CCR1 Signaling as a Common Injury Pathway in Retinal Degeneration

CCR1 Signaling as a Common Injury Pathway in Retinal Degeneration | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Case Report CCR1 Signaling as a Common Injury Pathway in Retinal Degeneration Sarah Elbaz-Hayoun, Shlomit Jaskoll, Adi Kramer, Lian Omari, Batya Rinsky, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8775900/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 12 You are reading this latest preprint version Abstract Inflammation is a key driver of atrophic Age-Related Macular Degeneration (aAMD), and also plays a role in Inherited Retinal Degenerations (IRDs), two major causes of irreversible visual loss. We previously demonstrated that the chemokine receptor CCR1 is upregulated in monocytes from AMD patients, and that it mediates the recruitment of neurotoxic macrophages and activates Müller glial cells in rodent model of photic retinal injury. Here we report that CCR1 is expressed in Müller glia in eyes affected by AMD and that variants in CCR1 are potentially associated with the rate of macular atrophy progression in AMD. We also show that Ccr1 deletion is associated with reduced inflammation, and with rescue of photoreceptor integrity and function in Crb1 rd8/rd8 mice and in Pde6b rd10 mice, two models of genetically-driven retinal degeneration. Finally, we demonstrate that treatment with small molecule CCR1 antagonists delayed photoreceptor loss in Pde6b rd10 mice. These data suggest that CCR1 is a mediator of retinal inflammation and injury in different forms of retinal degeneration, and that CCR1 may serve as a novel therapeutic target for atrophic AMD and IRDs. Rd8 mutation Rd10 mutation Ccr1 deletion CCR1 inhibition Müller cell Retinal degeneration Microglial activation Gliosis Small molecule Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Age-related macular degeneration (AMD) is the leading cause of blindness in the Western world, affecting ~ 30% of individuals aged ≥ 75 years, or ~ 196 million individuals globally 1 . With increasing life expectancy, the prevalence of AMD is expected to further rise. AMD has two main forms: non-neovascular (nnvAMD) and neovascular (nAMD). The non-neovascular form is marked by drusen deposits under the photoreceptors or retinal pigment epithelium (RPE), and may progress to confluent areas of atrophy, involving the RPE and photoreceptor layers, leading to substantial visual loss. nAMD involves the development of abnormal choroidal or retinal blood vessel, and if untreated often leads to marked vision loss 2 . While effective therapies are available for nAMD, the therapeutic options for the more common nnvAMD form are limited and are associated with insufficient efficacy and significant complications 3 . Multiple risk factors, such as older age, genetic predispositions, lipid metabolism alterations, and lifestyle, were associated with the initiation and progression of atrophy in AMD 4 . Inflammation was also shown to have a major role in AMD development 5 . Specifically, activation of the complement cascade and the inflammasome, as well as mononuclear cells activation were associated with AMD development and progression 6 . Mononuclear cells were detected at the vicinity of AMD atrophic and neovascular lesions 7 – 10 , and chemokine signaling, particularly the CCL2/CCR2 and CX3CL1/CX3CR1 pathways were associated with recruitment of monocytes during AMD progression. Increased CCL2 level was reported in the aqueous humor in AMD 11 , and we have previously reported of specific signature of monocyte gene expression in AMD patients, including elevated expression of CCR1 and CCR2 compared to healthy controls 12 . A total of 22 chemokine receptors have been identified in humans, classified into four families based on the spacing of cysteine residues in their amino acid sequences 13 . The CCR1 receptor was the first human CC chemokine receptor to be discovered and, like all other chemokine receptors, it signals through a G protein-coupled receptor (GPCR) mechanism 14 . It is expressed on various hematopoietic cells, including lymphocytes, monocytes, and dendritic cells, where it mediates several biological functions related to leukocyte infiltration 15 – 19 . Our previous work identified CCR1 as a potential significant player in retinal degeneration. Notably, we identified CCR1 expression on activated Müller glia cells during the course of retinal degeneration in mice 20 . Müller macroglia cells spans the neurosensory retinal layers, and have both structural roles and multiple regulatory roles that are crucial for maintaining retinal homeostasis 21 , 22 . In our previous study, pharmacological inhibition of CCR1 led to reduced retinal damage following photic injury in mice 20 . A recent transcriptome-wide analysis has revealed differential expression of CCR1 and CCR5 in the retina of AMD patients compared to healthy controls further implicating CCR1 in the disease 23 . Yet, the potential role of CCR1 in AMD and other retinal degenerative diseases has not been extensively investigated, and a comprehensive view of its involvement in the disease is lacking. Here we investigated the contribution of CCR1 to AMD and IRDs progression. To that end, we characterized the expression of CCR1 in human AMD retina sections and performed genotype-phenotype analysis to assess potential correlation between CCR1 variants and macular atrophy (MA) progression. We also crossed Crb1 rd8/rd8 mice and Pde6b rd10 mice with Ccr1 deficient mice to facilitate assessment of the impact of CCR1 loss of function on retinal structure, immune cell infiltration, and the retinal degeneration process. We then tested the effect of CCR1 antagonists in Pde6b rd10 mice to further validate the role of CCR1 in retinal degeneration. Combined, these experiments provided further support to the role of CCR1 signaling in retinal and macular degeneration. Materials and Methods Ethics approval and consent to participate All animal experiments were conducted in accordance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research. Ethical approval for all protocols involving animals was approved by the Authority for Biological and Biomedical Models (ABBM) and the University Ethics Committee for the Care and Use of Laboratory Animals at the Hebrew University, which is certified by the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC) (ethical approval number: MD-21-16793-2, NIH approval number: OPRR-A01-5011). The study of de-identified human postmortem eyes was approved by the human Institutional Review Board (IRB) at the University of Pennsylvania. The study of imaging and genotyping data of human subject was approved by the IRB of the Hadassah Medical Organization (IRB #81916 HMO). Genetic Variants in CCR1 We performed a genotype–phenotype analysis to investigate for potential association among CCR1 variants and MA progression. Linear mixed-effects models (LMMs) were applied, adjusting for inter-eye correlation, age, and gender. This approach was selected to account for the inclusion of both eyes per patient and the longitudinal nature of the data. In total, 603 variants were identified across the CCR1 locus, obtained directly from our genotyping dataset by extracting all variants within chromosome 3, positions 46,201,711–46,208,313 (GRCh38). Of these, 65 variants with a minor allele count >0 were tested as the primary fixed effects of interest. Age and gender were modeled as covariates, while random effects accounted for intra-patient correlation between eyes. These models were designed to evaluate differences in atrophy progression rates between carriers and non-carriers of CCR1 variants. To correct for multiple testing, p-values were adjusted using the Benjamini–Hochberg false discovery rate (FDR) procedure. OCT image annotation Automated quantification of atrophy lesion size was performed using a validated deep learning algorithm (RetinAI Discovery; Ikerian AG, Bern, Switzerland) deployed on a secure cloud-based platform. The platform enables segmentation of retinal layers and biomarkers in spectral-domain OCT (SD-OCT) scans acquired on the Spectralis HRA-OCT system (Heidelberg Engineering, Heidelberg, Germany). The RetinAI segmentation algorithm was trained and validated on manually annotated datasets from patients with atrophic, intermediate, and neovascular AMD, as well as other retinal diseases 24–26 . Layers segmented included: retinal nerve fiber layer (NFL), ganglion cell layer with inner plexiform layer (IPL), inner nuclear layer (INL) with outer plexiform layer (OPL), outer nuclear layer (ONL) with Henle’s fiber layer, myoid zone, ellipsoid zone + outer photoreceptor segment + interdigitation zone, retinal pigmented epithelium, choroidal capillaries with choroidal stroma, and total retinal thickness (including fluid cavities and Bruch’s membrane). For eyes with multiple OCT acquisitions at the same visit, the mean and standard deviation of atrophy lesion area across the retina were calculated to assess consistency. Visits were excluded if the standard deviation exceeded 0.1 mm². Otherwise, one annotation was randomly selected for inclusion to ensure unbiased representation. Eyes were eligible for analysis only if they had ≥3 visits and at least 1 year of follow-up and were excluded if other macular pathologies (high myopia, diabetic macular edema, or central serous chorioretinopathy) were present or if image quality was insufficient for reliable automated segmentation. Genotyping Genotype data were obtained as previously described 27 . Briefly, DNA was extracted from whole blood using the FlexiGene DNA Kit (Qiagen, Valencia, CA). Approximately 48% of samples were genotyped using a custom Illumina chip developed by the International AMD Genomics Consortium (IAMDGC), while 52% were genotyped on the Infinium Global Screening Array v3.0 (GSA). Both datasets underwent imputation separately at the Michigan Imputation Server, using Eagle v2.4 for phasing and Minimac4 for imputation, followed by lift-over from GRCh37 to GRCh38 and final harmonization. Post-imputation quality control confirmed no missing regions, consistent allele matching, and comparable imputation performance across platforms. Generation of mouse colonies All experiments were conducted in accordance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research. Given that sex differences can influence immune responses and rates of degeneration, an equal proportion of male and female mice was used across the various experiments. The Crb1 rd8/rd8 mouse, carry a frameshift mutation in the Crb1 gene; it exhibits structural abnormalities in Müller cells, affecting photoreceptor development. Rd8 (retinal degeneration 8) mutation in these mice results in the loss of function in the crumbs-like 1 (Crb1) protein, which regulates the polarity of epithelial cells and is involved in maintaining the integrity of the outer limiting membrane of the retina 28 . Mutations in the same gene cause retinal degeneration in humans 24,25 . B6.129S-Ccr1tm1Gao/AdlJ mice (Jackson laboratory, Bar Harbor, ME, US) lacking the Ccr1 gene (Ccr1 -/- ), and homozygous for the rd8 mutation in the Crb1 gene (Crb1 rd8/rd8 ) were compared to B6.129S also harboring the homozygous mutation of rd8. The second model for IRD which we have used is Pde6b rd10 mouse. This strain is characterized by a missense point mutation in the Pde6b gene. This results in mislocalization and instability of the encoded protein, leading to reduced enzymatic activity. Consequently, cyclic GMP (cGMP) accumulates, leading to toxicity to rod photoreceptors, and substantial photoreceptor cells loss by postnatal week 3 29,30 . To generate Pde6b rd10 /Ccr1 ⁻/⁻ mice, C57BL/6J-Pde6b rd10 mice (The Jackson Laboratory) were crossed with B6.129S-Ccr1tm1Gao/AdlJ mice (The Jackson Laboratory). Offspring heterozygous for the Pde6b rd10 , Crb1 rd8/rd8 , and Ccr1 alleles were intercrossed. Progeny were genotyped to identify and select two experimental strains: (1) mice homozygous for the Pde6b rd10 mutation, knockout for Ccr1, and free of the Crb1 rd8/rd8 mutation (Pde6b rd10 /Ccr1 ⁻/⁻ ); and (2) mice homozygous for the Pde6b rd10 mutation, wild-type for Ccr1, and free of the Crb1 rd8/rd8 mutation (Pde6b rd10 ). The Crb1 rd8/rd8 and Ccr1 mutant or wild-type alleles were identified by PCR as previously described 31,32 . The Pde6b rd10 mutation was validated via sequencing as previously described 33 . PCR reactions were performed using the primers described in Table 1. Five mice generations were necessary to establish each strain, minimizing the impact of genetic background. Table 1. PCR Primer Sequences Used for Genotyping Mouse Strains PCR reactions Primers name Sequences Ccr1 mouse m3xs300 GCTGTCTCTGATCTGGTCTTCCTT mouse m3X Rt3 R CCTGCTGCTTTGCCTACCTCTC mouse A neo R TGGGTGGAGAGGCTTTTTGCTTCCTCTTGC Crb1 rd8 Pde6b rd10 mouse Crb1 F1 mouse Crb1 F2 mouse Crb1 R mouse Pde6b F mouse Pde6b R GTGAAGACAGCTACAGTTCTGATC GCCCCTGTTTGCATGGAGGAAACTTGGAAGACAGCTACAGTTCTTCTG GCCCCATTTGCACACTGATGAC GGCTCTGATATGGTGCTGTG AAAGACTCACCCTAAGGACGC Fundus autofluorescence (FAF) and Optical Coherence Tomography (OCT) imaging Retinal images were obtained using a Spectralis OCT device (Heidelberg, Baden-Wurttemberg, Germany), and a Micron III retinal microscope (Phoenix Research Labs, San Francisco, CA). Images were obtained at the age of 10, 15 and 18 months for Crb1 rd8/rd8 mice. For image acquisition, mice were anesthetized with a mixture of ketamine and xylazine (Eurovet, United Arab Emirates) and pupils are dilated with cyclogil drop (Sandoz Farmaceutica S.A., Madrid, Spain). Eyes were lubricated during all the procedures using carboxymethylcellulose (Fischer Pharmaceutical Labs). Fundus images of the right eye from each mouse were analyzed. For all images, an identical area of 15 mm 2 in a similar region of the retina was captured (3 mm to the left and 2.5 mm superior and inferior of the optic nerve head (ONH)), and the number of hyper-fluorescent lesions was automatically quantified using QuPath bioimage analysis software (https://qupath.github.io/). Real-time quantitative PCR (qPCR) RNA was extracted from isolated retina samples using TRIzol Reagent (Sigma-Aldrich, Munich, Germany) in accordance with the manufacturer’s instructions. The RNA quality and quantity were measured using a NanoDrop spectrophotometer (Thermo Scientific, Waltham, MA) and a bioanalyzer (Agilent Technologies, Santa Clara, CA). RNA was reverse-transcribed to generate cDNA using the qScript cDNA Synthesis Kit (Quantabio, Beverly, MA) in accordance with the manufacturer’s instructions. qPCR was then performed using the PerfeCTa SYBR Green FastMix kit (Quantabio); the gene-specific primers (Sigma-Aldrich) used in this study are listed in Table 2. Each gene was amplified in triplicate, and the expression level of each gene was normalized to mouse Gapdh as an endogenous control using the standard 2(ΔΔCT) method 34 . Table 2. Gene-Specific Primers Used for Quantitative PCR Analysis Gene Forward (5’-3’) Reverse (5’-3’) mouse Gapdh AACTTTGGCATTGTGGAAGG ACACATTGGGGGTAGGAACA mouse Ccl5 CCTGCTGCTTTGCCTACCTCTC ACACACTTGGCGGTTCCTTCGA mouse Ccl3 CTGCCCTTGCTGTTCTTCTC CTTGGACCCAGGTCTCTTTG mouse Gfap GAAGAGGGCATTGGATTCAC TATGCCGTGGATGAACTGAG mouse Vimentin TCTCCTAGCCAGAGGAGGTG TGTCATAGCTATAGGTCGGAACTG mouse Adgre1 * GCATCATGGCATACCTGTTC AGTCTGGGAATGGGAGCTAA mouse Ccl2 AGGTCCCTGTCATGCTTCTG TCTGGACCCATTCCTTCTTG mouse Cxcl1 GACCATGGCTGGGATTCACC CCAAGGGAGCTTCAGGGTCA mouse Cxcl10 CATCCCTGCGAGCCTATCC CATCTCTGCTCATCATTCTTTTTCA *Encodes the F4/80 protein, also known as EMR1 (EGF-like module-containing mucin-like hormone receptor-like 1). Histological analysis and Immunohistochemistry For paraffin embedding, eyes were enucleated, fixated in Davidson solution for 8 h at 4 °C, and placed in 70% ethanol over-night at 4 °C. Eyes were incubated in 80–> 90–> 100–> 100% ethanol gradient in room temperature for 30 min per each concentration, placed for 15 min in ethanol 100%: Xylene (1:1) solution in room temperature and washed twice with xylene 100% for 20 min each wash. Samples were incubated in paraffin (Paraplast Plus, Leica biosystems) at 58 °C for 3 times, each incubation lasted 40 min, later they were embedded in paraplast. Serial sections were cut at 5 μm thickness, in nasally/temporally orientation through the center of the ONH. H&E staining was performed for retinal morphometry examination as previously described 35 . For immunohistochemistry, deparaffinized sections were placed in blocking solution (PBS containing 10% serum and 0.1% Triton X-100) for 1 hour at RT. The sections were then incubated with the primary antibody overnight at 4°C; the following day, the sections were incubated in secondary antibody for 1 hour at RT. The nuclei were counterstained with DAPI, and the sections were visualized using a fluorescence microscope. Donor human eyes from three individuals without AMD (2 women and 1 man; mean age (SD): 88 ± 3 years), and three individuals with AMD (3 women; mean age (SD): 92± 3 years) were evaluated. The posterior segment was fixed in 4%PFA, dissected, embedded in optimal cutting temperature, and sectioned. Mouse eyes were fixed in 4% PFA for 2 hours and then placed in 30% sucrose overnight at 4°C. The eyes were then placed in optimal cutting temperature solution (Scigen Scientific, Gardena CA), and 10 µm sections were cut using a cryostat. For immunohistochemistry, Goat anti-human CCR1 (10 µg/ml; ab139399, Abcam), Rabbit anti-IBA-1 (16.5 µg/ml; ab153696, Abcam), Rabbit anti-CD11b antibody (0.5 µg/ml; ab133357), and rabbit anti-GFAP (0.5 µg/ml; ab64347) were used as primary antibodies, and donkey anti-rabbit IgG-Alexa Fluor 488 (10 µg/ml; ab50081), donkey anti-goat IgG-Alexa Fluor 555 (10 µg/ml; ab150134), donkey anti-rabbit IgG-Alexa Fluor 555 (10 µg/ml; ab6939) was used as a secondary antibody. To measure the thickness of the ONL, the paraffin sections were stained with hematoxylin and eosin (H&E) and the optimal cutting temperature sections with DAPI, and the thickness of the ONL was measured at fixed distances from the ONH. Full- field Electroretinography (ERG) recording For ERG recording, the pupils were dilated with tropicamide and phenylephrine, and corneas were kept moist by application of carboxymethylcellulose. ERG was performed in dark-adapted mice. During ERG recording, the eyes were anesthetized with oxybuprocaine hydrochloride drops (all drops from Fischer Pharmaceutical Labs, Israel). All procedures were performed in dim red lighting or in total darkness, and the mice were kept warm throughout the recording. During the recording, the mouse was positioned facing the center of a Ganzfeld bowl, ensuring equal, simultaneous illumination of both eyes. ERG data were recorded inside a Faraday cage using an Espion computerized system (Diagnosys LLC, Littleton, MA). Dark-adapted ERG responses to a series of white flashes at increasing intensity (from 0.000012 to 10 cd·sec/m 2 ) were recorded at inter-stimulus intervals increasing from 10 sec (for the lowest-intensity flashes) to 90 sec (for the highest-intensity flashes). For analysis, the b-wave amplitude was measured from the trough of the a-wave to the peak of the b-wave. Pharmacologic CCR1 blocking treatments Pde6b rd10 mice received subcutaneous injections of either the CCR1-specific antagonists (50 mg/kg body weight BX471; Targetmol, Boston, MA, or 100 mg/kg body weight CCX354; Targetmol, Boston, MA), or vehicle (40% cyclodextrin in saline) every 8 hours during the peak of the degeneration process between P21-P24. For injection, BX471/CCX354 was dissolved at a final concentration of 0.5 mg/50 µl in saline containing 40% (w/v) cyclodextrin (Sigma-Aldrich); the solution was mixed thoroughly and dissolved overnight at 4°C, after which the pH was adjusted to 4.5 with NaOH, and the solution was filtered through a 0.45-µm filter. Statistical analysis The appropriate statistical tests were used based on normalcy and the sample distribution and parameters using InStat biostatistical software package (GraphPad Software, San Diego, CA). Data were analyzed using a one-way ANOVA followed by the Tukey-Kramer post-hoc test or an unpaired Student’s t -test, where appropriate. Values over 2 standard deviations from the average were excluded from statistical . Results CCR1 expression is increased in retina from AMD patients Immunostaining for CCR1, IBA-1 (marker of macrophages and microglia cells) and GFAP (marker of activated Müller cells) was performed in sections from eyes affected by nnvAMD and nvAMD. Both resident microglia and recruited macrophages, labelled by IBA-1 immunoreactivity, were distributed from the GCL to the INL in section from a nnvAMD eye (Fig. 1G). In the same retina region, macrophages accumulated under the Bruch's membrane (Fig. 1G), directly beneath drusen deposits (Fig. 1J, K). Additionally, resident and recruited macrophages were observed in proximity to the ONH (Fig. 1L). Importantly, these IBA-1-positive cells exhibited co-localization with CCR1 (Fig. 1H, I, M, N). In contrast, age-matched control eyes exhibited few IBA-1/CCR1 positive cells, located >4 mm from the ONH and primarily restricted to the GCL and INL (Fig. 1A–C). Notably, such cells were absent adjacent to the ONH and Bruch’s membrane (Data not shown). These findings suggest limited myeloid cell recruitment in control eyes, based on previous reports that identify the optic nerve as a reservoir for microglial repopulation 36,37 , and the choroidal fenestrated capillaries as a potential entry site for monocyte trafficking 38 . The detection of CCR1 positive immune cells in eyes affected by AMD suggests its potential role in facilitating monocyte recruitment and/or activation in the context of AMD, consistent with its involvement in other inflammatory conditions 39–41 . Enhanced glial fibrillary acidic protein (GFAP) immunoreactivity was detected in astrocytes in the NFL and in Müller glial cells in AMD retinas (Fig. 1O) compared to control tissue (Fig. 1D), as previously reported 39 . CCR1 expression was also evident in gliotic Müller cells (activated Müller) (Fig. 1P, Q), but not in unaffected retinas (1E, F), indicating a potential role for CCR1 in glial activation 38 . This association was further supported by increases expression of both GFAP and CCR1 in atrophic retinal regions (Fig. 1U–W), characterized by presence of fibrotic tissue (Fig. 1X), reduced ONL thickness (Fig. 1Y), hypertrophic Müller cell (Fig. 1Z), and inflammation evidenced by IBA-1-positive cells presence in the ONL and the RPE (Fig. 1R–T). Together, the detection of CCR1 in activated microglia/macrophages and its distinct expression in gliotic Müller cells within drusen-bearing and atrophic regions highlights its potential contribution to reactive gliosis and neuroinflammation in AMD. CCR1 variants are associated with accelerated atrophy progression A total of 635 patients (1,135 eyes) with available OCT annotations, genotyping data, and baseline macular atrophy (MA) area ≥0.1 mm² were included in the analysis. The mean ± sd follow-up duration was 6.23 ± 4.06 years, with an average of 37.29 ± 31.39 visits per eye. Across all eyes and visits, the mean atrophy lesion area was 4.23 ± 6.31 mm², while the mean progression rate based on square-root transformed lesion area measurements was 0.02 ± 2.69 mm/year. In the genotype–phenotype analysis of CCR1 , five variants demonstrated associations with higher rates of atrophy progression (Table 3). Two variants located in the 3′ untranslated