Management of industrial wine residues: Physicochemical, bacterial and fungal dynamics during composting processes

Management of industrial wine residues: Physicochemical, bacterial and fungal dynamics during composting processes | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Management of industrial wine residues: Physicochemical, bacterial and fungal dynamics during composting processes Alex Echeverría-Vega, Almendra Espinoza-Mondaca, Eduardo Arqueros-Sanhueza, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3861238/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Jun, 2024 Read the published version in Discover Applied Sciences → Version 1 posted 7 You are reading this latest preprint version Abstract Composting is a process of exothermic oxidative microbial degradation and stabilization of organic residues. The microorganisms driving the process, which are determined by temperature, change during the different phases. The main objective of this research was to study both physicochemical and microbiological dynamics during the composting process of wine industry residues composed by exhausted grape pomace and stalks supplemented by sludge from a winery wastewater treatment plant. Three composting windrows of 41 m 3 were constructed with 0, 10 and 20% sludge addition. Physical–chemical parameters were assessed following the Test Method for the Examination of Composting and Compost (TMECC), and the diversity and dynamics of bacterial and fungal communities involved in this process were assessed by a high-throughput sequencing metabarcoding approach. After six months of aerated turned windrow composting, it was observed that the addition of sludge increased moisture, bulk density, and pH. No effect of the sludge on the macronutrient composition of compost was observed. Bacterial and fungal dynamics showed significant differences depending on the addition of sludge and a high amount of beneficial microorganisms and a low presence of potentially pathogenic microorganisms in the final compost. Beneficial fungal phosphorus solubilizers, such as Aspergillus and Talaromyces , were found. Streptomyces and Mycobacterium were the most abundant beneficial bacteria. Finally, the addition of sludge results in a significant increase in the percentage of beneficial microorganisms in the final products. Composting Wine residues Microbial communities Wine industry Wastewater sludge Figures Figure 1 Figure 2 Figure 3 Figure 4 Highlights This study assesses the composting of grape pomace and stalks supplemented by sludge from the same winery wastewater treatment plant. The addition of sludge to composting improves water retention and bulk density and no effect was observed on the macronutrient composition. Sludge addition significantly increased beneficial microorganisms in the compost as Aspergillus , and Streptomyces . 1. Introduction Composting is one of the most commonly used techniques when valuing organic residues due to low operational cost and the production of a stable substrate enriched with nutrients named compost ​ (Martínez-Blanco et al., 2013 ) ​. Several studies have validated the use of compost as an enhancer of some physical, chemical, and biological properties of soils, such as structure, drainage, airing, water and nutrient retention, erosion prevention, and support of beneficial microbiota (Wilson et al., 2020 ). Composting is a process of exothermic oxidative microbial degradation consisting of mesophilic (25–45°C), thermophilic (45–70°C), late mesophilic and maturation ​ (Day & Shaw, 2001 ) processes. During the first stage, the mesophilic microorganisms multiply, metabolizing sugars and simple molecules quickly in exothermic processes, reaching a temperature of 45°C (Casco & Herrero, 2008 ). In this stage, the microbial community changes because of the increase in temperature. Thermophilic microorganisms degrade more complex molecules, such as sugars, fat, and proteins, increasing the temperature even more, reaching between 50°C and 70°C, and depleting most pathogenic bacteria and fungi ​ (Bueno et al., 2012 ; Day & Shaw, 2001 ; Román et al., 2013 ). Finally, a cooling phase named the late mesophilic stage takes place, reaching the ambient temperature. In this phase, the mesophilic microorganisms appear again, degrading the molecules already processed in the thermophilic stage. The process ends in the phase of stabilization or maturation, characterized by a fast decrease in microbial activity and temperatures and stabilization of nutrients and features of the compost ​ (Bueno et al., 2012 ; Román et al., 2013 ) ​. Since composting is a biological process, different factors affect its development, such as temperature, moisture, carbon-nitrogen ratio, pH, aeration, and bulk density ​ (Bueno et al., 2012 ; Casco & Herrero, 2008 ; Day & Shaw, 2001 ). Temperature is the main indicator of composting development, defining the different phases of the process. It is recommendable to maintain the pH of the windrow in a range between 6.5 and 7.5 for the best performance of the microorganisms and, subsequently, better biodegradation ​ (Bueno et al., 2012 ; Day & Shaw, 2001 ). The microorganisms use between 25 and 30 portions of carbon per nitrogen; therefore, it is considered theoretically optimal for the composting of a product that the C/N rate of the material is between 25/1–30/1 ​ (Casco & Herrero, 2008 ; Román et al., 2013 )​. The moisture levels must remain sufficient to assure bioactivity but avoid the generation of anaerobic regions caused by excessive moisture, which means between 45 and 60% moisture, maintaining an oxygen saturation over 5% ​ (Román et al., 2013 ) ​. The bulk density directly affects the behavior of the degradation and the physical structure of the compost windrow. The smaller the size of the particles of a mixture, the bigger it will be its bulk density, being more sensitive to microbial attack; however, it is important to equilibrate it because this also reduces the porosity, which increases the saturation by water, hindering the diffusion of oxygen and other gases ​ (Casco & Herrero, 2008 ; Román et al., 2013 ) ​. Additionally, it is important to consider some chemical parameters to understand the evolution of nutrients throughout the degradation process, as well as the agronomic value of the final compost. Therefore, the carbon (C), nitrogen (N), C:N ratio, ammonium-nitrate ratio, potassium, and phosphorous, among others, are normally analyzed ​(Day & Shaw, 2001 ; Román et al., 2013 ) ​. The most recognized microorganisms present in composting processes include mostly aerobic bacteria from the phyla Proteobacteria, Bacteroidetes, Firmicutes, Chloroflexi, and Actinobacteria and fungi from the phyla Ascomycota and Basidiomycota ​ (Day & Shaw, 2001 ; Insam & de Bertoldi, 2007 ; Román et al., 2013 ). The bacterial community composition is directly related to the temperature, which varies according to the process stage. ​ (Casco & Herrero, 2008 ; Day & Shaw, 2001 ; Insam & de Bertoldi, 2007 ). The fungi take part in degrading complex molecules, which are powerful ligninolytic, cellulolytic, and pectinolytic agents that also degrade chitin and keratin, and many of them release water-soluble substances, antibiotics, and dark pigments, which are very important for the humidification process ​ (Insam & de Bertoldi, 2007 ) ​. Composting of winery solid residues is mainly affected by the presence of phytotoxic and antibacterial substances, such as ethanol, organic acids, and phenolic compounds, which hinder microbial development, reducing the agronomic quality of the compost ​ (Bharathiraja et al., 2020 ; Burg et al., 2014 ; Zacharof, 2017 ). Nitrogen supplements such as manure and chemical fertilizers have been commonly used to increase the microbial load and nutrients, improving the biodegradation rate (Bustamante et al., 2008 , 2009 ; Martínez Salgado et al., 2019 ; Sánchez et al., 2017 ). However, it generates an additional expense for winery companies. Considering that sludge represents approximately 5% of the total residues produced by the winery (Bharathiraja et al., 2020 ), the composting of grape stalks, pomace and sludge rich in nitrogen has also been used to reduce operational costs ​ (Bertran et al., 2004 ; Bustamante et al., 2007 , 2009 ). Winery sludge is an alkaline and highly humid substrate with a high amount of nitrogen and an elevated number of microorganisms (Pascual et al., 2018 ), ​ including Proteobacteria, Bacteroidetes, Firmicutes, Nitrospira, Dechloromonas, Arcobacter, Nitrobacter, Planctomycetes, Chloroflexi, and several microorganisms that participate in the nitrogen cycle ​ (Gao et al., 2016 ; Kallistova et al., 2014 ; Neklyudov et al., 2008 ) ​. These phylogenetic groups have also been reported in the early stages of compost, suggesting that sludge could be a suitable supplement for the composting process of winery residues, improving the conditions of the process, increasing beneficial microorganisms, and reducing sludge management costs. Despite studies related to the microbial communities of the composting process (Insam et al., 2007; Neklyudov et al., 2008 ; Santos et al., 2008 ; Antunes et al., 2016 ; Tortosa et al., 2017 ; Viel et al., 2018 ; Sun et al., 2019 ; Liu et al., 2023 ; Martins et al., 2023 ), there are no studies focused on the microbiology of winery sludge composting using grape pomace and stalks. Consequently, this work studies the dynamics of microbiological communities and their physicochemical properties during the composting process of residues from the wine industry and the effect of adding winery sludge as a supplement to improve the process fostering a circular economy in the winery sector. 2. Material and Methods 2.1. Material The composting process was performed using exhausted grape pomace and stalks obtained from white grape cultivars. The mixture was composed of 65% of the exhaust grape pomace and 35% of the stalks by volume. The sludge utilized as a supplement was obtained from the wastewater treatment plant of the winemaking processes. 2.2. Experimental Design A fully randomized (DCA) experimental design was used to evaluate the effect of sludge on the psychochemical and biological properties of the composting process. The experimental design consisted of 3 treatments and 3 repetitions, making a total of 9 experimental units. Three composting windrows of 41 m 3 were constructed with the previously described mixture. Sludge (10% and 20% v/v) was added to the mixtures of compostable material for windrows 1 (T1) and 2 (T2), respectively, and homogenized to build the windrows. A third windrow (T0) corresponding to the control treatment was made up of a pomace and stalks mixture with no sludge. The windrows had a width of 2 m, a height of 1.5 m and a length of 27 m, reaching a final approximated volume of 41 m 3 each. 2.3. Sampling Samples were collected following the adapted standard version of the Sample Collection and Laboratory Preparation. Field Sampling of Compost Materials. (TMECC) (US Composting Council, 2001 ). In summary, samples were taken from the windrows at three different times corresponding to the mesophilic, thermophilic, and stabilization stages. The sample was taken from three equidistant zones from the windrow counting on three replicates per treatment. The sample collection for each of the replicates was made by digging five holes of 60 cm depth, covering the largest possible area of each zone. From each of these holes, nearly 500 g of samples were collected, placed together in one container where they were homogenized by agitation and divided into samples for chemical analysis and microbiological analysis and kept at 4°C and − 80°C, respectively, until further use. 2.4. Physicochemical Analysis Temperature, moisture, pH, and bulk density were monitored during the full composting process. The physicochemical properties, such as bulk density, pH, temperature, electrical conductivity (CE), pH, organic matter (OM), carbon (C), nitrogen (N), C/N ratio, ammonium and nitrate (NH 4 and NO 3 ), NH4/NO3 ratio phosphorus (P) and potassium (K), were analyzed for each stage of the different windrows according to the Test Method for the Examination of Composting and Compost (TMECC). 2.5. DNA Extraction and Sequencing DNA extraction was performed by following the protocol of the DNeasy Powersoil Pro commercial kit (Qiagen, 2022 ). The genes of interest sequenced with Illumina MiSeq correspond to the V3-V4 region of the ribosomal gene 16S using the primers 16SF CCTACGGGNGGCWGCAG and 16SR GGACTACHVGGGTATCTAATCC for their amplification and the internal transcribed spacer gen (ITS) using the primers ITS1F CTTGGTCATTTAGAGGAAGTAA and ITS2R GCTGCGTTCTTCATCGATGC. Demultiplexed fastq files were first trimmed to eliminate primers. Then, sequences were cleaned, filtered, trimmed, dereplicated, and merged, and chimeras were removed using the DADA2 pipeline (Callahan et al., 2016) in QIIME V.2 software (Bolyen et al., 2019 ) Amplicon Secuence Variants (ASV) were gathered and further compared to specialized databases for taxonomic assignment. The SILVA SSU 138 16.12.2019 (Quast et al., 2012 ) database was used for bacteria, and the UNITE V10.05.202 (Nilsson et al., 2019 ) database was used for fungi. The samples that had fewer sequences were used to define the rarefaction of each data series. 