Antitumor Immunotoxin Activity is Enhanced by Escherichia coli csrB-Promoter Expression

Antitumor Immunotoxin Activity is Enhanced by Escherichia coli csrB-Promoter Expression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Antitumor Immunotoxin Activity is Enhanced by Escherichia coli csrB-Promoter Expression Seyeon Hong, Sung-Gwon Lee, Dogeun Lee, Jihyeon Kim, Miryoung Song, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7854761/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Cancer treatment is often hindered by tumor complexity, treatment resistance, and off-target toxicity. Bacterial oncotherapy offers a promising alternative, using tumor-targeting bacteria to deliver cytotoxins that selectively induce cancer-cell apoptosis while sparing healthy tissue. However, this approach is limited by its reliance on exogenous inducers to activate anticancer agents. To address this, we engineered a bacterial platform using the tumor-specific csrB promoter, activated by the acetate-rich tumor microenvironment, to selectively induce immunotoxins without external cues. Methods Acetate concentrations within CT26 tumors were quantified to assess tumor-specific metabolic enrichment. Transcriptomic profiling of tumor-colonizing Escherichia coli was performed by RNA sequencing to identify promoters responsive to the tumor microenvironment, identifying csrB . This promoter region was cloned into an expression vector to drive the production of a recombinant immunotoxin, TGFα–PE38, comprising TGFα, Pseudomonas exotoxin A (PE38), and a secretion tag. Promoter activity was characterized by qPCR and a β-galactosidase reporter assay under varying acetate levels. Cytotoxicity was evaluated in vitro using supernatants from the engineered bacteria. CT26-bearing BALB/c mice were intravenously administered with the engineered bacteria, and tumor growth and survival were monitored. To explore mechanisms underlying survival gain, tumor cytokine dynamics and apoptosis-related gene expression were analyzed. Results csrB , encoding a small regulatory RNA, was highly upregulated in a tumor-specific manner. Genes under csrB control participate in acetate metabolism, which is enriched in tumors. qPCR of in vitro cultures showed that csrB expression depended on acetate levels, with the csrB promoter driving acetate-responsive β-galactosidase expression. The csrB promoter regulated expression of the TGFα–PE38 recombinant immunotoxin. Under csrB control, this immunotoxin was strongly expressed in the presence of acetate, persisting in the tumors of CT26-bearing mice treated with E. coli expressing this immunotoxin. Application of the bacterial-culture supernatant reduced tumor-cell viability, markedly suppressing tumor growth and extending survival. This demonstrates that the csrB promoter is ideal for use in auto-inducing therapeutic platforms in bacterial oncotherapy. Conclusions These findings highlight the ability of tumor-colonizing bacteria to sense tumor conditions and alter antitumor protein expression, thus potentially improving outcomes in oncotherapy. Bacterial oncotherapy tumor microenvironment immunotoxin csrB precision therapy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 INTRODUCTION Developing effective cancer treatment remains challenging owing to limitations in existing approaches [ 1 ], and traditional chemotherapy lacks specificity, resulting in systemic toxicity, immunosuppression, and organ damage [ 2 , 3 ]. Immunotherapy, although more targeted, can be compromised by tumor-driven immune invasion and off-target immune activation, diminishing effectiveness [ 4 ]. Recombinant immunotoxins, in contrast, combine targeted oncotherapy with potent cytotoxic effects, offering a promising solution that addresses the shortcomings of nonspecific treatments like chemotherapy. These agents comprise a cancer-targeting moiety (such as a monoclonal antibody fragment, cytokine, or growth factor) linked to a cytotoxic protein [ 6 ], enabling precise tumor-targeting while minimizing off-target effects [ 7 ]. A key principle of this strategy is the selective delivery of toxins to cancer cells, mediated by the targeting component, enabling their precise destruction [ 8 ]. Most tumor cells arise from mutations in growth factor receptors, with epidermal growth factor receptor (EGFR) overexpression being central to cancer progression [ 9 ]. The recombinant immunotoxin TGFα–PE38 (hereafter, “TP”) addresses this by combining transforming growth factor alpha (TGFα), a potent EGFR agonist, with PE38, a modified version of Pseudomonas exotoxin A [ 10 ]. TP specifically targets EGFR-expressing tumors, utilizing TGFα to bind to EGFR and delivering PE38, which disrupts protein synthesis in mammalian cells, thereby inducing cancer-cell death [ 11 ]. Immunotoxins, including TP, offer various benefits: they exhibit high specificity for cancer cells; they reduce collateral damage and systemic toxicity [ 12 , 13 ]; and their modular design supports their broad applicability across cancer types [ 14 – 16 ]. Despite these benefits, the application of immunotoxins remains challenging, first because their limited in vivo stability necessitates their repeated administration [ 17 ], and second because immune responses lead to the development of neutralizing antibodies, compromising their effectiveness [ 18 ]. Bacterial oncotherapy has emerged as an innovative approach to overcome these challenges [ 19 ]. Tumor-targeting bacteria thrive in the hypoxic and nutrient-deprived conditions within the tumor microenvironment (TME), where they selectively replicate within tumors, thus amplifying their therapeutic effects [ 20 – 22 ]. Bacteria can enhance antitumor immunity by modulating the immune microenvironment and promoting immune-cell recruitment [ 23 ]. Importantly, bacteria can serve as a platform for immunotoxin delivery, addressing stability- and delivery-related issues associated with protein-based therapies [ 19 , 24 – 26 ]. However, bacterial oncotherapy is limited by its reliance on exogenous signals, such as inducers like L-arabinose, to regulate gene expression [ 27 , 28 ]. However, continuous administration of such inducers is impractical, limiting the clinical feasibility of bacterial oncotherapy [ 29 ]. To address this, researchers are exploring auto-inducing systems that leverage endogenous signals present in the TME, providing a more sustainable and effective method for regulating therapeutic protein expression. The TME exhibits distinct metabolic characteristics, including the accumulation of metabolites such as lactate and acetate [ 30 ]. Acetate, a key metabolite in bacterial metabolism and precursor for acetyl-CoA production, activates the BarA/UvrY bacterial two-component regulatory system in acetate-rich environments [ 31 – 33 ]. BarA/UvrY detects acetate as a signal, triggering a cascade that upregulates the csrB promoter and enables sustained gene expression [ 34 ]. This system is crucial for bacterial adaptation in diverse conditions, as it regulates gene expression in response to environmental signals [ 35 ]. Within the TME, competition for nutrients between tumor and immune cells leads to nutrient depletion, further upregulating csrB [ 36 – 38 ]. Acetate, which is particularly abundant in the TME, is a significant signal for BarA activation [ 33 ]. Upon detecting acetate, BarA autophosphorylates and transfers a phosphate group to UvrY [ 39 ]. The phosphorylated UvrY then binds to the csrB promoter, significantly enhancing its transcription and regulating bacterial gene expression, allowing cellular responses to acetate and potentially influencing tumor-specific adaptation [ 40 , 41 ]. Building on these insights, this study aims to utilize the csrB promoter to develop an autoinducer-based expression platform for bacterial oncotherapy. By exploiting the ability of bacteria to sense and respond to acetate in the TME, this platform overcomes the limitations imposed by the need for exogenous inducers. In bacterial oncotherapy, this versatile platform, adapted to the dynamic metabolic conditions of tumors, enables tumor-specific, sustained immunotoxin expression, offering a robust and adaptable approach for precise therapeutic delivery. MATERIALS AND METHODS Bacterial strains and plasmids The bacterial strains and plasmids used here are listed in Table 1 . The wild-type strain, E. coli K-12 MG1655, was cultured in Luria–Bertani (LB) broth with high salt content (MB Cell, Republic of Korea; MB-L4488). The P csrB -lacZY plasmid was constructed using the Gibson assembly protocol. csrB contains a promoter region and an open reading frame. The csrB promoter, which contains Fis-binding sites within the upstream activation region (− 300 to + 100 bp, relative to the GTG start codon), was amplified from the chromosome of E. coli K-12 MG1655 and cloned into the pRS415 vector to create a transcriptional lacZY reporter plasmid. The P csrB –psp–TP plasmid was assembled using the Gibson Assembly Master Mix (New England Biolabs, Ipswich, MA; M5510AA). The csrB promoter segment was amplified from the chromosome of E. coli K-12 MG1655 and integrated into the secretion-tag gene and antitumor protein (psp–TP) to replace the araBAD promoter sequence in the araBAD–psp–TP plasmid. The specific primer sets used for amplification are listed in Table 2 . Plasmid construction was confirmed via DNA sequencing (Macrogen, Seoul, Republic of Korea), and plasmids were introduced into E. coli via heat-shock transformation. Table 1 Bacterial strains and plasmids used. Strain Description Reference MG1655 Wild-Type ATCC ESY002 MG1655, P csrB -lacZY, Amp r This study ESY004 MG1655, P csrB -psp-TP, Amp r This study Plasmid Description Reference pSY009 lacZY under control of P csrB in pRS415 (P csrB -lacZY, Amp r ) This study pSY002 psp-TP under control of P csrB in pBAD24 (P csrB -psp-TP, Amp r ) This study Table 2 Specific primer sequences for engineering plasmids Plasmid Name and Direction Sequence pSY009 lacZY vector Forward GTTTCAGGGAAAGGCTTCTGGATGAAGCGAGCGGCGACGCGCAGTTAATC lacZY vector Reverse TTTACGTGTTCCCAGCGTCTCTTTGCACACTTTCATCGGTTGTCCGGATCC csrB insert Forward AATTCCCGGGGATCCGGACAACCGATGAAAGTGTGCAAAGAGACGCTGGG csrB insert Reverse GCGGCTGTGGGATTAACTGCGCGTCGCCGCTCGCTTCATCCAGAAGCCTT pSY002 psp vector Forward GCGATCTAGATTTAAGAAGGAGATATACATATGGGTTTGAAGATGAAGAAAAGATCAG psp vector Reverse ATCCGCCAAAACAGCCAAGCTTGGCTGCAGTTACTTCAGGTCCTCGCGCG csrB insert Forward GGCAAACCGCCGCGCGAGGACCTGAAGTAACTGCAGCCAAGCTTGGCTGT csrB insert Reverse GCCTGATCTTTTCTTCATCTTCAAACCCATATGTATATCTCCTTCTTAAATCTAGATCGCTT Culture conditions Bacterial strains harboring the plasmid were cultured in LB broth at 37°C with vigorous shaking. Ampicillin (Sigma-Aldrich, St Louis, MO; A9518-25G) was added at 100 µg/mL when necessary. E. coli K-12 MG1655 and its plasmid-carrying derivatives were cultured in M9 Minimal Medium (M9MM) (Welgene, Gyeongsan, Republic of Korea, MM003-01) supplemented with 1 M MgSO 4 (Thermo Fisher Scientific, Waltham, MA; 033337.36) and 1 M CaCl 2 (Daejung, Republic of Korea, 10035-04-8), prepared according to the manufacturer’s protocol (Sigma-Aldrich). The medium was supplemented with 0.4% glucose (Sigma-Aldrich; 50-99-7), 50 mM sodium pyruvate (Sigma-Aldrich; 113-24-6), and 50 mM sodium acetate (Sigma-Aldrich; 127-09-3). Casamino acid (0.1%; MB Cell; MB-C1656) and 0.005% L-tryptophan (MB Cell; MB-T4863) were used instead of casein enzyme hydrolysate to create suitable growth conditions for analyzing gene expression, lacZ expression, and secretion efficiency. Cell Culture CT26 colon carcinoma, MC38 colon carcinoma, LLC1 lung carcinoma, and B16F10 skin melanoma cells, all sourced from American Type Culture Collection (ATCC) Korea, were cultured in high-glucose Dulbecco’s Modified Eagle Medium (Corning, New York, NY; 10-013-CV) supplemented with 10% fetal bovine serum (FBS) (Corning; 35-015-CV) and 1% penicillin–streptomycin (Corning; 30-002-CI). SW620 colon carcinoma cells (ATCC Korea) were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (Corning; 10-040-CV) supplemented with 10% FBS and 1% penicillin–streptomycin. Experimental animals Experiments were conducted using female BALB/c mice (6 weeks old, 18–20 g; Samtako, Seoul, Republic of Korea) in accordance with the guidelines of the Institutional Animal Care and Use Committee of Kangwon National University (approval number KW-230428-2). Each mouse received a subcutaneous injection of 1 × 10 6 CT26 cells suspended in 30 µL of 1× PBS into the right thigh. Bacterial administration was initiated once the tumors reached 80–100 mm 3 . To investigate the antitumor effects of the TP immunotoxin, mice implanted with CT26 cells were intravenously injected with MG1655 cells carrying P csrB –psp–TP (1 × 10 8 colony-forming units [CFU]/mouse) via the tail vein. Tumor size was monitored by measuring the length, width, and height of each tumor every 2 d post-injection (dpi). Tumor volume was calculated as Volume = length × width × height × 0.5. The mice were euthanized when the implanted tumor reached > 1500 mm 3 . Preparation for RNA extraction and cDNA synthesis RNA was extracted from the mouse tumor, liver, and spleen tissue at 1 and 3 d after E. coli injection. The excised tissue was promptly preserved at − 80°C in 1 mL tubes to maintain RNA integrity. During the exponential and stationary phases, RNA was extracted from E. coli K-12 MG1655 cells grown in each medium. Bacterial cultures of E. coli K-12 MG1655 were cultivated in LB medium and were sampled at 2 h post-inoculation (hpi) for the exponential (E) phase and 6 hpi for the stationary (S) phase. Bacteria were also cultured in M9MM supplemented with either 0.4% glucose, 50 mM sodium pyruvate, or 50 mM sodium acetate, and were sampled at 6 hpi (E) and 9 hpi (S), 5 hpi (E) and 11 hpi (S), and 7 hpi (E) and 11 hpi (S), respectively, facilitating examination of csrB gene expression dynamics. RNA was extracted from each sample using the Mornach Total RNA Miniprep Kit (New England Biolabs; T2010S). Extracted RNA integrity and quantity were validated using a NanoDrop spectrophotometer (Thermo Fisher Scientific). cDNA synthesis was initiated using 1–5 µg of total RNA, reverse transcriptase, and random hexamer primers, using by the TOPscript cDNA Synthesis Kit (Enzynomics, Daejeon, Republic of Korea; EZ005S), thus ensuring the acquisition of the high-quality cDNA templates essential for downstream gene expression analysis. Quantitative PCR For qPCR, a 20 µL reaction mixture was prepared, comprising 30 ng of template cDNA, a primer set (0.25 µM each), and 10 µL of TOPreal 2× SYBR Green qPCR PreMix (Enzynomics; RT500M). qPCR was conducted using a Rotor-GenQ Real-Time PCR system (Qiagen, Hilden, Germany) with the following cycling conditions: initial denaturation at 95°C for 15 min, followed by 40 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 15 s, and elongation at 72°C for 15 s. Cycle threshold (Ct) values were normalized using the housekeeping gene, via the 2 −ΔΔCt method. All reactions were performed in quadruplicate to ensure robustness and accuracy of the relative gene expression measurements. The primer sequences used are listed in Additional File 1, Table S1 . Assessment of glucose and acetate metabolites in vivo Colorimetric assay kits were used to quantify the concentration of glucose (Abcam, Cambridge, UK, ab169559) and acetate (Abcam, ab2047190) in tissue. Freshly harvested tissue was lysed and processed according to the manufacturer’s protocols. Metabolite concentrations were determined based on standard curves and expressed as nanomoles per gram of tissue. β-galactosidase assay to verify the pattern of promoter activity Bacteria carrying the plasmid P csrB -lacZY were cultured overnight, then subcultured into 50 mL fresh LB medium or M9MM supplemented with 0.4% glucose, 50 mM sodium pyruvate, or 50 mM sodium acetate (dilution 1:100). Throughout the culture period, samples were collected at various intervals for assessment of optical density at 600 nm using a spectrophotometer (Biochrom, Cambridge, UK). The β-galactosidase assay was performed as described by Miller in 1972 [ 46 ], using cells permeabilized with Koch’s lysis buffer. β-galactosidase activity (in Miller units) was calculated as A420 / △T (min) / A600 × 1000. The bacterial samples were harvested at the same time as the samples for RNA extraction. RNA sequencing and analysis At 1 and 3 d after E. coli administration, total RNA was extracted from the liver and tumor tissue. RNA quantification and purity assessment were conducted using a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). Sequencing libraries were prepared from 1 µg of total RNA from each sample, using the Illumina TruSeq Stranded Total RNA LT Sample Prep Kit (Illumina, San Diego, CA). The resulting cDNA libraries were sequenced on the NovaSeq platform (Illumina), generating approximately 8.65 billion paired-end reads of 101 nt each. Raw reads were quality-filtered and trimmed using Trimmomatic 0.36 with the following parameters: ILLUMINACLIP, TruSeq3-PE-2. fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 [ 42 ]. Clean reads were then mapped to the mm10 mouse reference genome using HISAT 2.1.1, with the default settings [ 43 ]. Unmapped reads were extracted using SAMtools 1.9 and were remapped to the E. coli K-12 MG1655 reference genome (ASM584v2) [ 44 ]. Reference genome data for the mice and E. coli were obtained from the UCSC genome browser ( https://genome.ucsc.edu ) and NCBI RefSeq ( https://www.ncbi.nlm.nih.gov/refseq ), respectively. Gene expression levels were quantified using Cufflinks 2.1.1, with a false discovery rate < 5% used as the threshold for differential gene expression [ 45 ]. Gene expression was log 2 -transformed for principal component analysis of E. coli gene expression across samples, using the ‘prcomp’ function in R. The threshold for gene expression was fragments per kilobase of transcript per million mapped reads (FPKM) > 1. The liver samples were designated as controls because of the liver’s essential role in the early systemic response to infections and its established physiological functions (Fig. 1 A) [ 42 ]. Western blot analysis of secretion activity Overnight cultures of MG1655 carrying the P csrB –psp–TP plasmid were sub-cultured in M9MM supplemented with 50 mM sodium acetate (dilution 1:100) and cultivated for the E and S phases