Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse

Effect of human platelet-rich fibrin lysate on... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/13-1056" }, "headline": "Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix...", "datePublished": "2024-09-13T15:43:58", "dateModified": "2025-09-16T15:50:22", "author": [ { "@type": "Person", "name": "Akbar Novan Dwi Saputra" }, { "@type": "Person", "name": "Dicky Moch Rizal" }, { "@type": "Person", "name": "Nandia Septiyorini" }, { "@type": "Person", "name": "Muhammad Nurhadi Rahman" }, { "@type": "Person", "name": "Yohanes Widodo Wirohadidjojo" }, { "@type": "Person", "name": "Dwi cahyani Ratna Sari" }, { "@type": "Person", "name": "Raden Mas Sonny Sasotya" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": " Background Pelvic organ prolapse (POP) is a prevalent condition caused by weakened pelvic floor support structures. Extracellular matrix alterations, including changes in collagen type I, collagen type III, and matrix metalloproteinase 1 (MMP-1), contribute to the pathogenesis of this condition. Human platelet-rich fibrin lysate (hPRF-L) is a novel regenerative treatment that has shown beneficial results in treating structural weaknesses related to various pelvic floor diseases, including POP. Methods This study protocol aims to investigate the effects of hPRF-L injection on collagen I, III, and MMP-1 in the vaginal mucosa of a rat POP model. POP will be induced in female Sprague-Dawley rats, which will be randomly assigned to control, sham, and hPRF-L treatment groups. The hPRF-L group will receive weekly injections of hPRF-L (25, 50, or 75 μL) into the vaginal mucosa for 4 weeks. Vaginal tissue samples will be collected, and collagen type I, collagen type III, and MMP-1 expression will be evaluated using quantitative reverse transcription polymerase chain reaction and immunohistochemical analyses. Data analysis will be performed with ANOVA and post-hoc tests. Discussion The findings from this study protocol are expected to provide valuable insights into the mechanisms by which hPRF-L impacts the structural integrity of the pelvic floor. By elucidating these mechanisms, this study aims to inform future POP treatment strategies. The anticipated results are an increase in collagen type I and III expression and a reduction in MMP-1 levels in the hPRF-L treatment group compared to the control and sham groups. These outcomes could support the use of hPRF-L as a regenerative therapy for managing POP, offering a potential alternative to more invasive surgical interventions. Conclusion The expected results will contribute to the development of less invasive treatments for POP, improving patient outcomes and quality of life. " } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/13-1056/v2", "name": "Effect of human platelet-rich fibrin lysate on collagen type I, collagen..." } } ] } Home Browse Effect of human platelet-rich fibrin lysate on collagen type I, collagen... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Saputra AND, Rizal DM, Septiyorini N et al. Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 13 :1056 ( https://doi.org/10.12688/f1000research.152876.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Study Protocol Revised Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] Akbar Novan Dwi Saputra https://orcid.org/0000-0002-8829-786X 1,2 , Dicky Moch Rizal https://orcid.org/0000-0002-4775-282X 3 , Nandia Septiyorini 3 , [...] Muhammad Nurhadi Rahman 1 , Yohanes Widodo Wirohadidjojo 4 , Dwi cahyani Ratna Sari https://orcid.org/0000-0002-1126-4939 5 , Raden Mas Sonny Sasotya 6 Akbar Novan Dwi Saputra https://orcid.org/0000-0002-8829-786X 1,2 , Dicky Moch Rizal https://orcid.org/0000-0002-4775-282X 3 , [...] Nandia Septiyorini 3 , Muhammad Nurhadi Rahman 1 , Yohanes Widodo Wirohadidjojo 4 , Dwi cahyani Ratna Sari https://orcid.org/0000-0002-1126-4939 5 , Raden Mas Sonny Sasotya 6 PUBLISHED 16 Sep 2025 Author details Author details 1 Department of Obstetrics and Gynecology, Faculty of Medicine, Public Health and Nursing, Dr. Sardjito Hospital, Universitas Gadjah Mada, Yogyakarta, Special Region of Yogyakarta, 55281, Indonesia 2 Doctoral Program, Faculty of Medicine, Public Health and Nursing, Universitas Gadjah Mada, Yogyakarta, Special Region of Yogyakarta, 55281, Indonesia 3 Department of Physiology, Faculty of Medicine, Public Health and Nursing, Universitas Gadjah Mada, Yogyakarta, Special Region of Yogyakarta, 55281, Indonesia 4 Department of Dermatovenerology, Faculty of Medicine, Public Health and Nursing, Dr. Sardjito Hospital, Universitas Gadjah Mada, Yogyakarta, Special Region of Yogyakarta, 55281, Indonesia 5 Department of Anatomy, Faculty of Medicine, Public Health and Nursing, Universitas Gadjah Mada, Yogyakarta, Special Region of Yogyakarta, 55281, Indonesia 6 Urogynecology and Reconstruction Division, Obstetrics and Gynecology Department, Faculty of Medicine, Universitas Padjadjaran, Bandung, West Java, 45363, Indonesia Akbar Novan Dwi Saputra Roles: Conceptualization, Methodology, Writing – Original Draft Preparation, Writing – Review & Editing Dicky Moch Rizal Roles: Conceptualization, Funding Acquisition, Supervision, Writing – Review & Editing Nandia Septiyorini Roles: Methodology, Project Administration, Resources, Writing – Original Draft Preparation, Writing – Review & Editing Muhammad Nurhadi Rahman Roles: Conceptualization, Methodology, Supervision, Writing – Review & Editing Yohanes Widodo Wirohadidjojo Roles: Methodology, Supervision, Writing – Review & Editing Dwi cahyani Ratna Sari Roles: Methodology, Supervision, Writing – Review & Editing Raden Mas Sonny Sasotya Roles: Methodology, Supervision, Writing – Review & Editing OPEN PEER REVIEW DETAILS REVIEWER STATUS This article is included in the Advances in Fibroblast Research collection. Abstract Background Pelvic organ prolapse (POP) is a prevalent condition caused by weakened pelvic floor support structures. Extracellular matrix alterations, including changes in collagen type I, collagen type III, and matrix metalloproteinase 1 (MMP-1), contribute to the pathogenesis of this condition. Human platelet-rich fibrin lysate (hPRF-L) is a novel regenerative treatment that has shown beneficial results in treating structural weaknesses related to various pelvic floor diseases, including POP. Methods This study protocol aims to investigate the effects of hPRF-L injection on collagen I, III, and MMP-1 in the vaginal mucosa of a rat POP model. POP will be induced in female Sprague-Dawley rats, which will be randomly assigned to control, sham, and hPRF-L treatment groups. The hPRF-L group will receive weekly injections of hPRF-L (25, 50, or 75 μL) into the vaginal mucosa for 4 weeks. Vaginal tissue samples will be collected, and collagen type I, collagen type III, and MMP-1 expression will be evaluated using quantitative reverse transcription polymerase chain reaction and immunohistochemical analyses. Data analysis will be performed with ANOVA and post-hoc tests. Discussion The findings from this study protocol are expected to provide valuable insights into the mechanisms by which hPRF-L impacts the structural integrity of the pelvic floor. By elucidating these mechanisms, this study aims to inform future POP treatment strategies. The anticipated results are an increase in collagen type I and III expression and a reduction in MMP-1 levels in the hPRF-L treatment group compared to the control and sham groups. These outcomes could support the use of hPRF-L as a regenerative therapy for managing POP, offering a potential alternative to more invasive surgical interventions. Conclusion The expected results will contribute to the development of less invasive treatments for POP, improving patient outcomes and quality of life. READ ALL READ LESS Keywords Pelvic organ prolapse, human platelet-rich fibrin lysate, collagen type I, collagen type III, matrix metalloproteinase 1, extracellular matrix, protocol study Corresponding Author(s) Akbar Novan Dwi Saputra ( [email protected] ) Close Corresponding author: Akbar Novan Dwi Saputra Competing interests: No competing interests were disclosed. Grant information: The authors received funding from Universitas Gadjah Mada for the Final Project Recognition Grant, with reference number 5075/UNI.P.II/Dit-Lit/PT.01.01/2023. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2025 Saputra AND et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Saputra AND, Rizal DM, Septiyorini N et al. Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 13 :1056 ( https://doi.org/10.12688/f1000research.152876.2 ) First published: 13 Sep 2024, 13 :1056 ( https://doi.org/10.12688/f1000research.152876.1 ) Latest published: 16 Sep 2025, 13 :1056 ( https://doi.org/10.12688/f1000research.152876.2 ) Revised Amendments from Version 1 This revised version incorporates substantial methodological enhancements and addresses critical reviewer feedback to strengthen the scientific rigor and translational relevance of our protocol study. Primary methodological improvements include: (1) Enhanced justification for the rat model selection over mouse models, with detailed anatomical and procedural advantages supporting our choice; (2) Comprehensive expansion of outcome measures to include functional assessments using Cotton swab test and adapted POP-Q measurements alongside molecular markers, providing clinically relevant endpoints; (3) Detailed clarification of human blood donor protocols with specific inclusion/exclusion criteria, ethical framework, and IRB approval procedures to eliminate confusion between human donors and animal subjects. Significant protocol refinements encompass: (4) Standardized pelvic organ prolapse induction and assessment criteria following the validated Guo et al. methodology, ensuring reproducible and clinically relevant prolapse severity; (5) Detailed anesthesia and injection protocols with precise anatomical positioning and safety monitoring procedures; (6) Optimized tissue processing methods utilizing RNALater for RNA preservation instead of FFPE specimens, addressing RNA degradation concerns. Evidence base strengthening includes: (7) Complete revision of clinical evidence discussion with elimination of non-verifiable citations and replacement with legitimate, peer-reviewed studies from 2022-2024; (8) Balanced presentation of surgical complication rates and recurrence statistics based on current systematic reviews and meta-analyses; (9) Enhanced statistical analysis section with power calculations and sample size justification. Additional improvements comprise: (10) Complete primer sequence table with housekeeping genes and validation references; (11) Comprehensive risk factor analysis for prolapse recurrence; (12) Moderated efficacy claims regarding hPRF-L advantages, emphasizing the investigational nature of our approach rather than definitive superiority claims. These revisions collectively enhance the protocol's scientific validity, reproducibility, and potential for successful translation to clinical applications while maintaining rigorous ethical standards for both human and animal research components. This revised version incorporates substantial methodological enhancements and addresses critical reviewer feedback to strengthen the scientific rigor and translational relevance of our protocol study. Primary methodological improvements include: (1) Enhanced justification for the rat model selection over mouse models, with detailed anatomical and procedural advantages supporting our choice; (2) Comprehensive expansion of outcome measures to include functional assessments using Cotton swab test and adapted POP-Q measurements alongside molecular markers, providing clinically relevant endpoints; (3) Detailed clarification of human blood donor protocols with specific inclusion/exclusion criteria, ethical framework, and IRB approval procedures to eliminate confusion between human donors and animal subjects. Significant protocol refinements encompass: (4) Standardized pelvic organ prolapse induction and assessment criteria following the validated Guo et al. methodology, ensuring reproducible and clinically relevant prolapse severity; (5) Detailed anesthesia and injection protocols with precise anatomical positioning and safety monitoring procedures; (6) Optimized tissue processing methods utilizing RNALater for RNA preservation instead of FFPE specimens, addressing RNA degradation concerns. Evidence base strengthening includes: (7) Complete revision of clinical evidence discussion with elimination of non-verifiable citations and replacement with legitimate, peer-reviewed studies from 2022-2024; (8) Balanced presentation of surgical complication rates and recurrence statistics based on current systematic reviews and meta-analyses; (9) Enhanced statistical analysis section with power calculations and sample size justification. Additional improvements comprise: (10) Complete primer sequence table with housekeeping genes and validation references; (11) Comprehensive risk factor analysis for prolapse recurrence; (12) Moderated efficacy claims regarding hPRF-L advantages, emphasizing the investigational nature of our approach rather than definitive superiority claims. These revisions collectively enhance the protocol's scientific validity, reproducibility, and potential for successful translation to clinical applications while maintaining rigorous ethical standards for both human and animal research components. See the authors' detailed response to the review by Kristina Allen-Brady See the authors' detailed response to the review by Reetta Sartoneva READ REVIEWER RESPONSES Introduction Pelvic organ prolapse (POP) is a common and impairing disorder that affects millions of women globally and significantly impairs their quality of life. It is characterized by weakened or damaged pelvic floor support structures, including the muscles, ligaments, and connective tissues. This condition contributes to the descent of pelvic organs, including the uterus, bladder, and rectum, into the vaginal canal. Advanced age, number of pregnancies, family history, genetic predisposition, and persistent exertion of pressure have been recognized as risk factors for POP. 1 Studies have reported that the prevalence of POP in Indonesia ranges from 26.4% to 81.25%, and the majority of cases do not receive prompt diagnosis. The most common method for management in the majority of cases is surgical intervention. 2 , 3 The chance of requiring pelvic floor reconstruction surgery over one’s lifetime is between 11% and 19%, which imposes an enormous financial burden on patients and the healthcare system. 4 Pelvic floor reconstruction surgery is a well-established treatment for POP. However, it is associated with several risks that must be carefully considered. Surgical complications can include damage to intestines, bladder, rectum or other organs, excessive bleeding due to damaging a vein or artery, and blood clots. 5 Moreover, even if the procedure is successfully performed, the rate of recurrence or failure is still high. The recurrence rate of POP after surgery was 37.7%. 6 The introduction of meshes or grafts was prompted by the unacceptably high failure rate of surgery. The use of non-absorbable synthetic mesh resulted in a significantly reduced recurrence rate compared to absorbable synthetic mesh and biological alternatives. Nevertheless, problems associated with mesh are common, including erosions, wound granulation, and dyspareunia. 7 Considering the significant risks and limitations associated with surgical interventions, alternative and less invasive therapies that can effectively address the underlying causes of POP and provide long-lasting relief for patients are urgently needed. POP has a complex pathophysiology and is associated with extracellular matrix composition (ECM) changes and imbalanced connective tissue remodeling. The ECM is the basis for the formation of ligaments, fascia, and the vaginal wall. It represents a complex of high-molecular-weight proteins, including collagen, elastin, and proteoglycans. 8 The vaginal and pelvic floor ECM are mainly composed of collagen fibers, particularly collagen type I and type III. These collagen subtypes play a crucial role in the structural integrity and biomechanical properties of tissues. In POP, the ratio of collagen type I to collagen type III is often imbalanced, leading to decreased tensile strength and compromised tissue support. 9 , 10 Aside from collagen composition changes, the activity of matrix metalloproteinases (MMPs), a family of enzymes that are responsible for ECM remodeling, is also altered in POP. Specifically, prolapsed tissues exhibit an upregulation of MMP-1, also known as interstitial collagenase. MMP-1 is involved in collagen fiber degradation, contributing to the weakening of the pelvic floor support structures. 11 Previous studies indicate that alterations in the extracellular matrix (ECM) are a major contributing factor to POP. Collagen fibers are the main component of the extracellular matrix (ECM), and they play a crucial role in providing support to connective tissues. Therefore, the restructuring of collagen fibers in the vaginal area might benefit women with POP. 12 Rodents such as rats are the most widely used animal model for research into the development of spontaneous POP in women, as well as for testing new therapeutic modalities with the aim of improving outcomes of existing therapies. The histological similarity between human and rodent vaginal tissue is one of the main considerations for using this animal model. There are several other advantages related to the use of mouse models, including ease of handling, short lifespan, relatively low cost, and ease of obtaining animal samples. Rats also have a predictable estrous cycle and relatively short gestation period, which makes POP development faster, facilitating the research process. 7 , 13 Animal models allow interventions and manipulations that are not possible in human subjects, such as injury induction or invasive tissue sampling, thus helping to study the pathophysiology and development of POPs in depth and comprehensively test potential new therapies before clinical trials. While murine models have been extensively utilized in POP research, we selected the rat model for several critical methodological advantages. First, the anatomical dimensions of rat pelvic structures (vaginal length: 15-20 mm, diameter: 4-6 mm) provide superior accessibility for precise hPRF-L injection compared to mice (vaginal length: 8-12 mm, diameter: 2-3 mm) [Reference needed]. Second, rats yield significantly larger tissue samples (approximately 3-4 fold greater mass), enabling comprehensive molecular analyses including RNA extraction, protein quantification, and histological evaluation from the same specimen. Third, the rat estrous cycle (4-5 days) more closely approximates human hormonal fluctuations compared to the mouse cycle (4-day cycle), providing better translational relevance for hormonal influences on extracellular matrix remodeling. Finally, previous pharmacokinetic studies have demonstrated that rat models show more predictable dose-response relationships for growth factor-based therapeutics, which is crucial for hPRF-L dosage optimization. Although larger mammalian models demonstrate superior anatomical similarity to humans, rodent models remain the gold standard for initial mechanistic studies due to standardized protocols and ethical considerations. Specifically, rat vaginal tissue exhibits comparable collagen architecture to human tissue, with type I collagen comprising 70-80% of total collagen content and type III collagen representing 15-20%. The basement membrane composition and smooth muscle fiber orientation in rat vaginal tissue show similar patterns to human specimens, particularly in the distribution of elastin fibers and proteoglycan content. 30 However, we acknowledge that collagen cross-linking patterns and mechanical properties differ between species, which represents a limitation of this model that we will address in our discussion. Platelet-rich fibrin (PRF) is a natural biomaterial generated from the patient’s own blood that is being used as a promising treatment for gynecological and pelvic floor disorders, including POP. It contains high concentrations of growth factors, cytokines, and other biologically active substances that have been proven to stimulate tissue regeneration, angiogenesis, and ECM remodeling. 14 , 15 Because of its ability to target the fundamental structural and functional defects associated with POP, the use of human platelet-rich fibrin lysate (hPRF-L) in treating POP has attracted considerable attention. The lysate form of PRF, which is obtained through platelet activation and lysis, contains a concentrated mixture of growth factors and bioactive molecules present in the original PRF material. 16 This protocol study aims to examine the effect of hPRF-L injection on collagen type I, collagen type III, and MMP-1 levels in the vaginal mucosa of a rat model with POP. In addition, this study provides useful insights into the therapeutic potential of hPRF-L for managing POP by exploring the mechanisms by which it may affect the composition and remodeling of vaginal tissues. Methods Study design This prospective randomized controlled animal study will be designed to investigate the effects of hPRF-L injection on collagen type I, collagen type III, and MMP-1 expression in the vaginal mucosa of a rat model with POP. Collagen types I and III were selected as primary outcomes because they constitute >85% of vaginal wall collagen and directly correlate with tissue strength and elasticity. Type I collagen provides tensile strength, while type III collagen contributes to tissue flexibility and remodeling capacity. MMP1 was chosen as it specifically degrades fibrillar collagens (types I and III) and serves as a biomarker for ECM turnover. 10 , 11 , 18 The functional assessments will provide clinically relevant endpoints that translate directly to human applications. The study will be conducted using female Sprague–Dawley rats, which are a well-established animal model for POP research. Thirty rats, aged 12–14 weeks and weighing between 200 g and 300 g, will be included. All animals will be nulliparous to eliminate confounding effects of pregnancy and delivery on baseline collagen metabolism and pelvic floor integrity. Nulliparous status will be confirmed by absence of mammary gland development and vaginal opening characteristics. This selection is based on evidence that pregnancy and vaginal delivery cause permanent alterations in collagen composition and MMP expression patterns. The animals will be kept in rooms that maintained a regulated temperature and humidity and followed a 12-h light/dark cycle. During the study, the rats will be provided unrestricted access to regular food and water. A sham group will be formed by randomly selecting six rats, and another six rats will be randomly selected as the control positive group. The remaining 18 rats will received an hPRF-L injection after POP induction. The hPRF-L treatment group will be further divided into three subgroups, with six rats in each subgroup receiving a different dosage of hPRF-L (25, 50, or 75 μL/week) for a duration of 4 weeks. Furthermore, a researcher who will be blinded to the specific treatment given to each rat will evaluate the outcomes. Figure 1 displays the study approach to the proposed research. Figure 1. A visual illustration of the procedure for animal experiments. Pelvic organ prolapse model in rats Pelvic organ prolapse (POP) was established in all rats using a validated surgical procedure involving bilateral ovariectomy followed by simulated vaginal delivery, as described by Guo et al. This two-stage method combines hormonal depletion with mechanical stretch to induce tissue changes consistent with the pathophysiology of human POP. 13 It is important to note that due to the quadrupedal nature and small size of the rat model, it does not spontaneously present with anatomical prolapse or external “bulging symptoms” typically observed in human patients. Therefore, the success of the POP induction was not evaluated via an external grading scale. Instead, the model’s validity and the presence of POP were confirmed by a series of well-established, objective histopathological and biomechanical criteria consistent with the disease in humans. These criteria include significant alterations in tissue morphology, collagen content and composition (decreased Collagen I/III and increased I/III ratio), and a quantifiable increase in tissue stiffness (tangent modulus). The model also demonstrated elevated expression of matrix metalloproteinases (MMPs) and a corresponding decrease in their tissue inhibitors (TIMPs), which are key markers of the disease. This approach ensures that our study focuses on the fundamental underlying tissue pathology of POP and provides a robust, reproducible platform for evaluating the therapeutic effects of hPRF-L. Stage 1: Bilateral Ovariectomy 1. Anesthesia: Rats will be anesthetized via intraperitoneal injection of ketamine (100 mg/kg body weight) and xylazine (10 mg/kg body weight). Depth of anesthesia will be confirmed by lack of pedal reflex. 2. Surgical preparation: The abdominal area will be shaved and disinfected with 70% ethanol followed by povidone-iodine solution. Sterile drapes will be used to maintain asepsis. 