2.6. Data Processing The multivariate statistical analysis of physicochemical and taxonomic data of the process was tested by using Primer6 (Primer E) software. The physicochemical results were standardized, and Euclidean distance matrices were created. The variables with a Pearson’s correlation higher than 0.95 were grouped and represented by one unique variable. The fourth root was applied to the values of the tables of taxonomic results to homogenize and reduce the dominance effect. Later, Bray‒Curtis similarity matrices were made. Triplicates were tested and averaged. Alpha and beta diversity analysis was performed, together searching for beneficial and pathogenic microorganisms, using data collected from an exhaustive bibliographic review as a reference. The physicochemical and microbiological results of the process were tested by using the PERMANOVA statistical analysis with 10,000 permutations and α = 0.05. Kruskal‒Wallis statistical analysis was used with α = 0.05 to test differences in the number of beneficial and pathogenic microorganisms at the final stage depending on treatment. A canonical analysis of main coordinates (CAP) was used to make a graphic representation of the biological composition of the samples based on environmental data. 3. Results and Discussion 3.1. Physicochemical Figure 1 shows the temperature of the different treatments, as well as the ambient temperature throughout the process. Days of irrigation and turning procedures are marked. All the treatments reached temperatures over 45°C in the first week of composting. The behavior of the temperature during the process did not show any unusual value, and it is comparable to other similar studies on wineries residues (Bertran et al., 2004 ; Bustamante et al., 2009 ; R. Pinto et al., 2021 ). The duration of the phases, especially the thermophilic phase, indicates correct decomposition and sanitation (Román et al., 2013 ). An increase in the temperatures over 75°C was not observed, but a progressive decrease after the eighth turning of the material. T0 shows a higher temperature than T2 and T1 after Day 161 of the test, which indicates more persistence of microbial activity due to less maturation. However, all the treatments began a stabilization phase (< 45°C) after 185 days. The windrows were irrigated periodically to keep the percentage of moisture over 40% during at least the first 140 days of the process. The moisture of each windrow was recorded during the test (Fig. 2 A). The treatments started with moisture values between 50 and 60% during the first month. Before irrigation (Day 42), since T1 and T2 showed a larger percentage of moisture, the presence of sludge seemed to improve the water retention of the windrows during the process. During the last month, no irrigation was performed to accelerate the stabilization of the final compost. The bulk density (Fig. 2 B) reflects the physical structure of the windrow and the pore space inside. As expected, an increase in bulk density was observed for all treatments, where T2 and T1 exhibited higher values during the whole process due to the addition of sludge. Although this means better retention of moisture, it negatively affects the gas exchange inside the windrows, increasing the number of turnings. The progressive rise of the bulk density of the treatments is considered a normal behavior in the composting processes (Carmona et al., 2012 ; Casco & Herrero, 2008 ; Román et al., 2013 ). The pH of the treatments when the process began was close to 4.5 (Fig. 2 C), and a progressive rise was observed for all the treatments. T1 and T2 showed a major tendency to stabilize, reaching pH 7 on Day 108; on the other hand, T0 stabilized on Day 143. This difference can be explained by the alkaline pH of the sludge and the nitrate content that induced a higher production of ammonia during the thermophilic phase, accelerating the increase in pH and the stability of the compost. (Bertran et al., 2004 ; Bustamante et al., 2007 ; R. Pinto et al., 2021 ). When analyzing the physicochemical data in a multivariate analysis, significant differences were found depending on treatments for each of the stages (PERMANOVA, p < 0.05). The sludge addition significantly affected the physicochemical parameters of the process in each of the phases. The physicochemical dynamics are described in the following paragraphs. 3.1.1. Mesophilic Phase In the initial mesophilic phase (Table 1 ), T2 and T1 showed, on average, an electrical conductivity 20% higher than T0. The nitrogen content regarding T0 increased by 28% in T2 and 14% in T1, respectively. In the study of Bertran et al. ( 2004 ), a rise of 40% in the content of nitrogen was found when composting sludge together with stalks, indicating that sludge is an excellent nitrogen source. According to these data, using 10% of the sludge would be enough to improve the carbon-nitrogen ratio of the material for the composting process to an optimum level. In this sense, T1, with a 10% sludge content, was theoretically the most optimized treatment, as shown by their nitrogen content in Table 1 . On the other hand, Pinto et al. ( 2021 ) reported a rise in the content of P and K when using winery sludge; however, this effect was not observed in the treatments at the beginning of this study, which was explained by differences in the composition of the raw material that generates the sludge. 3.1.2. Thermophilic Phase T1 and T2 showed on average a 20% higher content of nitrogen than T0, which might be related to a better process of nitrification (Bustamante et al., 2008 ; Day & Shaw, 2001 ; Insam & de Bertoldi, 2007 ). However, less nitrate was observed in treatments when adding sludge, but more ammonium was measured in the samples, indicating that fewer nitrate conversion bacteria were present at that time. A 10% lower content of organic matter was observed in T1 and T2 than in T0 (Table 1 ). This effect may be due to a better performance in the bacterial degradation processes associated with a higher content of nitrogen. The decrease in the C/N ratio associated with the addition of sludge in organic residue composting processes has been previously reported by other authors (Fernández et al., 2010 ; Semitela et al., 2019 ). The addition of sludge to the processes can support the formation of an environment that facilitates the growth of microorganisms by increasing the moisture, organic matter, nitrates and other minerals (Day & Shaw, 2001 ). As a consequence, a major presence of superior fungal fructification was observed in T1 and T2 compared to T0 (Fig. 3 B) (Casco & Herrero, 2008 ; Insam & de Bertoldi, 2007 ). Furthermore, windrows with sludge showed a rise in phosphorous mobilization explained by the presence of phosphate-solubilizing microorganisms (i.e., Aspergillus and Mycobacterium) during the composting process (Gangwar et al., 2017 ). An increase in the content of ammonium in the samples with sludge was also observed during this phase (Table 1 ), proving then a rise in the nitrification processes related to the sludge addition and the growth of nitrogen-fixing microorganisms (Pinto & Gomes, 2016 ). 3.1.3. Stabilization Phase All treatments showed a neutral pH at the stabilization stage (Table 1 ). The electrical conductivity was 25% higher in T2 than in T0 and T1, which is probably caused by a higher concentration of dissolved salts due to 20% v/v sludge addition (Day & Shaw, 2001 ; Insam & de Bertoldi, 2007 ). The electrical conductivity of all the final compost produced is under the maximum value of 3 dS/m and then complies with the requirements to be used as a soil amendment (Román et al., 2013 ). A low final C/N ratio has been reported in different studies when composting sludge and pomace stalks, with values in the range of 17 to 20 (Morales et al., 2016 ). The resulting values are consistent with the data published by Carmona et al. ( 2012 ), with ranges between 15,5–18,2 when composting pomace and grape stalks in a 1:1 ratio. Table 1 Results of the chemical analysis of the treatments throughout the composting process. P T E.C. (dS/m) pH O.M. (%) C (%) C:N N (%) P (%) K (%) NH 4 (mg/kg) NO 3 (mg/kg) NH 4 /NO 3 T0 3,7 ± 0,1 3,6 ± 0 91,2 ± 0,3 50,7 ± 0,3 34.5 ± 0.6 1,5 ± 0,1 0,8 ± 0,1 2,1 ± 0 531,7 ± 94 391,3 ± 22,4 1,4 ± 0,2 M T1 4,5 ± 0,2 3,8 ± 0 84,3 ± 1,2 46,7 ± 0,7 26,0 ± 0,3 1,8 ± 0,1 0,7 ± 0 2,2 ± 0 364,3 ± 42,2 586,3 ± 29.7 0,6 ± 0 T2 4,8 ± 0,2 3,9 ± 0 83,8 ± 0,2 46,4 ± 1 22,5 ± 1.1 2,1 ± 0,1 0,9 ± 0 1,9 ± 0,1 539 ± 145,5 456 ± 45 1,2 ± 0,1 T0 4,8 ± 0,1 3,9 ± 0,1 88,3 ± 0,5 49 ± 0,3 26,1 ± 1,7 1,9 ± 0,1 1 ± 0 2,4 ± 0 276,7 ± 38,9 228 ± 27,1 1,5 ± 0,3 T T1 5,8 ± 0,4 4,7 ± 0,3 79,7 ± 0,7 44,3 ± 0,1 19,2 ± 0,6 2,3 ± 0,1 1,3 ± 0,1 2,4 ± 0,1 613,3 ± 323,7 179 ± 31 3,4 ± 3 T2 4,8 ± 0,5 5,3 ± 0,2 77,8 ± 0,2 43,2 ± 2,3 17,8 ± 1,2 2,4 ± 0,4 1,4 ± 0 2,1 ± 0,2 453 ± 49,5 156 ± 22,5 2,9 ± 0,6 T0 1,4 ± 0 7,1 ± 0,1 75 ± 2,4 41,7 ± 2,4 16,4 ± 0,6 2,6 ± 0,1 2,4 ± 0,2 3,4 ± 0,1 634 ± 106 182 ± 38,4 3,6 ± 2,4 S T1 1,4 ± 0,3 7,2 ± 0 62,7 ± 2,5 34,8 ± 2,5 15,9 ± 4,1 2,2 ± 0,5 2,9 ± 0,1 3 ± 0,1 190 ± 16,3 126,7 ± 7,6 1,5 ± 0,2 T2 2 ± 0,3 7,1 ± 0,1 70 ± 2,3 38,9 ± 2,4 12,3 ± 0,5 2,4 ± 0,2 2,3 ± 0,2 2,7 ± 0,1 441,3 ± 116,6 162,3 ± 15,8 2,8 ± 0,9 *Each phase (P) corresponds to mesophilic (M), thermophilic (T) and stabilization (S) conditions. For the parameters measured, E.C.: electrical conductivity, O.M.: organic matter. The dispersion value is the result of the standard error of the triplicates of each treatment. The ammonium and nitrate contents in the final stage were higher in T0 than in T1 and T2, which could be explained by both the enhanced microbial activity of nitrifying microorganisms in previous stages and a major loss of NH 3 and nitrate by evaporation when sludge is present (Bustamante et al., 2008 ; Casco & Herrero, 2008 ; Insam & de Bertoldi, 2007 ). The final phosphorous content was higher in T1 than in T2 and T0 (~ 20% more), suggesting that 10% was the best proportion of sludge to increase the microorganism-mediated phosphorous mobilization processes (Bueno et al., 2012 ; Insam & de Bertoldi, 2007 ; Sánchez et al., 2017 ). 3.2. Dynamics of the Microbial Communities The canonical analysis of main coordinates (CAP) of Fig. 3 shows the relationship between the composition of the microbial communities (bacteria – fungi) in the different treatments and phases of composting and the physicochemical parameters observed during the process. Figure 3 A shows that the bacterial communities are clearly differentiated in the mesophilic stage (p < 0.05), mainly attributable to the different sludge contents in the treatments. In the thermophilic stage, a significant (p < 0.05) but lower differentiation was observed among the treatments, which was related to a rise in the conductivity and the ammonium/nitrate ratio. In the stabilization stage, there were fewer differences in the composition of the bacterial communities. In this stage, the C/N ratio reached its lowest value due to the carbon degradation of the organic matter, and the level of phosphorous increases in all the treatments, especially in T1. Similar to bacteria, the composition of the fungal communities was significantly different in the 3 stages of the composting process. In the mesophilic stage, the treatments show less spreading compared to bacteria; however, the differences found among the treatments are significant (p < 0.05). In the thermophilic stage, the fungal communities decreased significantly, showing differences among the treatments, related to a larger C/N ratio in T0 and less ammonium than in the sludge-added treatments. In the stabilization stage, the fungal communities showed important differences among treatments, mostly due to phosphorous rise and less organic carbon in T1 and T2. Sludge mainly provides a bacterial community into the system, which tends to be homogenized in the thermophilic stage due to the environmental conditions that regulate the growth of the different bacterial groups. This is in accordance with Liu et al. ( 2023 ), who stated that the physicochemical changes during the different composting stages had a higher impact on the bacterial community composition than the different materials utilized in the treatments. On the other hand, the contribution of fungi from the sludge seems to be less relevant, and their communities are highly sensitive to the environmental conditions, which generates noticeable changes in the composition during the process. On a comparative basis, there are noteworthy variations between bacterial and fungal dynamics during the composting process. While the composition of the bacterial communities is affected by sludge addition and tends to homogenize at the end of the composting process, fungi initially look homogeneous and tend to differentiate at the end, as shown in the canonical analysis of principal coordinates (CAP) of Fig. 3 . We found that the main bacterial phyla present along all the stages and treatments were Actinobacteria , Proteobacteria, Firmicutes and Chloroflexi. On the other hand, the main fungal phyla found along all stages and treatments were Ascomycota, Rozellomycota and Basidiomycota , which are the same as those reported by Antunes (2016) and Tortosa (2017). This shows the similarity of the composition of microbial communities related to the composting process independent of the type of initial organic material utilized. 3.2.1. Beneficial Microorganisms Figures 4 A and 4 B show the composition of the microbial communities in the stabilization stage as well as the contribution as beneficial or pathogenic microorganisms for vineyards. The principal beneficial fungal genera found in all the samples were Aspergillus and Talaromyces , where Aspergillus was the most abundant genus in all the treatments, especially in T1 and T2, showing the effect of sludge addition. Aspergillus is a common fungal genus found in compost that participates in processes of mineral solubilization, such as phosphorus and potassium solubilization (Pineda, 2015 ). Furthermore, this genus has been reported to produce secondary metabolites such as gibberellic acid, indoleacetic acid, and siderophores (Sánchez et al., 2017 ). The Talaromyces genus has been shown to have positive effects on plant growth. It was found as an endophyte in plants and has been reported as a phosphate solubilizer and a promising biocontrol agent against phytopathogenic fungi (ulišová et al., 2021). The beneficial bacterial genera present in the sludge were Streptomyces, Mycobacterium, Mesorhizobium, Gordonia, Rhodococcus, Brevundimonas , and Azospirillum. Representatives of the Rhodobacter genus were also observed in the sludge, but these were not found during the development of the tests, suggesting that the conditions of the composting processes were not optimal for their growth. Therefore, the principal beneficial genera Streptomyces, Mycobacterium , and Mesorhizobium involved in phosphate solubilization and Brevundimonas , which participates in the fixation of nitrogen and is a promoter of plant growth (Naqqash et al., 2020 ; Sun et al., 2019 ), were the most abundant in all the treatments. Despite the second most abundant bacteria in T0 being the Streptomyces genus, sludge addition affects the abundance of the Streptomyces genus, which is most abundant in T1 and T2. Mycobacterium and Mesorhizobium were found in all the treatments. These genera are commonly observed in soil and have been extensively studied for their role in promoting plant growth by several mechanisms, such as the production of siderophores, phytohormones, cellulases, lipases, proteases and chitinases, enhancing nutrient availability, stimulating root growth (Gangwar et al., 2017 ), nitrogen fixation (Verma et al., 2013 ), phosphate solubilization, and protecting plants from pathogens (Pinto & Gomes, 2016 ; Sreevidya et al., 2016 ). 3.2.2. Pathogen Microorganisms At the final stage, Acetobacter , Penicillium , Cladosporium , and Alternaria were observed. These genera have been reported as possible causes of acid rot of the fruit (Acuña, 2010 and Cortés et al., 2020 ). Agrobacterium and Acremonium genera can cause crown gall disease and stem decline, respectively (Acuña, 2010 ). Both Agrobacterium and Acremonium genres have the most putative negative effect on vines since they can directly affect the wood, thus, causing an ecological and economical issue for vineyards, reducing production and causing plant death (Díaz et al., 2013 ). However, their number is very reduced in every treatment and altogether represents less than 1% of the communities. Acremonium is only found in T1 and T2, although this genus is not present in the sludge. This suggests that adding sludge generated the appropriate conditions for its appearance. Penicillium, Alternaria, Agrobacterium , and Acetobacter genera are part of the sludge microbiota; however, these genera are also present in T0 regardless of sludge addition; therefore, their presence is not directly related to the addition of sludge. However, Cladosporium is absent in the sludge, and it is only present in T0, regardless of the sludge addition. The sludge addition generates significant differences between the bacteria in T0 and T1, finding that the addition of 10% sludge to the composting process in T1 resulted in a lower number of pathogenic bacteria. This can be explained by the high temperatures reached during the thermophilic phase, where the pathogenic bacteria were eliminated by the high temperatures (75°C) reached during the composting process. (Román et al., 2013 ). 