for 9 and 48 h, respectively. At specific time-points, the pellets were harvested and resuspended in 1× PBS (Welgene; ML008-02). The supernatants were obtained and subjected to filtration through 0.2 µm filters (GVS Filter Technology, Bologna, Italy; FJ13ASCCA002DL01). MG1655 strains carrying the P csrB –psp–TP plasmid (1 × 10 8 CFU/mouse) were intravenously injected into CT26-tumor-engrafted mice once the tumors reached 100–120 mm 3 . Tumor tissue was excised on predetermined days and homogenized in 1 mL Radioimmunoprecipitation assay buffer (Intron Biotechnology, Seongnam, Republic of Korea; IBS-BR002) supplemented with 1× Protease & Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific; 1861281) and 1× Ethylenediaminetetraacetic acid (Thermo Fisher Scientific; 1861274). After preparing the samples, the bacterial whole cells, pellets, and filtered supernatants were mixed with 5× Sodium Dodecyl Sulfate Polyacrylamide (SDS) buffer and boiled at 100°C for 1 min. Proteins were separated using electrophoresis on 10% SDS-PAGE gels and transferred onto polyvinylidene fluoride membranes (Merck Millipore, Burlington, MA; IPVH00010). TP expression was assessed via western blotting using a primary polyclonal anti-rabbit antibody against PE38 (Merck Millipore; P2318-1ML, dilution 1:5000). Spontaneous bacterial lysis was examined using the anti-rabbit antibody GroEL (Merck Millipore; G6532-5mL, dilution 1:5000). The abundance of β-actin (Santa Cruz Biotechnology, Dallas, TX; sc-47778, dilution 1:2000) was determined using a specific mouse polyclonal antibody. Following overnight incubation at 4°C in primary antibodies diluted in Difco 5% skim milk (BD, Franklin Lakes, NJ; 0252038) in Tris-buffered saline and Tween 20 (TBST), the membranes were incubated for 1 h at room temperature in anti-mouse and anti-rabbit IgG-HRP antibodies (Cell Signaling Technology; 7076S and 7074S, respectively; dilution 1:2000). Proteins were visualized using ECL solution (Thermo Fisher Scientific; 32209). Cell viability assay Bacteria carrying the P csrB –psp–TP plasmid were cultured overnight and then sub-cultured into 50 mL fresh LB medium supplemented with ampicillin (100 µg/mL; dilution 1:100) at 37°C in a shaking incubator. After 9 h of subculture, 50 mL of the bacterial broth was centrifuged at 4000 rpm for 20 min. To eliminate bacterial cells, the supernatant fractions were obtained by filtration through a 0.2 µm pore syringe filter (Sartorius, Göttingen, Germany; S6534). The supernatant filtrate was concentrated using Centricon columns (Merck Millipore; UFC900324). Total protein concentration was determined using the Bradford method [ 47 ]. The CT26, LLCI, MC38, B16F10, and SW620 cell lines were seeded in 96-well microplates at 2 × 10 3 cells per well. Upon reaching a cell density of 10 4 cells per well, bacterial supernatants containing 18 µg protein were administered to the adherent cells. Following a 2 d incubation period, 10 µL MTT solution (TCI Chemical, Tokyo, Japan; M3353) was introduced, and the cells were incubated for 3 h. Sample absorbance was measured at 575 nm using a microplate reader. Statistical analysis All experimental data were analyzed using GraphPad Prism 9.0 (GraphPad, San Diego, CA). Results are expressed as the mean (SD). Differences among groups were determined using two-way ANOVA followed by Tukey’s post hoc test. The log-rank (Mantel–Cox) test was used to analyze survival data. Differences were considered significant at P < 0.05. RESULTS RNA-seq reveals elevated csrB expression in E. coli injected into the model mice We aimed to improve the therapeutic efficacy of TP by identifying TME-specific genes that are essential for utilizing intrinsic factors and that could maximize TP expression within bacterial cells. To achieve this, RNA-seq of bacterial genes was performed using liver and tumor tissue from a CT26 colorectal carcinoma xenograft mouse model after the introduction of the bacteria. The mice were intravenously injected with E. coli K-12 MG1655, and the liver and tumor samples were collected at 1 and 3 d post-injection (dpi). In total, 22 samples (1 dpi livers, n = 6; 1 dpi tumors, n = 7; 3 dpi livers, n = 3; and 3 dpi tumors, n = 6) were analyzed. Following quality trimming, we obtained 248 million reads (98.3% of the total raw reads) with an average rate of alignment to the mm10 mouse reference genome of 75.0%. The unmapped reads were aligned to the E. coli genome (ASM584v2), revealing a markedly higher alignment rate in tumor tissue than in liver tissue (Fig. 1 B). Consistent with this, > 50% of the genes in the E. coli genome were expressed in tumor tissue (Fig. 1 C). However, in the liver tissue, approximately 40% of the E. coli genes were expressed at 1 dpi, with only 1% expressed at 3 dpi. These findings suggest that E. coli may persist sufficiently within tumor tissue while being significantly diminished in the liver, possibly owing to host immune responses [ 43 ]. Principal component analysis of the global gene expression profiles revealed marked differences between tumor and liver tissue, indicating differential E. coli transcriptional regulation (Fig. 1 D). csrB was identified as the top-ranking tumor-specific gene satisfying the following criteria: significantly differential expression between tumor and liver tissue and enhanced expression in tumor tissue at 3 dpi (Fig. 1 E). Using qPCR, we validated the significant induction of csrB in tumors relative to liver tissue at 1 and 3 dpi (Fig. 1 F). In tumors, csrB induction (normalized to 16S rRNA expression levels) was 700-fold higher at 3 dpi than at 1 dpi. This suggests that csrB , with its pronounced induction in the TME, is a promising candidate promoter for the regulation of anticancer proteins in bacterial oncotherapy. TME metabolic cues promote csrB -promoter activity and immunotoxin expression We next focused on the regulatory role of csrB , a small RNA that controls virulence-related gene expression in bacteria, aiming to identify the environmental factors driving its activation in tumors. Tumors undergo extensive metabolic reprogramming, often resulting in both nutrient depletion and the accumulation of specific metabolites that define the TME. Acetate, one of the metabolites accumulated, is both a major carbon source for cancer cells and a key signal sensed by bacterial regulatory systems. As the BarA/UvrY two-component regulatory system functions as an acetate sensor that triggers csrB transcription [ 48 ], we postulated that localized niches with the TME could become enriched in acetate. Such niches would be conducive to selective activation of the csrB promoter within tumor tissue, thereby providing a metabolic basis for tumor-specific regulation of bacterial gene expression. To verify whether acetate levels were higher in tumor tissue than in organs, we measured acetate concentrations in tumor and liver tissue The results showed that acetate concentration was significantly higher in tumor tissue than in liver, approximately 1.4-fold greater (Fig. 2 A), and the acetate/glucose ratio was also markedly elevated in tumors, by about 6-fold (Fig. 2 B). To examine whether this metabolic profile correlates with csrB expression, we simulated TME-like conditions in vitro and quantified csrB transcript levels via qPCR. csrB expression was significantly higher in the stationary phase (S) than in the exponential phase (E) and was inversely correlated with nutrient availability. These results suggest that the elevated csrB expression may be due to the nutrient-limitation commonly associated with the TME. Acetate, the most abundant metabolic byproduct in the TME, upregulated csrB expression by 4-fold relative to the glucose-rich conditions typical of normal tissue (Fig. 2 C). Acetate enrichment, together with nutrient limitation, is thus a key driver of elevated csrB expression in the TME. This provides a strong rationale for using the csrB promoter to achieve tumor-selective gene expression. To investigate whether the csrB promoter exhibits the same expression pattern as the csrB gene itself, we verified its expression by engineering the P csrB -lacZY construct (pSY009) (Fig. S1 A). E. coli K-12 MG1655 harboring the P csrB -lacZY construct was used to monitor csrB -promoter activity. Verification using a β-galactosidase assay revealed that csrB -promoter activation exhibited the same expression pattern as the csrB gene. Across all media types, csrB expression was significantly higher during the stationary phase (S) than during the exponential phase (E), as determined via growth-curve analysis (Fig. S1 B). Reporter gene assays revealed that, under acetate-rich conditions, csrB -promoter activity was significantly elevated, by 8-fold, in the stationary phase (S) relative to the exponential phase (E). csrB -promoter activity was 4-fold higher under acetate-rich conditions typical of tumor tissue than under the glucose-rich conditions typical of normal tissue (Fig. 2 D). This verifies the association between acetate abundance and csrB -promoter activity, indicating that the csrB promoter responds to acetate as an environmental signal, analogous to a two-component regulatory system. The csrB promoter therefore functions as a critical mediator of the bacterial response to acetate in the TME. The TME-specific activity of the csrB promoter further confirms its suitability for precisely controlling immunotoxin secretion and expression within the TME. To assess the efficacy of the csrB promoter in regulating functional immunotoxin secretion and expression, the csrB -promoter sequence was inserted into the pBAD24 vector, replacing the araBAD promoter. This construct was then fused with the coding sequence of the immunotoxin (TP). The P csrB –psp–TP plasmid (pSY004) was engineered by appending a psp secretion signal peptide to the N-terminus of TGFα–PE38 (Fig. 2 E) [ 49 ]. E. coli harboring the P csrB –psp–TP construct (ESY004) exhibited substantial expression of this construct within bacterial cell pellets, with notable secretion of it into the supernatant in the acetate-containing medium (Fig. 2 F). These findings indicate that the csrB promoter can be used to establish an endogenous platform that enables tumor-specific auto-inducing immunotoxin expression and secretion. Antitumor effects of this immunotoxin under csrB -promoter activation Based on these results, we evaluated the activity of the recombinant protein under elevated acetate production, by examining the antitumor effects of the immunotoxin secreted by the csrB -promoter. TGFα–PE38 is specifically effective against EGFR-overexpressing cancer cells. To further investigate its antitumor activity, we employed three tumor-cell lines with high EGFR expression (CT26, LLC1, and MC38) and two with low EGFR expression (B16F10 and SW620) [ 50 , 51 ]. First, the change in protein concentrations over time was determined (Fig. S2). Tumor cells were treated with 18 µg of protein and cultured for 48 h under the following conditions: Mock (PBS), concentrated E. coli K-12 MG1655 bacterial supernatant (18 µg protein), or ESY004, engineered bacteria, bacterial supernatant (18 µg protein). Treatment with the ESY004 supernatant for 48 h resulted in approximately 70–90% cell death of CT26, LLC1, and MC38 tumor cells, significantly higher than that of the MG1655 wild-type cells (Fig. 3 A). In contrast, treatment with the E. coli K-12 MG1655 supernatant (as a control) had a modest impact on cell viability. As expected, cell viability did not differ significantly between the three treatments for B16F10 and SW620 cells, the tumor cells with low EGFR expression (Fig. 3 B). These findings suggest that the TP secreted by ESY004 is specifically cytotoxic against EGFR-expressing tumor cells. Regulation of immunotoxin expression by the csrB -promoter in CT26-cell engrafted mice After confirming in vitro the cytotoxicity of the TP secreted under the control of the csrB promoter, we tested its secretion and antitumor activity in BALB/c mice implanted with CT26 colon cancer cells. Tumor-bearing mice were administered engineered E. coli intravenously, and tumor tissues were collected on days 1, 3, and 5 post-inoculation (Fig. 4 A). TP was consistently detected in the tumor filtrates from days 1 to 5 post-inoculation (Fig. 4 B). This confirms that the csrB promoter enables continuous and effective secretion of TP via the psp secretion-signal peptide. To determine whether the immunotoxin secreted in this manner is expressed in vivo and exerts antitumor activity, we evaluated its tumor-suppressive effect in tumor-bearing mice by monitoring tumor growth following administration of the engineered bacteria. When the engrafted tumors reached 80–100 mm², the mice received intravenous injections of (i) mock (PBS), (ii) E. coli K-12 MG1655 alone, or (iii) ESY004. ESY004 exhibited a clear tumor-suppressive effect in vivo (Fig. 4 C). As previously reported, the application of targeted E. coli or E. coli carrying a protein with no antitumor activity suppressed tumor growth by 1.2-fold [ 52 – 54 ]. Over a 16 d period, the mice with immunotoxin expression under the control of the csrB promoter exhibited 3-fold less tumor growth than those in the PBS control group. Mice expressing the immunotoxin exhibited > 2-fold greater inhibition of tumor growth than those that received E. coli alone (Fig. 4 C, D, Fig. S3). Few adverse effects on mouse health were detected, and no significant differences in body weight were noted among the groups (Fig. S4A). The bacterial count declined gradually in the non-tumor tissue within 5 dpi. After 30 dpi, bacteria were present in the tumor tissue but largely absent from other tissues (Fig. S4B). These findings demonstrate that TP, driven by the csrB promoter induced by the abundant acetate in the TME, autonomously and significantly inhibits tumor growth without side effects. Consequently, we performed additional in vivo experiments directly comparing our csrB -promoter-driven construct with an arabinose-inducible system (pBAD promoter), both expressing TP. Mice bearing subcutaneous tumors were injected intravenously with either strain, and tumor volumes were measured up to 10 d. At this endpoint, the groups showed comparable tumor suppression, with no statistically significant difference in efficacy ( Data not shown ). The csrB group exhibited a slightly smaller average tumor size, although this difference did not reach statistical significance. Considering that systemic delivery of arabinose in mice is logistically challenging, requiring repeated administration with limited tumor penetration and short half-life, the csrB system offers a distinct advantage in terms of operational simplicity and translational relevance. Therapeutic efficacy and apoptosis-associated cytokine dynamics in vivo Next, we evaluated the therapeutic efficacy of the engineered strain ESY004; tumor-bearing mice were intravenously administered with the bacteria and their overall survival was monitored. Mice treated with ESY004 exhibited a significant survival advantage, living approximately 10 d longer than those administered E. coli alone, demonstrating potent tumor-suppressive efficacy in vivo. (Fig. 5 A). To investigate the mechanism underlying the observed survival advantage, we quantified the expression of the key apoptotic regulators Bax and Bcl-2 in tumor tissue following bacterial administration [ 55 ]. Quantitative qPCR analysis revealed marked elevation of the Bax/Bcl-2 ratio in the ESY004-treated group relative to the mock control, with increases of ca. 2-, 4-, and 6-fold at days 1, 3, and 5 post-injection, respectively (Fig. 5 B). Analysis of Bax/Bcl2 expression in CT26 cells treated with bacterial supernatants revealed significantly elevated apoptotic signaling in the ESY004 group. The Bax/Bcl2 ratio was approximately 1.5-fold higher after 12 h and 1.2-fold higher after 24 h (Fig. S5) in the mice treated with ESY004 than in those that received E.coli alone, at the same time-points. This increase at both 12 and 24 h in the Bax/Bcl-2 ratio strongly indicates a shift toward a pro-apoptotic state within the TME. In parallel, we analyzed cytokine dynamics to explore the upstream triggers of apoptosis. qPCR analysis of spleen mRNA revealed a rapid and temporary increase (ca. 5-fold) in TNF-α expression at 1 d, while its expression declined to near-baseline levels by 5 d (Fig. 5 C). This temporal pattern suggests that ESY004 administration induces an acute pro-inflammatory response that primes the cells for apoptosis, followed by the execution of cell death programs, as evidenced by the increasing Bax/Bcl-2 ratio. Together, these findings indicate that ESY004-mediated tumor suppression is associated with early TNF-α signaling and sustained activation of apoptotic pathways. DISCUSSION This novel endogenous tumor-specific auto-inducing system enables selective immunotoxin expression within the TME, without requiring exogenous inducers. Unlike traditional inducible systems, which rely on exogenous inducers such as L-arabinose to activate gene expression [ 27 ], our approach leverages the unique metabolic characteristics of the TME, specifically acetate accumulation, to autonomously trigger csrB -promoter-driven expression of a therapeutic protein [ 32 ]. Previous studies on bacterial oncotherapy have predominantly relied on engineered bacteria that require external stimuli to regulate gene expression [ 56 ]. While such systems offer control over therapeutic-protein production, they often suffer from limitations such as the need for continuous administration and precise dosage adjustments to maintain efficacy [ 29 ]. In contrast, the csrB -promoter-driven system overcomes these challenges by taking advantage of the tumor’s endogenous metabolic landscape. The natural accumulation of acetate in the TME serves as a key regulatory signal, leading to selective activation of the therapeutic gene without external intervention, thereby driving the production of a therapeutic protein that effectively suppresses tumor growth (Fig S6). The csrB -promoter-driven system differs critically from previous approaches in the specificity and robustness of csrB -promoter activation within tumors. Based on RNA-seq analysis, csrB was the most highly expressed E. coli gene detected in tumors, highlighting its strong responsiveness to the TME (Fig. 1 ). This finding provides critical insights