region (3′ UTR), chr3:46202786:G:T (coefficient: 0.12 mm/year, 95% CI: 0.02–0.21, p = 0.01) and chr3:46202788:G:C (coefficient: 0.08 mm/year, 95% CI: 0.00–0.15, p = 0.05), showed an association with higher rates of atrophy progression. Two additional variants, chr3:46203522:G:A and chr3:46204152:C:G, are synonymous coding variants that also demonstrated positive associations with progression (coefficients 0.08–0.15 mm/year; p = 0.02–0.05). The final variant, chr3:46207342:C:A, is intronic and similarly showed a positive association (coefficient: 0.15 mm²/year, 95% CI: 0.02–0.27, p = 0.02). However, none of these associations remained significant after FDR, potentially due to low minor allele counts. Table 3. CCR1 Genetic Variants Associated with Macular Atrophy Progression Gene Variant Minor Allele Frequency (%) Coefficient (mm/year) Lower 95% CI Higher 95% CI P-value CCR1 chr3:46202786:G:T (rs200207639) 0.56 0.12 0.02 0.21 0.01 CCR1 chr3:46202788:G:C (rs199682159) 0.63 0.08 0.00 0.15 0.05 CCR1 chr3:46203522:G:A (rs764537530) 0.16 0.15 0.02 0.27 0.02 CCR1 chr3:46204152:C:G (rs61755291) 0.63 0.08 0.00 0.15 0.05 CCR1 chr3:46207342:C:A (rs970631558) 0.16 0.15 0.02 0.27 0.02 Linear mixed-effects models (LMMs) were used to evaluate for an association between CCR1 variants and atrophy progression rate (mm/year) in OCT imaging. Models were adjusted for age and gender, with random effects accounting for inter-eye correlation. Shown are the regression coefficients with 95% confidence intervals (CIs), corresponding p-values, and the calculated minor allele frequencies (MAF, %). The effect of Ccr1 genetic deletion in Crb1 rd8/rd8 mice To determine whether CCR1 expression contributes to retinal degeneration or represents an epiphenomenon, we examined the effect of Ccr1 deletion in retinal degeneration. To specifically assess the functional relevance of CCR1 signaling in glial cells, we first investigated the impact of Ccr1 deficiency in the context of retinal degeneration associated with the rd8 mutation in the Crb1 gene. The retinal phenotype observed in Crb1 rd8/rd8 mice was associated with altered structure of the CRB1 protein in Müller cells, disrupting photoreceptor-Müller glial interactions at the external limiting membrane (ELM) 42 . Prior to functional analysis, we confirmed CCR1 expression in this model. Immunostaining revealed increased CCR1 immunoreactivity in Müller cells from Crb1 rd8/rd8 mice at 10 and 15 months of age (Fig. S1b and Fig. S1c, respectively), compared to age-matched wild-type controls that did not show such immunoreactivity (Fig. S1a). Then, we compared the eyes of Crb1 rd8/rd8 /Ccr1 -/- mice with those of Crb1 rd8/rd8 mice. The rd8 mutation is not associated with marked ERG abnormalities, but FAF lesions reflects the degenerative process in these mice 43 . At 10 months, FAF fundus imaging demonstrated few altered patterns in Crb1 rd8/rd8 , Crb1 rd8/rd8 /Ccr1 -/- , and age-matched wild-type mice (n=4 per group; Fig. S1d, g, j). At the same age OCT imaging (Fig. S1e, h, k) and histological analysis (Fig. S1f, i, l) confirmed unaffected retinal structure in both mutant mice strains. In addition, qPCR results revealed similar expression level of pro-inflammatory genes such as Cxcl1 , Ccl2 and F4/80 (n= 4 per group, Fig. S1m-o), and of the Müller gliosis reporter gene Vimentin (Fig. S1q) across the different groups. Interestingly, the expression level of Gfap , a gene also associated with Müller cell gliosis, was reduced in both Crb1 rd8/rd8 mice and Crb1 rd8/rd8 /Ccr1 -/- mice compared to wild-type mice (n=4 per group, 0.30-fold change and 0.32-fold change respectively, p<0.01 for both comparisons, Fig. S1p). At 15 months of age, hyper-FAF lesions were observed in Crb1 rd8/rd8 mice (n=6), particularly in mid-peripheral and central retina areas (Fig. 2B) as previously reported 44 . In contrast, very few FAF lesions were observed in age-matched control mice (n=6; Fig. 2A), and a marked reduction in the number of FAF lesions was observed in Crb1 rd8/rd8 /Ccr1 -/- mice at the age of 15 months (n=14) and 18 months (n=6; Fig. 2C and 2D, respectively). Quantification of the number of FAF lesions revealed an 84% reduction of hyper-FAF lesions in Crb1 rd8/rd8 /Ccr1 -/- mice at the age of 15 months, and a 94% reduction at the age of 18 months compared to Crb1 rd8/rd8 mice at the age of 15 months (n≥ 5 per group, p<0.01, Fig. 2E). In addition to the hyper-FAF lesions, we also observed hypo-FAF lesion in the central sretina of Crb1 rd8/rd8 mice (Fig. 2F, G). OCT imaging sections through the hypo-FAF lesion revealed abnormal structure of the retinal layers (Fig. 2H, I). These findings were further confirmed by histological analysis, which showed the presence of pseudorosette formations corresponding with the hypo-FAF lesion (Fig. 2J). Additionally, loss of the OPL resulting in direct contact between the ONL and INL, was evident in Crb1 rd8/rd8 mice (Fig. 2P) at the age of 15 months. In contrast, Crb1 rd8/rd8 /Ccr1 -/- mice maintained normal retinal structure (Fig. 2K-P). Histological analysis also revealed a reduction in total retinal thickness in Crb1 rd8/rd8 mice compared to both wild-type and Crb1 rd8/rd8 /Ccr1 -/- mice (n ≥3 per group, 0.8-fold-change at 300 µm from the ONH, $ p<0.05 and *p<0.05 respectively, Fig. 2Q, R). In contrast, retinal thickness was similar in Crb1 rd8/rd8 /Ccr1 -/- mice and wild-type mice (Fig. 2Q, R). Among the six Crb1 rd8/rd8 mice evaluated, two exhibited severe retinal damage (including FAF lesions and retinal layers disruption), while two of the fourteen Crb1 rd8/rd8 /Ccr1 -/- mice exhibited FAF lesions and none showed abnormal retinal histological features. Previous studies reported that the presence of hyper-FAF retinal lesions correlated with migration of microglial cell towards the ONL and RPE layers, indicating a disruption of retinal homeostasis 45 . Accordingly, immune cells infiltration between the RPE and the photoreceptor segments layer was observed in retinal sections from Crb1 rd8/rd8 mice (Fig. 3B, C). Deletion of Ccr1 led to a notable reduction in the number of CD11b-positive cell in this region compared with Crb1 rd8/rd8 mice (Fig. 3A). Furthermore, Ccr1 deletion was associated with a reduction of activated CD11b-positive cells compared to Crb1 rd8/rd8 mice (Fig. 3D-O); characterized by an amoeboid morphology (Fig. 3I) and increased cell size (Fig. 3J) 46 . In Crb1 rd8/rd8 /Ccr1 -/- mice, ramified CD11b-positive cell predominantly localized in the IPL and the OPL (Fig. 3F, K and L), and a similar finding was observed in wild-type mice (Fig. 3D, G and H). Ccr1 deletion was also associated with a reduction in the migration of CD11b-positive cells from the IPL and OPL towards the ONL and RPE (n= 3 per group, 0.30-fold change, p< 0.0001, Fig. 3O). CD11b is a receptor expressed on various leukocyte populations, including macrophages, neutrophils, and natural killer cells, and also serves as a marker for tissue-resident macrophages such as microglial cells. During retinal inflammation, both recruited macrophages and resident microglia can proliferate and undergo similar morphological changes, making it challenging to distinguish between these cell populations 47 . However, in Crb1 rd8/rd8 mice CD11b-positive cells have been detected in the vitreous body (Fig. 3E), indicating the recruitment of macrophages in association with the degenerative process. CD11b-positive cells were not detected in the vitreous of either wild-type mice (Fig. 3D) or Crb1 rd8/rd8 /Ccr1 -/- mice (Fig. 3F). Retinal Müller gliosis, evidenced by GFAP staining, was also observed in Crb1 rd8/rd8 mice (Fig. 3Q-R), whereas a reduced GFAP-positive signal was detected in Crb1 rd8/rd8 /Ccr1 -/- mice (Fig. 3S). We further evaluated the level of retinal inflammation using qPCR for F4/80 mRNA expression, a marker for both resident microglia and infiltrating macrophages 48 . Increased F4/80 expression was detected in Crb1 rd8/rd8 mice compared to Crb1 rd8/rd8 /Ccr1 -/- mice at the age of 15 months (n ≥6 per group, 3-fold change, p<0.01, Fig. 3T), and 18 months (2.13-fold change, p<0.01, Fig. 3T), and compared to age-matched wild-type mice (5.80-fold change, p<0.01, Fig. 3T). qPCR for Gfap mRNA level confirmed the immunohistochemistry findings, showing elevated expression level in Crb1 rd8/rd8 mice compared to Crb1 rd8/rd8 /Ccr1 -/- mice at the age of 15 months (1.89- fold change p<0.05, Fig. 3U) and 18 months (2.67- fold change p<0.05, Fig. 3U), and compared with age-matched control mice (2.33- fold change, p<0.05, Fig. 3U). Deletion of Ccr1 resulted in a significant reduction in the mRNA expression levels of several Müller gliosis-associated genes in mice aged of 15 and 18 months, compared to Crb1 rd8/rd8 mice aged of 15 months. Specifically, Cxcl1 mRNA expression was markedly decreased in Crb1 rd8/rd8 /Ccr1 -/- mice at the age of 15 months (0.28-fold; ** p < 0.01, Fig. 3W). Ccl2 mRNA expression was also significantly reduced in both age groups (0.16-fold, *** p < 0.001; 0.46-fold, * p < 0.05, respectively, Fig. 3X). Similarly, Cxcl10 mRNA expression was reduced in 15 and 18-month-old Crb1 rd8/rd8 /Ccr1 -/- mice (0.33-fold, * p < 0.05; 0.65-fold, ** p < 0.01, respectively, Fig. 3Y). Together, these results indicate that Ccr1 deletion is associated with preserved retinal structure and reduced inflammation in Crb1 rd8/rd8 mice. The effect of Ccr1 genetic deletion in Pde6b rd10 mice We next aimed to evaluate the impact of Ccr1 deletion in a more aggressive and shorter duration genetic-derived model of retinal degeneration, the Pde6b rd10 mouse. In this model, rods degeneration begins around postnatal day 16 (P16) and reach its peak between P21 and P25 30 . We compared the retinal function of Pde6b rd10 mice with that of Pde6b rd10 /Ccr1 -/- mice at P21 (Fig. 4A, B), P26 (Fig. 4C, D) and P35 (Fig. 4E, F). ERG results showed a notable decrease of the b-wave amplitude in both Pde6b rd10 mice and Pde6b rd10 /Ccr1 -/- mice compared to age-matched Ccr1 -/- mice at P21 (n≥4 per group ,0.37 and 0.59- fold change, respectively at 10 cd.s light intensity, p<0.001, Fig. 4A, B). However, Pde6b rd10 /Ccr1 -/- mice had a higher b-wave amplitudes compared to Pde6b rd10 mice at P21 (n≥12 per group, 1.59-fold change at 10 cd.s light intensity, p<0.01 Fig. 4A, B). No difference was found between the both groups at P26 and P35 (Fig. 4C-F) when the mean ERG amplitudes were lower than 80% compared to age matched Ccr1 -/- mice. To evaluate the consequences of Ccr1 deletion before the onset of photoreceptors cell death, we examined the thickness of the ONL in the three above mentioned mice groups at P14 (ERG analysis is not technically possible at this age due to the eyelids coverage of the eyes). Histological analysis showed no difference between the groups at this stage (n=6 per group, Fig. 4G-J). At P21, a trend towards increased ONL thickness was observed in Pde6b rd10 /Ccr1 -/- mice compared to Pde6b rd10 mice (n≥4 per group, 1.53- fold change at 900 µm from ONH, p= 0.08, Fig. 4L-P). Additionally, photoreceptor degeneration was observed to occur unevenly across the retina (Fig. 4L), which may explain the absence of a statistically significant difference between the groups despite significant difference in the ERG findings. Similar ONL thickness was observed between Pde6b rd10 mice and Pde6b rd10 /Ccr1 -/- mice at P35 (n=4 per group, Fig. 4Q-T), where 2-3 rows of photoreceptor remained across the entire retina, correlating with the ERG results. To investigate why the protective effect associated with the Ccr1 deletion in Pde6b rd10 mice didn't not persist beyond P21, we evaluated the mRNA levels of proinflammatory genes in Ccr1 -/- , Pde6b rd10 , and Pde6b rd10 /Ccr1 -/- mice at P14, P21 and P35 using qPCR (Fig. 5A-H) . At P14 no differences were detected between the experimental groups for any of the analyzed genes ( Gfap, Vimentin, Cxcl1, Cxcl10, F4/80, Ccl2, Ccl3 and Ccl5; Fig. 5A-H) . mRNA levels of these genes were also similar across the three different time points evaluated (P14, P21, and P35) in Ccr1 -/- mice, suggesting that Ccr1 deletion does not alter homeostasis of these pathways (Fig. 5A-H). On the other hand, Pde6b rd10 mice showed upregulation of Gfap compared to Ccr1 -/- mice at P35 (n≥4 per group, 15.36-fold change, p= 0.0014, Fig. 5A) suggesting Müller cell gliosis. Although Pde6b rd10 /Ccr1 -/- mice also exhibited increased Gfap mRNA expression compared to Ccr1 -/- mice at P35, the magnitude of the upregulation was lower than in Pde6b rd10 mice (n≥4 per group, 10.84-fold change, p= 0.014, Fig. 5A). Pde6b rd10 /Ccr1 -/- showed increased expression of Cxcl1 (n≥5 per group, 10.44-fold change, p= 0.01, Fig.5C) and Cxcl10 (n≥5 per group, 99-fold change, p= 0.004, Fig. 5D) compared to Ccr1 -/- mice at P21. Increased expression of F4/80 was observed at P21 and P35 in Pde6b rd10 mice (n≥4 per group, 10-fold change, p= 0.0002, at P21 and 5.22-fold change, p= 0.0309, at P35, Fig. 5E) and in Pde6b rd10 /Ccr1 -/- (n≥4 per group, 5-fold change, p= 0.0346, at P21 and 5.29-fold change, p= 0.0233, at P35, Fig. 5E) compared to Ccr1 -/- mice. However, reduced expression of F4/80 was observed in Pde6b rd10 /Ccr1 -/- compared with Pde6b rd10 at P21 (n≥5 per group, 2-fold change, p= 0.0134, Fig. 5E), indicating that Ccr1 deletion diminish macrophage/microglial recruitment. Yet, Ccr1 deletion simultaneously leads to the upregulation of the mRNA of several pro-inflammatory cytokines. Among the upregulated mRNAs were CCR1 ligands including Ccl2 (n≥5 per group, 177-fold change, p= 0.0002, and 11-fold change, p= 0.0005, respectively Fig. 5F) at P21 , Ccl3 at p35 (n≥4 per group, 8-fold change, p= 0.0009, and 3-fold change, p= 0.0070, respectively Fig. 5G) and Ccl 5 at P35 (n≥5 per group, 88-fold change, p< 0.0001, and 2-fold change, p= 0.0009, respectively Fig. 5H) compared to Ccr1 -/- and Pde6b rd10 mice. Importantly, such changes were not observed over Ccl2 (Fig. 5F) and Ccl3 ( Fig. 5G) in Pde6b rd10 mice, suggesting that Ccr1 deletion selectively alters cytokine expression dynamics during retinal degeneration. Pharmacologic CCR1 inhibition in Pde6b rd10 mice The effect of CCR1 pharmacologic inhibition on the progression of genetically-derived photoreceptor degeneration was assessed in Pde6b rd10 mice to gain additional insight to the role of CCR1 in the degenerative process. The CCR1-specific inhibitor BX471 (or vehicle for the control group) was administrated subcutaneously twice daily starting at P21, and ERG was recorded at P21 (baseline) and at P25 (Fig. 6A). These time points were selected as to correlate with the peak of the degenerative process in the rd10 strain 30 . At P21, ERG recordings revealed similar b-wave amplitudes in BX471-treated and vehicle-treated mice (Fig. 6B, C). However, by P25, the BX471-treated group exhibited higher b-wave amplitude compared to the vehicle-treated group (n ≥ 12 per group; 1.73-fold, p= 0.02 at 10 cd·s/m² intensity, Fig. 6B, C). Analysis of the percentage decrease in b-wave amplitude between P21 and P25 revealed a mean reduction of 62% in vehicle-treated mice, whereas BX471-treated mice exhibited a lower reduction of 33% (p= 0.03, Fig. 6D). Histological analysis further confirmed the protective effect of CCR1 inhibition, demonstrating increased ONL thickness in BX471-treated mice compared with the vehicle-treated group at P25 (n= 6 per group; 1.51-fold increased thickness at 600 µm from the ONH, p= 0.01, Fig. 6E). Gene expression levels of CCR1 ligands including Ccl2 (Fig. 6F) , Ccl3( Fig. 6G) and Ccl 5 (Fig. 6H) were measured via qPCR at P25. Expression levels were similar following pharmacologic inhibition of CCR1 with BX471 and in untreated controls. To further evaluate the effect of CCR1 inhibition in Pde6b rd10 mice, we tested an additional CCR1-specific inhibitor, CCX354. Unlike BX471, CCX354 treatment did not lead to a significant preservation of b-wave amplitude at P25 compared with untreated mice (n=9, Fig. 6I, J). However, analysis of the percentage decrease in b-wave amplitude between P21 and P25 revealed a rescue effect: vehicle-treated mice exhibited a 46% reduction of the b-wave amplitude, whereas CCX354-treated mice showed only 26% reduction (p= 0.02 at 10 cd·s/m² intensity, Fig. 6K). Histological analysis indicated a trend toward increased ONL thickness in CCX354-treated mice compared to vehicle-treated controls at all measured distances from the ONH, with a statistically significant difference observed at -600 µm (n = 9 per group; 1.62-fold change, p= 0.005, Fig. 6L). Together, these results suggest that pharmacological inhibition of CCR1 reduces photoreceptor death rate in Pde6b rd10 mice. Discussion In this work we investigated the role of CCR1 in AMD and IRDs. We documented CCR1 expression in Müller glia cells in retinal areas affected by AMD, and a genotype-phenotype association of specific CCR1 genetic variants. We also show that deletion of the Ccr1 gene in the Pde6b rd10 mouse model of rapidly progressing retinal degeneration, and in the Crb1 rd8/rd8 mouse model of slowly progressing retinal degeneration suppresses the inflammatory response and is associated with a rescue effect. Additionally, pharmacologic inhibition of CCR1 yielded both structural and functional rescue in Pde6b rd10 . Combined, these data elucidate an important role for CCR1 signaling in AMD and IRDs. This conclusion is also supported by our previous work which documented CCR1 expression on Müller glia cell in the mouse following photic retina-injury 20 . Thus, CCR1 signaling in activated Müller glia and macrophages emerge as a common retinal injury pathway secondary to variable underlying causes. Further supporting a role for CCR1 in AMD are transcriptomic analyses of retinal tissue from healthy controls and AMD eyes showing elevated expression of Ccr1 mRNA in microglial cells 49 , and upregulation of CCR1 ligands in the aqueous humor of AMD patients 11 . Consistent with a prior report 50 , we demonstrated upregulated GFAP in Müller glia in advanced AMD, and more importantly revealed that CCR1 is expressed in these reactive Müller cells, as indicated by its co-localization with GFAP immunoreactivity. In the Crb1 rd8/rd8 model of retinal degeneration, Ccr1 deletion led to a reduction in hyper-FAF lesions, abnormal retinal folds, disorganization of retinal layers, and retinal atrophy. Previous studies have indicated that the retinal phenotype observed in Crb1 rd8/rd8 mice is primarily due to the loss of adherent junction integrity between photoreceptors and Müller glia cells 42 . The rd8 mutation in the Crb1 gene results not only in decreased Crb1 expression 44 , but it also disrupts its proper distribution along Müller cells 28 . Consequently, various alterations in Müller cells have been reported in Crb1 rd8/rd8 mice, including mislocalization within dysplastic lesions 51 , and altered activation status 52 . We show increased Müller cell activation (Müller gliosis) in Crb1 rd8/rd8 , compared to age-matched controls, and a rescue effect induced by Ccr1 deletion. This manifested in lower mRNA expression levels of Gfap, Ccl2 , and Cxcl10 , known markers of Müller glia activation 53,54 . In addition to their structural role in the retina, cross-talk between Müller cells and microglia have been reported to modify retinal inflammation 55 . Previous reports suggested that activated inflammatory microglia are implicated in the progression of retinal degeneration in Crb1 rd8/rd8 mice 45,56 . CCR1 is a well-characterized chemokine receptor involved in the recruitment of monocytes during inflammatory responses 57 . Accordingly, we noted reduced immune cell recruitment to the retina in Crb1 rd8/rd8 /Ccr1 -/- mice. Thus, conceivably, CCR1 has a role in promoting retinal inflammation in Crb1 rd8/rd8 mice. Taken together, these results suggest that the protective effects conferred by Ccr1 deletion in the Crb1 rd8/rd8 mice may be at least partially mediated through a reduction in Müller cell gliosis, in addition to decreased immune cell recruitment and activation. The Crb1 rd8/rd8 mouse recapitulate features of human retinal degeneration associated with Crb1 gene mutation 58 , including the phenotypic variability 44 . The underlying factors modulating the progression of retinal degeneration in Crb1-associated retinal degeneration are poorly understood. Genetic factors such as Arhgef12 and Prkci were suggested to influence disease severity 51 , and pharmacological inhibition of Platelet-derived growth factor (PDGF)-C demonstrated an anti-apoptotic effect in Ccl2 -/- /Cx3cr1 -/- /Crb1 rd8/rd8 mouse 59 . In this model, microglial activation 60 and macrophage recruitment are impaired 61,62 , further implicating this pathway in Crb1 rd8/rd8 associated retinal degeneration. Retinal degeneration in Crb1 rd8/rd8 mice is relatively mild and late-onset, by contrast, in Pde6b rd10 mice, there is an aggressive, rapidly progressing retinal degeneration, resulting in profound loss of visual function. In Pde6b rd10 mice, photoreceptor cell death is associated with inflammation manifesting in upregulation of pro-inflammatory cytokines, microglial activation, and oxidative stress markers 63–65 . In this model, various strategies were employed to mitigate retinal damage, including the use of antioxidant compounds, anti-apoptotic or neurotrophic factors, and neuroprotective hormones 66 . Targeting inflammation was also shown to slow the progression of photoreceptor degeneration in Pde6b rd10 mice. For example, inhibition of microglial activation using EP-2 inhibitors 67 , COX-1 inhibitors 68 , dexamethasone 69 , TNF-α 70,71 , IL-27 72 , and mYd88 inhibitors 73 was associated with reduced severity of retinal damage in this model. Ablation of Ccr2 , another chemokine receptor, also alleviated degeneration in this model 74 . The beneficial effect associated with Ccr2 deletion appears to be attributed to reduced monocytes infiltration 75 . In Arrestin-1 knockout mouse, a model of degeneration specific to photoreceptor cells, genetic deletion of Ccr2, specific genetic deletion of Ccl2 in Müller cell and CCL2 pharmacological inhibition reduced the influx of monocytes, but didn't not influence the course of the neurodegeneration 74 . By contrast, pharmacological inhibition of CCR1 in our study conferred neuroprotection, conceivably through its dual modulatory effects on monocytes recruitment and Müller glia activation. Both Ccr1 gene deletion and CCR1 pharmacologic inhibition showed rescue effect in models of retinal degeneration which we have tested. Nonetheless, the extent of neuroprotection conferred by each approach was variable. In accordance with a previous report 65 , we showed upregulation of Ccl3 and Ccl5 in Pde6b rd10 mice retina. Additionally, we observed that Ccr1 deletion in Pde6b rd10 mice lead to the sustained upregulation of these cytokines until P35. By contrast, in Pdeb rd10 mice retinal downregulation of the same cytokines was observed at P35. Beyond their functional roles, chemokine receptors can also regulate the levels of their ligands through receptor-ligand internalization and degradation 76,77 , feedback mechanism or enzymatic processing 78 . Thus, the lack of CCR1 receptor may explain why the CCR1-specific ligands remain elevated in the Pde6b rd10 /Ccr1 -/- mice. Additionally, Ccl2 shows dramatic upregulation in Pde6b rd10 /Ccr1 -/- mice, likely due to a compensatory effect, as observed in another model with receptor ablation 79 . The sustained upregulation of Ccl2 , Ccl3 and Ccl5 could exacerbate retinal inflammation, accelerating photoreceptor cell death through non-CCR1 signaling pathways. This may explain why the protective effects of Ccr1 ablation do not persist beyond P21 in an aggressive, rapidly progressing retinal degeneration process. On the other hand, our data show that in a slower progressing retinal degeneration process in Crb1 rd8/rd8 mouse, Ccr1 deletion exhibits a sustained protective effect accompanied by reduced expression levels of Ccl2 up to 18 months of age. The differential regulation of CCR1 ligands between acute and chronic retinal degeneration models may be attributed to the distinct pathophysiological contexts: the acute model is characterized by a rapid and severe loss of homeostatic feedback, triggering a marked upregulation of chemokines in an attempt to restore equilibrium; in contrast, the chronic model involves a more gradual disruption, allowing for a more adaptive and controlled inflammatory response 80 . Interestingly, unlike Ccr1 deletion, pharmacological inhibition of CCR1 did not lead to compensatory increases in Ccl2 , Ccl3 , or Ccl5 expression. Collectively, these findings indicate the therapeutic potential of pharmacological CCR1 inhibition as an effective strategy for treating slowly progressing retinal disorders, such as AMD and IRDs. Few important caveats associated with the current study should be noted. The effects of CCR1 inhibitors (BX471 and CCX354) were evaluated using acute injury models, Pde6b rd10 mice in the current study and photic-injury model in our previous work 20 , where the majority of photoreceptors degenerated within a 4 to 6 days window. The rapid progression of this degenerative model contrasts with the more gradual course characteristic of human retinal degeneration. Nevertheless, our findings in Crb1 rd8/rd8 mice, which exhibit a slower and milder form of degeneration, demonstrate the effectiveness of long-term CCR1 inhibition to modulate retinal degeneration. In conclusion, the current study combined with previous literature implicates Müller cell activation in retinal degeneration and AMD. In addition, we show that CCR1 signaling constitute a common injury pathway in retinal injury. Further research should be performed to evaluate if CCR1 inhibition may serve as a potential therapeutic strategy for common blinding diseases such as AMD and IRDs. analysis. The results were presented as the mean fold change ± the standard error of the mean (SEM). Declarations Authors contributions Conceptualization: SEH, IC. Methodology: SEH, SJ, AK, YS. Investigation: SEH, LO. Visualization: SEH, IC. Formal analysis: SEH, BR, MEM. Supervision: IC. Writing—original draft: SEH, IC. Funding This work was supported in part by grants from the Israel Science Foundation (#2080/23), by the Jonas Friedenwald Cathedra in Ophthalmological Research, and by a grant from the Israeli Ministry of Science (#0007972). Data Availability All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Ethical approval All procedures were conducted according to the Ethics Committee of the Hebrew University, the Hadassah Medical Organization and the University of Pennsylvania. Competing interests The authors declare no competing interests. Sandro De Zanet, Stefanos Apostolopoulos, and Carlos Ciller are employees and shareholders of RetinAI Medical AG (Bern, Switzerland). References Vyawahare H, Shinde P. Age-Related Macular Degeneration: Epidemiology, Pathophysiology, Diagnosis, and Treatment. Cureus . 