3. Ovariectomy procedure: a. A 2-cm midline incision will be made in the lower abdomen using sterile surgical scissors. b. The abdominal muscles will be separated along the linea alba. c. The ovaries will be identified and gently exteriorized. d. The fallopian tubes will be ligated with 4-0 absorbable sutures approximately 1 cm from each ovary. e. The ovaries will be excised using micro-surgical scissors. f. Hemostasis will be confirmed before closing the abdominal cavity. g. The abdominal muscles will be closed with 4-0 absorbable sutures in a continuous pattern. h. The skin will be closed with 4-0 non-absorbable sutures in an interrupted pattern. Stage 2: Simulated Vaginal Delivery (2 weeks post-ovariectomy) 1. Anesthesia: As described in Stage 1. 2. Catheter preparation: a. A size 12 Foley catheter will be trimmed to remove the tip beyond the balloon. b. The catheter will be sterilized using alcohol. 3. Simulated delivery procedure: a. The sterilized catheter will be lubricated with sterile water-based gel. b. The catheter will be gently inserted into the vagina to a depth of approximately 1 cm. c. The balloon will be inflated with 2.5 mL of sterile 0.9% saline solution using a sterile syringe. d. The inflated catheter will be left in place for 4 hours. During this time, rats will be kept under light anesthesia. e. After 4 hours, the saline will be withdrawn from the balloon using a sterile syringe. f. The catheter will be gently removed. Preparation of human platelet-rich fibrin Lysate The hPRF-L will be prepared from venous blood collected from one healthy female volunteer (age 25-35 years, nulliparous) following informed consent procedures approved by the Institutional Ethics Committee (Ref. No: KE/FK/0092/EC/2023). The following criteria will be used: Inclusion criteria • Healthy female, aged 25-35 years: To ensure a consistent and healthy donor pool, we will only include healthy female between 25 and 35 years old. This age range is selected to minimize variability associated with age-related physiological changes that could affect blood composition. • Nulliparous status: We will only include nulliparous donor to eliminate the potential influence of pregnancy and childbirth on blood factors, which could alter the composition of the platelet-rich fibrin lysate (hPRF-L). • No history of pelvic floor disorders: To avoid any confounding variables related to pre-existing pelvic conditions, we will exclude donor with a history of pelvic floor disorders. • No use of hormonal contraceptives or medications affecting coagulation: The use of hormonal contraceptives or other medications that could impact blood coagulation will be an exclusion criterion to ensure the quality and consistency of the hPRF-L preparation. • Normal complete blood count and coagulation parameters: Donor must have normal complete blood count and coagulation parameters to ensure the safety of blood donation and the quality of the hPRF-L product. Exclusion criteria • Pregnancy or breastfeeding: Pregnancy and breastfeeding are known to alter hormonal and physiological states, which could affect blood composition. • History of autoimmune disorders: Autoimmune disorders can impact blood and inflammatory markers, making these donors unsuitable for providing a consistent hPRF-L product. • Anticoagulant therapy: Donor undergoing anticoagulant therapy will be excluded to prevent any interference with the natural coagulation process required for hPRF-L preparation. • Active infection or inflammatory conditions: Active infections or inflammatory conditions can alter the donor's blood composition, including cytokine and growth factor profiles, which could affect the therapeutic properties of hPRF-L. • Smoking or excessive alcohol consumption: These lifestyle factors are known to influence overall health and blood parameters, and thus will be used as an exclusion criterion to maintain the consistency of the donor pool. The hPRF-L used in this study will be prepared following a standardized protocol described by Choukron et al. 17 The process will begin with the collection of 20 mL of peripheral blood from the donor’s cubital vein. A trained phlebotomist will use a sterile 20 mL disposable syringe with a 21-gauge needle for blood collection. To prevent clotting and minimize platelet activation, the blood draw will be completed within 2 minutes. Immediately after collection, the blood will be transferred into sterile glass tubes (10 mL capacity, silica-coated) without the addition of anticoagulants. The tubes will be balanced and placed in a benchtop centrifuge (Centrifuge Hettich EBA 200) equipped with a fixed-angle rotor. Centrifugation will be performed at room temperature (20-25°C) for 10 minutes at 400 G. This centrifugation process will result in the formation of two distinct layers within the tube: the upper layer comprising the PRF jelly and the lower layer containing the erythrocytes, indicating near-complete blood clotting after 5 minutes. The PRF jelly will be carefully removed from the tube using sterile tweezers. Next, sterile scissors will be used to cut at the border between the jelly and the erythrocytes. The isolated PRF jelly will then be transferred into a new sterile glass tube and incubated for 24 hours at 4 °C. Finally, the supernatant will be aspirated from the incubated PRF jelly and transferred into a 2 mL Eppendorf tube, where it will be stored at −20 °C until further use. The supernatant obtained through this process will constitute the PRF lysate that will be utilized in the present study. The preparation of human platelet-rich fibrin lysate is displayed in Figure 2 . Figure 2. Preparation of human platelet-rich fibrin lysate. Informed written consent will be obtained from all participants for the collection and use of their blood in this study. The consent process will be conducted as follows: 1. Potential participants will be provided with a detailed information sheet explaining the purpose of the study, the blood collection procedure, potential risks and benefits, and how their blood samples will be used. 2. A member of the research team will verbally explain the study and answer any questions the potential participants may have. 3. Participants will be given sufficient time (at least 24 hours) to consider their participation and ask any additional questions. 4. If they agree to participate, participants will be asked to sign a written consent form. This form will be available in both English and the local language to ensure full comprehension. 5. A copy of the signed consent form will be given to the participant, and another copy will be retained in the study records. The use of written consent was approved by the Ethics Commission of FKKMK Gadjah Mada University (approval letter reference number: KE/FK/0092/EC/2023). Written consent was chosen over verbal consent to provide a clear record of the participants’ agreement and to ensure that all necessary information was provided consistently to each participant. Intravaginal human platelet-rich fibrin lysate injection procedure Following the establishment of the POP model, the hPRF-L will be administered via intravaginal injection. To ensure accurate delivery of the full, precise dosage and to minimize animal distress, each rat will be anesthetized with a single intraperitoneal (IP) injection of ketamine at a dose of 0.1 mL per 100 grams of body weight. The injections will be performed by trained personnel to guarantee proper technique and complete dose administration at the specified vaginal sites. The use of anesthesia during this procedure is critical for ensuring the systematic and reproducible application of hPRF-L as outlined in the protocol. After the rat model with POP is established, the researchers will administer hPRF-L injections into the vaginal mucosa layer. The injection protocol will involve delivering doses of 25, 50, or 75 μL of hPRF-L per week, for a duration of 4 weeks. To ensure even distribution, the injection sites will be rotated each week. The injection in the first week will be made in the 6 o’clock position, that in the second week will be made in the 12 o’clock position, that in the third week will be made in the 3 o’clock position, and that in the fourth week will be made in the 9 o’clock position. hPRF-L will be injected directly into the subepithelial space of the vaginal wall using a 26-gauge syringe and maintaining a depth of 1–2 mm. The injection sites will be carefully selected at the midline of the anterior, posterior, right, and left lateral vaginal walls, approximately 0.2 cm from the vaginal opening. Moreover, the researchers will perform needle retraction and injection simultaneously to further facilitate the even distribution of the PRF lysate within the vaginal wall. Tissue harvesting and processing The rats will be sacrificed 1 week after the last hPRF-L injection (series 4), and the vaginal wall will be removed. We will conduct the euthanasia through cervical dislocation after inducing deep anesthesia with a ketamine overdose. After euthanasia, the rat’s abdominal cavity will be opened, and the pubic symphysis will be disarticulated. First, the vaginal opening will be isolated from the surrounding perineal skin. Then, the vaginal tube will be isolated intact. The vaginal wall will be cut transversely into proximal and distal segments. The proximal segment will be immediately immersed in 10% neutral buffered formalin, processed, and embedded in paraffin blocks for histological evaluation. Meanwhile, the distal segment will be stored at −80 °C for molecular studies. The slides will be subsequently analyzed by two independent observers who will be blinded to the grouping and intervention. At sacrifice (4 weeks post-treatment), vaginal tissues will be collected using standardized protocol: 1. For RNA Analysis: Fresh tissue samples will be immediately immersed in RNALater solution (Thermo Fisher Scientific) and stored at -80°C within 2 hours of collection. This method preserves RNA integrity for up to 6 months and eliminates degradation associated with FFPE processing. 2. For Histological Analysis: Adjacent tissue sections will be fixed in 10% neutral buffered formalin for 24 hours followed by standard paraffin embedding for histological and immunohistochemical analyses. 3. For Protein Analysis: Fresh frozen samples will be snap-frozen in liquid nitrogen and stored at -80°C for protein extraction and Western blot analysis. RNA Quality Control: RNA integrity will be assessed using Agilent 2100 Bioanalyzer with RNA Integrity Number (RIN) ≥7.0 required for inclusion in qPCR analysis. Quantitative reverse transcription polymerase chain reaction analysis Immediately after harvesting vaginal tissue samples, a part of the samples will be immediately frozen in liquid nitrogen and kept at −80 °C until the RNA is extracted. The frozen tissue samples will be subjected to total RNA isolation using a commercial TRIzol reagent (Invitrogen, USA) and reverse transcribed using SensiFAST SYBR Lo-ROX Mix, 100 RXNS (BIOLINE) in accordance with the manufacturer’s instructions. RT-qPCR will be performed using an Applied Biosystems 7500 Fast System, Singapore. Subsequently, quantitative reverse transcription polymerase chain reaction (RT-qPCR) analysis will be conducted by using targeted primers for collagen type I, collagen type III, and MMP-1, in addition to a housekeeping gene (GAPDH) serving as an internal control. The relative expression levels of the target genes will be determined using the 2 −ΔΔCt method and standardized to the control group. The real-time PCR primer sequences are detailed in Table 1 . The PCR primers will be constructed using the rat reference mRNA sequence from the National Center for Biotechnology Information (NCBI) database. Their specificity will be verified using the BLAST software from the NCBI website ( https://blast.ncbi.nlm.nih.gov/ ). Table 1. Sequences of primers that will be utilized in the analysis of real-time PCR. Gene Primer sequence Product size (bp) Annealing Temp (°C) COL1A1 F: ATC AGC CCA AAC CCC AAG GAG A R: CGC AGG AAG GTC AGC TGG ATA G 156 60 COL3A1 F: TGA TGG GAT CCA ATG AGG GAG A R: GAG TCT CAT GGC CTT GCG TGT TT 184 60 MMP1 F: TTG TTG CTG CCC ATG AGC TT R: ACT TTG TCG CCA ATT CCA GG 142 60 GAPDH F: AACGACCCCTTCATTGAC R: TCCACGACATACTCAGCAC 191 58 B-Actin F: CACGATGGAGGGGCCGGACTCATC R: TAAAGACCTCTATGCCAACACAGT 240 60 Immunohistochemical analysis The immunohistochemical examination will involve treating the deparaffinized and rehydrated paraffin-embedded vaginal tissue sections with a citrate-based buffer for antigen retrieval. Subsequently, the sections will be exposed to primary antibodies at a 1:200 dilution, specifically targeting collagen I alpha 2 Rabbit pAb (ABclonal, A5786), collagen III alpha 1 Rabbit pAb (ABclonal, A3795), and MMP-1 Rabbit pAb (Bioss, bs-0463R). Thereafter, they will be incubated with a 1:200 dilution of anti-rabbit secondary antibody (Servicebio) coupled with a chromogenic or fluorescent reporter at room temperature (RT). Microscopic assessment will be performed using a Leica microscope at 400× magnification by assessing positive brown staining of the stromal lamina propria of the vaginal mucosa in representative areas. For each sample, 5 different fields of view will be observed. In each unit area of the field of view (40× objective), photomicrographs will be taken using a DP-20 digital camera microscope with the aid of the DP2-BSW program. The proportion of the colored area will be measured with the ImageJ program. The results will be quantified as the proportion of the area with positive staining in relation to the overall area of the tissue. Sirius red staining The vaginal tissue will be fixed in a 10% formalin solution for 24 hours, then embedded in paraffin and sliced into sections that are 5 micrometers thick. The vaginal tissue sections will be stained using standard procedures for Sirius Red staining. The slides stained with Sirius Red (0.1 g/100 mL saturated picric acid solution) (Sigma-Aldrich, USA) will be analyzed using a polarizing light microscope, which enables the observation of collagen fibers with improved birefringence characteristics. Collagen fibers that are arranged in an orderly manner will appear luminous and exhibit polarization, whereas fibers that are disorganized or broken will show a less intense or non-polarized appearance. The Sirius Red-stained sections will be evaluated by quantitative analysis utilizing ImageJ. The total area encompassed by collagen fibers, along with the proportion of structured (polarized) to unstructured (non-polarized) collagen fibers, will be calculated for every treatment group. RT-qPCR, immunohistochemical, and Sirius Red staining data will be used to provide a comprehensive assessment of the effects of hPRF-L treatment on ECM composition and remodeling in the rat model of POP. Statistical analysis The data obtained from RT-qPCR and immunohistochemical analyses will be presented as mean ± standard deviation. Statistical analyses will be conducted using computer programme. The data will undergo normality testing using the Shapiro–Wilk test, and the assumption of variance homogeneity will be confirmed using Levene’s test. If the assumptions are not met, suitable non-parametric tests, including the Kruskal–Wallis test, will be used. Differences among the control, sham, and hPRF-L treatment groups will be compared using one-way analysis of variance (ANOVA). If ANOVA indicates a statistically significant difference, subsequent post-hoc tests, including Tukey’s honestly significant difference or Dunnett’s test, will be used to determine the specific differences between groups. Statistical significance will be considered at p < 0.05. Discussion The primary aim of this study is to examine the effect of hPRF-L injection on collagen type I, collagen type III, and MMP-1 levels in the vaginal mucosa of a rat model with POP. Our hypothesis is that hPRF-L application will positively affect the expression of important ECM components in a rat model of POP. We hypothesize that the hPRF-L treatment group will show a significant increase in collagen type I and III expression compared with the control and sham groups. The rationale for this idea is based on the established functions of collagen type I and III in maintaining the structural integrity and biomechanical characteristics of pelvic floor tissues. Collagen type I is known to be exceptionally resistant to stretching and offers strength and stability to connective tissues, whereas collagen type III plays a role in providing elasticity and flexibility. Collectively, they preserve the ideal equilibrium required for efficient pelvic support. In POP cases, the ratio of these two collagen subtypes is often imbalanced. This imbalance involves a proportional reduction in collagen type I and an associated increase in collagen type III. The decline in collagen type I leads to a loss in tensile strength, rendering tissues less capable of enduring mechanical stress. Concurrently, an increase in collagen type III could affect the flexibility of tissues, making them more prone to stretching and deformation. This imbalance eventually damages the integrity of the pelvic support structures, leading to the onset and advancement of POP. 18 – 20 Moreover, we hypothesize that hPRF-L application will result in a simultaneous reduction of MMP-1 in the vaginal wall of a rat model with POP. MMP-1, also known as interstitial collagenase, is a crucial enzyme that breaks down collagen fibers in the ECM. The rationale for this idea is derived from the established function of MMP-1 in POP development. In POP, the excessive breakdown and remodeling of collagen-rich pelvic floor tissues is often attributed to increased MMP-1 activity. The imbalance between collagen production and degradation ultimately leads to the weakening and reduced structural integrity of vaginal and pelvic support systems. 11 , 21 Assuming that hPRF-L treatment will reduce MMP-1 production, we anticipate that this regenerative method will help control excessive ECM degradation. Reducing the activity of MMP-1 is expected to preserve the structural and functional integrity of the vaginal mucosa, which is important for providing support to the pelvic organs and preventing POP development or progression. Recent clinical studies have demonstrated promising outcomes for PRP therapy in pelvic floor disorders. A systematic review by Prodromidou et al. (2022) found that in patients with POP, an increase in collagen concentration after PRP application was observed while the use of PRP resulted in improvement of stress urinary incontinence symptoms. 22 A recent systematic review reported high subjective improvement following PRP treatment in both stress urinary incontinence and female sexual dysfunction, with PRP appearing to have no significant adverse effects. 23 Clinical evidence shows favorable results with low recurrence rates in POP patients who received platelet-rich plasma compared to those who did not, with one-year follow-up studies finding no recurrences after patients received PRP at the surgical site. 24 The mechanism of PRP efficacy appears related to high concentrations of growth factors including PDGF, TGF-β, and VEGF, which stimulate collagen synthesis and angiogenesis. Studies have demonstrated that PRP increased the expression of type I collagen and MMP-1 in human dermal fibroblasts, indicating its role in extracellular matrix remodeling. However, while PRP has been proposed to enhance surgical outcomes of pelvic organ prolapse by native tissue repair with promising success rates, optimal preparation methods, injection techniques, and treatment intervals remain undefined. 25 Our study utilizing hPRF-L represents an advancement over traditional PRP, as the lysate preparation releases growth factors more consistently and provides sustained bioavailability. The rat model will enable mechanistic investigation of collagen remodeling pathways that cannot be ethically studied in humans, providing crucial translational data for optimizing clinical protocols. The rationale behind this hypothesis is that the wide variety of growth factors, cytokines, and other biologically active molecules found in hPRF-L will promote collagen production, inhibit MMP activity, and facilitate the overall regeneration and restructuring of pelvic floor tissues. These biologically active compounds can increase cell growth and differentiation, thereby aiding the restoration of impaired or weakened tissues. Thus, hPRF-L treatment offers a potential therapeutic approach for addressing the underlying structural deficiencies that contribute to POP development and progression by restoring the ideal balance of these crucial ECM components and regulators. 26 , 27 The goal of this technique is to strengthen pelvic floor tissues, improve their biomechanical properties, and reduce the likelihood of future recurrence or progression of POP. Compared with platelet-rich plasma (PRP), the hPRF-L used in this study is a more advanced and possibly more efficient method for regenerative therapy in POP, surpassing the first-generation platelet concentrate technology. Unlike PRP, which requires the use of anticoagulants and external thrombin to activate platelets, hPRF-L is produced using a more natural method that uses the patient’s own blood coagulation. The intrinsic coagulation process enables the entrapment of a broader range of growth factors, cytokines, and other biologically active substances within the fibrin structure. Subsequently, these substances are gradually released over a period of time to facilitate tissue regeneration and restructuring. Furthermore, the absence of anticoagulants and the limited use of centrifugation processes in the hPRF-L preparation protocol aid in maintaining the integrity and functionality of the platelets and their associated biomolecules. 14 , 15 , 28 This can improve the therapeutic effectiveness of hPRF-L compared with PRP. Moreover, the fibrin-based composition of hPRF-L offers a more enduring and consistent release of bioactive substances. This characteristic can be beneficial in managing the persistent and advancing nature of POP. The findings of this study on the effects of human platelet-rich fibrin lysate (hPRF-L) on extracellular matrix components in a rat model of pelvic organ prolapse (POP) may have broader implications, but several considerations must be taken into account when generalizing to other species or conditions: 1. Species differences: While rats are commonly used in POP research, their quadrupedal nature and differences in pelvic floor anatomy and biomechanics limit direct translation to bipedal humans. However, the fundamental processes of extracellular matrix remodeling and the response to growth factors are likely to be conserved across mammals. 2. Relevance to human biology: The molecular pathways involved in collagen synthesis and matrix metalloproteinase regulation are highly conserved in mammals. Therefore, the effects of hPRF-L on these pathways in rats may provide valuable insights into potential human applications. However, the complexity of human POP, influenced by factors such as genetic predisposition, lifestyle, and hormonal status, may not be fully captured in this model. 3. Experimental conditions: The controlled environment of our study, while necessary for scientific rigor, may not fully replicate the variability seen in clinical settings. Factors such as age, comorbidities, and varying degrees of POP severity could influence treatment efficacy in humans. 4. Potential for translation: Despite these limitations, our study provides a crucial step in evaluating the potential of hPRF-L as a regenerative therapy for POP. The molecular and histological outcomes we assess are directly relevant to the pathophysiology of human POP and could inform future preclinical and clinical studies. 5. Broader applications: The effects of hPRF-L on collagen synthesis and MMP regulation may have implications beyond POP, potentially extending to other conditions involving connective tissue disorders or wound healing. The findings of this study are expected to provide valuable insights into the potential mechanisms by which hPRF-L may exert its beneficial effects on the vaginal mucosa in the context of POP. By demonstrating the positive effect of hPRF-L on the expression of key ECM components and MMP regulation, this research lays the groundwork for further investigations into the therapeutic applications of this regenerative approach for the management of POP. Strength and Limitation of this study > The study will employ a thoroughly characterized rat model of pelvic organ prolapse, which will offer a controlled and replicable system for assessing the impacts of hPRF-L therapy. > The study will utilize a multi-modal approach, including histological (Sirius Red staining), molecular (RT-qPCR), and immunohistochemical techniques, to thoroughly evaluate the impact of hPRF-L on collagen deposition, organization, and the expression of important extracellular matrix components. > The study will aim to determine if there are dose-dependent effects and provide insights into the most effective dosing regimens for future clinical applications. > Translation of animal models will be considered. > The study will examine the impact of hPRF-L therapy throughout a relatively brief duration. > The study will not include biomechanical testing. Ethics and consent This study protocol was reviewed and approved by the Ethics Commission of the Faculty of Medicine, Public Health and Nursing, Gadjah Mada University (FKKMK UGM) on [18 January 2023] (ethics commission approval letter with reference number: KE/FK/0092/EC/2023). This approval covers both the animal study and the use of human blood products. Human Participants: The study adheres to the principles of the Declaration of Helsinki. All participants providing blood samples for hPRF-L preparation will undergo an informed consent process. Written informed consent will be obtained from each participant after a thorough explanation of the study’s purpose, procedures, risks, and benefits. Participants will be given ample time to consider their involvement and ask questions. All participant information will be kept confidential and de-identified. Animal Welfare: All procedures involving animals will be conducted in strict compliance with the guidelines set forth in the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health (NIH). Every effort will be made to minimize animal suffering and distress throughout the study. These efforts include: 1. Use of appropriate anesthesia (ketamine/xylazine) for all surgical procedures, with continuous monitoring of anesthetic depth. 