into the bacterial gene expression profile under tumor-specific conditions. In contrast, the earlier bacterial gene expression systems rely on oxygen gradients, hypoxia-inducible promoters, or synthetic regulatory circuits, which often exhibit variable and unpredictable activation levels [ 57 , 58 ]. By employing a naturally evolved regulatory element that is highly responsive to the TME, our approach enhances both the efficacy and consistency of bacterial oncotherapy. The selective upregulation of csrB- promoter activity in response to acetate supports its potential for effective therapeutic-protein delivery within the TME, where metabolic shifts and nutrient competition provide a favorable niche for bacterial survival (Fig. 2 B). The csrB promoter was shown to drive TP immunotoxin expression, effectively targeting cancer cells overexpressing EGFR, as demonstrated in vitro (Fig. 3 ). Validating these results, mice that received P csrB –psp–TP-engineered E. coli exhibited significantly reduced tumor size, with minimal off-target effects (Fig. 4 B). Importantly, the extent of tumor suppression achieved by the csrB promoter-driven system was comparable with that observed using conventional inducible promoters, indicating that endogenous acetate is sufficient to achieve therapeutic efficacy without the need for external inducers. Mechanistically, qPCR analysis revealed increased Bax and reduced Bcl-2 expression in tumor tissue, suggesting that the observed gain in survival was mediated, at least partially, by induction of apoptosis (Fig. 5 B). The csrB promoter-driven TP system maintained immunotoxin expression for 5 dpi. Moreover, in non-tumor tissue, bacterial levels were negligible at 30 dpi, confirming the system’s ability to achieve prolonged antitumor effects while minimizing systemic bacterial dissemination (Fig. S4B). These findings underscore the potential of the csrB promoter—autonomously activated by acetate to drive robust and sustained secretion and expression of therapeutic proteins via targeted oncotherapy. This study has certain limitations. The immunotoxin, derived from the csrB promoter, was not retained over time in the mouse-engrafted tumor (Fig. S7), posing a challenge to the long-term expression of the therapeutic protein. This could be overcome by applying established systems, such as the glmS -based balanced-lethal host-vector system, which can sustain plasmids in vivo for extended periods [ 59 ]. Replacing the antibiotic-resistance genes with those of the glmS system can potentially enhance plasmid stability, thereby improving the overall effectiveness and longevity of the system [ 60 ]. This study underscores the potential of utilizing endogenous bacterial responses to achieve tumor-specific therapeutic protein delivery. By eliminating the reliance on synthetic or externally controlled inducers, the csrB promoter-driven system represents a significant advancement in bacterial-based oncotherapy. The ability to harness TME-specific metabolic cues for targeted and sustained therapeutic expression provides a promising strategy for enhancing the precision and safety of bacterial oncotherapy. Future research should focus on expanding this approach to other tumor models and optimizing bacterial engineering strategies to further refine therapeutic outcomes. Abbreviations EGFR, Epidermal Growth Factor Receptor TGFα, Transforming Growth Factor alpha TME, Tumor Microenvironment LB, Luria Bertani ATCC, American Type Culture Collection DMEM, Dulbecco’s modified Eagle’s medium RPMI, Roswell Park Memorial Institute FBS, Fetal bovine serum CFU, Colony Forming Unit DPI, Day after Post Injection qPCR, Quantitative polymerase chain reaction OD, Optical Density MTT, Mitochondrial NADH-dehydrogenase FPKM, Fragments per kilobase of transcript per million mapped reads PBS, Phosphate Buffered Saline BAX, Bcl-2 Associated X protein TNFα, Tumor Necrosis Factor alpha Declarations Ethics approval and consent to participate The animal experiments were approved by the Institutional Animal Care and Use Committee of Kangwon National University (approval number KW-230428-2). Consent for publication Not applicable Availability of data and materials All raw sequence data have been deposited in the NCBI database (accession numbers SRR30041348–SRR30041359 under BioProject PRJNA1140531). Competing interests The authors declare that they have no competing interests. Funding This work was supported by the National Research Foundation of Korea grants funded by the Korean government [grant number NRF-RS-2023-00210053 and NRF-RS-2025-02263715] (Republic of Korea) and supported by the Regional Innovation System and Education program through the Gangwon RISE Center, funded by the Ministry of Education and the Gangwon State, Republic of Korea [grant number 2025-RISE-10-002]. M.S. was supported by the National Research Foundation of Korea [grant numbers 2019M3E5D5066666 and 2022M3E5F1018375] and by the Hankuk University of Foreign Studies Research Fund of 2025. Authors’ contributions S.H., S.L., D.L., and M.S. conceptualized the research. S.H., S.L., D.L., and J.K. performed the experiments. S.H., D.L., and M.S. carried out the data analysis. S.H., S.L., D.L., and M.S. wrote and revised the manuscript. All of the authors have read and approved the final manuscript. Acknowledgments Not applicable. Authors’ information 1 Present Address: Division of Biomedical Convergence, College of Biomedical Science, Kangwon National University, Chuncheon 24341, Republic of Korea. 2 Present Address: Section of Genetics and Physiology, Laboratory of Molecular and Cellular Biology, National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK), National Institutes of Health (NIH), Bethesda, MD, USA. 3 Present Address: Department of Bioscience and Biotechnology, Hankuk University of Foreign Studies, Yongin 17035, Republic of Korea References M. Sedighi, A. Zahedi Bialvaei, M.R. Hamblin, E. Ohadi, A. Asadi, M. Halajzadeh, V. Lohrasbi, N. Mohammadzadeh, T. Amiriani, M. Krutova, A. Amini, E. Kouhsari, Therapeutic bacteria to combat cancer; current advances, challenges, and opportunities, Cancer Med 8(6) (2019) 3167–3181. B. Liu, H. Zhou, L. Tan, K.T.H. Siu, X.-Y. Guan, Exploring treatment options in cancer: tumor treatment strategies, Signal Transduction and Targeted Therapy 9(1) (2024) 175. A. Sharma, S. Jasrotia, A. Kumar, Effects of Chemotherapy on the Immune System: Implications for Cancer Treatment and Patient Outcomes, Naunyn-Schmiedeberg's Archives of Pharmacology 397(5) (2024) 2551–2566. D.-R. Wang, X.-L. Wu, Y.-L. Sun, Therapeutic targets and biomarkers of tumor immunotherapy: response versus non-response, Signal Transduction and Targeted Therapy 7(1) (2022) 331. R.J. Kreitman, Immunotoxins for targeted cancer therapy, Aaps j 8(3) (2006) E532-51. I. Pastan, R. Hassan, D.J. Fitzgerald, R.J. Kreitman, Immunotoxin therapy of cancer, Nat Rev Cancer 6(7) (2006) 559–65. C. Alewine, R. Hassan, I. Pastan, Advances in anticancer immunotoxin therapy, Oncologist 20(2) (2015) 176 – 85. C.B. Siegall, D.J. FitzGerald, I. Pastan, Selective killing of tumor cells using EGF or TGF alpha-Pseudomonas exotoxin chimeric molecules, Semin Cancer Biol 1(5) (1990) 345–50. J.R. Grandis, D.J. Tweardy, Elevated levels of transforming growth factor alpha and epidermal growth factor receptor messenger RNA are early markers of carcinogenesis in head and neck cancer, Cancer Res 53(15) (1993) 3579–84. P.C. Phillips, C. Levow, M. Catterall, O.M. Colvin, I. Pastan, H. Brem, Transforming growth factor-alpha-Pseudomonas exotoxin fusion protein (TGF-alpha-PE38) treatment of subcutaneous and intracranial human glioma and medulloblastoma xenografts in athymic mice, Cancer Res 54(4) (1994) 1008–15. J.E. Weldon, I. Pastan, A guide to taming a toxin–recombinant immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer, Febs j 278(23) (2011) 4683–700. R. Guo, D. Zhang, C. Zhang, Y. Yang, H. Liu, Y. Yang, J. Lin, Immunotoxin IHP25-BT with low immunogenicity and off-target toxicity inhibits the growth and metastasis of trastuzumab-resistant tumor cells, Int J Pharm 608 (2021) 121081. S.M. Havaei, M.G. Aucoin, A. Jahanian-Najafabadi, Pseudomonas Exotoxin-Based Immunotoxins: Over Three Decades of Efforts on Targeting Cancer Cells With the Toxin, Front Oncol 11 (2021) 781800. J. Narbona, L. Hernández-Baraza, R.G. Gordo, L. Sanz, J. Lacadena, Nanobody-Based EGFR-Targeting Immunotoxins for Colorectal Cancer Treatment, Biomolecules 13(7) (2023). N.L. Mutter, M. Soskine, G. Huang, I.S. Albuquerque, G.J.L. Bernardes, G. Maglia, Modular Pore-Forming Immunotoxins with Caged Cytotoxicity Tailored by Directed Evolution, ACS Chemical Biology 13(11) (2018) 3153–3160. M. Kleinschmidt, R. Rudolph, H. Lilie, Design of a modular immunotoxin connected by polyionic adapter peptides, J Mol Biol 327(2) (2003) 445–52. M. Rahban, F. Ahmad, M.A. Piatyszek, T. Haertlé, L. Saso, A.A. Saboury, Stabilization challenges and aggregation in protein-based therapeutics in the pharmaceutical industry, RSC Adv 13(51) (2023) 35947–35963. R. Mazor, I. Pastan, Immunogenicity of Immunotoxins Containing Pseudomonas Exotoxin A: Causes, Consequences, and Mitigation, Frontiers in Immunology 11 (2020). M.T. Duong, Y. Qin, S.H. You, J.J. Min, Bacteria-cancer interactions: bacteria-based cancer therapy, Exp Mol Med 51(12) (2019) 1–15. S. Zhang, R. Li, Y. Xu, R. Liu, D. Sun, Z. Dai, Engineered bacteria: Strategies and applications in cancer immunotherapy, Fundamental Research (2024). D. Lin, X. Feng, B. Mai, X. Li, F. Wang, J. Liu, X. Liu, K. Zhang, X. Wang, Bacterial-based cancer therapy: An emerging toolbox for targeted drug/gene delivery, Biomaterials 277 (2021) 121124. C. Zu, J. Wang, Tumor-colonizing bacteria: a potential tumor targeting therapy, Crit Rev Microbiol 40(3) (2014) 225 – 35. D.-H. Nguyen, A. Chong, Y. Hong, J.-J. Min, Bioengineering of bacteria for cancer immunotherapy, Nature Communications 14(1) (2023) 3553. C.J. Thomas, K. Delgado, K. Sawant, J. Roy, U. Gupta, C.S. Song, R. Poojary, P. de Figueiredo, J. Song, Harnessing Bacterial Agents to Modulate the Tumor Microenvironment and Enhance Cancer Immunotherapy, Cancers 16(22) (2024) 3810. V. Mayakrishnan, P. Kannappan, N. Tharmalingam, R.J.C. Bose, T. Madheswaran, M. Ramasamy, Bacterial cancer therapy: A turning point for new paradigms, Drug Discovery Today 27(8) (2022) 2043–2050. R. Kunjalwar, A. Keerti, A. Chaudhari, K. Sahoo, S. Meshram, Microbial Therapeutics in Oncology: A Comprehensive Review of Bacterial Role in Cancer Treatment, Cureus 16(10) (2024) e70920. H. Hong, D. Lim, G.J. Kim, S.H. Park, H. Sik Kim, Y. Hong, H.E. Choy, J.J. Min, Targeted deletion of the ara operon of Salmonella typhimurium enhances L-arabinose accumulation and drives PBAD-promoted expression of anti-cancer toxins and imaging agents, Cell Cycle 13(19) (2014) 3112–20. D.H. Nguyen, S.H. You, A.N. Vo, H.T. Ngo, K. Van Nguyen, M.T. Duong, H.E. Choy, M. Song, Y. Hong, J.J. Min, Optimized Doxycycline-Inducible Gene Expression System for Genetic Programming of Tumor-Targeting Bacteria, Mol Imaging Biol 24(1) (2022) 82–92. P.T. Mai, D. Lim, E. So, H.Y. Kim, T. Duysak, T.Q. Tran, M. Song, J.H. Jeong, H.E. Choy, Constitutive Expression of a Cytotoxic Anticancer Protein in Tumor-Colonizing Bacteria, Cancers (Basel) 15(5) (2023). I. Elia, M.C. Haigis, Metabolites and the tumour microenvironment: from cellular mechanisms to systemic metabolism, Nature Metabolism 3(1) (2021) 21–32. A.F. Alvarez, C. Rodríguez, R. González-Chávez, D. Georgellis, The Escherichia coli two-component signal sensor BarA binds protonated acetate via a conserved hydrophobic-binding pocket, Journal of Biological Chemistry 297(6) (2021) 101383. S. Bose, V. Ramesh, J.W. Locasale, Acetate Metabolism in Physiology, Cancer, and Beyond, Trends Cell Biol 29(9) (2019) 695–703. S.A. Comerford, Z. Huang, X. Du, Y. Wang, L. Cai, A.K. Witkiewicz, H. Walters, M.N. Tantawy, A. Fu, H.C. Manning, J.D. Horton, R.E. Hammer, S.L. McKnight, B.P. Tu, Acetate dependence of tumors, Cell 159(7) (2014) 1591 – 602. F.U. Contreras, M.I. Camacho, A. Pannuri, T. Romeo, A.F. Alvarez, D. Georgellis, Spatiotemporal regulation of the BarA/UvrY two-component signaling system, J Biol Chem 299(6) (2023) 104835. S. Palaniyandi, A. Mitra, C.D. Herren, C.V. Lockatell, D.E. Johnson, X. Zhu, S. Mukhopadhyay, BarA-UvrY two-component system regulates virulence of uropathogenic E. coli CFT073, PLoS One 7(2) (2012) e31348. G.P. Lobel, Y. Jiang, M.C. Simon, Tumor microenvironmental nutrients, cellular responses, and cancer, Cell Chem Biol 30(9) (2023) 1015–1032. A. Vaziri-Gohar, J. Cassel, F.S. Mohammed, M. Zarei, J.J. Hue, O. Hajihassani, H.J. Graor, Y.V.V. Srikanth, S.A. Karim, A. Abbas, E. Prendergast, V. Chen, E.S. Katayama, K. Dukleska, I. Khokhar, A. Andren, L. Zhang, C. Wu, B. Erokwu, C.A. Flask, M. Zarei, R. Wang, L.D. Rothermel, A.M.P. Romani, J. Bowers, R. Getts, C. Tatsuoka, J.P. Morton, I. Bederman, H. Brunengraber, C.A. Lyssiotis, J.M. Salvino, J.R. Brody, J.M. Winter, Limited nutrient availability in the tumor microenvironment renders pancreatic tumors sensitive to allosteric IDH1 inhibitors, Nat Cancer 3(7) (2022) 852–865. K. Jonas, Ö. Melefors, The Escherichia coli CsrB and CsrC small RNAs are strongly induced during growth in nutrient-poor medium, FEMS Microbiology Letters 297(1) (2009) 80–86. R.G. Chavez, A.F. Alvarez, T. Romeo, D. Georgellis, The physiological stimulus for the BarA sensor kinase, J Bacteriol 192(7) (2010) 2009–12. T. Esquerré, M. Bouvier, C. Turlan, A.J. Carpousis, L. Girbal, M. Cocaign-Bousquet, The Csr system regulates genome-wide mRNA stability and transcription and thus gene expression in Escherichia coli, Sci Rep 6 (2016) 25057. A.K. Pernestig, O. Melefors, D. Georgellis, Identification of UvrY as the cognate response regulator for the BarA sensor kinase in Escherichia coli, J Biol Chem 276(1) (2001) 225–31. A.M. Bolger, M. Lohse, B. Usadel, Trimmomatic: a flexible trimmer for Illumina sequence data, Bioinformatics 30(15) (2014) 2114–20. D. Kim, J.M. Paggi, C. Park, C. Bennett, S.L. Salzberg, Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype, Nat Biotechnol 37(8) (2019) 907–915. H. Li, B. Handsaker, A. Wysoker, T. Fennell, J. Ruan, N. Homer, G. Marth, G. Abecasis, R. Durbin, The Sequence Alignment/Map format and SAMtools, Bioinformatics 25(16) (2009) 2078–9. C. Trapnell, B.A. Williams, G. Pertea, A. Mortazavi, G. Kwan, M.J. van Baren, S.L. Salzberg, B.J. Wold, L. Pachter, Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation, Nat Biotechnol 28(5) (2010) 511–5. J.H. Miller, Experiments in Molecular Genetics, Cold Spring Harbor Laboratory1972. M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal Biochem 72 (1976) 248–54. M.I. Camacho, A.F. Alvarez, R.G. Chavez, T. Romeo, E. Merino, D. Georgellis, Effects of the global regulator CsrA on the BarA/UvrY two-component signaling system, Journal of bacteriology 197(5) (2015) 983–991. D. Lim, K.S. Kim, H. Kim, K.C. Ko, J.J. Song, J.H. Choi, M. Shin, J.J. Min, J.H. Jeong, H.E. Choy, Anti-tumor activity of an immunotoxin (TGFα-PE38) delivered by attenuated Salmonella typhimurium, Oncotarget 8(23) (2017) 37550–37560. H. Wang, X. Zhao, H. Zhang, X. Zou, D. Jia, W. Liu, B. Tian, D. Yuan, Y. Li, Y. Zhu, F. Zhang, Y. Dai, Y. Fan, Y. Wei, X. Sun, Q. Fan, J. Dong, EGFR-antagonistic affibody-functionalized Pt-based nanozyme for enhanced tumor radiotherapy, Materials Today Advances 18 (2023) 100375. C. Deng, J. Xiong, X. Gu, X. Chen, S. Wu, Z. Wang, D. Wang, J. Tu, J. Xie, Novel recombinant immunotoxin of EGFR specific nanobody fused with cucurmosin, construction and antitumor efficiency in vitro, Oncotarget 8(24) (2017) 38568–38580. J.J. Min, V.H. Nguyen, H.J. Kim, Y. Hong, H.E. Choy, Quantitative bioluminescence imaging of tumor-targeting bacteria in living animals, Nat Protoc 3(4) (2008) 629–36. N. Van Dessel, C.A. Swofford, N.S. Forbes, Potent and tumor specific: arming bacteria with therapeutic proteins, Ther Deliv 6(3) (2015) 385–99. N.S. Forbes, Engineering the perfect (bacterial) cancer therapy, Nat Rev Cancer 10(11) (2010) 785–94. F. Edlich, BCL-2 proteins and apoptosis: Recent insights and unknowns, Biochemical and Biophysical Research Communications 500(1) (2018) 26–34. S.N. Jiang, S.H. Park, H.J. Lee, J.H. Zheng, H.S. Kim, H.S. Bom, Y. Hong, M. Szardenings, M.G. Shin, S.C. Kim, V. Ntziachristos, H.E. Choy, J.J. Min, Engineering of bacteria for the visualization of targeted delivery of a cytolytic anticancer agent, Mol Ther 21(11) (2013) 1985–95. N. Suzuki, K. Gradin, L. Poellinger, M. Yamamoto, Regulation of hypoxia-inducible gene expression after HIF activation, Exp Cell Res 356(2) (2017) 182–186. T. Chien, T. Harimoto, B. Kepecs, K. Gray, C. Coker, N. Hou, K. Pu, T. Azad, A. Nolasco, M. Pavlicova, T. Danino, Enhancing the tropism of bacteria via genetically programmed biosensors, Nat Biomed Eng 6(1) (2022) 94–104. K. Kim, J.H. Jeong, D. Lim, Y. Hong, M. Yun, J.J. Min, S.J. Kwak, H.E. Choy, A novel balanced-lethal host-vector system based on glmS, PLoS One 8(3) (2013) e60511. D. Lim, K. Kim, T. Duysak, E. So, J.H. Jeong, H.E. Choy, Bacterial cancer therapy using the attenuated fowl-adapted Salmonella enterica serovar Gallinarum, Mol Ther Oncolytics 31 (2023) 100745. Additional Declarations No competing interests reported. Supplementary Files 251008Supplementalinformation.docx Additional File 1 File name: Additional File 1 Format: .pdf Title: Supplementary data. Description: Table S1 and Figure S1. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7854761","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":551583814,"identity":"6e4247cb-6f8a-46f8-9469-a7c6e9fc3e7f","order_by":0,"name":"Seyeon Hong","email":"","orcid":"","institution":"Kangwon National University","correspondingAuthor":false,"prefix":"","firstName":"Seyeon","middleName":"","lastName":"Hong","suffix":""},{"id":551583817,"identity":"f4acc43c-b26e-4efa-bd04-bf06facc9875","order_by":1,"name":"Sung-Gwon Lee","email":"","orcid":"","institution":"National Institutes of Health","correspondingAuthor":false,"prefix":"","firstName":"Sung-Gwon","middleName":"","lastName":"Lee","suffix":""},{"id":551583818,"identity":"59be6d08-8d51-439d-ab95-61ac06fddf9a","order_by":2,"name":"Dogeun Lee","email":"","orcid":"","institution":"Kangwon National University","correspondingAuthor":false,"prefix":"","firstName":"Dogeun","middleName":"","lastName":"Lee","suffix":""},{"id":551583819,"identity":"d0105181-f50c-487c-a229-942e86886a76","order_by":3,"name":"Jihyeon Kim","email":"","orcid":"","institution":"Kangwon National University","correspondingAuthor":false,"prefix":"","firstName":"Jihyeon","middleName":"","lastName":"Kim","suffix":""},{"id":551583820,"identity":"b3defbf3-9f72-48d9-8501-5fd74d25ee46","order_by":4,"name":"Miryoung Song","email":"","orcid":"","institution":"Hankuk University of Foreign Studies","correspondingAuthor":false,"prefix":"","firstName":"Miryoung","middleName":"","lastName":"Song","suffix":""},{"id":551583821,"identity":"3fc70bb2-de0b-42e2-8a34-3e0a587dc279","order_by":5,"name":"Daejin LIM","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAy0lEQVRIiWNgGAWjYBACPmYgwVORgCTEQ0ALG1jLGZK0gAjeNpK0sHMnMLydlyZvzr/G8HEBg508A8/ZBwQcxruBce62HMOdM94YG89gSDZs4G03IKiFmXdbBeOGG2e3SfMwMCcw8LMRcBhYy5wKe6iWemK1NOQkbjjfC9JyOAEYGIS1HJxzLC15ww3+z8Y8BscN23iO4dfCz39244M3Ncm2G84fS3zMU1Etz8+Thl8LCBwAkxIJQMIAGlPEAf4DxKsdBaNgFIyCkQUAtKM51sikVacAAAAASUVORK5CYII=","orcid":"","institution":"Kangwon National University","correspondingAuthor":true,"prefix":"","firstName":"Daejin","middleName":"","lastName":"LIM","suffix":""}],"badges":[],"createdAt":"2025-10-14 06:23:36","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7854761/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7854761/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":96995018,"identity":"dd29aa2d-dbee-4338-8f0c-e49833873886","added_by":"auto","created_at":"2025-11-28 12:06:35","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18206068,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/49737e1f368457dfdcde83f9.tif"},{"id":96995022,"identity":"956a3921-41c8-4cb8-8824-b9431cbf29c4","added_by":"auto","created_at":"2025-11-28 12:06:35","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":139764,"visible":true,"origin":"","legend":"","description":"","filename":"251008Mainscrpits.docx","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/16c24921da8692d7388af795.docx"},{"id":97137280,"identity":"320b684d-586a-428f-bf1a-c7c29c3314ac","added_by":"auto","created_at":"2025-12-01 09:57:32","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":19316228,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/354b0d081ba194da8400a9c0.tif"},{"id":97139094,"identity":"1a25c94d-328d-4739-bcce-2aee1d8fd113","added_by":"auto","created_at":"2025-12-01 09:59:38","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22079736,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/8914e29c6ef613490013b2b1.tif"},{"id":96995032,"identity":"d6186420-1d0a-4e0b-8bf4-2fdcf625a0a7","added_by":"auto","created_at":"2025-11-28 12:06:35","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14634008,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/34b028788790c584bdb4973e.tif"},{"id":97139792,"identity":"9d45b356-ee65-4469-840e-3f7fe2dfab52","added_by":"auto","created_at":"2025-12-01 10:02:31","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7702020,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.5.tif","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/62333ce2a88d5505ff82cf16.tif"},{"id":97139188,"identity":"fb987835-37b1-4a73-9e5a-03d36caf95d3","added_by":"auto","created_at":"2025-12-01 09:59:44","extension":"json","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8369,"visible":true,"origin":"","legend":"","description":"","filename":"66b8f542db0349a4a9a573cc5b68de7a.json","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/0e89f5154d6fe5b0f1c18325.json"},{"id":96995033,"identity":"2ab5be9d-0f84-4d0f-879e-dac49a75bc3b","added_by":"auto","created_at":"2025-11-28 12:06:35","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2519596,"visible":true,"origin":"","legend":"","description":"","filename":"251008Supplementalinformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/434c8c9aa9f9abaf429a4122.docx"},{"id":96995019,"identity":"3338f961-ac05-4f6a-9bd4-d896ae0aa049","added_by":"auto","created_at":"2025-11-28 12:06:35","extension":"xml","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":163203,"visible":true,"origin":"","legend":"","description":"","filename":"66b8f542db0349a4a9a573cc5b68de7a1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/a3f8a345a60302cf91706b01.xml"},{"id":96995028,"identity":"af02b925-2dfb-4867-ac24-c70f31b88cfe","added_by":"auto","created_at":"2025-11-28 12:06:35","extension":"tif","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18206068,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/00edf9f603a1bb32f6f62555.tif"},{"id":96995045,"identity":"4df7fbee-bc3b-477d-87fb-64fb1eb5a202","added_by":"auto","created_at":"2025-11-28 12:06:36","extension":"tif","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":19316228,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/3e39a47dbad893411535ae24.tif"},{"id":97137820,"identity":"178d1c6b-d164-49a4-9920-94ed96cb1214","added_by":"auto","created_at":"2025-12-01 09:58:11","extension":"tif","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22079736,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/c7cf8f0ea2f3413a72037869.tif"},{"id":96995041,"identity":"11fb1edf-7b68-44ae-bb43-9ff0282b16e8","added_by":"auto","created_at":"2025-11-28 12:06:36","extension":"tif","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14634008,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/92b3cf05161440a407eaf6bb.tif"},{"id":96995037,"identity":"5606087f-39b0-4fd7-bddc-6e92bf91e9e9","added_by":"auto","created_at":"2025-11-28 12:06:36","extension":"tif","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7702020,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.5.tif","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/0d0ed0e2420726ecada06d2d.tif"},{"id":96995038,"identity":"5375f885-b677-4499-b625-76697b1386fe","added_by":"auto","created_at":"2025-11-28 12:06:36","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":125136,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/7f64b42a51d86c2e2cfe011f.png"},{"id":96995036,"identity":"7e8f8bd8-37b6-443d-9567-22fb782a6df3","added_by":"auto","created_at":"2025-11-28 12:06:35","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":100450,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/2972ef3bad635d64b2a563b0.png"},{"id":96995035,"identity":"08a7491d-bab0-4dbc-8586-51ad88684c50","added_by":"auto","created_at":"2025-11-28 12:06:35","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":60262,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/9d9bb90f81616303368d0208.png"},{"id":97139154,"identity":"81f1d288-9668-4ff9-ba33-5db0e0eae65e","added_by":"auto","created_at":"2025-12-01 09:59:42","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":125800,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/ad0963aabe8182989c90f97f.png"},{"id":96995040,"identity":"85b47c91-220c-4307-9c28-8489b7054e76","added_by":"auto","created_at":"2025-11-28 12:06:36","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":48438,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/b9b633d0113a26d29f6ef374.png"},{"id":96995042,"identity":"3c208650-75ec-4b7d-a399-417bf74a63d2","added_by":"auto","created_at":"2025-11-28 12:06:36","extension":"xml","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":163643,"visible":true,"origin":"","legend":"","description":"","filename":"66b8f542db0349a4a9a573cc5b68de7a1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/a34b16c309e53bc5dd7347dd.xml"},{"id":96995044,"identity":"8b21dd95-f1cc-408a-86a6-10db48e75637","added_by":"auto","created_at":"2025-11-28 12:06:36","extension":"html","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":176217,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/4fd7858d42b9753aef6d1362.html"},{"id":96995016,"identity":"fd2d0354-c36f-47b1-a353-811a26d4de63","added_by":"auto","created_at":"2025-11-28 12:06:34","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":951867,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscriptome analysis demonstrating high tumor-specific expression of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ecsrB\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e \u003cstrong\u003e(A)\u003c/strong\u003e Schematic of experimental design for transcriptome analysis. \u003cem\u003eE. coli\u003c/em\u003e K-12 MG1655 was intravenously injected into CT26-engrafted mice (1 × 10\u003csup\u003e8\u003c/sup\u003e CFU/mouse). Liver and tumor tissue were harvested at 1 and 3 d post injection (dpi). \u003cstrong\u003e(B) \u003c/strong\u003ePercentage of reads aligned to the \u003cem\u003eE. coli\u003c/em\u003e genome out of the reads that remained unmapped to the mouse genome.\u003cstrong\u003e \u003c/strong\u003eError bars, SD. \u003cstrong\u003e(C)\u003c/strong\u003e Numbers of genes expressed in each group, categorized by tissue type and time-point. \u003cstrong\u003e(D)\u003c/strong\u003e Principal component analysis results, showing clustering of samples based on their \u003cem\u003eE.coli\u003c/em\u003e gene expression profiles, highlighting differences between tissue types and time-points. \u003cstrong\u003e(E)\u003c/strong\u003e Log\u003csub\u003e2\u003c/sub\u003eFC of gene expression at 3 dpi against log\u003csub\u003e2\u003c/sub\u003eFC of tumor versus liver gene expression at 1 dpi. Red dots, genes significantly differentially expressed between tumor and liver tissue, with elevated expression in tumor tissue 3 dpi. \u003cstrong\u003e(F)\u003c/strong\u003e Relative expression of \u003cem\u003ecsrB\u003c/em\u003e normalized against 16S rRNA, based on qPCR and quantified using \u003csub\u003eΔΔ\u003c/sub\u003eCt values. Measurements were performed in quadruplicate. Data are presented as the ratio of \u003cem\u003ecsrB\u003c/em\u003e expression to 16S rRNA expression (AU, Arbitrary Units). (***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0005)\u003c/p\u003e","description":"","filename":"Fig.1.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/44db9b2838b10783683e2aab.jpg"},{"id":96995024,"identity":"d2cf203f-d2aa-4b5e-b634-a017e0128502","added_by":"auto","created_at":"2025-11-28 12:06:35","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":911568,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMetabolic profiling indicating acetate-mediated activation of the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ecsrB\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e promoter and TP secretion. (A-B)\u003c/strong\u003e BALB/c mice were subcutaneously implanted with 1 × 10\u003csup\u003e6\u003c/sup\u003e CT26 colon carcinoma cells (n = 3 per group) on the upper flank. Tissue samples (n = 3) were collected when the tumor volume reached 100–150 mm³. \u003cstrong\u003e(A)\u003c/strong\u003e Acetate concentrations (nmol/mg tissue) were measured in the indicated tissues. \u003cstrong\u003e(B)\u003c/strong\u003e Acetate-to-glucose ratio was calculated by dividing the acetate concentration (nmol/mg) by the glucose concentration (nmol/mg) for each tissue. \u003cstrong\u003e(C)\u003c/strong\u003e Relative gene expression (in AU, arbitrary units), based on \u003csub\u003eΔΔ\u003c/sub\u003eCt values in bacterial samples, calculated for both the exponential (E) and stationary phases (S), measured via qPCR and normalized against the housekeeping gene 16S rRNA. Relative expression = \u003cem\u003ecsrB\u003c/em\u003e expression / 16S rRNA expression. The assay was performed in triplicate. \u003cstrong\u003e(D)\u003c/strong\u003e \u003cem\u003ecsrB\u003c/em\u003e promoter activity (in Miller units) in bacterial samples, calculated for both the exponential (E) and stationary (S) phases, based on the growth curve, and measured via β-galactosidase assay. Promoter activity = A420 / ΔT(min) / A600. Light Grey is LB media, Grey is M9 minima media with 0.4% Glucose, Dark Grey is M9 minima media with 50mM pyruvate, Black is minimal media with 50mM acetate. The assay was calculated in triplicate. For both the MG1655 and ESY002 strains, in LB or M9 minimal medium, the media were supplemented with 0.4% glucose, 50 mM sodium pyruvate, or 50 mM sodium acetate at 37 °C. \u003cstrong\u003e(E)\u003c/strong\u003e Schematic of the plasmid map of the P\u003csub\u003ecsrB\u003c/sub\u003e–psp–TP construct (ESY004).\u003cstrong\u003e (F) \u003c/strong\u003eSecretion of TGFα–PE38 (TP) \u003cem\u003ein vitro\u003c/em\u003e. ESY004 was cultured in LB broth with 50mM acetate and samples were cultivated for the specified durations. Bacterial samples were centrifuged to separate the supernatants and pellets. The entire protein was loaded onto 10% SDS-PAGE gels to detect TP (48 kDa) via western blotting, using an antibody against \u003cem\u003ePseudomonas\u003c/em\u003e exotoxin. The efficacy of bacterial lysis was assessed using GroEL (58.3 kDa) as a cytosolic protein control. hpi, hours post inoculation; W, whole bacteria; P, pellet; S, supernatant. Data are presented as mean (SD) (\u003cem\u003en\u003c/em\u003e = 3 per group). (*\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0345, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0086, ***\u003cem\u003eP\u003c/em\u003e = 0.0002, ****\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001)\u003c/p\u003e","description":"","filename":"Fig.2.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/b2a4b2765f278631511e586c.jpg"},{"id":97139320,"identity":"27603e0d-aaa8-490d-bbb9-06c190ea6321","added_by":"auto","created_at":"2025-12-01 10:00:01","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":611621,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCell line-based immunotoxin functional test of cytotoxicity. \u003c/strong\u003eBacterial supernatants from the MG1655 or ESY004 \u003cem\u003eE. coli\u003c/em\u003e strains were harvested 48 h post bacterial inoculation. The proteins were concentrated via centrifugation and filtration. The CT26 LLCI, MC38 (A), B16F10 and SW620 (B) cell lines were seeded in 96-well microplates at 2 × 10\u003csup\u003e3\u003c/sup\u003e cells per well. B16F10 and SW620 cells, which have lower levels of EGFR, were used as the negative controls. Upon reaching a cell density of approximately 10\u003csup\u003e4\u003c/sup\u003e cells per well, bacterial supernatants containing 18 µg protein were administered to the adherent cells. Following a 2 d incubation period, 10 µL of MTT solution was introduced, followed by incubation for 3 h. Subsequently, sample absorbance was measured at OD\u003csub\u003e570\u003c/sub\u003e using a microplate reader. Data are presented as mean ± SD (\u003cem\u003en\u003c/em\u003e = 3 per group). AU (as %) = A570\u003csub\u003eMG1655 or \u003c/sub\u003e\u003csub\u003e\u003cem\u003ecsrB\u003c/em\u003e\u003c/sub\u003e\u003csub\u003e \u003c/sub\u003e/ A570\u003csub\u003ePBS\u003c/sub\u003e × 100. (*\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.005)\u003c/p\u003e","description":"","filename":"Fig.3.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/100704ab369a575bc86ede5b.jpg"},{"id":96995031,"identity":"44cd4c6f-5eba-4f97-be0d-d2b226eeaec8","added_by":"auto","created_at":"2025-11-28 12:06:35","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":800917,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eIn vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e analysis revealing \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ecsrB\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e promoter–driven TP expression and tumor regression in CT26-engrafted mice.\u003c/strong\u003e BALB/c mice were subcutaneously implanted with 1 × 10\u003csup\u003e6\u003c/sup\u003e CT26 colon carcinoma cells (\u003cem\u003en =\u003c/em\u003e 5 per group) on the upper flank. The bacteria were injected into the tail vein of mice bearing CT26 tumors (1 × 10\u003csup\u003e8\u003c/sup\u003e CFU/mouse). On the specified days, the tumors were excised, homogenized, centrifuged, and filtrated to isolate the supernatants. (A) Schematic of the experimental design for monitoring CT26-engrafted mice (1 × 10\u003csup\u003e8\u003c/sup\u003e CFU/mouse) after bacterial injection. (B) TP expression \u003cem\u003ein vivo\u003c/em\u003e. Western blotting was performed to detect TP, with β-actin (42 kDa) serving as the loading control. The control panel comprised bacteria cultivated in LB broth, sampled during the stationary phase. Lane N (Negative control), MG1655; lane P (Positive control), ESY004 (α, antibody). (C) Upon reaching tumor volumes of 80–120 mm\u003csup\u003e3\u003c/sup\u003e, the mice were intravenously administered PBS (grey line), \u003cem\u003eE. coli\u003c/em\u003e WT (black line), or ESY004 (red line) at 1 × 10\u003csup\u003e8\u003c/sup\u003e CFU/mouse. The average tumor dimensions in each cohort of CT26-engrafted mice were documented twice daily after treatment with the modified bacteria until the tumor volume reached 1500 mm\u003csup\u003e3\u003c/sup\u003e. (D) Representative images of CT26 carcinoma cells in the treated mice. (**\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.005, ****\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001)\u003c/p\u003e","description":"","filename":"Fig.4.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/1b765578b3edd0159b9a4cfe.jpg"},{"id":96995034,"identity":"271951bd-ce96-4a97-bb00-64b9d96bcbab","added_by":"auto","created_at":"2025-11-28 12:06:35","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":425899,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIn vivo assessment highlighting survival gain through apoptosis-associated gene regulation in CT26-engrafted mice. \u003c/strong\u003eBALB/c mice were subcutaneously implanted with 1 × 10\u003csup\u003e6\u003c/sup\u003e CT26 colon carcinoma cells (\u003cem\u003en =\u003c/em\u003e 5 per group) on the upper flank. Mice bearing CT26 tumors were intravenously injected via the tail vein with 1 × 10\u003csup\u003e8\u003c/sup\u003e CFU of PBS, \u003cem\u003eE. coli\u003c/em\u003e MG1655 K-12 (WT), ESY004. \u003cstrong\u003e(A)\u003c/strong\u003e Kaplan–Meier survival curves of CT26 tumor–engrafted mice following bacterial administration. Treatments were initiated when tumor volumes reached 80–120 mm\u003csup\u003e3\u003c/sup\u003e. \u003cstrong\u003e(B-C)\u003c/strong\u003e On the specified days, tumors and spleens were excised, and total RNA was extracted from each tissues. \u003cstrong\u003e(B)\u003c/strong\u003e The relative mRNA expression levels of \u003cem\u003eBax\u003c/em\u003e and \u003cem\u003eBcl-2\u003c/em\u003e in tumor tissue were quantified by qPCR and normalized to GAPDH. \u003cstrong\u003e(C)\u003c/strong\u003e The relative mRNA expression levels of TNFα in spleen tissue were quantified by qPCR and normalized to GAPDH. Data are presented as mean ± SD (\u003cem\u003en\u003c/em\u003e = 3 per group). (** P \u0026lt; 0.0023, *** P = 0.0005, **** P \u0026lt; 0.0001)\u003c/p\u003e","description":"","filename":"Fig.5.