli\u003eChapman JM, Kelly LA, Teffer AK, Miller KM, Cooke SJ. Disease ecology of wild fish: opportunities and challenges for linking infection metrics with behaviour, condition, and survival. Can J Fish Aquat Sci. 2021;78:995\u0026ndash;1007.\u003c/li\u003e\n \u003cli\u003eMojzesz M, Widziolek M, Adamek M, Orzechowska U, Podlasz P, Prajsnar TK, et al. Tilapia lake virus-induced neuroinflammation in zebrafish: microglia activation and sickness behavior. Front Immunol. 2021;12.\u003c/li\u003e\n \u003cli\u003eMu\u0026ntilde;oz D, Fuentes R, Carnicero B, Aguilar A, Sanhueza N, San-Martin S, et al. Viral Infection Drives the Regulation of Feeding Behavior Related Genes in\u003cem\u003e\u0026nbsp;Salmo salar\u003c/em\u003e. Int J Mol Sci. 2021;22:11391.\u003c/li\u003e\n \u003cli\u003eEngeszer RE, Ryan MJ, Parichy DM. Learned social preference in zebrafish. Curr Biol. 2004;14:881\u0026ndash;4.\u003c/li\u003e\n \u003cli\u003eCastanheira MF, Concei\u0026ccedil;\u0026atilde;o LEC, Millot S, Rey S, B\u0026eacute;gout M-L, Damsg\u0026aring;rd B, et al. Coping styles in farmed fish: consequences for aquaculture. Rev Aquac. 2017;9:23\u0026ndash;41.\u003c/li\u003e\n \u003cli\u003eCavallino L, Rinc\u0026oacute;n L, Scaia MF. Social behaviors as welfare indicators in teleost fish. Front Vet Sci. 2023;10.\u003c/li\u003e\n \u003cli\u003eGilmour KM, DiBattista JD, Thomas JB. Physiological causes and consequences of social status in salmonid fish. Integr Comp Biol. 2005;45:263\u0026ndash;73.\u003c/li\u003e\n \u003cli\u003eKorzan WJ, Summers CH. Evolution of stress responses refine mechanisms of social rank. Neurobiol Stress. 2021;14:100328.\u003c/li\u003e\n \u003cli\u003eKrause J, Butlin RK, Peuhkuri N, Pritchard VL. The social organization of fish shoals: a test of the predictive power of laboratory experiments for the field. Biol Rev Camb Philos Soc. 2000;75:477\u0026ndash;501.\u003c/li\u003e\n \u003cli\u003e\u0026Oslash;verli \u0026Oslash;, Korzan WJ, H\u0026ouml;glund E, Winberg S, Bollig H, Watt M, et al. Stress coping style predicts aggression and social dominance in rainbow trout. Horm Behav. 2004;45:235\u0026ndash;41.\u003c/li\u003e\n \u003cli\u003eRuiz-Gomez M de L, Kittilsen S, H\u0026ouml;glund E, Huntingford FA, S\u0026oslash;rensen C, Pottinger TG, et al. Behavioral plasticity in rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) with divergent coping styles: when doves become hawks. Horm Behav. 2008;54:534\u0026ndash;8.\u003c/li\u003e\n \u003cli\u003eSchjolden J, Backstr\u0026ouml;m T, Pulman KGT, Pottinger TG, Winberg S. Divergence in behavioural responses to stress in two strains of rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) with contrasting stress responsiveness. Horm Behav. 2005;48:537\u0026ndash;44.\u003c/li\u003e\n \u003cli\u003eArchard GA, Earley RL, Hanninen AF, Braithwaite VA. Correlated behaviour and stress physiology in fish exposed to different levels of predation pressure. Funct Ecol. 2012;26:637\u0026ndash;45.\u003c/li\u003e\n \u003cli\u003eRoberts LJ, Taylor J, Garcia de Leaniz C. Environmental enrichment reduces maladaptive risk-taking behavior in salmon reared for conservation. Biol Conserv. 2011;144:1972\u0026ndash;9.\u003c/li\u003e\n \u003cli\u003eWang C, Su B, Lu S, Han S, Jiang H, Li Z, et al. Effects of glutathione on growth, intestinal antioxidant capacity, histology, gene expression, and microbiota of juvenile triploid\u003cem\u003e\u0026nbsp;Oncorhynchus mykiss\u003c/em\u003e. Front Physiol. 2021;12:784852.\u003c/li\u003e\n \u003cli\u003eGaleotti M, Orioles M, Sacc\u0026agrave; E, Byadgi O, Pesaro S, Di Cerbo A, et al. Understanding the pathogenesis of red mark syndrome in rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) through an integrated morphological and molecular approach. Anim Open Access J MDPI. 2023;13.\u003c/li\u003e\n \u003cli\u003eCastro R, Zou J, Secombes CJ, Martin SAM. Cortisol modulates the induction of inflammatory gene expression in a rainbow trout macrophage cell line. Fish Shellfish Immunol. 2011;30:215\u0026ndash;23.\u003c/li\u003e\n \u003cli\u003eYarahmadi P, Miandare HK, Fayaz S, Caipang CMA. Increased stocking density causes changes in expression of selected stress- and immune-related genes, humoral innate immune parameters and stress responses of rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e). Fish Shellfish Immunol. 2016;48:43\u0026ndash;53.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Fish egg microinjections, Trout hybrids, Infectious Pancreatic Necrosis Virus (IPNV), Survival analysis, Behavioural response, Viral susceptibility, Salmonid hybridization, Survival analysis, Aquaculture pathology, Non-invasive diagnostics","lastPublishedDoi":"10.21203/rs.3.rs-6550822/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6550822/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eViral infections remain a persistent challenge in salmonid aquaculture, with infectious pancreatic necrosis virus (IPNV) causing substantial economic losses worldwide. Interspecific crossbreeding has been explored as a strategy to increase disease resistance, but its effectiveness remains uncertain.\u003c/p\u003e \u003cp\u003eIn this study, brook trout (\u003cem\u003eSalvelinus fontinalis\u003c/em\u003e) and brook trout \u0026times; rainbow trout hybrids (\u003cem\u003eS. fontinalis\u003c/em\u003e \u0026times; \u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) were experimentally infected with IPNV via a microinjection method to compare species-specific responses. Survival was assessed via Kaplan-Meier curves and Cox models. Behavioural changes, including locomotion, spatial preference, and social interactions, were analysed via automated tracking software. Gene expression of selected immune markers (IL-1β, IL-6, IL-8, TNFα, IFN2, IFNγ, and lysozyme type II) was quantified via RT-qPCR. Growth and morphological abnormalities were also examined to evaluate the physiological effects of infection.\u003c/p\u003e \u003cp\u003eThe survival of hybrid embryos decreased during incubation, suggesting increased vulnerability to developmental stressors. IPNV infection significantly increased post-hatching mortality, particularly in brook trout. Infection also altered behaviour in a species-specific manner: infected brook trout demonstrated erratic movement, avoidance behaviours, and reduced social interaction, whereas hybrids maintained more stable but reactive patterns. Gene expression profiling revealed that hybrids presented earlier immune activation, notably of IL-6 and IFN2, without improved survival.\u003c/p\u003e \u003cp\u003eThese findings indicate that interspecific hybridization does not confer consistent resistance to viral pathogens. The behavioural alterations observed during infection may serve as early indicators of disease, supporting their potential for real-time health monitoring in aquaculture. This study highlights important trade-offs between developmental acceleration and immune adaptation, with implications for hybrid viability and fish welfare management.\u003c/p\u003e","manuscriptTitle":"Experimental Infectious Pancreatic Necrosis Virus infection via egg microinjection: effects on survival, behaviour, and early immune response in brook trout (Salvelinus fontinalis) and brook trout × rainbow trout hybrids (S. fontinalis × Oncorhynchus mykiss)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-06 09:26:05","doi":"10.21203/rs.3.rs-6550822/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"88caaa35-9167-47a0-aa74-d13cf27ac2ab","owner":[],"postedDate":"May 6th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-24T08:13:53+00:00","versionOfRecord":[],"versionCreatedAt":"2025-05-06 09:26:05","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6550822","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6550822","identity":"rs-6550822","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}