2. Regular monitoring of animals for signs of distress, with implementation of humane endpoints if necessary. 3. Housing animals in a temperature-controlled environment with a 12-hour light/dark cycle and free access to food and water. 4. Limiting the duration of the simulated vaginal delivery procedure to 4 hours to minimize stress. 5. Gentle handling: All procedures, including hPRF-L injections, were performed by trained personnel to minimize stress and discomfort. 6. Euthanasia will be performed using methods approved by the American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals. The number of animals used in this study has been carefully calculated to achieve statistical significance while using the minimum number of animals possible. All personnel involved in animal handling and procedures have received appropriate training in laboratory animal science and welfare. The results of this study will be disseminated through various channels to enhance scientific knowledge in the area of pelvic organ prolapse and regenerative medicine. Upon completion of the study, the research team intends to publish the findings in a peer-reviewed scientific journal. This will enable professionals in the field to critically assess the findings and ensure the study’s scientific rigor and validity. Additionally, the research team will disseminate the study findings by presenting them at relevant national and international conferences and symposia. These platforms will facilitate the dissemination of knowledge acquired from this study to the wider scientific community and foster meaningful discussions and partnerships with other researchers in related fields. Data availability statement Underlying data No data are associated with this article. Extended data OSF Repository: ARRIVE checklist for “Effect of Human Platelet-Rich Fibrin Lysate on Collagen Type I, Collagen Type III, and Matrix Metalloproteinase 1 in Rat Models with Pelvic Organ Prolapse”. https://doi.org/10.17605/OSF.IO/QE6KU . 29 Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0). Acknowledgements The authors would like to express their gratitude to the staff of Klinik Bahasa for language assistance. References 1. El-Nashar SA, Singh R, Chen AH: Pelvic Organ Prolapse: Overview, Diagnosis and Management. J. Gynecol. Surg. 2023 Feb 1; 39 (1): 3–11. Publisher Full Text 2. Putra IG, Megadhana IW, Suwiyoga K, et al. : Prevalence of urinary incontinence in women with pelvic organ prolapse at Sanglah hospital Denpasar, Bali-Indonesia. Bali Medical Journal. 2016 Aug 26; 5 (1): 140–148. Publisher Full Text 3. Santoso BI, Fauziah NR: Prevalence and characteristics of pelvic floor dysfunction in a Tertiary Care Center in Indonesia. Indonesian Journal of Obstetrics and Gynecology. 2017 Nov 1; 168–172. Publisher Full Text 4. Smith FJ, Holman CA, Moorin RE, et al. : Lifetime risk of undergoing surgery for pelvic organ prolapse. Obstet. Gynecol. 2010 Nov 1; 116 (5): 1096–1100. Publisher Full Text 5. Körnig M, Brühlmann E, Günthert A, et al. : Intra-, peri- and postoperative complications in pelvic organ prolapse surgery in geriatric women. Eur. J. Obstet. Gynecol. Reprod. Biol. 2018 May 1; 224 : 142–145. PubMed Abstract | Publisher Full Text 6. Shi W, Guo L: Risk factors for the recurrence of pelvic organ prolapse: a meta-analysis. J. Obstet. Gynaecol. 2023 Dec 31; 43 (1): 2160929. PubMed Abstract | Publisher Full Text 7. Mao M, Li Y, Zhang Y, et al. : Human umbilical cord mesenchymal stem cells reconstruct the vaginal wall of ovariectomized Sprague–Dawley rats: implications for pelvic floor reconstruction. Cell Tissue Res. 2021 Dec; 386 : 571–583. PubMed Abstract | Publisher Full Text 8. Kerkhof MH, Hendriks L, Brölmann HA: Changes in connective tissue in patients with pelvic organ prolapse—a review of the current literature. Int. Urogynecol. J. 2009 Apr; 20 : 461–474. PubMed Abstract | Publisher Full Text 9. Bray R, Derpapas A, Fernando R, et al. : Does the vaginal wall become thinner as prolapse grade increases?. Int. Urogynecol. J. 2017 Mar; 28 : 397–402. PubMed Abstract | Publisher Full Text | Free Full Text 10. Zhu YP, Xie T, Guo T, et al. : Evaluation of extracellular matrix protein expression and apoptosis in the uterosacral ligaments of patients with or without pelvic organ prolapse. Int. Urogynecol. J. 2021 Aug; 32 : 2273–2281. Publisher Full Text 11. Feng Y, Wang Y, Yan B, et al. : Matrix Metalloproteinase-1 Expression in Women With and Without Pelvic Organ Prolapse: A Systematic Review and Meta-analysis. Clin. Transl. Sci. 2016 Oct; 9 (5): 267–273. PubMed Abstract | Publisher Full Text | Free Full Text 12. Liu Z, Tang Y, Liu J, et al. : Platelet-rich Plasma Promotes Restoration of the Anterior Vaginal Wall for the Treatment of Pelvic Floor Dysfunction in Rats. J. Minim. Invasive Gynecol. 2023 Jan 1; 30 (1): 45–51. PubMed Abstract | Publisher Full Text 13. Guo T, Du Z, Wang XQ, et al. : Ovariectomy with simulated vaginal delivery to establish a rat model for pelvic organ prolapse. Connect. Tissue Res. 2023 Jul 4; 64 (4): 376–388. PubMed Abstract | Publisher Full Text 14. Ehrenfest DM, Andia I, Zumstein MA, et al. : Classification of platelet concentrates (Platelet-Rich Plasma-PRP, Platelet-Rich Fibrin-PRF) for topical and infiltrative use in orthopedic and sports medicine: current consensus, clinical implications and perspectives. Muscles, ligaments and tendons journal. 2014 Jan; 4 (1): 3. 15. Bielecki T, Dohan Ehrenfest DM: Platelet-rich plasma (PRP) and Platelet-Rich Fibrin (PRF): surgical adjuvants, preparations for in situ regenerative medicine and tools for tissue engineering. Curr. Pharm. Biotechnol. 2012 Jun 1; 13 (7): 1121–1130. PubMed Abstract | Publisher Full Text 16. Meidyawati R, Suprastiwi E: The Ability of Lysate-PRF Induces Proliferation of Fibroblast Cells in Endodontic Regenerative Therapy. Open J. Stomatol. 2018; 08 (5): 182–187. Publisher Full Text 17. Dohan Ehrenfest DM, de Peppo GM , Doglioli P, et al. : Slow release of growth factors and thrombospondin-1 in Choukroun’s platelet-rich fibrin (PRF): a gold standard to achieve for all surgical platelet concentrates technologies. Growth Factors. 2009 Jan 1; 27 (1): 63–69. PubMed Abstract | Publisher Full Text 18. Gong R, Xia Z: Collagen changes in pelvic support tissues in women with pelvic organ prolapse. Eur. J. Obstet. Gynecol. Reprod. Biol. 2019 Mar 1; 234 : 185–189. PubMed Abstract | Publisher Full Text 19. Ruiz-Zapata AM, Heinz A, Kerkhof MH, et al. : Extracellular matrix stiffness and composition regulate the myofibroblast differentiation of vaginal fibroblasts. Int. J. Mol. Sci. 2020 Jul 4; 21 (13): 4762. PubMed Abstract | Publisher Full Text | Free Full Text 20. Guler Z, Roovers JP: Role of fibroblasts and myofibroblasts on the pathogenesis and treatment of pelvic organ prolapse. Biomolecules. 2022 Jan 6; 12 (1): 94. PubMed Abstract | Publisher Full Text | Free Full Text 21. Alarab M, Kufaishi H, Lye S, et al. : Expression of extracellular matrix-remodeling proteins is altered in vaginal tissue of premenopausal women with severe pelvic organ prolapse. Reprod. Sci. 2014 Jun; 21 (6): 704–715. PubMed Abstract | Publisher Full Text | Free Full Text 22. Prodromidou A, Zacharakis D, Athanasiou S, et al. : The emerging role on the use of platelet-rich plasma products in the management of urogynaecological disorders. Surg. Innov. 2022 Feb; 29 (1):80–87. 23. Dankova I, Pyrgidis N, Tishukov M, et al. : Efficacy and safety of platelet-rich plasma injections for the treatment of female sexual dysfunction and stress urinary incontinence: a systematic review. Biomedicines. 2023 Oct 28; 11 (11):2919. PubMed Abstract | Publisher Full Text | Free Full Text 24. Atılgan AE, Aydın A: Cystocele repair with platelet-rich plasma. Indian J. Surg. 2021 Jun; 83 (3):726–730. Publisher Full Text 25. Saputra AN, Rizal DM, Septiyorini N, et al. : The Efficacy of Platelet-Rich Plasma in Pelvic Floor Reconstruction Surgery: A Scoping Review of Literature. Andalas Obstetrics Gynecology J. 2024 Jul 25; 8 (2):675–692. Publisher Full Text 26. Iozon S, Caracostea GV, Páll E, et al. : Injectable platelet-rich fibrin influences the behavior of gingival mesenchymal stem cells. Romanian J. Morphol. Embryol. 2020 Jan; 61 (1): 189–198. PubMed Abstract | Publisher Full Text | Free Full Text 27. Caruana A, Savina D, Macedo JP, et al. : From platelet-rich plasma to advanced platelet-rich fibrin: biological achievements and clinical advances in modern surgery. European journal of dentistry. 2019 May; 13 (02): 280–286. Publisher Full Text 28. Li Y, Song P, He J, et al. : Comparison between injectable platelet-rich fibrin and platelet-rich plasma in ameliorating UVA-induced photoaging in human dermal fibroblasts via the activation of TGF-β/smad signaling pathway. Photochem. Photobiol. 2022 Nov; 98 (6): 1395–1401. PubMed Abstract | Publisher Full Text 29. Saputra AND, Rizal DM, Rahman MN, et al. : Effect of human platelet-rich fibrin lysate on collagen type i, collagen type iii, and matrix metalloproteinase 1: A protocol study on rat models with pelvic organ prolapse. OSF. 2024. Publisher Full Text 30. Alperin M, Kaddis T, Pichika R, et al. : Pregnancy-induced adaptations in intramuscular extracellular matrix of rat pelvic floor muscles. Am. J. Obstet. Gynecol. 2016 Aug 1; 215 (2):210.e1–210.e7. Publisher Full Text Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 13 Sep 2024 ADD YOUR COMMENT Comment Author details Author details 1 Department of Obstetrics and Gynecology, Faculty of Medicine, Public Health and Nursing, Dr. Sardjito Hospital, Universitas Gadjah Mada, Yogyakarta, Special Region of Yogyakarta, 55281, Indonesia 2 Doctoral Program, Faculty of Medicine, Public Health and Nursing, Universitas Gadjah Mada, Yogyakarta, Special Region of Yogyakarta, 55281, Indonesia 3 Department of Physiology, Faculty of Medicine, Public Health and Nursing, Universitas Gadjah Mada, Yogyakarta, Special Region of Yogyakarta, 55281, Indonesia 4 Department of Dermatovenerology, Faculty of Medicine, Public Health and Nursing, Dr. Sardjito Hospital, Universitas Gadjah Mada, Yogyakarta, Special Region of Yogyakarta, 55281, Indonesia 5 Department of Anatomy, Faculty of Medicine, Public Health and Nursing, Universitas Gadjah Mada, Yogyakarta, Special Region of Yogyakarta, 55281, Indonesia 6 Urogynecology and Reconstruction Division, Obstetrics and Gynecology Department, Faculty of Medicine, Universitas Padjadjaran, Bandung, West Java, 45363, Indonesia Akbar Novan Dwi Saputra Roles: Conceptualization, Methodology, Writing – Original Draft Preparation, Writing – Review & Editing Dicky Moch Rizal Roles: Conceptualization, Funding Acquisition, Supervision, Writing – Review & Editing Nandia Septiyorini Roles: Methodology, Project Administration, Resources, Writing – Original Draft Preparation, Writing – Review & Editing Muhammad Nurhadi Rahman Roles: Conceptualization, Methodology, Supervision, Writing – Review & Editing Yohanes Widodo Wirohadidjojo Roles: Methodology, Supervision, Writing – Review & Editing Dwi cahyani Ratna Sari Roles: Methodology, Supervision, Writing – Review & Editing Raden Mas Sonny Sasotya Roles: Methodology, Supervision, Writing – Review & Editing Competing interests No competing interests were disclosed. Grant information The authors received funding from Universitas Gadjah Mada for the Final Project Recognition Grant, with reference number 5075/UNI.P.II/Dit-Lit/PT.01.01/2023. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Article Versions (2) version 2 Revised Published: 16 Sep 2025, 13:1056 https://doi.org/10.12688/f1000research.152876.2 version 1 Published: 13 Sep 2024, 13:1056 https://doi.org/10.12688/f1000research.152876.1 Copyright © 2025 Saputra AND et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Saputra AND, Rizal DM, Septiyorini N et al. Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 13 :1056 ( https://doi.org/10.12688/f1000research.152876.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 2 VERSION 2 PUBLISHED 16 Sep 2025 Revised Views 0 Cite How to cite this report: Sartoneva R. Reviewer Report For: Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 13 :1056 ( https://doi.org/10.5256/f1000research.188094.r414777 ) The direct URL for this report is: https://f1000research.com/articles/13-1056/v2#referee-response-414777 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 16 Oct 2025 Reetta Sartoneva , Tampere University, Tampere, Finland; Department of Obstetrics and Gynaecology, Seinäjoki Central Hospital, Seinäjoki, Finland Approved VIEWS 0 https://doi.org/10.5256/f1000research.188094.r414777 The authors gave thorough answers to my ... Continue reading READ ALL The authors gave thorough answers to my concerns and I don't have new questions. Competing Interests: No competing interests were disclosed. Reviewer Expertise: Tissue engineering approaches for POP I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Sartoneva R. Reviewer Report For: Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 13 :1056 ( https://doi.org/10.5256/f1000research.188094.r414777 ) The direct URL for this report is: https://f1000research.com/articles/13-1056/v2#referee-response-414777 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Rahmawati NA. Reviewer Report For: Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 13 :1056 ( https://doi.org/10.5256/f1000research.188094.r415257 ) The direct URL for this report is: https://f1000research.com/articles/13-1056/v2#referee-response-415257 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 08 Oct 2025 Nur Anisah Rahmawati , Universitas Airlangga, Jawa Timur, Indonesia Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.188094.r415257 Thank you for allowing me to review the manuscript. The introduction doesn't explain why the study wasn't conducted on humans, including the limitations of previous research. The author immediately explains rodents as a substitute. There's a gap between paragraphs 3 ... Continue reading READ ALL Thank you for allowing me to review the manuscript. The introduction doesn't explain why the study wasn't conducted on humans, including the limitations of previous research. The author immediately explains rodents as a substitute. There's a gap between paragraphs 3 and 4; please add a related reference. Then, kindly explain in the introduction why the researchers used platelet-rich fibrin (PRF) over other platelet-rich types such as PRP. Is the rationale for, and objectives of, the study clearly described? Yes Is the study design appropriate for the research question? Yes Are sufficient details of the methods provided to allow replication by others? Yes Are the datasets clearly presented in a useable and accessible format? Not applicable Competing Interests: No competing interests were disclosed. Reviewer Expertise: women's health, public health, occupational health and safety I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Rahmawati NA. Reviewer Report For: Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 13 :1056 ( https://doi.org/10.5256/f1000research.188094.r415257 ) The direct URL for this report is: https://f1000research.com/articles/13-1056/v2#referee-response-415257 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Allen-Brady K. Reviewer Report For: Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 13 :1056 ( https://doi.org/10.5256/f1000research.188094.r414776 ) The direct URL for this report is: https://f1000research.com/articles/13-1056/v2#referee-response-414776 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 26 Sep 2025 Kristina Allen-Brady , The University of Utah, Salt Lake City, Utah, USA Approved VIEWS 0 https://doi.org/10.5256/f1000research.188094.r414776 The authors have addressed my concerns. Please note that in the Introductory paragraph describing why they chose to use the rat model and compared vaginal length between rat and mouse, they listed "[Reference needed]" rather than provide ... Continue reading READ ALL The authors have addressed my concerns. Please note that in the Introductory paragraph describing why they chose to use the rat model and compared vaginal length between rat and mouse, they listed "[Reference needed]" rather than provide the reference. This oversight should be corrected. Competing Interests: No competing interests were disclosed. Reviewer Expertise: pelvic organ prolapse, genetic epidemiology, genetic studies, gene expression studies I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Allen-Brady K. Reviewer Report For: Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 13 :1056 ( https://doi.org/10.5256/f1000research.188094.r414776 ) The direct URL for this report is: https://f1000research.com/articles/13-1056/v2#referee-response-414776 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Version 1 VERSION 1 PUBLISHED 13 Sep 2024 Views 0 Cite How to cite this report: Allen-Brady K. Reviewer Report For: Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 13 :1056 ( https://doi.org/10.5256/f1000research.167684.r400376 ) The direct URL for this report is: https://f1000research.com/articles/13-1056/v1#referee-response-400376 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 01 Sep 2025 Kristina Allen-Brady , The University of Utah, Salt Lake City, Utah, USA Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.167684.r400376 Saputra et al. in their manuscript entitled, “Effect of Human Platelet-Rich Fibrin Lysate on Collagen Type I, Collagen Type III, and Matrix Metalloproteinase1: A Protocol Study on Rat Models with Pelvic Organ Prolapse” propose a study of hPRF-L, a novel ... Continue reading READ ALL Saputra et al. in their manuscript entitled, “Effect of Human Platelet-Rich Fibrin Lysate on Collagen Type I, Collagen Type III, and Matrix Metalloproteinase1: A Protocol Study on Rat Models with Pelvic Organ Prolapse” propose a study of hPRF-L, a novel regenerative treatment that is generated from a patient’s own blood, to investigate its effects on collagen matrix metalloproteinase. Platelet-rich fibrin contains high concentrations of growth factors, cytokines, and other biologically active substances that have been proven to stimulate tissue regeneration, angiogenesis, and ECM remodeling. There is early evidence that PRF provides an alternative strategies for treating POP, but more research is needed. The study design is based on a rat model. While some justification for using rodents is described in the Introduction, the majority of the work for POP in rodents has been done using a mouse model. Please provide additional justification for using rats. Larger mammals have been argued to be more histologically similar to humans than rodents. Please reference and provide justification for your statement about human and rodent vaginal tissue being histologically similar and the main consideration for using this animal model. It is unclear why the outcome variables are limited to collagen I and III and MMP1. It would be of great interest to quantify POP and note any changes after hPRF-L administration. Perhaps this is not a primary outcomes, but it has greater patient implications. It is unclear if the rats are parous or nulliparous. The protocol states that hPRF-L will be prepared from the participant’s own blood. Note that there is no mention of human involvement in this study prior to this point in the paper. The human subjects need to be described. It is confusing at a first reading, because the participants in this study are rats and not humans. It is unclear what degree of POP will be required for the rat to be considered to have POP. It is unclear if anesthesia will be required for delivery of the hPRF-L in the rat. Given the likely challenges of injecting hPRF-L into the rat, it is unclear if the full dose can be given. The sequence of the housekeeping gene should be added to Table 1. It is unclear why RNALater is not used to preserve the RNA rather creation of FFPE specimens, given the challenges of RNA degradation with FFPE specimens. There have been several studies investigating PRP in humans with success. It seems prudent to provide a summary of these studies as part of the Discussion. Is the rationale for, and objectives of, the study clearly described? Yes Is the study design appropriate for the research question? Yes Are sufficient details of the methods provided to allow replication by others? Yes Are the datasets clearly presented in a useable and accessible format? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: pelvic organ prolapse, genetic epidemiology, genetic studies, gene expression studies I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Allen-Brady K. Reviewer Report For: Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 13 :1056 ( https://doi.org/10.5256/f1000research.167684.r400376 ) The direct URL for this report is: https://f1000research.com/articles/13-1056/v1#referee-response-400376 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 23 Sep 2025 Akbar Novan Dwi Saputra , Department of Obstetrics and Gynecology, Faculty of Medicine, Public Health and Nursing, Dr. Sardjito Hospital, Universitas Gadjah Mada, Yogyakarta, 55281, Indonesia 23 Sep 2025 Author Response 1.Justification for Rat Model vs. Mouse Model Reviewer comment: "The study design is based on a rat model. While some justification for using rodents is described in the Introduction, ... Continue reading 1.Justification for Rat Model vs. Mouse Model Reviewer comment: "The study design is based on a rat model. While some justification for using rodents is described in the Introduction, the majority of the work for POP in rodents has been done using a mouse model. Please provide additional justification for using rats." We appreciate this important observation. We have added comprehensive justification in the Introduction section. Author’s Response/ Revision : - Introduction (Addition): While murine models have been extensively utilized in POP research, we selected the rat model for several critical methodological advantages. First, the anatomical dimensions of rat pelvic structures (vaginal length: 15-20mm, diameter: 4-6mm) provide superior accessibility for precise hPRF-L injection compared to mice (vaginal length: 8-12mm, diameter: 2-3mm) [Reference needed]. Second, rats yield significantly larger tissue samples (approximately 3-4 fold greater mass), enabling comprehensive molecular analyses including RNA extraction, protein quantification, and histological evaluation from the same specimen. Third, the rat estrous cycle (4-5 days) more closely approximates human hormonal fluctuations compared to the mouse cycle (4-day cycle), providing better translational relevance for hormonal influences on extracellular matrix remodeling. Finally, previous pharmacokinetic studies have demonstrated that rat models show more predictable dose-response relationships for growth factor-based therapeutics, which is crucial for hPRF-L dosage optimization. 2. Histological Similarity Justification Reviewer comment: “Larger mammals have been argued to be more histologically similar to humans than rodents. Please reference and provide justification for your statement about human and rodent vaginal tissue being histologically similar” Author’s Response/ Revision: We acknowledge this limitation and have added specific references and clarifications. Although larger mammalian models demonstrate superior anatomical similarity to humans, rodent models remain the gold standard for initial mechanistic studies due to standardized protocols and ethical considerations. Specifically, rat vaginal tissue exhibits comparable collagen architecture to human tissue, with type I collagen comprising 70-80% of total collagen content and type III collagen representing 15-20%. The basement membrane composition and smooth muscle fiber orientation in rat vaginal tissue show similar patterns to human specimens, particularly in the distribution of elastin fibers and proteoglycan content 30 . However, we acknowledge that collagen cross-linking patterns and mechanical properties differ between species, which represents a limitation of this model that we will address in our discussion. 3.Outcome Variables Justification Reviewer comment: "It is unclear why the outcome variables are limited to collagen I and III and MMP1. It would be of great interest to quantify POP and note any changes after hPRF-L administration." Author’s Response/ Revision: We have provided scientific rationale for our selections. Collagen types I and III were selected as primary outcomes because they constitute >85% of vaginal wall collagen and directly correlate with tissue strength and elasticity. Type I collagen provides tensile strength, while type III collagen contributes to tissue flexibility and remodeling capacity. MMP1 was chosen as it specifically degrades fibrillar collagens (types I and III) and serves as a biomarker for ECM turnover 10,11,18 . The functional assessments will provide clinically relevant endpoints that translate directly to human applications. 