2022;14(9):e29583. doi:10.7759/cureus.29583 Leeuwen R Van, Klaver CCW, Vingerling JR, Hofman A, Jong PTVM De. The Risk and Natural Course of Age-Related Maculopathy. Arch Ophthalmol . 2003;121:519-526. doi:10.1001/archopht.121.4.519 Regillo CD, Busbee BG, Ho AC, Ding B, Haskova Z. Baseline predictors of 12-month treatment response to ranibizumab in patients with wet age-related macular degeneration. Am J Ophthalmol . 2015;160(5):1014-1023.e2. doi:10.1016/j.ajo.2015.07.034 Heesterbeek TJ, Lorés-Motta L, Hoyng CB, Lechanteur YTE, den Hollander AI. Risk factors for progression of age-related macular degeneration. Ophthalmic Physiol Opt . 2020;40(2):140-170. doi:10.1111/opo.12675 Buschini E, Piras A, Nuzzi R, Vercelli A. Age related macular degeneration and drusen: neuroinflammation in the retina. Prog Neurobiol . 2011;95(1):14-25. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=21740956 Kauppinen A, Paterno JJ, Blasiak J, Salminen A, Kaarniranta K. Inflammation and its role in age-related macular degeneration. Cell Mol Life Sci . 2016;73(9):1765-1786. doi:10.1007/s00018-016-2147-8 Cao X, Shen D, Patel MM, et al. Macrophage polarization in the maculae of age-related macular degeneration: A pilot study. Pathol Int . 2011;61(9):528-535. doi:10.1111/j.1440-1827.2011.02695.x Lad EM, Cousins SW, Van Arnam JS, Proia AD. Abundance of infiltrating CD163+ cells in the retina of postmortem eyes with dry and neovascular age-related macular degeneration. Graefe’s Archive for Clinical and Experimental Ophthalmology . 2015;253(11):1941-1945. doi:10.1007/s00417-015-3094-z Buschini E, Piras A, Nuzzi R, Vercelli A. Age related macular degeneration and drusen: Neuroinflammation in the retina. Prog Neurobiol . 2011;95(1):14-25. doi:10.1016/j.pneurobio.2011.05.011 Gupta N, Brown KE, Milam AH. Activated microglia in human retinitis pigmentosa, late-onset retinal degeneration, and age-related macular degeneration. Exp Eye Res . 2003;76(4):463-471. doi:10.1016/S0014-4835(02)00332-9 Joo JH, Kim H, Shin JH, Moon SW. Aqueous humor cytokine levels through microarray analysis and a sub-analysis based on optical coherence tomography in wet age-related macular degeneration patients. BMC Ophthalmol . 2021;21(1):399. doi:10.1186/s12886-021-02152-6 Grunin M, Shira-Hagbi-Levi, Rinsky B, Smith Y, Chowers I. Transcriptome analysis on monocytes from patients with neovascular age-related macular degeneration. Sci Rep . 2016;6. doi:10.1038/srep29046 Nomiyama H, Osada N, Yoshie O. The evolution of mammalian chemokine genes. Cytokine Growth Factor Rev . 2010;21(4):253-262. doi:10.1016/j.cytogfr.2010.03.004 Gilchrist A, Echeverria SL. Targeting Chemokine Receptor CCR1 as a Potential Therapeutic Approach for Multiple Myeloma. Front Endocrinol (Lausanne) . 2022;13:846310. doi:10.3389/fendo.2022.846310 Yan J, Zuo G, Sherchan P, Huang L, Ocak U, Xu W, Travis ZD, Wang W, Zhang JH TJ. CCR1 Activation Promotes Neuroinflammation Through CCR1/TPR1/ERK1/2 Signaling Pathway After Intracerebral Hemorrhage in Mice. Neurotherapeutics . 2020;17(3):1170-1183. Lee MMK, Wong YH. CCR1-mediated activation of nuclear factor-kB in THP-1 monocytic cells involves pertussis toxin-insensitive Galpha (14) and Galpha (16) signaling cascades. J Leukoc Biol . 2009;86(6):1319-1329. doi:10.1189/jlb.0209052 Trebst C, Sørensen TL, Kivisäkk P, et al. CCR1+/CCR5+ mononuclear phagocytes accumulate in the central nervous system of patients with multiple sclerosis. Am J Pathol . 2001;159(5):1701-1710. doi:10.1016/S0002-9440(10)63017-9 Rottman JB, Slavin AJ, Silva R, Weiner HL, Gerard CG, Hancock WW. Leukocyte recruitment during onset of experimental allergic encephalomyelitis is CCR1 dependent. Eur J Immunol . 2000;30(8):2372-2377. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=10940928 Weber C, Weber KSC, Klier C, et al. Specialized roles of the chemokine receptors CCR1 and CCR5 in the recruitment of monocytes and TH1-like/CD45RO+ T cells. Blood . 2001;97(4):1144-1146. doi:10.1182/blood.V97.4.1144 Elbaz-Hayoun S, Rinsky B, Hagbi-Levi S, Grunin M, Chowers I. CCR1 mediates Müller cell activation and photoreceptor cell death in macular and retinal degeneration. Elife . 2023;12:1-28. doi:10.7554/eLife.81208 Reichenbach A, Bringmann A. New Functions of Muller Cells. Glia . 2013;61(5):651-678. doi:10.1002/glia.22477 Bringmann A, Wiedemann P. Müller Glial Cells in Retinal Disease. Ophtalmologica . 2012;227:1-19. doi:10.1159/000328979 Saddala MS, Lennikov A, Mukwaya A, Fan L, Hu Z, Huang H. Transcriptome-wide analysis of differentially expressed chemokine receptors, SNPs, and SSRs in the age-related macular degeneration. Hum Genomics . 2019;13(1):15. doi:10.1186/s40246-019-0199-1 Gigon A, Mosinska A, Montesel A, et al. Personalized Atrophy Risk Mapping in Age-Related Macular Degeneration. Transl Vis Sci Technol . 2021;10(13):18. doi:10.1167/tvst.10.13.18 Mantel I, Mosinska A, Bergin C, et al. Automated Quantification of Pathological Fluids in Neovascular Age-Related Macular Degeneration, and Its Repeatability Using Deep Learning. Transl Vis Sci Technol . 2021;10(4):17. doi:10.1167/tvst.10.4.17 Martin-Pinardel R, Izquierdo-Serra J, De Zanet S, et al. Artificial intelligence-based fluid quantification and associated visual outcomes in a real-world, multicentre neovascular age-related macular degeneration national database. Br J Ophthalmol . 2024;108(2):253-262. doi:10.1136/bjo-2022-322297 Jaskoll S, Shwartz Y, Kramer A, et al. Genetic Risk and OCT-Based Phenotypic Associations in Age-Related Macular Degeneration. Ophthalmology science . 2025;5(6):100853. doi:10.1016/j.xops.2025.100853 Mehalow AK, Kameya S, Smith RS, et al. CRB1 is essential for external limiting membrane integrity and photoreceptor morphogenesis in the mammalian retina. Hum Mol Genet . 2003;12(17):2179-2189. doi:10.1093/hmg/ddg232 Wang T, Reingruber J, Woodruff ML, et al. The PDE6 mutation in the rd10 retinal degeneration mouse model causes protein mislocalization and instability and promotes cell death through increased ion influx. J Biol Chem . 2018;293(40):15332-15346. doi:10.1074/jbc.RA118.004459 Pennesi ME, Michaels K V, Magee SS, et al. Long-term characterization of retinal degeneration in rd1 and rd10 mice using spectral domain optical coherence tomography. Invest Ophthalmol Vis Sci . 2012;53(8):4644-4656. doi:10.1167/iovs.12-9611 Mattapallil MJ, Wawrousek EF, Chan CC, et al. The Rd8 mutation of the Crb1 gene is present in vendor lines of C57BL/6N mice and embryonic stem cells, and confounds ocular induced mutant phenotypes. Invest Ophthalmol Vis Sci . 2012;53(6):2921-2927. doi:10.1167/iovs.12-9662 Gao JL, Wynn TA, Chang Y, et al. Impaired host defense, hematopoiesis, granulomatous inflammation and type 1-type 2 cytokine balance in mice lacking CC chemokine receptor 1. J Exp Med . 1997;185(11):1959-1968. doi:10.1084/jem.185.11.1959 Chang B, Hawes NL, Pardue MT, et al. Two mouse retinal degenerations caused by missense mutations in the beta-subunit of rod cGMP phosphodiesterase gene. Vision Res . 2007;47(5):624-633. doi:10.1016/j.visres.2006.11.020 Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods . 2001;25(4):402-408. doi:10.1006/meth.2001.1262 Banin E, Obolensky A, Idelson M, et al. Retinal incorporation and differentiation of neural precursors derived from human embryonic stem cells. Stem Cells . 2006;24(2):246-257. doi:10.1634/stemcells.2005-0009 Yao Y, Li J, Zhou Y, et al. Macrophage/microglia polarization for the treatment of diabetic retinopathy. Front Endocrinol (Lausanne) . 2023;14:1276225. doi:10.3389/fendo.2023.1276225 Heuss ND, Pierson MJ, Roehrich H, et al. Optic nerve as a source of activated retinal microglia post-injury. Acta Neuropathol Commun . 2018;6(1):66. doi:10.1186/s40478-018-0571-8 Benhar I, Reemst K, Kalchenko V, Schwartz M. The retinal pigment epithelium as a gateway for monocyte trafficking into the eye. EMBO J . 2016;35(11):1219-1235. doi:10.15252/embj.201694202 Le K, Sun J, Ghaemmaghami J, et al. Blockade of CCR1 induces a phenotypic shift in macrophages and triggers a favorable antilymphoma activity. Blood Adv . 2023;7(15):3952-3967. doi:10.1182/bloodadvances.2022008722 Stikker B, Stik G, Hendriks RW, Stadhouders R. Severe COVID-19 associated variants linked to chemokine receptor gene control in monocytes and macrophages. bioRxiv . Published online June 11, 2021. doi:10.1101/2021.01.22.427813 Li H, Pan T, Gao L, et al. Chemokine receptor CCR1 regulates macrophage activation through mTORC1 signaling in nonalcoholic steatohepatitis. Metabolism . 2024;151:155758. doi:10.1016/j.metabol.2023.155758 Sahu B, Chavali VRM, Alapati A, et al. Presence of rd8 mutation does not alter the ocular phenotype of late-onset retinal degeneration mouse model. Mol Vis . 2015;21:273-284. Saul AB, Cui X, Markand S, Smith SB. Detailed electroretinographic findings in rd8 mice. Doc Ophthalmol . 2017;134(3):195-203. doi:10.1007/s10633-017-9585-y Luhmann UFO, Carvalho LS, Holthaus SM kleine, et al. The severity of retinal pathology in homozygous Crb1rd8/rd8 mice is dependent on additional genetic factors. Hum Mol Genet . 2015;24(1):128-141. doi:10.1093/hmg/ddu424 Aredo B, Zhang K, Chen X, Wang CXZ, Li T, Ufret-Vincenty RL. Differences in the distribution, phenotype and gene expression of subretinal microglia/macrophages in C57BL/6N (Crb1 rd8/rd8) versus C57BL6/J (Crb1 wt/wt) mice. J Neuroinflammation . 2015;12:6. doi:10.1186/s12974-014-0221-4 Davis BM, Salinas-Navarro M, Cordeiro MF, Moons L, De Groef L. Characterizing microglia activation: a spatial statistics approach to maximize information extraction. Sci Rep . 2017;7(1):1576. doi:10.1038/s41598-017-01747-8 Ronning KE, Karlen SJ, Burns ME. Structural and functional distinctions of co-resident microglia and monocyte-derived macrophages after retinal degeneration. J Neuroinflammation . 2022;19(1):299. doi:10.1186/s12974-022-02652-2 Perry VH, Hume DA, Gordon S. Immunohistochemical localization of macrophages and microglia in the adult and developing mouse brain. Neuroscience . 1985;15(2):313-326. doi:10.1016/0306-4522(85)90215-5 Lyu Y, Zauhar R, Dana N, et al. Implication of specific retinal cell-type involvement and gene expression changes in AMD progression using integrative analysis of single-cell and bulk RNA-seq profiling. Sci Rep . 2021;11(1):15612. doi:10.1038/s41598-021-95122-3 Wu KHC, Madigan MC, Billson FA, Penfold PL. Differential expression of GFAP in early v late AMD: a quantitative analysis. Br J Ophthalmol . 2003;87(9):1159-1166. doi:10.1136/bjo.87.9.1159 Weatherly SM, Collin GB, Charette JR, et al. Identification of Arhgef12 and Prkci as genetic modifiers of retinal dysplasia in the Crb1rd8 mouse model. PLoS Genet . 2022;18(6):e1009798. doi:10.1371/journal.pgen.1009798 Hippert C, Graca AB, Barber AC, et al. Müller glia activation in response to inherited retinal degeneration is highly varied and disease-specific. PLoS One . 2015;10(3):e0120415. doi:10.1371/journal.pone.0120415 Kang S, Larbi D, Andrade M, Reardon S, Reh TA, Wohl SG. A Comparative Analysis of Reactive Müller Glia Gene Expression After Light Damage and microRNA-Depleted Müller Glia-Focus on microRNAs. Front Cell Dev Biol . 2020;8:620459. doi:10.3389/fcell.2020.620459 Rutar M, Natoli R, Chia R, Valter K, Provis JM. Chemokine-mediated inflammation in the degenerating retina is coordinated by Muller cells, activated microglia, and retinal pigment epithelium. J Neuroinflammation . 2015;12. doi:10.1186/s12974-014-0224-1 Arroba AI, Alvarez-Lindo N, van Rooijen N de la REJ. Microglia-Müller glia crosstalk in the rd10 mouse model of retinitis pigmentosa. Adv Exp Med Biol . 2014;801:373-379. Chen X, Kezic J, Bernard C, McMenamin PG. Rd8 mutation in the Crb1 gene of CD11c-eYFP transgenic reporter mice results in abnormal numbers of CD11c-positive cells in the retina. J Neuropathol Exp Neurol . 2013;72(8):782-790. doi:10.1097/NEN.0b013e31829e8375 Kaufmann a, Salentin R, Gemsa D, Sprenger H. Increase of CCR1 and CCR5 expression and enhanced functional response to MIP-1 alpha during differentiation of human monocytes to macrophages. J Leukoc Biol . 2001;69(2):248-252. Bujakowska K, Audo I, Mohand-Saïd S, et al. CRB1 mutations in inherited retinal dystrophies. Hum Mutat . 2012;33(2):306-315. doi:10.1002/humu.21653 Wang Y, Abu-Asab MS, Yu CR, et al. Platelet-derived growth factor (PDGF)-C inhibits neuroretinal apoptosis in a murine model of focal retinal degeneration. Lab Invest . 2014;94(6):674-682. doi:10.1038/labinvest.2014.60 Lee S, Varvel NH, Konerth ME, et al. CX3CR1 deficiency alters microglial activation and reduces beta-amyloid deposition in two Alzheimer’s disease mouse models. Am J Pathol . 2010;177(5):2549-2562. doi:10.2353/ajpath.2010.100265 Saederup N, Chan L, Lira SA, Charo IF. Fractalkine deficiency markedly reduces macrophage accumulation and atherosclerotic lesion formation in CCR2-/- mice: evidence for independent chemokine functions in atherogenesis. Circulation . 2008;117(13):1642-1648. doi:10.1161/CIRCULATIONAHA.107.743872 Combadière C, Potteaux S, Rodero M, et al. Combined inhibition of CCL2, CX3CR1, and CCR5 abrogates Ly6C(hi) and Ly6C(lo) monocytosis and almost abolishes atherosclerosis in hypercholesterolemic mice. Circulation . 2008;117(13):1649-1657. doi:10.1161/CIRCULATIONAHA.107.745091 Zhao L, Zabel MK, Wang X, et al. Microglial phagocytosis of living photoreceptors contributes to inherited retinal degeneration. EMBO Mol Med . 2015;7(9):e201505298. doi:10.15252/emmm.201505298 Ortega JT, Jastrzebska B. Neuroinflammation as a Therapeutic Target in Retinitis Pigmentosa and Quercetin as Its Potential Modulator. Pharmaceutics . 2021;13(11). doi:10.3390/pharmaceutics13111935 Canto A, Martínez-González J, Miranda M, Olivar T, Almansa I, Hernández-Rabaza V. Sulforaphane Modulates the Inflammation and Delays Neurodegeneration on a Retinitis Pigmentosa Mice Model. Front Pharmacol . 2022;13:811257. doi:10.3389/fphar.2022.811257 Yang H, Zhang H, Li X. Navigating the future of retinitis pigmentosa treatments: A comprehensive analysis of therapeutic approaches in rd10 mice. Neurobiol Dis . 2024;193:106436. doi:10.1016/j.nbd.2024.106436 Yang W, Xiong G, Lin B. Cyclooxygenase-1 mediates neuroinflammation and neurotoxicity in a mouse model of retinitis pigmentosa. J Neuroinflammation . 2020;17(1):306. doi:10.1186/s12974-020-01993-0 Peng B, Xiao J, Wang K, So KF, Tipoe GL, Lin B. Suppression of microglial activation is neuroprotective in a mouse model of human retinitis pigmentosa. J Neurosci . 2014;34(24):8139-8150. doi:10.1523/JNEUROSCI.5200-13.2014 Guadagni V, Biagioni M, Novelli E, Aretini P, Mazzanti CM, Strettoi E. Rescuing cones and daylight vision in retinitis pigmentosa mice. FASEB J . 2019;33(9):10177-10192. doi:10.1096/fj.201900414R Martínez-Fernández de la Cámara C, Hernández-Pinto AM, Olivares-González L, et al. Adalimumab Reduces Photoreceptor Cell Death in A Mouse Model of Retinal Degeneration. Sci Rep . 2015;5:11764. doi:10.1038/srep11764 Olivares-González L, Velasco S, Millán JM, Rodrigo R. Intravitreal administration of adalimumab delays retinal degeneration in rd10 mice. FASEB J . 2020;34(10):13839-13861. doi:10.1096/fj.202000044RR Nortey A, Garces K, Carmy-Bennun T, Hackam AS. The cytokine IL-27 reduces inflammation and protects photoreceptors in a mouse model of retinal degeneration. J Neuroinflammation . 2022;19(1):216. doi:10.1186/s12974-022-02576-x Garces K, Carmy T, Illiano P, Brambilla R, Hackam AS. Increased Neuroprotective Microglia and Photoreceptor Survival in the Retina from a Peptide Inhibitor of Myeloid Differentiation Factor 88 (MyD88). J Mol Neurosci . 2020;70(6):968-980. doi:10.1007/s12031-020-01503-0 Karlen SJ, Miller EB, Wang X, Levine ES, Zawadzki RJ, Burns ME. Monocyte infiltration rather than microglia proliferation dominates the early immune response to rapid photoreceptor degeneration. J Neuroinflammation . 2018;15(1):344. doi:10.1186/s12974-018-1365-4 Sennlaub F, Auvynet C, Calippe B, et al. CCR2(+) monocytes infiltrate atrophic lesions in age-related macular disease and mediate photoreceptor degeneration in experimental subretinal inflammation in Cx3cr1 deficient mice. EMBO Mol Med . 2013;5(11):1775-1793. doi:10.1002/emmm.201302692 Gu S, Maurya S, Lona A, et al. Ligand-Dependent Mechanisms of CC Chemokine Receptor 5 (CCR5) Trafficking Revealed by APEX2 Proximity Labeling Proteomics. bioRxiv . Published online August 8, 2024. doi:10.1101/2023.11.01.565224 Black JB, Premont RT, Daaka Y. Feedback regulation of G protein-coupled receptor signaling by GRKs and arrestins. Semin Cell Dev Biol . 2016;50:95-104. doi:10.1016/j.semcdb.2015.12.015 Grady E, Böhm S, McConalogue K, et al. Mechanisms attenuating cellular responses to neuropeptides: extracellular degradation of ligands and desensitization of receptors. J Investig Dermatol Symp Proc . 1997;2(1):69-75. doi:10.1038/jidsymp.1997.14 Cardona AE, Sasse ME, Liu L, et al. Scavenging roles of chemokine receptors: chemokine receptor deficiency is associated with increased levels of ligand in circulation and tissues. Blood . 2008;112(2):256-263. doi:10.1182/blood-2007-10-118497 Changeux J, Edelstein SJ. Allosteric mechanisms in normal and pathological nicotinic acetylcholine receptors. Curr Opin Neurobiol . 