4. Conclusions Addition of sludge to composting improves water retention and bulk density. The composition of the bacterial communities tended to homogenize at the end of the process, while fungi tended to differentiate. Microbial community dynamics were affected mostly by the temperature of the process rather than the sludge content. Considering the proper temperature reached during composting, the most beneficial genera, such as Aspergillus , Talaromyces , Streptomyces , Mycobacterium , Mesorhizobium , Gordonia , and Azospirillum , were found. Nevertheless, sludge addition generates a significant increase in beneficial microorganisms and a decrease in pathogenic microorganisms. Consequently, it is feasible to compost exhausted grape pomace stalks supplemented by sludge. Declarations Funding This work was supported by the Production Promotion Corporation of the Government of Chile (Corporación de Fomento de la Producción, CORFO), through the “Proyecto CORFO PI3486, Desarrollo y validación de tecnologías para la composta y su efecto sobre el suelo, la viña y el vino”. Author Contributions Alex Echeverría-Vega: Methodology, Investigation, Visualization, Writing – original draft, Writing – review & editing. Almendra Espinoza-Mondaca: Methodology, Investigation, Writing – original draft. Eduardo Arqueros-Sanhueza: Conceptualization, Methodology, Visualization, Writing – original draft. Denisse Mellado-Quintanilla : Methodology, Investigation, Visualization, Writing – review & editing. Rosa Roa-Roco: Conceptualization, Methodology, Supervision, Project administration. Alvaro González: Funding acquisition, Resources. Rodrigo Morales-Vera: Conceptualization, Methodology, Investigation, Visualization, Writing – original draft Writing – review & editing, Supervision. Competing interest The authors have no relevant financial or non-financial interests to disclose. Data Availability The authors declare that the data supporting the findings of this study are available within the paper. If any raw data files are needed in another format, they are available from the corresponding author upon reasonable request. References Acuña, R. (2010). Compendio De Bacterias Y Hongos De Frutales Y Vides En Chile. Antunes, L. P., Martins, L. F., Pereira, R. V., Thomas, A. M., Barbosa, D., Lemos, L. N., Silva, G. M. M., Moura, L. M. S., Epamino, G. W. C., Digiampietri, L. A., Lombardi, K. C., Ramos, P. L., Quaggio, R. B., De Oliveira, J. C. F., Pascon, R. C., Da Cruz, J. B., Da Silva, A. M., & Setubal, J. C. (2016). Microbial community structure and dynamics in thermophilic composting viewed through metagenomics and metatranscriptomics. Scientific Reports, 6(December), 1–13. https://doi.org/10.1038/srep38915 Bertran, E., Sort, X., Soliva, M., & Trillas, I. (2004). Composting winery waste: Sludges and grape stalks. Bioresource Technology , 95 (2), 203–208. https://doi.org/10.1016/j.biortech.2003.07.012 Bharathiraja, B., Iyyappan, J., Jayamuthunagai, J., Kumar, R. P., Sirohi, R., Gnansounou, E., & Pandey, A. (2020). Critical review on bioconversion of winery residues into value-added products. Industrial Crops and Products , 158 (January), 112954. https://doi.org/10.1016/j.indcrop.2020.112954 Bolyen, E., Rideout, J. R., Dillon, M. R., Bokulich, N. A., Abnet, C. C., Al-Ghalith, G. A., Alexander, H., Alm, E. J., Arumugam, M., Asnicar, F., Bai, Y., Bisanz, J. E., Bittinger, K., Brejnrod, A., Brislawn, C. J., Brown, C. T., Callahan, B. J., Caraballo-Rodríguez, A. M., Chase, J., … Caporaso, J. G. (2019). Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nature Biotechnology , 37 (8), 852–857. https://doi.org/10.1038/s41587-019-0209-9 Bueno, P., Díaz, J., & Cabrera, F. (2012). Capítulo 4. Factores que afectan al proceso de Compostaje. In compostaje . http://digital.csic.es/bitstream/10261/20837/3/Factores que afectan al proceso de compostaje.pdf Burg, P., Vítěz, T., Turan, J., & Burgová, J. (2014). Evaluation of grape pomace composting process. Acta Universitatis Agriculturae et Silviculturae Mendelianae Brunensis , 62 (5), 875–881. https://doi.org/10.11118/actaun201462050875 Bustamante, M. A., Paredes, C., Marhuenda-Egea, F. C., Pérez-Espinosa, A., Bernal, M. P., & Moral, R. (2008). Co-composting of distillery residues with animal manures: Carbon and nitrogen transformations in the evaluation of compost stability . https://doi.org/10.1016/j.chemosphere.2008.03.030 Bustamante, M. A., Paredes, C., Moral, R., Moreno-Caselles, J., Pérez-Murcia, M. D., Pérez-Espinosa, A., & Bernal, M. P. (2007). Co-composting of distillery and winery residues with sewage sludge. Water Science and Technology , 56 (2), 187–192. https://doi.org/10.2166/wst.2007.488 Bustamante, M. A., Paredes, C., Morales, J., Mayoral, A. M., & Moral, R. (2009). Study of the composting process of winery and distillery residues using multivariate techniques. Bioresource Technology , 100 (20), 4766–4772. https://doi.org/10.1016/j.biortech.2009.04.033 Carmona, E., Moreno, M. T., Avilés, M., & Ordovás, J. (2012). Compostaje de residuos de la industria vinícola y su uso como sustrato para el cultivo sin suelo de plantas ornamentales. Spanish Journal of Agricultural Research , 10 (2), 482–491. https://doi.org/10.5424/sjar/2012102-320-11 Casco, J. M., & Herrero, R. M. (2008). Compostaje (4th ed.). Ediciones Mundi-Prensa. https://books.google.es/books?id=V2x2hEfBbboC Cortés, A., Oliveira, L. F. S., Ferrari, V., Taffarel, S. R., Feijoo, G., & Moreira, M. T. (2020). Environmental assessment of viticulture waste valorisation through composting as a biofertilisation strategy for cereal and fruit crops. Environmental Pollution, 264, 1–8. https://doi.org/10.1016/j.envpol.2020.114794 Day, M., & Shaw, K. (2001). CHAPTER 2: Biological, Chemical, and Physical Processes of Composting. In stoffella peter j. & kahn brian A. (Eds.), Compost Utilization In Horticultural Cropping Systems (1st ed., Vol. 1, pp. 1–34). CRC Press. https://doi.org/10.1201/9781420026221.ch2 Díaz, G. A., Auger, J., Besoain, X., Bordeu, E., & Latorre, B. A. (2013). Prevalence and pathogenicity of fungi associated with grapevine trunk diseases in Chilean vineyards. Ciencia e Investigación Agraria , 40 (2), 327–339. https://doi.org/10.4067/S0718-16202013000200008 Fernández, F. J., Sánchez-Arias, V., Rodríguez, L., & Villaseñor, J. (2010). Feasibility of composting combinations of sewage sludge, olive mill waste and winery waste in a rotary drum reactor. Waste Management , 30 (10), 1948–1956. https://doi.org/10.1016/j.wasman.2010.04.007 Gangwar, M., Saini, P., Nikhanj, P., & Kaur, S. (2017). Plant Growth-Promoting Microbes (PGPM) as Potential Microbial Bio-Agents for Eco-Friendly Agriculture (pp. 37–55). https://doi.org/10.1007/978-981-10-7380-9_3 Gao, P., Xu, W., Sontag, P., Li, X., Xue, G., Liu, T., & Sun, W. (2016). Correlating microbial community compositions with environmental factors in activated sludge from four full-scale municipal wastewater treatment plants in Shanghai, China. Applied Microbiology and Biotechnology , 100 (10), 4663–4673. https://doi.org/10.1007/s00253-016-7307-0 Insam, H., & de Bertoldi, M. (2007). Chapter 3 Microbiology of the composting process. Waste Management Series , 8 , 25–48. Kallistova, A. I., Pimenov, N. v, Kozlov, M. N., Nikolaev, I. A., Dorofeev, A. G., Aseeva, V. G., Grachev, V. A., Men’ko, E. v, Berestovskaia, I. I., Nozhevnikova, A. N., & Kevbrina, M. v. (2014). [Microbial composition of the activated sludges of the Moscow wastewater treatment plants]. Mikrobiologiia , 83 (5), 615–625. Kulišová, M., Vrublevskaya, M., Lovecká, P., Vrchotová, B., Stránská, M., Kolařík, M., & Kolouchová, I. (2021). Fungal Endophytes of Vitis vinifera—Plant Growth Promotion Factors. Agriculture , 11 (12), 1250. https://doi.org/10.3390/agriculture11121250 Liu, X., Rong, X., Yang, J., Li, H., Hu, W., Yang, Y., Jiang, G., Xiao, R., Deng, X., Xie, G., Luo, G., & Zhang, J. (2023). Community succession of microbial populations related to C–N–P–S biological transformations regulates product maturity during cow-manure-driven composting. Bioresource Technology , 369 (December 2022), 128493. https://doi.org/10.1016/j.biortech.2022.128493 Martínez Salgado, M. M., Ortega Blu, R., Janssens, M., & Fincheira, P. (2019). Grape pomace compost as a source of organic matter: Evolution of quality parameters to evaluate maturity and stability. Journal of Cleaner Production , 216 , 56–63. https://doi.org/10.1016/J.JCLEPRO.2019.01.156 Martínez-Blanco, J., Lazcano, C., Christensen, T. H., Muñoz, P., Rieradevall, J., Møller, J., Antón, A., Boldrin, A., Martínez-Blanco, J., Rieradevall, J., Lazcano, C., Christensen, T. H., Møller, J., Boldrin, A., Muñoz, P., Antón, A., & Sustain Dev, A. (2013). Compost benefits for agriculture evaluated by life cycle assessment. A review. Agronomy for Sustainable Development , 33 (4), 721732. https://doi.org/10.1007/s13593-013-0148-7 Martins, G. L., de Souza, A. J., Mendes, L. W., Gontijo, J. B., Rodrigues, M. M., Coscione, A. R., Oliveira, F. C., & Regitano, J. B. (2023). Physicochemical and bacterial changes during composting of vegetable and animal-derived agro-industrial wastes. Bioresource Technology , 376 (November 2022), 1–9. https://doi.org/10.1016/j.biortech.2023.128842 Morales, A. B., Bustamante, M. A., Marhuenda-Egea, F. C., Moral, R., Ros, M., & Pascual, J. A. (2016). Agri-food sludge management using different co-composting strategies: Study of the added value of the composts obtained. Journal of Cleaner Production , 121 , 186–197. https://doi.org/10.1016/j.jclepro.2016.02.012 Naqqash, T., Imran, A., Hameed, S., Shahid, M., Majeed, A., Iqbal, J., Hanif, M. K., Ejaz, S., & Malik, K. A. (2020). First report of diazotrophic Brevundimonas spp. as growth enhancer and root colonizer of potato. Scientific Reports , 10 (1), 12893. https://doi.org/10.1038/s41598-020-69782-6 Neklyudov, A. D., Fedotov, G. N., & Ivankin, A. (2008). Intensification of composting processes by aerobic microorganisms: A review. Applied Biochemistry and Microbiology , 44 , 6–18. Nilsson, R. H., Larsson, K.-H., Taylor, A. F. S., Bengtsson-Palme, J., Jeppesen, T. S., Schigel, D., Kennedy, P., Picard, K., Glöckner, F. O., Tedersoo, L., Saar, I., Kõljalg, U., & Abarenkov, K. (2019). The UNITE database for molecular identification of fungi: handling dark taxa and parallel taxonomic classifications. Nucleic Acids Research , 47 (D1), D259–D264. https://doi.org/10.1093/nar/gky1022 Pascual, J. A., Morales, A. B., Ayuso, L. M., Segura, P., & Ros, M. (2018). Characterisation of sludge produced by the agri-food industry and recycling options for its agricultural uses in a typical Mediterranean area, the Segura River basin (Spain). Waste Management , 82 , 118–128. https://doi.org/10.1016/j.wasman.2018.10.020 Pineda, M. E. B. (2015). La solubilización de fosfatos como estrategia microbiana para promover el crecimiento vegetal. Corpoica Ciencia y Tecnología Agropecuaria , 15 , 101–113. Pinto, C., & Gomes, A. C. (2016). Vitis vinifera microbiome: from basic research to technological development. BioControl , 61 (3), 243–256. https://doi.org/10.1007/s10526-016-9725-4 Pinto, R., Brito, L. M., Gonçalves, F., Mourao, I., Torres, L., & Coutinho, J. (2021). Recycling wastes from Douro wine industry by composting. Acta Horticulturae , 1305 , 285–292. https://doi.org/10.17660/ActaHortic.2021.1305.39 Qiagen. (2022). Qiagen DNeasy PowerSoil Pro Kits . Qiagen. https://www.qiagen.com/us/products/discovery-and-translational-research/dna-rna-purification/dna-purification/microbial-dna/dneasy-powersoil-pro-kit Quast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P., Peplies, J., & Glöckner, F. O. (2012). The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Research , 41 (D1), D590–D596. https://doi.org/10.1093/nar/gks1219 Román, P., Martínez, M. M., & Pantoja, A. (2013). Manual Compostaje FAO (A. Pantoja, Ed.; 2nd ed.). FAO. http://www.fao.org/documents/card/en/c/0230bef3-2008-49a0-a45e-ff5370895219/ Sánchez, Ó. J., Ospina, D. A., & Montoya, S. (2017). Compost supplementation with nutrients and microorganisms in composting process. In Waste Management (Vol. 69, pp. 136–153). Pergamon. https://doi.org/10.1016/j.wasman.2017.08.012 Santos, M., Diánez, F., del Valle, M. G., & Tello, J. C. (2008). Grape marc compost: microbial studies and suppression of soil-borne mycosis in vegetable seedlings. World Journal of Microbiology and Biotechnology , 24 , 1493–1505. Semitela, S., Pirra, A., & Braga, F. G. (2019). Impact of mesophilic co-composting conditions on the quality of substrates produced from winery waste activated sludge and grape stalks: Lab-scale and pilot-scale studies. Bioresource Technology , 289 , 121622. https://doi.org/10.1016/j.biortech.2019.121622 Sreevidya, M., Gopalakrishnan, S., Kudapa, H., & Varshney, R. K. (2016). Exploring plant growth-promotion actinomycetes from vermicompost and rhizosphere soil for yield enhancement in chickpea. Brazilian Journal of Microbiology , 47 (1), 85–95. https://doi.org/10.1016/j.bjm.2015.11.030 Sun, Y., Men, M., Xu, B., Meng, Q., Bello, A., Xu, X., & Huang, X. (2019). Assessing key microbial communities determining nitrogen transformation in composting of cow manure using illumina high-throughput sequencing. Waste Management , 92 , 59–67. https://doi.org/10.1016/j.wasman.2019.05.007 Tortosa, G., Castellano-Hinojosa, A., Correa-Galeote, D., & Bedmar, E. J. (2017). Evolution of bacterial diversity during two-phase olive mill waste (“alperujo”) composting by 16S rRNA gene pyrosequencing. Bioresource Technology , 224 , 101–111. https://doi.org/10.1016/j.biortech.2016.11.098 US Composting Council. (2001). TMECC 02.01 Field Sampling Of Compost Materials. Test Methods for the Examination of Composting and Compost, 26. http://soiltestlab.com/wp-content/uploads/2012/10/TMECC-Field-Sampling-Protocol.pdf Verma, J. P., Yadav, J., Tiwari, K. N., & Kumar, A. (2013). Effect of indigenous Mesorhizobium spp. and plant growth promoting rhizobacteria on yields and nutrients uptake of chickpea (Cicer arietinum L.) under sustainable agriculture. Ecological Engineering , 51 , 282–286. https://doi.org/10.1016/j.ecoleng.2012.12.022 Viel, A., Stellin, F., Carlot, M., Nadai, C., Concheri, G., Stevanato, P., Squartini, A., Corich, V., & Giacomini, A. (2018). Characteristics of Compost Obtained from Winemaking Byproducts. Waste and Biomass Valorization , 9 (11), 2021–2029. https://doi.org/10.1007/s12649-017-0160-2 Wilson, S. G., Lambert, J.-J., & Dahlgren, R. (2020). Aplicación de abono a suelos degradados de viñedos: efecto sobre la química del suelo, la fertilidad y el rendimiento de la vid. Revista Americana de Enología y Viticultura , 72 (1), 85–93. https://doi.org/10.1177/0734242X10380117 Zacharof, M.