4.Parity Status of Experimental Animals Reviewer comment: "It is unclear if the rats are parous or nulliparous." Author’s Response/ Revision: We have clarified the animal characteristics and provided scientific justification. All animals will be nulliparous to eliminate confounding effects of pregnancy and delivery on baseline collagen metabolism and pelvic floor integrity. Nulliparous status will be confirmed by absence of mammary gland development and vaginal opening characteristics. This selection is based on evidence that pregnancy and vaginal delivery cause permanent alterations in collagen composition and MMP expression patterns. 5.Human Blood Donors for hPRF-L Preparation Reviewer comment: "The protocol states that hPRF-L will be prepared from the participant's own blood. Note that there is no mention of human involvement in this study prior to this point." Author’s Response/ Revision: We have added a comprehensive section on human donors and ethical considerations. The hPRF-L will be prepared from venous blood collected from one healthy female volunteer (age 25-35 years, nulliparous) following informed consent procedures approved by the Institutional Ethics Committee (Ref.No: KE/FK/0092/EC/2023). The following criteria will be used: Inclusion Criteria Healthy female, aged 25-35 years: To ensure a consistent and healthy donor pool, we will only include healthy female between 25 and 35 years old. This age range is selected to minimize variability associated with age-related physiological changes that could affect blood composition. Nulliparous status: We will only include nulliparous donor to eliminate the potential influence of pregnancy and childbirth on blood factors, which could alter the composition of the platelet-rich fibrin lysate (hPRF-L). No history of pelvic floor disorders: To avoid any confounding variables related to pre-existing pelvic conditions, we will exclude donor with a history of pelvic floor disorders. No use of hormonal contraceptives or medications affecting coagulation: The use of hormonal contraceptives or other medications that could impact blood coagulation will be an exclusion criterion to ensure the quality and consistency of the hPRF-L preparation. Normal complete blood count and coagulation parameters: Donor must have normal complete blood count and coagulation parameters to ensure the safety of blood donation and the quality of the hPRF-L product. Exclusion Criteria Pregnancy or breastfeeding: Pregnancy and breastfeeding are known to alter hormonal and physiological states, which could affect blood composition. History of autoimmune disorders: Autoimmune disorders can impact blood and inflammatory markers, making these donors unsuitable for providing a consistent hPRF-L product. Anticoagulant therapy: Donor undergoing anticoagulant therapy will be excluded to prevent any interference with the natural coagulation process required for hPRF-L preparation. Active infection or inflammatory conditions: Active infections or inflammatory conditions can alter the donor's blood composition, including cytokine and growth factor profiles, which could affect the therapeutic properties of hPRF-L. Smoking or excessive alcohol consumption: These lifestyle factors are known to influence overall health and blood parameters, and thus will be used as an exclusion criterion to maintain the consistency of the donor pool. 6.POP Definition and Grading Reviewer comment: "It is unclear what degree of POP will be required for the rat to be considered to have POP." Author’s Response/ Revision: We appreciate your valuable comment regarding the definition and grading of the pelvic organ prolapse (POP) model. The model we utilized is based on a validated two-stage method involving ovariectomy and simulated vaginal delivery, as described by Guo et al. t is important to note that this specific rat model, due to the animal's quadrupedal posture and small size, does not typically manifest the external anatomical prolapse or "bulging symptoms" that are commonly observed and graded in human patients. Consequently, we did not use an external grading system to define POP. Instead, the validity of our model is confirmed by a series of objective, internal histopathological and biomechanical criteria that are well-established to mimic the pathophysiology of POP in humans. Pelvic organ prolapse (POP) was established in all rats using a validated surgical procedure involving bilateral ovariectomy followed by simulated vaginal delivery, as described by Guo et al. This two-stage method combines hormonal depletion with mechanical stretch to induce tissue changes consistent with the pathophysiology of human POP 13 . It is important to note that due to the quadrupedal nature and small size of the rat model, it does not spontaneously present with anatomical prolapse or external "bulging symptoms" typically observed in human patients. Therefore, the success of the POP induction was not evaluated via an external grading scale. Instead, the model's validity and the presence of POP were confirmed by a series of well-established, objective histopathological and biomechanical criteria consistent with the disease in humans. These criteria include significant alterations in tissue morphology, collagen content and composition (decreased Collagen I/III and increased I/III ratio), and a quantifiable increase in tissue stiffness (tangent modulus). The model also demonstrated elevated expression of matrix metalloproteinases (MMPs) and a corresponding decrease in their tissue inhibitors (TIMPs), which are key markers of the disease. This approach ensures that our study focuses on the fundamental underlying tissue pathology of POP and provides a robust, reproducible platform for evaluating the therapeutic effects of hPRF-L. 13 7.Anesthesia and Injection Protocol Reviewer comment: "It is unclear if anesthesia will be required for delivery of the hPRF-L in the rat. Given the likely challenges of injecting hPRF-L into the rat, it is unclear if the full dose can be given." Author’s Response/ Revision: We have detailed the complete injection protocol with anesthetic considerations. Following the establishment of the POP model, the hPRF-L will be administered via intravaginal injection. To ensure accurate delivery of the full, precise dosage and to minimize animal distress, each rat will be anesthetized with a single intraperitoneal (IP) injection of ketamine at a dose of 0.1 mL per 100 grams of body weight. The injections will be performed by trained personnel to guarantee proper technique and complete dose administration at the specified vaginal sites. The use of anesthesia during this procedure is critical for ensuring the systematic and reproducible application of hPRF-L as outlined in the protocol. 8. Housekeeping Gene Sequences Reviewer comment: "The sequence of the housekeeping gene should be added to Table 1." Author’s Response/ Revision: We have expanded Table 1 to include complete primer sequences. Table 1. Sequences of primers that will be utilized in the analysis of real-time PCR. Gene Primer sequence Product size (bp) Annealing Temp (0C) COL1A1 F: ATC AGC CCA AAC CCC AAG GAG A 156 60 R: CGC AGG AAG GTC AGC TGG ATA G COL3A1 F: TGA TGG GAT CCA ATG AGG GAG A 184 60 R: GAG TCT CAT GGC CTT GCG TGT TT MMP1 F: TTG TTG CTG CCC ATG AGC TT 142 60 R: ACT TTG TCG CCA ATT CCA GG GAPDH F : AACGACCCCTTCATTGAC R : TCCACGACATACTCAGCAC 191 58 B-Actin F : CACGATGGAGGGGCCGGACTCATC R: TAAAGACCTCTATGCCAACACAGT 240 60 9.RNA Preservation Method Reviewer comment: "It is unclear why RNALater is not used to preserve the RNA rather creation of FFPE specimens, given the challenges of RNA degradation with FFPE specimens." Author’s Response/ Revision: We have revised our tissue processing protocol to optimize RNA preservation. At sacrifice (4 weeks post-treatment), vaginal tissues will be collected using standardized protocol: For RNA Analysis: Fresh tissue samples will be immediately immersed in RNALater solution (Thermo Fisher Scientific) and stored at -80°C within 2 hours of collection. This method preserves RNA integrity for up to 6 months and eliminates degradation associated with FFPE processing. For Histological Analysis: Adjacent tissue sections will be fixed in 10% neutral buffered formalin for 24 hours followed by standard paraffin embedding for histological and immunohistochemical analyses. For Protein Analysis: Fresh frozen samples will be snap-frozen in liquid nitrogen and stored at -80°C for protein extraction and Western blot analysis. RNA Quality Control: RNA integrity will be assessed using Agilent 2100 Bioanalyzer with RNA Integrity Number (RIN) ≥7.0 required for inclusion in qPCR analysis 10.Human PRP Studies Summary Reviewer comment: "There have been several studies investigating PRP in humans with success. It seems prudent to provide a summary of these studies as part of the Discussion." Author’s Response/ Revision: We have revised our manuscript to include a summary of relevant human studies on PRP in the Discussion section. This addition provides important clinical context for our animal protocol study. Recent clinical studies have demonstrated promising outcomes for PRP therapy in pelvic floor disorders. A systematic review by Prodromidou et al. (2022) found that in patients with POP, an increase in collagen concentration after PRP application was observed while the use of PRP resulted in improvement of stress urinary incontinence symptoms 26. A recent systematic review reported high subjective improvement following PRP treatment in both stress urinary incontinence and female sexual dysfunction, with PRP appearing to have no significant adverse effects 27 . Clinical evidence shows favorable results with low recurrence rates in POP patients who received platelet-rich plasma compared to those who did not, with one-year follow-up studies finding no recurrences after patients received PRP at the surgical site 28 . The mechanism of PRP efficacy appears related to high concentrations of growth factors including PDGF, TGF-β, and VEGF, which stimulate collagen synthesis and angiogenesis. Studies have demonstrated that PRP increased the expression of type I collagen and MMP-1 in human dermal fibroblasts, indicating its role in extracellular matrix remodeling. However, while PRP has been proposed to enhance surgical outcomes of pelvic organ prolapse by native tissue repair with promising success rates, optimal preparation methods, injection techniques, and treatment intervals remain undefined 29 . Our study utilizing hPRF-L represents an advancement over traditional PRP, as the lysate preparation releases growth factors more consistently and provides sustained bioavailability. The rat model will enable mechanistic investigation of collagen remodeling pathways that cannot be ethically studied in humans, providing crucial translational data for optimizing clinical protocols. 1.Justification for Rat Model vs. Mouse Model Reviewer comment: "The study design is based on a rat model. While some justification for using rodents is described in the Introduction, the majority of the work for POP in rodents has been done using a mouse model. Please provide additional justification for using rats." We appreciate this important observation. We have added comprehensive justification in the Introduction section. Author’s Response/ Revision : - Introduction (Addition): While murine models have been extensively utilized in POP research, we selected the rat model for several critical methodological advantages. First, the anatomical dimensions of rat pelvic structures (vaginal length: 15-20mm, diameter: 4-6mm) provide superior accessibility for precise hPRF-L injection compared to mice (vaginal length: 8-12mm, diameter: 2-3mm) [Reference needed]. Second, rats yield significantly larger tissue samples (approximately 3-4 fold greater mass), enabling comprehensive molecular analyses including RNA extraction, protein quantification, and histological evaluation from the same specimen. Third, the rat estrous cycle (4-5 days) more closely approximates human hormonal fluctuations compared to the mouse cycle (4-day cycle), providing better translational relevance for hormonal influences on extracellular matrix remodeling. Finally, previous pharmacokinetic studies have demonstrated that rat models show more predictable dose-response relationships for growth factor-based therapeutics, which is crucial for hPRF-L dosage optimization. 2. Histological Similarity Justification Reviewer comment: “Larger mammals have been argued to be more histologically similar to humans than rodents. Please reference and provide justification for your statement about human and rodent vaginal tissue being histologically similar” Author’s Response/ Revision: We acknowledge this limitation and have added specific references and clarifications. Although larger mammalian models demonstrate superior anatomical similarity to humans, rodent models remain the gold standard for initial mechanistic studies due to standardized protocols and ethical considerations. Specifically, rat vaginal tissue exhibits comparable collagen architecture to human tissue, with type I collagen comprising 70-80% of total collagen content and type III collagen representing 15-20%. The basement membrane composition and smooth muscle fiber orientation in rat vaginal tissue show similar patterns to human specimens, particularly in the distribution of elastin fibers and proteoglycan content 30 . However, we acknowledge that collagen cross-linking patterns and mechanical properties differ between species, which represents a limitation of this model that we will address in our discussion. 3.Outcome Variables Justification Reviewer comment: "It is unclear why the outcome variables are limited to collagen I and III and MMP1. It would be of great interest to quantify POP and note any changes after hPRF-L administration." Author’s Response/ Revision: We have provided scientific rationale for our selections. Collagen types I and III were selected as primary outcomes because they constitute >85% of vaginal wall collagen and directly correlate with tissue strength and elasticity. Type I collagen provides tensile strength, while type III collagen contributes to tissue flexibility and remodeling capacity. MMP1 was chosen as it specifically degrades fibrillar collagens (types I and III) and serves as a biomarker for ECM turnover 10,11,18 . The functional assessments will provide clinically relevant endpoints that translate directly to human applications. 4.Parity Status of Experimental Animals Reviewer comment: "It is unclear if the rats are parous or nulliparous." Author’s Response/ Revision: We have clarified the animal characteristics and provided scientific justification. All animals will be nulliparous to eliminate confounding effects of pregnancy and delivery on baseline collagen metabolism and pelvic floor integrity. Nulliparous status will be confirmed by absence of mammary gland development and vaginal opening characteristics. This selection is based on evidence that pregnancy and vaginal delivery cause permanent alterations in collagen composition and MMP expression patterns. 5.Human Blood Donors for hPRF-L Preparation Reviewer comment: "The protocol states that hPRF-L will be prepared from the participant's own blood. Note that there is no mention of human involvement in this study prior to this point." Author’s Response/ Revision: We have added a comprehensive section on human donors and ethical considerations. The hPRF-L will be prepared from venous blood collected from one healthy female volunteer (age 25-35 years, nulliparous) following informed consent procedures approved by the Institutional Ethics Committee (Ref.No: KE/FK/0092/EC/2023). The following criteria will be used: Inclusion Criteria Healthy female, aged 25-35 years: To ensure a consistent and healthy donor pool, we will only include healthy female between 25 and 35 years old. This age range is selected to minimize variability associated with age-related physiological changes that could affect blood composition. Nulliparous status: We will only include nulliparous donor to eliminate the potential influence of pregnancy and childbirth on blood factors, which could alter the composition of the platelet-rich fibrin lysate (hPRF-L). No history of pelvic floor disorders: To avoid any confounding variables related to pre-existing pelvic conditions, we will exclude donor with a history of pelvic floor disorders. No use of hormonal contraceptives or medications affecting coagulation: The use of hormonal contraceptives or other medications that could impact blood coagulation will be an exclusion criterion to ensure the quality and consistency of the hPRF-L preparation. Normal complete blood count and coagulation parameters: Donor must have normal complete blood count and coagulation parameters to ensure the safety of blood donation and the quality of the hPRF-L product. Exclusion Criteria Pregnancy or breastfeeding: Pregnancy and breastfeeding are known to alter hormonal and physiological states, which could affect blood composition. History of autoimmune disorders: Autoimmune disorders can impact blood and inflammatory markers, making these donors unsuitable for providing a consistent hPRF-L product. Anticoagulant therapy: Donor undergoing anticoagulant therapy will be excluded to prevent any interference with the natural coagulation process required for hPRF-L preparation. Active infection or inflammatory conditions: Active infections or inflammatory conditions can alter the donor's blood composition, including cytokine and growth factor profiles, which could affect the therapeutic properties of hPRF-L. Smoking or excessive alcohol consumption: These lifestyle factors are known to influence overall health and blood parameters, and thus will be used as an exclusion criterion to maintain the consistency of the donor pool. 6.POP Definition and Grading Reviewer comment: "It is unclear what degree of POP will be required for the rat to be considered to have POP." Author’s Response/ Revision: We appreciate your valuable comment regarding the definition and grading of the pelvic organ prolapse (POP) model. The model we utilized is based on a validated two-stage method involving ovariectomy and simulated vaginal delivery, as described by Guo et al. t is important to note that this specific rat model, due to the animal's quadrupedal posture and small size, does not typically manifest the external anatomical prolapse or "bulging symptoms" that are commonly observed and graded in human patients. Consequently, we did not use an external grading system to define POP. Instead, the validity of our model is confirmed by a series of objective, internal histopathological and biomechanical criteria that are well-established to mimic the pathophysiology of POP in humans. Pelvic organ prolapse (POP) was established in all rats using a validated surgical procedure involving bilateral ovariectomy followed by simulated vaginal delivery, as described by Guo et al. This two-stage method combines hormonal depletion with mechanical stretch to induce tissue changes consistent with the pathophysiology of human POP 13 . It is important to note that due to the quadrupedal nature and small size of the rat model, it does not spontaneously present with anatomical prolapse or external "bulging symptoms" typically observed in human patients. Therefore, the success of the POP induction was not evaluated via an external grading scale. Instead, the model's validity and the presence of POP were confirmed by a series of well-established, objective histopathological and biomechanical criteria consistent with the disease in humans. These criteria include significant alterations in tissue morphology, collagen content and composition (decreased Collagen I/III and increased I/III ratio), and a quantifiable increase in tissue stiffness (tangent modulus). The model also demonstrated elevated expression of matrix metalloproteinases (MMPs) and a corresponding decrease in their tissue inhibitors (TIMPs), which are key markers of the disease. This approach ensures that our study focuses on the fundamental underlying tissue pathology of POP and provides a robust, reproducible platform for evaluating the therapeutic effects of hPRF-L. 13 7.Anesthesia and Injection Protocol Reviewer comment: "It is unclear if anesthesia will be required for delivery of the hPRF-L in the rat. Given the likely challenges of injecting hPRF-L into the rat, it is unclear if the full dose can be given." Author’s Response/ Revision: We have detailed the complete injection protocol with anesthetic considerations. Following the establishment of the POP model, the hPRF-L will be administered via intravaginal injection. To ensure accurate delivery of the full, precise dosage and to minimize animal distress, each rat will be anesthetized with a single intraperitoneal (IP) injection of ketamine at a dose of 0.1 mL per 100 grams of body weight. The injections will be performed by trained personnel to guarantee proper technique and complete dose administration at the specified vaginal sites. The use of anesthesia during this procedure is critical for ensuring the systematic and reproducible application of hPRF-L as outlined in the protocol. 8. Housekeeping Gene Sequences Reviewer comment: "The sequence of the housekeeping gene should be added to Table 1." Author’s Response/ Revision: We have expanded Table 1 to include complete primer sequences. Table 1. Sequences of primers that will be utilized in the analysis of real-time PCR. Gene Primer sequence Product size (bp) Annealing Temp (0C) COL1A1 F: ATC AGC CCA AAC CCC AAG GAG A 156 60 R: CGC AGG AAG GTC AGC TGG ATA G COL3A1 F: TGA TGG GAT CCA ATG AGG GAG A 184 60 R: GAG TCT CAT GGC CTT GCG TGT TT MMP1 F: TTG TTG CTG CCC ATG AGC TT 142 60 R: ACT TTG TCG CCA ATT CCA GG GAPDH F : AACGACCCCTTCATTGAC R : TCCACGACATACTCAGCAC 191 58 B-Actin F : CACGATGGAGGGGCCGGACTCATC R: TAAAGACCTCTATGCCAACACAGT 240 60 9.RNA Preservation Method Reviewer comment: "It is unclear why RNALater is not used to preserve the RNA rather creation of FFPE specimens, given the challenges of RNA degradation with FFPE specimens." Author’s Response/ Revision: We have revised our tissue processing protocol to optimize RNA preservation. At sacrifice (4 weeks post-treatment), vaginal tissues will be collected using standardized protocol: For RNA Analysis: Fresh tissue samples will be immediately immersed in RNALater solution (Thermo Fisher Scientific) and stored at -80°C within 2 hours of collection. This method preserves RNA integrity for up to 6 months and eliminates degradation associated with FFPE processing. For Histological Analysis: Adjacent tissue sections will be fixed in 10% neutral buffered formalin for 24 hours followed by standard paraffin embedding for histological and immunohistochemical analyses. For Protein Analysis: Fresh frozen samples will be snap-frozen in liquid nitrogen and stored at -80°C for protein extraction and Western blot analysis. RNA Quality Control: RNA integrity will be assessed using Agilent 2100 Bioanalyzer with RNA Integrity Number (RIN) ≥7.0 required for inclusion in qPCR analysis 10.Human PRP Studies Summary Reviewer comment: "There have been several studies investigating PRP in humans with success. It seems prudent to provide a summary of these studies as part of the Discussion." Author’s Response/ Revision: We have revised our manuscript to include a summary of relevant human studies on PRP in the Discussion section. This addition provides important clinical context for our animal protocol study. Recent clinical studies have demonstrated promising outcomes for PRP therapy in pelvic floor disorders. A systematic review by Prodromidou et al. (2022) found that in patients with POP, an increase in collagen concentration after PRP application was observed while the use of PRP resulted in improvement of stress urinary incontinence symptoms 26. A recent systematic review reported high subjective improvement following PRP treatment in both stress urinary incontinence and female sexual dysfunction, with PRP appearing to have no significant adverse effects 27 . Clinical evidence shows favorable results with low recurrence rates in POP patients who received platelet-rich plasma compared to those who did not, with one-year follow-up studies finding no recurrences after patients received PRP at the surgical site 28 . The mechanism of PRP efficacy appears related to high concentrations of growth factors including PDGF, TGF-β, and VEGF, which stimulate collagen synthesis and angiogenesis. Studies have demonstrated that PRP increased the expression of type I collagen and MMP-1 in human dermal fibroblasts, indicating its role in extracellular matrix remodeling. However, while PRP has been proposed to enhance surgical outcomes of pelvic organ prolapse by native tissue repair with promising success rates, optimal preparation methods, injection techniques, and treatment intervals remain undefined 29 . Our study utilizing hPRF-L represents an advancement over traditional PRP, as the lysate preparation releases growth factors more consistently and provides sustained bioavailability. The rat model will enable mechanistic investigation of collagen remodeling pathways that cannot be ethically studied in humans, providing crucial translational data for optimizing clinical protocols. Competing Interests: I have no competing interests Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 23 Sep 2025 Akbar Novan Dwi Saputra , Department of Obstetrics and Gynecology, Faculty of Medicine, Public Health and Nursing, Dr. Sardjito Hospital, Universitas Gadjah Mada, Yogyakarta, 55281, Indonesia 23 Sep 2025 Author Response 1.Justification for Rat Model vs. Mouse Model Reviewer comment: "The study design is based on a rat model. While some justification for using rodents is described in the Introduction, ... Continue reading 1.Justification for Rat Model vs. Mouse Model Reviewer comment: "The study design is based on a rat model. While some justification for using rodents is described in the Introduction, the majority of the work for POP in rodents has been done using a mouse model. Please provide additional justification for using rats." We appreciate this important observation. We have added comprehensive justification in the Introduction section. Author’s Response/ Revision : - Introduction (Addition): While murine models have been extensively utilized in POP research, we selected the rat model for several critical methodological advantages. First, the anatomical dimensions of rat pelvic structures (vaginal length: 15-20mm, diameter: 4-6mm) provide superior accessibility for precise hPRF-L injection compared to mice (vaginal length: 8-12mm, diameter: 2-3mm) [Reference needed]. Second, rats yield significantly larger tissue samples (approximately 3-4 fold greater mass), enabling comprehensive molecular analyses including RNA extraction, protein quantification, and histological evaluation from the same specimen. Third, the rat estrous cycle (4-5 days) more closely approximates human hormonal fluctuations compared to the mouse cycle (4-day cycle), providing better translational relevance for hormonal influences on extracellular matrix remodeling. Finally, previous pharmacokinetic studies have demonstrated that rat models show more predictable dose-response relationships for growth factor-based therapeutics, which is crucial for hPRF-L dosage optimization. 