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/a8905869abf30e16662a7dcf.jpg"},{"id":98622705,"identity":"94544c0a-969d-4140-bdde-a5a1a332dc89","added_by":"auto","created_at":"2025-12-19 17:01:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4978276,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/03617020-81bc-4fc9-9284-4d1c92c09237.pdf"},{"id":96995026,"identity":"e324be87-1d25-4ff1-948a-1db7d4c9e740","added_by":"auto","created_at":"2025-11-28 12:06:35","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2519596,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAdditional File 1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFile name: Additional File 1\u003c/p\u003e\n\u003cp\u003eFormat: .pdf\u003c/p\u003e\n\u003cp\u003eTitle: Supplementary data.\u003c/p\u003e\n\u003cp\u003eDescription: Table S1 and Figure S1.\u003c/p\u003e","description":"","filename":"251008Supplementalinformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-7854761/v1/4bca6fc407558af39a035599.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Antitumor Immunotoxin Activity is Enhanced by Escherichia coli csrB-Promoter Expression","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eDeveloping effective cancer treatment remains challenging owing to limitations in existing approaches [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], and traditional chemotherapy lacks specificity, resulting in systemic toxicity, immunosuppression, and organ damage [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Immunotherapy, although more targeted, can be compromised by tumor-driven immune invasion and off-target immune activation, diminishing effectiveness [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Recombinant immunotoxins, in contrast, combine targeted oncotherapy with potent cytotoxic effects, offering a promising solution that addresses the shortcomings of nonspecific treatments like chemotherapy. These agents comprise a cancer-targeting moiety (such as a monoclonal antibody fragment, cytokine, or growth factor) linked to a cytotoxic protein [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], enabling precise tumor-targeting while minimizing off-target effects [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eA key principle of this strategy is the selective delivery of toxins to cancer cells, mediated by the targeting component, enabling their precise destruction [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Most tumor cells arise from mutations in growth factor receptors, with epidermal growth factor receptor (EGFR) overexpression being central to cancer progression [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The recombinant immunotoxin TGFα\u0026ndash;PE38 (hereafter, \u0026ldquo;TP\u0026rdquo;) addresses this by combining transforming growth factor alpha (TGFα), a potent EGFR agonist, with PE38, a modified version of \u003cem\u003ePseudomonas\u003c/em\u003e exotoxin A [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. TP specifically targets EGFR-expressing tumors, utilizing TGFα to bind to EGFR and delivering PE38, which disrupts protein synthesis in mammalian cells, thereby inducing cancer-cell death [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Immunotoxins, including TP, offer various benefits: they exhibit high specificity for cancer cells; they reduce collateral damage and systemic toxicity [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]; and their modular design supports their broad applicability across cancer types [\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Despite these benefits, the application of immunotoxins remains challenging, first because their limited in vivo stability necessitates their repeated administration [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], and second because immune responses lead to the development of neutralizing antibodies, compromising their effectiveness [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eBacterial oncotherapy has emerged as an innovative approach to overcome these challenges [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Tumor-targeting bacteria thrive in the hypoxic and nutrient-deprived conditions within the tumor microenvironment (TME), where they selectively replicate within tumors, thus amplifying their therapeutic effects [\u003cspan additionalcitationids=\"CR21\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Bacteria can enhance antitumor immunity by modulating the immune microenvironment and promoting immune-cell recruitment [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Importantly, bacteria can serve as a platform for immunotoxin delivery, addressing stability- and delivery-related issues associated with protein-based therapies [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. However, bacterial oncotherapy is limited by its reliance on exogenous signals, such as inducers like L-arabinose, to regulate gene expression [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. However, continuous administration of such inducers is impractical, limiting the clinical feasibility of bacterial oncotherapy [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. To address this, researchers are exploring auto-inducing systems that leverage endogenous signals present in the TME, providing a more sustainable and effective method for regulating therapeutic protein expression.\u003c/p\u003e\u003cp\u003eThe TME exhibits distinct metabolic characteristics, including the accumulation of metabolites such as lactate and acetate [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Acetate, a key metabolite in bacterial metabolism and precursor for acetyl-CoA production, activates the BarA/UvrY bacterial two-component regulatory system in acetate-rich environments [\u003cspan additionalcitationids=\"CR32\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. BarA/UvrY detects acetate as a signal, triggering a cascade that upregulates the \u003cem\u003ecsrB\u003c/em\u003e promoter and enables sustained gene expression [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. This system is crucial for bacterial adaptation in diverse conditions, as it regulates gene expression in response to environmental signals [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Within the TME, competition for nutrients between tumor and immune cells leads to nutrient depletion, further upregulating \u003cem\u003ecsrB\u003c/em\u003e [\u003cspan additionalcitationids=\"CR37\" citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Acetate, which is particularly abundant in the TME, is a significant signal for \u003cem\u003eBarA\u003c/em\u003e activation [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Upon detecting acetate, \u003cem\u003eBarA\u003c/em\u003e autophosphorylates and transfers a phosphate group to \u003cem\u003eUvrY\u003c/em\u003e [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. The phosphorylated \u003cem\u003eUvrY\u003c/em\u003e then binds to the \u003cem\u003ecsrB\u003c/em\u003e promoter, significantly enhancing its transcription and regulating bacterial gene expression, allowing cellular responses to acetate and potentially influencing tumor-specific adaptation [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eBuilding on these insights, this study aims to utilize the \u003cem\u003ecsrB\u003c/em\u003e promoter to develop an autoinducer-based expression platform for bacterial oncotherapy. By exploiting the ability of bacteria to sense and respond to acetate in the TME, this platform overcomes the limitations imposed by the need for exogenous inducers. In bacterial oncotherapy, this versatile platform, adapted to the dynamic metabolic conditions of tumors, enables tumor-specific, sustained immunotoxin expression, offering a robust and adaptable approach for precise therapeutic delivery.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eBacterial strains and plasmids\u003c/h2\u003e\u003cp\u003eThe bacterial strains and plasmids used here are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The wild-type strain, \u003cem\u003eE. coli\u003c/em\u003e K-12 MG1655, was cultured in Luria\u0026ndash;Bertani (LB) broth with high salt content (MB Cell, Republic of Korea; MB-L4488). The P\u003csub\u003ecsrB\u003c/sub\u003e-lacZY plasmid was constructed using the Gibson assembly protocol. \u003cem\u003ecsrB\u003c/em\u003e contains a promoter region and an open reading frame. The \u003cem\u003ecsrB\u003c/em\u003e promoter, which contains Fis-binding sites within the upstream activation region (\u0026minus;\u0026thinsp;300 to +\u0026thinsp;100 bp, relative to the GTG start codon), was amplified from the chromosome of \u003cem\u003eE. coli\u003c/em\u003e K-12 MG1655 and cloned into the pRS415 vector to create a transcriptional lacZY reporter plasmid. The P\u003csub\u003ecsrB\u003c/sub\u003e\u0026ndash;psp\u0026ndash;TP plasmid was assembled using the Gibson Assembly Master Mix (New England Biolabs, Ipswich, MA; M5510AA). The \u003cem\u003ecsrB\u003c/em\u003e promoter segment was amplified from the chromosome of \u003cem\u003eE. coli\u003c/em\u003e K-12 MG1655 and integrated into the secretion-tag gene and antitumor protein (psp\u0026ndash;TP) to replace the araBAD promoter sequence in the araBAD\u0026ndash;psp\u0026ndash;TP plasmid. The specific primer sets used for amplification are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Plasmid construction was confirmed via DNA sequencing (Macrogen, Seoul, Republic of Korea), and plasmids were introduced into \u003cem\u003eE. coli\u003c/em\u003e via heat-shock transformation.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eBacterial strains and plasmids used.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eStrain\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDescription\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReference\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMG1655\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eWild-Type\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eESY002\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMG1655, P\u003csub\u003ecsrB\u003c/sub\u003e-lacZY,\u0026nbsp;Amp\u003csup\u003er\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eESY004\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMG1655, P\u003csub\u003ecsrB\u003c/sub\u003e-psp-TP,\u0026nbsp;Amp\u003csup\u003er\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePlasmid\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDescription\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReference\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epSY009\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003elacZY\u0026nbsp;under control of P\u003csub\u003ecsrB\u003c/sub\u003e\u0026nbsp;in pRS415 (P\u003csub\u003ecsrB\u003c/sub\u003e-lacZY,\u0026nbsp;Amp\u003csup\u003er\u003c/sup\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epSY002\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003epsp-TP under control of P\u003csub\u003ecsrB\u003c/sub\u003e\u0026nbsp;in pBAD24 (P\u003csub\u003ecsrB\u003c/sub\u003e-psp-TP,\u0026nbsp;Amp\u003csup\u003er\u003c/sup\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eSpecific primer sequences for engineering plasmids\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePlasmid\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eName and Direction\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSequence\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epSY009\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003elacZY vector Forward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGTTTCAGGGAAAGGCTTCTGGATGAAGCGAGCGGCGACGCGCAGTTAATC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003elacZY vector Reverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTTACGTGTTCCCAGCGTCTCTTTGCACACTTTCATCGGTTGTCCGGATCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ecsrB insert Forward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAATTCCCGGGGATCCGGACAACCGATGAAAGTGTGCAAAGAGACGCTGGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ecsrB insert Reverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCGGCTGTGGGATTAACTGCGCGTCGCCGCTCGCTTCATCCAGAAGCCTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epSY002\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003epsp vector Forward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCGATCTAGATTTAAGAAGGAGATATACATATGGGTTTGAAGATGAAGAAAAGATCAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003epsp vector Reverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATCCGCCAAAACAGCCAAGCTTGGCTGCAGTTACTTCAGGTCCTCGCGCG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ecsrB insert Forward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCAAACCGCCGCGCGAGGACCTGAAGTAACTGCAGCCAAGCTTGGCTGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ecsrB insert Reverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCCTGATCTTTTCTTCATCTTCAAACCCATATGTATATCTCCTTCTTAAATCTAGATCGCTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eCulture conditions\u003c/h3\u003e\n\u003cp\u003eBacterial strains harboring the plasmid were cultured in LB broth at 37\u0026deg;C with vigorous shaking. Ampicillin (Sigma-Aldrich, St Louis, MO; A9518-25G) was added at 100 \u0026micro;g/mL when necessary. \u003cem\u003eE. coli\u003c/em\u003e K-12 MG1655 and its plasmid-carrying derivatives were cultured in M9 Minimal Medium (M9MM) (Welgene, Gyeongsan, Republic of Korea, MM003-01) supplemented with 1 M MgSO\u003csub\u003e4\u003c/sub\u003e (Thermo Fisher Scientific, Waltham, MA; 033337.36) and 1 M CaCl\u003csub\u003e2\u003c/sub\u003e (Daejung, Republic of Korea, 10035-04-8), prepared according to the manufacturer\u0026rsquo;s protocol (Sigma-Aldrich). The medium was supplemented with 0.4% glucose (Sigma-Aldrich; 50-99-7), 50 mM sodium pyruvate (Sigma-Aldrich; 113-24-6), and 50 mM sodium acetate (Sigma-Aldrich; 127-09-3). Casamino acid (0.1%; MB Cell; MB-C1656) and 0.005% L-tryptophan (MB Cell; MB-T4863) were used instead of casein enzyme hydrolysate to create suitable growth conditions for analyzing gene expression, lacZ expression, and secretion efficiency.\u003c/p\u003e\n\u003ch3\u003eCell Culture\u003c/h3\u003e\n\u003cp\u003eCT26 colon carcinoma, MC38 colon carcinoma, LLC1 lung carcinoma, and B16F10 skin melanoma cells, all sourced from American Type Culture Collection (ATCC) Korea, were cultured in high-glucose Dulbecco\u0026rsquo;s Modified Eagle Medium (Corning, New York, NY; 10-013-CV) supplemented with 10% fetal bovine serum (FBS) (Corning; 35-015-CV) and 1% penicillin\u0026ndash;streptomycin (Corning; 30-002-CI). SW620 colon carcinoma cells (ATCC Korea) were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (Corning; 10-040-CV) supplemented with 10% FBS and 1% penicillin\u0026ndash;streptomycin.\u003c/p\u003e\n\u003ch3\u003eExperimental animals\u003c/h3\u003e\n\u003cp\u003e Experiments were conducted using female BALB/c mice (6 weeks old, 18\u0026ndash;20 g; Samtako, Seoul, Republic of Korea) in accordance with the guidelines of the Institutional Animal Care and Use Committee of Kangwon National University (approval number KW-230428-2). Each mouse received a subcutaneous injection of 1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e CT26 cells suspended in 30 \u0026micro;L of 1\u0026times; PBS into the right thigh. Bacterial administration was initiated once the tumors reached 80\u0026ndash;100 mm\u003csup\u003e3\u003c/sup\u003e. To investigate the antitumor effects of the TP immunotoxin, mice implanted with CT26 cells were intravenously injected with MG1655 cells carrying P\u003csub\u003ecsrB\u003c/sub\u003e\u0026ndash;psp\u0026ndash;TP (1 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e colony-forming units [CFU]/mouse) via the tail vein. Tumor size was monitored by measuring the length, width, and height of each tumor every 2 d post-injection (dpi). Tumor volume was calculated as Volume\u0026thinsp;=\u0026thinsp;length \u0026times; width \u0026times; height \u0026times; 0.5. The mice were euthanized when the implanted tumor reached\u0026thinsp;\u0026gt;\u0026thinsp;1500 mm\u003csup\u003e3\u003c/sup\u003e.\u003c/p\u003e\n\u003ch3\u003ePreparation for RNA extraction and cDNA synthesis\u003c/h3\u003e\n\u003cp\u003eRNA was extracted from the mouse tumor, liver, and spleen tissue at 1 and 3 d after \u003cem\u003eE. coli\u003c/em\u003e injection. The excised tissue was promptly preserved at \u0026minus;\u0026thinsp;80\u0026deg;C in 1 mL tubes to maintain RNA integrity.\u003c/p\u003e\u003cp\u003eDuring the exponential and stationary phases, RNA was extracted from \u003cem\u003eE. coli\u003c/em\u003e K-12 MG1655 cells grown in each medium. Bacterial cultures of \u003cem\u003eE. coli\u003c/em\u003e K-12 MG1655 were cultivated in LB medium and were sampled at 2 h post-inoculation (hpi) for the exponential (E) phase and 6 hpi for the stationary (S) phase. Bacteria were also cultured in M9MM supplemented with either 0.4% glucose, 50 mM sodium pyruvate, or 50 mM sodium acetate, and were sampled at 6 hpi (E) and 9 hpi (S), 5 hpi (E) and 11 hpi (S), and 7 hpi (E) and 11 hpi (S), respectively, facilitating examination of \u003cem\u003ecsrB\u003c/em\u003e gene expression dynamics. RNA was extracted from each sample using the Mornach Total RNA Miniprep Kit (New England Biolabs; T2010S). Extracted RNA integrity and quantity were validated using a NanoDrop spectrophotometer (Thermo Fisher Scientific). cDNA synthesis was initiated using 1\u0026ndash;5 \u0026micro;g of total RNA, reverse transcriptase, and random hexamer primers, using by the TOPscript cDNA Synthesis Kit (Enzynomics, Daejeon, Republic of Korea; EZ005S), thus ensuring the acquisition of the high-quality cDNA templates essential for downstream gene expression analysis.