-P. (2017). Grape Winery Waste as Feedstock for Bioconversions: Applying the Biorefinery Concept. Waste and Biomass Valorization , 8 , 1122. https://doi.org/10.1007/s12649-016-9674-2 Additional Declarations No competing interests reported. Supplementary Files GraphicalAbstractSludgeCompostingDAS.docx Cite Share Download PDF Status: Published Journal Publication published 26 Jun, 2024 Read the published version in Discover Applied Sciences → Version 1 posted Editorial decision: Revision requested 23 Feb, 2024 Reviews received at journal 27 Jan, 2024 Reviewers agreed at journal 24 Jan, 2024 Reviewers invited by journal 24 Jan, 2024 Editor assigned by journal 24 Jan, 2024 Submission checks completed at journal 24 Jan, 2024 First submitted to journal 13 Jan, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3861238","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":269142499,"identity":"a1d5efd9-a7d0-4bf3-a1a6-36b6404bc7e5","order_by":0,"name":"Alex Echeverría-Vega","email":"","orcid":"","institution":"Universidad Católica del Maule","correspondingAuthor":false,"prefix":"","firstName":"Alex","middleName":"","lastName":"Echeverría-Vega","suffix":""},{"id":269142500,"identity":"a7c3014b-13e8-4649-b194-59df7ae248e6","order_by":1,"name":"Almendra Espinoza-Mondaca","email":"","orcid":"","institution":"Universidad Católica del Maule","correspondingAuthor":false,"prefix":"","firstName":"Almendra","middleName":"","lastName":"Espinoza-Mondaca","suffix":""},{"id":269142501,"identity":"490b1e68-2d06-4f6c-9ca2-85cb2bfbf7d6","order_by":2,"name":"Eduardo Arqueros-Sanhueza","email":"","orcid":"","institution":"Universidad Católica del Maule","correspondingAuthor":false,"prefix":"","firstName":"Eduardo","middleName":"","lastName":"Arqueros-Sanhueza","suffix":""},{"id":269142502,"identity":"abace53e-589e-4162-aa31-2ea9b9382896","order_by":3,"name":"Denisse Mellado-Quintanilla","email":"","orcid":"","institution":"Universidad Católica del Maule","correspondingAuthor":false,"prefix":"","firstName":"Denisse","middleName":"","lastName":"Mellado-Quintanilla","suffix":""},{"id":269142503,"identity":"eb0ae7cb-7943-4496-aafa-a9b254c9befc","order_by":4,"name":"Rosa Roa-Roco","email":"","orcid":"","institution":"Viña Concha y Toro S.A, Center for Research and Innovation","correspondingAuthor":false,"prefix":"","firstName":"Rosa","middleName":"","lastName":"Roa-Roco","suffix":""},{"id":269142504,"identity":"dbee4045-8aa9-4a48-b55f-8d6bb3b40190","order_by":5,"name":"Alvaro González","email":"","orcid":"","institution":"Viña Concha y Toro S.A, Center for Research and Innovation","correspondingAuthor":false,"prefix":"","firstName":"Alvaro","middleName":"","lastName":"González","suffix":""},{"id":269142505,"identity":"0209f842-dfb9-493c-9591-fd2e0a1d6887","order_by":6,"name":"Rodrigo Morales-Vera","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAApElEQVRIiWNgGAWjYNCCAgYGfgjLglgtBgwMkg1glgQJWgwOEKvFfNrhYx9+GNjYG99IfrqBoYYILTK305Jn9hikJW67kWZ2g+EYEVokpHOMGXgMDieY3chhu8HYQKQWxj8G/+2NZ5CihZnH4ADjBgnitaQlM8sYJCfOOPPM7EYCcX5JPsz4psLOnr89+dmNDzU2hLWgggRSNYyCUTAKRsEowA4AdcoxNrHQz+gAAAAASUVORK5CYII=","orcid":"","institution":"Universidad Católica del Maule","correspondingAuthor":true,"prefix":"","firstName":"Rodrigo","middleName":"","lastName":"Morales-Vera","suffix":""}],"badges":[],"createdAt":"2024-01-13 20:44:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3861238/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3861238/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s42452-024-06047-1","type":"published","date":"2024-06-27T00:30:50+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":50151424,"identity":"f5758b75-f2ac-43f0-bcc3-47c1c2993a87","added_by":"auto","created_at":"2024-01-25 10:16:24","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":382179,"visible":true,"origin":"","legend":"\u003cp\u003eTemperature behavior of each treatment throughout the composting process. Each spot represents the average of triplicates where the standard deviation had a range between 0 and 3.9.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3861238/v1/70c6a7551bb84011d13f541c.png"},{"id":50151421,"identity":"3771076c-d45a-4802-bfd0-c6c240ecabcf","added_by":"auto","created_at":"2024-01-25 10:16:24","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":117190,"visible":true,"origin":"","legend":"\u003cp\u003eEvolution of the physicochemical properties of the compost process. A) Moisture content. B) Bulk density. C) The behavior of pH. The error bars are the result of the standard error of the triplicates of each treatment.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3861238/v1/ba533c5a90b9597c6b85d443.png"},{"id":50152118,"identity":"f2e40baf-2437-42e9-9e0f-394033cde956","added_by":"auto","created_at":"2024-01-25 10:24:23","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":57367,"visible":true,"origin":"","legend":"\u003cp\u003eCanonic analysis of the main components (CAP). A) Bacterial communities during the composting process. B) Fungi communities during the composting process. EC: electrical conductivity, OC: organic carbon, C/N: rate carbon: nitrogen, A/N: rate ammonium: nitrate, TN: total nitrogen, A: ammonium, P: phosphorus, K: potassium\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3861238/v1/a1a07752b5d84adb8d772c8b.png"},{"id":50151423,"identity":"25b24342-171b-4a88-b193-4a9e6868c6d7","added_by":"auto","created_at":"2024-01-25 10:16:24","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":169656,"visible":true,"origin":"","legend":"\u003cp\u003eBeneficial and pathogenic microorganism genera in the final stage and sludge. A) Bacterial genera. B) Fungi genres. The “X” axis shows experimental units, and the “Y” axis shows the presence of microbial genera.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-3861238/v1/171b6cdb819e1de40d480a8b.png"},{"id":59146587,"identity":"c3082e3e-9f25-4efa-a04e-a9dc7e6696a5","added_by":"auto","created_at":"2024-06-27 00:30:56","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1427470,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3861238/v1/52f019aa-91ae-4e02-9d2b-401de52c1d16.pdf"},{"id":50151425,"identity":"25ed41c6-3330-4ecd-aa47-31fc7d2cd833","added_by":"auto","created_at":"2024-01-25 10:16:24","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":724149,"visible":true,"origin":"","legend":"","description":"","filename":"GraphicalAbstractSludgeCompostingDAS.docx","url":"https://assets-eu.researchsquare.com/files/rs-3861238/v1/eaca0ac9f479ee7a503326fb.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Management of industrial wine residues: Physicochemical, bacterial and fungal dynamics during composting processes","fulltext":[{"header":"Highlights","content":"\u003cul\u003e\n \u003cli\u003eThis study assesses\u0026nbsp;the composting of grape pomace and stalks supplemented by sludge from the same winery wastewater treatment plant.\u003c/li\u003e\n \u003cli\u003eThe addition\u0026nbsp;of sludge to composting improves water retention and bulk density and no effect was observed on the\u0026nbsp;macronutrient\u0026nbsp;composition.\u003c/li\u003e\n \u003cli\u003eSludge addition significantly increased beneficial microorganisms in the compost as \u003cem\u003eAspergillus\u003c/em\u003e\u003cem\u003e,\u0026nbsp;\u003c/em\u003eand\u0026nbsp;\u003cem\u003eStreptomyces\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e\u003c/li\u003e\n\u003c/ul\u003e"},{"header":"1. Introduction","content":"\u003cp\u003eComposting is one of the most commonly used techniques when valuing organic residues due to low operational cost and the production of a stable substrate enriched with nutrients named compost ​ (Mart\u0026iacute;nez-Blanco et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) ​. Several studies have validated the use of compost as an enhancer of some physical, chemical, and biological properties of soils, such as structure, drainage, airing, water and nutrient retention, erosion prevention, and support of beneficial microbiota (Wilson et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Composting is a process of exothermic oxidative microbial degradation consisting of mesophilic (25\u0026ndash;45\u0026deg;C), thermophilic (45\u0026ndash;70\u0026deg;C), late mesophilic and maturation ​ (Day \u0026amp; Shaw, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2001\u003c/span\u003e) processes. During the first stage, the mesophilic microorganisms multiply, metabolizing sugars and simple molecules quickly in exothermic processes, reaching a temperature of 45\u0026deg;C (Casco \u0026amp; Herrero, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). In this stage, the microbial community changes because of the increase in temperature. Thermophilic microorganisms degrade more complex molecules, such as sugars, fat, and proteins, increasing the temperature even more, reaching between 50\u0026deg;C and 70\u0026deg;C, and depleting most pathogenic bacteria and fungi ​ (Bueno et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Day \u0026amp; Shaw, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Rom\u0026aacute;n et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Finally, a cooling phase named the late mesophilic stage takes place, reaching the ambient temperature. In this phase, the mesophilic microorganisms appear again, degrading the molecules already processed in the thermophilic stage. The process ends in the phase of stabilization or maturation, characterized by a fast decrease in microbial activity and temperatures and stabilization of nutrients and features of the compost ​ (Bueno et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Rom\u0026aacute;n et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) ​.\u003c/p\u003e \u003cp\u003eSince composting is a biological process, different factors affect its development, such as temperature, moisture, carbon-nitrogen ratio, pH, aeration, and bulk density ​ (Bueno et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Casco \u0026amp; Herrero, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Day \u0026amp; Shaw, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Temperature is the main indicator of composting development, defining the different phases of the process. It is recommendable to maintain the pH of the windrow in a range between 6.5 and 7.5 for the best performance of the microorganisms and, subsequently, better biodegradation ​ (Bueno et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Day \u0026amp; Shaw, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). The microorganisms use between 25 and 30 portions of carbon per nitrogen; therefore, it is considered theoretically optimal for the composting of a product that the C/N rate of the material is between 25/1\u0026ndash;30/1 ​ (Casco \u0026amp; Herrero, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Rom\u0026aacute;n et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2013\u003c/span\u003e)​. The moisture levels must remain sufficient to assure bioactivity but avoid the generation of anaerobic regions caused by excessive moisture, which means between 45 and 60% moisture, maintaining an oxygen saturation over 5% ​ (Rom\u0026aacute;n et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) ​. The bulk density directly affects the behavior of the degradation and the physical structure of the compost windrow. The smaller the size of the particles of a mixture, the bigger it will be its bulk density, being more sensitive to microbial attack; however, it is important to equilibrate it because this also reduces the porosity, which increases the saturation by water, hindering the diffusion of oxygen and other gases ​ (Casco \u0026amp; Herrero, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Rom\u0026aacute;n et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) ​. Additionally, it is important to consider some chemical parameters to understand the evolution of nutrients throughout the degradation process, as well as the agronomic value of the final compost. Therefore, the carbon (C), nitrogen (N), C:N ratio, ammonium-nitrate ratio, potassium, and phosphorous, among others, are normally analyzed ​(Day \u0026amp; Shaw, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Rom\u0026aacute;n et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) ​.\u003c/p\u003e \u003cp\u003eThe most recognized microorganisms present in composting processes include mostly aerobic bacteria from the phyla Proteobacteria, Bacteroidetes, Firmicutes, Chloroflexi, and Actinobacteria and fungi from the phyla Ascomycota and Basidiomycota ​ (Day \u0026amp; Shaw, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Insam \u0026amp; de Bertoldi, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Rom\u0026aacute;n et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The bacterial community composition is directly related to the temperature, which varies according to the process stage. ​ (Casco \u0026amp; Herrero, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Day \u0026amp; Shaw, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Insam \u0026amp; de Bertoldi, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). The fungi take part in degrading complex molecules, which are powerful ligninolytic, cellulolytic, and pectinolytic agents that also degrade chitin and keratin, and many of them release water-soluble substances, antibiotics, and dark pigments, which are very important for the humidification process ​ (Insam \u0026amp; de Bertoldi, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2007\u003c/span\u003e) ​.\u003c/p\u003e \u003cp\u003eComposting of winery solid residues is mainly affected by the presence of phytotoxic and antibacterial substances, such as ethanol, organic acids, and phenolic compounds, which hinder microbial development, reducing the agronomic quality of the compost ​ (Bharathiraja et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Burg et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Zacharof, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Nitrogen supplements such as manure and chemical fertilizers have been commonly used to increase the microbial load and nutrients, improving the biodegradation rate (Bustamante et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2008\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Mart\u0026iacute;nez Salgado et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; S\u0026aacute;nchez et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). However, it generates an additional expense for winery companies. Considering that sludge represents approximately 5% of the total residues produced by the winery (Bharathiraja et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), the composting of grape stalks, pomace and sludge rich in nitrogen has also been used to reduce operational costs ​ (Bertran et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Bustamante et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2007\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Winery sludge is an alkaline and highly humid substrate with a high amount of nitrogen and an elevated number of microorganisms (Pascual et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), ​ including Proteobacteria, Bacteroidetes, Firmicutes, Nitrospira, Dechloromonas, Arcobacter, Nitrobacter, Planctomycetes, Chloroflexi, and several microorganisms that participate in the nitrogen cycle ​ (Gao et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Kallistova et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Neklyudov et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2008\u003c/span\u003e) ​. These phylogenetic groups have also been reported in the early stages of compost, suggesting that sludge could be a suitable supplement for the composting process of winery residues, improving the conditions of the process, increasing beneficial microorganisms, and reducing sludge management costs. Despite studies related to the microbial communities of the composting process (Insam et al., 2007; Neklyudov et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Santos et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Antunes et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Tortosa et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Viel et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Sun et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Liu et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Martins et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), there are no studies focused on the microbiology of winery sludge composting using grape pomace and stalks. Consequently, this work studies the dynamics of microbiological communities and their physicochemical properties during the composting process of residues from the wine industry and the effect of adding winery sludge as a supplement to improve the process fostering a circular economy in the winery sector.\u003c/p\u003e"},{"header":"2. Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Material\u003c/h2\u003e \u003cp\u003eThe composting process was performed using exhausted grape pomace and stalks obtained from white grape cultivars. The mixture was composed of 65% of the exhaust grape pomace and 35% of the stalks by volume. The sludge utilized as a supplement was obtained from the wastewater treatment plant of the winemaking processes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Experimental Design\u003c/h2\u003e \u003cp\u003eA fully randomized (DCA) experimental design was used to evaluate the effect of sludge on the psychochemical and biological properties of the composting process. The experimental design consisted of 3 treatments and 3 repetitions, making a total of 9 experimental units. Three composting windrows of 41 m\u003csup\u003e3\u003c/sup\u003e were constructed with the previously described mixture. Sludge (10% and 20% v/v) was added to the mixtures of compostable material for windrows 1 (T1) and 2 (T2), respectively, and homogenized to build the windrows. A third windrow (T0) corresponding to the control treatment was made up of a pomace and stalks mixture with no sludge. The windrows had a width of 2 m, a height of 1.5 m and a length of 27 m, reaching a final approximated volume of 41 m\u003csup\u003e3\u003c/sup\u003e each.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Sampling\u003c/h2\u003e \u003cp\u003eSamples were collected following the adapted standard version of the Sample Collection and Laboratory Preparation. Field Sampling of Compost Materials. (TMECC) (US Composting Council, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). In summary, samples were taken from the windrows at three different times corresponding to the mesophilic, thermophilic, and stabilization stages. The sample was taken from three equidistant zones from the windrow counting on three replicates per treatment. The sample collection for each of the replicates was made by digging five holes of 60 cm depth, covering the largest possible area of each zone. From each of these holes, nearly 500 g of samples were collected, placed together in one container where they were homogenized by agitation and divided into samples for chemical analysis and microbiological analysis and kept at 4\u0026deg;C and \u0026minus;\u0026thinsp;80\u0026deg;C, respectively, until further use.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Physicochemical Analysis\u003c/h2\u003e \u003cp\u003eTemperature, moisture, pH, and bulk density were monitored during the full composting process. The physicochemical properties, such as bulk density, pH, temperature, electrical conductivity (CE), pH, organic matter (OM), carbon (C), nitrogen (N), C/N ratio, ammonium and nitrate (NH\u003csub\u003e4\u003c/sub\u003e and NO\u003csub\u003e3\u003c/sub\u003e), NH4/NO3 ratio phosphorus (P) and potassium (K), were analyzed for each stage of the different windrows according to the Test Method for the Examination of Composting and Compost (TMECC).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. DNA Extraction and Sequencing\u003c/h2\u003e \u003cp\u003eDNA extraction was performed by following the protocol of the DNeasy Powersoil Pro commercial kit (Qiagen, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The genes of interest sequenced with Illumina MiSeq correspond to the V3-V4 region of the ribosomal gene 16S using the primers 16SF CCTACGGGNGGCWGCAG and 16SR GGACTACHVGGGTATCTAATCC for their amplification and the internal transcribed spacer gen (ITS) using the primers ITS1F CTTGGTCATTTAGAGGAAGTAA and ITS2R GCTGCGTTCTTCATCGATGC. Demultiplexed fastq files were first trimmed to eliminate primers. Then, sequences were cleaned, filtered, trimmed, dereplicated, and merged, and chimeras were removed using the DADA2 pipeline (Callahan et al., 2016) in QIIME V.2 software (Bolyen et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) Amplicon Secuence Variants (ASV) were gathered and further compared to specialized databases for taxonomic assignment. The SILVA SSU 138 16.12.2019 (Quast et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) database was used for bacteria, and the UNITE V10.05.202 (Nilsson et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) database was used for fungi. The samples that had fewer sequences were used to define the rarefaction of each data series.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Data Processing\u003c/h2\u003e \u003cp\u003eThe multivariate statistical analysis of physicochemical and taxonomic data of the process was tested by using Primer6 (Primer E) software. The physicochemical results were standardized, and Euclidean distance matrices were created. The variables with a Pearson\u0026rsquo;s correlation higher than 0.95 were grouped and represented by one unique variable.\u003c/p\u003e \u003cp\u003eThe fourth root was applied to the values of the tables of taxonomic results to homogenize and reduce the dominance effect. Later, Bray‒Curtis similarity matrices were made. Triplicates were tested and averaged. Alpha and beta diversity analysis was performed, together searching for beneficial and pathogenic microorganisms, using data collected from an exhaustive bibliographic review as a reference.\u003c/p\u003e \u003cp\u003eThe physicochemical and microbiological results of the process were tested by using the PERMANOVA statistical analysis with 10,000 permutations and α\u0026thinsp;=\u0026thinsp;0.05. Kruskal‒Wallis statistical analysis was used with α\u0026thinsp;=\u0026thinsp;0.05 to test differences in the number of beneficial and pathogenic microorganisms at the final stage depending on treatment. A canonical analysis of main coordinates (CAP) was used to make a graphic representation of the biological composition of the samples based on environmental data.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results and Discussion","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Physicochemical\u003c/h2\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e shows the temperature of the different treatments, as well as the ambient temperature throughout the process. Days of irrigation and turning procedures are marked. All the treatments reached temperatures over 45\u0026deg;C in the first week of composting. The behavior of the temperature during the process did not show any unusual value, and it is comparable to other similar studies on wineries residues (Bertran et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Bustamante et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; R. Pinto et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The duration of the phases, especially the thermophilic phase, indicates correct decomposition and sanitation (Rom\u0026aacute;n et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). An increase in the temperatures over 75\u0026deg;C was not observed, but a progressive decrease after the eighth turning of the material. T0 shows a higher temperature than T2 and T1 after Day 161 of the test, which indicates more persistence of microbial activity due to less maturation. However, all the treatments began a stabilization phase (\u0026lt;\u0026thinsp;45\u0026deg;C) after 185 days.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe windrows were irrigated periodically to keep the percentage of moisture over 40% during at least the first 140 days of the process. The moisture of each windrow was recorded during the test (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). The treatments started with moisture values between 50 and 60% during the first month. Before irrigation (Day 42), since T1 and T2 showed a larger percentage of moisture, the presence of sludge seemed to improve the water retention of the windrows during the process. During the last month, no irrigation was performed to accelerate the stabilization of the final compost. The bulk density (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB) reflects the physical structure of the windrow and the pore space inside. As expected, an increase in bulk density was observed for all treatments, where T2 and T1 exhibited higher values during the whole process due to the addition of sludge. Although this means better retention of moisture, it negatively affects the gas exchange inside the windrows, increasing the number of turnings. The progressive rise of the bulk density of the treatments is considered a normal behavior in the composting processes (Carmona et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Casco \u0026amp; Herrero, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Rom\u0026aacute;n et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe pH of the treatments when the process began was close to 4.5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), and a progressive rise was observed for all the treatments. T1 and T2 showed a major tendency to stabilize, reaching pH 7 on Day 108; on the other hand, T0 stabilized on Day 143. This difference can be explained by the alkaline pH of the sludge and the nitrate content that induced a higher production of ammonia during the thermophilic phase, accelerating the increase in pH and the stability of the compost. (Bertran et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Bustamante et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; R. Pinto et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWhen analyzing the physicochemical data in a multivariate analysis, significant differences were found depending on treatments for each of the stages (PERMANOVA, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The sludge addition significantly affected the physicochemical parameters of the process in each of the phases. The physicochemical dynamics are described in the following paragraphs.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e3.1.1. Mesophilic Phase\u003c/h2\u003e \u003cp\u003eIn the initial mesophilic phase (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), T2 and T1 showed, on average, an electrical conductivity 20% higher than T0. The nitrogen content regarding T0 increased by 28% in T2 and 14% in T1, respectively. In the study of Bertran et al. (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2004\u003c/span\u003e), a rise of 40% in the content of nitrogen was found when composting sludge together with stalks, indicating that sludge is an excellent nitrogen source. According to these data, using 10% of the sludge would be enough to improve the carbon-nitrogen ratio of the material for the composting process to an optimum level. In this sense, T1, with a 10% sludge content, was theoretically the most optimized treatment, as shown by their nitrogen content in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. On the other hand, Pinto et al. (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) reported a rise in the content of P and K when using winery sludge; however, this effect was not observed in the treatments at the beginning of this study, which was explained by differences in the composition of the raw material that generates the sludge.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e3.1.2. Thermophilic Phase\u003c/h2\u003e \u003cp\u003eT1 and T2 showed on average a 20% higher content of nitrogen than T0, which might be related to a better process of nitrification (Bustamante et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Day \u0026amp; Shaw, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Insam \u0026amp; de Bertoldi, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). However, less nitrate was observed in treatments when adding sludge, but more ammonium was measured in the samples, indicating that fewer nitrate conversion bacteria were present at that time. A 10% lower content of organic matter was observed in T1 and T2 than in T0 (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). This effect may be due to a better performance in the bacterial degradation processes associated with a higher content of nitrogen. The decrease in the C/N ratio associated with the addition of sludge in organic residue composting processes has been previously reported by other authors (Fern\u0026aacute;ndez et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Semitela et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe addition of sludge to the processes can support the formation of an environment that facilitates the growth of microorganisms by increasing the moisture, organic matter, nitrates and other minerals (Day \u0026amp; Shaw, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). As a consequence, a major presence of superior fungal fructification was observed in T1 and T2 compared to T0 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB) (Casco \u0026amp; Herrero, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Insam \u0026amp; de Bertoldi, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Furthermore, windrows with sludge showed a rise in phosphorous mobilization explained by the presence of phosphate-solubilizing microorganisms (i.e., \u003cem\u003eAspergillus\u003c/em\u003e and \u003cem\u003eMycobacterium)\u003c/em\u003e during the composting process (Gangwar et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). An increase in the content of ammonium in the samples with sludge was also observed during this phase (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), proving then a rise in the nitrification processes related to the sludge addition and the growth of nitrogen-fixing microorganisms (Pinto \u0026amp; Gomes, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003e3.1.3. Stabilization Phase\u003c/h2\u003e \u003cp\u003eAll treatments showed a neutral pH at the stabilization stage (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The electrical conductivity was 25% higher in T2 than in T0 and T1, which is probably caused by a higher concentration of dissolved salts due to 20% v/v sludge addition (Day \u0026amp; Shaw, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Insam \u0026amp; de Bertoldi, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). The electrical conductivity of all the final compost produced is under the maximum value of 3 dS/m and then complies with the requirements to be used as a soil amendment (Rom\u0026aacute;n et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). A low final C/N ratio has been reported in different studies when composting sludge and pomace stalks, with values in the range of 17 to 20 (Morales et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The resulting values are consistent with the data published by Carmona et al. (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2012\u003c/span\u003e), with ranges between 15,5\u0026ndash;18,2 when composting pomace and grape stalks in a 1:1 ratio.