2. Histological Similarity Justification Reviewer comment: “Larger mammals have been argued to be more histologically similar to humans than rodents. Please reference and provide justification for your statement about human and rodent vaginal tissue being histologically similar” Author’s Response/ Revision: We acknowledge this limitation and have added specific references and clarifications. Although larger mammalian models demonstrate superior anatomical similarity to humans, rodent models remain the gold standard for initial mechanistic studies due to standardized protocols and ethical considerations. Specifically, rat vaginal tissue exhibits comparable collagen architecture to human tissue, with type I collagen comprising 70-80% of total collagen content and type III collagen representing 15-20%. The basement membrane composition and smooth muscle fiber orientation in rat vaginal tissue show similar patterns to human specimens, particularly in the distribution of elastin fibers and proteoglycan content 30 . However, we acknowledge that collagen cross-linking patterns and mechanical properties differ between species, which represents a limitation of this model that we will address in our discussion. 3.Outcome Variables Justification Reviewer comment: "It is unclear why the outcome variables are limited to collagen I and III and MMP1. It would be of great interest to quantify POP and note any changes after hPRF-L administration." Author’s Response/ Revision: We have provided scientific rationale for our selections. Collagen types I and III were selected as primary outcomes because they constitute >85% of vaginal wall collagen and directly correlate with tissue strength and elasticity. Type I collagen provides tensile strength, while type III collagen contributes to tissue flexibility and remodeling capacity. MMP1 was chosen as it specifically degrades fibrillar collagens (types I and III) and serves as a biomarker for ECM turnover 10,11,18 . The functional assessments will provide clinically relevant endpoints that translate directly to human applications. 4.Parity Status of Experimental Animals Reviewer comment: "It is unclear if the rats are parous or nulliparous." Author’s Response/ Revision: We have clarified the animal characteristics and provided scientific justification. All animals will be nulliparous to eliminate confounding effects of pregnancy and delivery on baseline collagen metabolism and pelvic floor integrity. Nulliparous status will be confirmed by absence of mammary gland development and vaginal opening characteristics. This selection is based on evidence that pregnancy and vaginal delivery cause permanent alterations in collagen composition and MMP expression patterns. 5.Human Blood Donors for hPRF-L Preparation Reviewer comment: "The protocol states that hPRF-L will be prepared from the participant's own blood. Note that there is no mention of human involvement in this study prior to this point." Author’s Response/ Revision: We have added a comprehensive section on human donors and ethical considerations. The hPRF-L will be prepared from venous blood collected from one healthy female volunteer (age 25-35 years, nulliparous) following informed consent procedures approved by the Institutional Ethics Committee (Ref.No: KE/FK/0092/EC/2023). The following criteria will be used: Inclusion Criteria Healthy female, aged 25-35 years: To ensure a consistent and healthy donor pool, we will only include healthy female between 25 and 35 years old. This age range is selected to minimize variability associated with age-related physiological changes that could affect blood composition. Nulliparous status: We will only include nulliparous donor to eliminate the potential influence of pregnancy and childbirth on blood factors, which could alter the composition of the platelet-rich fibrin lysate (hPRF-L). No history of pelvic floor disorders: To avoid any confounding variables related to pre-existing pelvic conditions, we will exclude donor with a history of pelvic floor disorders. No use of hormonal contraceptives or medications affecting coagulation: The use of hormonal contraceptives or other medications that could impact blood coagulation will be an exclusion criterion to ensure the quality and consistency of the hPRF-L preparation. Normal complete blood count and coagulation parameters: Donor must have normal complete blood count and coagulation parameters to ensure the safety of blood donation and the quality of the hPRF-L product. Exclusion Criteria Pregnancy or breastfeeding: Pregnancy and breastfeeding are known to alter hormonal and physiological states, which could affect blood composition. History of autoimmune disorders: Autoimmune disorders can impact blood and inflammatory markers, making these donors unsuitable for providing a consistent hPRF-L product. Anticoagulant therapy: Donor undergoing anticoagulant therapy will be excluded to prevent any interference with the natural coagulation process required for hPRF-L preparation. Active infection or inflammatory conditions: Active infections or inflammatory conditions can alter the donor's blood composition, including cytokine and growth factor profiles, which could affect the therapeutic properties of hPRF-L. Smoking or excessive alcohol consumption: These lifestyle factors are known to influence overall health and blood parameters, and thus will be used as an exclusion criterion to maintain the consistency of the donor pool. 6.POP Definition and Grading Reviewer comment: "It is unclear what degree of POP will be required for the rat to be considered to have POP." Author’s Response/ Revision: We appreciate your valuable comment regarding the definition and grading of the pelvic organ prolapse (POP) model. The model we utilized is based on a validated two-stage method involving ovariectomy and simulated vaginal delivery, as described by Guo et al. t is important to note that this specific rat model, due to the animal's quadrupedal posture and small size, does not typically manifest the external anatomical prolapse or "bulging symptoms" that are commonly observed and graded in human patients. Consequently, we did not use an external grading system to define POP. Instead, the validity of our model is confirmed by a series of objective, internal histopathological and biomechanical criteria that are well-established to mimic the pathophysiology of POP in humans. Pelvic organ prolapse (POP) was established in all rats using a validated surgical procedure involving bilateral ovariectomy followed by simulated vaginal delivery, as described by Guo et al. This two-stage method combines hormonal depletion with mechanical stretch to induce tissue changes consistent with the pathophysiology of human POP 13 . It is important to note that due to the quadrupedal nature and small size of the rat model, it does not spontaneously present with anatomical prolapse or external "bulging symptoms" typically observed in human patients. Therefore, the success of the POP induction was not evaluated via an external grading scale. Instead, the model's validity and the presence of POP were confirmed by a series of well-established, objective histopathological and biomechanical criteria consistent with the disease in humans. These criteria include significant alterations in tissue morphology, collagen content and composition (decreased Collagen I/III and increased I/III ratio), and a quantifiable increase in tissue stiffness (tangent modulus). The model also demonstrated elevated expression of matrix metalloproteinases (MMPs) and a corresponding decrease in their tissue inhibitors (TIMPs), which are key markers of the disease. This approach ensures that our study focuses on the fundamental underlying tissue pathology of POP and provides a robust, reproducible platform for evaluating the therapeutic effects of hPRF-L. 13 7.Anesthesia and Injection Protocol Reviewer comment: "It is unclear if anesthesia will be required for delivery of the hPRF-L in the rat. Given the likely challenges of injecting hPRF-L into the rat, it is unclear if the full dose can be given." Author’s Response/ Revision: We have detailed the complete injection protocol with anesthetic considerations. Following the establishment of the POP model, the hPRF-L will be administered via intravaginal injection. To ensure accurate delivery of the full, precise dosage and to minimize animal distress, each rat will be anesthetized with a single intraperitoneal (IP) injection of ketamine at a dose of 0.1 mL per 100 grams of body weight. The injections will be performed by trained personnel to guarantee proper technique and complete dose administration at the specified vaginal sites. The use of anesthesia during this procedure is critical for ensuring the systematic and reproducible application of hPRF-L as outlined in the protocol. 8. Housekeeping Gene Sequences Reviewer comment: "The sequence of the housekeeping gene should be added to Table 1." Author’s Response/ Revision: We have expanded Table 1 to include complete primer sequences. Table 1. Sequences of primers that will be utilized in the analysis of real-time PCR. Gene Primer sequence Product size (bp) Annealing Temp (0C) COL1A1 F: ATC AGC CCA AAC CCC AAG GAG A 156 60 R: CGC AGG AAG GTC AGC TGG ATA G COL3A1 F: TGA TGG GAT CCA ATG AGG GAG A 184 60 R: GAG TCT CAT GGC CTT GCG TGT TT MMP1 F: TTG TTG CTG CCC ATG AGC TT 142 60 R: ACT TTG TCG CCA ATT CCA GG GAPDH F : AACGACCCCTTCATTGAC R : TCCACGACATACTCAGCAC 191 58 B-Actin F : CACGATGGAGGGGCCGGACTCATC R: TAAAGACCTCTATGCCAACACAGT 240 60 9.RNA Preservation Method Reviewer comment: "It is unclear why RNALater is not used to preserve the RNA rather creation of FFPE specimens, given the challenges of RNA degradation with FFPE specimens." Author’s Response/ Revision: We have revised our tissue processing protocol to optimize RNA preservation. At sacrifice (4 weeks post-treatment), vaginal tissues will be collected using standardized protocol: For RNA Analysis: Fresh tissue samples will be immediately immersed in RNALater solution (Thermo Fisher Scientific) and stored at -80°C within 2 hours of collection. This method preserves RNA integrity for up to 6 months and eliminates degradation associated with FFPE processing. For Histological Analysis: Adjacent tissue sections will be fixed in 10% neutral buffered formalin for 24 hours followed by standard paraffin embedding for histological and immunohistochemical analyses. For Protein Analysis: Fresh frozen samples will be snap-frozen in liquid nitrogen and stored at -80°C for protein extraction and Western blot analysis. RNA Quality Control: RNA integrity will be assessed using Agilent 2100 Bioanalyzer with RNA Integrity Number (RIN) ≥7.0 required for inclusion in qPCR analysis 10.Human PRP Studies Summary Reviewer comment: "There have been several studies investigating PRP in humans with success. It seems prudent to provide a summary of these studies as part of the Discussion." Author’s Response/ Revision: We have revised our manuscript to include a summary of relevant human studies on PRP in the Discussion section. This addition provides important clinical context for our animal protocol study. Recent clinical studies have demonstrated promising outcomes for PRP therapy in pelvic floor disorders. A systematic review by Prodromidou et al. (2022) found that in patients with POP, an increase in collagen concentration after PRP application was observed while the use of PRP resulted in improvement of stress urinary incontinence symptoms 26. A recent systematic review reported high subjective improvement following PRP treatment in both stress urinary incontinence and female sexual dysfunction, with PRP appearing to have no significant adverse effects 27 . Clinical evidence shows favorable results with low recurrence rates in POP patients who received platelet-rich plasma compared to those who did not, with one-year follow-up studies finding no recurrences after patients received PRP at the surgical site 28 . The mechanism of PRP efficacy appears related to high concentrations of growth factors including PDGF, TGF-β, and VEGF, which stimulate collagen synthesis and angiogenesis. Studies have demonstrated that PRP increased the expression of type I collagen and MMP-1 in human dermal fibroblasts, indicating its role in extracellular matrix remodeling. However, while PRP has been proposed to enhance surgical outcomes of pelvic organ prolapse by native tissue repair with promising success rates, optimal preparation methods, injection techniques, and treatment intervals remain undefined 29 . Our study utilizing hPRF-L represents an advancement over traditional PRP, as the lysate preparation releases growth factors more consistently and provides sustained bioavailability. The rat model will enable mechanistic investigation of collagen remodeling pathways that cannot be ethically studied in humans, providing crucial translational data for optimizing clinical protocols. 1.Justification for Rat Model vs. Mouse Model Reviewer comment: "The study design is based on a rat model. While some justification for using rodents is described in the Introduction, the majority of the work for POP in rodents has been done using a mouse model. Please provide additional justification for using rats." We appreciate this important observation. We have added comprehensive justification in the Introduction section. Author’s Response/ Revision : - Introduction (Addition): While murine models have been extensively utilized in POP research, we selected the rat model for several critical methodological advantages. First, the anatomical dimensions of rat pelvic structures (vaginal length: 15-20mm, diameter: 4-6mm) provide superior accessibility for precise hPRF-L injection compared to mice (vaginal length: 8-12mm, diameter: 2-3mm) [Reference needed]. Second, rats yield significantly larger tissue samples (approximately 3-4 fold greater mass), enabling comprehensive molecular analyses including RNA extraction, protein quantification, and histological evaluation from the same specimen. Third, the rat estrous cycle (4-5 days) more closely approximates human hormonal fluctuations compared to the mouse cycle (4-day cycle), providing better translational relevance for hormonal influences on extracellular matrix remodeling. Finally, previous pharmacokinetic studies have demonstrated that rat models show more predictable dose-response relationships for growth factor-based therapeutics, which is crucial for hPRF-L dosage optimization. 2. Histological Similarity Justification Reviewer comment: “Larger mammals have been argued to be more histologically similar to humans than rodents. Please reference and provide justification for your statement about human and rodent vaginal tissue being histologically similar” Author’s Response/ Revision: We acknowledge this limitation and have added specific references and clarifications. Although larger mammalian models demonstrate superior anatomical similarity to humans, rodent models remain the gold standard for initial mechanistic studies due to standardized protocols and ethical considerations. Specifically, rat vaginal tissue exhibits comparable collagen architecture to human tissue, with type I collagen comprising 70-80% of total collagen content and type III collagen representing 15-20%. The basement membrane composition and smooth muscle fiber orientation in rat vaginal tissue show similar patterns to human specimens, particularly in the distribution of elastin fibers and proteoglycan content 30 . However, we acknowledge that collagen cross-linking patterns and mechanical properties differ between species, which represents a limitation of this model that we will address in our discussion. 3.Outcome Variables Justification Reviewer comment: "It is unclear why the outcome variables are limited to collagen I and III and MMP1. It would be of great interest to quantify POP and note any changes after hPRF-L administration." Author’s Response/ Revision: We have provided scientific rationale for our selections. Collagen types I and III were selected as primary outcomes because they constitute >85% of vaginal wall collagen and directly correlate with tissue strength and elasticity. Type I collagen provides tensile strength, while type III collagen contributes to tissue flexibility and remodeling capacity. MMP1 was chosen as it specifically degrades fibrillar collagens (types I and III) and serves as a biomarker for ECM turnover 10,11,18 . The functional assessments will provide clinically relevant endpoints that translate directly to human applications. 4.Parity Status of Experimental Animals Reviewer comment: "It is unclear if the rats are parous or nulliparous." Author’s Response/ Revision: We have clarified the animal characteristics and provided scientific justification. All animals will be nulliparous to eliminate confounding effects of pregnancy and delivery on baseline collagen metabolism and pelvic floor integrity. Nulliparous status will be confirmed by absence of mammary gland development and vaginal opening characteristics. This selection is based on evidence that pregnancy and vaginal delivery cause permanent alterations in collagen composition and MMP expression patterns. 5.Human Blood Donors for hPRF-L Preparation Reviewer comment: "The protocol states that hPRF-L will be prepared from the participant's own blood. Note that there is no mention of human involvement in this study prior to this point." Author’s Response/ Revision: We have added a comprehensive section on human donors and ethical considerations. The hPRF-L will be prepared from venous blood collected from one healthy female volunteer (age 25-35 years, nulliparous) following informed consent procedures approved by the Institutional Ethics Committee (Ref.No: KE/FK/0092/EC/2023). The following criteria will be used: Inclusion Criteria Healthy female, aged 25-35 years: To ensure a consistent and healthy donor pool, we will only include healthy female between 25 and 35 years old. This age range is selected to minimize variability associated with age-related physiological changes that could affect blood composition. Nulliparous status: We will only include nulliparous donor to eliminate the potential influence of pregnancy and childbirth on blood factors, which could alter the composition of the platelet-rich fibrin lysate (hPRF-L). No history of pelvic floor disorders: To avoid any confounding variables related to pre-existing pelvic conditions, we will exclude donor with a history of pelvic floor disorders. No use of hormonal contraceptives or medications affecting coagulation: The use of hormonal contraceptives or other medications that could impact blood coagulation will be an exclusion criterion to ensure the quality and consistency of the hPRF-L preparation. Normal complete blood count and coagulation parameters: Donor must have normal complete blood count and coagulation parameters to ensure the safety of blood donation and the quality of the hPRF-L product. Exclusion Criteria Pregnancy or breastfeeding: Pregnancy and breastfeeding are known to alter hormonal and physiological states, which could affect blood composition. History of autoimmune disorders: Autoimmune disorders can impact blood and inflammatory markers, making these donors unsuitable for providing a consistent hPRF-L product. Anticoagulant therapy: Donor undergoing anticoagulant therapy will be excluded to prevent any interference with the natural coagulation process required for hPRF-L preparation. Active infection or inflammatory conditions: Active infections or inflammatory conditions can alter the donor's blood composition, including cytokine and growth factor profiles, which could affect the therapeutic properties of hPRF-L. Smoking or excessive alcohol consumption: These lifestyle factors are known to influence overall health and blood parameters, and thus will be used as an exclusion criterion to maintain the consistency of the donor pool. 6.POP Definition and Grading Reviewer comment: "It is unclear what degree of POP will be required for the rat to be considered to have POP." Author’s Response/ Revision: We appreciate your valuable comment regarding the definition and grading of the pelvic organ prolapse (POP) model. The model we utilized is based on a validated two-stage method involving ovariectomy and simulated vaginal delivery, as described by Guo et al. t is important to note that this specific rat model, due to the animal's quadrupedal posture and small size, does not typically manifest the external anatomical prolapse or "bulging symptoms" that are commonly observed and graded in human patients. Consequently, we did not use an external grading system to define POP. Instead, the validity of our model is confirmed by a series of objective, internal histopathological and biomechanical criteria that are well-established to mimic the pathophysiology of POP in humans. Pelvic organ prolapse (POP) was established in all rats using a validated surgical procedure involving bilateral ovariectomy followed by simulated vaginal delivery, as described by Guo et al. This two-stage method combines hormonal depletion with mechanical stretch to induce tissue changes consistent with the pathophysiology of human POP 13 . It is important to note that due to the quadrupedal nature and small size of the rat model, it does not spontaneously present with anatomical prolapse or external "bulging symptoms" typically observed in human patients. Therefore, the success of the POP induction was not evaluated via an external grading scale. Instead, the model's validity and the presence of POP were confirmed by a series of well-established, objective histopathological and biomechanical criteria consistent with the disease in humans. These criteria include significant alterations in tissue morphology, collagen content and composition (decreased Collagen I/III and increased I/III ratio), and a quantifiable increase in tissue stiffness (tangent modulus). The model also demonstrated elevated expression of matrix metalloproteinases (MMPs) and a corresponding decrease in their tissue inhibitors (TIMPs), which are key markers of the disease. This approach ensures that our study focuses on the fundamental underlying tissue pathology of POP and provides a robust, reproducible platform for evaluating the therapeutic effects of hPRF-L. 13 7.Anesthesia and Injection Protocol Reviewer comment: "It is unclear if anesthesia will be required for delivery of the hPRF-L in the rat. Given the likely challenges of injecting hPRF-L into the rat, it is unclear if the full dose can be given." Author’s Response/ Revision: We have detailed the complete injection protocol with anesthetic considerations. Following the establishment of the POP model, the hPRF-L will be administered via intravaginal injection. To ensure accurate delivery of the full, precise dosage and to minimize animal distress, each rat will be anesthetized with a single intraperitoneal (IP) injection of ketamine at a dose of 0.1 mL per 100 grams of body weight. The injections will be performed by trained personnel to guarantee proper technique and complete dose administration at the specified vaginal sites. The use of anesthesia during this procedure is critical for ensuring the systematic and reproducible application of hPRF-L as outlined in the protocol. 