2001;11(3):369-377. doi:10.1016/s0959-4388(00)00221-x Additional Declarations No competing interests reported. Supplementary Files CCR1SignalingasaCommonInjuryPathwayinRetinalDegenerationsupplementarymaterials.docx Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 27 Feb, 2026 Reviews received at journal 26 Feb, 2026 Reviews received at journal 26 Feb, 2026 Reviews received at journal 24 Feb, 2026 Reviewers agreed at journal 20 Feb, 2026 Reviewers agreed at journal 18 Feb, 2026 Reviewers agreed at journal 17 Feb, 2026 Reviewers agreed at journal 17 Feb, 2026 Reviewers invited by journal 17 Feb, 2026 Editor assigned by journal 13 Feb, 2026 Submission checks completed at journal 11 Feb, 2026 First submitted to journal 03 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8775900","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Case Report","associatedPublications":[],"authors":[{"id":593489767,"identity":"1a10bc5d-8fbb-428b-9375-866073cb106c","order_by":0,"name":"Sarah Elbaz-Hayoun","email":"","orcid":"","institution":"Hadassah-Hebrew University Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Sarah","middleName":"","lastName":"Elbaz-Hayoun","suffix":""},{"id":593489768,"identity":"325143fe-6161-4e30-b615-ee94bb456bd3","order_by":1,"name":"Shlomit Jaskoll","email":"","orcid":"","institution":"Hadassah-Hebrew University Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Shlomit","middleName":"","lastName":"Jaskoll","suffix":""},{"id":593489769,"identity":"6b9c5b00-ab6c-44c7-80f7-1aef9b6d2909","order_by":2,"name":"Adi Kramer","email":"","orcid":"","institution":"Hadassah-Hebrew University Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Adi","middleName":"","lastName":"Kramer","suffix":""},{"id":593489770,"identity":"424d6dd0-8d3e-49ae-bf80-03b0fabeb5c7","order_by":3,"name":"Lian Omari","email":"","orcid":"","institution":"Hadassah-Hebrew University Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Lian","middleName":"","lastName":"Omari","suffix":""},{"id":593489771,"identity":"2de2d7e0-be71-403b-a3d4-3705d636c9dd","order_by":4,"name":"Batya Rinsky","email":"","orcid":"","institution":"Hadassah-Hebrew University Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Batya","middleName":"","lastName":"Rinsky","suffix":""},{"id":593489772,"identity":"6995d42a-4bb9-4292-9a60-c0ffa9950f2a","order_by":5,"name":"Maya Eiger-Moscovich","email":"","orcid":"","institution":"Hadassah-Hebrew University Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Maya","middleName":"","lastName":"Eiger-Moscovich","suffix":""},{"id":593489773,"identity":"09d56566-3baa-457a-a721-9f8217d696fd","order_by":6,"name":"Ying Song","email":"","orcid":"","institution":"Scheie Eye Institute, University of Pennsylvania Perelman School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Song","suffix":""},{"id":593489774,"identity":"065840c3-807e-4549-85e2-7e65269a7eb0","order_by":7,"name":"Joshua L Dunaief","email":"","orcid":"","institution":"Scheie Eye Institute, University of Pennsylvania Perelman School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Joshua","middleName":"L","lastName":"Dunaief","suffix":""},{"id":593489775,"identity":"39ffd12b-5b2b-41d8-8fb8-41f53786e1c8","order_by":8,"name":"Sandro De Zanet","email":"","orcid":"","institution":"RetinAI Medical AG","correspondingAuthor":false,"prefix":"","firstName":"Sandro","middleName":"","lastName":"De Zanet","suffix":""},{"id":593489776,"identity":"e72a30e1-92b3-4a4e-9052-6c12f55c859f","order_by":9,"name":"Stefanos Apostolopoulos","email":"","orcid":"","institution":"RetinAI Medical AG","correspondingAuthor":false,"prefix":"","firstName":"Stefanos","middleName":"","lastName":"Apostolopoulos","suffix":""},{"id":593489777,"identity":"8bf17e6d-094a-4497-b6b7-26d777cf5ec8","order_by":10,"name":"Carlos Ciller","email":"","orcid":"","institution":"RetinAI Medical AG","correspondingAuthor":false,"prefix":"","firstName":"Carlos","middleName":"","lastName":"Ciller","suffix":""},{"id":593489778,"identity":"0d891119-2042-43bc-b266-e3df6f778add","order_by":11,"name":"Itay Chowers","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8UlEQVRIiWNgGAWjYDACCQglZ8DAYABiJED4BhYEtRija5EgqCVxA6oWBtxa+Gc3H5P4uKcufTv74Y0ff/yxy2Ng7338gqEAtxaJO8fSJGc8O5y7syetWJq3LbmYgee4mQU+hxlI5Jjd5jlwIHfDgRwDacYG5sQGiTQ2A4Ja/hyoSzc4/8b4548/9URqYTjAnGBwI8dMgoftMEgL8wN8WiRupKX/7Dlw2HDDjWdl1rxtxxPbeI6xMSTg0cI/I/mwwY8DdfIG55M33/zxpzqxn72N+cOHPzY4tWACNiCSSCBBAxgwfyBVxygYBaNgFAxrAABzBFOM3pAcagAAAABJRU5ErkJggg==","orcid":"","institution":"Hadassah-Hebrew University Medical Center","correspondingAuthor":true,"prefix":"","firstName":"Itay","middleName":"","lastName":"Chowers","suffix":""}],"badges":[],"createdAt":"2026-02-03 12:39:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8775900/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8775900/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":103176270,"identity":"b29444a3-7668-4321-acec-cb1cb8614f7e","added_by":"auto","created_at":"2026-02-22 16:34:52","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":747565,"visible":true,"origin":"","legend":"\u003cp\u003eCCR1 expression in retina from AMD patients. (\u003cstrong\u003eA–F\u003c/strong\u003e) Retinal sections from a healthy donor were immunostained for IBA-1 (\u003cstrong\u003eA\u003c/strong\u003e), CCR1 (\u003cstrong\u003eB, E\u003c/strong\u003e), and GFAP (\u003cstrong\u003eD\u003c/strong\u003e). Co-localization of IBA-1 and CCR1 was observed in the IPL and INL (\u003cstrong\u003eC\u003c/strong\u003e), indicating resting retinal microglial distribution. No co-localization was detected between GFAP and CCR1 (\u003cstrong\u003eF\u003c/strong\u003e), suggesting the absence of Müller cell activation (gliosis) in the healthy retina. (\u003cstrong\u003eG–Q\u003c/strong\u003e) In retinal sections nnvAMD patient, IBA-1⁺/CCR1⁺ macrophages (\u003cstrong\u003eG-I\u003c/strong\u003e, orange arrowheads) were identified in the choroid adjacent to drusen deposits (\u003cstrong\u003eG-I,\u003c/strong\u003e arrows). Drusen formation was detected by the presence of vacuole-like structures extending from Bruch’s membrane toward the RPE, as observed by light microscopy (\u003cstrong\u003eJ\u003c/strong\u003e, red arrow), and subsequently confirmed by Hematoxylin and eosin (H\u0026amp;E) staining (\u003cstrong\u003eK\u003c/strong\u003e, red arrow). Increased IBA-1/CCR1 signal intensity was also detected in the overlying retina (\u003cstrong\u003eG–I\u003c/strong\u003e), indicating activated microglia/macrophages. IBA-1⁺/CCR1⁺ cells were also observed in the vicinity of the ONH \u003cstrong\u003e(L–N\u003c/strong\u003e). Unlike healthy retina, CCR1 expression was evident in GFAP⁺ Müller cells (\u003cstrong\u003eO–Q)\u003c/strong\u003e. (\u003cstrong\u003eR-Z'\u003c/strong\u003e) In retinal sections from a patient with neovascular age-related macular degeneration (nvAMD), a marked increase in migrating IBA-1⁺/CCR1⁺ cells were noted towards the thickened ONL (\u003cstrong\u003eR–T\u003c/strong\u003e). Enhanced GFAP/CCR1 co-localization staining in Müller cells was observed in the proximity of fibrotic retinal area, where the laminar structure was still preserved (\u003cstrong\u003eU–W\u003c/strong\u003e). H\u0026amp;E staining revealed a fibrotic region (X, red-dashed rectangle), accompanied by atrophy of the ONL (\u003cstrong\u003eY\u003c/strong\u003e) and the presence of hypertrophic Müller cells (\u003cstrong\u003eZ\u003c/strong\u003e, white arrows) in the surrounding area. In contrast, regions located further from the fibrotic site exhibited a thicker ONL and absence of detectable Müller cell structures (\u003cstrong\u003eZ')\u003c/strong\u003e. GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer; IPL, inner plexiform layer. Scale bars: 200 µm (\u003cstrong\u003eA-C, L-N, R-T, X\u003c/strong\u003e), 100 µm (\u003cstrong\u003eG-I, Y\u003c/strong\u003e), 50 µm (\u003cstrong\u003eD-F, O-Q, U-W, Z-Z'\u003c/strong\u003e), 20 µm (\u003cstrong\u003eJ-K\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8775900/v1/31279c990ed91bfbde21c383.jpeg"},{"id":103176272,"identity":"561fffd2-7cd3-4b65-a13c-6ba65ecbc9bf","added_by":"auto","created_at":"2026-02-22 16:34:52","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":566798,"visible":true,"origin":"","legend":"\u003cp\u003eRetinal imaging, histology and inflammation in Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003erd8\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003emice at 15 months of age. (\u003cstrong\u003eA-D\u003c/strong\u003e) Increased hyper-autofluorescence lesions were detected in Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003erd8\u003c/sup\u003e mice (\u003cstrong\u003eB\u003c/strong\u003e) but less in wild-type mice (\u003cstrong\u003eA\u003c/strong\u003e) and Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003erd8\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003emice (\u003cstrong\u003eC\u003c/strong\u003e, \u003cstrong\u003eD\u003c/strong\u003e). (\u003cstrong\u003eE\u003c/strong\u003e) Automated quantification of retinal hyper-autofluorescent lesions demonstrated markedly reduced number of lesion in Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003e rd8\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003emice at the age of 15 and 18 months compared to 15-month-old Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003erd8 \u003c/sup\u003emice; (n≥ 5 per group). (\u003cstrong\u003eF-O)\u003c/strong\u003e Hypo-autofluorescent lesion was also detected in Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003erd8 \u003c/sup\u003e(red circle\u003cstrong\u003e; F-G\u003c/strong\u003e); this lesion correlated with disruption in retinal layers observed in OCT (\u003cstrong\u003eH, I\u003c/strong\u003e displayed at higher magnification), and in histological sections of the same region (\u003cstrong\u003eJ\u003c/strong\u003e). Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003erd8\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e exhibited a preserved retinal structure (\u003cstrong\u003eK-O\u003c/strong\u003e). (\u003cstrong\u003eP-R\u003c/strong\u003e) Histological analysis confirmed thinning of the outer plexiform layer (OPL) (red dashed lines; \u003cstrong\u003eP\u003c/strong\u003e) in Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003erd8\u003c/sup\u003e mice. Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003erd8\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003emice maintained normal retinal thickness, whereas Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003erd8\u003c/sup\u003e mice showed a notable thinning (n ≥3 per group, \u003csup\u003e$\u003c/sup\u003ep=wild type vs. Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e, and *p=Crb1\u003csup\u003erd8/rd8 \u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e vs. Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e; \u003cstrong\u003eQ, R\u003c/strong\u003e). GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer; RPE, retinal pigment epithelium. Data shown as mean ± SEM. p-values indicated by *p\u0026lt;0.01, \u003csup\u003e$\u003c/sup\u003ep\u0026lt;0.01 and\u003csup\u003e \u003c/sup\u003e**p\u0026lt;0.01, one-way ANOVA with correction for multiple comparisons. Scale bars: 200 µm (\u003cstrong\u003eA-D, F-H, K-M, Q\u003c/strong\u003e); 100 µm \u003cstrong\u003e(I, J, N, O, P\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8775900/v1/9191ffcff1332304c5cf3f39.jpeg"},{"id":103505176,"identity":"331b3169-fc1a-415b-b04d-28dd3f0c3880","added_by":"auto","created_at":"2026-02-26 13:26:25","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":606915,"visible":true,"origin":"","legend":"\u003cp\u003eInflammation in Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003e rd8\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003emice retina. (\u003cstrong\u003eA-O\u003c/strong\u003e) Immune cell distribution in retina sections from Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003e rd8 \u003c/sup\u003emice and Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003e rd8\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice at 15 months, and age-matched wild-type mice. No cells were detected above the RPE layer in Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003erd8\u003c/sup\u003e/Ccr1\u003csup\u003e-/- \u003c/sup\u003emice (\u003cstrong\u003eA\u003c/strong\u003e), whereas numerous cells were detected in Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003erd8 \u003c/sup\u003emice (\u003cstrong\u003eB\u003c/strong\u003e, red arrows).\u0026nbsp; Immunostaining for CD11b indicated that these cells were immune cells (\u003cstrong\u003eC\u003c/strong\u003e, yellow arrow). CD11b immunostaining (\u003cstrong\u003eD-L\u003c/strong\u003e) revealed activated microglial and recruited macrophages cell in Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003erd8\u003c/sup\u003e mice, indicated by presence of CD11b+ cells in the outer retina and vitreous (\u003cstrong\u003eE\u003c/strong\u003e, yellow arrow and yellow arrowheads, respectively). Few immune cells were detected above the RPE in Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003e rd8\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice (yellow arrows, \u003cstrong\u003eF\u003c/strong\u003e) whereas no cells are detected in wild-type mice (\u003cstrong\u003eD\u003c/strong\u003e). Activation was also note by typical amoeboid cell structure in the IPL layer (I) and increased cell body size in the OPL (\u003cstrong\u003eJ\u003c/strong\u003e) in contrast with elongated cell structure observed in the IPL layer of the Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003erd8\u003c/sup\u003e/Ccr1\u003csup\u003e-/- \u003c/sup\u003e(\u003cstrong\u003eK)\u003c/strong\u003e\u003csup\u003e \u003c/sup\u003eand wild-type mice (\u003cstrong\u003eG\u003c/strong\u003e) and normal cell body size in the OPL (\u003cstrong\u003eH, L\u003c/strong\u003e). Quantification of the CD11b+ cells across the mice groups revealed similar number of cells in the IPL (\u003cstrong\u003eM\u003c/strong\u003e) and the OPL (\u003cstrong\u003eN\u003c/strong\u003e) layers, whereas increased CD11b+ cells number was observed in the OS layer of Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003erd8\u003c/sup\u003e mice, suggesting enhanced macrophage/microglia cell activation (\u003cstrong\u003eO\u003c/strong\u003e). (\u003cstrong\u003eP-S\u003c/strong\u003e) Increased GFAP staining, suggestive of Müller cell gliosis, is evident in Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003erd8\u003c/sup\u003e mice (\u003cstrong\u003eQ\u003c/strong\u003e- yellow arrows; R-higher magnification, yellow arrowheads), compared with Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003erd8\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e (\u003cstrong\u003eS\u003c/strong\u003e), and wild-type mice (\u003cstrong\u003eP\u003c/strong\u003e). (\u003cstrong\u003eT-Y\u003c/strong\u003e) qPCR analysis of pro-inflammatory genes revealed a reduced level of retinal inflammation in Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003e rd8\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice at the age of 15- and 18-months, and 15-month-old wild-type mice compared to 15-month-old Crb1\u003csup\u003erd8\u003c/sup\u003e/\u003csup\u003e rd8\u003c/sup\u003e mice (n ≥6 per group). GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer; RPE, retinal pigment epithelium. Data shown as mean ± SEM. p-values indicated by *p\u0026lt;0.01, **p\u0026lt;0.001 and ***p\u0026lt;0.0001; one-way ANOVA with correction for multiple comparisons. Scale bars: 200 µm (\u003cstrong\u003eD-F\u003c/strong\u003e and \u003cstrong\u003eP-S\u003c/strong\u003e); 50 µm (R); 20 µm (\u003cstrong\u003eA-C\u003c/strong\u003e and \u003cstrong\u003eG-L\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8775900/v1/4b9e70680a81a50eda5b9889.jpeg"},{"id":103176269,"identity":"42d67645-7239-435b-9e86-bfc82bfc2f4c","added_by":"auto","created_at":"2026-02-22 16:34:52","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":533560,"visible":true,"origin":"","legend":"\u003cp\u003eElectrophysiology and histology of Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice retina. (\u003cstrong\u003eA-F\u003c/strong\u003e) Electroretinogram (ERG) analysis at P21 revealed an increased b-wave amplitude in Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice compared with Pde6b\u003csup\u003erd10\u003c/sup\u003e mice (\u003cstrong\u003eA, B\u003c/strong\u003e). The b-wave amplitude in Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice remained stable between P21-P35, indicating the absence of retinal degeneration in these mice (n≥4 per group\u003cstrong\u003e; A-F\u003c/strong\u003e). No difference was observed in the b-wave amplitude between the Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice and the Pde6b\u003csup\u003erd10\u003c/sup\u003e mice at P26 and P35 (\u003cstrong\u003eC-F\u003c/strong\u003e). (\u003cstrong\u003eG-T\u003c/strong\u003e) Similar ONL thickness (yellow-dashed line) was recorded among the three mice groups at P14 (\u003cstrong\u003eG-J\u003c/strong\u003e), whereas ONL thinning was observed at P21 and P35 in both Pde6b\u003csup\u003erd10\u003c/sup\u003e and Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice (\u003cstrong\u003eK-P, Q-T\u003c/strong\u003e respectively). At P21, Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice exhibited a trend towards increased ONL thickness compared with Pde6b\u003csup\u003erd10\u003c/sup\u003e (n≥4 per group; \u003cstrong\u003eP\u003c/strong\u003e). DAPI staining of retinal sections from the three groups revealed variable photoreceptor degeneration across retina regions at P21 in Pde6b\u003csup\u003erd10 \u003c/sup\u003emice (\u003cstrong\u003eL\u003c/strong\u003e), and a notable ONL thinning in specific area (\u003cstrong\u003eL\u003c/strong\u003e, red arrow and higher magnification rectangle (\u003cstrong\u003eM\u003c/strong\u003e)) compared to Pdeb\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/- \u003c/sup\u003emice (\u003cstrong\u003eN-O\u003c/strong\u003e). ONL, outer nuclear layer. Data shown as mean ± SEM. p-values indicated by \u003csup\u003e$\u003c/sup\u003ep\u0026lt;0.001 compared Ccr1\u003csup\u003e-/-\u003c/sup\u003e vs. Pde6b\u003csup\u003erd10\u003c/sup\u003e and Pdeb\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e and *p\u0026lt;0.05 compared Pde6b\u003csup\u003erd10\u003c/sup\u003e vs. Pdeb\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e, one-way ANOVA with multiple comparisons. Scale bars: 200 µm (\u003cstrong\u003eG-S\u003c/strong\u003e), 50 µm (\u003cstrong\u003eM-N\u003c/strong\u003e, red rectangle).\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8775900/v1/a791742bbf0fc098d6747d54.jpeg"},{"id":103176271,"identity":"896756a1-045e-4f3b-af04-e0e7f74cde2c","added_by":"auto","created_at":"2026-02-22 16:34:52","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":389588,"visible":true,"origin":"","legend":"\u003cp\u003eqPCR analysis of pro-inflammatory genes expression in Ccr1\u003csup\u003e-/-\u003c/sup\u003e, Pde6b\u003csup\u003erd10\u003c/sup\u003e, and Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice. (\u003cstrong\u003eA-H\u003c/strong\u003e) Distinct gene expression profiles were detected for Pde6b\u003csup\u003erd10\u003c/sup\u003e and Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice at P21 and P35 (n≥6 per group). (\u003cstrong\u003eI-N\u003c/strong\u003e) Immunohistochemical detection of GFAP in retinal sections from Ccr1\u003csup\u003e⁻/⁻\u003c/sup\u003e, Pde6b\u003csup\u003erd10\u003c/sup\u003e and Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e⁻/⁻\u003c/sup\u003e mice validated qPCR results, in showing activation of Müller cell gliosis at P21 (\u003cstrong\u003eJ, K\u003c/strong\u003e), with a marked increase in GFAP expression observed by P35 (\u003cstrong\u003eM, N\u003c/strong\u003e) when compared to Ccr1\u003csup\u003e⁻/⁻\u003c/sup\u003e mice (\u003cstrong\u003eI, L\u003c/strong\u003e). No GFAP signal was detected in Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice at either P21 or P35 (\u003cstrong\u003eI, L\u003c/strong\u003e). GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer. Data shown as mean ± SEM. p-Values indicated by *p\u0026lt;0.01, **p\u0026lt;0.002, ***p\u0026lt;0.0002, ****p\u0026lt;0.00002; one-way ANOVA with correction for multiple comparisons. Scale bars: 200 µm (I-N).\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8775900/v1/8937f50f3fc0217045b8aa58.jpeg"},{"id":103505019,"identity":"9b8395a9-dbca-4741-86f4-ce0706111fa1","added_by":"auto","created_at":"2026-02-26 13:22:29","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":334526,"visible":true,"origin":"","legend":"\u003cp\u003ePharmacologic inhibition of CCR1 during retinal degeneration in Pde6b\u003csup\u003erd10 \u003c/sup\u003emice.\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e) A diagram showing the experimental procedure of the pharmacological CCR1 inhibition with BX471 and CCX354 in Pde6b\u003csup\u003erd10 \u003c/sup\u003emice. ERGs were recorded at P21 (baseline) and at P25 (end of the experiment) for both treated and the untreated groups. CCR1-antagonist or vehicle were injected subcutaneously twice-daily (red arrows). (\u003cstrong\u003eB, I)\u003c/strong\u003e Representative results of ERG recordings performed at P21 and P25 for the vehicle, BX471 and CCX354-treated groups. (\u003cstrong\u003eC, J\u003c/strong\u003e) At P21 ERG analysis revealed similar b-wave amplitudes in treated and control groups. (\u003cstrong\u003eC\u003c/strong\u003e) At P25, BX471-treated mice exhibited a larger mean b-wave amplitude compared to the vehicle-treated group (n≥12 per group). (\u003cstrong\u003eD, K\u003c/strong\u003e) Percentage reduction of b-wave amplitude at P25 vs. P21 were calculated for the vehicle (\u003cstrong\u003eD, K\u003c/strong\u003e), BX471(\u003cstrong\u003eD\u003c/strong\u003e) and CCX354 (\u003cstrong\u003eK\u003c/strong\u003e) groups (n≥12 or 9 per group respectively). (\u003cstrong\u003eE-L\u003c/strong\u003e) ONL thickness measurement at P25 in vehicle (\u003cstrong\u003eE, F\u003c/strong\u003e), BX471 (\u003cstrong\u003eE\u003c/strong\u003e), and CCX354 (\u003cstrong\u003eL\u003c/strong\u003e) groups (n=6 or 9 per group, respectively). (\u003cstrong\u003eF-H\u003c/strong\u003e) qPCR analysis revealed similar expression levels of CCR1-ligands in BX471-treated and vehicle-treated\u003csup\u003e \u003c/sup\u003emice. Data shown as mean ± SEM. p-values indicated by *p\u0026lt;0.03, Student t-test.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8775900/v1/c68c4b874dd613ad11d3b280.jpeg"},{"id":103509257,"identity":"6502147c-7523-4409-952f-68090c210d03","added_by":"auto","created_at":"2026-02-26 13:57:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4559212,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8775900/v1/666de353-fe00-49b7-96b6-ab3a5e640078.pdf"},{"id":103176273,"identity":"dd715ba0-e0b1-484d-ae98-2b9ff37720e8","added_by":"auto","created_at":"2026-02-22 16:34:52","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":756879,"visible":true,"origin":"","legend":"","description":"","filename":"CCR1SignalingasaCommonInjuryPathwayinRetinalDegenerationsupplementarymaterials.docx","url":"https://assets-eu.researchsquare.com/files/rs-8775900/v1/1dc9e4ede44adf6000d08a60.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"CCR1 Signaling as a Common Injury Pathway in Retinal Degeneration","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAge-related macular degeneration (AMD) is the leading cause of blindness in the Western world, affecting\u0026thinsp;~\u0026thinsp;30% of individuals aged\u0026thinsp;\u0026ge;\u0026thinsp;75 years, or ~\u0026thinsp;196\u0026nbsp;million individuals globally\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. With increasing life expectancy, the prevalence of AMD is expected to further rise. AMD has two main forms: non-neovascular (nnvAMD) and neovascular (nAMD). The non-neovascular form is marked by drusen deposits under the photoreceptors or retinal pigment epithelium (RPE), and may progress to confluent areas of atrophy, involving the RPE and photoreceptor layers, leading to substantial visual loss. nAMD involves the development of abnormal choroidal or retinal blood vessel, and if untreated often leads to marked vision loss\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. While effective therapies are available for nAMD, the therapeutic options for the more common nnvAMD form are limited and are associated with insufficient efficacy and significant complications\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eMultiple risk factors, such as older age, genetic predispositions, lipid metabolism alterations, and lifestyle, were associated with the initiation and progression of atrophy in AMD\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Inflammation was also shown to have a major role in AMD development\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Specifically, activation of the complement cascade and the inflammasome, as well as mononuclear cells activation were associated with AMD development and progression\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eMononuclear cells were detected at the vicinity of AMD atrophic and neovascular lesions\u003csup\u003e\u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e, and chemokine signaling, particularly the CCL2/CCR2 and CX3CL1/CX3CR1 pathways were associated with recruitment of monocytes during AMD progression. Increased CCL2 level was reported in the aqueous humor in AMD\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e, and we have previously reported of specific signature of monocyte gene expression in AMD patients, including elevated expression of CCR1 and CCR2 compared to healthy controls\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eA total of 22 chemokine receptors have been identified in humans, classified into four families based on the spacing of cysteine residues in their amino acid sequences\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. The CCR1 receptor was the first human CC chemokine receptor to be discovered and, like all other chemokine receptors, it signals through a G protein-coupled receptor (GPCR) mechanism\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. It is expressed on various hematopoietic cells, including lymphocytes, monocytes, and dendritic cells, where it mediates several biological functions related to leukocyte infiltration\u003csup\u003e\u003cspan additionalcitationids=\"CR16 CR17 CR18\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. Our previous work identified CCR1 as a potential significant player in retinal degeneration. Notably, we identified CCR1 expression on activated M\u0026uuml;ller glia cells during the course of retinal degeneration in mice\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. M\u0026uuml;ller macroglia cells spans the neurosensory retinal layers, and have both structural roles and multiple regulatory roles that are crucial for maintaining retinal homeostasis\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn our previous study, pharmacological inhibition of CCR1 led to reduced retinal damage following photic injury in mice\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. A recent transcriptome-wide analysis has revealed differential expression of \u003cem\u003eCCR1\u003c/em\u003e and \u003cem\u003eCCR5\u003c/em\u003e in the retina of AMD patients compared to healthy controls further implicating CCR1 in the disease\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Yet, the potential role of CCR1 in AMD and other retinal degenerative diseases has not been extensively investigated, and a comprehensive view of its involvement in the disease is lacking.