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eResults of the chemical analysis of the treatments throughout the composting process.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"13\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c13\" colnum=\"13\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eE.C. (dS/m)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003epH\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eO.M. (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eC (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC:N\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eN (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eP (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eK (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c11\"\u003e \u003cp\u003eNH\u003csub\u003e4\u003c/sub\u003e (mg/kg)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c12\"\u003e \u003cp\u003eNO\u003csub\u003e3\u003c/sub\u003e (mg/kg)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c13\"\u003e \u003cp\u003eNH\u003csub\u003e4\u003c/sub\u003e/NO\u003csub\u003e3\u003c/sub\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e3,7\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e3,6\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e91,2\u0026thinsp;\u0026plusmn;\u0026thinsp;0,3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e50,7\u0026thinsp;\u0026plusmn;\u0026thinsp;0,3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e34.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e1,5\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e0,8\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c10\"\u003e \u003cp\u003e2,1\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c11\"\u003e \u003cp\u003e531,7\u0026thinsp;\u0026plusmn;\u0026thinsp;94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c12\"\u003e \u003cp\u003e391,3\u0026thinsp;\u0026plusmn;\u0026thinsp;22,4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c13\"\u003e \u003cp\u003e1,4\u0026thinsp;\u0026plusmn;\u0026thinsp;0,2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e4,5\u0026thinsp;\u0026plusmn;\u0026thinsp;0,2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e3,8\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e84,3\u0026thinsp;\u0026plusmn;\u0026thinsp;1,2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e46,7\u0026thinsp;\u0026plusmn;\u0026thinsp;0,7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e26,0\u0026thinsp;\u0026plusmn;\u0026thinsp;0,3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e1,8\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e0,7\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c10\"\u003e \u003cp\u003e2,2\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c11\"\u003e \u003cp\u003e364,3\u0026thinsp;\u0026plusmn;\u0026thinsp;42,2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c12\"\u003e \u003cp\u003e586,3\u0026thinsp;\u0026plusmn;\u0026thinsp;29.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c13\"\u003e \u003cp\u003e0,6\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e4,8\u0026thinsp;\u0026plusmn;\u0026thinsp;0,2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e3,9\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e83,8\u0026thinsp;\u0026plusmn;\u0026thinsp;0,2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e46,4\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e22,5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e2,1\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e0,9\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c10\"\u003e \u003cp\u003e1,9\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c11\"\u003e \u003cp\u003e539\u0026thinsp;\u0026plusmn;\u0026thinsp;145,5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c12\"\u003e \u003cp\u003e456\u0026thinsp;\u0026plusmn;\u0026thinsp;45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c13\"\u003e \u003cp\u003e1,2\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e4,8\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e3,9\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e88,3\u0026thinsp;\u0026plusmn;\u0026thinsp;0,5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e49\u0026thinsp;\u0026plusmn;\u0026thinsp;0,3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e26,1\u0026thinsp;\u0026plusmn;\u0026thinsp;1,7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e1,9\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e1\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c10\"\u003e \u003cp\u003e2,4\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c11\"\u003e \u003cp\u003e276,7\u0026thinsp;\u0026plusmn;\u0026thinsp;38,9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c12\"\u003e \u003cp\u003e228\u0026thinsp;\u0026plusmn;\u0026thinsp;27,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c13\"\u003e \u003cp\u003e1,5\u0026thinsp;\u0026plusmn;\u0026thinsp;0,3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e5,8\u0026thinsp;\u0026plusmn;\u0026thinsp;0,4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e4,7\u0026thinsp;\u0026plusmn;\u0026thinsp;0,3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e79,7\u0026thinsp;\u0026plusmn;\u0026thinsp;0,7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e44,3\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e19,2\u0026thinsp;\u0026plusmn;\u0026thinsp;0,6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e2,3\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e1,3\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c10\"\u003e \u003cp\u003e2,4\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c11\"\u003e \u003cp\u003e613,3\u0026thinsp;\u0026plusmn;\u0026thinsp;323,7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c12\"\u003e \u003cp\u003e179\u0026thinsp;\u0026plusmn;\u0026thinsp;31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c13\"\u003e \u003cp\u003e3,4\u0026thinsp;\u0026plusmn;\u0026thinsp;3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e4,8\u0026thinsp;\u0026plusmn;\u0026thinsp;0,5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e5,3\u0026thinsp;\u0026plusmn;\u0026thinsp;0,2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e77,8\u0026thinsp;\u0026plusmn;\u0026thinsp;0,2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e43,2\u0026thinsp;\u0026plusmn;\u0026thinsp;2,3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e17,8\u0026thinsp;\u0026plusmn;\u0026thinsp;1,2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e2,4\u0026thinsp;\u0026plusmn;\u0026thinsp;0,4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e1,4\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c10\"\u003e \u003cp\u003e2,1\u0026thinsp;\u0026plusmn;\u0026thinsp;0,2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c11\"\u003e \u003cp\u003e453\u0026thinsp;\u0026plusmn;\u0026thinsp;49,5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c12\"\u003e \u003cp\u003e156\u0026thinsp;\u0026plusmn;\u0026thinsp;22,5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c13\"\u003e \u003cp\u003e2,9\u0026thinsp;\u0026plusmn;\u0026thinsp;0,6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e1,4\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e7,1\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e75\u0026thinsp;\u0026plusmn;\u0026thinsp;2,4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e41,7\u0026thinsp;\u0026plusmn;\u0026thinsp;2,4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e16,4\u0026thinsp;\u0026plusmn;\u0026thinsp;0,6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e2,6\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e2,4\u0026thinsp;\u0026plusmn;\u0026thinsp;0,2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c10\"\u003e \u003cp\u003e3,4\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c11\"\u003e \u003cp\u003e634\u0026thinsp;\u0026plusmn;\u0026thinsp;106\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c12\"\u003e \u003cp\u003e182\u0026thinsp;\u0026plusmn;\u0026thinsp;38,4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c13\"\u003e \u003cp\u003e3,6\u0026thinsp;\u0026plusmn;\u0026thinsp;2,4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e1,4\u0026thinsp;\u0026plusmn;\u0026thinsp;0,3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e7,2\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e62,7\u0026thinsp;\u0026plusmn;\u0026thinsp;2,5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e34,8\u0026thinsp;\u0026plusmn;\u0026thinsp;2,5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e15,9\u0026thinsp;\u0026plusmn;\u0026thinsp;4,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e2,2\u0026thinsp;\u0026plusmn;\u0026thinsp;0,5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e2,9\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c10\"\u003e \u003cp\u003e3\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c11\"\u003e \u003cp\u003e190\u0026thinsp;\u0026plusmn;\u0026thinsp;16,3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c12\"\u003e \u003cp\u003e126,7\u0026thinsp;\u0026plusmn;\u0026thinsp;7,6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c13\"\u003e \u003cp\u003e1,5\u0026thinsp;\u0026plusmn;\u0026thinsp;0,2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e2\u0026thinsp;\u0026plusmn;\u0026thinsp;0,3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e7,1\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e70\u0026thinsp;\u0026plusmn;\u0026thinsp;2,3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e38,9\u0026thinsp;\u0026plusmn;\u0026thinsp;2,4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e12,3\u0026thinsp;\u0026plusmn;\u0026thinsp;0,5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e2,4\u0026thinsp;\u0026plusmn;\u0026thinsp;0,2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c9\"\u003e \u003cp\u003e2,3\u0026thinsp;\u0026plusmn;\u0026thinsp;0,2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c10\"\u003e \u003cp\u003e2,7\u0026thinsp;\u0026plusmn;\u0026thinsp;0,1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c11\"\u003e \u003cp\u003e441,3\u0026thinsp;\u0026plusmn;\u0026thinsp;116,6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c12\"\u003e \u003cp\u003e162,3\u0026thinsp;\u0026plusmn;\u0026thinsp;15,8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c13\"\u003e \u003cp\u003e2,8\u0026thinsp;\u0026plusmn;\u0026thinsp;0,9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e*Each phase (P) corresponds to mesophilic (M), thermophilic (T) and stabilization (S) conditions. For the parameters measured, E.C.: electrical conductivity, O.M.: organic matter. The dispersion value is the result of the standard error of the triplicates of each treatment.\u003c/p\u003e \u003cp\u003eThe ammonium and nitrate contents in the final stage were higher in T0 than in T1 and T2, which could be explained by both the enhanced microbial activity of nitrifying microorganisms in previous stages and a major loss of NH\u003csub\u003e3\u003c/sub\u003e and nitrate by evaporation when sludge is present (Bustamante et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Casco \u0026amp; Herrero, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Insam \u0026amp; de Bertoldi, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). The final phosphorous content was higher in T1 than in T2 and T0 (~\u0026thinsp;20% more), suggesting that 10% was the best proportion of sludge to increase the microorganism-mediated phosphorous mobilization processes (Bueno et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Insam \u0026amp; de Bertoldi, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; S\u0026aacute;nchez et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Dynamics of the Microbial Communities\u003c/h2\u003e \u003cp\u003eThe canonical analysis of main coordinates (CAP) of Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e shows the relationship between the composition of the microbial communities (bacteria \u0026ndash; fungi) in the different treatments and phases of composting and the physicochemical parameters observed during the process.\u003c/p\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA shows that the bacterial communities are clearly differentiated in the mesophilic stage (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), mainly attributable to the different sludge contents in the treatments. In the thermophilic stage, a significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) but lower differentiation was observed among the treatments, which was related to a rise in the conductivity and the ammonium/nitrate ratio. In the stabilization stage, there were fewer differences in the composition of the bacterial communities. In this stage, the C/N ratio reached its lowest value due to the carbon degradation of the organic matter, and the level of phosphorous increases in all the treatments, especially in T1. Similar to bacteria, the composition of the fungal communities was significantly different in the 3 stages of the composting process. In the mesophilic stage, the treatments show less spreading compared to bacteria; however, the differences found among the treatments are significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In the thermophilic stage, the fungal communities decreased significantly, showing differences among the treatments, related to a larger C/N ratio in T0 and less ammonium than in the sludge-added treatments. In the stabilization stage, the fungal communities showed important differences among treatments, mostly due to phosphorous rise and less organic carbon in T1 and T2.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSludge mainly provides a bacterial community into the system, which tends to be homogenized in the thermophilic stage due to the environmental conditions that regulate the growth of the different bacterial groups. This is in accordance with Liu et al. (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), who stated that the physicochemical changes during the different composting stages had a higher impact on the bacterial community composition than the different materials utilized in the treatments. On the other hand, the contribution of fungi from the sludge seems to be less relevant, and their communities are highly sensitive to the environmental conditions, which generates noticeable changes in the composition during the process.\u003c/p\u003e \u003cp\u003eOn a comparative basis, there are noteworthy variations between bacterial and fungal dynamics during the composting process. While the composition of the bacterial communities is affected by sludge addition and tends to homogenize at the end of the composting process, fungi initially look homogeneous and tend to differentiate at the end, as shown in the canonical analysis of principal coordinates (CAP) of Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. We found that the main bacterial phyla present along all the stages and treatments were \u003cem\u003eActinobacteria\u003c/em\u003e, \u003cem\u003eProteobacteria, Firmicutes\u003c/em\u003e and \u003cem\u003eChloroflexi.\u003c/em\u003e On the other hand, the main fungal phyla found along all stages and treatments were \u003cem\u003eAscomycota, Rozellomycota\u003c/em\u003e and \u003cem\u003eBasidiomycota\u003c/em\u003e, which are the same as those reported by Antunes (2016) and Tortosa (2017). This shows the similarity of the composition of microbial communities related to the composting process independent of the type of initial organic material utilized.\u003c/p\u003e \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e \u003ch2\u003e3.2.1. Beneficial Microorganisms\u003c/h2\u003e \u003cp\u003eFigures \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB show the composition of the microbial communities in the stabilization stage as well as the contribution as beneficial or pathogenic microorganisms for vineyards. The principal beneficial fungal genera found in all the samples were \u003cem\u003eAspergillus\u003c/em\u003e and \u003cem\u003eTalaromyces\u003c/em\u003e, where \u003cem\u003eAspergillus\u003c/em\u003e was the most abundant genus in all the treatments, especially in T1 and T2, showing the effect of sludge addition. \u003cem\u003eAspergillus\u003c/em\u003e is a common fungal genus found in compost that participates in processes of mineral solubilization, such as phosphorus and potassium \u003cem\u003esolubilization\u003c/em\u003e (Pineda, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Furthermore, this genus has been reported to produce secondary metabolites such as gibberellic acid, indoleacetic acid, and siderophores (S\u0026aacute;nchez et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The \u003cem\u003eTalaromyces\u003c/em\u003e genus has been shown to have positive effects on plant growth. It was found as an endophyte in plants and has been reported as a phosphate solubilizer and a promising biocontrol agent against phytopathogenic fungi (ulišov\u0026aacute; et al., 2021). The beneficial bacterial genera present in the sludge were \u003cem\u003eStreptomyces, Mycobacterium, Mesorhizobium, Gordonia, Rhodococcus, Brevundimonas\u003c/em\u003e, and \u003cem\u003eAzospirillum.\u003c/em\u003e Representatives of the \u003cem\u003eRhodobacter\u003c/em\u003e genus were also observed in the sludge, but these were not found during the development of the tests, suggesting that the conditions of the composting processes were not optimal for their growth. Therefore, the principal beneficial genera \u003cem\u003eStreptomyces, Mycobacterium\u003c/em\u003e, and \u003cem\u003eMesorhizobium\u003c/em\u003e involved in phosphate solubilization and \u003cem\u003eBrevundimonas\u003c/em\u003e, which participates in the fixation of nitrogen and is a promoter of plant growth (Naqqash et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Sun et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), were the most abundant in all the treatments.\u003c/p\u003e \u003cp\u003eDespite the second most abundant bacteria in T0 being the \u003cem\u003eStreptomyces\u003c/em\u003e genus, sludge addition affects the abundance of the \u003cem\u003eStreptomyces\u003c/em\u003e genus, which is most abundant in T1 and T2. \u003cem\u003eMycobacterium and Mesorhizobium\u003c/em\u003e were found in all the treatments. These genera are commonly observed in soil and have been extensively studied for their role in promoting plant growth by several mechanisms, such as the production of siderophores, phytohormones, cellulases, lipases, proteases and chitinases, enhancing nutrient availability, stimulating root growth (Gangwar et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), nitrogen fixation (Verma et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), phosphate solubilization, and protecting plants from pathogens (Pinto \u0026amp; Gomes, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Sreevidya et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section3\"\u003e \u003ch2\u003e3.2.2. Pathogen Microorganisms\u003c/h2\u003e \u003cp\u003eAt the final stage, \u003cem\u003eAcetobacter\u003c/em\u003e, \u003cem\u003ePenicillium\u003c/em\u003e, \u003cem\u003eCladosporium\u003c/em\u003e, and \u003cem\u003eAlternaria\u003c/em\u003e were observed. These genera have been reported as possible causes of acid rot of the fruit (Acu\u0026ntilde;a, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2010\u003c/span\u003e and Cort\u0026eacute;s et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). \u003cem\u003eAgrobacterium\u003c/em\u003e and \u003cem\u003eAcremonium\u003c/em\u003e genera can cause crown gall disease and stem decline, respectively (Acu\u0026ntilde;a, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Both \u003cem\u003eAgrobacterium\u003c/em\u003e and \u003cem\u003eAcremonium\u003c/em\u003e genres have the most putative negative effect on vines since they can directly affect the wood, thus, causing an ecological and economical issue for vineyards, reducing production and causing plant death (D\u0026iacute;az et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). However, their number is very reduced in every treatment and altogether represents less than 1% of the communities.\u003c/p\u003e \u003cp\u003e \u003cem\u003eAcremonium\u003c/em\u003e is only found in T1 and T2, although this genus is not present in the sludge. This suggests that adding sludge generated the appropriate conditions for its appearance. \u003cem\u003ePenicillium, Alternaria, Agrobacterium\u003c/em\u003e, and \u003cem\u003eAcetobacter\u003c/em\u003e genera are part of the sludge microbiota; however, these genera are also present in T0 regardless of sludge addition; therefore, their presence is not directly related to the addition of sludge. However, \u003cem\u003eCladosporium\u003c/em\u003e is absent in the sludge, and it is only present in T0, regardless of the sludge addition. The sludge addition generates significant differences between the bacteria in T0 and T1, finding that the addition of 10% sludge to the composting process in T1 resulted in a lower number of pathogenic bacteria. This can be explained by the high temperatures reached during the thermophilic phase, where the pathogenic bacteria were eliminated by the high temperatures (75\u0026deg;C) reached during the composting process. (Rom\u0026aacute;n et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"4. Conclusions","content":"\u003cp\u003eAddition of sludge to composting improves water retention and bulk density. The composition of the bacterial communities tended to homogenize at the end of the process, while fungi tended to differentiate. Microbial community dynamics were affected mostly by the temperature of the process rather than the sludge content. Considering the proper temperature reached during composting, the most beneficial genera, such as \u003cem\u003eAspergillus\u003c/em\u003e, \u003cem\u003eTalaromyces\u003c/em\u003e, \u003cem\u003eStreptomyces\u003c/em\u003e, \u003cem\u003eMycobacterium\u003c/em\u003e, \u003cem\u003eMesorhizobium\u003c/em\u003e, \u003cem\u003eGordonia\u003c/em\u003e, and \u003cem\u003eAzospirillum\u003c/em\u003e, were found. Nevertheless, sludge addition generates a significant increase in beneficial microorganisms and a decrease in pathogenic microorganisms. Consequently, it is feasible to compost exhausted grape pomace stalks supplemented by sludge.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Production Promotion Corporation of the Government of Chile (Corporaci\u0026oacute;n de Fomento de la Producci\u0026oacute;n, CORFO), through the \u0026ldquo;Proyecto CORFO PI3486, Desarrollo y validaci\u0026oacute;n de tecnolog\u0026iacute;as para la composta y su efecto sobre el suelo, la vi\u0026ntilde;a y el vino\u0026rdquo;.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAlex Echeverr\u0026iacute;a-Vega:\u003c/strong\u003e Methodology, Investigation, Visualization, Writing \u0026ndash; original draft, Writing \u0026ndash; review \u0026amp; editing. \u003cstrong\u003eAlmendra Espinoza-Mondaca:\u003c/strong\u003e Methodology, Investigation, Writing \u0026ndash; original draft. \u003cstrong\u003eEduardo Arqueros-Sanhueza:\u003c/strong\u003e Conceptualization, Methodology, Visualization, Writing \u0026ndash; original draft. \u003cstrong\u003eDenisse Mellado-Quintanilla\u003c/strong\u003e: Methodology, Investigation, Visualization, Writing \u0026ndash; review \u0026amp; editing. \u003cstrong\u003eRosa Roa-Roco:\u003c/strong\u003e Conceptualization, Methodology, Supervision, Project administration. \u003cstrong\u003eAlvaro Gonz\u0026aacute;lez:\u0026nbsp;\u003c/strong\u003eFunding acquisition, Resources.\u003cstrong\u003e\u0026nbsp;Rodrigo Morales-Vera:\u003c/strong\u003e Conceptualization, Methodology, Investigation, Visualization, Writing \u0026ndash; original draft Writing \u0026ndash; review \u0026amp; editing, Supervision.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the data supporting the findings of this study are available within the paper. If any raw data files are needed in another format, they are available from the corresponding author upon reasonable request.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAcu\u0026ntilde;a, R. (2010). Compendio De Bacterias Y Hongos De Frutales Y Vides En Chile. \u003c/li\u003e\n\u003cli\u003eAntunes, L. P., Martins, L. F., Pereira, R. V., Thomas, A. M., Barbosa, D., Lemos, L. N., Silva, G. M. M., Moura, L. M. S., Epamino, G. W. C., Digiampietri, L. A., Lombardi, K. C., Ramos, P. L., Quaggio, R. B., De Oliveira, J. C. F., Pascon, R. C., Da Cruz, J. B., Da Silva, A. M., \u0026amp; Setubal, J. C. (2016). Microbial community structure and dynamics in thermophilic composting viewed through metagenomics and metatranscriptomics. Scientific Reports, 6(December), 1\u0026ndash;13. https://doi.org/10.1038/srep38915 \u003c/li\u003e\n\u003cli\u003eBertran, E., Sort, X., Soliva, M., \u0026amp; Trillas, I. (2004). Composting winery waste: Sludges and grape stalks. \u003cem\u003eBioresource Technology\u003c/em\u003e, \u003cem\u003e95\u003c/em\u003e(2), 203\u0026ndash;208. https://doi.org/10.1016/j.biortech.2003.07.012\u003c/li\u003e\n\u003cli\u003eBharathiraja, B., Iyyappan, J., Jayamuthunagai, J., Kumar, R. P., Sirohi, R., Gnansounou, E., \u0026amp; Pandey, A. (2020). Critical review on bioconversion of winery residues into value-added products. \u003cem\u003eIndustrial Crops and Products\u003c/em\u003e, \u003cem\u003e158\u003c/em\u003e(January), 112954. https://doi.org/10.1016/j.indcrop.2020.112954\u003c/li\u003e\n\u003cli\u003eBolyen, E., Rideout, J. R., Dillon, M. R., Bokulich, N. A., Abnet, C. C., Al-Ghalith, G. A., Alexander, H., Alm, E. J., Arumugam, M., Asnicar, F., Bai, Y., Bisanz, J. E., Bittinger, K., Brejnrod, A., Brislawn, C. J., Brown, C. T., Callahan, B. J., Caraballo-Rodr\u0026iacute;guez, A. M., Chase, J., \u0026hellip; Caporaso, J. G. (2019). Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. \u003cem\u003eNature Biotechnology\u003c/em\u003e, \u003cem\u003e37\u003c/em\u003e(8), 852\u0026ndash;857. https://doi.org/10.1038/s41587-019-0209-9\u003c/li\u003e\n\u003cli\u003eBueno, P., D\u0026iacute;az, J., \u0026amp; Cabrera, F. (2012). Cap\u0026iacute;tulo 4. Factores que afectan al proceso de Compostaje. In \u003cem\u003ecompostaje\u003c/em\u003e. http://digital.csic.es/bitstream/10261/20837/3/Factores que afectan al proceso de compostaje.pdf \u003c/li\u003e\n\u003cli\u003eBurg, P., V\u0026iacute;těz, T., Turan, J., \u0026amp; Burgov\u0026aacute;, J. (2014). Evaluation of grape pomace composting process. \u003cem\u003eActa \u003c/em\u003e\u003cem\u003eUniversitatis Agriculturae et Silviculturae Mendelianae Brunensis\u003c/em\u003e, \u003cem\u003e62\u003c/em\u003e(5), 875\u0026ndash;881. https://doi.org/10.11118/actaun201462050875\u003c/li\u003e\n\u003cli\u003eBustamante, M. A., Paredes, C., Marhuenda-Egea, F. C., P\u0026eacute;rez-Espinosa, A., Bernal, M. P., \u0026amp; Moral, R. (2008). \u003cem\u003eCo-composting of distillery residues with animal manures: Carbon and nitrogen transformations in the evaluation of compost stability\u003c/em\u003e. https://doi.org/10.1016/j.chemosphere.2008.03.030\u003c/li\u003e\n\u003cli\u003eBustamante, M. A., Paredes, C., Moral, R., Moreno-Caselles, J., P\u0026eacute;rez-Murcia, M. D., P\u0026eacute;rez-Espinosa, A., \u0026amp; Bernal, M. P. (2007). Co-composting of distillery and winery residues with sewage sludge. \u003cem\u003eWater Science and Technology\u003c/em\u003e, \u003cem\u003e56\u003c/em\u003e(2), 187\u0026ndash;192. https://doi.org/10.2166/wst.2007.488\u003c/li\u003e\n\u003cli\u003eBustamante, M. A., Paredes, C., Morales, J., Mayoral, A. M., \u0026amp; Moral, R. (2009). Study of the composting process of winery and distillery residues using multivariate techniques. \u003cem\u003eBioresource Technology\u003c/em\u003e, \u003cem\u003e100\u003c/em\u003e(20), 4766\u0026ndash;4772. https://doi.org/10.1016/j.biortech.2009.04.033\u003c/li\u003e\n\u003cli\u003eCarmona, E., Moreno, M. T., Avil\u0026eacute;s, M., \u0026amp; Ordov\u0026aacute;s, J. (2012). Compostaje de residuos de la industria vin\u0026iacute;cola y su uso como sustrato para el cultivo sin suelo de plantas ornamentales. \u003cem\u003eSpanish Journal of Agricultural Research\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(2), 482\u0026ndash;491. https://doi.org/10.5424/sjar/2012102-320-11\u003c/li\u003e\n\u003cli\u003eCasco, J. M., \u0026amp; Herrero, R. M. (2008). \u003cem\u003eCompostaje\u003c/em\u003e (4th ed.). Ediciones Mundi-Prensa. https://books.google.es/books?id=V2x2hEfBbboC\u003c/li\u003e\n\u003cli\u003eCort\u0026eacute;s, A., Oliveira, L. F. S., Ferrari, V., Taffarel, S. R., Feijoo, G., \u0026amp; Moreira, M. T. (2020). Environmental assessment of viticulture waste valorisation through composting as a biofertilisation strategy for cereal and fruit crops. Environmental Pollution, 264, 1\u0026ndash;8. https://doi.org/10.1016/j.envpol.2020.114794\u003c/li\u003e\n\u003cli\u003eDay, M., \u0026amp; Shaw, K. (2001). CHAPTER 2: Biological, Chemical, and Physical Processes of Composting. In stoffella peter j. \u0026amp; kahn brian A. (Eds.), \u003cem\u003eCompost Utilization In Horticultural Cropping Systems\u003c/em\u003e (1st ed., Vol. 1, pp. 1\u0026ndash;34). CRC Press. https://doi.org/10.1201/9781420026221.ch2\u003c/li\u003e\n\u003cli\u003eD\u0026iacute;az, G. A., Auger, J., Besoain, X., Bordeu, E., \u0026amp; Latorre, B. A. (2013). Prevalence and pathogenicity of fungi associated with grapevine trunk diseases in Chilean vineyards. \u003cem\u003eCiencia e Investigaci\u0026oacute;n Agraria\u003c/em\u003e, \u003cem\u003e40\u003c/em\u003e(2), 327\u0026ndash;339. https://doi.org/10.4067/S0718-16202013000200008\u003c/li\u003e\n\u003cli\u003eFern\u0026aacute;ndez, F. J., S\u0026aacute;nchez-Arias, V., Rodr\u0026iacute;guez, L., \u0026amp; Villase\u0026ntilde;or, J. (2010). Feasibility of composting combinations of sewage sludge, olive mill waste and winery waste in a rotary drum reactor. \u003cem\u003eWaste Management\u003c/em\u003e, \u003cem\u003e30\u003c/em\u003e(10), 1948\u0026ndash;1956. https://doi.org/10.1016/j.wasman.2010.04.007\u003c/li\u003e\n\u003cli\u003eGangwar, M., Saini, P., Nikhanj, P., \u0026amp; Kaur, S. (2017). \u003cem\u003ePlant Growth-Promoting Microbes (PGPM) as Potential Microbial Bio-Agents for Eco-Friendly Agriculture\u003c/em\u003e (pp. 37\u0026ndash;55). https://doi.org/10.1007/978-981-10-7380-9_3\u003c/li\u003e\n\u003cli\u003eGao, P., Xu, W., Sontag, P., Li, X., Xue, G., Liu, T., \u0026amp; Sun, W. (2016). Correlating microbial community compositions with environmental factors in activated sludge from four full-scale municipal wastewater treatment plants in Shanghai, China. \u003cem\u003eApplied Microbiology and Biotechnology\u003c/em\u003e, \u003cem\u003e100\u003c/em\u003e(10), 4663\u0026ndash;4673. https://doi.org/10.1007/s00253-016-7307-0\u003c/li\u003e\n\u003cli\u003eInsam, H., \u0026amp; de Bertoldi, M. (2007). Chapter 3 Microbiology of the composting process. \u003cem\u003eWaste Management Series\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e, 25\u0026ndash;48. \u003c/li\u003e\n\u003cli\u003eKallistova, A. I., Pimenov, N. v, Kozlov, M. N., Nikolaev, I. A., Dorofeev, A. G., Aseeva, V. G., Grachev, V. A., Men\u0026rsquo;ko, E. v, Berestovskaia, I. I., Nozhevnikova, A. N., \u0026amp; Kevbrina, M. v. (2014). [Microbial composition of the activated sludges of the Moscow wastewater treatment plants]. \u003cem\u003eMikrobiologiia\u003c/em\u003e, \u003cem\u003e83\u003c/em\u003e(5), 615\u0026ndash;625. \u003c/li\u003e\n\u003cli\u003eKuli\u0026scaron;ov\u0026aacute;, M., Vrublevskaya, M., Loveck\u0026aacute;, P., Vrchotov\u0026aacute;, B., Str\u0026aacute;nsk\u0026aacute;, M., Kolař\u0026iacute;k, M., \u0026amp; Kolouchov\u0026aacute;, I. (2021). Fungal Endophytes of Vitis vinifera\u0026mdash;Plant Growth Promotion Factors. \u003cem\u003eAgriculture\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(12), 1250. https://doi.org/10.3390/agriculture11121250\u003c/li\u003e\n\u003cli\u003eLiu, X., Rong, X., Yang, J., Li, H., Hu, W., Yang, Y., Jiang, G., Xiao, R., Deng, X., Xie, G., Luo, G., \u0026amp; Zhang, J. (2023). Community succession of microbial populations related to C\u0026ndash;N\u0026ndash;P\u0026ndash;S biological transformations regulates product maturity during cow-manure-driven composting. \u003cem\u003eBioresource Technology\u003c/em\u003e, \u003cem\u003e369\u003c/em\u003e(December 2022), 128493. https://doi.org/10.1016/j.biortech.2022.128493\u003c/li\u003e\n\u003cli\u003eMart\u0026iacute;nez Salgado, M. M., Ortega Blu, R., Janssens, M., \u0026amp; Fincheira, P. (2019). Grape pomace compost as a source of organic matter: Evolution of quality parameters to evaluate maturity and stability. \u003cem\u003eJournal of Cleaner Production\u003c/em\u003e, \u003cem\u003e216\u003c/em\u003e, 56\u0026ndash;63. https://doi.org/10.1016/J.JCLEPRO.2019.01.156\u003c/li\u003e\n\u003cli\u003eMart\u0026iacute;nez-Blanco, J., Lazcano, C., Christensen, T. H., Mu\u0026ntilde;oz, P., Rieradevall, J., M\u0026oslash;ller, J., Ant\u0026oacute;n, A., Boldrin, A., Mart\u0026iacute;nez-Blanco, J., Rieradevall, J., Lazcano, C., Christensen, T. H., M\u0026oslash;ller, J., Boldrin, A., Mu\u0026ntilde;oz, P., Ant\u0026oacute;n, A., \u0026amp; Sustain Dev, A. (2013). Compost benefits for agriculture evaluated by life cycle assessment. A review. \u003cem\u003eAgronomy for Sustainable Development\u003c/em\u003e, \u003cem\u003e33\u003c/em\u003e(4), 721732. https://doi.org/10.1007/s13593-013-0148-7\u003c/li\u003e\n\u003cli\u003eMartins, G. L., de Souza, A. J., Mendes, L. W., Gontijo, J. B., Rodrigues, M. M., Coscione, A. R., Oliveira, F. C., \u0026amp; Regitano, J. B. (2023). Physicochemical and bacterial changes during composting of vegetable and animal-derived agro-industrial wastes. \u003cem\u003eBioresource Technology\u003c/em\u003e, \u003cem\u003e376\u003c/em\u003e(November 2022), 1\u0026ndash;9. https://doi.org/10.1016/j.biortech.2023.128842\u003c/li\u003e\n\u003cli\u003eMorales, A. B., Bustamante, M. A., Marhuenda-Egea, F. C., Moral, R., Ros, M., \u0026amp; Pascual, J. A. (2016). Agri-food sludge management using different co-composting strategies: Study of the added value of the composts obtained. \u003cem\u003eJournal of Cleaner Production\u003c/em\u003e, \u003cem\u003e121\u003c/em\u003e, 186\u0026ndash;197. https://doi.org/10.1016/j.jclepro.2016.02.012\u003c/li\u003e\n\u003cli\u003eNaqqash, T., Imran, A., Hameed, S., Shahid, M., Majeed, A., Iqbal, J., Hanif, M. K., Ejaz, S., \u0026amp; Malik, K. A. (2020). First report of diazotrophic Brevundimonas spp. as growth enhancer and root colonizer of potato. \u003cem\u003eScientific Reports\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(1), 12893. https://doi.org/10.1038/s41598-020-69782-6\u003c/li\u003e\n\u003cli\u003eNeklyudov, A. D., Fedotov, G. N., \u0026amp; Ivankin, A. (2008). Intensification of composting processes by aerobic microorganisms: A review. \u003cem\u003eApplied Biochemistry and Microbiology\u003c/em\u003e, \u003cem\u003e44\u003c/em\u003e, 6\u0026ndash;18. \u003c/li\u003e\n\u003cli\u003eNilsson, R. H., Larsson, K.-H., Taylor, A. F. S., Bengtsson-Palme, J., Jeppesen, T. S., Schigel, D., Kennedy, P., Picard, K., Gl\u0026ouml;ckner, F. O., Tedersoo, L., Saar, I., K\u0026otilde;ljalg, U., \u0026amp; Abarenkov, K. (2019). The UNITE database for molecular identification of fungi: handling dark taxa and parallel taxonomic classifications. \u003cem\u003eNucleic Acids Research\u003c/em\u003e, \u003cem\u003e47\u003c/em\u003e(D1), D259\u0026ndash;D264. https://doi.org/10.1093/nar/gky1022\u003c/li\u003e\n\u003cli\u003ePascual, J. A., Morales, A. B., Ayuso, L. M., Segura, P., \u0026amp; Ros, M. (2018). Characterisation of sludge produced by the agri-food industry and recycling options for its agricultural uses in a typical Mediterranean area, the Segura River basin (Spain). \u003cem\u003eWaste Management\u003c/em\u003e, \u003cem\u003e82\u003c/em\u003e, 118\u0026ndash;128. https://doi.org/10.1016/j.wasman.2018.10.020\u003c/li\u003e\n\u003cli\u003ePineda, M. E. B. (2015). La solubilizaci\u0026oacute;n de fosfatos como estrategia microbiana para promover el crecimiento vegetal. \u003cem\u003eCorpoica Ciencia y Tecnolog\u0026iacute;a Agropecuaria\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e, 101\u0026ndash;113. \u003c/li\u003e\n\u003cli\u003ePinto, C., \u0026amp; Gomes, A. C. (2016). Vitis vinifera microbiome: from basic research to technological development. \u003cem\u003eBioControl\u003c/em\u003e, \u003cem\u003e61\u003c/em\u003e(3), 243\u0026ndash;256. https://doi.org/10.1007/s10526-016-9725-4\u003c/li\u003e\n\u003cli\u003ePinto, R., Brito, L. M., Gon\u0026ccedil;alves, F., Mourao, I., Torres, L., \u0026amp; Coutinho, J. (2021). Recycling wastes from Douro wine industry by composting. \u003cem\u003eActa Horticulturae\u003c/em\u003e, \u003cem\u003e1305\u003c/em\u003e, 285\u0026ndash;292. https://doi.org/10.17660/ActaHortic.2021.1305.39\u003c/li\u003e\n\u003cli\u003eQiagen. (2022). \u003cem\u003eQiagen DNeasy PowerSoil Pro Kits\u003c/em\u003e. Qiagen. https://www.qiagen.com/us/products/discovery-and-translational-research/dna-rna-purification/dna-purification/microbial-dna/dneasy-powersoil-pro-kit\u003c/li\u003e\n\u003cli\u003eQuast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P., Peplies, J., \u0026amp; Gl\u0026ouml;ckner, F. O. (2012). The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. \u003cem\u003eNucleic Acids Research\u003c/em\u003e, \u003cem\u003e41\u003c/em\u003e(D1), D590\u0026ndash;D596. https://doi.org/10.1093/nar/gks1219\u003c/li\u003e\n\u003cli\u003eRom\u0026aacute;n, P., Mart\u0026iacute;nez, M. M., \u0026amp; Pantoja, A. (2013). \u003cem\u003eManual Compostaje FAO\u003c/em\u003e (A. Pantoja, Ed.; 2nd ed.). FAO. http://www.fao.org/documents/card/en/c/0230bef3-2008-49a0-a45e-ff5370895219/\u003c/li\u003e\n\u003cli\u003eS\u0026aacute;nchez, \u0026Oacute;. J., Ospina, D. A., \u0026amp; Montoya, S. (2017). Compost supplementation with nutrients and microorganisms in composting process. In \u003cem\u003eWaste Management\u003c/em\u003e (Vol. 69, pp. 136\u0026ndash;153). Pergamon. https://doi.org/10.1016/j.wasman.2017.08.012\u003c/li\u003e\n\u003cli\u003eSantos, M., Di\u0026aacute;nez, F., del Valle, M. G., \u0026amp; Tello, J. C. (2008). Grape marc compost: microbial studies and suppression of soil-borne mycosis in vegetable seedlings. \u003cem\u003eWorld Journal of Microbiology and Biotechnology\u003c/em\u003e, \u003cem\u003e24\u003c/em\u003e, 1493\u0026ndash;1505. \u003c/li\u003e\n\u003cli\u003eSemitela, S., Pirra, A., \u0026amp; Braga, F. G. (2019). Impact of mesophilic co-composting conditions on the quality of substrates produced from winery waste activated sludge and grape stalks: Lab-scale and pilot-scale studies. \u003cem\u003eBioresource Technology\u003c/em\u003e, \u003cem\u003e289\u003c/em\u003e, 121622. https://doi.org/10.1016/j.biortech.2019.121622\u003c/li\u003e\n\u003cli\u003eSreevidya, M., Gopalakrishnan, S., Kudapa, H., \u0026amp; Varshney, R. K. (2016). Exploring plant growth-promotion actinomycetes from vermicompost and rhizosphere soil for yield enhancement in chickpea. \u003cem\u003eBrazilian Journal of Microbiology\u003c/em\u003e, \u003cem\u003e47\u003c/em\u003e(1), 85\u0026ndash;95. https://doi.org/10.1016/j.bjm.2015.11.030\u003c/li\u003e\n\u003cli\u003eSun, Y., Men, M., Xu, B., Meng, Q., Bello, A., Xu, X., \u0026amp; Huang, X. (2019). Assessing key microbial communities determining nitrogen transformation in composting of cow manure using illumina high-throughput sequencing. \u003cem\u003eWaste Management\u003c/em\u003e, \u003cem\u003e92\u003c/em\u003e, 59\u0026ndash;67. https://doi.org/10.1016/j.wasman.2019.05.007\u003c/li\u003e\n\u003cli\u003eTortosa, G., Castellano-Hinojosa, A., Correa-Galeote, D., \u0026amp; Bedmar, E. J. (2017). Evolution of bacterial diversity during two-phase olive mill waste (\u0026ldquo;alperujo\u0026rdquo;) composting by 16S rRNA gene pyrosequencing. \u003cem\u003eBioresource Technology\u003c/em\u003e, \u003cem\u003e224\u003c/em\u003e, 101\u0026ndash;111. https://doi.org/10.1016/j.biortech.2016.11.098\u003c/li\u003e\n\u003cli\u003eUS Composting Council. (2001). TMECC 02.01 Field Sampling Of Compost Materials. Test Methods for the Examination of Composting and Compost, 26. http://soiltestlab.com/wp-content/uploads/2012/10/TMECC-Field-Sampling-Protocol.pdf\u003c/li\u003e\n\u003cli\u003eVerma, J. P., Yadav, J., Tiwari, K. N., \u0026amp; Kumar, A. (2013). Effect of indigenous Mesorhizobium spp. and plant growth promoting rhizobacteria on yields and nutrients uptake of chickpea (Cicer arietinum L.) under sustainable agriculture. \u003cem\u003eEcological Engineering\u003c/em\u003e, \u003cem\u003e51\u003c/em\u003e, 282\u0026ndash;286. https://doi.org/10.1016/j.ecoleng.2012.12.022\u003c/li\u003e\n\u003cli\u003eViel, A., Stellin, F., Carlot, M., Nadai, C., Concheri, G., Stevanato, P., Squartini, A., Corich, V., \u0026amp; Giacomini, A. (2018). Characteristics of Compost Obtained from Winemaking Byproducts. \u003cem\u003eWaste and Biomass Valorization\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(11), 2021\u0026ndash;2029. https://doi.org/10.1007/s12649-017-0160-2\u003c/li\u003e\n\u003cli\u003eWilson, S. G., Lambert, J.-J., \u0026amp; Dahlgren, R. (2020). Aplicaci\u0026oacute;n de abono a suelos degradados de vi\u0026ntilde;edos: efecto sobre la qu\u0026iacute;mica del suelo, la fertilidad y el rendimiento de la vid. \u003cem\u003eRevista Americana de Enolog\u0026iacute;a y Viticultura\u003c/em\u003e, \u003cem\u003e72\u003c/em\u003e(1), 85\u0026ndash;93. https://doi.org/10.1177/0734242X10380117 \u003c/li\u003e\n\u003cli\u003eZacharof, M.-P. (2017). Grape Winery Waste as Feedstock for Bioconversions: Applying the Biorefinery Concept. \u003cem\u003eWaste and Biomass Valorization\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e, 1122. https://doi.org/10.1007/s12649-016-9674-2\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"discover-applied-sciences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Discover Applied Sciences](https://link.springer.com/journal/42452)","snPcode":"42452","submissionUrl":"https://submission.springernature.com/new-submission/42452/3","title":"Discover Applied Sciences","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Discover Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Composting, Wine residues, Microbial communities, Wine industry, Wastewater sludge","lastPublishedDoi":"10.21203/rs.3.rs-3861238/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3861238/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eComposting is a process of exothermic oxidative microbial degradation and stabilization of organic residues. The microorganisms driving the process, which are determined by temperature, change during the different phases. The main objective of this research was to study both physicochemical and microbiological dynamics during the composting process of wine industry residues composed by exhausted grape pomace and stalks supplemented by sludge from a winery wastewater treatment plant. Three composting windrows of 41 m\u003csup\u003e3\u003c/sup\u003e were constructed with 0, 10 and 20% sludge addition. Physical\u0026ndash;chemical parameters were assessed following the Test Method for the Examination of Composting and Compost (TMECC), and the diversity and dynamics of bacterial and fungal communities involved in this process were assessed by a high-throughput sequencing metabarcoding approach. After six months of aerated turned windrow composting, it was observed that the addition of sludge increased moisture, bulk density, and pH. No effect of the sludge on the macronutrient composition of compost was observed. Bacterial and fungal dynamics showed significant differences depending on the addition of sludge and a high amount of beneficial microorganisms and a low presence of potentially pathogenic microorganisms in the final compost. Beneficial fungal phosphorus solubilizers, such as \u003cem\u003eAspergillus\u003c/em\u003e and \u003cem\u003eTalaromyces\u003c/em\u003e, were found. \u003cem\u003eStreptomyces\u003c/em\u003e and \u003cem\u003eMycobacterium\u003c/em\u003e were the most abundant beneficial bacteria. Finally, the addition of sludge results in a significant increase in the percentage of beneficial microorganisms in the final products.\u003c/p\u003e","manuscriptTitle":"Management of industrial wine residues: Physicochemical, bacterial and fungal dynamics during composting processes","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-25 10:16:19","doi":"10.21203/rs.3.rs-3861238/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-02-24T03:43:27+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-01-28T03:25:30+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"59b2403e-5c72-4bdd-b8c0-faa9a1a5472c","date":"2024-01-25T02:17:11+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-01-24T12:02:04+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-01-24T07:31:23+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-01-24T07:31:05+00:00","index":"","fulltext":""},{"type":"submitted","content":"Discover Applied Sciences","date":"2024-01-13T20:38:53+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"discover-applied-sciences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Discover Applied Sciences](https://link.springer.com/journal/42452)","snPcode":"42452","submissionUrl":"https://submission.springernature.com/new-submission/42452/3","title":"Discover Applied Sciences","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Discover Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"2578014a-f9b5-432c-ab32-5f86ae648dd2","owner":[],"postedDate":"January 25th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-06-27T00:30:50+00:00","versionOfRecord":{"articleIdentity":"rs-3861238","link":"https://doi.org/10.1007/s42452-024-06047-1","journal":{"identity":"discover-applied-sciences","isVorOnly":false,"title":"Discover Applied Sciences"},"publishedOn":"2024-06-27 00:30:50","publishedOnDateReadable":"June 27th, 2024"},"versionCreatedAt":"2024-01-25 10:16:19","video":"","vorDoi":"10.1007/s42452-024-06047-1","vorDoiUrl":"https://doi.org/10.1007/s42452-024-06047-1","workflowStages":[]},"version":"v1","identity":"rs-3861238","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3861238","identity":"rs-3861238","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}