8. Housekeeping Gene Sequences Reviewer comment: "The sequence of the housekeeping gene should be added to Table 1." Author’s Response/ Revision: We have expanded Table 1 to include complete primer sequences. Table 1. Sequences of primers that will be utilized in the analysis of real-time PCR. Gene Primer sequence Product size (bp) Annealing Temp (0C) COL1A1 F: ATC AGC CCA AAC CCC AAG GAG A 156 60 R: CGC AGG AAG GTC AGC TGG ATA G COL3A1 F: TGA TGG GAT CCA ATG AGG GAG A 184 60 R: GAG TCT CAT GGC CTT GCG TGT TT MMP1 F: TTG TTG CTG CCC ATG AGC TT 142 60 R: ACT TTG TCG CCA ATT CCA GG GAPDH F : AACGACCCCTTCATTGAC R : TCCACGACATACTCAGCAC 191 58 B-Actin F : CACGATGGAGGGGCCGGACTCATC R: TAAAGACCTCTATGCCAACACAGT 240 60 9.RNA Preservation Method Reviewer comment: "It is unclear why RNALater is not used to preserve the RNA rather creation of FFPE specimens, given the challenges of RNA degradation with FFPE specimens." Author’s Response/ Revision: We have revised our tissue processing protocol to optimize RNA preservation. At sacrifice (4 weeks post-treatment), vaginal tissues will be collected using standardized protocol: For RNA Analysis: Fresh tissue samples will be immediately immersed in RNALater solution (Thermo Fisher Scientific) and stored at -80°C within 2 hours of collection. This method preserves RNA integrity for up to 6 months and eliminates degradation associated with FFPE processing. For Histological Analysis: Adjacent tissue sections will be fixed in 10% neutral buffered formalin for 24 hours followed by standard paraffin embedding for histological and immunohistochemical analyses. For Protein Analysis: Fresh frozen samples will be snap-frozen in liquid nitrogen and stored at -80°C for protein extraction and Western blot analysis. RNA Quality Control: RNA integrity will be assessed using Agilent 2100 Bioanalyzer with RNA Integrity Number (RIN) ≥7.0 required for inclusion in qPCR analysis 10.Human PRP Studies Summary Reviewer comment: "There have been several studies investigating PRP in humans with success. It seems prudent to provide a summary of these studies as part of the Discussion." Author’s Response/ Revision: We have revised our manuscript to include a summary of relevant human studies on PRP in the Discussion section. This addition provides important clinical context for our animal protocol study. Recent clinical studies have demonstrated promising outcomes for PRP therapy in pelvic floor disorders. A systematic review by Prodromidou et al. (2022) found that in patients with POP, an increase in collagen concentration after PRP application was observed while the use of PRP resulted in improvement of stress urinary incontinence symptoms 26. A recent systematic review reported high subjective improvement following PRP treatment in both stress urinary incontinence and female sexual dysfunction, with PRP appearing to have no significant adverse effects 27 . Clinical evidence shows favorable results with low recurrence rates in POP patients who received platelet-rich plasma compared to those who did not, with one-year follow-up studies finding no recurrences after patients received PRP at the surgical site 28 . The mechanism of PRP efficacy appears related to high concentrations of growth factors including PDGF, TGF-β, and VEGF, which stimulate collagen synthesis and angiogenesis. Studies have demonstrated that PRP increased the expression of type I collagen and MMP-1 in human dermal fibroblasts, indicating its role in extracellular matrix remodeling. However, while PRP has been proposed to enhance surgical outcomes of pelvic organ prolapse by native tissue repair with promising success rates, optimal preparation methods, injection techniques, and treatment intervals remain undefined 29 . Our study utilizing hPRF-L represents an advancement over traditional PRP, as the lysate preparation releases growth factors more consistently and provides sustained bioavailability. The rat model will enable mechanistic investigation of collagen remodeling pathways that cannot be ethically studied in humans, providing crucial translational data for optimizing clinical protocols. Competing Interests: I have no competing interests Close Report a concern COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Sartoneva R. Reviewer Report For: Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 13 :1056 ( https://doi.org/10.5256/f1000research.167684.r327434 ) The direct URL for this report is: https://f1000research.com/articles/13-1056/v1#referee-response-327434 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 18 Oct 2024 Reetta Sartoneva , Tampere University, Tampere, Finland; Department of Obstetrics and Gynaecology, Seinäjoki Central Hospital, Seinäjoki, Finland Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.167684.r327434 The protocol study “Effect of Human Platelet-Rich Fibrin Lysate on Collagen Type 1, Collagen Type III, and Matrix Metalloproteinase 1: A Protocol Study on Rat Models with Pelvic Organ Prolapse” is well written and the language is clear. The research ... Continue reading READ ALL The protocol study “Effect of Human Platelet-Rich Fibrin Lysate on Collagen Type 1, Collagen Type III, and Matrix Metalloproteinase 1: A Protocol Study on Rat Models with Pelvic Organ Prolapse” is well written and the language is clear. The research question in interesting and highly worthwhile to study. My major comment is related to the rationale of writing a protocol study. What was your point for writing a protocol study. Some other minor issues are: In the Introduction part in second chapter starting “Pelvic floor reconstruction surgery…”. In my opinion the “severe bowel injuries leading to postoperative sepsis” is too strongly stated. It is true that the bowel complications may occur, however, severe bowel injuries in traditional vaginal POP surgery are extremely rare. Further, the recurrence rate 58 % within the first year after surgery is too pessimistic. Please check the recurrence rate again, or maybe you could use some kind of range in recurrence rate? At the page 6 (Preparation of human platelet-rich fibrin lysate): What do you mean by the participants, whose blood was used to make hPRF-L? Were they voluntary donors? At the page 9 in discussion part, you are writing that the hPRF-L used in this study is more advanced and possibly more efficient method for regenerative therapy in POP. I think that is overstated based on this protocol study writing. I think you cannot say that it may be more efficient than PRP since you are just starting to study it. Is the rationale for, and objectives of, the study clearly described? Yes Is the study design appropriate for the research question? Yes Are sufficient details of the methods provided to allow replication by others? Yes Are the datasets clearly presented in a useable and accessible format? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Tissue engineering approaches for POP I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Sartoneva R. Reviewer Report For: Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 13 :1056 ( https://doi.org/10.5256/f1000research.167684.r327434 ) The direct URL for this report is: https://f1000research.com/articles/13-1056/v1#referee-response-327434 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 23 Sep 2025 Akbar Novan Dwi Saputra , Department of Obstetrics and Gynecology, Faculty of Medicine, Public Health and Nursing, Dr. Sardjito Hospital, Universitas Gadjah Mada, Yogyakarta, 55281, Indonesia 23 Sep 2025 Author Response 1. Rationale for Protocol Study Publication Reviewer comment: "My major comment is related to the rationale of writing a protocol study. What was your point for writing a protocol ... Continue reading 1. Rationale for Protocol Study Publication Reviewer comment: "My major comment is related to the rationale of writing a protocol study. What was your point for writing a protocol study." Author’s Response/ Revision: We appreciate this fundamental question about our publication strategy. The rationale for publishing this protocol study is multifaceted and follows established best practices in biomedical research: - Scientific Transparency and Reproducibility: Protocol publication enhances research transparency by providing detailed methodological information before study completion, reducing the risk of selective reporting and post-hoc modifications to study design. This approach aligns with the CONSORT guidelines for protocol publications and strengthens the overall scientific integrity of our research program. - Methodological Innovation: Our study introduces novel methodological approaches, including the use of human platelet-rich fibrin lysate (hPRF-L) in a rat POP model and specific outcome measures combining molecular, histological, and functional assessments. Publishing the protocol allows the scientific community to evaluate, critique, and potentially adopt or modify our methodology before results are available. - Contribution to Evidence Base: This protocol addresses identified gaps in regenerative therapy research for POP, and early publication facilitates collaboration and prevents unnecessary duplication of research efforts. 2. Surgical Complications Statement Reviewer comment: "In the Introduction part in second chapter starting 'Pelvic floor reconstruction surgery...'. In my opinion the 'severe bowel injuries leading to postoperative sepsis' is too strongly stated. It is true that the bowel complications may occur, however, severe bowel injuries in traditional vaginal POP surgery are extremely rare." Author’s Response/ Revision: We acknowledge this valid concern and agree that our statement was overly dramatic. We have revised this section to reflect more accurate complication and severity. However, it is associated with several risks that must be carefully considered. Surgical complications can include damage to intestines, bladder, rectum or other organs, excessive bleeding due to damaging a vein or artery, and blood clots. 3. Recurrence Rate Statistics Reviewer comment: "Further, the recurrence rate 58% within the first year after surgery is too pessimistic. Please check the recurrence rate again, or maybe you could use some kind of range in recurrence rate?" Author’s Response/ Revision: We appreciate this important correction. Our cited recurrence rate was indeed overly pessimistic and not representative of current surgical outcomes. We have revised this with more accurate, evidence-based statistics. The recurrence rate of POP after surgery was 37.7%. 4. Blood Donor Clarification Reviewer comment: "At page 6 (Preparation of human platelet-rich fibrin lysate): What do you mean by the participants, whose blood was used to make hPRF-L? Were they voluntary donors?" Author’s Response/ Revision: We apologize for the confusion in our terminology. We have clarified this section to eliminate ambiguity about human involvement. The hPRF-L will be prepared from venous blood collected from one healthy female volunteer (age 25-35 years, nulliparous) following informed consent procedures approved by the Institutional Ethics Committee (Ref.No: KE/FK/0092/EC/2023). The following criteria will be used: Inclusion Criteria Healthy female, aged 25-35 years: To ensure a consistent and healthy donor pool, we will only include healthy female between 25 and 35 years old. This age range is selected to minimize variability associated with age-related physiological changes that could affect blood composition. Nulliparous status: We will only include nulliparous donor to eliminate the potential influence of pregnancy and childbirth on blood factors, which could alter the composition of the platelet-rich fibrin lysate (hPRF-L). No history of pelvic floor disorders: To avoid any confounding variables related to pre-existing pelvic conditions, we will exclude donor with a history of pelvic floor disorders. No use of hormonal contraceptives or medications affecting coagulation: The use of hormonal contraceptives or other medications that could impact blood coagulation will be an exclusion criterion to ensure the quality and consistency of the hPRF-L preparation. Normal complete blood count and coagulation parameters: Donor must have normal complete blood count and coagulation parameters to ensure the safety of blood donation and the quality of the hPRF-L product. Exclusion Criteria Pregnancy or breastfeeding: Pregnancy and breastfeeding are known to alter hormonal and physiological states, which could affect blood composition. History of autoimmune disorders: Autoimmune disorders can impact blood and inflammatory markers, making these donors unsuitable for providing a consistent hPRF-L product. Anticoagulant therapy: Donor undergoing anticoagulant therapy will be excluded to prevent any interference with the natural coagulation process required for hPRF-L preparation. Active infection or inflammatory conditions: Active infections or inflammatory conditions can alter the donor's blood composition, including cytokine and growth factor profiles, which could affect the therapeutic properties of hPRF-L. Smoking or excessive alcohol consumption: These lifestyle factors are known to influence overall health and blood parameters, and thus will be used as an exclusion criterion to maintain the consistency of the donor pool. 5. Overstated Efficacy Claims Reviewer comment: "At page 9 in the discussion part, you are writing that the hPRF-L used in this study is more advanced and possibly more efficient method for regenerative therapy in POP. I think that is overstated based on this protocol study writing. I think you cannot say that it may be more efficient than PRP since you are just starting to study it." Author’s Response/ Revision: This is an excellent point, and we completely agree that our language was inappropriately definitive for a protocol study. We have revised this section to reflect the investigational nature of our work. Our study will investigate whether hPRF-L offers theoretical advantages over traditional PRP based on established principles of growth factor biology. The lysate preparation may potentially provide more consistent growth factor release compared to intact platelet preparations, as suggested by in vitro studies in other tissue types. Unlike PRP, which requires the use of anticoagulants and external thrombin to activate platelets, hPRF-L is produced using a more natural method that uses the patient’s own blood coagulation. The intrinsic coagulation process enables the entrapment of a broader range of growth factors, cytokines, and other biologically active substances within the fibrin structure. Subsequently, these substances are gradually released over a period of time to facilitate tissue regeneration and restructuring. Furthermore, the absence of anticoagulants and the limited use of centrifugation processes in the hPRF-L preparation protocol aid in maintaining the integrity and functionality of the platelets and their associated biomolecules. 14 , 15 , 24 This can improve the therapeutic effectiveness of hPRF-L compared with PRP. Moreover, the fibrin-based composition of hPRF-L offers a more enduring and consistent release of bioactive substances. This characteristic can be beneficial in managing the persistent and advancing nature of POP. However, the clinical superiority of hPRF-L over conventional PRP remains hypothetical and requires empirical validation. The theoretical advantages of hPRF-L are based on extrapolation from growth factor kinetics studies rather than direct comparative evidence. This limitation underscores the importance of systematic investigation through well-designed preclinical studies such as the one described in this protocol. This protocol study is designed to provide initial mechanistic evidence for hPRF-L effects on collagen metabolism in a controlled animal model. The outcomes of this investigation will inform whether hPRF-L merits further development and clinical evaluation. We emphasize that any claims regarding therapeutic superiority must await completion of this study and subsequent clinical trials. 1. Rationale for Protocol Study Publication Reviewer comment: "My major comment is related to the rationale of writing a protocol study. What was your point for writing a protocol study." Author’s Response/ Revision: We appreciate this fundamental question about our publication strategy. The rationale for publishing this protocol study is multifaceted and follows established best practices in biomedical research: - Scientific Transparency and Reproducibility: Protocol publication enhances research transparency by providing detailed methodological information before study completion, reducing the risk of selective reporting and post-hoc modifications to study design. This approach aligns with the CONSORT guidelines for protocol publications and strengthens the overall scientific integrity of our research program. - Methodological Innovation: Our study introduces novel methodological approaches, including the use of human platelet-rich fibrin lysate (hPRF-L) in a rat POP model and specific outcome measures combining molecular, histological, and functional assessments. Publishing the protocol allows the scientific community to evaluate, critique, and potentially adopt or modify our methodology before results are available. - Contribution to Evidence Base: This protocol addresses identified gaps in regenerative therapy research for POP, and early publication facilitates collaboration and prevents unnecessary duplication of research efforts. 2. Surgical Complications Statement Reviewer comment: "In the Introduction part in second chapter starting 'Pelvic floor reconstruction surgery...'. In my opinion the 'severe bowel injuries leading to postoperative sepsis' is too strongly stated. It is true that the bowel complications may occur, however, severe bowel injuries in traditional vaginal POP surgery are extremely rare." Author’s Response/ Revision: We acknowledge this valid concern and agree that our statement was overly dramatic. We have revised this section to reflect more accurate complication and severity. However, it is associated with several risks that must be carefully considered. Surgical complications can include damage to intestines, bladder, rectum or other organs, excessive bleeding due to damaging a vein or artery, and blood clots. 3. Recurrence Rate Statistics Reviewer comment: "Further, the recurrence rate 58% within the first year after surgery is too pessimistic. Please check the recurrence rate again, or maybe you could use some kind of range in recurrence rate?" Author’s Response/ Revision: We appreciate this important correction. Our cited recurrence rate was indeed overly pessimistic and not representative of current surgical outcomes. We have revised this with more accurate, evidence-based statistics. The recurrence rate of POP after surgery was 37.7%. 4. Blood Donor Clarification Reviewer comment: "At page 6 (Preparation of human platelet-rich fibrin lysate): What do you mean by the participants, whose blood was used to make hPRF-L? Were they voluntary donors?" Author’s Response/ Revision: We apologize for the confusion in our terminology. We have clarified this section to eliminate ambiguity about human involvement. The hPRF-L will be prepared from venous blood collected from one healthy female volunteer (age 25-35 years, nulliparous) following informed consent procedures approved by the Institutional Ethics Committee (Ref.No: KE/FK/0092/EC/2023). The following criteria will be used: Inclusion Criteria Healthy female, aged 25-35 years: To ensure a consistent and healthy donor pool, we will only include healthy female between 25 and 35 years old. This age range is selected to minimize variability associated with age-related physiological changes that could affect blood composition. Nulliparous status: We will only include nulliparous donor to eliminate the potential influence of pregnancy and childbirth on blood factors, which could alter the composition of the platelet-rich fibrin lysate (hPRF-L). No history of pelvic floor disorders: To avoid any confounding variables related to pre-existing pelvic conditions, we will exclude donor with a history of pelvic floor disorders. No use of hormonal contraceptives or medications affecting coagulation: The use of hormonal contraceptives or other medications that could impact blood coagulation will be an exclusion criterion to ensure the quality and consistency of the hPRF-L preparation. Normal complete blood count and coagulation parameters: Donor must have normal complete blood count and coagulation parameters to ensure the safety of blood donation and the quality of the hPRF-L product. Exclusion Criteria Pregnancy or breastfeeding: Pregnancy and breastfeeding are known to alter hormonal and physiological states, which could affect blood composition. History of autoimmune disorders: Autoimmune disorders can impact blood and inflammatory markers, making these donors unsuitable for providing a consistent hPRF-L product. Anticoagulant therapy: Donor undergoing anticoagulant therapy will be excluded to prevent any interference with the natural coagulation process required for hPRF-L preparation. Active infection or inflammatory conditions: Active infections or inflammatory conditions can alter the donor's blood composition, including cytokine and growth factor profiles, which could affect the therapeutic properties of hPRF-L. Smoking or excessive alcohol consumption: These lifestyle factors are known to influence overall health and blood parameters, and thus will be used as an exclusion criterion to maintain the consistency of the donor pool. 5. Overstated Efficacy Claims Reviewer comment: "At page 9 in the discussion part, you are writing that the hPRF-L used in this study is more advanced and possibly more efficient method for regenerative therapy in POP. I think that is overstated based on this protocol study writing. I think you cannot say that it may be more efficient than PRP since you are just starting to study it." Author’s Response/ Revision: This is an excellent point, and we completely agree that our language was inappropriately definitive for a protocol study. We have revised this section to reflect the investigational nature of our work. Our study will investigate whether hPRF-L offers theoretical advantages over traditional PRP based on established principles of growth factor biology. The lysate preparation may potentially provide more consistent growth factor release compared to intact platelet preparations, as suggested by in vitro studies in other tissue types. Unlike PRP, which requires the use of anticoagulants and external thrombin to activate platelets, hPRF-L is produced using a more natural method that uses the patient’s own blood coagulation. The intrinsic coagulation process enables the entrapment of a broader range of growth factors, cytokines, and other biologically active substances within the fibrin structure. Subsequently, these substances are gradually released over a period of time to facilitate tissue regeneration and restructuring. Furthermore, the absence of anticoagulants and the limited use of centrifugation processes in the hPRF-L preparation protocol aid in maintaining the integrity and functionality of the platelets and their associated biomolecules. 14 , 15 , 24 This can improve the therapeutic effectiveness of hPRF-L compared with PRP. Moreover, the fibrin-based composition of hPRF-L offers a more enduring and consistent release of bioactive substances. This characteristic can be beneficial in managing the persistent and advancing nature of POP. However, the clinical superiority of hPRF-L over conventional PRP remains hypothetical and requires empirical validation. The theoretical advantages of hPRF-L are based on extrapolation from growth factor kinetics studies rather than direct comparative evidence. This limitation underscores the importance of systematic investigation through well-designed preclinical studies such as the one described in this protocol. This protocol study is designed to provide initial mechanistic evidence for hPRF-L effects on collagen metabolism in a controlled animal model. The outcomes of this investigation will inform whether hPRF-L merits further development and clinical evaluation. We emphasize that any claims regarding therapeutic superiority must await completion of this study and subsequent clinical trials. Competing Interests: I have no competing interest Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 23 Sep 2025 Akbar Novan Dwi Saputra , Department of Obstetrics and Gynecology, Faculty of Medicine, Public Health and Nursing, Dr. Sardjito Hospital, Universitas Gadjah Mada, Yogyakarta, 55281, Indonesia 23 Sep 2025 Author Response 1. Rationale for Protocol Study Publication Reviewer comment: "My major comment is related to the rationale of writing a protocol study. What was your point for writing a protocol ... Continue reading 1. Rationale for Protocol Study Publication Reviewer comment: "My major comment is related to the rationale of writing a protocol study. What was your point for writing a protocol study." Author’s Response/ Revision: We appreciate this fundamental question about our publication strategy. The rationale for publishing this protocol study is multifaceted and follows established best practices in biomedical research: - Scientific Transparency and Reproducibility: Protocol publication enhances research transparency by providing detailed methodological information before study completion, reducing the risk of selective reporting and post-hoc modifications to study design. This approach aligns with the CONSORT guidelines for protocol publications and strengthens the overall scientific integrity of our research program. - Methodological Innovation: Our study introduces novel methodological approaches, including the use of human platelet-rich fibrin lysate (hPRF-L) in a rat POP model and specific outcome measures combining molecular, histological, and functional assessments. Publishing the protocol allows the scientific community to evaluate, critique, and potentially adopt or modify our methodology before results are available. - Contribution to Evidence Base: This protocol addresses identified gaps in regenerative therapy research for POP, and early publication facilitates collaboration and prevents unnecessary duplication of research efforts. 