\u003c/p\u003e \u003cp\u003eHere we investigated the contribution of CCR1 to AMD and IRDs progression. To that end, we characterized the expression of CCR1 in human AMD retina sections and performed genotype-phenotype analysis to assess potential correlation between \u003cem\u003eCCR1\u003c/em\u003e variants and macular atrophy (MA) progression. We also crossed Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e mice and Pde6b\u003csup\u003erd10\u003c/sup\u003e mice with \u003cem\u003eCcr1\u003c/em\u003e deficient mice to facilitate assessment of the impact of CCR1 loss of function on retinal structure, immune cell infiltration, and the retinal degeneration process. We then tested the effect of CCR1 antagonists in Pde6b\u003csup\u003erd10\u003c/sup\u003e mice to further validate the role of CCR1 in retinal degeneration. Combined, these experiments provided further support to the role of CCR1 signaling in retinal and macular degeneration.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments were conducted in accordance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research. Ethical approval for all protocols involving animals was approved by the Authority for Biological and Biomedical Models (ABBM) and the University Ethics Committee for the Care and Use of Laboratory Animals at the Hebrew University, which is certified by the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC) (ethical approval number: MD-21-16793-2, NIH approval\u003c/p\u003e\n\u003cp\u003enumber: OPRR-A01-5011). The study of de-identified human postmortem eyes was approved by the human Institutional Review Board (IRB) at the University of Pennsylvania. The study of imaging and genotyping data of human subject was approved by the IRB of the Hadassah Medical Organization (IRB #81916 HMO).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGenetic Variants in \u003cem\u003eCCR1\u003c/em\u003e\u003cbr\u003e\u003c/strong\u003eWe performed a genotype\u0026ndash;phenotype analysis to investigate for potential association among \u003cem\u003eCCR1\u003c/em\u003e variants and MA progression. Linear mixed-effects models (LMMs) were applied, adjusting for inter-eye correlation, age, and gender. This approach was selected to account for the inclusion of both eyes per patient and the longitudinal nature of the data.\u003c/p\u003e\n\u003cp\u003eIn total, 603 variants were identified across the \u003cem\u003eCCR1\u003c/em\u003e locus, obtained directly from our genotyping dataset by extracting all variants within chromosome 3, positions 46,201,711\u0026ndash;46,208,313 (GRCh38). Of these, 65 variants with a minor allele count \u0026gt;0 were tested as the primary fixed effects of interest. Age and gender were modeled as covariates, while random effects accounted for intra-patient correlation between eyes. These models were designed to evaluate differences in atrophy progression rates between carriers and non-carriers of \u003cem\u003eCCR1\u003c/em\u003e variants. To correct for multiple testing, p-values were adjusted using the Benjamini\u0026ndash;Hochberg false discovery rate (FDR) procedure.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOCT image annotation\u003cbr\u003e\u003c/strong\u003eAutomated quantification of atrophy lesion size was performed using a validated deep learning algorithm (RetinAI Discovery; Ikerian AG, Bern, Switzerland) deployed on a secure cloud-based platform. The platform enables segmentation of retinal layers and biomarkers in spectral-domain OCT (SD-OCT) scans acquired on the Spectralis HRA-OCT system (Heidelberg Engineering, Heidelberg, Germany). The RetinAI segmentation algorithm was trained and validated on manually annotated datasets from patients with atrophic, intermediate, and neovascular AMD, as well as other retinal diseases\u003csup\u003e24\u0026ndash;26\u003c/sup\u003e. Layers segmented included: retinal nerve fiber layer (NFL), ganglion cell layer with inner plexiform layer (IPL), inner nuclear layer (INL) with outer plexiform layer (OPL), outer nuclear layer (ONL) with Henle\u0026rsquo;s fiber layer, myoid zone, ellipsoid zone + outer photoreceptor segment + interdigitation zone, retinal pigmented epithelium, choroidal capillaries with choroidal stroma, and total retinal thickness (including fluid cavities and Bruch\u0026rsquo;s membrane). For eyes with multiple OCT acquisitions at the same visit, the mean and standard deviation of atrophy lesion area across the retina were calculated to assess consistency. Visits were excluded if the standard deviation exceeded 0.1 mm\u0026sup2;. Otherwise, one annotation was randomly selected for inclusion to ensure unbiased representation. Eyes were eligible for analysis only if they had \u0026ge;3 visits and at least 1 year of follow-up and were excluded if other macular pathologies (high myopia, diabetic macular edema, or central serous chorioretinopathy) were present or if image quality was insufficient for reliable automated segmentation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGenotyping\u003cbr\u003e\u003c/strong\u003eGenotype data were obtained as previously described\u003csup\u003e27\u003c/sup\u003e. Briefly, DNA was extracted from whole blood using the FlexiGene DNA Kit (Qiagen, Valencia, CA). Approximately 48% of samples were genotyped using a custom Illumina chip developed by the International AMD Genomics Consortium (IAMDGC), while 52% were genotyped on the Infinium Global Screening Array v3.0 (GSA). Both datasets underwent imputation separately at the Michigan Imputation Server, using Eagle v2.4 for phasing and Minimac4 for imputation, followed by lift-over from GRCh37 to GRCh38 and final harmonization. Post-imputation quality control confirmed no missing regions, consistent allele matching, and comparable imputation performance across platforms.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGeneration of mouse colonies\u003cbr\u003e\u003c/strong\u003eAll experiments were conducted in accordance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research. Given that sex differences can influence immune responses and rates of degeneration, an equal proportion of male and female mice was used across the various experiments.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e mouse, carry a frameshift mutation in the Crb1 gene; it exhibits structural abnormalities in M\u0026uuml;ller cells, affecting photoreceptor development. Rd8 (retinal degeneration 8) mutation in these mice results in the loss of function in the crumbs-like 1 (Crb1) protein, which regulates the polarity of epithelial cells and is involved in maintaining the integrity of the outer limiting membrane of the retina\u003csup\u003e28\u003c/sup\u003e. Mutations in the same gene cause retinal degeneration in humans\u003csup\u003e24,25\u003c/sup\u003e. B6.129S-Ccr1tm1Gao/AdlJ mice (Jackson laboratory, Bar Harbor, ME, US) lacking the Ccr1 gene (Ccr1\u003csup\u003e-/-\u003c/sup\u003e), and homozygous for\u0026nbsp;the rd8 mutation in the Crb1 gene (Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e) were compared to B6.129S also harboring the homozygous mutation of rd8.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe second model for IRD which we have used is Pde6b\u003csup\u003erd10\u003c/sup\u003e mouse. This strain is characterized by a missense point mutation in the \u003cem\u003ePde6b\u003c/em\u003e gene. This results in mislocalization and instability of the encoded protein, leading to reduced enzymatic activity. Consequently, cyclic GMP (cGMP) accumulates, leading to toxicity to rod photoreceptors, and substantial photoreceptor cells loss by postnatal week 3\u003csup\u003e29,30\u003c/sup\u003e. To generate Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e⁻/⁻\u003c/sup\u003e mice, C57BL/6J-Pde6b\u003csup\u003erd10\u003c/sup\u003e mice (The Jackson Laboratory) were crossed with B6.129S-Ccr1tm1Gao/AdlJ mice (The Jackson Laboratory). Offspring heterozygous for the Pde6b\u003csup\u003erd10\u003c/sup\u003e, Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e, and Ccr1 alleles were intercrossed. Progeny were genotyped to identify and select two experimental strains: (1) mice homozygous for the Pde6b\u003csup\u003erd10\u003c/sup\u003e mutation, knockout for Ccr1, and free of the Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e mutation (Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e⁻/⁻\u003c/sup\u003e); and (2) mice homozygous for the Pde6b\u003csup\u003erd10\u003c/sup\u003e mutation, wild-type for Ccr1, and free of the Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e mutation (Pde6b\u003csup\u003erd10\u003c/sup\u003e). The Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003eand Ccr1 mutant or wild-type alleles were identified by PCR as previously described\u003csup\u003e31,32\u003c/sup\u003e. The Pde6b\u003csup\u003erd10\u003c/sup\u003e mutation was validated via sequencing as previously described\u003csup\u003e33\u003c/sup\u003e. PCR reactions were performed using the primers described in Table 1. Five mice generations were necessary to establish each strain, minimizing the impact of genetic background.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1. PCR Primer Sequences Used for Genotyping Mouse Strains\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"588\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003ePCR reactions\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003ePrimers name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 371px;\"\u003e\n \u003cp\u003eSequences\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003eCcr1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003emouse m3xs300\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 371px;\"\u003e\n \u003cp\u003eGCTGTCTCTGATCTGGTCTTCCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003emouse m3X\u003cem\u003eRt3\u003c/em\u003e R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 371px;\"\u003e\n \u003cp\u003eCCTGCTGCTTTGCCTACCTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003emouse A\u003cem\u003eneo\u003c/em\u003e R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 371px;\"\u003e\n \u003cp\u003eTGGGTGGAGAGGCTTTTTGCTTCCTCTTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 371px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003eCrb1\u003csup\u003erd8\u003c/sup\u003e\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003ePde6b\u003csup\u003erd10\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003emouse Crb1 F1\u003c/p\u003e\n \u003cp\u003emouse Crb1 F2\u003c/p\u003e\n \u003cp\u003emouse Crb1 R\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003emouse Pde6b F\u003c/p\u003e\n \u003cp\u003emouse Pde6b R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 371px;\"\u003e\n \u003cp\u003eGTGAAGACAGCTACAGTTCTGATC\u003c/p\u003e\n \u003cp\u003eGCCCCTGTTTGCATGGAGGAAACTTGGAAGACAGCTACAGTTCTTCTG\u003c/p\u003e\n \u003cp\u003eGCCCCATTTGCACACTGATGAC\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eGGCTCTGATATGGTGCTGTG\u003c/p\u003e\n \u003cp\u003eAAAGACTCACCCTAAGGACGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eFundus autofluorescence (FAF) and Optical Coherence Tomography (OCT) imaging\u003cbr\u003e\u003c/strong\u003eRetinal images were obtained using a Spectralis OCT device (Heidelberg, Baden-Wurttemberg, Germany), and a Micron III retinal microscope (Phoenix Research Labs, San Francisco, CA). Images were obtained at the age of 10, 15 and 18\u0026nbsp;months for Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice. For image acquisition, mice were anesthetized with a mixture of ketamine and xylazine (Eurovet, United Arab Emirates) and pupils are dilated with cyclogil drop (Sandoz Farmaceutica S.A., Madrid, Spain). Eyes were lubricated during all the procedures using carboxymethylcellulose (Fischer Pharmaceutical Labs).\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFundus images of the right eye from each mouse were analyzed. For\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eall images, an identical area of 15 mm\u003csup\u003e2\u003c/sup\u003e in a similar region of the retina was captured (3 mm to the left and 2.5 mm superior and inferior of the optic nerve head (ONH)), and the number of hyper-fluorescent lesions was automatically quantified using QuPath bioimage analysis software (https://qupath.github.io/).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReal-time quantitative PCR (qPCR)\u0026nbsp;\u003cbr\u003e\u003c/strong\u003eRNA was extracted from isolated retina samples using TRIzol Reagent (Sigma-Aldrich, Munich, Germany) in accordance with the manufacturer\u0026rsquo;s instructions. The RNA quality and quantity were measured using a NanoDrop spectrophotometer (Thermo Scientific, Waltham, MA) and a bioanalyzer (Agilent Technologies, Santa Clara, CA). RNA was reverse-transcribed to generate cDNA using the qScript cDNA Synthesis Kit (Quantabio, Beverly, MA) in accordance with the manufacturer\u0026rsquo;s instructions. qPCR was then performed using the PerfeCTa SYBR Green FastMix kit (Quantabio); the gene-specific primers (Sigma-Aldrich) used in this study are listed in Table 2. Each gene was amplified in triplicate, and the expression level of each gene was normalized to mouse \u003cem\u003eGapdh\u003c/em\u003e as an endogenous control using the standard 2(\u0026Delta;\u0026Delta;CT) method\u003csup\u003e34\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2. Gene-Specific Primers Used for Quantitative PCR Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"567\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 238px;\"\u003e\n \u003cp\u003eForward (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 197px;\"\u003e\n \u003cp\u003eReverse (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 1px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003emouse \u003cem\u003eGapdh\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 238px;\"\u003e\n \u003cp\u003eAACTTTGGCATTGTGGAAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 198px;\"\u003e\n \u003cp\u003eACACATTGGGGGTAGGAACA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003emouse \u003cem\u003eCcl5\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 238px;\"\u003e\n \u003cp\u003eCCTGCTGCTTTGCCTACCTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 198px;\"\u003e\n \u003cp\u003eACACACTTGGCGGTTCCTTCGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003emouse \u003cem\u003eCcl3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 238px;\"\u003e\n \u003cp\u003eCTGCCCTTGCTGTTCTTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 198px;\"\u003e\n \u003cp\u003eCTTGGACCCAGGTCTCTTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003emouse Gfap\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 238px;\"\u003e\n \u003cp\u003eGAAGAGGGCATTGGATTCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 198px;\"\u003e\n \u003cp\u003eTATGCCGTGGATGAACTGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003emouse Vimentin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 238px;\"\u003e\n \u003cp\u003eTCTCCTAGCCAGAGGAGGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 198px;\"\u003e\n \u003cp\u003eTGTCATAGCTATAGGTCGGAACTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003emouse \u003cem\u003eAdgre1\u003c/em\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 238px;\"\u003e\n \u003cp\u003eGCATCATGGCATACCTGTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 198px;\"\u003e\n \u003cp\u003eAGTCTGGGAATGGGAGCTAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003emouse \u003cem\u003eCcl2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 238px;\"\u003e\n \u003cp\u003eAGGTCCCTGTCATGCTTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 198px;\"\u003e\n \u003cp\u003eTCTGGACCCATTCCTTCTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003emouse \u003cem\u003eCxcl1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 238px;\"\u003e\n \u003cp\u003eGACCATGGCTGGGATTCACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 198px;\"\u003e\n \u003cp\u003eCCAAGGGAGCTTCAGGGTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003emouse \u003cem\u003eCxcl10\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 238px;\"\u003e\n \u003cp\u003eCATCCCTGCGAGCCTATCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 198px;\"\u003e\n \u003cp\u003eCATCTCTGCTCATCATTCTTTTTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e*Encodes the F4/80 protein, also known as EMR1 (EGF-like module-containing mucin-like hormone receptor-like 1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistological analysis and Immunohistochemistry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor paraffin embedding, eyes were enucleated, fixated in Davidson solution for 8\u0026nbsp;h at 4\u0026nbsp;\u0026deg;C, and placed in 70% ethanol over-night at 4\u0026nbsp;\u0026deg;C. Eyes were incubated in 80\u0026ndash;\u0026gt;\u0026thinsp;90\u0026ndash;\u0026gt;\u0026thinsp;100\u0026ndash;\u0026gt;\u0026thinsp;100% ethanol gradient in room temperature for 30\u0026nbsp;min per each concentration, placed for 15\u0026nbsp;min in ethanol 100%: Xylene (1:1) solution in room temperature and washed twice with xylene 100% for 20\u0026nbsp;min each wash. Samples were incubated in paraffin (Paraplast Plus, Leica biosystems) at 58\u0026nbsp;\u0026deg;C for 3 times, each incubation lasted 40\u0026nbsp;min, later they were embedded in paraplast. Serial sections were cut at 5\u0026nbsp;\u0026mu;m thickness, in nasally/temporally orientation through the center of the ONH. H\u0026amp;E staining was performed for retinal morphometry examination as previously described\u003csup\u003e35\u003c/sup\u003e. For immunohistochemistry, deparaffinized sections were placed in blocking solution (PBS containing 10% serum and 0.1% Triton X-100) for 1 hour at RT. The sections were then incubated with the primary antibody overnight at 4\u0026deg;C; the following day, the sections were incubated in secondary antibody for 1 hour at RT. The nuclei were counterstained with DAPI, and the sections were visualized using a fluorescence microscope.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDonor human eyes from three individuals without AMD (2 women and 1 man; mean age (SD): 88 \u0026plusmn; 3 years), and three individuals with AMD (3 women; mean age (SD): 92\u0026plusmn; 3 years) were evaluated. The posterior segment was fixed in 4%PFA, dissected, embedded in optimal cutting temperature, and sectioned. Mouse eyes were fixed in 4% PFA for 2 hours and then placed in 30% sucrose overnight at 4\u0026deg;C. The eyes were then placed in optimal cutting temperature solution (Scigen Scientific, Gardena CA), and 10 \u0026micro;m sections were cut using a cryostat.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor immunohistochemistry, Goat anti-human CCR1 (10\u0026nbsp;\u0026micro;g/ml; ab139399, Abcam), Rabbit anti-IBA-1 (16.5\u0026nbsp;\u0026micro;g/ml; ab153696, Abcam), Rabbit anti-CD11b antibody (0.5\u0026nbsp;\u0026micro;g/ml; ab133357), and rabbit anti-GFAP (0.5 \u0026micro;g/ml; ab64347) were used as primary antibodies, and donkey anti-rabbit IgG-Alexa Fluor 488 (10 \u0026micro;g/ml; ab50081), donkey anti-goat IgG-Alexa Fluor 555 (10 \u0026micro;g/ml; ab150134), donkey anti-rabbit IgG-Alexa Fluor 555 (10 \u0026micro;g/ml; ab6939) was used as a secondary antibody.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo measure the thickness of the ONL, the paraffin sections were stained with hematoxylin and eosin (H\u0026amp;E) and the optimal cutting temperature sections with DAPI, and the thickness of the ONL was measured at fixed distances from the ONH.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFull- field Electroretinography (ERG) recording\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor ERG recording, the pupils were dilated with tropicamide and phenylephrine, and corneas were kept moist by application of carboxymethylcellulose. ERG was performed in dark-adapted mice. During ERG recording, the eyes were anesthetized with oxybuprocaine hydrochloride drops (all drops from Fischer Pharmaceutical Labs, Israel). All procedures were performed in dim red lighting or in total darkness, and the mice were kept warm throughout the recording. During the recording, the mouse was positioned facing the center of a Ganzfeld bowl, ensuring equal, simultaneous illumination of both eyes. ERG data were recorded inside a Faraday cage using an Espion computerized system (Diagnosys LLC, Littleton, MA). Dark-adapted ERG responses to a series of white flashes at increasing intensity (from 0.000012 to 10 cd\u0026middot;sec/m\u003csup\u003e2\u003c/sup\u003e) were recorded at inter-stimulus intervals increasing from 10 sec (for the lowest-intensity flashes) to 90 sec (for the highest-intensity flashes). For analysis, the b-wave amplitude was measured from the trough of the a-wave to the peak of the b-wave.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePharmacologic CCR1 blocking treatments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePde6b\u003csup\u003erd10\u003c/sup\u003e mice received subcutaneous injections of either the CCR1-specific antagonists (50 mg/kg body weight BX471; Targetmol, Boston, MA, or 100 mg/kg body weight CCX354;\u0026nbsp;Targetmol, Boston, MA), or vehicle (40% cyclodextrin in saline) every 8 hours during the peak of the degeneration process between P21-P24.\u0026nbsp;For injection, BX471/CCX354 was dissolved at a final concentration of 0.5 mg/50 \u0026micro;l in saline containing 40% (w/v) cyclodextrin (Sigma-Aldrich); the solution was mixed thoroughly and dissolved overnight at 4\u0026deg;C, after which the pH was adjusted to 4.5 with NaOH, and the solution was filtered through a 0.45-\u0026micro;m filter.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe appropriate statistical tests were used based on normalcy and the sample distribution and parameters using InStat biostatistical software package (GraphPad Software, San Diego, CA). Data were analyzed using a one-way ANOVA followed by the Tukey-Kramer post-hoc test or an unpaired Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test, where appropriate. Values over 2 standard deviations from the average were excluded from statistical\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eCCR1 expression is increased in retina from AMD patients\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u003cbr\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eImmunostaining for CCR1, IBA-1 (marker of macrophages and microglia cells) and GFAP (marker of activated M\u0026uuml;ller cells) was performed in sections from eyes affected by nnvAMD and nvAMD. Both resident microglia and recruited macrophages, labelled by IBA-1 immunoreactivity, were distributed from the GCL to the INL in section from a nnvAMD eye (Fig. 1G). In the same retina region, macrophages accumulated under the Bruch\u0026apos;s membrane (Fig. 1G), directly beneath drusen deposits (Fig. 1J, K). Additionally, resident and recruited macrophages were observed in proximity to the ONH (Fig. 1L). Importantly, these IBA-1-positive cells exhibited co-localization with CCR1 (Fig. 1H, I, M, N). In contrast, age-matched control eyes exhibited few IBA-1/CCR1 positive cells, located \u0026gt;4 mm from the ONH and primarily restricted to the GCL and INL (Fig. 1A\u0026ndash;C). Notably, such cells were absent adjacent to the ONH and Bruch\u0026rsquo;s membrane (Data not shown). These findings suggest limited myeloid cell recruitment in control eyes, based on previous reports that identify the optic nerve as a reservoir for microglial repopulation\u003csup\u003e36,37\u003c/sup\u003e, and the choroidal fenestrated capillaries as a potential entry site for monocyte trafficking\u003csup\u003e38\u003c/sup\u003e. The detection of CCR1 positive immune cells in eyes affected by AMD suggests its potential role in facilitating monocyte recruitment and/or activation in the context of AMD, consistent with its involvement in other inflammatory conditions\u003csup\u003e39\u0026ndash;41\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eEnhanced glial fibrillary acidic protein (GFAP) immunoreactivity was detected in astrocytes in the NFL and in M\u0026uuml;ller glial cells in AMD retinas (Fig. 1O) compared to control tissue (Fig. 1D), as previously reported\u003csup\u003e39\u003c/sup\u003e. CCR1 expression was also evident in gliotic M\u0026uuml;ller cells (activated M\u0026uuml;ller) (Fig. 1P, Q), but not in unaffected retinas (1E, F), indicating a potential role for CCR1 in glial activation\u003csup\u003e38\u003c/sup\u003e. This association was further supported by increases expression of both GFAP and CCR1 in atrophic retinal regions (Fig. 1U\u0026ndash;W), characterized by presence of fibrotic tissue (Fig. 1X), reduced ONL thickness (Fig. 1Y), hypertrophic M\u0026uuml;ller cell (Fig. 1Z), and inflammation evidenced by IBA-1-positive cells presence in the ONL and the RPE (Fig. 1R\u0026ndash;T).\u003c/p\u003e\n\u003cp\u003eTogether, the detection of CCR1 in activated microglia/macrophages and its distinct expression in gliotic M\u0026uuml;ller cells within drusen-bearing and atrophic regions highlights its potential contribution to reactive gliosis and neuroinflammation in AMD.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eCCR1 variants are associated with accelerated atrophy progression\u003cbr\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eA total of 635 patients (1,135 eyes) with available OCT annotations, genotyping data, and baseline macular atrophy (MA) area \u0026ge;0.1 mm\u0026sup2; were included in the analysis. The mean \u0026plusmn; sd follow-up duration was 6.23 \u0026plusmn; 4.06 years, with an average of 37.29 \u0026plusmn; 31.39 visits per eye. Across all eyes and visits, the mean atrophy lesion area was 4.23 \u0026plusmn; 6.31 mm\u0026sup2;, while the mean progression rate based on square-root transformed lesion area measurements was 0.02 \u0026plusmn; 2.69 mm/year.\u003c/p\u003e\n\u003cp\u003eIn the genotype\u0026ndash;phenotype analysis of\u0026nbsp;\u003cem\u003eCCR1\u003c/em\u003e, five variants demonstrated associations with higher rates of atrophy progression (Table 3). Two variants located in the 3\u0026prime; untranslated region (3\u0026prime; UTR), chr3:46202786:G:T (coefficient: 0.12 mm/year, 95% CI: 0.02\u0026ndash;0.21, p = 0.01) and chr3:46202788:G:C (coefficient: 0.08 mm/year, 95% CI: 0.00\u0026ndash;0.15, p = 0.05), showed an association with higher rates of atrophy progression. Two additional variants, chr3:46203522:G:A and chr3:46204152:C:G, are synonymous coding variants that also demonstrated positive associations with progression (coefficients 0.08\u0026ndash;0.15 mm/year; p = 0.02\u0026ndash;0.05). The final variant, chr3:46207342:C:A, is intronic and similarly showed a positive association (coefficient: 0.15 mm\u0026sup2;/year, 95% CI: 0.02\u0026ndash;0.27, p = 0.02). However, none of these associations remained significant after FDR, potentially due to low minor allele counts.\u003cbr\u003e\u003cstrong\u003eTable 3. CCR1 Genetic Variants Associated with Macular Atrophy Progression\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"591\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 200px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eVariant\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMinor Allele Frequency (%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCoefficient (mm/year)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 49px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eLower 95% CI\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 63px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHigher 95% CI\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 64px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eP-value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46px;\"\u003e\n \u003cp\u003eCCR1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 200px;\"\u003e\n \u003cp\u003echr3:46202786:G:T (rs200207639)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003e0.56\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 49px;\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63px;\"\u003e\n \u003cp\u003e0.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 64px;\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46px;\"\u003e\n \u003cp\u003eCCR1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 200px;\"\u003e\n \u003cp\u003echr3:46202788:G:C (rs199682159)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003e0.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.08\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 49px;\"\u003e\n \u003cp\u003e0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63px;\"\u003e\n \u003cp\u003e0.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 64px;\"\u003e\n \u003cp\u003e0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46px;\"\u003e\n \u003cp\u003eCCR1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 200px;\"\u003e\n \u003cp\u003echr3:46203522:G:A (rs764537530)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003e0.16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 49px;\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63px;\"\u003e\n \u003cp\u003e0.27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 64px;\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46px;\"\u003e\n \u003cp\u003eCCR1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 200px;\"\u003e\n \u003cp\u003echr3:46204152:C:G (rs61755291)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003e0.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.08\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 49px;\"\u003e\n \u003cp\u003e0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63px;\"\u003e\n \u003cp\u003e0.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 64px;\"\u003e\n \u003cp\u003e0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46px;\"\u003e\n \u003cp\u003eCCR1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 200px;\"\u003e\n \u003cp\u003echr3:46207342:C:A (rs970631558)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003e0.16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 49px;\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63px;\"\u003e\n \u003cp\u003e0.27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 64px;\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\" valign=\"bottom\" style=\"width: 591px;\"\u003e\n \u003cp\u003eLinear mixed-effects models (LMMs) were used to evaluate for an association between CCR1 variants and atrophy progression rate (mm/year) in OCT imaging. Models were adjusted for age and gender, with random effects accounting for inter-eye correlation. Shown are the regression coefficients with 95% confidence intervals (CIs), corresponding p-values, and the calculated minor allele frequencies (MAF, %).\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eThe effect of Ccr1 genetic deletion in Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice\u003c/em\u003e\u003c/strong\u003e\u003cem\u003e\u003csup\u003e\u003cbr\u003e\u0026nbsp;\u003c/sup\u003e\u003c/em\u003eTo determine whether CCR1 expression contributes to retinal degeneration or represents an epiphenomenon, we examined the effect of \u003cem\u003eCcr1\u003c/em\u003e deletion in retinal degeneration. To specifically assess the functional relevance of CCR1 signaling in glial cells, we first investigated the impact of \u003cem\u003eCcr1\u003c/em\u003e deficiency in the context of retinal degeneration associated with the rd8 mutation in the \u003cem\u003eCrb1\u003c/em\u003e gene. The retinal phenotype observed in Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e mice was associated with altered structure of the CRB1 protein in M\u0026uuml;ller cells, disrupting photoreceptor-M\u0026uuml;ller glial interactions at the external limiting membrane (ELM)\u003csup\u003e42\u003c/sup\u003e. Prior to functional analysis, we confirmed CCR1 expression in this model. Immunostaining revealed increased CCR1 immunoreactivity in M\u0026uuml;ller cells from Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e mice at 10 and 15 months of age (Fig. S1b and Fig. S1c, respectively), compared to age-matched wild-type controls that did not show such immunoreactivity (Fig. S1a). Then, we compared the eyes of Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice with those of Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice. The rd8 mutation is not associated with marked ERG abnormalities, but FAF lesions reflects the degenerative process in these mice\u003csup\u003e43\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eAt 10 months, FAF fundus imaging demonstrated few altered patterns in Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e, Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e /Ccr1\u003csup\u003e-/-\u003c/sup\u003e, and age-matched wild-type mice (n=4 per group; Fig. S1d, g, j). At the same age OCT imaging (Fig. S1e, h, k) and histological analysis (Fig. S1f, i, l) confirmed unaffected retinal structure in both mutant mice strains. In addition, qPCR results revealed similar expression level of pro-inflammatory genes such as \u003cem\u003eCxcl1\u003c/em\u003e, \u003cem\u003eCcl2\u003c/em\u003e and \u003cem\u003eF4/80\u003c/em\u003e (n= 4 per group, Fig. S1m-o), and of the M\u0026uuml;ller gliosis reporter gene \u003cem\u003eVimentin\u0026nbsp;\u003c/em\u003e(Fig. S1q) across the different groups. Interestingly, the expression level of \u003cem\u003eGfap\u003c/em\u003e, a gene also associated with M\u0026uuml;ller cell gliosis, was reduced in both Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice and Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003emice compared to wild-type mice (n=4 per group, 0.30-fold change and 0.32-fold change respectively, p\u0026lt;0.01 for both comparisons, Fig. S1p). \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAt 15 months of age, hyper-FAF lesions were observed in Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice (n=6), particularly in mid-peripheral and central retina areas (Fig. 2B) as previously reported\u003csup\u003e44\u003c/sup\u003e. In contrast, very few FAF lesions were observed in age-matched control mice (n=6; Fig. 2A), and a marked reduction in the number of FAF lesions was observed in Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e /Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice at the age of 15 months (n=14) and 18 months (n=6; Fig. 2C and 2D, respectively). Quantification of the number of FAF lesions revealed an 84% reduction of hyper-FAF lesions in Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e /Ccr1\u003csup\u003e-/-\u0026nbsp;\u003c/sup\u003emice at the age of 15 months, and a 94% reduction at the age of 18 months compared to Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice at the age of 15 months (n\u0026ge; 5 per group, p\u0026lt;0.01, Fig. 2E).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn addition to the hyper-FAF lesions, we also observed hypo-FAF lesion in the central sretina of Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice (Fig. 2F, G). OCT imaging sections through the hypo-FAF lesion revealed abnormal structure of the retinal layers (Fig. 2H, I). These findings were further confirmed by histological analysis, which showed the presence of pseudorosette formations corresponding with the hypo-FAF lesion (Fig. 2J). Additionally, loss of the OPL resulting in direct contact between the ONL and INL, was evident in Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice (Fig. 2P) at the age of 15 months. In contrast, Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e /Ccr1\u003csup\u003e-/-\u003c/sup\u003emice maintained normal retinal structure (Fig. 2K-P).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHistological analysis also revealed a reduction in total retinal thickness in Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice compared to both wild-type and Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e /Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice (n \u0026ge;3 per group, 0.8-fold-change at 300 \u0026micro;m from the ONH, \u003csup\u003e$\u003c/sup\u003ep\u0026lt;0.05 and *p\u0026lt;0.05 respectively, Fig. 2Q, R). In contrast, retinal thickness was similar in Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e /Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice and wild-type mice (Fig. 2Q, R). Among the six Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice evaluated, two exhibited severe retinal damage (including FAF lesions and retinal layers disruption), while two of the fourteen Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e /Ccr1\u003csup\u003e-/-\u0026nbsp;\u003c/sup\u003emice exhibited FAF lesions and none showed abnormal retinal histological features.\u003c/p\u003e\n\u003cp\u003ePrevious studies reported that the presence of hyper-FAF retinal lesions correlated with migration of microglial cell towards the ONL and RPE layers, indicating a disruption of retinal homeostasis\u003csup\u003e45\u003c/sup\u003e. Accordingly, immune cells infiltration between the RPE and the photoreceptor segments layer was observed in retinal sections from Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice (Fig. 3B, C). Deletion of \u003cem\u003eCcr1\u003c/em\u003e led to a notable reduction in the number of CD11b-positive cell in this region compared with Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice (Fig. 3A). Furthermore, \u003cem\u003eCcr1\u003c/em\u003e deletion was associated with a reduction of activated CD11b-positive cells compared to Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice (Fig. 3D-O); characterized by an amoeboid morphology (Fig. 3I) and increased cell size (Fig. 3J)\u003csup\u003e46\u003c/sup\u003e. In Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e /Ccr1\u003csup\u003e-/-\u0026nbsp;\u003c/sup\u003emice, ramified CD11b-positive cell predominantly localized in the IPL and the OPL (Fig. 3F, K and L), and a similar finding was observed in wild-type mice (Fig. 3D, G and H). \u003cem\u003eCcr1\u003c/em\u003e deletion was also associated with a reduction in the migration of CD11b-positive cells from the IPL and OPL towards the ONL and RPE (n= 3 per group, 0.30-fold change, p\u0026lt; 0.0001, Fig. 3O).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCD11b is a receptor expressed on various leukocyte populations, including macrophages, neutrophils, and natural killer cells, and also serves as a marker for tissue-resident macrophages such as microglial cells. During retinal inflammation, both recruited macrophages and resident microglia can proliferate and undergo similar morphological changes, making it challenging to distinguish between these cell populations\u003csup\u003e47\u003c/sup\u003e. However, in Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice CD11b-positive cells have been detected in the vitreous body (Fig. 3E), indicating the recruitment of macrophages in association with the degenerative process. CD11b-positive cells were not detected in the vitreous of either wild-type mice (Fig. 3D) or Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice (Fig. 3F).\u003c/p\u003e\n\u003cp\u003eRetinal M\u0026uuml;ller gliosis, evidenced by GFAP staining, was also observed in Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice (Fig. 3Q-R), whereas a reduced GFAP-positive signal was detected in Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice (Fig. 3S). We further evaluated the level of retinal inflammation using qPCR for \u003cem\u003eF4/80\u003c/em\u003e mRNA expression, a marker for both resident microglia and infiltrating macrophages\u003csup\u003e48\u003c/sup\u003e. Increased \u003cem\u003eF4/80\u003c/em\u003e expression was detected in Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice compared to Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e /Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice at the age of 15 months (n \u0026ge;6 per group, 3-fold change, p\u0026lt;0.01, Fig. 3T), and 18 months (2.13-fold change, p\u0026lt;0.01, Fig. 3T), and compared to age-matched wild-type mice (5.80-fold change, p\u0026lt;0.01, Fig. 3T). qPCR for \u003cem\u003eGfap\u003c/em\u003e mRNA level confirmed the immunohistochemistry findings, showing elevated expression level in Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice compared to Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e /Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice at the age of 15 months (1.89- fold change p\u0026lt;0.05, Fig. 3U) and 18 months (2.67- fold change p\u0026lt;0.05, Fig. 3U), and compared with age-matched control mice (2.33- fold change, p\u0026lt;0.05, Fig. 3U). Deletion of \u003cem\u003eCcr1\u003c/em\u003e resulted in a significant reduction in the mRNA expression levels of several M\u0026uuml;ller gliosis-associated genes in mice aged of 15 and 18 months, compared to Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e mice aged of 15 months. Specifically, \u003cem\u003eCxcl1\u003c/em\u003e mRNA expression was markedly decreased in Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e /Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice at the age of 15 months (0.28-fold; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, Fig. 3W). \u003cem\u003eCcl2\u003c/em\u003e mRNA expression was also significantly reduced in both age groups (0.16-fold, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001; 0.46-fold, *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, respectively, Fig. 3X). Similarly, \u003cem\u003eCxcl10\u003c/em\u003e mRNA expression was reduced in 15 and 18-month-old Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e /Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice (0.33-fold, *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; 0.65-fold, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, respectively, Fig. 3Y). Together, these results indicate that \u003cem\u003eCcr1\u003c/em\u003e deletion is associated with preserved retinal structure and reduced inflammation in Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eThe effect of Ccr1 genetic deletion in Pde6b\u003csup\u003erd10\u003c/sup\u003e mice\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe next aimed to evaluate the impact of \u003cem\u003eCcr1\u003c/em\u003e deletion in a more aggressive and shorter duration genetic-derived model of retinal degeneration, the Pde6b\u003csup\u003erd10\u003c/sup\u003e mouse. In this model, rods degeneration begins around postnatal day 16 (P16) and reach its peak between P21 and P25\u003csup\u003e30\u003c/sup\u003e.\u0026nbsp;We compared the retinal function of Pde6b\u003csup\u003erd10\u003c/sup\u003e mice with that of Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice at P21 (Fig. 4A, B), P26 (Fig. 4C, D) and P35 (Fig. 4E, F). ERG results showed a notable decrease of the b-wave amplitude in both Pde6b\u003csup\u003erd10\u003c/sup\u003e mice and Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice compared to age-matched Ccr1\u003csup\u003e-/-\u0026nbsp;\u003c/sup\u003emice at P21 (n\u0026ge;4 per group ,0.37 and 0.59- fold change, respectively at 10 cd.s light intensity, p\u0026lt;0.001, Fig. 4A, B). However, Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice had a higher b-wave amplitudes compared to Pde6b\u003csup\u003erd10\u0026nbsp;\u003c/sup\u003emice at P21 (n\u0026ge;12 per group, 1.59-fold change at 10 cd.s light intensity, p\u0026lt;0.01 Fig. 4A, B). No difference was found between the both groups at P26 and P35 (Fig. 4C-F) when the mean ERG amplitudes were lower than 80% compared to age matched Ccr1\u003csup\u003e-/-\u0026nbsp;\u003c/sup\u003emice.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo evaluate the consequences of \u003cem\u003eCcr1\u003c/em\u003e deletion before the onset of photoreceptors cell death, we examined the thickness of the ONL in the three above mentioned mice groups at P14 (ERG analysis is not technically possible at this age due to the eyelids coverage of the eyes). Histological analysis showed no difference between the groups at this stage (n=6 per group, Fig. 4G-J). At P21, a trend towards increased ONL thickness was observed in Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice compared to Pde6b\u003csup\u003erd10\u003c/sup\u003e mice (n\u0026ge;4 per group, 1.53- fold change at 900 \u0026micro;m from ONH, p= 0.08, Fig. 4L-P). Additionally, photoreceptor degeneration was observed to occur unevenly across the retina (Fig. 4L), which may explain the absence of a statistically significant difference between the groups despite significant difference in the ERG findings. Similar ONL thickness was observed between Pde6b\u003csup\u003erd10\u0026nbsp;\u003c/sup\u003emice and Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice at P35 (n=4 per group, Fig. 4Q-T), where 2-3 rows of photoreceptor remained across the entire retina, correlating with the ERG results.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo investigate why the protective effect associated with the \u003cem\u003eCcr1\u0026nbsp;\u003c/em\u003edeletion in \u0026nbsp; \u0026nbsp; \u0026nbsp; Pde6b \u003csup\u003erd10\u003c/sup\u003e mice didn\u0026apos;t not persist beyond P21, we evaluated the mRNA levels of proinflammatory genes in Ccr1\u003csup\u003e-/-\u003c/sup\u003e, Pde6b\u003csup\u003erd10\u003c/sup\u003e, and Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice at P14, P21 and P35 using qPCR (Fig. 5A-H)\u003cem\u003e.\u003c/em\u003e At P14 no differences were detected between the experimental groups for any of the analyzed genes (\u003cem\u003eGfap, Vimentin, Cxcl1, Cxcl10, F4/80, Ccl2, Ccl3\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Ccl5;\u0026nbsp;\u003c/em\u003eFig. 5A-H)\u003cem\u003e.\u0026nbsp;\u003c/em\u003emRNA levels of these genes were also similar across the three different time points evaluated (P14, P21, and P35) in Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice, suggesting that \u003cem\u003eCcr1\u003c/em\u003e deletion does not alter homeostasis of these pathways (Fig. 5A-H). On the other hand, Pde6b\u003csup\u003erd10\u003c/sup\u003e mice showed upregulation of \u003cem\u003eGfap\u003c/em\u003e compared to Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice at P35 (n\u0026ge;4 per group, 15.36-fold change, p= 0.0014, Fig. 5A) suggesting M\u0026uuml;ller cell gliosis. Although Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice also exhibited increased \u003cem\u003eGfap\u003c/em\u003e mRNA expression compared to Ccr1\u003csup\u003e-/-\u0026nbsp;\u003c/sup\u003emice at P35, the magnitude of the upregulation was lower than in Pde6b\u003csup\u003erd10\u003c/sup\u003e mice (n\u0026ge;4 per group, 10.84-fold change, p= 0.014, Fig. 5A). Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e showed increased expression of \u003cem\u003eCxcl1\u0026nbsp;\u003c/em\u003e(n\u0026ge;5 per group, 10.44-fold change, p= 0.01, Fig.5C) and \u003cem\u003eCxcl10\u003c/em\u003e (n\u0026ge;5 per group, 99-fold change, p= 0.004, Fig. 5D) compared to Ccr1\u003csup\u003e-/-\u0026nbsp;\u003c/sup\u003emice at P21.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIncreased expression of \u003cem\u003eF4/80\u003c/em\u003e was observed at P21 and P35 in Pde6b\u003csup\u003erd10\u003c/sup\u003e mice (n\u0026ge;4 per group, 10-fold change, p= 0.0002, at P21 and 5.22-fold change, p= 0.0309, at P35, Fig. 5E) and in Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e\u0026nbsp; (n\u0026ge;4 per group, 5-fold change, p= 0.0346, at P21 and 5.29-fold change, p= 0.0233, at P35, Fig. 5E) compared to Ccr1\u003csup\u003e-/-\u0026nbsp;\u003c/sup\u003emice. However, reduced expression of \u003cem\u003eF4/80\u003c/em\u003e was observed in Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e compared with Pde6b\u003csup\u003erd10\u003c/sup\u003e at P21 (n\u0026ge;5 per group, 2-fold change, p= 0.0134, Fig. 5E), indicating that \u003cem\u003eCcr1\u003c/em\u003e deletion diminish macrophage/microglial recruitment. Yet, \u003cem\u003eCcr1\u003c/em\u003e deletion simultaneously leads to the upregulation of the mRNA of several pro-inflammatory cytokines. Among the upregulated mRNAs were CCR1 ligands including\u003cem\u003e\u0026nbsp;Ccl2\u0026nbsp;\u003c/em\u003e(n\u0026ge;5 per group, 177-fold change, p=\u0026nbsp;0.0002, and 11-fold change, p=\u0026nbsp;0.0005, respectively Fig. 5F)\u003cem\u003e\u0026nbsp;\u003c/em\u003eat P21\u003cem\u003e, Ccl3\u0026nbsp;\u003c/em\u003eat p35 (n\u0026ge;4 per group, 8-fold change, p=\u0026nbsp;0.0009, and 3-fold change, p=\u0026nbsp;0.0070, respectively Fig. 5G)\u003cem\u003e\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Ccl\u003c/em\u003e5 at P35 (n\u0026ge;5 per group, 88-fold change, p\u0026lt;\u0026nbsp;0.0001, and 2-fold change, p= 0.0009, respectively Fig. 5H) compared to Ccr1\u003csup\u003e-/- \u0026nbsp;\u0026nbsp;\u003c/sup\u003eand Pde6b\u003csup\u003erd10\u003c/sup\u003e mice. Importantly, such changes were not observed over \u003cem\u003eCcl2\u0026nbsp;\u003c/em\u003e(Fig. 5F)\u003cem\u003e\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Ccl3 (\u003c/em\u003eFig. 5G)\u003cem\u003e\u0026nbsp;\u003c/em\u003ein Pde6b\u003csup\u003erd10\u003c/sup\u003e mice, suggesting that \u003cem\u003eCcr1\u003c/em\u003e deletion selectively alters cytokine expression dynamics during retinal degeneration. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003ePharmacologic CCR1 inhibition in Pde6b\u003csup\u003erd10\u0026nbsp;\u003c/sup\u003emice\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe effect of CCR1 pharmacologic inhibition on the progression of genetically-derived photoreceptor degeneration was assessed in Pde6b\u003csup\u003erd10\u003c/sup\u003e mice to gain additional insight to the role of CCR1 in the degenerative process. The CCR1-specific inhibitor BX471 (or vehicle for the control group) was administrated subcutaneously twice daily starting at P21, and ERG was recorded at P21 (baseline) and at P25 (Fig. 6A). These time points were selected as to correlate with the peak of the degenerative process in the rd10 strain\u003csup\u003e30\u003c/sup\u003e. At P21, ERG recordings revealed similar b-wave amplitudes in BX471-treated and vehicle-treated mice (Fig. 6B, C). However, by P25, the BX471-treated group exhibited higher b-wave amplitude compared to the vehicle-treated group (n \u0026ge; 12 per group; 1.73-fold, p= 0.02 at 10 cd\u0026middot;s/m\u0026sup2; intensity, Fig. 6B, C). Analysis of the percentage decrease in b-wave amplitude between P21 and P25 revealed a mean reduction of 62% in vehicle-treated mice, whereas BX471-treated mice exhibited a lower reduction of 33% (p= 0.03, Fig. 6D).\u0026nbsp;Histological analysis further confirmed the protective effect of CCR1 inhibition, demonstrating increased ONL thickness in BX471-treated mice compared with the vehicle-treated group at P25 (n= 6 per group; 1.51-fold increased thickness at 600 \u0026micro;m from the ONH, p= 0.01, Fig. 6E). Gene expression levels of CCR1 ligands including\u003cem\u003e\u0026nbsp;Ccl2\u0026nbsp;\u003c/em\u003e(Fig. 6F)\u003cem\u003e, Ccl3(\u003c/em\u003eFig. 6G)\u003cem\u003e\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Ccl\u003c/em\u003e5 (Fig. 6H) were measured via qPCR at P25. Expression levels were similar following pharmacologic inhibition of CCR1 with BX471 and in untreated controls.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo further evaluate the effect of CCR1 inhibition in Pde6b\u003csup\u003erd10\u003c/sup\u003e mice, we tested an additional CCR1-specific inhibitor, CCX354. Unlike BX471, CCX354 treatment did not lead to a significant preservation of b-wave amplitude at P25 compared with untreated mice (n=9, Fig. 6I, J). However, analysis of the percentage decrease in b-wave amplitude between P21 and P25 revealed a rescue effect: vehicle-treated mice exhibited a 46% reduction of the b-wave amplitude, whereas CCX354-treated mice showed only 26% reduction (p= 0.02 at 10 cd\u0026middot;s/m\u0026sup2; intensity, Fig. 6K). Histological analysis indicated a trend toward increased ONL thickness in CCX354-treated mice compared to vehicle-treated controls at all measured distances from the ONH, with a statistically significant difference observed at -600 \u0026micro;m (n = 9 per group; 1.62-fold change, p= 0.005, Fig. 6L). Together, these results suggest that pharmacological inhibition of CCR1 reduces photoreceptor death rate in Pde6b\u003csup\u003erd10\u003c/sup\u003e mice.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this work we investigated the role of CCR1 in AMD and IRDs. We documented CCR1 expression in M\u0026uuml;ller glia cells in retinal areas affected by AMD, and a genotype-phenotype association of specific \u003cem\u003eCCR1\u003c/em\u003e genetic variants. We also show that deletion of the \u003cem\u003eCcr1\u003c/em\u003e gene in the Pde6b\u003csup\u003erd10\u003c/sup\u003e mouse model of rapidly progressing retinal degeneration, and in the Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emouse model of slowly progressing retinal degeneration suppresses the inflammatory response and is associated with a rescue effect. Additionally, pharmacologic inhibition of CCR1 yielded both structural and functional rescue in Pde6b\u003csup\u003erd10\u003c/sup\u003e. Combined, these data elucidate an important role for CCR1 signaling in AMD and IRDs.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis conclusion is also supported by our previous work which documented\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCCR1 expression on M\u0026uuml;ller glia cell in the mouse following photic retina-injury\u003csup\u003e20\u003c/sup\u003e. Thus, CCR1 signaling in activated M\u0026uuml;ller glia and macrophages emerge as a common retinal injury pathway secondary to variable underlying causes. Further supporting a role for CCR1 in AMD are transcriptomic analyses of retinal tissue from healthy controls and AMD eyes showing elevated expression of \u003cem\u003eCcr1\u003c/em\u003e mRNA in microglial cells\u003csup\u003e49\u003c/sup\u003e, and upregulation of CCR1 ligands in the aqueous humor of AMD patients\u003csup\u003e11\u003c/sup\u003e. Consistent with a prior report\u003csup\u003e50\u003c/sup\u003e, we demonstrated upregulated GFAP in M\u0026uuml;ller glia in advanced AMD, and more importantly revealed that CCR1 is expressed in these reactive M\u0026uuml;ller cells, as indicated by its co-localization with GFAP immunoreactivity.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn the Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emodel of retinal degeneration, \u003cem\u003eCcr1\u003c/em\u003e deletion led to a reduction in hyper-FAF lesions, abnormal retinal folds, disorganization of retinal layers, and retinal atrophy. Previous studies have indicated that the retinal phenotype observed in Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e mice is primarily due to the loss of adherent junction integrity between photoreceptors and M\u0026uuml;ller glia cells\u003csup\u003e42\u003c/sup\u003e. The rd8 mutation in the Crb1 gene results not only in decreased Crb1 expression\u003csup\u003e44\u003c/sup\u003e, but it also disrupts its proper distribution along M\u0026uuml;ller cells\u003csup\u003e28\u003c/sup\u003e. Consequently, various alterations in M\u0026uuml;ller cells have been reported in Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e mice, including mislocalization within dysplastic lesions\u003csup\u003e51\u003c/sup\u003e, and altered activation status\u003csup\u003e52\u003c/sup\u003e. We show increased M\u0026uuml;ller cell activation (M\u0026uuml;ller gliosis) in Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e, compared to age-matched controls, and a rescue effect induced by \u003cem\u003eCcr1\u003c/em\u003e deletion. This manifested in lower mRNA expression levels of \u003cem\u003eGfap,\u003c/em\u003e \u003cem\u003eCcl2\u003c/em\u003e, and \u003cem\u003eCxcl10\u003c/em\u003e, known markers of M\u0026uuml;ller glia activation\u003csup\u003e53,54\u003c/sup\u003e. In addition to their structural role in the retina, cross-talk between M\u0026uuml;ller cells and microglia have been reported to modify retinal inflammation\u003csup\u003e55\u003c/sup\u003e. Previous reports suggested that activated inflammatory microglia are implicated in the progression of retinal degeneration in Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e mice\u003csup\u003e45,56\u003c/sup\u003e. CCR1 is a well-characterized chemokine receptor involved in the recruitment of monocytes during inflammatory responses\u003csup\u003e57\u003c/sup\u003e. Accordingly, we noted reduced immune cell recruitment to the retina in Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice. Thus, conceivably, CCR1 has a role in promoting retinal inflammation in Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e mice. Taken together, these results suggest that the protective effects conferred by \u003cem\u003eCcr1\u003c/em\u003e deletion in the Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e mice may be at least partially mediated through a reduction in M\u0026uuml;ller cell gliosis, in addition to decreased immune cell recruitment and activation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emouse recapitulate features of human retinal degeneration associated with Crb1 gene mutation\u003csup\u003e58\u003c/sup\u003e, including the phenotypic variability\u003csup\u003e44\u003c/sup\u003e. The underlying factors modulating the progression of retinal degeneration in Crb1-associated retinal degeneration are poorly understood. Genetic factors such as Arhgef12 and Prkci were suggested to influence disease severity\u003csup\u003e51\u003c/sup\u003e, and pharmacological inhibition of Platelet-derived growth factor (PDGF)-C demonstrated an anti-apoptotic effect in Ccl2\u003csup\u003e-/-\u003c/sup\u003e/Cx3cr1\u003csup\u003e-/-\u003c/sup\u003e/Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emouse\u003csup\u003e59\u003c/sup\u003e. In this model, microglial activation\u003csup\u003e60\u003c/sup\u003e and macrophage recruitment are impaired\u003csup\u003e61,62\u003c/sup\u003e, further implicating this pathway in Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e associated retinal degeneration.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eRetinal degeneration in Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e mice is relatively mild and late-onset, by contrast, in Pde6b\u003csup\u003erd10\u003c/sup\u003e mice, there is an aggressive, rapidly progressing retinal degeneration, resulting in profound loss of visual function. In Pde6b\u003csup\u003erd10\u003c/sup\u003e mice, photoreceptor cell death is associated with inflammation manifesting in upregulation of pro-inflammatory cytokines, microglial activation, and oxidative stress markers\u003csup\u003e63\u0026ndash;65\u003c/sup\u003e. In this model, various strategies were employed to mitigate retinal damage, including the use of antioxidant compounds, anti-apoptotic or neurotrophic factors, and neuroprotective hormones\u003csup\u003e66\u003c/sup\u003e. Targeting inflammation was also shown to slow the progression of photoreceptor degeneration in Pde6b\u003csup\u003erd10\u003c/sup\u003e mice. For example, inhibition of microglial activation using EP-2 inhibitors\u003csup\u003e67\u003c/sup\u003e, COX-1 inhibitors\u003csup\u003e68\u003c/sup\u003e, dexamethasone\u003csup\u003e69\u003c/sup\u003e, TNF-\u0026alpha;\u003csup\u003e70,71\u003c/sup\u003e, IL-27\u003csup\u003e72\u003c/sup\u003e, and mYd88 inhibitors\u003csup\u003e73\u003c/sup\u003e was associated with reduced severity of retinal damage in this model. Ablation of\u003cem\u003e\u0026nbsp;Ccr2\u003c/em\u003e, another chemokine receptor, also alleviated degeneration in this model\u003csup\u003e74\u003c/sup\u003e. The beneficial effect associated with \u003cem\u003eCcr2\u003c/em\u003e deletion appears to be attributed to reduced monocytes infiltration\u003csup\u003e75\u003c/sup\u003e. In Arrestin-1 knockout mouse, a model of degeneration specific to photoreceptor cells, genetic deletion of Ccr2, specific genetic deletion of Ccl2 in M\u0026uuml;ller cell and CCL2 pharmacological inhibition\u0026nbsp;reduced the influx of monocytes, but didn\u0026apos;t not influence the course of the neurodegeneration\u003csup\u003e74\u003c/sup\u003e. By contrast, pharmacological inhibition of CCR1 in our study conferred neuroprotection, conceivably through its dual modulatory effects on monocytes recruitment and M\u0026uuml;ller glia activation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBoth \u003cem\u003eCcr1\u003c/em\u003e gene deletion and CCR1 pharmacologic inhibition showed rescue effect in models of retinal degeneration which we have tested. Nonetheless, the extent of neuroprotection conferred by each approach was variable. In accordance with a previous report\u003csup\u003e65\u003c/sup\u003e, we showed upregulation of \u003cem\u003eCcl3\u003c/em\u003e and \u003cem\u003eCcl5\u003c/em\u003e in Pde6b\u003csup\u003erd10\u003c/sup\u003e mice retina. Additionally, we observed that \u003cem\u003eCcr1\u003c/em\u003e deletion in Pde6b\u003csup\u003erd10\u003c/sup\u003e mice lead to the sustained upregulation of these cytokines until P35. By contrast, in Pdeb\u003csup\u003erd10\u003c/sup\u003e mice retinal downregulation of the same cytokines was observed at P35. Beyond their functional roles, chemokine receptors can also regulate the levels of their ligands through receptor-ligand internalization and degradation\u003csup\u003e76,77\u003c/sup\u003e, feedback mechanism or enzymatic processing\u003csup\u003e78\u003c/sup\u003e. Thus, the lack of CCR1 receptor may explain why the CCR1-specific ligands remain elevated in the Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice. Additionally, \u003cem\u003eCcl2\u003c/em\u003e shows dramatic upregulation in Pde6b\u003csup\u003erd10\u003c/sup\u003e/Ccr1\u003csup\u003e-/-\u003c/sup\u003e mice, likely due to a compensatory effect, as observed in another model with receptor ablation\u003csup\u003e79\u003c/sup\u003e. The sustained upregulation of \u003cem\u003eCcl2\u003c/em\u003e, \u003cem\u003eCcl3\u003c/em\u003e and \u003cem\u003eCcl5\u003c/em\u003e could exacerbate retinal inflammation, accelerating photoreceptor cell death through non-CCR1 signaling pathways. This may explain why the protective effects of \u003cem\u003eCcr1\u003c/em\u003e ablation do not persist beyond P21 in an aggressive, rapidly progressing retinal degeneration process. On the other hand, our data show that in a slower progressing retinal degeneration process in Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emouse, \u003cem\u003eCcr1\u003c/em\u003e deletion exhibits a sustained protective effect accompanied by reduced expression levels of \u003cem\u003eCcl2\u003c/em\u003e up to 18 months of age. The differential regulation of CCR1 ligands between acute and chronic retinal degeneration models may be attributed to the distinct pathophysiological contexts: the acute model is characterized by a rapid and severe loss of homeostatic feedback, triggering a marked upregulation of chemokines in an attempt to restore equilibrium; in contrast, the chronic model involves a more gradual disruption, allowing for a more adaptive and controlled inflammatory response\u003csup\u003e80\u003c/sup\u003e. Interestingly, unlike \u003cem\u003eCcr1\u003c/em\u003e deletion, pharmacological inhibition of CCR1 did not lead to compensatory increases in \u003cem\u003eCcl2\u003c/em\u003e, \u003cem\u003eCcl3\u003c/em\u003e, or \u003cem\u003eCcl5\u003c/em\u003e expression. Collectively, these findings indicate the therapeutic potential of pharmacological CCR1 inhibition as an effective strategy for treating slowly progressing retinal disorders, such as AMD and IRDs.\u003c/p\u003e\n\u003cp\u003eFew important caveats associated with the current study should be noted. The effects of CCR1 inhibitors (BX471 and CCX354) were evaluated using acute injury models, Pde6b\u003csup\u003erd10\u003c/sup\u003e mice in the current study and photic-injury model in our previous work\u003csup\u003e20\u003c/sup\u003e, where the majority of photoreceptors degenerated within a 4 to 6 days window. The rapid progression of this degenerative model contrasts with the more gradual course characteristic of human retinal degeneration. Nevertheless, our findings in Crb1\u003csup\u003erd8/rd8\u0026nbsp;\u003c/sup\u003emice, which exhibit a slower and milder form of degeneration, demonstrate the effectiveness of long-term CCR1 inhibition to modulate retinal degeneration.\u003c/p\u003e\n\u003cp\u003eIn conclusion, the current study combined with previous literature implicates M\u0026uuml;ller cell activation in retinal degeneration and AMD. In addition, we show that CCR1 signaling constitute a common injury pathway in retinal injury. Further research should be performed to evaluate if CCR1 inhibition may serve as a potential therapeutic strategy for common blinding diseases such as AMD and IRDs.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eanalysis. The results were presented as the mean fold change \u0026plusmn; the standard error of the mean (SEM).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization: SEH, IC. Methodology: SEH, SJ, AK, YS. Investigation: SEH, LO. Visualization: SEH, IC. Formal analysis: SEH, BR, MEM. Supervision: IC. Writing\u0026mdash;original draft: SEH, IC.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported in part by grants from the Israel Science Foundation (#2080/23), by the Jonas Friedenwald Cathedra in Ophthalmological Research, and by a grant from the Israeli Ministry of Science (#0007972).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll procedures were conducted according to the Ethics Committee of the Hebrew University, the Hadassah Medical Organization and the University of Pennsylvania.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests. Sandro De Zanet, Stefanos Apostolopoulos, and Carlos Ciller are employees and shareholders of RetinAI Medical AG (Bern, Switzerland).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eVyawahare H, Shinde P. Age-Related Macular Degeneration: Epidemiology, Pathophysiology, Diagnosis, and Treatment. \u003cem\u003eCureus\u003c/em\u003e. 2022;14(9):e29583. doi:10.7759/cureus.29583\u003c/li\u003e\n\u003cli\u003eLeeuwen R Van, Klaver CCW, Vingerling JR, Hofman A, Jong PTVM De. The Risk and Natural Course of Age-Related Maculopathy. \u003cem\u003eArch Ophthalmol\u003c/em\u003e. 2003;121:519-526. doi:10.1001/archopht.121.4.519\u003c/li\u003e\n\u003cli\u003eRegillo CD, Busbee BG, Ho AC, Ding B, Haskova Z. Baseline predictors of 12-month treatment response to ranibizumab in patients with wet age-related macular degeneration. \u003cem\u003eAm J Ophthalmol\u003c/em\u003e. 2015;160(5):1014-1023.e2. doi:10.1016/j.ajo.2015.07.034\u003c/li\u003e\n\u003cli\u003eHeesterbeek TJ, Lor\u0026eacute;s-Motta L, Hoyng CB, Lechanteur YTE, den Hollander AI. Risk factors for progression of age-related macular degeneration. \u003cem\u003eOphthalmic Physiol Opt\u003c/em\u003e. 2020;40(2):140-170. doi:10.1111/opo.12675\u003c/li\u003e\n\u003cli\u003eBuschini E, Piras A, Nuzzi R, Vercelli A. Age related macular degeneration and drusen: neuroinflammation in the retina. \u003cem\u003eProg Neurobiol\u003c/em\u003e. 2011;95(1):14-25. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve\u0026amp;db=PubMed\u0026amp;dopt=Citation\u0026amp;list_uids=21740956\u003c/li\u003e\n\u003cli\u003eKauppinen A, Paterno JJ, Blasiak J, Salminen A, Kaarniranta K. Inflammation and its role in age-related macular degeneration. \u003cem\u003eCell Mol Life Sci\u003c/em\u003e. 2016;73(9):1765-1786. doi:10.1007/s00018-016-2147-8\u003c/li\u003e\n\u003cli\u003eCao X, Shen D, Patel MM, et al. Macrophage polarization in the maculae of age-related macular degeneration: A pilot study. \u003cem\u003ePathol Int\u003c/em\u003e. 2011;61(9):528-535. doi:10.1111/j.1440-1827.2011.02695.x\u003c/li\u003e\n\u003cli\u003eLad EM, Cousins SW, Van Arnam JS, Proia AD. Abundance of infiltrating CD163+ cells in the retina of postmortem eyes with dry and neovascular age-related macular degeneration. \u003cem\u003eGraefe\u0026rsquo;s Archive for Clinical and Experimental Ophthalmology\u003c/em\u003e. 2015;253(11):1941-1945. doi:10.1007/s00417-015-3094-z\u003c/li\u003e\n\u003cli\u003eBuschini E, Piras A, Nuzzi R, Vercelli A. Age related macular degeneration and drusen: Neuroinflammation in the retina. \u003cem\u003eProg Neurobiol\u003c/em\u003e. 2011;95(1):14-25. doi:10.1016/j.pneurobio.2011.05.011\u003c/li\u003e\n\u003cli\u003eGupta N, Brown KE, Milam AH. Activated microglia in human retinitis pigmentosa, late-onset retinal degeneration, and age-related macular degeneration. \u003cem\u003eExp Eye Res\u003c/em\u003e. 2003;76(4):463-471. doi:10.1016/S0014-4835(02)00332-9\u003c/li\u003e\n\u003cli\u003eJoo JH, Kim H, Shin JH, Moon SW. Aqueous humor cytokine levels through microarray analysis and a sub-analysis based on optical coherence tomography in wet age-related macular degeneration patients. \u003cem\u003eBMC Ophthalmol\u003c/em\u003e. 2021;21(1):399. doi:10.1186/s12886-021-02152-6\u003c/li\u003e\n\u003cli\u003eGrunin M, Shira-Hagbi-Levi, Rinsky B, Smith Y, Chowers I. Transcriptome analysis on monocytes from patients with neovascular age-related macular degeneration. \u003cem\u003eSci Rep\u003c/em\u003e. 2016;6. doi:10.1038/srep29046\u003c/li\u003e\n\u003cli\u003eNomiyama H, Osada N, Yoshie O. The evolution of mammalian chemokine genes. \u003cem\u003eCytokine Growth Factor Rev\u003c/em\u003e. 2010;21(4):253-262. doi:10.1016/j.cytogfr.2010.03.004\u003c/li\u003e\n\u003cli\u003eGilchrist A, Echeverria SL. Targeting Chemokine Receptor CCR1 as a Potential Therapeutic Approach for Multiple Myeloma. \u003cem\u003eFront Endocrinol (Lausanne)\u003c/em\u003e. 2022;13:846310. doi:10.3389/fendo.2022.846310\u003c/li\u003e\n\u003cli\u003eYan J, Zuo G, Sherchan P, Huang L, Ocak U, Xu W, Travis ZD, Wang W, Zhang JH TJ. CCR1 Activation Promotes Neuroinflammation Through CCR1/TPR1/ERK1/2 Signaling Pathway After Intracerebral Hemorrhage in Mice. \u003cem\u003eNeurotherapeutics\u003c/em\u003e. 2020;17(3):1170-1183.