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eQuantitative PCR\u003c/h2\u003e\u003cp\u003eFor qPCR, a 20 \u0026micro;L reaction mixture was prepared, comprising 30 ng of template cDNA, a primer set (0.25 \u0026micro;M each), and 10 \u0026micro;L of TOPreal 2\u0026times; SYBR Green qPCR PreMix (Enzynomics; RT500M). qPCR was conducted using a Rotor-GenQ Real-Time PCR system (Qiagen, Hilden, Germany) with the following cycling conditions: initial denaturation at 95\u0026deg;C for 15 min, followed by 40 cycles of denaturation at 95\u0026deg;C for 10 s, annealing at 60\u0026deg;C for 15 s, and elongation at 72\u0026deg;C for 15 s. Cycle threshold (Ct) values were normalized using the housekeeping gene, via the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method. All reactions were performed in quadruplicate to ensure robustness and accuracy of the relative gene expression measurements. The primer sequences used are listed in Additional File 1, Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eAssessment of glucose and acetate metabolites in vivo\u003c/h3\u003e\n\u003cp\u003eColorimetric assay kits were used to quantify the concentration of glucose (Abcam, Cambridge, UK, ab169559) and acetate (Abcam, ab2047190) in tissue. Freshly harvested tissue was lysed and processed according to the manufacturer\u0026rsquo;s protocols. Metabolite concentrations were determined based on standard curves and expressed as nanomoles per gram of tissue.\u003c/p\u003e\n\u003ch3\u003eβ-galactosidase assay to verify the pattern of promoter activity\u003c/h3\u003e\n\u003cp\u003eBacteria carrying the plasmid P\u003csub\u003ecsrB\u003c/sub\u003e-lacZY were cultured overnight, then subcultured into 50 mL fresh LB medium or M9MM supplemented with 0.4% glucose, 50 mM sodium pyruvate, or 50 mM sodium acetate (dilution 1:100). Throughout the culture period, samples were collected at various intervals for assessment of optical density at 600 nm using a spectrophotometer (Biochrom, Cambridge, UK). The β-galactosidase assay was performed as described by Miller in 1972 [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e], using cells permeabilized with Koch\u0026rsquo;s lysis buffer. β-galactosidase activity (in Miller units) was calculated as A420 / △T (min) / A600 \u0026times; 1000. The bacterial samples were harvested at the same time as the samples for RNA extraction.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eRNA sequencing and analysis\u003c/h2\u003e\u003cp\u003eAt 1 and 3 d after \u003cem\u003eE. coli\u003c/em\u003e administration, total RNA was extracted from the liver and tumor tissue. RNA quantification and purity assessment were conducted using a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). Sequencing libraries were prepared from 1 \u0026micro;g of total RNA from each sample, using the Illumina TruSeq Stranded Total RNA LT Sample Prep Kit (Illumina, San Diego, CA). The resulting cDNA libraries were sequenced on the NovaSeq platform (Illumina), generating approximately 8.65\u0026nbsp;billion paired-end reads of 101 nt each. Raw reads were quality-filtered and trimmed using Trimmomatic 0.36 with the following parameters: ILLUMINACLIP, TruSeq3-PE-2. fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Clean reads were then mapped to the mm10 mouse reference genome using HISAT 2.1.1, with the default settings [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Unmapped reads were extracted using SAMtools 1.9 and were remapped to the \u003cem\u003eE. coli\u003c/em\u003e K-12 MG1655 reference genome (ASM584v2) [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Reference genome data for the mice and \u003cem\u003eE. coli\u003c/em\u003e were obtained from the UCSC genome browser (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://genome.ucsc.edu\u003c/span\u003e\u003cspan address=\"https://genome.ucsc.edu\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and NCBI RefSeq (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/refseq\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/refseq\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), respectively. Gene expression levels were quantified using Cufflinks 2.1.1, with a false discovery rate\u0026thinsp;\u0026lt;\u0026thinsp;5% used as the threshold for differential gene expression [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Gene expression was log\u003csub\u003e2\u003c/sub\u003e-transformed for principal component analysis of \u003cem\u003eE. coli\u003c/em\u003e gene expression across samples, using the \u0026lsquo;prcomp\u0026rsquo; function in R. The threshold for gene expression was fragments per kilobase of transcript per million mapped reads (FPKM)\u0026thinsp;\u0026gt;\u0026thinsp;1. The liver samples were designated as controls because of the liver\u0026rsquo;s essential role in the early systemic response to infections and its established physiological functions (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eWestern blot analysis of secretion activity\u003c/h2\u003e\u003cp\u003eOvernight cultures of MG1655 carrying the P\u003csub\u003ecsrB\u003c/sub\u003e\u0026ndash;psp\u0026ndash;TP plasmid were sub-cultured in M9MM supplemented with 50 mM sodium acetate (dilution 1:100) and cultivated for the E and S phases for 9 and 48 h, respectively. At specific time-points, the pellets were harvested and resuspended in 1\u0026times; PBS (Welgene; ML008-02). The supernatants were obtained and subjected to filtration through 0.2 \u0026micro;m filters (GVS Filter Technology, Bologna, Italy; FJ13ASCCA002DL01). MG1655 strains carrying the P\u003csub\u003ecsrB\u003c/sub\u003e\u0026ndash;psp\u0026ndash;TP plasmid (1 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e CFU/mouse) were intravenously injected into CT26-tumor-engrafted mice once the tumors reached 100\u0026ndash;120 mm\u003csup\u003e3\u003c/sup\u003e. Tumor tissue was excised on predetermined days and homogenized in 1 mL Radioimmunoprecipitation assay buffer (Intron Biotechnology, Seongnam, Republic of Korea; IBS-BR002) supplemented with 1\u0026times; Protease \u0026amp; Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific; 1861281) and 1\u0026times; Ethylenediaminetetraacetic acid (Thermo Fisher Scientific; 1861274). After preparing the samples, the bacterial whole cells, pellets, and filtered supernatants were mixed with 5\u0026times; Sodium Dodecyl Sulfate Polyacrylamide (SDS) buffer and boiled at 100\u0026deg;C for 1 min.\u003c/p\u003e\u003cp\u003eProteins were separated using electrophoresis on 10% SDS-PAGE gels and transferred onto polyvinylidene fluoride membranes (Merck Millipore, Burlington, MA; IPVH00010). TP expression was assessed via western blotting using a primary polyclonal anti-rabbit antibody against PE38 (Merck Millipore; P2318-1ML, dilution 1:5000). Spontaneous bacterial lysis was examined using the anti-rabbit antibody GroEL (Merck Millipore; G6532-5mL, dilution 1:5000). The abundance of β-actin (Santa Cruz Biotechnology, Dallas, TX; sc-47778, dilution 1:2000) was determined using a specific mouse polyclonal antibody. Following overnight incubation at 4\u0026deg;C in primary antibodies diluted in Difco 5% skim milk (BD, Franklin Lakes, NJ; 0252038) in Tris-buffered saline and Tween 20 (TBST), the membranes were incubated for 1 h at room temperature in anti-mouse and anti-rabbit IgG-HRP antibodies (Cell Signaling Technology; 7076S and 7074S, respectively; dilution 1:2000). Proteins were visualized using ECL solution (Thermo Fisher Scientific; 32209).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eCell viability assay\u003c/h2\u003e\u003cp\u003eBacteria carrying the P\u003csub\u003ecsrB\u003c/sub\u003e\u0026ndash;psp\u0026ndash;TP plasmid were cultured overnight and then sub-cultured into 50 mL fresh LB medium supplemented with ampicillin (100 \u0026micro;g/mL; dilution 1:100) at 37\u0026deg;C in a shaking incubator. After 9 h of subculture, 50 mL of the bacterial broth was centrifuged at 4000 rpm for 20 min. To eliminate bacterial cells, the supernatant fractions were obtained by filtration through a 0.2 \u0026micro;m pore syringe filter (Sartorius, G\u0026ouml;ttingen, Germany; S6534). The supernatant filtrate was concentrated using Centricon columns (Merck Millipore; UFC900324). Total protein concentration was determined using the Bradford method [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. The CT26, LLCI, MC38, B16F10, and SW620 cell lines were seeded in 96-well microplates at 2 \u0026times; 10\u003csup\u003e3\u003c/sup\u003e cells per well. Upon reaching a cell density of 10\u003csup\u003e4\u003c/sup\u003e cells per well, bacterial supernatants containing 18 \u0026micro;g protein were administered to the adherent cells. Following a 2 d incubation period, 10 \u0026micro;L MTT solution (TCI Chemical, Tokyo, Japan; M3353) was introduced, and the cells were incubated for 3 h. Sample absorbance was measured at 575 nm using a microplate reader.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eAll experimental data were analyzed using GraphPad Prism 9.0 (GraphPad, San Diego, CA). Results are expressed as the mean (SD). Differences among groups were determined using two-way ANOVA followed by Tukey\u0026rsquo;s post hoc test. The log-rank (Mantel\u0026ndash;Cox) test was used to analyze survival data. Differences were considered significant at \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\u003c/div\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cb\u003eRNA-seq reveals elevated\u003c/b\u003e \u003cb\u003ecsrB\u003c/b\u003e \u003cb\u003eexpression in\u003c/b\u003e \u003cb\u003eE. coli\u003c/b\u003e \u003cb\u003einjected into the model mice\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe aimed to improve the therapeutic efficacy of TP by identifying TME-specific genes that are essential for utilizing intrinsic factors and that could maximize TP expression within bacterial cells. To achieve this, RNA-seq of bacterial genes was performed using liver and tumor tissue from a CT26 colorectal carcinoma xenograft mouse model after the introduction of the bacteria. The mice were intravenously injected with \u003cem\u003eE. coli\u003c/em\u003e K-12 MG1655, and the liver and tumor samples were collected at 1 and 3 d post-injection (dpi). In total, 22 samples (1 dpi livers, \u003cem\u003en\u0026thinsp;=\u003c/em\u003e\u0026thinsp;6; 1 dpi tumors, \u003cem\u003en\u0026thinsp;=\u003c/em\u003e\u0026thinsp;7; 3 dpi livers, \u003cem\u003en\u0026thinsp;=\u003c/em\u003e\u0026thinsp;3; and 3 dpi tumors, \u003cem\u003en\u0026thinsp;=\u003c/em\u003e\u0026thinsp;6) were analyzed. Following quality trimming, we obtained 248\u0026nbsp;million reads (98.3% of the total raw reads) with an average rate of alignment to the mm10 mouse reference genome of 75.0%. The unmapped reads were aligned to the \u003cem\u003eE. coli\u003c/em\u003e genome (ASM584v2), revealing a markedly higher alignment rate in tumor tissue than in liver tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Consistent with this, \u0026gt;\u0026thinsp;50% of the genes in the \u003cem\u003eE. coli\u003c/em\u003e genome were expressed in tumor tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). However, in the liver tissue, approximately 40% of the \u003cem\u003eE. coli\u003c/em\u003e genes were expressed at 1 dpi, with only 1% expressed at 3 dpi. These findings suggest that \u003cem\u003eE. coli\u003c/em\u003e may persist sufficiently within tumor tissue while being significantly diminished in the liver, possibly owing to host immune responses [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Principal component analysis of the global gene expression profiles revealed marked differences between tumor and liver tissue, indicating differential \u003cem\u003eE. coli\u003c/em\u003e transcriptional regulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). \u003cem\u003ecsrB\u003c/em\u003e was identified as the top-ranking tumor-specific gene satisfying the following criteria: significantly differential expression between tumor and liver tissue and enhanced expression in tumor tissue at 3 dpi (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). Using qPCR, we validated the significant induction of \u003cem\u003ecsrB\u003c/em\u003e in tumors relative to liver tissue at 1 and 3 dpi (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). In tumors, \u003cem\u003ecsrB\u003c/em\u003e induction (normalized to 16S rRNA expression levels) was 700-fold higher at 3 dpi than at 1 dpi. This suggests that \u003cem\u003ecsrB\u003c/em\u003e, with its pronounced induction in the TME, is a promising candidate promoter for the regulation of anticancer proteins in bacterial oncotherapy.\u003c/p\u003e\u003cp\u003e\u003cb\u003eTME metabolic cues promote\u003c/b\u003e \u003cb\u003ecsrB\u003c/b\u003e\u003cb\u003e-promoter activity and immunotoxin expression\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe next focused on the regulatory role of \u003cem\u003ecsrB\u003c/em\u003e, a small RNA that controls virulence-related gene expression in bacteria, aiming to identify the environmental factors driving its activation in tumors. Tumors undergo extensive metabolic reprogramming, often resulting in both nutrient depletion and the accumulation of specific metabolites that define the TME. Acetate, one of the metabolites accumulated, is both a major carbon source for cancer cells and a key signal sensed by bacterial regulatory systems. As the BarA/UvrY two-component regulatory system functions as an acetate sensor that triggers \u003cem\u003ecsrB\u003c/em\u003e transcription [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e], we postulated that localized niches with the TME could become enriched in acetate. Such niches would be conducive to selective activation of the \u003cem\u003ecsrB\u003c/em\u003e promoter within tumor tissue, thereby providing a metabolic basis for tumor-specific regulation of bacterial gene expression.\u003c/p\u003e\u003cp\u003eTo verify whether acetate levels were higher in tumor tissue than in organs, we measured acetate concentrations in tumor and liver tissue The results showed that acetate concentration was significantly higher in tumor tissue than in liver, approximately 1.4-fold greater (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), and the acetate/glucose ratio was also markedly elevated in tumors, by about 6-fold (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo examine whether this metabolic profile correlates with \u003cem\u003ecsrB\u003c/em\u003e expression, we simulated TME-like conditions in vitro and quantified \u003cem\u003ecsrB\u003c/em\u003e transcript levels via qPCR. \u003cem\u003ecsrB\u003c/em\u003e expression was significantly higher in the stationary phase (S) than in the exponential phase (E) and was inversely correlated with nutrient availability. These results suggest that the elevated \u003cem\u003ecsrB\u003c/em\u003e expression may be due to the nutrient-limitation commonly associated with the TME. Acetate, the most abundant metabolic byproduct in the TME, upregulated \u003cem\u003ecsrB\u003c/em\u003e expression by 4-fold relative to the glucose-rich conditions typical of normal tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Acetate enrichment, together with nutrient limitation, is thus a key driver of elevated \u003cem\u003ecsrB\u003c/em\u003e expression in the TME. This provides a strong rationale for using the \u003cem\u003ecsrB\u003c/em\u003e promoter to achieve tumor-selective gene expression.\u003c/p\u003e\u003cp\u003eTo investigate whether the \u003cem\u003ecsrB\u003c/em\u003e promoter exhibits the same expression pattern as the \u003cem\u003ecsrB\u003c/em\u003e gene itself, we verified its expression by engineering the P\u003csub\u003ecsrB\u003c/sub\u003e-lacZY construct (pSY009) (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA). \u003cem\u003eE. coli\u003c/em\u003e K-12 MG1655 harboring the P\u003csub\u003ecsrB\u003c/sub\u003e-lacZY construct was used to monitor \u003cem\u003ecsrB\u003c/em\u003e-promoter activity. Verification using a β-galactosidase assay revealed that \u003cem\u003ecsrB\u003c/em\u003e-promoter activation exhibited the same expression pattern as the \u003cem\u003ecsrB\u003c/em\u003e gene. Across all media types, \u003cem\u003ecsrB\u003c/em\u003e expression was significantly higher during the stationary phase (S) than during the exponential phase (E), as determined via growth-curve analysis (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB). Reporter gene assays revealed that, under acetate-rich conditions, \u003cem\u003ecsrB\u003c/em\u003e-promoter activity was significantly elevated, by 8-fold, in the stationary phase (S) relative to the exponential phase (E). \u003cem\u003ecsrB\u003c/em\u003e-promoter activity was 4-fold higher under acetate-rich conditions typical of tumor tissue than under the glucose-rich conditions typical of normal tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). This verifies the association between acetate abundance and \u003cem\u003ecsrB\u003c/em\u003e-promoter activity, indicating that the \u003cem\u003ecsrB\u003c/em\u003e promoter responds to acetate as an environmental signal, analogous to a two-component regulatory system. The \u003cem\u003ecsrB\u003c/em\u003e promoter therefore functions as a critical mediator of the bacterial response to acetate in the TME. The TME-specific activity of the \u003cem\u003ecsrB\u003c/em\u003e promoter further confirms its suitability for precisely controlling immunotoxin secretion and expression within the TME.\u003c/p\u003e\u003cp\u003eTo assess the efficacy of the \u003cem\u003ecsrB\u003c/em\u003e promoter in regulating functional immunotoxin secretion and expression, the \u003cem\u003ecsrB\u003c/em\u003e-promoter sequence was inserted into the pBAD24 vector, replacing the araBAD promoter. This construct was then fused with the coding sequence of the immunotoxin (TP). The P\u003csub\u003ecsrB\u003c/sub\u003e\u0026ndash;psp\u0026ndash;TP plasmid (pSY004) was engineered by appending a psp secretion signal peptide to the N-terminus of TGFα\u0026ndash;PE38 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE) [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. \u003cem\u003eE. coli\u003c/em\u003e harboring the P\u003csub\u003ecsrB\u003c/sub\u003e\u0026ndash;psp\u0026ndash;TP construct (ESY004) exhibited substantial expression of this construct within bacterial cell pellets, with notable secretion of it into the supernatant in the acetate-containing medium (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). These findings indicate that the \u003cem\u003ecsrB\u003c/em\u003e promoter can be used to establish an endogenous platform that enables tumor-specific auto-inducing immunotoxin expression and secretion.\u003c/p\u003e\u003cp\u003e\u003cb\u003eAntitumor effects of this immunotoxin under\u003c/b\u003e \u003cb\u003ecsrB\u003c/b\u003e\u003cb\u003e-promoter activation\u003c/b\u003e\u003c/p\u003e\u003cp\u003eBased on these results, we evaluated the activity of the recombinant protein under elevated acetate production, by examining the antitumor effects of the immunotoxin secreted by the \u003cem\u003ecsrB\u003c/em\u003e-promoter. TGFα\u0026ndash;PE38 is specifically effective against EGFR-overexpressing cancer cells. To further investigate its antitumor activity, we employed three tumor-cell lines with high EGFR expression (CT26, LLC1, and MC38) and two with low EGFR expression (B16F10 and SW620) [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. First, the change in protein concentrations over time was determined (Fig. S2). Tumor cells were treated with 18 \u0026micro;g of protein and cultured for 48 h under the following conditions: Mock (PBS), concentrated \u003cem\u003eE. coli\u003c/em\u003e K-12 MG1655 bacterial supernatant (18 \u0026micro;g protein), or ESY004, engineered bacteria, bacterial supernatant (18 \u0026micro;g protein). Treatment with the ESY004 supernatant for 48 h resulted in approximately 70\u0026ndash;90% cell death of CT26, LLC1, and MC38 tumor cells, significantly higher than that of the MG1655 wild-type cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). In contrast, treatment with the \u003cem\u003eE. coli\u003c/em\u003e K-12 MG1655 supernatant (as a control) had a modest impact on cell viability. As expected, cell viability did not differ significantly between the three treatments for B16F10 and SW620 cells, the tumor cells with low EGFR expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). These findings suggest that the TP secreted by ESY004 is specifically cytotoxic against EGFR-expressing tumor cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eRegulation of immunotoxin expression by the\u003c/b\u003e \u003cb\u003ecsrB\u003c/b\u003e\u003cb\u003e-promoter in CT26-cell engrafted mice\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAfter confirming in vitro the cytotoxicity of the TP secreted under the control of the \u003cem\u003ecsrB\u003c/em\u003e promoter, we tested its secretion and antitumor activity in BALB/c mice implanted with CT26 colon cancer cells. Tumor-bearing mice were administered engineered \u003cem\u003eE. coli\u003c/em\u003e intravenously, and tumor tissues were collected on days 1, 3, and 5 post-inoculation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). TP was consistently detected in the tumor filtrates from days 1 to 5 post-inoculation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). This confirms that the \u003cem\u003ecsrB\u003c/em\u003e promoter enables continuous and effective secretion of TP via the psp secretion-signal peptide.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo determine whether the immunotoxin secreted in this manner is expressed in vivo and exerts antitumor activity, we evaluated its tumor-suppressive effect in tumor-bearing mice by monitoring tumor growth following administration of the engineered bacteria. When the engrafted tumors reached 80\u0026ndash;100 mm\u0026sup2;, the mice received intravenous injections of (i) mock (PBS), (ii) \u003cem\u003eE. coli\u003c/em\u003e K-12 MG1655 alone, or (iii) ESY004. ESY004 exhibited a clear tumor-suppressive effect in vivo (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). As previously reported, the application of targeted \u003cem\u003eE. coli\u003c/em\u003e or \u003cem\u003eE. coli\u003c/em\u003e carrying a protein with no antitumor activity suppressed tumor growth by 1.2-fold [\u003cspan additionalcitationids=\"CR53\" citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. Over a 16 d period, the mice with immunotoxin expression under the control of the \u003cem\u003ecsrB\u003c/em\u003e promoter exhibited 3-fold less tumor growth than those in the PBS control group. Mice expressing the immunotoxin exhibited\u0026thinsp;\u0026gt;\u0026thinsp;2-fold greater inhibition of tumor growth than those that received \u003cem\u003eE. coli\u003c/em\u003e alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC, D, Fig. S3). Few adverse effects on mouse health were detected, and no significant differences in body weight were noted among the groups (Fig. S4A). The bacterial count declined gradually in the non-tumor tissue within 5 dpi. After 30 dpi, bacteria were present in the tumor tissue but largely absent from other tissues (Fig. S4B). These findings demonstrate that TP, driven by the \u003cem\u003ecsrB\u003c/em\u003e promoter induced by the abundant acetate in the TME, autonomously and significantly inhibits tumor growth without side effects.\u003c/p\u003e\u003cp\u003eConsequently, we performed additional in vivo experiments directly comparing our \u003cem\u003ecsrB\u003c/em\u003e-promoter-driven construct with an arabinose-inducible system (pBAD promoter), both expressing TP. Mice bearing subcutaneous tumors were injected intravenously with either strain, and tumor volumes were measured up to 10 d. At this endpoint, the groups showed comparable tumor suppression, with no statistically significant difference in efficacy (\u003cem\u003eData not shown\u003c/em\u003e). The \u003cem\u003ecsrB\u003c/em\u003e group exhibited a slightly smaller average tumor size, although this difference did not reach statistical significance. Considering that systemic delivery of arabinose in mice is logistically challenging, requiring repeated administration with limited tumor penetration and short half-life, the \u003cem\u003ecsrB\u003c/em\u003e system offers a distinct advantage in terms of operational simplicity and translational relevance.\u003c/p\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eTherapeutic efficacy and apoptosis-associated cytokine dynamics in vivo\u003c/h2\u003e\u003cp\u003eNext, we evaluated the therapeutic efficacy of the engineered strain ESY004; tumor-bearing mice were intravenously administered with the bacteria and their overall survival was monitored. Mice treated with ESY004 exhibited a significant survival advantage, living approximately 10 d longer than those administered \u003cem\u003eE. coli\u003c/em\u003e alone, demonstrating potent tumor-suppressive efficacy in vivo. (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo investigate the mechanism underlying the observed survival advantage, we quantified the expression of the key apoptotic regulators \u003cem\u003eBax\u003c/em\u003e and \u003cem\u003eBcl-2\u003c/em\u003e in tumor tissue following bacterial administration [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Quantitative qPCR analysis revealed marked elevation of the \u003cem\u003eBax/Bcl-2\u003c/em\u003e ratio in the ESY004-treated group relative to the mock control, with increases of ca. 2-, 4-, and 6-fold at days 1, 3, and 5 post-injection, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Analysis of \u003cem\u003eBax/Bcl2\u003c/em\u003e expression in CT26 cells treated with bacterial supernatants revealed significantly elevated apoptotic signaling in the ESY004 group. The \u003cem\u003eBax/Bcl2\u003c/em\u003e ratio was approximately 1.5-fold higher after 12 h and 1.2-fold higher after 24 h (Fig. S5) in the mice treated with ESY004 than in those that received \u003cem\u003eE.coli\u003c/em\u003e alone, at the same time-points. This increase at both 12 and 24 h in the \u003cem\u003eBax/Bcl-2\u003c/em\u003e ratio strongly indicates a shift toward a pro-apoptotic state within the TME.\u003c/p\u003e\u003cp\u003eIn parallel, we analyzed cytokine dynamics to explore the upstream triggers of apoptosis. qPCR analysis of spleen mRNA revealed a rapid and temporary increase (ca. 5-fold) in TNF-α expression at 1 d, while its expression declined to near-baseline levels by 5 d (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). This temporal pattern suggests that ESY004 administration induces an acute pro-inflammatory response that primes the cells for apoptosis, followed by the execution of cell death programs, as evidenced by the increasing \u003cem\u003eBax/Bcl-2\u003c/em\u003e ratio. Together, these findings indicate that ESY004-mediated tumor suppression is associated with early TNF-α signaling and sustained activation of apoptotic pathways.\u003c/p\u003e\u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eThis novel endogenous tumor-specific auto-inducing system enables selective immunotoxin expression within the TME, without requiring exogenous inducers. Unlike traditional inducible systems, which rely on exogenous inducers such as L-arabinose to activate gene expression [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], our approach leverages the unique metabolic characteristics of the TME, specifically acetate accumulation, to autonomously trigger \u003cem\u003ecsrB\u003c/em\u003e-promoter-driven expression of a therapeutic protein [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e\u003cp\u003ePrevious studies on bacterial oncotherapy have predominantly relied on engineered bacteria that require external stimuli to regulate gene expression [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. While such systems offer control over therapeutic-protein production, they often suffer from limitations such as the need for continuous administration and precise dosage adjustments to maintain efficacy [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. In contrast, the \u003cem\u003ecsrB\u003c/em\u003e-promoter-driven system overcomes these challenges by taking advantage of the tumor\u0026rsquo;s endogenous metabolic landscape. The natural accumulation of acetate in the TME serves as a key regulatory signal, leading to selective activation of the therapeutic gene without external intervention, thereby driving the production of a therapeutic protein that effectively suppresses tumor growth (Fig S6).\u003c/p\u003e\u003cp\u003eThe \u003cem\u003ecsrB\u003c/em\u003e-promoter-driven system differs critically from previous approaches in the specificity and robustness of \u003cem\u003ecsrB\u003c/em\u003e-promoter activation within tumors. Based on RNA-seq analysis, \u003cem\u003ecsrB\u003c/em\u003e was the most highly expressed \u003cem\u003eE. coli\u003c/em\u003e gene detected in tumors, highlighting its strong responsiveness to the TME (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). This finding provides critical insights into the bacterial gene expression profile under tumor-specific conditions. In contrast, the earlier bacterial gene expression systems rely on oxygen gradients, hypoxia-inducible promoters, or synthetic regulatory circuits, which often exhibit variable and unpredictable activation levels [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. By employing a naturally evolved regulatory element that is highly responsive to the TME, our approach enhances both the efficacy and consistency of bacterial oncotherapy.\u003c/p\u003e\u003cp\u003eThe selective upregulation of \u003cem\u003ecsrB-\u003c/em\u003epromoter activity in response to acetate supports its potential for effective therapeutic-protein delivery within the TME, where metabolic shifts and nutrient competition provide a favorable niche for bacterial survival (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). The \u003cem\u003ecsrB\u003c/em\u003e promoter was shown to drive TP immunotoxin expression, effectively targeting cancer cells overexpressing EGFR, as demonstrated in vitro (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Validating these results, mice that received P\u003csub\u003ecsrB\u003c/sub\u003e\u0026ndash;psp\u0026ndash;TP-engineered \u003cem\u003eE. coli\u003c/em\u003e exhibited significantly reduced tumor size, with minimal off-target effects (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Importantly, the extent of tumor suppression achieved by the \u003cem\u003ecsrB\u003c/em\u003e promoter-driven system was comparable with that observed using conventional inducible promoters, indicating that endogenous acetate is sufficient to achieve therapeutic efficacy without the need for external inducers. Mechanistically, qPCR analysis revealed increased \u003cem\u003eBax\u003c/em\u003e and reduced \u003cem\u003eBcl-2\u003c/em\u003e expression in tumor tissue, suggesting that the observed gain in survival was mediated, at least partially, by induction of apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). The \u003cem\u003ecsrB\u003c/em\u003e promoter-driven TP system maintained immunotoxin expression for 5 dpi. Moreover, in non-tumor tissue, bacterial levels were negligible at 30 dpi, confirming the system\u0026rsquo;s ability to achieve prolonged antitumor effects while minimizing systemic bacterial dissemination (Fig. S4B). These findings underscore the potential of the \u003cem\u003ecsrB\u003c/em\u003e promoter\u0026mdash;autonomously activated by acetate to drive robust and sustained secretion and expression of therapeutic proteins via targeted oncotherapy.\u003c/p\u003e\u003cp\u003eThis study has certain limitations. The immunotoxin, derived from the \u003cem\u003ecsrB\u003c/em\u003e promoter, was not retained over time in the mouse-engrafted tumor (Fig. S7), posing a challenge to the long-term expression of the therapeutic protein. This could be overcome by applying established systems, such as the \u003cem\u003eglmS\u003c/em\u003e-based balanced-lethal host-vector system, which can sustain plasmids in vivo for extended periods [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. Replacing the antibiotic-resistance genes with those of the \u003cem\u003eglmS\u003c/em\u003e system can potentially enhance plasmid stability, thereby improving the overall effectiveness and longevity of the system [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThis study underscores the potential of utilizing endogenous bacterial responses to achieve tumor-specific therapeutic protein delivery. By eliminating the reliance on synthetic or externally controlled inducers, the \u003cem\u003ecsrB\u003c/em\u003e promoter-driven system represents a significant advancement in bacterial-based oncotherapy. The ability to harness TME-specific metabolic cues for targeted and sustained therapeutic expression provides a promising strategy for enhancing the precision and safety of bacterial oncotherapy. Future research should focus on expanding this approach to other tumor models and optimizing bacterial engineering strategies to further refine therapeutic outcomes.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eEGFR, Epidermal Growth Factor Receptor\u003c/p\u003e\n\u003cp\u003eTGF\u0026alpha;, Transforming Growth Factor alpha\u003c/p\u003e\n\u003cp\u003eTME, Tumor\u0026nbsp;Microenvironment\u003c/p\u003e\n\u003cp\u003eLB, Luria\u0026nbsp;Bertani\u003c/p\u003e\n\u003cp\u003eATCC, American Type Culture Collection\u003c/p\u003e\n\u003cp\u003eDMEM, Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium\u003c/p\u003e\n\u003cp\u003eRPMI, Roswell Park Memorial Institute\u003c/p\u003e\n\u003cp\u003eFBS, Fetal bovine serum\u003c/p\u003e\n\u003cp\u003eCFU, Colony Forming Unit\u003c/p\u003e\n\u003cp\u003eDPI, Day after Post Injection\u003c/p\u003e\n\u003cp\u003eqPCR, Quantitative polymerase chain reaction\u003c/p\u003e\n\u003cp\u003eOD, Optical Density\u003c/p\u003e\n\u003cp\u003eMTT, Mitochondrial NADH-dehydrogenase\u003c/p\u003e\n\u003cp\u003eFPKM, Fragments per kilobase of transcript per million mapped reads\u003c/p\u003e\n\u003cp\u003ePBS, Phosphate Buffered Saline\u003c/p\u003e\n\u003cp\u003eBAX, Bcl-2 Associated X protein\u003c/p\u003e\n\u003cp\u003eTNF\u0026alpha;, Tumor Necrosis Factor alpha\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal experiments were approved by the Institutional Animal Care and Use Committee of Kangwon National University (approval number KW-230428-2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll raw sequence data have been deposited in the NCBI database (accession numbers SRR30041348\u0026ndash;SRR30041359 under BioProject PRJNA1140531).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Research Foundation of Korea grants funded by the Korean government [grant number NRF-RS-2023-00210053 and NRF-RS-2025-02263715] (Republic of Korea) and supported by the Regional Innovation System and Education program through the Gangwon RISE Center, funded by the Ministry of Education and the Gangwon State, Republic of Korea [grant number 2025-RISE-10-002]. M.S. was supported by the National Research Foundation of Korea [grant numbers 2019M3E5D5066666 and 2022M3E5F1018375] and by the Hankuk University of Foreign Studies Research Fund of 2025.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eS.H., S.L., D.L., and M.S. conceptualized the research. S.H., S.L., D.L., and J.K. performed the experiments. S.H., D.L., and M.S. carried out the data analysis. S.H., S.L., D.L., and M.S. wrote and revised the manuscript. All of the authors have read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003ePresent Address:\u0026nbsp;Division of Biomedical Convergence, College of Biomedical Science, Kangwon\u0026nbsp;National University, Chuncheon 24341, Republic of Korea.\u0026nbsp;\u003csup\u003e2\u003c/sup\u003e\u003csup\u003e\u0026nbsp;\u003c/sup\u003ePresent Address:\u0026nbsp;Section of Genetics and Physiology, Laboratory of Molecular and Cellular Biology, National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK), National Institutes of Health (NIH), Bethesda, MD, USA.\u0026nbsp;\u003csup\u003e3\u003c/sup\u003ePresent Address: Department of Bioscience and Biotechnology, Hankuk University of Foreign Studies, Yongin 17035, Republic of Korea\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eM. Sedighi, A. Zahedi Bialvaei, M.R. Hamblin, E. Ohadi, A. Asadi, M. Halajzadeh, V. Lohrasbi, N. Mohammadzadeh, T. Amiriani, M. Krutova, A. Amini, E. Kouhsari, Therapeutic bacteria to combat cancer; current advances, challenges, and opportunities, Cancer Med 8(6) (2019) 3167\u0026ndash;3181.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eB. Liu, H. Zhou, L. Tan, K.T.H. Siu, X.-Y. Guan, Exploring treatment options in cancer: tumor treatment strategies, Signal Transduction and Targeted Therapy 9(1) (2024) 175.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eA. Sharma, S. Jasrotia, A. Kumar, Effects of Chemotherapy on the Immune System: Implications for Cancer Treatment and Patient Outcomes, Naunyn-Schmiedeberg's Archives of Pharmacology 397(5) (2024) 2551\u0026ndash;2566.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eD.-R. Wang, X.-L. Wu, Y.-L. Sun, Therapeutic targets and biomarkers of tumor immunotherapy: response versus non-response, Signal Transduction and Targeted Therapy 7(1) (2022) 331.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eR.J. Kreitman, Immunotoxins for targeted cancer therapy, Aaps j 8(3) (2006) E532-51.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eI. Pastan, R. Hassan, D.J. Fitzgerald, R.J. Kreitman, Immunotoxin therapy of cancer, Nat Rev Cancer 6(7) (2006) 559\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eC. Alewine, R. Hassan, I. Pastan, Advances in anticancer immunotoxin therapy, Oncologist 20(2) (2015) 176\u0026thinsp;\u0026ndash;\u0026thinsp;85.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eC.B. Siegall, D.J. FitzGerald, I. Pastan, Selective killing of tumor cells using EGF or TGF alpha-Pseudomonas exotoxin chimeric molecules, Semin Cancer Biol 1(5) (1990) 345\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJ.R. Grandis, D.J. Tweardy, Elevated levels of transforming growth factor alpha and epidermal growth factor receptor messenger RNA are early markers of carcinogenesis in head and neck cancer, Cancer Res 53(15) (1993) 3579\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eP.C. Phillips, C. Levow, M. Catterall, O.M. Colvin, I. Pastan, H. Brem, Transforming growth factor-alpha-Pseudomonas exotoxin fusion protein (TGF-alpha-PE38) treatment of subcutaneous and intracranial human glioma and medulloblastoma xenografts in athymic mice, Cancer Res 54(4) (1994) 1008\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJ.E. Weldon, I. Pastan, A guide to taming a toxin\u0026ndash;recombinant immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer, Febs j 278(23) (2011) 4683\u0026ndash;700.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eR. Guo, D. Zhang, C. Zhang, Y. Yang, H. Liu, Y. Yang, J. Lin, Immunotoxin IHP25-BT with low immunogenicity and off-target toxicity inhibits the growth and metastasis of trastuzumab-resistant tumor cells, Int J Pharm 608 (2021) 121081.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eS.M. Havaei, M.G. Aucoin, A. Jahanian-Najafabadi, Pseudomonas Exotoxin-Based Immunotoxins: Over Three Decades of Efforts on Targeting Cancer Cells With the Toxin, Front Oncol 11 (2021) 781800.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJ. Narbona, L. Hern\u0026aacute;ndez-Baraza, R.G. Gordo, L. Sanz, J. Lacadena, Nanobody-Based EGFR-Targeting Immunotoxins for Colorectal Cancer Treatment, Biomolecules 13(7) (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eN.L. Mutter, M. Soskine, G. Huang, I.S. Albuquerque, G.J.L. Bernardes, G. Maglia, Modular Pore-Forming Immunotoxins with Caged Cytotoxicity Tailored by Directed Evolution, ACS Chemical Biology 13(11) (2018) 3153\u0026ndash;3160.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM. Kleinschmidt, R. Rudolph, H. Lilie, Design of a modular immunotoxin connected by polyionic adapter peptides, J Mol Biol 327(2) (2003) 445\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM. Rahban, F. Ahmad, M.A. Piatyszek, T. Haertl\u0026eacute;, L. Saso, A.A. Saboury, Stabilization challenges and aggregation in protein-based therapeutics in the pharmaceutical industry, RSC Adv 13(51) (2023) 35947\u0026ndash;35963.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eR. Mazor, I. Pastan, Immunogenicity of Immunotoxins Containing Pseudomonas Exotoxin A: Causes, Consequences, and Mitigation, Frontiers in Immunology 11 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM.T. Duong, Y. Qin, S.H. You, J.J. Min, Bacteria-cancer interactions: bacteria-based cancer therapy, Exp Mol Med 51(12) (2019) 1\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eS. Zhang, R. Li, Y. Xu, R. Liu, D. Sun, Z. Dai, Engineered bacteria: Strategies and applications in cancer immunotherapy, Fundamental Research (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eD. Lin, X. Feng, B. Mai, X. Li, F. Wang, J. Liu, X. Liu, K. Zhang, X. Wang, Bacterial-based cancer therapy: An emerging toolbox for targeted drug/gene delivery, Biomaterials 277 (2021) 121124.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eC. Zu, J. Wang, Tumor-colonizing bacteria: a potential tumor targeting therapy, Crit Rev Microbiol 40(3) (2014) 225\u0026thinsp;\u0026ndash;\u0026thinsp;35.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eD.-H. Nguyen, A. Chong, Y. Hong, J.-J. Min, Bioengineering of bacteria for cancer immunotherapy, Nature Communications 14(1) (2023) 3553.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eC.J. Thomas, K. Delgado, K. Sawant, J. Roy, U. Gupta, C.S. Song, R. Poojary, P. de Figueiredo, J. Song, Harnessing Bacterial Agents to Modulate the Tumor Microenvironment and Enhance Cancer Immunotherapy, Cancers 16(22) (2024) 3810.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eV. Mayakrishnan, P. Kannappan, N. Tharmalingam, R.J.C. Bose, T. Madheswaran, M. Ramasamy, Bacterial cancer therapy: A turning point for new paradigms, Drug Discovery Today 27(8) (2022) 2043\u0026ndash;2050.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eR. Kunjalwar, A. Keerti, A. Chaudhari, K. Sahoo, S. Meshram, Microbial Therapeutics in Oncology: A Comprehensive Review of Bacterial Role in Cancer Treatment, Cureus 16(10) (2024) e70920.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eH. Hong, D. Lim, G.J. Kim, S.H. Park, H. Sik Kim, Y. Hong, H.E. Choy, J.J. Min, Targeted deletion of the ara operon of Salmonella typhimurium enhances L-arabinose accumulation and drives PBAD-promoted expression of anti-cancer toxins and imaging agents, Cell Cycle 13(19) (2014) 3112\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eD.H. Nguyen, S.H. You, A.N. Vo, H.T. Ngo, K. Van Nguyen, M.T. Duong, H.E. Choy, M. Song, Y. Hong, J.J. Min, Optimized Doxycycline-Inducible Gene Expression System for Genetic Programming of Tumor-Targeting Bacteria, Mol Imaging Biol 24(1) (2022) 82\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eP.T. Mai, D. Lim, E. So, H.Y. Kim, T. Duysak, T.Q. Tran, M. Song, J.H. Jeong, H.E. Choy, Constitutive Expression of a Cytotoxic Anticancer Protein in Tumor-Colonizing Bacteria, Cancers (Basel) 15(5) (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eI. Elia, M.C. Haigis, Metabolites and the tumour microenvironment: from cellular mechanisms to systemic metabolism, Nature Metabolism 3(1) (2021) 21\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eA.F. Alvarez, C. Rodr\u0026iacute;guez, R. Gonz\u0026aacute;lez-Ch\u0026aacute;vez, D. Georgellis, The Escherichia coli two-component signal sensor BarA binds protonated acetate via a conserved hydrophobic-binding pocket, Journal of Biological Chemistry 297(6) (2021) 101383.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eS. Bose, V. Ramesh, J.W. Locasale, Acetate Metabolism in Physiology, Cancer, and Beyond, Trends Cell Biol 29(9) (2019) 695\u0026ndash;703.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eS.A. Comerford, Z. Huang, X. Du, Y. Wang, L. Cai, A.K. Witkiewicz, H. Walters, M.N. Tantawy, A. Fu, H.C. Manning, J.D. Horton, R.E. Hammer, S.L. McKnight, B.P. Tu, Acetate dependence of tumors, Cell 159(7) (2014) 1591\u0026thinsp;\u0026ndash;\u0026thinsp;602.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eF.U. Contreras, M.I. Camacho, A. Pannuri, T. Romeo, A.F. Alvarez, D. Georgellis, Spatiotemporal regulation of the BarA/UvrY two-component signaling system, J Biol Chem 299(6) (2023) 104835.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eS. Palaniyandi, A. Mitra, C.D. Herren, C.V. Lockatell, D.E. Johnson, X. Zhu, S. Mukhopadhyay, BarA-UvrY two-component system regulates virulence of uropathogenic E. coli CFT073, PLoS One 7(2) (2012) e31348.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eG.P. Lobel, Y. Jiang, M.C. Simon, Tumor microenvironmental nutrients, cellular responses, and cancer, Cell Chem Biol 30(9) (2023) 1015\u0026ndash;1032.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eA. Vaziri-Gohar, J. Cassel, F.S. Mohammed, M. Zarei, J.J. Hue, O. Hajihassani, H.J. Graor, Y.V.V. Srikanth, S.A. Karim, A. Abbas, E. Prendergast, V. Chen, E.S. Katayama, K. Dukleska, I. Khokhar, A. Andren, L. Zhang, C. Wu, B. Erokwu, C.A. Flask, M. Zarei, R. Wang, L.D. Rothermel, A.M.P. Romani, J. Bowers, R. Getts, C. Tatsuoka, J.P. Morton, I. Bederman, H. Brunengraber, C.A. Lyssiotis, J.M. Salvino, J.R. Brody, J.M. Winter, Limited nutrient availability in the tumor microenvironment renders pancreatic tumors sensitive to allosteric IDH1 inhibitors, Nat Cancer 3(7) (2022) 852\u0026ndash;865.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eK. Jonas, \u0026Ouml;. Melefors, The Escherichia coli CsrB and CsrC small RNAs are strongly induced during growth in nutrient-poor medium, FEMS Microbiology Letters 297(1) (2009) 80\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eR.G. Chavez, A.F. Alvarez, T. Romeo, D. Georgellis, The physiological stimulus for the BarA sensor kinase, J Bacteriol 192(7) (2010) 2009\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eT. Esquerr\u0026eacute;, M. Bouvier, C. Turlan, A.J. Carpousis, L. Girbal, M. Cocaign-Bousquet, The Csr system regulates genome-wide mRNA stability and transcription and thus gene expression in Escherichia coli, Sci Rep 6 (2016) 25057.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eA.K. Pernestig, O. Melefors, D. Georgellis, Identification of UvrY as the cognate response regulator for the BarA sensor kinase in Escherichia coli, J Biol Chem 276(1) (2001) 225\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eA.M. Bolger, M. Lohse, B. Usadel, Trimmomatic: a flexible trimmer for Illumina sequence data, Bioinformatics 30(15) (2014) 2114\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eD. Kim, J.M. Paggi, C. Park, C. Bennett, S.L. Salzberg, Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype, Nat Biotechnol 37(8) (2019) 907\u0026ndash;915.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eH. Li, B. Handsaker, A. Wysoker, T. Fennell, J. Ruan, N. Homer, G. Marth, G. Abecasis, R. Durbin, The Sequence Alignment/Map format and SAMtools, Bioinformatics 25(16) (2009) 2078\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eC. Trapnell, B.A. Williams, G. Pertea, A. Mortazavi, G. Kwan, M.J. van Baren, S.L. Salzberg, B.J. Wold, L. Pachter, Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation, Nat Biotechnol 28(5) (2010) 511\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJ.H. Miller, Experiments in Molecular Genetics, Cold Spring Harbor Laboratory1972.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal Biochem 72 (1976) 248\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM.I. Camacho, A.F. Alvarez, R.G. Chavez, T. Romeo, E. Merino, D. Georgellis, Effects of the global regulator CsrA on the BarA/UvrY two-component signaling system, Journal of bacteriology 197(5) (2015) 983\u0026ndash;991.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eD. Lim, K.S. Kim, H. Kim, K.C. Ko, J.J. Song, J.H. Choi, M. Shin, J.J. Min, J.H. Jeong, H.E. Choy, Anti-tumor activity of an immunotoxin (TGFα-PE38) delivered by attenuated Salmonella typhimurium, Oncotarget 8(23) (2017) 37550\u0026ndash;37560.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eH. Wang, X. Zhao, H. Zhang, X. Zou, D. Jia, W. Liu, B. Tian, D. Yuan, Y. Li, Y. Zhu, F. Zhang, Y. Dai, Y. Fan, Y. Wei, X. Sun, Q. Fan, J. Dong, EGFR-antagonistic affibody-functionalized Pt-based nanozyme for enhanced tumor radiotherapy, Materials Today Advances 18 (2023) 100375.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eC. Deng, J. Xiong, X. Gu, X. Chen, S. Wu, Z. Wang, D. Wang, J. Tu, J. Xie, Novel recombinant immunotoxin of EGFR specific nanobody fused with cucurmosin, construction and antitumor efficiency in vitro, Oncotarget 8(24) (2017) 38568\u0026ndash;38580.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJ.J. Min, V.H. Nguyen, H.J. Kim, Y. Hong, H.E. Choy, Quantitative bioluminescence imaging of tumor-targeting bacteria in living animals, Nat Protoc 3(4) (2008) 629\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eN. Van Dessel, C.A. Swofford, N.S. Forbes, Potent and tumor specific: arming bacteria with therapeutic proteins, Ther Deliv 6(3) (2015) 385\u0026ndash;99.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eN.S. Forbes, Engineering the perfect (bacterial) cancer therapy, Nat Rev Cancer 10(11) (2010) 785\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eF. Edlich, BCL-2 proteins and apoptosis: Recent insights and unknowns, Biochemical and Biophysical Research Communications 500(1) (2018) 26\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eS.N. Jiang, S.H. Park, H.J. Lee, J.H. Zheng, H.S. Kim, H.S. Bom, Y. Hong, M. Szardenings, M.G. Shin, S.C. Kim, V. Ntziachristos, H.E. Choy, J.J. Min, Engineering of bacteria for the visualization of targeted delivery of a cytolytic anticancer agent, Mol Ther 21(11) (2013) 1985\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eN. Suzuki, K. Gradin, L. Poellinger, M. Yamamoto, Regulation of hypoxia-inducible gene expression after HIF activation, Exp Cell Res 356(2) (2017) 182\u0026ndash;186.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eT. Chien, T. Harimoto, B. Kepecs, K. Gray, C. Coker, N. Hou, K. Pu, T. Azad, A. Nolasco, M. Pavlicova, T. Danino, Enhancing the tropism of bacteria via genetically programmed biosensors, Nat Biomed Eng 6(1) (2022) 94\u0026ndash;104.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eK. Kim, J.H. Jeong, D. Lim, Y. Hong, M. Yun, J.J. Min, S.J. Kwak, H.E. Choy, A novel balanced-lethal host-vector system based on glmS, PLoS One 8(3) (2013) e60511.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eD. Lim, K. Kim, T. Duysak, E. So, J.H. Jeong, H.E. Choy, Bacterial cancer therapy using the attenuated fowl-adapted Salmonella enterica serovar Gallinarum, Mol Ther Oncolytics 31 (2023) 100745.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Bacterial oncotherapy, tumor microenvironment, immunotoxin, csrB, precision therapy","lastPublishedDoi":"10.21203/rs.3.rs-7854761/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7854761/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eCancer treatment is often hindered by tumor complexity, treatment resistance, and off-target toxicity. Bacterial oncotherapy offers a promising alternative, using tumor-targeting bacteria to deliver cytotoxins that selectively induce cancer-cell apoptosis while sparing healthy tissue. However, this approach is limited by its reliance on exogenous inducers to activate anticancer agents. To address this, we engineered a bacterial platform using the tumor-specific \u003cem\u003ecsrB\u003c/em\u003e promoter, activated by the acetate-rich tumor microenvironment, to selectively induce immunotoxins without external cues.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eAcetate concentrations within CT26 tumors were quantified to assess tumor-specific metabolic enrichment. Transcriptomic profiling of tumor-colonizing Escherichia coli was performed by RNA sequencing to identify promoters responsive to the tumor microenvironment, identifying \u003cem\u003ecsrB\u003c/em\u003e. This promoter region was cloned into an expression vector to drive the production of a recombinant immunotoxin, TGFα\u0026ndash;PE38, comprising TGFα, \u003cem\u003ePseudomonas\u003c/em\u003e exotoxin A (PE38), and a secretion tag. Promoter activity was characterized by qPCR and a β-galactosidase reporter assay under varying acetate levels. Cytotoxicity was evaluated in vitro using supernatants from the engineered bacteria. CT26-bearing BALB/c mice were intravenously administered with the engineered bacteria, and tumor growth and survival were monitored. To explore mechanisms underlying survival gain, tumor cytokine dynamics and apoptosis-related gene expression were analyzed.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003e\u003cem\u003ecsrB\u003c/em\u003e, encoding a small regulatory RNA, was highly upregulated in a tumor-specific manner. Genes under \u003cem\u003ecsrB\u003c/em\u003e control participate in acetate metabolism, which is enriched in tumors. qPCR of in vitro cultures showed that \u003cem\u003ecsrB\u003c/em\u003e expression depended on acetate levels, with the \u003cem\u003ecsrB\u003c/em\u003e promoter driving acetate-responsive β-galactosidase expression. The \u003cem\u003ecsrB\u003c/em\u003e promoter regulated expression of the TGFα\u0026ndash;PE38 recombinant immunotoxin. Under \u003cem\u003ecsrB\u003c/em\u003e control, this immunotoxin was strongly expressed in the presence of acetate, persisting in the tumors of CT26-bearing mice treated with \u003cem\u003eE. coli\u003c/em\u003e expressing this immunotoxin. Application of the bacterial-culture supernatant reduced tumor-cell viability, markedly suppressing tumor growth and extending survival. This demonstrates that the \u003cem\u003ecsrB\u003c/em\u003e promoter is ideal for use in auto-inducing therapeutic platforms in bacterial oncotherapy.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e\u003cp\u003eThese findings highlight the ability of tumor-colonizing bacteria to sense tumor conditions and alter antitumor protein expression, thus potentially improving outcomes in oncotherapy.\u003c/p\u003e","manuscriptTitle":"Antitumor Immunotoxin Activity is Enhanced by Escherichia coli csrB-Promoter Expression","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-28 12:06:30","doi":"10.21203/rs.3.rs-7854761/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0b37ecea-da79-448e-95a9-8a48a0480232","owner":[],"postedDate":"November 28th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-12-17T03:09:06+00:00","versionOfRecord":[],"versionCreatedAt":"2025-11-28 12:06:30","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7854761","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7854761","identity":"rs-7854761","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}