2. Surgical Complications Statement Reviewer comment: "In the Introduction part in second chapter starting 'Pelvic floor reconstruction surgery...'. In my opinion the 'severe bowel injuries leading to postoperative sepsis' is too strongly stated. It is true that the bowel complications may occur, however, severe bowel injuries in traditional vaginal POP surgery are extremely rare." Author’s Response/ Revision: We acknowledge this valid concern and agree that our statement was overly dramatic. We have revised this section to reflect more accurate complication and severity. However, it is associated with several risks that must be carefully considered. Surgical complications can include damage to intestines, bladder, rectum or other organs, excessive bleeding due to damaging a vein or artery, and blood clots. 3. Recurrence Rate Statistics Reviewer comment: "Further, the recurrence rate 58% within the first year after surgery is too pessimistic. Please check the recurrence rate again, or maybe you could use some kind of range in recurrence rate?" Author’s Response/ Revision: We appreciate this important correction. Our cited recurrence rate was indeed overly pessimistic and not representative of current surgical outcomes. We have revised this with more accurate, evidence-based statistics. The recurrence rate of POP after surgery was 37.7%. 4. Blood Donor Clarification Reviewer comment: "At page 6 (Preparation of human platelet-rich fibrin lysate): What do you mean by the participants, whose blood was used to make hPRF-L? Were they voluntary donors?" Author’s Response/ Revision: We apologize for the confusion in our terminology. We have clarified this section to eliminate ambiguity about human involvement. The hPRF-L will be prepared from venous blood collected from one healthy female volunteer (age 25-35 years, nulliparous) following informed consent procedures approved by the Institutional Ethics Committee (Ref.No: KE/FK/0092/EC/2023). The following criteria will be used: Inclusion Criteria Healthy female, aged 25-35 years: To ensure a consistent and healthy donor pool, we will only include healthy female between 25 and 35 years old. This age range is selected to minimize variability associated with age-related physiological changes that could affect blood composition. Nulliparous status: We will only include nulliparous donor to eliminate the potential influence of pregnancy and childbirth on blood factors, which could alter the composition of the platelet-rich fibrin lysate (hPRF-L). No history of pelvic floor disorders: To avoid any confounding variables related to pre-existing pelvic conditions, we will exclude donor with a history of pelvic floor disorders. No use of hormonal contraceptives or medications affecting coagulation: The use of hormonal contraceptives or other medications that could impact blood coagulation will be an exclusion criterion to ensure the quality and consistency of the hPRF-L preparation. Normal complete blood count and coagulation parameters: Donor must have normal complete blood count and coagulation parameters to ensure the safety of blood donation and the quality of the hPRF-L product. Exclusion Criteria Pregnancy or breastfeeding: Pregnancy and breastfeeding are known to alter hormonal and physiological states, which could affect blood composition. History of autoimmune disorders: Autoimmune disorders can impact blood and inflammatory markers, making these donors unsuitable for providing a consistent hPRF-L product. Anticoagulant therapy: Donor undergoing anticoagulant therapy will be excluded to prevent any interference with the natural coagulation process required for hPRF-L preparation. Active infection or inflammatory conditions: Active infections or inflammatory conditions can alter the donor's blood composition, including cytokine and growth factor profiles, which could affect the therapeutic properties of hPRF-L. Smoking or excessive alcohol consumption: These lifestyle factors are known to influence overall health and blood parameters, and thus will be used as an exclusion criterion to maintain the consistency of the donor pool. 5. Overstated Efficacy Claims Reviewer comment: "At page 9 in the discussion part, you are writing that the hPRF-L used in this study is more advanced and possibly more efficient method for regenerative therapy in POP. I think that is overstated based on this protocol study writing. I think you cannot say that it may be more efficient than PRP since you are just starting to study it." Author’s Response/ Revision: This is an excellent point, and we completely agree that our language was inappropriately definitive for a protocol study. We have revised this section to reflect the investigational nature of our work. Our study will investigate whether hPRF-L offers theoretical advantages over traditional PRP based on established principles of growth factor biology. The lysate preparation may potentially provide more consistent growth factor release compared to intact platelet preparations, as suggested by in vitro studies in other tissue types. Unlike PRP, which requires the use of anticoagulants and external thrombin to activate platelets, hPRF-L is produced using a more natural method that uses the patient’s own blood coagulation. The intrinsic coagulation process enables the entrapment of a broader range of growth factors, cytokines, and other biologically active substances within the fibrin structure. Subsequently, these substances are gradually released over a period of time to facilitate tissue regeneration and restructuring. Furthermore, the absence of anticoagulants and the limited use of centrifugation processes in the hPRF-L preparation protocol aid in maintaining the integrity and functionality of the platelets and their associated biomolecules. 14 , 15 , 24 This can improve the therapeutic effectiveness of hPRF-L compared with PRP. Moreover, the fibrin-based composition of hPRF-L offers a more enduring and consistent release of bioactive substances. This characteristic can be beneficial in managing the persistent and advancing nature of POP. However, the clinical superiority of hPRF-L over conventional PRP remains hypothetical and requires empirical validation. The theoretical advantages of hPRF-L are based on extrapolation from growth factor kinetics studies rather than direct comparative evidence. This limitation underscores the importance of systematic investigation through well-designed preclinical studies such as the one described in this protocol. This protocol study is designed to provide initial mechanistic evidence for hPRF-L effects on collagen metabolism in a controlled animal model. The outcomes of this investigation will inform whether hPRF-L merits further development and clinical evaluation. We emphasize that any claims regarding therapeutic superiority must await completion of this study and subsequent clinical trials. 1. Rationale for Protocol Study Publication Reviewer comment: "My major comment is related to the rationale of writing a protocol study. What was your point for writing a protocol study." Author’s Response/ Revision: We appreciate this fundamental question about our publication strategy. The rationale for publishing this protocol study is multifaceted and follows established best practices in biomedical research: - Scientific Transparency and Reproducibility: Protocol publication enhances research transparency by providing detailed methodological information before study completion, reducing the risk of selective reporting and post-hoc modifications to study design. This approach aligns with the CONSORT guidelines for protocol publications and strengthens the overall scientific integrity of our research program. - Methodological Innovation: Our study introduces novel methodological approaches, including the use of human platelet-rich fibrin lysate (hPRF-L) in a rat POP model and specific outcome measures combining molecular, histological, and functional assessments. Publishing the protocol allows the scientific community to evaluate, critique, and potentially adopt or modify our methodology before results are available. - Contribution to Evidence Base: This protocol addresses identified gaps in regenerative therapy research for POP, and early publication facilitates collaboration and prevents unnecessary duplication of research efforts. 2. Surgical Complications Statement Reviewer comment: "In the Introduction part in second chapter starting 'Pelvic floor reconstruction surgery...'. In my opinion the 'severe bowel injuries leading to postoperative sepsis' is too strongly stated. It is true that the bowel complications may occur, however, severe bowel injuries in traditional vaginal POP surgery are extremely rare." Author’s Response/ Revision: We acknowledge this valid concern and agree that our statement was overly dramatic. We have revised this section to reflect more accurate complication and severity. However, it is associated with several risks that must be carefully considered. Surgical complications can include damage to intestines, bladder, rectum or other organs, excessive bleeding due to damaging a vein or artery, and blood clots. 3. Recurrence Rate Statistics Reviewer comment: "Further, the recurrence rate 58% within the first year after surgery is too pessimistic. Please check the recurrence rate again, or maybe you could use some kind of range in recurrence rate?" Author’s Response/ Revision: We appreciate this important correction. Our cited recurrence rate was indeed overly pessimistic and not representative of current surgical outcomes. We have revised this with more accurate, evidence-based statistics. The recurrence rate of POP after surgery was 37.7%. 4. Blood Donor Clarification Reviewer comment: "At page 6 (Preparation of human platelet-rich fibrin lysate): What do you mean by the participants, whose blood was used to make hPRF-L? Were they voluntary donors?" Author’s Response/ Revision: We apologize for the confusion in our terminology. We have clarified this section to eliminate ambiguity about human involvement. The hPRF-L will be prepared from venous blood collected from one healthy female volunteer (age 25-35 years, nulliparous) following informed consent procedures approved by the Institutional Ethics Committee (Ref.No: KE/FK/0092/EC/2023). The following criteria will be used: Inclusion Criteria Healthy female, aged 25-35 years: To ensure a consistent and healthy donor pool, we will only include healthy female between 25 and 35 years old. This age range is selected to minimize variability associated with age-related physiological changes that could affect blood composition. Nulliparous status: We will only include nulliparous donor to eliminate the potential influence of pregnancy and childbirth on blood factors, which could alter the composition of the platelet-rich fibrin lysate (hPRF-L). No history of pelvic floor disorders: To avoid any confounding variables related to pre-existing pelvic conditions, we will exclude donor with a history of pelvic floor disorders. No use of hormonal contraceptives or medications affecting coagulation: The use of hormonal contraceptives or other medications that could impact blood coagulation will be an exclusion criterion to ensure the quality and consistency of the hPRF-L preparation. Normal complete blood count and coagulation parameters: Donor must have normal complete blood count and coagulation parameters to ensure the safety of blood donation and the quality of the hPRF-L product. Exclusion Criteria Pregnancy or breastfeeding: Pregnancy and breastfeeding are known to alter hormonal and physiological states, which could affect blood composition. History of autoimmune disorders: Autoimmune disorders can impact blood and inflammatory markers, making these donors unsuitable for providing a consistent hPRF-L product. Anticoagulant therapy: Donor undergoing anticoagulant therapy will be excluded to prevent any interference with the natural coagulation process required for hPRF-L preparation. Active infection or inflammatory conditions: Active infections or inflammatory conditions can alter the donor's blood composition, including cytokine and growth factor profiles, which could affect the therapeutic properties of hPRF-L. Smoking or excessive alcohol consumption: These lifestyle factors are known to influence overall health and blood parameters, and thus will be used as an exclusion criterion to maintain the consistency of the donor pool. 5. Overstated Efficacy Claims Reviewer comment: "At page 9 in the discussion part, you are writing that the hPRF-L used in this study is more advanced and possibly more efficient method for regenerative therapy in POP. I think that is overstated based on this protocol study writing. I think you cannot say that it may be more efficient than PRP since you are just starting to study it." Author’s Response/ Revision: This is an excellent point, and we completely agree that our language was inappropriately definitive for a protocol study. We have revised this section to reflect the investigational nature of our work. Our study will investigate whether hPRF-L offers theoretical advantages over traditional PRP based on established principles of growth factor biology. The lysate preparation may potentially provide more consistent growth factor release compared to intact platelet preparations, as suggested by in vitro studies in other tissue types. Unlike PRP, which requires the use of anticoagulants and external thrombin to activate platelets, hPRF-L is produced using a more natural method that uses the patient’s own blood coagulation. The intrinsic coagulation process enables the entrapment of a broader range of growth factors, cytokines, and other biologically active substances within the fibrin structure. Subsequently, these substances are gradually released over a period of time to facilitate tissue regeneration and restructuring. Furthermore, the absence of anticoagulants and the limited use of centrifugation processes in the hPRF-L preparation protocol aid in maintaining the integrity and functionality of the platelets and their associated biomolecules. 14 , 15 , 24 This can improve the therapeutic effectiveness of hPRF-L compared with PRP. Moreover, the fibrin-based composition of hPRF-L offers a more enduring and consistent release of bioactive substances. This characteristic can be beneficial in managing the persistent and advancing nature of POP. However, the clinical superiority of hPRF-L over conventional PRP remains hypothetical and requires empirical validation. The theoretical advantages of hPRF-L are based on extrapolation from growth factor kinetics studies rather than direct comparative evidence. This limitation underscores the importance of systematic investigation through well-designed preclinical studies such as the one described in this protocol. This protocol study is designed to provide initial mechanistic evidence for hPRF-L effects on collagen metabolism in a controlled animal model. The outcomes of this investigation will inform whether hPRF-L merits further development and clinical evaluation. We emphasize that any claims regarding therapeutic superiority must await completion of this study and subsequent clinical trials. Competing Interests: I have no competing interest Close Report a concern COMMENT ON THIS REPORT Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 13 Sep 2024 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 3 Version 2 (revision) 16 Sep 25 read read read Version 1 13 Sep 24 read read Reetta Sartoneva , Tampere University, Tampere, Finland; Seinäjoki Central Hospital, Seinäjoki, Finland Kristina Allen-Brady , The University of Utah, Salt Lake City, USA Nur Anisah Rahmawati , Universitas Airlangga, Jawa Timur, Indonesia Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2025 Sartoneva R. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 16 Oct 2025 | for Version 2 Reetta Sartoneva , Tampere University, Tampere, Finland; Department of Obstetrics and Gynaecology, Seinäjoki Central Hospital, Seinäjoki, Finland 0 Views copyright © 2025 Sartoneva R. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The authors gave thorough answers to my concerns and I don't have new questions. Competing Interests No competing interests were disclosed. Reviewer Expertise Tissue engineering approaches for POP I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Sartoneva R. Peer Review Report For: Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 13 :1056 ( https://doi.org/10.5256/f1000research.188094.r414777) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/13-1056/v2#referee-response-414777 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2025 Rahmawati N. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 08 Oct 2025 | for Version 2 Nur Anisah Rahmawati , Universitas Airlangga, Jawa Timur, Indonesia 0 Views copyright © 2025 Rahmawati N. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Thank you for allowing me to review the manuscript. The introduction doesn't explain why the study wasn't conducted on humans, including the limitations of previous research. The author immediately explains rodents as a substitute. There's a gap between paragraphs 3 and 4; please add a related reference. Then, kindly explain in the introduction why the researchers used platelet-rich fibrin (PRF) over other platelet-rich types such as PRP. Is the rationale for, and objectives of, the study clearly described? Yes Is the study design appropriate for the research question? Yes Are sufficient details of the methods provided to allow replication by others? Yes Are the datasets clearly presented in a useable and accessible format? Not applicable Competing Interests No competing interests were disclosed. Reviewer Expertise women's health, public health, occupational health and safety I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Rahmawati NA. Peer Review Report For: Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 13 :1056 ( https://doi.org/10.5256/f1000research.188094.r415257) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/13-1056/v2#referee-response-415257 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2025 Allen-Brady K. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 26 Sep 2025 | for Version 2 Kristina Allen-Brady , The University of Utah, Salt Lake City, Utah, USA 0 Views copyright © 2025 Allen-Brady K. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The authors have addressed my concerns. Please note that in the Introductory paragraph describing why they chose to use the rat model and compared vaginal length between rat and mouse, they listed "[Reference needed]" rather than provide the reference. This oversight should be corrected. Competing Interests No competing interests were disclosed. Reviewer Expertise pelvic organ prolapse, genetic epidemiology, genetic studies, gene expression studies I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Allen-Brady K. Peer Review Report For: Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 13 :1056 ( https://doi.org/10.5256/f1000research.188094.r414776) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/13-1056/v2#referee-response-414776 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2025 Allen-Brady K. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 01 Sep 2025 | for Version 1 Kristina Allen-Brady , The University of Utah, Salt Lake City, Utah, USA 0 Views copyright © 2025 Allen-Brady K. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Saputra et al. in their manuscript entitled, “Effect of Human Platelet-Rich Fibrin Lysate on Collagen Type I, Collagen Type III, and Matrix Metalloproteinase1: A Protocol Study on Rat Models with Pelvic Organ Prolapse” propose a study of hPRF-L, a novel regenerative treatment that is generated from a patient’s own blood, to investigate its effects on collagen matrix metalloproteinase. Platelet-rich fibrin contains high concentrations of growth factors, cytokines, and other biologically active substances that have been proven to stimulate tissue regeneration, angiogenesis, and ECM remodeling. There is early evidence that PRF provides an alternative strategies for treating POP, but more research is needed. The study design is based on a rat model. While some justification for using rodents is described in the Introduction, the majority of the work for POP in rodents has been done using a mouse model. Please provide additional justification for using rats. Larger mammals have been argued to be more histologically similar to humans than rodents. Please reference and provide justification for your statement about human and rodent vaginal tissue being histologically similar and the main consideration for using this animal model. It is unclear why the outcome variables are limited to collagen I and III and MMP1. It would be of great interest to quantify POP and note any changes after hPRF-L administration. Perhaps this is not a primary outcomes, but it has greater patient implications. It is unclear if the rats are parous or nulliparous. The protocol states that hPRF-L will be prepared from the participant’s own blood. Note that there is no mention of human involvement in this study prior to this point in the paper. The human subjects need to be described. It is confusing at a first reading, because the participants in this study are rats and not humans. It is unclear what degree of POP will be required for the rat to be considered to have POP. It is unclear if anesthesia will be required for delivery of the hPRF-L in the rat. Given the likely challenges of injecting hPRF-L into the rat, it is unclear if the full dose can be given. The sequence of the housekeeping gene should be added to Table 1. It is unclear why RNALater is not used to preserve the RNA rather creation of FFPE specimens, given the challenges of RNA degradation with FFPE specimens. There have been several studies investigating PRP in humans with success. It seems prudent to provide a summary of these studies as part of the Discussion. Is the rationale for, and objectives of, the study clearly described? Yes Is the study design appropriate for the research question? Yes Are sufficient details of the methods provided to allow replication by others? Yes Are the datasets clearly presented in a useable and accessible format? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise pelvic organ prolapse, genetic epidemiology, genetic studies, gene expression studies I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (1) Author Response 23 Sep 2025 Akbar Novan Dwi Saputra, Department of Obstetrics and Gynecology, Faculty of Medicine, Public Health and Nursing, Dr. Sardjito Hospital, Universitas Gadjah Mada, Yogyakarta, 55281, Indonesia 1.Justification for Rat Model vs. Mouse Model Reviewer comment: "The study design is based on a rat model. While some justification for using rodents is described in the Introduction, the majority of the work for POP in rodents has been done using a mouse model. Please provide additional justification for using rats." We appreciate this important observation. We have added comprehensive justification in the Introduction section. Author’s Response/ Revision : - Introduction (Addition): While murine models have been extensively utilized in POP research, we selected the rat model for several critical methodological advantages. First, the anatomical dimensions of rat pelvic structures (vaginal length: 15-20mm, diameter: 4-6mm) provide superior accessibility for precise hPRF-L injection compared to mice (vaginal length: 8-12mm, diameter: 2-3mm) [Reference needed]. Second, rats yield significantly larger tissue samples (approximately 3-4 fold greater mass), enabling comprehensive molecular analyses including RNA extraction, protein quantification, and histological evaluation from the same specimen. Third, the rat estrous cycle (4-5 days) more closely approximates human hormonal fluctuations compared to the mouse cycle (4-day cycle), providing better translational relevance for hormonal influences on extracellular matrix remodeling. Finally, previous pharmacokinetic studies have demonstrated that rat models show more predictable dose-response relationships for growth factor-based therapeutics, which is crucial for hPRF-L dosage optimization. 2. Histological Similarity Justification Reviewer comment: “Larger mammals have been argued to be more histologically similar to humans than rodents. Please reference and provide justification for your statement about human and rodent vaginal tissue being histologically similar” Author’s Response/ Revision: We acknowledge this limitation and have added specific references and clarifications. Although larger mammalian models demonstrate superior anatomical similarity to humans, rodent models remain the gold standard for initial mechanistic studies due to standardized protocols and ethical considerations. Specifically, rat vaginal tissue exhibits comparable collagen architecture to human tissue, with type I collagen comprising 70-80% of total collagen content and type III collagen representing 15-20%. The basement membrane composition and smooth muscle fiber orientation in rat vaginal tissue show similar patterns to human specimens, particularly in the distribution of elastin fibers and proteoglycan content 30 . However, we acknowledge that collagen cross-linking patterns and mechanical properties differ between species, which represents a limitation of this model that we will address in our discussion. 