\u003c/li\u003e\n\u003cli\u003eLee MMK, Wong YH. CCR1-mediated activation of nuclear factor-kB in THP-1 monocytic cells involves pertussis toxin-insensitive Galpha (14) and Galpha (16) signaling cascades. \u003cem\u003eJ Leukoc Biol\u003c/em\u003e. 2009;86(6):1319-1329. doi:10.1189/jlb.0209052\u003c/li\u003e\n\u003cli\u003eTrebst C, S\u0026oslash;rensen TL, Kivis\u0026auml;kk P, et al. CCR1+/CCR5+ mononuclear phagocytes accumulate in the central nervous system of patients with multiple sclerosis. \u003cem\u003eAm J Pathol\u003c/em\u003e. 2001;159(5):1701-1710. doi:10.1016/S0002-9440(10)63017-9\u003c/li\u003e\n\u003cli\u003eRottman JB, Slavin AJ, Silva R, Weiner HL, Gerard CG, Hancock WW. Leukocyte recruitment during onset of experimental allergic encephalomyelitis is CCR1 dependent. \u003cem\u003eEur J Immunol\u003c/em\u003e. 2000;30(8):2372-2377. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve\u0026amp;db=PubMed\u0026amp;dopt=Citation\u0026amp;list_uids=10940928\u003c/li\u003e\n\u003cli\u003eWeber C, Weber KSC, Klier C, et al. Specialized roles of the chemokine receptors CCR1 and CCR5 in the recruitment of monocytes and TH1-like/CD45RO+ T cells. \u003cem\u003eBlood\u003c/em\u003e. 2001;97(4):1144-1146. doi:10.1182/blood.V97.4.1144\u003c/li\u003e\n\u003cli\u003eElbaz-Hayoun S, Rinsky B, Hagbi-Levi S, Grunin M, Chowers I. CCR1 mediates M\u0026uuml;ller cell activation and photoreceptor cell death in macular and retinal degeneration. \u003cem\u003eElife\u003c/em\u003e. 2023;12:1-28. doi:10.7554/eLife.81208\u003c/li\u003e\n\u003cli\u003eReichenbach A, Bringmann A. New Functions of Muller Cells. \u003cem\u003eGlia\u003c/em\u003e. 2013;61(5):651-678. doi:10.1002/glia.22477\u003c/li\u003e\n\u003cli\u003eBringmann A, Wiedemann P. M\u0026uuml;ller Glial Cells in Retinal Disease. \u003cem\u003eOphtalmologica\u003c/em\u003e. 2012;227:1-19. doi:10.1159/000328979\u003c/li\u003e\n\u003cli\u003eSaddala MS, Lennikov A, Mukwaya A, Fan L, Hu Z, Huang H. Transcriptome-wide analysis of differentially expressed chemokine receptors, SNPs, and SSRs in the age-related macular degeneration. \u003cem\u003eHum Genomics\u003c/em\u003e. 2019;13(1):15. doi:10.1186/s40246-019-0199-1\u003c/li\u003e\n\u003cli\u003eGigon A, Mosinska A, Montesel A, et al. Personalized Atrophy Risk Mapping in Age-Related Macular Degeneration. \u003cem\u003eTransl Vis Sci Technol\u003c/em\u003e. 2021;10(13):18. doi:10.1167/tvst.10.13.18\u003c/li\u003e\n\u003cli\u003eMantel I, Mosinska A, Bergin C, et al. Automated Quantification of Pathological Fluids in Neovascular Age-Related Macular Degeneration, and Its Repeatability Using Deep Learning. \u003cem\u003eTransl Vis Sci Technol\u003c/em\u003e. 2021;10(4):17. doi:10.1167/tvst.10.4.17\u003c/li\u003e\n\u003cli\u003eMartin-Pinardel R, Izquierdo-Serra J, De Zanet S, et al. Artificial intelligence-based fluid quantification and associated visual outcomes in a real-world, multicentre neovascular age-related macular degeneration national database. \u003cem\u003eBr J Ophthalmol\u003c/em\u003e. 2024;108(2):253-262. doi:10.1136/bjo-2022-322297\u003c/li\u003e\n\u003cli\u003eJaskoll S, Shwartz Y, Kramer A, et al. Genetic Risk and OCT-Based Phenotypic Associations in Age-Related Macular Degeneration. \u003cem\u003eOphthalmology science\u003c/em\u003e. 2025;5(6):100853. doi:10.1016/j.xops.2025.100853\u003c/li\u003e\n\u003cli\u003eMehalow AK, Kameya S, Smith RS, et al. CRB1 is essential for external limiting membrane integrity and photoreceptor morphogenesis in the mammalian retina. \u003cem\u003eHum Mol Genet\u003c/em\u003e. 2003;12(17):2179-2189. doi:10.1093/hmg/ddg232\u003c/li\u003e\n\u003cli\u003eWang T, Reingruber J, Woodruff ML, et al. The PDE6 mutation in the rd10 retinal degeneration mouse model causes protein mislocalization and instability and promotes cell death through increased ion influx. \u003cem\u003eJ Biol Chem\u003c/em\u003e. 2018;293(40):15332-15346. doi:10.1074/jbc.RA118.004459\u003c/li\u003e\n\u003cli\u003ePennesi ME, Michaels K V, Magee SS, et al. Long-term characterization of retinal degeneration in rd1 and rd10 mice using spectral domain optical coherence tomography. \u003cem\u003eInvest Ophthalmol Vis Sci\u003c/em\u003e. 2012;53(8):4644-4656. doi:10.1167/iovs.12-9611\u003c/li\u003e\n\u003cli\u003eMattapallil MJ, Wawrousek EF, Chan CC, et al. The Rd8 mutation of the Crb1 gene is present in vendor lines of C57BL/6N mice and embryonic stem cells, and confounds ocular induced mutant phenotypes. \u003cem\u003eInvest Ophthalmol Vis Sci\u003c/em\u003e. 2012;53(6):2921-2927. doi:10.1167/iovs.12-9662\u003c/li\u003e\n\u003cli\u003eGao JL, Wynn TA, Chang Y, et al. Impaired host defense, hematopoiesis, granulomatous inflammation and type 1-type 2 cytokine balance in mice lacking CC chemokine receptor 1. \u003cem\u003eJ Exp Med\u003c/em\u003e. 1997;185(11):1959-1968. doi:10.1084/jem.185.11.1959\u003c/li\u003e\n\u003cli\u003eChang B, Hawes NL, Pardue MT, et al. Two mouse retinal degenerations caused by missense mutations in the beta-subunit of rod cGMP phosphodiesterase gene. \u003cem\u003eVision Res\u003c/em\u003e. 2007;47(5):624-633. doi:10.1016/j.visres.2006.11.020\u003c/li\u003e\n\u003cli\u003eLivak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. \u003cem\u003eMethods\u003c/em\u003e. 2001;25(4):402-408. doi:10.1006/meth.2001.1262\u003c/li\u003e\n\u003cli\u003eBanin E, Obolensky A, Idelson M, et al. Retinal incorporation and differentiation of neural precursors derived from human embryonic stem cells. \u003cem\u003eStem Cells\u003c/em\u003e. 2006;24(2):246-257. doi:10.1634/stemcells.2005-0009\u003c/li\u003e\n\u003cli\u003eYao Y, Li J, Zhou Y, et al. Macrophage/microglia polarization for the treatment of diabetic retinopathy. \u003cem\u003eFront Endocrinol (Lausanne)\u003c/em\u003e. 2023;14:1276225. doi:10.3389/fendo.2023.1276225\u003c/li\u003e\n\u003cli\u003eHeuss ND, Pierson MJ, Roehrich H, et al. Optic nerve as a source of activated retinal microglia post-injury. \u003cem\u003eActa Neuropathol Commun\u003c/em\u003e. 2018;6(1):66. doi:10.1186/s40478-018-0571-8\u003c/li\u003e\n\u003cli\u003eBenhar I, Reemst K, Kalchenko V, Schwartz M. The retinal pigment epithelium as a gateway for monocyte trafficking into the eye. \u003cem\u003eEMBO J\u003c/em\u003e. 2016;35(11):1219-1235. doi:10.15252/embj.201694202\u003c/li\u003e\n\u003cli\u003eLe K, Sun J, Ghaemmaghami J, et al. Blockade of CCR1 induces a phenotypic shift in macrophages and triggers a favorable antilymphoma activity. \u003cem\u003eBlood Adv\u003c/em\u003e. 2023;7(15):3952-3967. doi:10.1182/bloodadvances.2022008722\u003c/li\u003e\n\u003cli\u003eStikker B, Stik G, Hendriks RW, Stadhouders R. Severe COVID-19 associated variants linked to chemokine receptor gene control in monocytes and macrophages. \u003cem\u003ebioRxiv\u003c/em\u003e. Published online June 11, 2021. doi:10.1101/2021.01.22.427813\u003c/li\u003e\n\u003cli\u003eLi H, Pan T, Gao L, et al. Chemokine receptor CCR1 regulates macrophage activation through mTORC1 signaling in nonalcoholic steatohepatitis. \u003cem\u003eMetabolism\u003c/em\u003e. 2024;151:155758. doi:10.1016/j.metabol.2023.155758\u003c/li\u003e\n\u003cli\u003eSahu B, Chavali VRM, Alapati A, et al. Presence of rd8 mutation does not alter the ocular phenotype of late-onset retinal degeneration mouse model. \u003cem\u003eMol Vis\u003c/em\u003e. 2015;21:273-284.\u003c/li\u003e\n\u003cli\u003eSaul AB, Cui X, Markand S, Smith SB. Detailed electroretinographic findings in rd8 mice. \u003cem\u003eDoc Ophthalmol\u003c/em\u003e. 2017;134(3):195-203. doi:10.1007/s10633-017-9585-y\u003c/li\u003e\n\u003cli\u003eLuhmann UFO, Carvalho LS, Holthaus SM kleine, et al. The severity of retinal pathology in homozygous Crb1rd8/rd8 mice is dependent on additional genetic factors. \u003cem\u003eHum Mol Genet\u003c/em\u003e. 2015;24(1):128-141. doi:10.1093/hmg/ddu424\u003c/li\u003e\n\u003cli\u003eAredo B, Zhang K, Chen X, Wang CXZ, Li T, Ufret-Vincenty RL. Differences in the distribution, phenotype and gene expression of subretinal microglia/macrophages in C57BL/6N (Crb1 rd8/rd8) versus C57BL6/J (Crb1 wt/wt) mice. \u003cem\u003eJ Neuroinflammation\u003c/em\u003e. 2015;12:6. doi:10.1186/s12974-014-0221-4\u003c/li\u003e\n\u003cli\u003eDavis BM, Salinas-Navarro M, Cordeiro MF, Moons L, De Groef L. Characterizing microglia activation: a spatial statistics approach to maximize information extraction. \u003cem\u003eSci Rep\u003c/em\u003e. 2017;7(1):1576. doi:10.1038/s41598-017-01747-8\u003c/li\u003e\n\u003cli\u003eRonning KE, Karlen SJ, Burns ME. Structural and functional distinctions of co-resident microglia and monocyte-derived macrophages after retinal degeneration. \u003cem\u003eJ Neuroinflammation\u003c/em\u003e. 2022;19(1):299. doi:10.1186/s12974-022-02652-2\u003c/li\u003e\n\u003cli\u003ePerry VH, Hume DA, Gordon S. Immunohistochemical localization of macrophages and microglia in the adult and developing mouse brain. \u003cem\u003eNeuroscience\u003c/em\u003e. 1985;15(2):313-326. doi:10.1016/0306-4522(85)90215-5\u003c/li\u003e\n\u003cli\u003eLyu Y, Zauhar R, Dana N, et al. Implication of specific retinal cell-type involvement and gene expression changes in AMD progression using integrative analysis of single-cell and bulk RNA-seq profiling. \u003cem\u003eSci Rep\u003c/em\u003e. 2021;11(1):15612. doi:10.1038/s41598-021-95122-3\u003c/li\u003e\n\u003cli\u003eWu KHC, Madigan MC, Billson FA, Penfold PL. Differential expression of GFAP in early v late AMD: a quantitative analysis. \u003cem\u003eBr J Ophthalmol\u003c/em\u003e. 2003;87(9):1159-1166. doi:10.1136/bjo.87.9.1159\u003c/li\u003e\n\u003cli\u003eWeatherly SM, Collin GB, Charette JR, et al. Identification of Arhgef12 and Prkci as genetic modifiers of retinal dysplasia in the Crb1rd8 mouse model. \u003cem\u003ePLoS Genet\u003c/em\u003e. 2022;18(6):e1009798. doi:10.1371/journal.pgen.1009798\u003c/li\u003e\n\u003cli\u003eHippert C, Graca AB, Barber AC, et al. M\u0026uuml;ller glia activation in response to inherited retinal degeneration is highly varied and disease-specific. \u003cem\u003ePLoS One\u003c/em\u003e. 2015;10(3):e0120415. doi:10.1371/journal.pone.0120415\u003c/li\u003e\n\u003cli\u003eKang S, Larbi D, Andrade M, Reardon S, Reh TA, Wohl SG. A Comparative Analysis of Reactive M\u0026uuml;ller Glia Gene Expression After Light Damage and microRNA-Depleted M\u0026uuml;ller Glia-Focus on microRNAs. \u003cem\u003eFront Cell Dev Biol\u003c/em\u003e. 2020;8:620459. doi:10.3389/fcell.2020.620459\u003c/li\u003e\n\u003cli\u003eRutar M, Natoli R, Chia R, Valter K, Provis JM. Chemokine-mediated inflammation in the degenerating retina is coordinated by Muller cells, activated microglia, and retinal pigment epithelium. \u003cem\u003eJ Neuroinflammation\u003c/em\u003e. 2015;12. doi:10.1186/s12974-014-0224-1\u003c/li\u003e\n\u003cli\u003eArroba AI, Alvarez-Lindo N, van Rooijen N de la REJ. Microglia-M\u0026uuml;ller glia crosstalk in the rd10 mouse model of retinitis pigmentosa. \u003cem\u003eAdv Exp Med Biol\u003c/em\u003e. 2014;801:373-379.\u003c/li\u003e\n\u003cli\u003eChen X, Kezic J, Bernard C, McMenamin PG. Rd8 mutation in the Crb1 gene of CD11c-eYFP transgenic reporter mice results in abnormal numbers of CD11c-positive cells in the retina. \u003cem\u003eJ Neuropathol Exp Neurol\u003c/em\u003e. 2013;72(8):782-790. doi:10.1097/NEN.0b013e31829e8375\u003c/li\u003e\n\u003cli\u003eKaufmann a, Salentin R, Gemsa D, Sprenger H. Increase of CCR1 and CCR5 expression and enhanced functional response to MIP-1 alpha during differentiation of human monocytes to macrophages. \u003cem\u003eJ Leukoc Biol\u003c/em\u003e. 2001;69(2):248-252.\u003c/li\u003e\n\u003cli\u003eBujakowska K, Audo I, Mohand-Sa\u0026iuml;d S, et al. CRB1 mutations in inherited retinal dystrophies. \u003cem\u003eHum Mutat\u003c/em\u003e. 2012;33(2):306-315. doi:10.1002/humu.21653\u003c/li\u003e\n\u003cli\u003eWang Y, Abu-Asab MS, Yu CR, et al. Platelet-derived growth factor (PDGF)-C inhibits neuroretinal apoptosis in a murine model of focal retinal degeneration. \u003cem\u003eLab Invest\u003c/em\u003e. 2014;94(6):674-682. doi:10.1038/labinvest.2014.60\u003c/li\u003e\n\u003cli\u003eLee S, Varvel NH, Konerth ME, et al. CX3CR1 deficiency alters microglial activation and reduces beta-amyloid deposition in two Alzheimer\u0026rsquo;s disease mouse models. \u003cem\u003eAm J Pathol\u003c/em\u003e. 2010;177(5):2549-2562. doi:10.2353/ajpath.2010.100265\u003c/li\u003e\n\u003cli\u003eSaederup N, Chan L, Lira SA, Charo IF. Fractalkine deficiency markedly reduces macrophage accumulation and atherosclerotic lesion formation in CCR2-/- mice: evidence for independent chemokine functions in atherogenesis. \u003cem\u003eCirculation\u003c/em\u003e. 2008;117(13):1642-1648. doi:10.1161/CIRCULATIONAHA.107.743872\u003c/li\u003e\n\u003cli\u003eCombadi\u0026egrave;re C, Potteaux S, Rodero M, et al. Combined inhibition of CCL2, CX3CR1, and CCR5 abrogates Ly6C(hi) and Ly6C(lo) monocytosis and almost abolishes atherosclerosis in hypercholesterolemic mice. \u003cem\u003eCirculation\u003c/em\u003e. 2008;117(13):1649-1657. doi:10.1161/CIRCULATIONAHA.107.745091\u003c/li\u003e\n\u003cli\u003eZhao L, Zabel MK, Wang X, et al. Microglial phagocytosis of living photoreceptors contributes to inherited retinal degeneration. \u003cem\u003eEMBO Mol Med\u003c/em\u003e. 2015;7(9):e201505298. doi:10.15252/emmm.201505298\u003c/li\u003e\n\u003cli\u003eOrtega JT, Jastrzebska B. Neuroinflammation as a Therapeutic Target in Retinitis Pigmentosa and Quercetin as Its Potential Modulator. \u003cem\u003ePharmaceutics\u003c/em\u003e. 2021;13(11). doi:10.3390/pharmaceutics13111935\u003c/li\u003e\n\u003cli\u003eCanto A, Mart\u0026iacute;nez-Gonz\u0026aacute;lez J, Miranda M, Olivar T, Almansa I, Hern\u0026aacute;ndez-Rabaza V. Sulforaphane Modulates the Inflammation and Delays Neurodegeneration on a Retinitis Pigmentosa Mice Model. \u003cem\u003eFront Pharmacol\u003c/em\u003e. 2022;13:811257. doi:10.3389/fphar.2022.811257\u003c/li\u003e\n\u003cli\u003eYang H, Zhang H, Li X. Navigating the future of retinitis pigmentosa treatments: A comprehensive analysis of therapeutic approaches in rd10 mice. \u003cem\u003eNeurobiol Dis\u003c/em\u003e. 2024;193:106436. doi:10.1016/j.nbd.2024.106436\u003c/li\u003e\n\u003cli\u003eYang W, Xiong G, Lin B. Cyclooxygenase-1 mediates neuroinflammation and neurotoxicity in a mouse model of retinitis pigmentosa. \u003cem\u003eJ Neuroinflammation\u003c/em\u003e. 2020;17(1):306. doi:10.1186/s12974-020-01993-0\u003c/li\u003e\n\u003cli\u003ePeng B, Xiao J, Wang K, So KF, Tipoe GL, Lin B. Suppression of microglial activation is neuroprotective in a mouse model of human retinitis pigmentosa. \u003cem\u003eJ Neurosci\u003c/em\u003e. 2014;34(24):8139-8150. doi:10.1523/JNEUROSCI.5200-13.2014\u003c/li\u003e\n\u003cli\u003eGuadagni V, Biagioni M, Novelli E, Aretini P, Mazzanti CM, Strettoi E. Rescuing cones and daylight vision in retinitis pigmentosa mice. \u003cem\u003eFASEB J\u003c/em\u003e. 2019;33(9):10177-10192. doi:10.1096/fj.201900414R\u003c/li\u003e\n\u003cli\u003eMart\u0026iacute;nez-Fern\u0026aacute;ndez de la C\u0026aacute;mara C, Hern\u0026aacute;ndez-Pinto AM, Olivares-Gonz\u0026aacute;lez L, et al. Adalimumab Reduces Photoreceptor Cell Death in A Mouse Model of Retinal Degeneration. \u003cem\u003eSci Rep\u003c/em\u003e. 2015;5:11764. doi:10.1038/srep11764\u003c/li\u003e\n\u003cli\u003eOlivares-Gonz\u0026aacute;lez L, Velasco S, Mill\u0026aacute;n JM, Rodrigo R. Intravitreal administration of adalimumab delays retinal degeneration in rd10 mice. \u003cem\u003eFASEB J\u003c/em\u003e. 2020;34(10):13839-13861. doi:10.1096/fj.202000044RR\u003c/li\u003e\n\u003cli\u003eNortey A, Garces K, Carmy-Bennun T, Hackam AS. The cytokine IL-27 reduces inflammation and protects photoreceptors in a mouse model of retinal degeneration. \u003cem\u003eJ Neuroinflammation\u003c/em\u003e. 2022;19(1):216. doi:10.1186/s12974-022-02576-x\u003c/li\u003e\n\u003cli\u003eGarces K, Carmy T, Illiano P, Brambilla R, Hackam AS. Increased Neuroprotective Microglia and Photoreceptor Survival in the Retina from a Peptide Inhibitor of Myeloid Differentiation Factor 88 (MyD88). \u003cem\u003eJ Mol Neurosci\u003c/em\u003e. 2020;70(6):968-980. doi:10.1007/s12031-020-01503-0\u003c/li\u003e\n\u003cli\u003eKarlen SJ, Miller EB, Wang X, Levine ES, Zawadzki RJ, Burns ME. Monocyte infiltration rather than microglia proliferation dominates the early immune response to rapid photoreceptor degeneration. \u003cem\u003eJ Neuroinflammation\u003c/em\u003e. 2018;15(1):344. doi:10.1186/s12974-018-1365-4\u003c/li\u003e\n\u003cli\u003eSennlaub F, Auvynet C, Calippe B, et al. CCR2(+) monocytes infiltrate atrophic lesions in age-related macular disease and mediate photoreceptor degeneration in experimental subretinal inflammation in Cx3cr1 deficient mice. \u003cem\u003eEMBO Mol Med\u003c/em\u003e. 2013;5(11):1775-1793. doi:10.1002/emmm.201302692\u003c/li\u003e\n\u003cli\u003eGu S, Maurya S, Lona A, et al. Ligand-Dependent Mechanisms of CC Chemokine Receptor 5 (CCR5) Trafficking Revealed by APEX2 Proximity Labeling Proteomics. \u003cem\u003ebioRxiv\u003c/em\u003e. Published online August 8, 2024. doi:10.1101/2023.11.01.565224\u003c/li\u003e\n\u003cli\u003eBlack JB, Premont RT, Daaka Y. Feedback regulation of G protein-coupled receptor signaling by GRKs and arrestins. \u003cem\u003eSemin Cell Dev Biol\u003c/em\u003e. 2016;50:95-104. doi:10.1016/j.semcdb.2015.12.015\u003c/li\u003e\n\u003cli\u003eGrady E, B\u0026ouml;hm S, McConalogue K, et al. Mechanisms attenuating cellular responses to neuropeptides: extracellular degradation of ligands and desensitization of receptors. \u003cem\u003eJ Investig Dermatol Symp Proc\u003c/em\u003e. 1997;2(1):69-75. doi:10.1038/jidsymp.1997.14\u003c/li\u003e\n\u003cli\u003eCardona AE, Sasse ME, Liu L, et al. Scavenging roles of chemokine receptors: chemokine receptor deficiency is associated with increased levels of ligand in circulation and tissues. \u003cem\u003eBlood\u003c/em\u003e. 2008;112(2):256-263. doi:10.1182/blood-2007-10-118497\u003c/li\u003e\n\u003cli\u003eChangeux J, Edelstein SJ. Allosteric mechanisms in normal and pathological nicotinic acetylcholine receptors. \u003cem\u003eCurr Opin Neurobiol\u003c/em\u003e. 2001;11(3):369-377. doi:10.1016/s0959-4388(00)00221-x\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-neuroinflammation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jneu","sideBox":"Learn more about [Journal of Neuroinflammation](http://jneuroinflammation.biomedcentral.com)","snPcode":"12974","submissionUrl":"https://submission.nature.com/new-submission/12974/3","title":"Journal of Neuroinflammation","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Rd8 mutation, Rd10 mutation, Ccr1 deletion, CCR1 inhibition, Müller cell, Retinal degeneration, Microglial activation, Gliosis, Small molecule","lastPublishedDoi":"10.21203/rs.3.rs-8775900/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8775900/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eInflammation is a key driver of atrophic Age-Related Macular Degeneration (aAMD), and also plays a role in Inherited Retinal Degenerations (IRDs), two major causes of irreversible visual loss. We previously demonstrated that the chemokine receptor CCR1 is upregulated in monocytes from AMD patients, and that it mediates the recruitment of neurotoxic macrophages and activates M\u0026uuml;ller glial cells in rodent model of photic retinal injury. Here we report that CCR1 is expressed in M\u0026uuml;ller glia in eyes affected by AMD and that variants in \u003cem\u003eCCR1\u003c/em\u003e are potentially associated with the rate of macular atrophy progression in AMD. We also show that \u003cem\u003eCcr1\u003c/em\u003e deletion is associated with reduced inflammation, and with rescue of photoreceptor integrity and function in Crb1\u003csup\u003erd8/rd8\u003c/sup\u003e mice and in Pde6b\u003csup\u003erd10\u003c/sup\u003e mice, two models of genetically-driven retinal degeneration. Finally, we demonstrate that treatment with small molecule CCR1 antagonists delayed photoreceptor loss in Pde6b\u003csup\u003erd10\u003c/sup\u003e mice. These data suggest that CCR1 is a mediator of retinal inflammation and injury in different forms of retinal degeneration, and that CCR1 may serve as a novel therapeutic target for atrophic AMD and IRDs.\u003c/p\u003e","manuscriptTitle":"CCR1 Signaling as a Common Injury Pathway in Retinal Degeneration","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-22 16:34:42","doi":"10.21203/rs.3.rs-8775900/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-02-27T08:36:23+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-26T20:39:51+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-26T14:21:12+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-24T16:54:11+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"274484261045127397507173646308919869544","date":"2026-02-20T12:45:15+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"165447660427472500321603469796567421390","date":"2026-02-18T18:12:03+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"141342857368737924515428588394705561247","date":"2026-02-17T19:15:36+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"253684656144290775525031069045884642822","date":"2026-02-17T17:45:27+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-02-17T17:39:30+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-02-13T06:22:31+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-11T11:59:49+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Neuroinflammation","date":"2026-02-03T11:42:19+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-neuroinflammation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jneu","sideBox":"Learn more about [Journal of Neuroinflammation](http://jneuroinflammation.biomedcentral.com)","snPcode":"12974","submissionUrl":"https://submission.nature.com/new-submission/12974/3","title":"Journal of Neuroinflammation","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"084c5141-f974-4d2f-845e-8cd3741f3efc","owner":[],"postedDate":"February 22nd, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[],"tags":[],"updatedAt":"2026-02-27T08:40:41+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-22 16:34:42","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8775900","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8775900","identity":"rs-8775900","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}