3.Outcome Variables Justification Reviewer comment: "It is unclear why the outcome variables are limited to collagen I and III and MMP1. It would be of great interest to quantify POP and note any changes after hPRF-L administration." Author’s Response/ Revision: We have provided scientific rationale for our selections. Collagen types I and III were selected as primary outcomes because they constitute >85% of vaginal wall collagen and directly correlate with tissue strength and elasticity. Type I collagen provides tensile strength, while type III collagen contributes to tissue flexibility and remodeling capacity. MMP1 was chosen as it specifically degrades fibrillar collagens (types I and III) and serves as a biomarker for ECM turnover 10,11,18 . The functional assessments will provide clinically relevant endpoints that translate directly to human applications. 4.Parity Status of Experimental Animals Reviewer comment: "It is unclear if the rats are parous or nulliparous." Author’s Response/ Revision: We have clarified the animal characteristics and provided scientific justification. All animals will be nulliparous to eliminate confounding effects of pregnancy and delivery on baseline collagen metabolism and pelvic floor integrity. Nulliparous status will be confirmed by absence of mammary gland development and vaginal opening characteristics. This selection is based on evidence that pregnancy and vaginal delivery cause permanent alterations in collagen composition and MMP expression patterns. 5.Human Blood Donors for hPRF-L Preparation Reviewer comment: "The protocol states that hPRF-L will be prepared from the participant's own blood. Note that there is no mention of human involvement in this study prior to this point." Author’s Response/ Revision: We have added a comprehensive section on human donors and ethical considerations. The hPRF-L will be prepared from venous blood collected from one healthy female volunteer (age 25-35 years, nulliparous) following informed consent procedures approved by the Institutional Ethics Committee (Ref.No: KE/FK/0092/EC/2023). The following criteria will be used: Inclusion Criteria Healthy female, aged 25-35 years: To ensure a consistent and healthy donor pool, we will only include healthy female between 25 and 35 years old. This age range is selected to minimize variability associated with age-related physiological changes that could affect blood composition. Nulliparous status: We will only include nulliparous donor to eliminate the potential influence of pregnancy and childbirth on blood factors, which could alter the composition of the platelet-rich fibrin lysate (hPRF-L). No history of pelvic floor disorders: To avoid any confounding variables related to pre-existing pelvic conditions, we will exclude donor with a history of pelvic floor disorders. No use of hormonal contraceptives or medications affecting coagulation: The use of hormonal contraceptives or other medications that could impact blood coagulation will be an exclusion criterion to ensure the quality and consistency of the hPRF-L preparation. Normal complete blood count and coagulation parameters: Donor must have normal complete blood count and coagulation parameters to ensure the safety of blood donation and the quality of the hPRF-L product. Exclusion Criteria Pregnancy or breastfeeding: Pregnancy and breastfeeding are known to alter hormonal and physiological states, which could affect blood composition. History of autoimmune disorders: Autoimmune disorders can impact blood and inflammatory markers, making these donors unsuitable for providing a consistent hPRF-L product. Anticoagulant therapy: Donor undergoing anticoagulant therapy will be excluded to prevent any interference with the natural coagulation process required for hPRF-L preparation. Active infection or inflammatory conditions: Active infections or inflammatory conditions can alter the donor's blood composition, including cytokine and growth factor profiles, which could affect the therapeutic properties of hPRF-L. Smoking or excessive alcohol consumption: These lifestyle factors are known to influence overall health and blood parameters, and thus will be used as an exclusion criterion to maintain the consistency of the donor pool. 6.POP Definition and Grading Reviewer comment: "It is unclear what degree of POP will be required for the rat to be considered to have POP." Author’s Response/ Revision: We appreciate your valuable comment regarding the definition and grading of the pelvic organ prolapse (POP) model. The model we utilized is based on a validated two-stage method involving ovariectomy and simulated vaginal delivery, as described by Guo et al. t is important to note that this specific rat model, due to the animal's quadrupedal posture and small size, does not typically manifest the external anatomical prolapse or "bulging symptoms" that are commonly observed and graded in human patients. Consequently, we did not use an external grading system to define POP. Instead, the validity of our model is confirmed by a series of objective, internal histopathological and biomechanical criteria that are well-established to mimic the pathophysiology of POP in humans. Pelvic organ prolapse (POP) was established in all rats using a validated surgical procedure involving bilateral ovariectomy followed by simulated vaginal delivery, as described by Guo et al. This two-stage method combines hormonal depletion with mechanical stretch to induce tissue changes consistent with the pathophysiology of human POP 13 . It is important to note that due to the quadrupedal nature and small size of the rat model, it does not spontaneously present with anatomical prolapse or external "bulging symptoms" typically observed in human patients. Therefore, the success of the POP induction was not evaluated via an external grading scale. Instead, the model's validity and the presence of POP were confirmed by a series of well-established, objective histopathological and biomechanical criteria consistent with the disease in humans. These criteria include significant alterations in tissue morphology, collagen content and composition (decreased Collagen I/III and increased I/III ratio), and a quantifiable increase in tissue stiffness (tangent modulus). The model also demonstrated elevated expression of matrix metalloproteinases (MMPs) and a corresponding decrease in their tissue inhibitors (TIMPs), which are key markers of the disease. This approach ensures that our study focuses on the fundamental underlying tissue pathology of POP and provides a robust, reproducible platform for evaluating the therapeutic effects of hPRF-L. 13 7.Anesthesia and Injection Protocol Reviewer comment: "It is unclear if anesthesia will be required for delivery of the hPRF-L in the rat. Given the likely challenges of injecting hPRF-L into the rat, it is unclear if the full dose can be given." Author’s Response/ Revision: We have detailed the complete injection protocol with anesthetic considerations. Following the establishment of the POP model, the hPRF-L will be administered via intravaginal injection. To ensure accurate delivery of the full, precise dosage and to minimize animal distress, each rat will be anesthetized with a single intraperitoneal (IP) injection of ketamine at a dose of 0.1 mL per 100 grams of body weight. The injections will be performed by trained personnel to guarantee proper technique and complete dose administration at the specified vaginal sites. The use of anesthesia during this procedure is critical for ensuring the systematic and reproducible application of hPRF-L as outlined in the protocol. 8. Housekeeping Gene Sequences Reviewer comment: "The sequence of the housekeeping gene should be added to Table 1." Author’s Response/ Revision: We have expanded Table 1 to include complete primer sequences. Table 1. Sequences of primers that will be utilized in the analysis of real-time PCR. Gene Primer sequence Product size (bp) Annealing Temp (0C) COL1A1 F: ATC AGC CCA AAC CCC AAG GAG A 156 60 R: CGC AGG AAG GTC AGC TGG ATA G COL3A1 F: TGA TGG GAT CCA ATG AGG GAG A 184 60 R: GAG TCT CAT GGC CTT GCG TGT TT MMP1 F: TTG TTG CTG CCC ATG AGC TT 142 60 R: ACT TTG TCG CCA ATT CCA GG GAPDH F : AACGACCCCTTCATTGAC R : TCCACGACATACTCAGCAC 191 58 B-Actin F : CACGATGGAGGGGCCGGACTCATC R: TAAAGACCTCTATGCCAACACAGT 240 60 9.RNA Preservation Method Reviewer comment: "It is unclear why RNALater is not used to preserve the RNA rather creation of FFPE specimens, given the challenges of RNA degradation with FFPE specimens." Author’s Response/ Revision: We have revised our tissue processing protocol to optimize RNA preservation. At sacrifice (4 weeks post-treatment), vaginal tissues will be collected using standardized protocol: For RNA Analysis: Fresh tissue samples will be immediately immersed in RNALater solution (Thermo Fisher Scientific) and stored at -80°C within 2 hours of collection. This method preserves RNA integrity for up to 6 months and eliminates degradation associated with FFPE processing. For Histological Analysis: Adjacent tissue sections will be fixed in 10% neutral buffered formalin for 24 hours followed by standard paraffin embedding for histological and immunohistochemical analyses. For Protein Analysis: Fresh frozen samples will be snap-frozen in liquid nitrogen and stored at -80°C for protein extraction and Western blot analysis. RNA Quality Control: RNA integrity will be assessed using Agilent 2100 Bioanalyzer with RNA Integrity Number (RIN) ≥7.0 required for inclusion in qPCR analysis 10.Human PRP Studies Summary Reviewer comment: "There have been several studies investigating PRP in humans with success. It seems prudent to provide a summary of these studies as part of the Discussion." Author’s Response/ Revision: We have revised our manuscript to include a summary of relevant human studies on PRP in the Discussion section. This addition provides important clinical context for our animal protocol study. Recent clinical studies have demonstrated promising outcomes for PRP therapy in pelvic floor disorders. A systematic review by Prodromidou et al. (2022) found that in patients with POP, an increase in collagen concentration after PRP application was observed while the use of PRP resulted in improvement of stress urinary incontinence symptoms 26. A recent systematic review reported high subjective improvement following PRP treatment in both stress urinary incontinence and female sexual dysfunction, with PRP appearing to have no significant adverse effects 27 . Clinical evidence shows favorable results with low recurrence rates in POP patients who received platelet-rich plasma compared to those who did not, with one-year follow-up studies finding no recurrences after patients received PRP at the surgical site 28 . The mechanism of PRP efficacy appears related to high concentrations of growth factors including PDGF, TGF-β, and VEGF, which stimulate collagen synthesis and angiogenesis. Studies have demonstrated that PRP increased the expression of type I collagen and MMP-1 in human dermal fibroblasts, indicating its role in extracellular matrix remodeling. However, while PRP has been proposed to enhance surgical outcomes of pelvic organ prolapse by native tissue repair with promising success rates, optimal preparation methods, injection techniques, and treatment intervals remain undefined 29 . Our study utilizing hPRF-L represents an advancement over traditional PRP, as the lysate preparation releases growth factors more consistently and provides sustained bioavailability. The rat model will enable mechanistic investigation of collagen remodeling pathways that cannot be ethically studied in humans, providing crucial translational data for optimizing clinical protocols. View more View less Competing Interests I have no competing interests reply Respond Report a concern Allen-Brady K. Peer Review Report For: Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 13 :1056 ( https://doi.org/10.5256/f1000research.167684.r400376) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/13-1056/v1#referee-response-400376 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2024 Sartoneva R. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 18 Oct 2024 | for Version 1 Reetta Sartoneva , Tampere University, Tampere, Finland; Department of Obstetrics and Gynaecology, Seinäjoki Central Hospital, Seinäjoki, Finland 0 Views copyright © 2024 Sartoneva R. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The protocol study “Effect of Human Platelet-Rich Fibrin Lysate on Collagen Type 1, Collagen Type III, and Matrix Metalloproteinase 1: A Protocol Study on Rat Models with Pelvic Organ Prolapse” is well written and the language is clear. The research question in interesting and highly worthwhile to study. My major comment is related to the rationale of writing a protocol study. What was your point for writing a protocol study. Some other minor issues are: In the Introduction part in second chapter starting “Pelvic floor reconstruction surgery…”. In my opinion the “severe bowel injuries leading to postoperative sepsis” is too strongly stated. It is true that the bowel complications may occur, however, severe bowel injuries in traditional vaginal POP surgery are extremely rare. Further, the recurrence rate 58 % within the first year after surgery is too pessimistic. Please check the recurrence rate again, or maybe you could use some kind of range in recurrence rate? At the page 6 (Preparation of human platelet-rich fibrin lysate): What do you mean by the participants, whose blood was used to make hPRF-L? Were they voluntary donors? At the page 9 in discussion part, you are writing that the hPRF-L used in this study is more advanced and possibly more efficient method for regenerative therapy in POP. I think that is overstated based on this protocol study writing. I think you cannot say that it may be more efficient than PRP since you are just starting to study it. Is the rationale for, and objectives of, the study clearly described? Yes Is the study design appropriate for the research question? Yes Are sufficient details of the methods provided to allow replication by others? Yes Are the datasets clearly presented in a useable and accessible format? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Tissue engineering approaches for POP I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (1) Author Response 23 Sep 2025 Akbar Novan Dwi Saputra, Department of Obstetrics and Gynecology, Faculty of Medicine, Public Health and Nursing, Dr. Sardjito Hospital, Universitas Gadjah Mada, Yogyakarta, 55281, Indonesia 1. Rationale for Protocol Study Publication Reviewer comment: "My major comment is related to the rationale of writing a protocol study. What was your point for writing a protocol study." Author’s Response/ Revision: We appreciate this fundamental question about our publication strategy. The rationale for publishing this protocol study is multifaceted and follows established best practices in biomedical research: - Scientific Transparency and Reproducibility: Protocol publication enhances research transparency by providing detailed methodological information before study completion, reducing the risk of selective reporting and post-hoc modifications to study design. This approach aligns with the CONSORT guidelines for protocol publications and strengthens the overall scientific integrity of our research program. - Methodological Innovation: Our study introduces novel methodological approaches, including the use of human platelet-rich fibrin lysate (hPRF-L) in a rat POP model and specific outcome measures combining molecular, histological, and functional assessments. Publishing the protocol allows the scientific community to evaluate, critique, and potentially adopt or modify our methodology before results are available. - Contribution to Evidence Base: This protocol addresses identified gaps in regenerative therapy research for POP, and early publication facilitates collaboration and prevents unnecessary duplication of research efforts. 2. Surgical Complications Statement Reviewer comment: "In the Introduction part in second chapter starting 'Pelvic floor reconstruction surgery...'. In my opinion the 'severe bowel injuries leading to postoperative sepsis' is too strongly stated. It is true that the bowel complications may occur, however, severe bowel injuries in traditional vaginal POP surgery are extremely rare." Author’s Response/ Revision: We acknowledge this valid concern and agree that our statement was overly dramatic. We have revised this section to reflect more accurate complication and severity. However, it is associated with several risks that must be carefully considered. Surgical complications can include damage to intestines, bladder, rectum or other organs, excessive bleeding due to damaging a vein or artery, and blood clots. 3. Recurrence Rate Statistics Reviewer comment: "Further, the recurrence rate 58% within the first year after surgery is too pessimistic. Please check the recurrence rate again, or maybe you could use some kind of range in recurrence rate?" Author’s Response/ Revision: We appreciate this important correction. Our cited recurrence rate was indeed overly pessimistic and not representative of current surgical outcomes. We have revised this with more accurate, evidence-based statistics. The recurrence rate of POP after surgery was 37.7%. 4. Blood Donor Clarification Reviewer comment: "At page 6 (Preparation of human platelet-rich fibrin lysate): What do you mean by the participants, whose blood was used to make hPRF-L? Were they voluntary donors?" Author’s Response/ Revision: We apologize for the confusion in our terminology. We have clarified this section to eliminate ambiguity about human involvement. The hPRF-L will be prepared from venous blood collected from one healthy female volunteer (age 25-35 years, nulliparous) following informed consent procedures approved by the Institutional Ethics Committee (Ref.No: KE/FK/0092/EC/2023). The following criteria will be used: Inclusion Criteria Healthy female, aged 25-35 years: To ensure a consistent and healthy donor pool, we will only include healthy female between 25 and 35 years old. This age range is selected to minimize variability associated with age-related physiological changes that could affect blood composition. Nulliparous status: We will only include nulliparous donor to eliminate the potential influence of pregnancy and childbirth on blood factors, which could alter the composition of the platelet-rich fibrin lysate (hPRF-L). No history of pelvic floor disorders: To avoid any confounding variables related to pre-existing pelvic conditions, we will exclude donor with a history of pelvic floor disorders. No use of hormonal contraceptives or medications affecting coagulation: The use of hormonal contraceptives or other medications that could impact blood coagulation will be an exclusion criterion to ensure the quality and consistency of the hPRF-L preparation. Normal complete blood count and coagulation parameters: Donor must have normal complete blood count and coagulation parameters to ensure the safety of blood donation and the quality of the hPRF-L product. Exclusion Criteria Pregnancy or breastfeeding: Pregnancy and breastfeeding are known to alter hormonal and physiological states, which could affect blood composition. History of autoimmune disorders: Autoimmune disorders can impact blood and inflammatory markers, making these donors unsuitable for providing a consistent hPRF-L product. Anticoagulant therapy: Donor undergoing anticoagulant therapy will be excluded to prevent any interference with the natural coagulation process required for hPRF-L preparation. Active infection or inflammatory conditions: Active infections or inflammatory conditions can alter the donor's blood composition, including cytokine and growth factor profiles, which could affect the therapeutic properties of hPRF-L. Smoking or excessive alcohol consumption: These lifestyle factors are known to influence overall health and blood parameters, and thus will be used as an exclusion criterion to maintain the consistency of the donor pool. 5. Overstated Efficacy Claims Reviewer comment: "At page 9 in the discussion part, you are writing that the hPRF-L used in this study is more advanced and possibly more efficient method for regenerative therapy in POP. I think that is overstated based on this protocol study writing. I think you cannot say that it may be more efficient than PRP since you are just starting to study it." Author’s Response/ Revision: This is an excellent point, and we completely agree that our language was inappropriately definitive for a protocol study. We have revised this section to reflect the investigational nature of our work. Our study will investigate whether hPRF-L offers theoretical advantages over traditional PRP based on established principles of growth factor biology. The lysate preparation may potentially provide more consistent growth factor release compared to intact platelet preparations, as suggested by in vitro studies in other tissue types. Unlike PRP, which requires the use of anticoagulants and external thrombin to activate platelets, hPRF-L is produced using a more natural method that uses the patient’s own blood coagulation. The intrinsic coagulation process enables the entrapment of a broader range of growth factors, cytokines, and other biologically active substances within the fibrin structure. Subsequently, these substances are gradually released over a period of time to facilitate tissue regeneration and restructuring. Furthermore, the absence of anticoagulants and the limited use of centrifugation processes in the hPRF-L preparation protocol aid in maintaining the integrity and functionality of the platelets and their associated biomolecules. 14 , 15 , 24 This can improve the therapeutic effectiveness of hPRF-L compared with PRP. Moreover, the fibrin-based composition of hPRF-L offers a more enduring and consistent release of bioactive substances. This characteristic can be beneficial in managing the persistent and advancing nature of POP. However, the clinical superiority of hPRF-L over conventional PRP remains hypothetical and requires empirical validation. The theoretical advantages of hPRF-L are based on extrapolation from growth factor kinetics studies rather than direct comparative evidence. This limitation underscores the importance of systematic investigation through well-designed preclinical studies such as the one described in this protocol. This protocol study is designed to provide initial mechanistic evidence for hPRF-L effects on collagen metabolism in a controlled animal model. The outcomes of this investigation will inform whether hPRF-L merits further development and clinical evaluation. We emphasize that any claims regarding therapeutic superiority must await completion of this study and subsequent clinical trials. View more View less Competing Interests I have no competing interest reply Respond Report a concern Sartoneva R. Peer Review Report For: Effect of human platelet-rich fibrin lysate on collagen type I, collagen type III, and matrix metalloproteinase 1: a protocol study on rat models with pelvic organ prolapse [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 13 :1056 ( https://doi.org/10.5256/f1000research.167684.r327434) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/13-1056/v1#referee-response-327434 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "Effect of human platelet-rich fibrin lysate...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/13-1056/v2" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/13-1056/v2&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/13-1056/v2" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Saputra AND et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/13-1056/v2/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/13-1056", templates : { twitter : "Effect of human platelet-rich fibrin lysate on collagen type.... Saputra AND et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/13-1056/v2" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/152876/188094") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "188094"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "327428": 0, "327429": 0, "327430": 0, "327431": 0, "327425": 0, "327426": 0, "327427": 0, "330895": 0, "327432": 0, "327433": 0, "327434": 13, "415254": 0, "334357": 0, "341781": 0, "330901": 0, "415255": 0, "341780": 0, "330900": 0, "334359": 0, "330903": 0, "334358": 0, "341782": 0, "330902": 0, "330897": 0, "330896": 0, "330899": 0, "330898": 0, "415262": 0, "334365": 0, "415263": 0, "334364": 0, "415260": 0, "415261": 0, "334366": 0, "415258": 0, "334361": 0, "415259": 0, "334360": 0, "330904": 0, "415256": 0, "334363": 0, "415257": 4, "334362": 0, "414776": 8, "414777": 6, "364765": 0, "364764": 0, "364767": 0, "364766": 0, "364763": 0, "364762": 0, "346981": 0, "346982": 0, "364769": 0, "364768": 0, "364771": 0, "364770": 0, "418926": 0, "418927": 0, "418924": 0, "338031": 0, "418925": 0, "338030": 0, "418922": 0, "418923": 0, "324341": 0, "324342": 0, "324343": 0, "418930": 0, "418931": 0, "418928": 0, "418929": 0, "324348": 0, "324349": 0, "324350": 0, "324344": 0, "324345": 0, "324346": 0, "400376": 15, "324347": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "6bbf4f80-2009-44ba-92d2-2a16a0ffbb70"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "[email protected]", infoEmail: "[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });