Identification of a gene from Streptomyces rimosus M527 negatively affecting antibiotic biosynthesis and morphological differentiation

Identification of a gene from Streptomyces rimosus M527 negatively affecting antibiotic biosynthesis and morphological differentiation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Identification of a gene from Streptomyces rimosus M527 negatively affecting antibiotic biosynthesis and morphological differentiation Zheng Ma, Zhangqing Song, Jie Xu, Andreas Bechthold, Xiaoping Yu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-17670/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: The polyene macrolide rimocidin, produced by Streptomyces rimosus M527, was found to be highly effective against a broad range of fungal plant pathogens. Current understanding of the regulatory mechanism of rimocidin biosynthesis and morphological differentiation in S. rimosus M527 is limited. NsdA is considered as a negative regulator involved in morphological differentiation and biosynthesis of secondary metabolites in some Streptomyces . Results: In this study, nsdA sr was cloned from S. rimosus M527. The role of nsdA sr in rimocidin biosynthesis and morphological differentiation was investigated by gene deletion, complementation, and over-expression. A ΔnsdA sr mutant was obtained using CRISPR/Cas9. The mutant produced more rimocidin (46%) and generated more spores than the wild-type strain. Over-expression of nsdA sr led to a decrease in rimocidin production and impairment of sporulation. Quantitative reverse transcription-PCR (qRT-PCR) analysis revealed that transcription of rim genes responsible for rimocidin biosynthesis was up-regulated in the ΔnsdA sr mutant but down-regulated in the nsdA sr over-expression strain. Similar effects have been described for Streptomyces coelicolor M145 and the industrial toyocamycin-producing strain Streptomyces diastatochromogenes 1628. Conclusion: NsdA sr is identified as a negative regulator of sporluation and antibiotic biosynthesis as well as the transcription of biosynthetic genes both in its host S. rimosus M527 and in model strain S. coelicolor and industrial producer strain S. diastatochromogenes 1628. This work will provide further information for understanding regulatory mechanisms controlling rimocidin biosynthesis in S. rimosus M527. Applied & Industrial Microbiology NsdAsr Streptomyces rimosus Rimocidin CRISPR/Cas9 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background Streptomyces are Gram-positive bacteria with complex morphological differentiation and secondary metabolism. They are well-known to produce a wide variety of valuable natural products with diverse biological activities [1-3]. In Streptomyces , the processes of morphological differentiation and antibiotic biosynthesis are tightly controlled via multiple levels of regulation that includes cluster-situated, pleiotropic, and global regulators that respond to numerous physiological and environmental conditions [4-6]. Among the many regulatory genes, a gene n egatively affecting S treptomyces d ifferentiation ( nsdA ) was first found in model strain Streptomyces coelicolor A3(2) [7]. The disruption of nsdA in S . coelicolor resulted in accelerated sporulation and increased production of three antibiotics, actinorhodin (Act), methylenomycin, and a calcium-dependent antibiotic. Subsequent studies report that n sdA negatively affects antibiotic biosynthesis and morphological differentiation in Streptomyces . For example, in Streptomyces bingchengensis and Streptomyces lydicus A02, disruption of nsdA caused increased production of secondary metabolites (milbemycin A4, nanchangmycin, and natamycin, along with greater production of pigment and spores than their wild-type strain [8, 9]. The tetraene rimocidin is a glycosylated polyketide [10]. Like other macrolides, rimocidin is synthesized in Streptomyces sp . by so-called type I modular polyketide synthases [11]. Because of its broad range of biological activity against pathogenic fungi, rimocidin possessed some potential as a fungicide for controlling plant diseases and became an attractive target for research [12-14]. Streptomyces rimosus M527 (China Center for Type Culture Collection (CCTCC) M2013270), which was originally isolated in 2011 from soil, is also known as rimocidin producer [15]. In 2019, a gene transfer system for the strain was developed [16] and the genome of the strain was sequenced (GenBank accession No. GCA_004196335.1). Recently rimocidin production in the strain could be enhanced by ribosome engineering [17]. Our knowledge about regulatory mechanisms controlling rimocidin biosynthesis and about morphological differentiation lagged far behind our knowledge about the biosynthesis of rimocidin [11, 18, 19]. Elucidation and manipulation of regulatory networks have recently been shown to be an efficient strategy for further improving production of various industrial compounds [20, 21]. For example, Luo et al. [22] identified a transcriptional regulator PhaR in Streptomyces roseosporus L30. Deletion of phaR led to an increased expression of the gene cluster resulting in a 6.14-fold increased daptomycin production. In the genome sequence of S. rimosus M527 nsdA sr (GenBank accession No. MN395042) was identified which encodes a protein with high similarity to NsdA from S. coelicolor . This study aimed to explore the role of nsdA sr in morphological differentiation and rimocidin biosynthesis in S. rimosus M527. Construction of a mutant of S. rimosus M527 with a nsdA sr deletion was accomplished using the CRISPR/Cas9 system. NsdA sr was identified as a negative regulator of rimocidin biosynthesis by repressing transcription of structural genes. Furthermore, heterologous expression of nsdA sr in Streptomyces diastatochromogenes 1628 and S. coelicolor M145 also affected morphological differentiation and inhibited natural product biosynthesis. Results Cloning and identification of putative nsdA sr from S. rimosus M527 Referencing the available genome sequence of S. rimosus M527 (GenBank accession No. GCA_004196335.1), a nsdA orthologue nsdA sr gene from S. rimosus M527 was cloned. The nucleotide sequence was submitted to the GenBank database under the accession number MN395042. The 1476 bp nsdA sr gene encodes a protein of 491 amino acids. A phylogenetic tree was constructed to show the relationship between NsdA sr and known NsdA homologues in other Streptomyces species (Additional file 1: Figure S1). NsdA sr (boldface) was very similar to known NsdA proteins submitted to National Center for Biotechnology Information (NCBI). Among them, NsdA sr showed the highest similarity to NsdA from S. griseoflavus (KOG64483, 99.6% identical amino acids). Deletion of nsdA sr gene increases rimocidin production and acceleration of sporulation To further determine the role of nsdA sr in rimocidin biosynthesis and morphological differentiation, knock-out plasmid pWHU2653-Δ nsdA sr was created (Figure 1A). The construction of the nsdA sr disruption mutant M527-ΔnsdA sr was achieved using the CRISPR/Cas9-CodA(sm) combined system. The deletion of nsdA sr was validated by PCR with the corresponding verification primers P5/P8 and P9/P10. As shown in Figure 1B, a 1476 bp nsdA sr gene could be amplified from M527 (lane 1), but not from M527-ΔnsdA sr (lane 2). In addition, amplicons of 5.7 kb (lane 3) and 4.2 kb (lane 4) represented products of the wild-type strain M527 and the mutant strain M527-ΔnsdA sr . These results indicate that the nsdA sr gene was deleted in mutant M527- ΔnsdA sr . To investigate the effect of the nsdA sr gene on rimocidin production, a shake-flask fermentation experiment was performed using mutant S. rimosus M527-ΔnsdA sr and wild-type S. rimosus M527. Samples were periodically collected and analyzed to determine the concentration of rimocidin in the fermentation broth using HPLC (Additional file 2: Figure S2). After 96 h, the level of rimocidin produced by S. rimosus M527-ΔnsdA sr had reached 318.5 mg/L, an increase of 46% compared to S. rimosus M527 (Figure 2), suggesting that NsdA sr acts as a negative regulator in rimocidin biosynthesis. To confirm that the deletion of the nsdA sr gene was the sole reason for the increase in rimocidin production, the mutant M527-ΔnsdA sr was complemented by introducing an integrative plasmid pSET152:: nsdA sr , in which the nsdA sr gene was driven by its own promoter, to generate the complemented strain M527-ΔnsdA sr /pSET152:: nsdA sr . The complemented strain M527- ΔnsdA sr /pSET152:: nsdA sr produced rimocidin at levels comparable with levels produced by the wild-type strain (Additional file 2: Figure S2 and Figure 2). Moreover, to further investigate the effect of nsdA sr on morphological differentiation, scanning electron microscopy (SEM) was employed to examine morphological characteristics of wild-type M527 and mutant M527-ΔnsdA sr strains . More abundant sporulation in mutant M527-ΔnsdA sr was observed (Figure 3). Moreover, no significant difference between S. rimosus M527 and the complemented strain M527-ΔnsdA sr /pSET152:: nsdA sr was found (Figure 3). These results indicate that NsdA sr negatively affected sporulation. In addition, the expression of the empty plasmid pSET152 in S. rimosus M527 had no effect on morphological differentiation or rimocidin production (data not shown). Construction of recombinant strain S. rimosus M527- NA sr NsdA sr was predicted to be a negative regulator, suggesting that an increased copy number of nsdA sr might play a negative role in the morphological differentiation and further depress rimocidin production. The gene nsdA sr was placed under the control of promoter ermE * in plasmid pIB139 to create pIB139- nsdA sr (Additional file 3: Figure S3). The plasmid pIB139- nsdA sr was then introduced into S. rimosus M527 by intergeneric conjugation [16], to generate the recombinant strain S. rimosus M527-NA sr resistant to 300 µg/mL apramycin (Additional file 4: Figure S4). The integration of plasmid pIB139- nsdA sr into the chromosome of S. rimosus M527 was verified by PCR (Additional file 5: Figure S5). Over-expression of nsdA sr gene negatively affects sporulation behavior and rimocidin production, and represses transcription of rim genes S. rimosus M527 Morphological characteristics of the wild-type S. rimosus M527 and the recombinant M527-NA sr when cultivated on MS agar plates at 28°C were assessed. Both S. rimosus M527 and M527-NA sr produced white aerial hyphae, however, a difference in sporulation was observed between both strains (Figure 3). The wild-type strain gave rise to abundant yellow spores, whereas the recombinant strain hardly sporulated. To evaluate the effect of nsdA sr gene on rimocidin production, recombinant strain S. rimosus M527-NA sr and control strain S. rimosus M527 were cultured in shake-flask fermentation. As shown in Figure 2, a large decrease in rimocidin production was observed for the recombinant strain M527-NA sr . After 96 h, the amount of rimocidin produced by M527-NA sr reached the highest level of 91.1 mg/L, a 58.2% decrease in the yield of rimocidin produced by the S. rimosus M527 (218.2 mg/L). These results indicate that nsdA sr negatively affects on S. rimosus M527 morphological differentiation and rimocidin biosynthesis. Accordingly, the expression of empty plasmid pIB139 in S. rimosus M527 had no effect on morphological differentiation and rimocidin production (data not shown). The partial sequence of the rim gene cluster involved in rimocidin biosynthesis in S. rimosus M527 was cloned and published (GenBank accession No: MK300953). The putative functions of 10 rim genes ( rimA to rimK ) located in the cluster have been analyzed, and these genes are anticipated to be responsible for rimocidin biosynthesis [11, 17]. To test whether NsdA sr regulates rimocidin biosynthesis through affecting transcription of rim genes, we performed qRT-PCR analysis using total RNA of S. rimosus M527, mutant M527-ΔnsdA sr , complemented strain M527-ΔnsdA sr /pSET152:: nsdA sr , and S. rimosus M527-NA sr , after 48 and 84 h of fermentation. As compared with wild-type, transcriptional levels of rim genes were obviously increased in M527-ΔnsdA sr , and the increase was diminished in the complemented strain. Transcriptional levels of rim genes were repressed in strain S. rimosus M527-NA sr (Figure 4). NsdA sr thus impairs gene expression at the transcriptional level for all rim genes and further decreases rimocidin production in over-expressing recombinant strains. Heterologous expression of the nsdA sr gene negatively affects sporulation behavior and antibiotic production of S. coelicolor M145 and S. diastatochromogenes 1628 To determine whether the nsdA sr has similar negative effects on S. coelicolor M145 and S. diastatochromogenes 1628, the plasmid pIB139- nsdA sr was also introduced into S. coelicolor M145 and S. diastatochromogenes 1628 by intergeneric conjugation, to generate the recombinant strains M145-NA sr and 1628-NA sr , both resistant to 50 µg/mL apramycin (data not shown). The integration of plasmid pIB139- nsdA sr into the chromosome of S. coelicolor M145 (Additional file 6: Figure S6) and S. diastatochromogenes 1628 (Additional file 7: Figure S7) was verified by PCR, respectively. When grown on Gauze’s No. 1 medium for 6 days, blue pigment corresponding to Act, which diffuses into the agar, can be detected earlier and is increased in wild-type S. coelicolor M145 comparing with the recombinant strain M145-NA sr (Figure 5A). Sporulation behaviors of S. coelicolor M145-NA sr was also delayed because of the introduction of the nsdA sr gene. Similarly, heterologous expression of the nsdA sr gene had negative effects on sporulation and toyocamycin(TM) production of S. diastatochromogenes 1628. Nearly no difference between control strain S. diastatochromogenes 1628 and S. diastatochromogenes 1628-NA sr in terms of cell growth was observed (Figure 5B). However, after 24 h of cultivation, the sporulation of S. diastatochromogenes 1628-NA sr was obviously impaired. TM production for S. diastatochromogenes 1628-NA sr was greatly reduced (Figure 5C). After 84 h, TM production by 1628-NA sr was reduced by 52%. Additionally, the effect of nsdA sr on the transcription of the respective genes involved in biosynthesis of Act and TM was investigated. In S . coelicolor , Act biosynthesis is dependent on the transcriptional activation of the Act biosynthesis cluster by the ActII-orf4 protein, and increased expression of actII-orf4 results in the overproduction of Act [23-26]. Total RNA from S. coelicolor M145 and M145-NA sr was isolated after 48 and 84 h of cultivation. Semi-quantitative RT-PCR analysis results indicated that gene actII-orf4 was down-regulated in S. coelicolor M145-NA sr (Figure 6A), indicating that heterologous expression of nsdA sr weakens transcription of actII-orf4 . As an internal control, the expression of 16S rDNA was comparable in the two strains. As expected, semi-quantitative RT-PCR analysis also indicated that heterologous expression of nsdA sr had similar negative effects on the transcription of five toy genes( toyA , toyB , toyE , toyF , and toyG ). Compared to the wild-type strain, the transcriptional levels of all toy genes were greatly decreased in 1628-NA sr (Figure 6B). Discussion The polyene macrolide rimocidin shows strong antifungal activity and can be used to treat plant fungal diseases. S. rimosus M527 is a rimocidin producer, but its rimocidin production is very limited. Accordingly, significant focus has been placed on developing genetic transformation methods and expression systems [16] or ribosome engineering technology combined with new fermentation conditions to improve rimocidin production [17]. The long-term goal of our research is to better understand regulatory mechanisms involved in rimocidin biosynthesis. Such understanding will allow rational modification of regulatory networks to achieve up- or down-expression of specific gene(s) to control the desired metabolic flow. This will eventually lead to an increased rimocidin production and more potent and useful rimocidin analogues. To date, a lack of knowledge of the regulation of rimocidin biosynthesis has prevented titer enhancement of rimocidin production by rational strategies. The nsdA gene, which is found and conserved in some Streptomyces , negatively affects morphological differentiation and secondary metabolite production [7-9]. Recently, by genome mining of S. rimosus M527, the nsdA homologue nsdA sr was found, which encodes a 491-amino-acid protein that shares up to 75% amino acids with other NsdA proteins. An obvious question is whether nsdA sr has similar effects on sporulation behavior and rimocidin production. An efficient gene disruption technology in S. rimosus M527 will make it possible to determine gene function through characterization of deletion mutant phenotypes. And it will certainly contribute to a better understanding of the relationship between regulators and rimocidin biosynthesis. Unfortunately, biotechnological methods available in Streptomyces are limited. Typically, for gene disruption in Streptomyces , single crossover integration of a suicide plasmid can be employed, resulting in disruption of the gene of interest with a selectable marker [27]. However, the limited number of selectable markers limits the reusability of this approach. Alternatively, clean genomic deletions can be made via double-crossover integration. However, this multistep process is often time-consuming and laborious [27-29]. Auspiciously, the appearance of clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR -associated (Cas) protein systems provides an ideal solution to these problems. Compared with traditional methods, the application of CRISPR/Cas9 has several advantages, including higher efficiency and ease of operation [30]. The establishment of CRISPR/Cas9-based genetic manipulation approaches in Streptomyces opened a new era for genome engineering of this type of microorganism [31]. A few CRISPR/Cas9 systems for genome editing have been developed and applied in various Streptomyces species, such as Streptomyces coelicolor [32] and Streptomyces lividans [33]. By co-expression with customized single guide RNAs (sgRNAs), Streptococcus pyogenes Cas9 nuclease can mediate a double-strand break in the sgRNA binding region; efficient double crossover can be achieved when the homologous templates are provided in the same plasmid. Among them, pWHU2653, based on engineered CRISPR/Cas9 combined with the counter selection system CodA(sm), has been developed and was successfully used to rapidly and effectively delete the Act polyketide chain length factor gene actI-ORF2 [34]. In this study, in order to clarify the relationship of nsdA sr to morphological differentiation and rimocidin biosynthesis in S. rimosus M527, pWHU2653 was adopted for the construction of a nsdA sr deletion mutant using CRISPR/Cas9 system. Results show that gene deletion of nsdA sr results in an increase in rimocidin production. Complementation of nsdA sr reduced rimocidin production to levels comparable with production in the wild-type strain. qRT-PCR analysis revealed that rim genes were up-regulated in the nsdA sr mutant and down-regulated in the nsdA sr over-expression strain. In addition, deletion and over-expression of nsdA sr led to acceleration and delaying of sporulation, respectively. The qRT-PCR result demonstrated that the decreased rimocidin production caused by the introduction of nsdA sr was attributed to the inhibition of transcription of rimocidin biosynthetic genes. These results support the conclusion that NsdA sr plays a negative role in morphological differentiation and rimocidin production in S. rimosus M527. Whether the negative effect of NsdA sr is universal to other Streptomyces is still unknown. In this study, the deduced amino acid sequence of NsdA sr showed 77.6% similarity to NsdA sc from model strain S . coelicolor . The disruption of the nsdA sc gene resulted in the overproduction of Act in S . coelicolor . Thus, the heterologous expression of nsdA sr in S . coelicolor was considered and performed. As expected, NsdA sr had negative effects on sporulation and Act biosynthesis as well as on transcription of the pathway-specific regulator, actII-orf4 . This result confirmed that NsdA sr is not only a homologue of NsdA sc but also has similar effects. Subsequently, by heterologous expression of nsdA sr , similar negative effects on morphological differentiation and antibiotic production were observed in S. diastatochromogenes 1628, which is considered a significant industrial producer of the nucleoside antibiotic, TM [35, 36]. Conclusions In conclusion, n sdA sr cloned in this study is identified as a negative regulator of sporluation and antibiotic biosynthesis as well as the transcription of biosynthetic genes both in its host S. rimosus M527 and in model strain S . coelicolor and industrial producer strain S. diastatochromogenes 1628. However, the exact molecular mechanism of rimocidin biosynthesis and other metabolic pathways affected by NsdA sr remains unknown. This point could be elucidated by RNA-seq or -omics strategies using the nsdA sr deletion mutant and wild-type strains. Further studies are needed to elucidate other key genes or metabolic pathways involved in rimocidin biosynthesis. The importance of this work is that it provides further information for understanding regulatory mechanisms controlling rimocidin biosynthesis in S. rimosus M527. In addition, the successful application of a CRISPR/Cas9 system based on pWHU2653 in this study will provide a basis for efficient genome manipulation for the overproduction of rimocidin. Materials And Methods Materials Q5 High-Fidelity Master Mix with GC-buffer was purchased from NEB. Restriction endonucleases, Miniprep, and Gel Extraction kits were purchased from TaKaRa Biotechnology Co. Ltd. 5-Fluorocytosine (5FC) was purchased from Aladdin. Oligonucleotide primer synthesis and DNA sequencing of PCR products were performed by Shanghai Sunny Biotechnology Co. Ltd. China. Strains, plasmids, and primers The strains and plasmids used in this study are listed in Table 1. Strains were used as follows: Rimocidin producer S. rimosus M527 has been deposited in the China Center for Type Culture Collection (CCTCC: M2013270). Act producer S. coelicolor M145 was provided by Prof. Andreas Bechthold (University of Freiburg, Freiburg, Germany). TM producer S. diastatochromogenes 1628 has been deposited in the China General Microbiological Culture Collection Center (CGMCC No. 2060) [37]. Escherichia coli JM109 was used as a general host for gene cloning and plasmid construction. Methylation-deficient strain, E. coli ET12567/pUZ8002, was used as the donor for plasmid transfer to Streptomyces by intergeneric conjugation. Table 1 Strains and plasmids used in this study Strain or plasmid Description Source or reference Strain E. coli JM109 General cloning host Our lab E. coli ET12567/pUZ8002 Cm r , Km r , donor strain for conjugation Our lab S. rimosus M527 Rimocidin producer CCTCC 2013270 S. diastatochromogenes 1628 Toyocamycin producer CGMCC 2060 S. coelicolor M145 Actinorhodin producer Prof. Andreas M527-ΔnsdA sr nsdA sr gene deletion mutant, derived from M527 strain This work M527-ΔnsdA sr /pSET152:: nsdA sr nsdA sr complemented strain, mutant M527-Δ nsdA sr with integrative plasmid pSET152:: nsdA sr This work M527-NA sr M527 with integrative vector pIB139- nsdA sr This work M145 - NA sr M145 with integrative vector pIB139- nsdA sr This work 1628-NA sr 1628 with integrative vector pIB139- nsdA sr This work Plasmids pSET152 Integrative plasmid, apr r , oriT RK2 , φC31 int/att P Our lab pIB139 Derivative of integrative plasmid pSET152, harboring a PermE * promoter, apr r , oriT RK2 , φC31 int/att P Our lab pWHU2653 Scas9, sgRNA cloning cassette , codA(sm), apr r , ori(coE l) [34] pWHU2653-△ nsdA sr Derived from pWHU2653, for deletion of nsdA sr , containing up- and down-stream homologous arms of nsdA sr This work pSET152:: nsdA sr Derived from pSET152, harboring nsdA sr driven by its own promoter This work pIB139- nsdA sr nsdA sr gene under the control of promoter PermE * in pIB139 This work Plasmid pWHU2653 [34], a gift from Prof. Sun YH, was used for disruption of the nsdA sr gene using the CRISPR/Cas9 system. The primers (restriction sites are underlined) used in this study are listed in Table 2. Table 2 Primers used in this study Primers Description Source or reference P1 5’-CACCACCACCACTGA GCTAGC TTCAGACGTGTCTA-3’ This work P2 5’-TCCGTGTCCGGCGTCGACCTGCTGGATCCT-3’ This work P3 5’-AGGTCGACGCCGGACACGGAGTTTTAGAGC-3’ This work P4 5’-GTCGACTAGAGGATCCCCGGGTA TCTAGA AA-3’ This work P5 5’-CGTCGACCTGCAGGCATGCAAGCTTCGCGTCGTCCACCAGCACCTCG-3’ This work P6 5’-AATCGGAATGGGGGCGTTCCACAGCACTCCCACAGACCCCGG-3’ This work P7 5’-GGTCTGTGGGAGTGCTGTGGAACGCCCCCATTCCGATTGC-3’ This work P8 5’-GAGTGCTTGCGGCAGCGTGAAGCTTGGCATGGTCGGCCTTACGGACAG-3’ This work P9 5’-ACCG CATATG GTGGGCGGCAGTGGCGGCAC-3’ ( Nde I) This work P10 5’-ACCG TCTAGA TTATCAGACGGCCTCCGCGCCGG-3’ ( Xba I) This work P11 5’-ACCG CATATG CGGCAGCCGGACCGAGCAGT-3’ ( Nde I) This work Primers P1-P4 were used for amplification of sgRNA. Primers P5 and P6 were used for amplification of up-stream homologous arms of nsdA sr . Primers P7 and P8 were used for amplification of down-stream homologous arms of nsdA sr . Primers P9 and P10 were used for amplification of nsdA sr . Nde I and Xba I restriction enzyme sites are underlined. Primers P11 and P10 were used for amplification of a 1776-bp DNA fragment containing the coding region of nsdA sr and its 300-bp upstream promoter region. Media and culture conditions E. coli strains were cultured using liquid or solid LB medium containing appropriate antibiotics at 37 °C. Antibiotics were used in the following concentrations: apramycin (100 µg/mL), chloramphenicol (25 µg/mL), ampicillin (100 µg/mL), and kanamycin (50 µg/mL). To generate spores, Streptomyces cells were sprayed on MS medium [17] and incubated for 5-6 days at 28°C. Collected spores were washed with water and preserved in water/glycerol (1:1, v/v) at −80°C. 2CMC solid medium [16] was used for conjugation. CP liquid medium [38] was used as seed medium. MS, YMG [39], and Gauze’s No. 1 medium were used for morphological observation. Gauze’s No. 1 medium composes of 20 g of starch, 1 g of KNO 3 , 0.5 g of KH 2 PO 4 , 0.5 g of MgSO 4 , 0.5 g of NaCl, 0.01 g of FeSO 4 , and 20 g of agar per liter. S. rimosus M527 and its derivates were incubated using the method of Zhao et al. [17]. S. diastatochromogenes 1628 and its derivative were incubated using the method of Xu et al. [35]. S. coelicolor M145 and its derivative were incubated using the method of Zhao et al. [38]. Construction of the ΔnsdA sr mutant and its complementation Plasmid pWHU2653, a delivery vector containing the sgRNA cloning cassette and counterselection marker CodA(sm), was developed for genome editing in Streptomyces using the CRISPR/Cas9 system [34, 40]. sgRNA consists of an exchangeable 20 nt guide sequence that matches the target DNA and an invariant scaffold that binds to Cas9 in pWHU2653. In this study, a protospacer adjacent motif (PAM) for sgRNA and a 20 nt target guide sequence AGGTCGACGCCGGACACGGA of the nsdA sr gene extended by PAM were selected according to the guide design tool ( https://zlab.bio/guide-design-resources ). To construct the double-enzyme digestion sgRNA cloning cassette, PCR was used to generate the sgRNA with the target sequence using pWHU2653 as the template. Primers P1/P2 were used to amplify the upstream fragment, whereas another pair of primers P3/P4 were used to amplify the downstream fragment. The two fragments, each end flanked by a 20 bp homology sequence from pWHU2653, were spliced together by overlap extension PCR, yielding a 0.3 kb sgRNA fragment in which expression of sgRNA is under control of the constitutive promoter ermE * . The 0.3 kb sgRNA cloning cassette was inserted into pWHU2653 between Nhe I/ Xba I using an infusion cloning kit, generating plasmid pWHU2653-sgRNA. Subsequently, the 2.1 kb upstream homologous arm (UHA) and 2.1 kb downstream homologous arm (DHA) of the nsdA sr start codon were amplified by primer pairs P5/P6 and P7/P8 from genomic DNA of S. rimosus M527, respectively. The resulting DNA fragments, UHA and DHA, were ligated into the Hin dIII site of pWHU2653-sgRNA using Gibson assembly methods as described by Gibson et al. [41], yielding plasmid pWHU2653-Δ nsdA sr for gene knock out. The constructed pWHU2653-Δ nsdA sr was introduced into the wild-type strain S. rimosus M527 by intergeneric conjugation as described by Song et al. [16]. Single apramycin-resistant exconjugants were patched on 2CMC agar, containing apramycin and nalidixic acid (300 and 100 µg/mL, respectively), and grown at 28 °C for four or five generations. Genomic DNA was extracted from mycelium grown on the plate and amplified by PCR using primers P9/P10 to verify the deletion of nsdA sr . To obtain plasmid-free progeny, single exconjugants were picked and streaked on 2CMC agar containing 800 μg/mL 5FC and grown in the dark at 28 °C for 3 or 4 days. The 5FC R colonies were then replicated to 2CMC with and without apramycin to confirm plasmid loss. The ΔnsdA sr mutants were named S. rimosus M527-ΔnsdA sr . For complementation of nsdA sr in S. rimosus M527-ΔnsdA sr , a 1776 bp DNA fragment containing the coding region of nsdA sr and its 300 bp upstream promoter region was amplified by PCR using P11 and P10 as primers. The DNA fragment was inserted into the Nde I and Xba I sites of pSET152 to obtain pSET152:: nsdA sr . Introduction of pSET152:: nsdA sr and the empty vector pSET152 as a control into mutant M527-ΔnsdA sr by conjugation resulted in the complemented strain S. rimosus M527-ΔnsdA sr /pSET152:: nsdA sr and the control strain S. rimosus M527- ΔnsdA sr /pSET152, respectively. Over-expression/Heterologous expression of nsdA sr in S. rimosus M527/ S. coelicolor M145 and S. diastatochromogenes 1628 All recombinant DNA techniques were performed as described by Sambrook and Russell [42]. Plasmid pIB139 [43, 44] is a shuttle vector that replicates in E. coli and integrates site-specifically into Streptomyces chromosomes. Using S. rimosus M527 genomic DNA as a template, a 1476 bp nsdA sr open reading frame (ORF) was amplified by PCR using primers P9 and P10 (Table 1). The PCR product was then digested with Nde I and Xba I and inserted into the corresponding sites of pIB139, yielding plasmid pIB139- nsdA sr . Sequencing of the inserted gene fragment confirmed that the gene did not contain any mutations. Subsequently, the introduction of the constructed pIB139- nsdA sr into S. rimosus M527, S. coelicolor M145, and S. diastatochromogenes 1628 was conducted by intergeneric conjugation to yield recombinant strains S. rimosus M527-NA sr , S. coelicolor M145-NA sr and S. diastatochromogenes 1628-NA sr , respectively. Recombinant strains were confirmed using apramycin resistance and PCR. Morphological observation To evaluate morphological differentiation, wild-type strain S. rimosus M527, the nsdA sr- disrupted mutant M527-ΔnsdA sr , the complemented strain M527-ΔnsdA sr /pSET152:: nsdA sr , and the recombinant strain M527-NA sr were streaked on solid MS medium; the wild-type S. diastatochromogenes 1628 and recombinant strain 1628-NA sr were streaked on solid YMG medium; and the wild-type S. coelicolor M145 and recombinant strain M145-NA sr were streaked on Gauze’s No. 1 medium. The morphology of all strains was observed after incubation for 6-7 days at 28°C. Morphological characteristics of the mycelia surface were examined under SEM (JSM-5410LV, JEOL, Tokyo, Japan). Analysis of gene transcriptional levels by qRT-PCR Extraction of RNA and analysis of transcriptional levels of rim genes were performed as described previously [17, 36]. Extraction of RNA, design of primers, and analysis of the transcription of toy genes were performed as described by Xu et al. [35]. Extraction of RNA, design of primers, and analysis of transcription of actII-orf4 gene were performed as described by Zhao et al. [38]. Fermentation of antibiotic Production of rimocidin by S. rimosus M527 was achieved using the method of Zhao et al. [17]. Production of TM by S. diastatochromogenes 1628 was achieved using the method of Ma et al. [36]. Analysis of antibiotic Rimocidin was analyzed using high-performance liquid chromatography (HPLC) (Varian, USA) method described previously [17]. HPLC analysis of TM used the method of Ma et al. [36]. Gauze’s No. 1 medium was used to identify the production of Act on agar media by directly evaluating the density of the blue color characteristic of this antibiotic. Statistical analysis All experiments were performed at least three times, and results were expressed as mean ± standard deviations (SD). Statistical analysis was performed with Student’s t -test. Abbreviations qRT-PCR: quantitative RT-PCR; TM: toyocamycin; Act: actinorhodin; SEM: scanning electron microscopy; sgRNA: single guide RNA; 5FC:5-Fluorocytosine; CCTCC: China Center for Type Culture Collection; CGMCC: China General Microbiological Culture Collection Center; PAM: protospacer adjacent motif; UHA: upstream homologous arm; DHA: downstream homologous arm; ORF: open reading frame; HPLC: high-performance liquid chromatography; SD: standard deviations. CRISPR/Cas: clustered regularly interspaced short palindromic repeats(CRISPR) /CRISPR-associated Declarations Ethics approval and consent to participate: Not applicable. Consent for publication: Not applicable. Availability of data and materials: All data generated or analyzed during this study are included in this published article [and its supplementary information files]. Competing interests: The authors declare that they have no competing interests. Funding: This work was supported by the National Natural Science Foundation of China (31972320, 31772213), and the excellent youth fund of Zhejiang province, China (LR17C140002). Authors’ contributions: Z Ma designed research wrote this article. ZQ Song and J Xu conducted experiments. A Bechthold revised this article. XP Yu checked the final version. All authors read and approved the manuscript. Acknowledgments: The authors are grateful to Prof. Yuhui Sun (Wuhan University) for kindly providing the pWHU2653. Additional File Information Additional file 1: Figure S1. Phylogenetic analysis of NsdA sr using NCBI BLASTP. Additional file 2: Figure S2. HPLC-analysis to measure the influence of NsdA sr on rimocidin production. Additional file 3: Figure S3. Map of constructed plasmid pIB139- nsdA sr . Additional file 4: Figure S4. Phenotypic verification of recombinant strains S. rimosus M527-NA sr . Additional file 5: Figure S5. PCR analysis of apramycin ( ap r ) gene from recombinant strains S. rimosus M527- NA sr . Additional file 6: Figure S6. PCR analysis of apramycin ( ap r ) gene from recombinant strains S. coelicolor M145- NA sr . Additional file 7: Figure S7. PCR analysis of apramycin ( ap r ) gene from recombinant strains S. diastatochromogenes 1628-NA sr . References Kemung HM, Tan LT, Khan TM, Chan KG, Pusparajah P, Goh BH, Lee LH. Streptomyces as a prominent resource of future anti-MRSA drugs. Front Microbiol. 2018;9:2221. Liu R, Deng Z, Liu T. Streptomyces species: Ideal chassis for natural product discovery and overproduction. Metab Eng. 2018;50:74-84. Olanrewaju OS, Babalola OO. Streptomyces : implications and interactions in plant growth promotion. Appl Microbiol Biotechnol. 2019;103:1179-88. Martín JF, Ramos A, Liras P. Regulation of geldanamycin biosynthesis by cluster-situated transcription factors and the master regulator PhoP. Antibiotics (Basel). 2019;8. pii: E87. Kang Y, Wang Y, Hou B, Wang R, Ye J, Zhu X, Wu H, Zhang H. AdpA lin , a pleiotropic transcriptional regulator, is involved in the cascade regulation of lincomycin biosynthesis in Streptomyces lincolnensis . Front Microbiol. 2019;10:2428. Hou B, Tao L, Zhu X, Wu W, Guo M, Ye J, Wu H, Zhang H. Global regulator BldA regulates morphological differentiation and lincomycin production in Streptomyces lincolnensis . Appl Microbiol Biotechnol. 2018;102:4101-15. Li W, Ying X, Guo Y, Yu Z, Zhou X, Deng Z, Kieser H, Chater KF, Tao M. Identification of a gene negatively affecting antibiotic production and morphological differentiation in Streptomyces coelicolor A3(2). J Bacteriol. 2006;188:8368-75. Wang XJ, Guo SL, Guo WQ, Xi D, Xiang WS. Role of nsdA in negative regulation of antibiotic production and morphological differentiation in Streptomyces bingchengensis . J Antibiot (Tokyo). 2009;62:309-13. Wu H, Liu W, Shi L, Si K, Liu T, Dong D, Zhang T, Zhao J, Liu D, Tian Z, Yue Y, Zhang H, Xuelian B, Liang Y. Comparative genomic and regulatory analyses of natamycin production of Streptomyces lydicus Sci Rep. 2017;7:9114. Sowiński P, Pawlak J, Borowski E, Gariboldi P. Stereostructure of rimocidin. J Antibiot (Tokyo). 1995;48:1288-91. Seco EM, Pérez-Zúñiga FJ, Rolón MS, Malpartida F. Starter unit choice determines the production of two tetraene macrolides, rimocidin and CE-108, in Streptomyces diastaticus 108. Chem Biol. 2004;11:357-66. Caffrey P, Aparicio JF, Malpartida F, Zotchev SB. Biosynthetic engineering of polyene macrolides towards generation of improved antifungal and antiparasitic agents. Curr Top Med Chem. 2008;8:639-53. Jeon BJ, Kim JD, Han JW, Kim BS. Antifungal activity of rimocidin and a new rimocidin derivative BU16 produced by Streptomyces mauvecolor BU16 and their effects on pepper anthracnose. J Appl Microbiol. 2016;120:1219-28. Yu J, Liu Q, Chen C, Qi X. Antifungal activity change of Streptomyces rimosus MY02 mediated by confront culture with other microorganism. J Basic Microbiol. 2017;57:276-82. Lu D, Ma Z, Xu X, Yu X. Isolation and identification of biocontrol agent Streptomyces rimosus M527 against Fusarium oxysporum sp. cucumerinum . J Basic Microbiol. 2016;56: 929-33. Song ZQ, Liao ZJ, Hu YF, Ma Z, Bechthold A, Yu XP. Development and optimization of an intergeneric conjugation system and analysis of promoter activity in Streptomyces rimosus J Zhejiang Univ Sci B. 2019;20:891-900. Zhao Y, Song Z, Ma Z, Bechthold A, Yu X. Sequential improvement of rimocidin production in Streptomyces rimosus M527 by introduction of cumulative drug-resistance mutations. J Ind Microbiol Biotechnol. 2019;46:697-708. Escudero L, Al-Refai M, Nieto C, Laatsch H, Malpartida F, Seco EM. New rimocidin/CE-108 derivatives obtained by a crotonyl-CoA carboxylase/reductase gene disruption in Streptomyces diastaticus 108: substrates for the polyene carboxamide synthase PcsA. PLoS One. 2015;10:e0135891. Seco EM, Miranzo D, Nieto C, Malpartida F. The pcsA gene from Streptomyces diastaticus 108 encodes a polyene carboxamide synthase with broad substrate specificity for polyene amides biosynthesis. Appl Microbiol Biotechnol. 2010;85:1797-807. Bednarz B, Kotowska M, Pawlik KJ. Multi-level regulation of coelimycin synthesis in Streptomyces coelicolor A3(2). Appl Microbiol Biotechnol. 2019;103:6423-34. Xia H, Zhan X, Mao XM, Li YQ. The regulatory cascades of antibiotic production in Streptomyces . World J Microbiol Biotechnol. 2020;36:13. Luo S, Chen XA, Mao XM, Li YQ. Transposon-based identification of a negative regulator for the antibiotic hyper-production in Streptomyces . Appl Microbiol Biotechnol. 2018;102:6581-92. Bruheim P, Sletta H, Bibb MJ, White J, Levine DW. High-yield actinorhodin production in fed-batch culture by a Streptomyces lividans strain overexpressing the pathway-specific activator gene act II-ORF4. J Ind Microbiol Biotechnol. 2002;28:103-11. Imai Y, Sato S, Tanaka Y, Ochi K, Hosaka T. Lincomycin at subinhibitory concentrations potentiates secondary metabolite production by Streptomyces Appl Environ Microbiol. 2015;81:3869-79. Sohoni SV, Fazio A, Workman CT, Mijakovic I, Lantz AE. Synthetic promoter library for modulation of actinorhodin production in Streptomyces coelicolor A3(2). PLoS One. 2014;9:e99701. Wei J, Tian J, Pan G, Xie J, Bao J, Zhou Z. Development and application of a T7 RNA polymerase-dependent expression system for antibiotic production improvement in Streptomyces . Biotechnol Lett. 2017;39:857-64. Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA. Practical Streptomyces Norwich: John Innes Centre; 2000. Novakova R, Núñez LE, Homerova D, Knirschova R, Feckova L, Rezuchova B, Sevcikova B, Menéndez N, Morís F, Cortés J, Kormanec J. Increased heterologous production of the antitumoral polyketide mithramycin A by engineered Streptomyces lividans TK24 strains. Appl Microbiol Biotechnol. 2018;102:857-69. Rezuchova B, Homerova D, Sevcikova B, Núñez LE, Novakova R, Feckova L, Skultety L, Cortés J, Kormanec J. An efficient blue-white screening system for markerless deletions and stable integrations in Streptomyces chromosomes based on the blue pigment indigoidine biosynthetic gene bpsA . Appl Microbiol Biotechnol. 2018;102:10231-44. Neldeborg S, Lin L, Stougaard M, Luo Y. Rapid and efficient gene deletion by CRISPR/Cas9. Methods Mol Biol. 2019;1961:233-47. Zhang MM, Wong FT, Wang Y, Luo S, Lim YH, Heng E, Yeo WL, Cobb RE, Enghiad B, Ang EL, Zhao H. CRISPR-Cas9 strategy for activation of silent Streptomyces biosynthetic gene clusters. Nat Chem Biol. 2017. doi: 1038/nchembio.2341. Tong Y, Charusanti P, Zhang L, Weber T, Lee SY. CRISPR-Cas9 based engineering of actinomycetal genomes. ACS Synth Biol. 2015;4:1020-9. Cobb RE, Wang Y, Zhao H. High-efficiency multiplex genome editing of Streptomyces species using an engineered CRISPR/Cas system. ACS Synth Biol. 2015;4:723-8. Zeng H, Wen S, Xu W, He Z, Zhai G, Liu Y, Deng Z, Sun Y. Highly efficient editing of the actinorhodin polyketide chain length factor gene in Streptomyces coelicolor M145 using CRISPR/Cas9-CodA(sm) combined system. Appl Microbiol Biotechnol. 2015;99:10575-85. Xu J, Song Z, Xu X, Ma Z, Bechthold A, Yu X. ToyA, a positive pathway-specific regulator for toyocamycin biosynthesis in Streptomyces diastatochromogenes Appl Microbiol Biotechnol. 2019;103:7071-84. Ma Z, Tao L, Bechthold A, Shentu X, Bian Y, Yu X. Overexpression of ribosome recycling factor is responsible for improvement of nucleotide antibiotic-toyocamycin in Streptomyces diastatochromogenes Appl Microbiol Biotechnol. 2014;98:5051-8. Ma Z, Liu J, Bechthold A, Tao L, Shentu X, Bian Y, Yu X. Development of intergeneric conjugal gene transfer system in Streptomyces diastatochromogenes 1628 and its application for improvement of toyocamycin production. Curr Microbiol. 2014;68:180-5. Zhao YF, Lu DD, Bechthold A, Ma Z, Yu XP. Impact of otrA expression on morphological differentiation, actinorhodin production, and resistance to aminoglycosides in Streptomyces coelicolor J Zhejiang Univ Sci B. 2018;19:708-17. Qiu J, Zhuo Y, Zhu D, Zhou X, Zhang L, Bai L, Deng Z. Overexpression of the ABC transporter AvtAB increases avermectin production in Streptomyces avermitilis . Appl Microbiol Biotechnol. 2011;92:337-45. Mo J, Wang S, Zhang W, Li C, Deng Z, Zhang L, Qu X. Efficient editing DNA regions with high sequence identity in actinomycetal genomes by a CRISPR-Cas9 system. Synth Syst Biotechnol. 2019;4:86-91. Gibson DG, Benders GA, Axelrod KC, Zaveri J, Algire MA, Moodie M, Montague MG, Venter JC, Smith HO, Hutchison CA. One-step assembly in yeast of 25 overlapping DNA fragments to form a complete synthetic Mycoplasma genitalium Proc Natl Acad Sci U S A. 2008;105:20404-9. Sambrook J, Russel DW. Molecular cloning: a laboratory manual. New York: Cold Spring Harbor Laboratory; 2001. Wang T, Bai L, Zhu D, Lei X, Liu G, Deng Z, You D. Enhancing macrolide production in Streptomyces by coexpressing three heterologous genes. Enzyme Microb Technol. 2012;50:5-9. Xu X, Wang J, Bechthold A, Ma Z, Yu X. Selection of an efficient promoter and its application in toyocamycin production improvement in Streptomyces diastatochromogenes World J Microbiol Biotechnol. 2017;33:30. Supplementary Files Additionalfile7.docx Additionalfile6.docx Additionalfile5.docx Additionalfile4.docx Additionalfile1.docx Additionalfile2.docx Additionalfile3.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-17670","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research","associatedPublications":[],"authors":[{"id":416378,"identity":"80a90325-38cd-4529-8a35-d28b4ba2e9e9","order_by":1,"name":"Zheng Ma","email":"","orcid":"","institution":"China Jiliang University","correspondingAuthor":false,"prefix":"","firstName":"Zheng","middleName":"","lastName":"Ma","suffix":""},{"id":416379,"identity":"e58a1f0b-3e54-4900-b29a-b1a815437209","order_by":2,"name":"Zhangqing Song","email":"","orcid":"","institution":"China Jiliang University","correspondingAuthor":false,"prefix":"","firstName":"Zhangqing","middleName":"","lastName":"Song","suffix":""},{"id":416380,"identity":"248ca226-513a-4f89-bb9c-0a7a8f9a0b79","order_by":3,"name":"Jie Xu","email":"","orcid":"","institution":"China Jiliang University","correspondingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Xu","suffix":""},{"id":416381,"identity":"89c01a10-99ff-4ba2-9461-853e7fa6a48e","order_by":4,"name":"Andreas Bechthold","email":"","orcid":"","institution":"Albert-Ludwigs-Universitat Freiburg","correspondingAuthor":false,"prefix":"","firstName":"Andreas","middleName":"","lastName":"Bechthold","suffix":""},{"id":416382,"identity":"f2f650f8-07cd-4b53-b4db-0ccacceb8d4b","order_by":5,"name":"Xiaoping Yu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABGklEQVRIiWNgGAWjYJCCA0DMw8DA2Pjgww8JOzb25gMHPvwgSgtzs+HMHptkfp5jiQdn9hBlGXubNAdbGuPMGT7GhznYcKszuJFjeOBHxR0Zc/6FbdIMPIeZDW7wfDgMtFWeX+wADi1pCQd7zjzjsZzxsNm6wOIwn8Ht3g2HCywYDGfOTsChJfnAAd62wzwGNw423p4BsuXO2Q2HZ/AwJBjcxqUlseHgX4iWBmketsOMG27kPDjMw4ZPS/KBw2Bbzjc2AbWAvJ/DgFeL5JlnCYdlgH4xuMEID2QDYCBL4PQL3/Ec449vKu7YG5w//hAWlY8/fPhhI88vjV2LwgEwBSQlUBVIYFUOAvINMC38B3AqGgWjYBSMghEOAGdgdGIlPpnoAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-1775-6467","institution":"China Jiliang University","correspondingAuthor":true,"prefix":"","firstName":"Xiaoping","middleName":"","lastName":"Yu","suffix":""}],"badges":[],"createdAt":"2020-03-16 15:18:06","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-17670/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-17670/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":666667,"identity":"2eae30cd-b1f2-442a-af2b-5df7f67de355","added_by":"auto","created_at":"2020-03-18 15:12:47","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":136564,"visible":true,"origin":"","legend":"Construction of mutant S. rimosus M527-ΔnsdAsr. Map of plasmid pWHU2653 -ΔnsdAsr. A. The sgRNA consists of the 20 nt target gene specific guide sequence of S. rimosus M527 (yellow) and the invariant scaffold RNA (green). Light orange parallelograms connect the identical UHA and DHA sequences on pWHU2653 and the S. rimosus M527 chromosome where homologous recombination can take place. B. PCR verification of the mutant S. rimosus M527-ΔnsdAsr. M: DL10000 DNA Marker. Lane 1, PCR products of nsdAsr gene were amplified by using the primers P9/P10 from wild-type strain S. rimosus M527; lane 2, PCR products of nsdAsr gene were amplified by using the primers P9/P10 from mutant M527-ΔnsdAsr; lane 3, PCR product amplified from the wild-type S. rimosus M527 by using the primers P5/P8; lane 4, PCR product amplified from the mutant S. rimosus M527-ΔnsdAsr by using the primers P5/P8.","description":"","filename":"F1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-17670/v1/F1.jpeg"},{"id":666669,"identity":"958ce4b6-81fd-4b5f-9ddf-b75d412bd701","added_by":"auto","created_at":"2020-03-18 15:12:47","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":13009,"visible":true,"origin":"","legend":"Determination of effects of NsdAsr on rimocidin production. Rimocidin production of the wild-type strain S. rimosus M527 (●), S. rimosus M527-ΔnsdAsr (♦), S. rimosus M527-ΔnsdAsr/pSET152::nsdAsr (▲) and S. rimosus M527-NAsr (■) in shake-flask cultures. All shake-flask fermentations were carried out in 250 mL flasks with a working volume of 40 mL at 200 rpm and 28°C. The medium was inoculated at 5% (v/v). The error bars were calculated from three different batches of fermentation.","description":"","filename":"F2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-17670/v1/F2.jpg"},{"id":666671,"identity":"daade478-cbd4-4d5c-a1aa-aba4400a084f","added_by":"auto","created_at":"2020-03-18 15:12:47","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":351374,"visible":true,"origin":"","legend":"NsdAsr negatively affected on morphological differentiation. Morphological characteristics of the wild-type strain S. rimosus M527, S. rimosus M527-ΔnsdAsr, S. rimosus M527-ΔnsdAsr/pSET152::nsdAsr, and S. rimosus M527-NAsr. A. Picture of an agar plate taken after 7 days of growth. B. Scanning electron micrographs SEM of four strains grown on MS medium for 7 days.","description":"","filename":"F3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-17670/v1/F3.jpeg"},{"id":666673,"identity":"b9ce81d7-a4a1-4d54-95fc-afe68658d861","added_by":"auto","created_at":"2020-03-18 15:12:48","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":269523,"visible":true,"origin":"","legend":"Summary of qRT-PCR analysis using rim genes (rimA~rimK) involved in rimocidin biosynthesis. The following strains were investigates: M527: S. rimosus M527; M527-ΔnsdAsr: S. rimosus M527-ΔnsdAsr; M527-ΔnsdAsr/pSET152::nsdAsr: S. rimosus M527-ΔnsdAsr/pSET 152::nsdAsr and M527-NAsr: S. rimosus M527-NAsr. SigBsr was used as an internal control. The cells were harvested from the fermentation broth after 48 and 84 h. Error bars were calculated by measuring the standard deviations of the data from three replicates of each sample. (*) indicates statistically significant results (0.01\u003cP-value\u003c0.05). (**) indicates highly statistically significant results (P-value \u003c 0.01). rimA: type I polyketide synthase gene; rimB: type I polyketide synthase gene; rimC: tyrosine phosphatase gene; rimD: cholesterol oxidase gene; rimE: glycosyl transferase gene; rimF: aminotransferase gene; rimG: cytochrome P450 monooxygenase gene; rimH: ferredoxin gene; rimJ: crotonyl-CoA reductase gene; rimK: acetyltransferase gene.","description":"","filename":"F4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-17670/v1/F4.jpeg"},{"id":666675,"identity":"765da8ff-758b-4b71-95da-5e3fb00e0da5","added_by":"auto","created_at":"2020-03-18 15:12:48","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":134310,"visible":true,"origin":"","legend":"Heterologous expression of nsdAsr in S. coelicolor M145 and S. diastatochromogenes 1628 and its effects. A. Visual observation of morphological differentiation and Act biosynthesis by S. coelicolor M145 and S. coelicolor M145-NAsr grown on the Gauze’s No.1 media. Spores (1×108) were streaked on Gauze’s No.1 agar media and then incubated at 28 °C for 6 days. The reverse sides of the plates are shown to indicate the amount of Act produced. B. Detection of morphological differentiation of S. diastatochromogenes 1628 and S. diastatochromogenes 1628-NAsr. Spores (1×108) were streaked on MS agar media and then incubated at 28 °C for 6 days. C. Detection of TM production of S. diastatochromogenes 1628 and S. diastatochromogenes 1628-NAsr in shake-flask cultures. All shake-flask fermentations were carried out in 250 mL flasks with a working volume of 40 mL at 200 rpm and 28°C. The medium was inoculated at 5% (v/v). Error bars were calculated from three different batches of fermentation.","description":"","filename":"F5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-17670/v1/F5.jpeg"},{"id":666677,"identity":"2096ae4b-865d-4042-a1da-18100c0c49d8","added_by":"auto","created_at":"2020-03-18 15:12:48","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":57700,"visible":true,"origin":"","legend":"Summary of qRT-PCR analysis. A. Studies on the regulator actII-orf4 are shown. Here the following strains were investigates: M145: S. coelicolor M145; M145-NAsr: S. coelicolor M145-NAsr. B. Studies on toy genes (toyA~toyM) involved in TM biosynthesis are shown. Here the following strains were investigates: 1628: S. diastatochromogenes 1628; 1628-NAsr: S. diastatochromogenes 1628-NAsr. 16S rDNA was used as the positive internal control. Cells were harvested from fermentation broth at 48 and 84 h, respectively.","description":"","filename":"F6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-17670/v1/F6.jpeg"},{"id":15666452,"identity":"4dc8e633-18bc-4e22-9e9d-d7c236accd18","added_by":"auto","created_at":"2021-11-18 13:36:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1124552,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-17670/v1/873f2744-56d6-4011-9f62-595c16ffbaee.pdf"},{"id":666679,"identity":"b5ee2d97-a0df-45cf-a73c-89bf40fa5ca7","added_by":"auto","created_at":"2020-03-18 15:12:49","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":109744,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile7.docx","url":"https://assets-eu.researchsquare.com/files/rs-17670/v1/Additional file7.docx"},{"id":666678,"identity":"1abb31e0-b542-4700-bd91-895c27425b7b","added_by":"auto","created_at":"2020-03-18 15:12:49","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":97296,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile6.docx","url":"https://assets-eu.researchsquare.com/files/rs-17670/v1/Additional file6.docx"},{"id":666676,"identity":"15deeb2c-26df-4d0e-a356-ef77e2b4ae7f","added_by":"auto","created_at":"2020-03-18 15:12:48","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":1128259,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile5.docx","url":"https://assets-eu.researchsquare.com/files/rs-17670/v1/Additional file5.docx"},{"id":666674,"identity":"4cfcc6d7-0ba5-4d7b-b80c-f2312bb9149c","added_by":"auto","created_at":"2020-03-18 15:12:48","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":758858,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile4.docx","url":"https://assets-eu.researchsquare.com/files/rs-17670/v1/Additional file4.docx"},{"id":666668,"identity":"33740eae-3d68-4397-b75d-20ae5ff7e551","added_by":"auto","created_at":"2020-03-18 15:12:47","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":51650,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile1.docx","url":"https://assets-eu.researchsquare.com/files/rs-17670/v1/Additional file1.docx"},{"id":666670,"identity":"8637ad79-7c80-4f69-988f-f8f5a49ad2b7","added_by":"auto","created_at":"2020-03-18 15:12:47","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":21713,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile2.docx","url":"https://assets-eu.researchsquare.com/files/rs-17670/v1/Additional file2.docx"},{"id":666672,"identity":"44b79080-3abf-4c33-8f99-a45ba31bfbed","added_by":"auto","created_at":"2020-03-18 15:12:47","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":55387,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile3.docx","url":"https://assets-eu.researchsquare.com/files/rs-17670/v1/Additional file3.docx"}],"financialInterests":"","formattedTitle":"\u003cp\u003eIdentification of a gene from\u003cem\u003e Streptomyces rimosus\u003c/em\u003e M527 negatively affecting antibiotic biosynthesis and morphological differentiation\u003c/p\u003e","fulltext":[{"header":"Background","content":"\u003cp\u003e\u003cem\u003eStreptomyces \u003c/em\u003eare Gram-positive bacteria with complex morphological differentiation and secondary metabolism. They are well-known to produce a wide variety of valuable natural products with diverse biological activities [1-3]. In \u003cem\u003eStreptomyces\u003c/em\u003e, the processes of morphological differentiation and antibiotic biosynthesis are tightly controlled via multiple levels of regulation that includes cluster-situated, pleiotropic, and global regulators that respond to numerous physiological and environmental conditions [4-6]. Among the many regulatory genes, a gene \u003cu\u003en\u003c/u\u003eegatively affecting \u003cem\u003e\u003cu\u003eS\u003c/u\u003etreptomyces\u003c/em\u003e \u003cu\u003ed\u003c/u\u003eifferentiation (\u003cem\u003ensdA\u003c/em\u003e) was first found in model strain \u003cem\u003eStreptomyces coelicolor \u003c/em\u003eA3(2) [7]. The disruption of \u003cem\u003ensdA \u003c/em\u003ein \u003cem\u003eS\u003c/em\u003e. \u003cem\u003ecoelicolor \u003c/em\u003eresulted in accelerated sporulation and increased production of three antibiotics, actinorhodin (Act), methylenomycin, and a calcium-dependent antibiotic. Subsequent studies report that \u003cem\u003en\u003c/em\u003e\u003cem\u003esdA\u003c/em\u003e negatively affects antibiotic biosynthesis and morphological differentiation in \u003cem\u003eStreptomyces\u003c/em\u003e. For example, in \u003cem\u003eStreptomyces\u003c/em\u003e \u003cem\u003ebingchengensis \u003c/em\u003eand \u003cem\u003eStreptomyces\u003c/em\u003e \u003cem\u003elydicus \u003c/em\u003eA02, disruption of \u003cem\u003ensdA\u003c/em\u003e caused increased production of secondary metabolites (milbemycin A4, nanchangmycin, and natamycin, along with greater production of pigment and spores than their wild-type strain [8, 9].\u003c/p\u003e\n\u003cp\u003eThe tetraene rimocidin is a glycosylated polyketide [10]. Like other macrolides, rimocidin is synthesized in \u003cem\u003eStreptomyces \u003c/em\u003esp\u003cem\u003e. \u003c/em\u003eby so-called type I modular polyketide synthases [11]. Because of its broad range of biological activity against pathogenic fungi, rimocidin possessed some potential as a fungicide for controlling plant diseases and became an attractive target for research [12-14]. \u003cem\u003eStreptomyces rimosus\u003c/em\u003e M527 (China Center for Type Culture Collection (CCTCC) M2013270), which was originally isolated in 2011 from soil, is also known as rimocidin producer [15]. In 2019, a gene transfer system for the strain was developed [16] and the genome of the strain was sequenced (GenBank accession No. GCA_004196335.1). Recently rimocidin production in the strain could be enhanced by ribosome engineering [17]. Our knowledge about regulatory mechanisms controlling rimocidin biosynthesis and about morphological differentiation lagged far behind our knowledge about the biosynthesis of rimocidin [11, 18, 19]. Elucidation and manipulation of regulatory networks have recently been shown to be an efficient strategy for further improving production of various industrial compounds [20, 21]. For example, Luo et al. [22] identified a transcriptional regulator PhaR in \u003cem\u003eStreptomyces roseosporus \u003c/em\u003eL30. Deletion of \u003cem\u003ephaR\u003c/em\u003e led to an increased expression of the gene cluster resulting in a 6.14-fold increased daptomycin production.\u003c/p\u003e\n\u003cp\u003eIn the genome sequence of \u003cem\u003eS.\u003c/em\u003e \u003cem\u003erimosus\u003c/em\u003e M527 \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e \u003c/em\u003e(GenBank accession No. MN395042) was identified which encodes a protein with high similarity to NsdA from \u003cem\u003eS. coelicolor\u003c/em\u003e. This study aimed to explore the role of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e in morphological differentiation and rimocidin biosynthesis in \u003cem\u003eS.\u003c/em\u003e \u003cem\u003erimosus\u003c/em\u003e M527. Construction of a mutant of \u003cem\u003eS.\u003c/em\u003e \u003cem\u003erimosus\u003c/em\u003e M527 with a \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e deletion was accomplished using the CRISPR/Cas9 system. NsdA\u003csub\u003esr\u003c/sub\u003e was identified as a negative regulator of rimocidin biosynthesis by repressing transcription of structural genes. Furthermore, heterologous expression of\u003cem\u003e nsdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e in \u003cem\u003eStreptomyces diastatochromogenes \u003c/em\u003e1628 and \u003cem\u003eS. coelicolor \u003c/em\u003eM145 also affected morphological differentiation and inhibited natural product biosynthesis.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eCloning and identification of putative \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e from \u003cem\u003eS. rimosus\u003c/em\u003e M527\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eReferencing the available genome sequence of \u003cem\u003eS. rimosus\u003c/em\u003e M527 (GenBank accession No. GCA_004196335.1), a \u003cem\u003ensdA\u003c/em\u003e orthologue \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e gene from \u003cem\u003eS. rimosus\u003c/em\u003e M527 was cloned. The nucleotide sequence was submitted to the GenBank database under the accession number MN395042. The 1476 bp \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e gene encodes a protein of 491 amino acids. A phylogenetic tree was constructed to show the relationship between NsdA\u003csub\u003esr\u003c/sub\u003e and known NsdA homologues in other \u003cem\u003eStreptomyces \u003c/em\u003especies (Additional file 1: Figure S1). NsdA\u003csub\u003esr\u003c/sub\u003e (boldface) was very similar to known NsdA proteins submitted to National Center for Biotechnology Information (NCBI). Among them, NsdA\u003csub\u003esr\u003c/sub\u003e showed the highest similarity to NsdA from \u003cem\u003eS. griseoflavus\u003c/em\u003e (KOG64483, 99.6% identical amino acids).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeletion of \u003c/strong\u003e\u003cstrong\u003e\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e gene\u003c/strong\u003e\u003cstrong\u003e increases rimocidin production and acceleration of sporulation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further determine the role of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e in rimocidin biosynthesis and morphological differentiation, knock-out plasmid pWHU2653-\u0026Delta;\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e was created (Figure 1A). The construction of the \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e disruption mutant M527-\u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e was achieved using the CRISPR/Cas9-CodA(sm) combined system. The deletion of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e was validated by PCR with the corresponding verification primers P5/P8 and P9/P10. As shown in Figure 1B, a 1476 bp \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e gene could be amplified from M527 (lane 1), but not from M527-\u0026Delta;nsdA\u003csub\u003esr \u003c/sub\u003e(lane 2). In addition, amplicons of 5.7 kb (lane 3) and 4.2 kb (lane 4) represented products of the wild-type strain M527 and the mutant strain M527-\u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e. These results indicate that the \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e gene was deleted in mutant M527- \u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e.\u003c/p\u003e\n\u003cp\u003eTo investigate the effect of the \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e gene on rimocidin production, a shake-flask fermentation experiment was performed using mutant \u003cem\u003eS.\u003c/em\u003e \u003cem\u003erimosus\u003c/em\u003e M527-\u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e and wild-type \u003cem\u003eS. rimosus\u003c/em\u003e M527. Samples were periodically collected and analyzed to determine the concentration of rimocidin in the fermentation broth using HPLC (Additional file 2: Figure S2). After 96 h, the level of rimocidin produced by \u003cem\u003eS.\u003c/em\u003e \u003cem\u003erimosus\u003c/em\u003e M527-\u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e had reached 318.5 mg/L, an increase of 46% compared to \u003cem\u003eS. rimosus\u003c/em\u003e M527 (Figure 2), suggesting that NsdA\u003csub\u003esr\u003c/sub\u003e acts as a negative regulator in rimocidin biosynthesis.\u003c/p\u003e\n\u003cp\u003eTo confirm that the deletion of the \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e gene was the sole reason for the increase in rimocidin production, the mutant M527-\u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e was complemented by introducing an integrative plasmid pSET152::\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e, in which the \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e gene was driven by its own promoter, to generate the complemented strain M527-\u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e/pSET152::\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e. The complemented strain M527- \u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e/pSET152::\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e produced rimocidin at levels comparable with levels produced by the wild-type strain (Additional file 2: Figure S2 and Figure 2).\u003c/p\u003e\n\u003cp\u003eMoreover, to further investigate the effect of \u003cem\u003ensdA\u003csub\u003esr \u003c/sub\u003e\u003c/em\u003eon morphological differentiation, scanning electron microscopy (SEM) was employed to examine morphological characteristics of wild-type M527 and mutant M527-\u0026Delta;nsdA\u003csub\u003esr \u003c/sub\u003estrains\u003csub\u003e. \u003c/sub\u003eMore abundant sporulation in mutant M527-\u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e was observed (Figure 3). Moreover, no significant difference between \u003cem\u003eS. rimosus\u003c/em\u003e M527 and the complemented strain M527-\u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e/pSET152::\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e was found (Figure 3). These results indicate that NsdA\u003csub\u003esr\u003c/sub\u003e negatively affected sporulation. In addition, the expression of the empty plasmid pSET152 in \u003cem\u003eS. rimosus\u003c/em\u003e M527 had no effect on morphological differentiation or rimocidin production (data not shown).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConstruction of recombinant strain \u003cem\u003eS. rimosus\u003c/em\u003e M527-\u003c/strong\u003e\u003cstrong\u003eNA\u003csub\u003esr\u003c/sub\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eNsdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e was predicted to be a negative regulator, suggesting that an increased copy number of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e might play a negative role in the morphological differentiation and further depress rimocidin production. The gene \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e was placed under the control of promoter \u003cem\u003eermE\u003csup\u003e*\u003c/sup\u003e\u003c/em\u003e in plasmid pIB139 to create pIB139-\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e (Additional file 3: Figure S3). The plasmid pIB139-\u003cem\u003ensdA\u003csub\u003esr \u003c/sub\u003e\u003c/em\u003ewas then introduced into \u003cem\u003eS. rimosus\u003c/em\u003e M527 by intergeneric conjugation [16], to generate the recombinant strain \u003cem\u003eS. rimosus\u003c/em\u003e M527-NA\u003csub\u003esr\u003c/sub\u003e resistant to 300\u0026nbsp;\u0026micro;g/mL apramycin (Additional file 4: Figure S4). The integration of plasmid pIB139-\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e into the chromosome of \u003cem\u003eS. rimosus\u003c/em\u003e M527 was verified by PCR (Additional file 5: Figure S5).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOver-expression of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e gene negatively affects sporulation behavior and rimocidin production, and represses transcription of \u003cem\u003erim \u003c/em\u003egenes \u003cem\u003eS. rimosus\u003c/em\u003e M527 \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMorphological characteristics of the wild-type \u003cem\u003eS. rimosus\u003c/em\u003e M527 and the recombinant M527-NA\u003csub\u003esr\u003c/sub\u003e when cultivated on MS agar plates at 28\u0026deg;C were assessed. Both \u003cem\u003eS. rimosus\u003c/em\u003e M527 and M527-NA\u003csub\u003esr\u003c/sub\u003e produced white aerial hyphae, however, a difference in sporulation was observed between both strains (Figure 3). The wild-type strain gave rise to abundant yellow spores, whereas the recombinant strain hardly sporulated.\u003c/p\u003e\n\u003cp\u003eTo evaluate the effect of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e gene on rimocidin production, recombinant strain \u003cem\u003eS. rimosus\u003c/em\u003e M527-NA\u003csub\u003esr\u003c/sub\u003e and control strain \u003cem\u003eS. rimosus\u003c/em\u003e M527 were cultured in shake-flask fermentation. As shown in Figure 2, a large decrease in rimocidin production was observed for the recombinant strain M527-NA\u003csub\u003esr\u003c/sub\u003e. After 96 h, the amount of rimocidin produced by M527-NA\u003csub\u003esr\u003c/sub\u003e reached the highest level of 91.1\u0026nbsp;mg/L, a 58.2% decrease in the yield of rimocidin produced by the \u003cem\u003eS. rimosus\u003c/em\u003e M527 (218.2 mg/L). These results indicate that \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e negatively affects on \u003cem\u003eS. rimosus\u003c/em\u003e M527 morphological differentiation and rimocidin biosynthesis. Accordingly, the expression of empty plasmid pIB139 in \u003cem\u003eS. rimosus\u003c/em\u003e M527 had no effect on morphological differentiation and rimocidin production (data not shown).\u003c/p\u003e\n\u003cp\u003eThe partial sequence of the \u003cem\u003erim\u003c/em\u003e gene cluster involved in rimocidin biosynthesis in \u003cem\u003eS. rimosus\u003c/em\u003e M527 was cloned and published (GenBank accession No: MK300953). The putative functions of 10 \u003cem\u003erim\u003c/em\u003e genes (\u003cem\u003erimA\u003c/em\u003e to \u003cem\u003erimK\u003c/em\u003e) located in the cluster have been analyzed, and these genes are anticipated to be responsible for rimocidin biosynthesis [11, 17]. To test whether NsdA\u003csub\u003esr\u003c/sub\u003e regulates rimocidin biosynthesis through affecting transcription of \u003cem\u003erim\u003c/em\u003e genes, we performed qRT-PCR analysis using total RNA of \u003cem\u003eS. rimosus\u003c/em\u003e M527, mutant M527-\u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e, complemented strain M527-\u0026Delta;nsdA\u003csub\u003esr \u003c/sub\u003e/pSET152::\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e, and \u003cem\u003eS. rimosus\u003c/em\u003e M527-NA\u003csub\u003esr\u003c/sub\u003e, after 48 and 84 h of fermentation. As compared with wild-type, transcriptional levels of \u003cem\u003erim\u003c/em\u003e genes were obviously increased in M527-\u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e, and the increase was diminished in the complemented strain. Transcriptional levels of \u003cem\u003erim\u003c/em\u003e genes were repressed in strain \u003cem\u003eS. rimosus\u003c/em\u003e M527-NA\u003csub\u003esr\u003c/sub\u003e (Figure\u0026nbsp;4). NsdA\u003csub\u003esr\u003c/sub\u003e thus impairs gene expression at the transcriptional level for all \u003cem\u003erim\u003c/em\u003e genes and further decreases rimocidin production in over-expressing recombinant strains.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHeterologous expression of\u0026nbsp;the \u003c/strong\u003e\u003cstrong\u003e\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e gene negatively affects sporulation behavior and antibiotic production of \u003cem\u003eS. coelicolor\u003c/em\u003e M145 and\u003cem\u003e S. diastatochromogenes\u003c/em\u003e 1628\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo determine whether the \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e has similar negative effects on \u003cem\u003eS. coelicolor\u003c/em\u003e M145 and \u003cem\u003eS. diastatochromogenes \u003c/em\u003e1628, the plasmid pIB139-\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e was also introduced into \u003cem\u003eS. coelicolor\u003c/em\u003e M145 and\u003cem\u003e S. diastatochromogenes\u003c/em\u003e 1628 by intergeneric conjugation, to generate the recombinant strains M145-NA\u003csub\u003esr\u003c/sub\u003e and 1628-NA\u003csub\u003esr\u003c/sub\u003e, both resistant to 50\u0026nbsp;\u0026micro;g/mL apramycin (data not shown). The integration of plasmid pIB139-\u003cem\u003ensdA\u003csub\u003esr \u003c/sub\u003e\u003c/em\u003einto the chromosome of \u003cem\u003eS. coelicolor\u003c/em\u003e M145 (Additional file 6: Figure S6) and\u003cem\u003e S. diastatochromogenes\u003c/em\u003e 1628 (Additional file 7: Figure S7) was verified by PCR, respectively. When grown on Gauze\u0026rsquo;s No. 1 medium for 6 days, blue pigment corresponding to Act, which diffuses into the agar, can be detected earlier and is increased in wild-type \u003cem\u003eS. coelicolor \u003c/em\u003eM145 comparing with the recombinant strain M145-NA\u003csub\u003esr \u003c/sub\u003e(Figure 5A). Sporulation behaviors of \u003cem\u003eS. coelicolor\u003c/em\u003e M145-NA\u003csub\u003esr\u003c/sub\u003e was also delayed because of the introduction of\u0026nbsp;the \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e gene. Similarly, heterologous expression of the \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e gene had negative effects on sporulation and toyocamycin(TM) production of \u003cem\u003eS. diastatochromogenes\u003c/em\u003e 1628. Nearly no difference between control strain \u003cem\u003eS. diastatochromogenes\u003c/em\u003e 1628 and \u003cem\u003eS. diastatochromogenes\u003c/em\u003e 1628-NA\u003csub\u003esr\u003c/sub\u003e in terms of cell growth was observed (Figure 5B). However, after 24 h of cultivation, the sporulation of \u003cem\u003eS. diastatochromogenes\u003c/em\u003e 1628-NA\u003csub\u003esr\u003c/sub\u003e was obviously impaired. TM production for \u003cem\u003eS. diastatochromogenes\u003c/em\u003e 1628-NA\u003csub\u003esr\u003c/sub\u003e was greatly reduced (Figure 5C). After 84 h, TM production by 1628-NA\u003csub\u003esr\u003c/sub\u003e was reduced by 52%.\u003c/p\u003e\n\u003cp\u003eAdditionally, the effect of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e on the transcription of the respective genes involved in biosynthesis of Act and TM was investigated. In \u003cem\u003eS\u003c/em\u003e. \u003cem\u003ecoelicolor\u003c/em\u003e, Act biosynthesis is dependent on the transcriptional activation of the Act biosynthesis cluster by the ActII-orf4 protein, and increased expression of \u003cem\u003eactII-orf4\u003c/em\u003e results in the overproduction of Act [23-26]. Total RNA from \u003cem\u003eS. coelicolor \u003c/em\u003eM145 and M145-NA\u003csub\u003esr\u003c/sub\u003e was isolated after 48 and 84 h of cultivation. Semi-quantitative RT-PCR analysis results indicated that gene \u003cem\u003eactII-orf4 \u003c/em\u003ewas down-regulated in\u003cem\u003e S. coelicolor \u003c/em\u003eM145-NA\u003csub\u003esr\u003c/sub\u003e (Figure 6A), indicating that heterologous expression of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e weakens transcription of \u003cem\u003eactII-orf4\u003c/em\u003e. As an internal control, the expression of 16S rDNA was comparable in the two strains.\u003c/p\u003e\n\u003cp\u003eAs expected, semi-quantitative RT-PCR analysis also indicated that heterologous expression of \u003cem\u003ensdA\u003csub\u003esr \u003c/sub\u003e\u003c/em\u003ehad similar negative effects on the transcription of five \u003cem\u003etoy \u003c/em\u003egenes(\u003cem\u003etoyA\u003c/em\u003e,\u003cem\u003e toyB\u003c/em\u003e,\u003cem\u003e toyE\u003c/em\u003e,\u003cem\u003e toyF\u003c/em\u003e, and \u003cem\u003etoyG\u003c/em\u003e). Compared to the wild-type strain, the transcriptional levels of all \u003cem\u003etoy\u003c/em\u003e genes were greatly decreased in 1628-NA\u003csub\u003esr\u003c/sub\u003e (Figure 6B).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe polyene macrolide rimocidin shows strong antifungal activity and can be used to treat plant fungal diseases. \u003cem\u003eS. rimosus\u003c/em\u003e M527 is a rimocidin producer, but its rimocidin production is very limited. Accordingly, significant focus has been placed on developing genetic transformation methods and expression systems [16] or ribosome engineering technology combined with new fermentation conditions to improve rimocidin production [17]. The long-term goal of our research is to better understand regulatory mechanisms involved in rimocidin biosynthesis. Such understanding will allow rational modification of regulatory networks to achieve up- or down-expression of specific gene(s) to control the desired metabolic flow. This will eventually lead to an increased rimocidin production and more potent and useful rimocidin analogues. To date, a lack of knowledge of the regulation of rimocidin biosynthesis has prevented titer enhancement of rimocidin production by rational strategies.\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003ensdA\u003c/em\u003e gene, which is found and conserved in some \u003cem\u003eStreptomyces\u003c/em\u003e, negatively affects morphological differentiation and secondary metabolite production [7-9]. Recently, by genome mining of \u003cem\u003eS. rimosus\u003c/em\u003e M527, the \u003cem\u003ensdA\u003c/em\u003e homologue \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e was found, which encodes a 491-amino-acid protein that shares up to 75% amino acids with other NsdA proteins. An obvious question is whether \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e has similar effects on sporulation behavior and rimocidin production.\u003c/p\u003e\n\u003cp\u003eAn efficient gene disruption technology in \u003cem\u003eS. rimosus\u003c/em\u003e M527 will make it possible to determine gene function through characterization of deletion mutant phenotypes. And it will certainly contribute to a better understanding of the relationship between regulators and rimocidin biosynthesis. Unfortunately, biotechnological methods available in \u003cem\u003eStreptomyces\u003c/em\u003e are limited. Typically, for gene disruption in \u003cem\u003eStreptomyces\u003c/em\u003e, single crossover integration of a suicide plasmid can be employed, resulting in disruption of the gene of interest with a selectable marker [27]. However, the limited number of selectable markers limits the reusability of this approach. Alternatively, clean genomic deletions can be made \u003cem\u003evia\u003c/em\u003e double-crossover integration. However, this multistep process is often time-consuming and laborious [27-29]. Auspiciously, the appearance of clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR -associated (Cas) protein systems provides an ideal solution to these problems. Compared with traditional methods, the application of CRISPR/Cas9 has several advantages, including higher efficiency and ease of operation [30]. The establishment of CRISPR/Cas9-based genetic manipulation approaches in \u003cem\u003eStreptomyces\u003c/em\u003e opened a new era for genome engineering of this type of microorganism [31]. A few CRISPR/Cas9 systems for genome editing have been developed and applied in various \u003cem\u003eStreptomyces \u003c/em\u003especies, such as \u003cem\u003eStreptomyces coelicolor \u003c/em\u003e[32] and \u003cem\u003eStreptomyces lividans \u003c/em\u003e[33]. By co-expression with customized single guide RNAs (sgRNAs), \u003cem\u003eStreptococcus pyogenes\u003c/em\u003e Cas9 nuclease can mediate a double-strand break in the sgRNA binding region; efficient double crossover can be achieved when the homologous templates are provided in the same plasmid. Among them, pWHU2653, based on engineered CRISPR/Cas9 combined with the counter selection system CodA(sm), has been developed and was successfully used to rapidly and effectively delete the Act polyketide chain length factor gene \u003cem\u003eactI-ORF2\u003c/em\u003e [34]. In this study, in order to clarify the relationship of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e to morphological differentiation and rimocidin biosynthesis in \u003cem\u003eS. rimosus\u003c/em\u003e M527, pWHU2653 was adopted for the construction of a \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e deletion mutant using CRISPR/Cas9 system. Results show that gene deletion of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e results in an increase in rimocidin production. Complementation of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e reduced rimocidin production to levels comparable with production in the wild-type strain. qRT-PCR analysis revealed that \u003cem\u003erim\u003c/em\u003e genes were up-regulated in the nsdA\u003csub\u003esr\u003c/sub\u003e mutant and down-regulated in the \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e over-expression strain. In addition, deletion and over-expression of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e led to acceleration and delaying of sporulation, respectively. The qRT-PCR result demonstrated that the decreased rimocidin production caused by the introduction of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e was attributed to the inhibition of transcription of rimocidin biosynthetic genes. These results support the conclusion that NsdA\u003csub\u003esr\u003c/sub\u003e plays a negative role in morphological differentiation and rimocidin production in \u003cem\u003eS. rimosus\u003c/em\u003e M527.\u003c/p\u003e\n\u003cp\u003eWhether the negative effect of NsdA\u003csub\u003esr\u003c/sub\u003e is universal to other \u003cem\u003eStreptomyces\u003c/em\u003e is still unknown. In this study, the deduced amino acid sequence of NsdA\u003csub\u003esr\u003c/sub\u003e showed 77.6% similarity to NsdA\u003csub\u003esc\u003c/sub\u003e from model strain \u003cem\u003eS\u003c/em\u003e\u003cem\u003e. coelicolor\u003c/em\u003e. The disruption of the \u003cem\u003ensdA\u003csub\u003esc\u003c/sub\u003e\u003c/em\u003e gene resulted in the overproduction of Act in \u003cem\u003eS\u003c/em\u003e\u003cem\u003e. coelicolor\u003c/em\u003e. Thus, the heterologous expression of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e in \u003cem\u003eS\u003c/em\u003e\u003cem\u003e. coelicolor\u003c/em\u003e was considered and performed. As expected, NsdA\u003csub\u003esr\u003c/sub\u003e had negative effects on sporulation and Act biosynthesis as well as on transcription of the pathway-specific regulator, \u003cem\u003eactII-orf4\u003c/em\u003e. This result confirmed that NsdA\u003csub\u003esr\u003c/sub\u003e is not only a homologue of NsdA\u003csub\u003esc\u003c/sub\u003e but also has similar effects. Subsequently, by heterologous expression of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e, similar negative effects on morphological differentiation and antibiotic production were observed in \u003cem\u003eS. diastatochromogenes\u003c/em\u003e 1628, which is considered a significant industrial producer of the nucleoside antibiotic, TM [35, 36].\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn conclusion, \u003cem\u003en\u003c/em\u003e\u003cem\u003esdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e cloned in this study is identified as a negative regulator of sporluation and antibiotic biosynthesis as well as the transcription of biosynthetic genes both in its host \u003cem\u003eS. rimosus\u003c/em\u003e M527 and in model strain \u003cem\u003eS\u003c/em\u003e\u003cem\u003e. coelicolor\u003c/em\u003e and industrial producer strain \u003cem\u003eS. diastatochromogenes\u003c/em\u003e 1628. However, the exact molecular mechanism of rimocidin biosynthesis and other metabolic pathways affected by NsdA\u003csub\u003esr\u003c/sub\u003e remains unknown. This point could be elucidated by RNA-seq or -omics strategies using the\u003cem\u003e nsdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e deletion mutant and wild-type strains. Further studies are needed to elucidate other key genes or metabolic pathways involved in rimocidin biosynthesis.\u003c/p\u003e\n\u003cp\u003eThe importance of this work is that it provides further information for understanding regulatory mechanisms controlling rimocidin biosynthesis in\u003cem\u003e S. rimosus\u003c/em\u003e M527. In addition, the successful application of a CRISPR/Cas9 system based on pWHU2653 in this study will provide a basis for efficient genome manipulation for the overproduction of rimocidin.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003eMaterials \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eQ5 High-Fidelity Master Mix with GC-buffer was purchased from NEB. Restriction endonucleases, Miniprep, and Gel Extraction kits were purchased from TaKaRa Biotechnology Co. Ltd. 5-Fluorocytosine (5FC) was purchased from Aladdin. Oligonucleotide primer synthesis and DNA sequencing of PCR products were performed by Shanghai Sunny Biotechnology Co. Ltd. China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStrains, plasmids, and\u003c/strong\u003e\u003cstrong\u003e primers\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe strains and plasmids used in this study are listed in Table 1. Strains were used as follows: Rimocidin producer \u003cem\u003eS. rimosus\u003c/em\u003e M527 has been deposited in the China Center for Type Culture Collection (CCTCC: M2013270). Act producer\u003cem\u003e S. coelicolor\u003c/em\u003e M145 was provided by Prof. Andreas Bechthold (University of Freiburg, Freiburg, Germany). TM producer \u003cem\u003eS. diastatochromogenes\u003c/em\u003e 1628 has been deposited in the China General Microbiological Culture Collection Center (CGMCC No. 2060) [37]. \u003cem\u003eEscherichia coli\u003c/em\u003e JM109 was used as a general host for gene cloning and plasmid construction. Methylation-deficient strain, \u003cem\u003eE. coli\u003c/em\u003e ET12567/pUZ8002, was used as the donor for plasmid transfer to \u003cem\u003eStreptomyces\u003c/em\u003e by intergeneric conjugation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1 \u003c/strong\u003e\u003cstrong\u003eStrains and plasmids used in this study\u003c/strong\u003e\u003c/p\u003e\n\u003ctable\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003eStrain or plasmid\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003eDescription\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eSource or reference\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003eStrain\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003e\u003cem\u003eE. coli \u003c/em\u003eJM109\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003eGeneral cloning host\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eOur lab\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003e\u003cem\u003eE. coli \u003c/em\u003eET12567/pUZ8002\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003e\u003cem\u003eCm\u003c/em\u003e\u003csup\u003er\u003c/sup\u003e, \u003cem\u003eKm\u003c/em\u003e\u003csup\u003er\u003c/sup\u003e, donor strain for conjugation\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eOur lab\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003e\u003cem\u003eS. rimosus \u003c/em\u003eM527\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003eRimocidin producer\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eCCTCC 2013270\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003e\u003cem\u003eS. diastatochromogenes \u003c/em\u003e1628\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003eToyocamycin producer\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eCGMCC 2060\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003e\u003cem\u003eS. coelicolor \u003c/em\u003eM145\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003eActinorhodin producer\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eProf. Andreas\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003eM527-\u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003e\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e gene deletion mutant, derived from M527 strain\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003eM527-\u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e/pSET152::\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003e\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e complemented strain, mutant M527-\u0026Delta;\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e with integrative plasmid pSET152::\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003eM527-NA\u003csub\u003esr\u003c/sub\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003eM527 with integrative vector pIB139-\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003eM145\u003cem\u003e-\u003c/em\u003eNA\u003csub\u003esr\u003c/sub\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003eM145 with integrative vector pIB139-\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003e1628-NA\u003csub\u003esr\u003c/sub\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003e1628 with integrative vector pIB139-\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003ePlasmids\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003epSET152\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003eIntegrative plasmid, \u003cem\u003eapr\u003csup\u003er\u003c/sup\u003e\u003c/em\u003e, \u003cem\u003eoriT\u003c/em\u003e\u003csub\u003eRK2\u003c/sub\u003e, \u0026phi;C31 \u003cem\u003eint/att\u003c/em\u003eP\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eOur lab\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003epIB139\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003eDerivative of integrative plasmid pSET152, harboring a \u003cem\u003ePermE\u003csup\u003e*\u003c/sup\u003e \u003c/em\u003epromoter, \u003cem\u003eapr\u003csup\u003er\u003c/sup\u003e\u003c/em\u003e ,\u003cem\u003eoriT\u003c/em\u003e\u003csub\u003eRK2\u003c/sub\u003e, \u0026phi;C31 \u003cem\u003eint/att\u003c/em\u003eP\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eOur lab\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003epWHU2653\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003eScas9, sgRNA cloning cassette\u003cem\u003e, codA(sm), apr\u003csup\u003er\u003c/sup\u003e\u003c/em\u003e , \u003cem\u003eori(coE\u003c/em\u003el)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003e[34]\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003epWHU2653-△\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003eDerived from pWHU2653, for deletion of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e, containing up- and down-stream homologous arms of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003epSET152::\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003eDerived from pSET152, harboring \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e driven by its own promoter\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"175\"\u003e\n\u003cp\u003epIB139-\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"282\"\u003e\n\u003cp\u003e\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e gene under the control of promoter \u003cem\u003ePermE\u003csup\u003e* \u003c/sup\u003e\u003c/em\u003ein pIB139\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePlasmid pWHU2653 [34], a gift from Prof. Sun YH, was used for disruption of the \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e gene using the CRISPR/Cas9 system. The primers (restriction sites are underlined) used in this study are listed in Table 2.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2 \u003c/strong\u003e\u003cstrong\u003ePrimers used in this study\u003c/strong\u003e\u003c/p\u003e\n\u003ctable\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003ePrimers\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"437\"\u003e\n\u003cp\u003eDescription\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"77\"\u003e\n\u003cp\u003eSource or reference\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003eP1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"437\"\u003e\n\u003cp\u003e5\u0026rsquo;-CACCACCACCACTGA\u003cu\u003eGCTAGC\u003c/u\u003eTTCAGACGTGTCTA-3\u0026rsquo;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"77\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003eP2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"437\"\u003e\n\u003cp\u003e5\u0026rsquo;-TCCGTGTCCGGCGTCGACCTGCTGGATCCT-3\u0026rsquo;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"77\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003eP3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"437\"\u003e\n\u003cp\u003e5\u0026rsquo;-AGGTCGACGCCGGACACGGAGTTTTAGAGC-3\u0026rsquo;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"77\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003eP4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"437\"\u003e\n\u003cp\u003e5\u0026rsquo;-GTCGACTAGAGGATCCCCGGGTA\u003cu\u003eTCTAGA\u003c/u\u003eAA-3\u0026rsquo;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"77\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003eP5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"437\"\u003e\n\u003cp\u003e5\u0026rsquo;-CGTCGACCTGCAGGCATGCAAGCTTCGCGTCGTCCACCAGCACCTCG-3\u0026rsquo;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"77\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003eP6\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"437\"\u003e\n\u003cp\u003e5\u0026rsquo;-AATCGGAATGGGGGCGTTCCACAGCACTCCCACAGACCCCGG-3\u0026rsquo;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"77\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003eP7\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"437\"\u003e\n\u003cp\u003e5\u0026rsquo;-GGTCTGTGGGAGTGCTGTGGAACGCCCCCATTCCGATTGC-3\u0026rsquo;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"77\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003eP8\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"437\"\u003e\n\u003cp\u003e5\u0026rsquo;-GAGTGCTTGCGGCAGCGTGAAGCTTGGCATGGTCGGCCTTACGGACAG-3\u0026rsquo;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"77\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003eP9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"437\"\u003e\n\u003cp\u003e5\u0026rsquo;-ACCG\u003cu\u003eCATATG\u003c/u\u003eGTGGGCGGCAGTGGCGGCAC-3\u0026rsquo; (\u003cem\u003eNde\u003c/em\u003eI)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"77\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003eP10\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"437\"\u003e\n\u003cp\u003e5\u0026rsquo;-ACCG\u003cu\u003eTCTAGA\u003c/u\u003eTTATCAGACGGCCTCCGCGCCGG-3\u0026rsquo; (\u003cem\u003eXba\u003c/em\u003eI)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"77\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003eP11\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"437\"\u003e\n\u003cp\u003e5\u0026rsquo;-ACCG\u003cu\u003eCATATG\u003c/u\u003eCGGCAGCCGGACCGAGCAGT-3\u0026rsquo; (\u003cem\u003eNde\u003c/em\u003eI)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"77\"\u003e\n\u003cp\u003eThis work\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePrimers P1-P4 were used for amplification of sgRNA. Primers P5 and P6 were used for amplification of up-stream homologous arms of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e. Primers P7 and P8 were used for amplification of down-stream homologous arms of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e. Primers P9 and P10 were used for amplification of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e. \u003cem\u003eNde\u003c/em\u003eI and \u003cem\u003eXba\u003c/em\u003eI restriction enzyme sites are underlined. Primers P11 and P10 were used for amplification of a 1776-bp DNA fragment containing the coding region of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e and its 300-bp upstream promoter region.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMedia and culture conditions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eE. coli\u003c/em\u003e strains were cultured using liquid or solid LB medium containing appropriate antibiotics at 37 \u0026deg;C. Antibiotics were used in the following concentrations: apramycin (100\u0026nbsp;\u0026micro;g/mL), chloramphenicol (25\u0026nbsp;\u0026micro;g/mL), ampicillin (100\u0026nbsp;\u0026micro;g/mL), and kanamycin (50\u0026nbsp;\u0026micro;g/mL). To generate spores, \u003cem\u003eStreptomyces\u003c/em\u003e cells were sprayed on MS medium [17] and incubated for 5-6 days at 28\u0026deg;C. Collected spores were washed with water and preserved in water/glycerol (1:1, v/v) at \u0026minus;80\u0026deg;C.\u003c/p\u003e\n\u003cp\u003e2CMC solid medium [16] was used for conjugation. CP liquid medium [38] was used as seed medium. MS, YMG [39], and Gauze\u0026rsquo;s No. 1 medium were used for morphological observation. Gauze\u0026rsquo;s No. 1 medium composes of 20 g of starch, 1 g of KNO\u003csub\u003e3\u003c/sub\u003e, 0.5 g of KH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 0.5 g of MgSO\u003csub\u003e4\u003c/sub\u003e, 0.5 g of NaCl, 0.01 g of FeSO\u003csub\u003e4\u003c/sub\u003e, and 20 g of agar per liter.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eS. rimosus\u003c/em\u003e M527 and its derivates were incubated using the method of Zhao et al. [17]. \u003cem\u003eS. diastatochromogenes\u003c/em\u003e 1628 and its derivative were incubated using the method of Xu et al. [35]. \u003cem\u003eS. coelicolor\u003c/em\u003e M145 and its derivative were incubated using the method of Zhao et al. [38].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConstruction of the \u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e mutant and its complementation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePlasmid pWHU2653, a delivery vector containing the sgRNA cloning cassette and counterselection marker CodA(sm), was developed for genome editing in \u003cem\u003eStreptomyces\u003c/em\u003e using the CRISPR/Cas9 system [34, 40]. sgRNA consists of an exchangeable 20 nt guide sequence that matches the target DNA and an invariant scaffold that binds to Cas9 in pWHU2653. In this study, a protospacer adjacent motif (PAM) for sgRNA and a 20 nt target guide sequence AGGTCGACGCCGGACACGGA of the \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e gene extended by PAM were selected according to the guide design tool (\u003ca href=\"https://zlab.bio/guide-design-resources\"\u003ehttps://zlab.bio/guide-design-resources\u003c/a\u003e). To construct the double-enzyme digestion sgRNA cloning cassette, PCR was used to generate the sgRNA with the target sequence using pWHU2653 as the template. Primers P1/P2 were used to amplify the upstream fragment, whereas another pair of primers P3/P4 were used to amplify the downstream fragment. The two fragments, each end flanked by a 20 bp homology sequence from pWHU2653, were spliced together by overlap extension PCR, yielding a 0.3 kb sgRNA fragment in which expression of sgRNA is under control of the constitutive promoter ermE\u003csup\u003e*\u003c/sup\u003e. The 0.3 kb sgRNA cloning cassette was inserted into pWHU2653 between \u003cem\u003eNhe\u003c/em\u003eI/\u003cem\u003eXba\u003c/em\u003eI using an infusion cloning kit, generating plasmid pWHU2653-sgRNA. Subsequently, the 2.1 kb upstream homologous arm (UHA) and 2.1 kb downstream homologous arm (DHA) of the \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e start codon were amplified by primer pairs P5/P6 and P7/P8 from genomic DNA of \u003cem\u003eS. rimosus\u003c/em\u003e M527, respectively. The resulting DNA fragments, UHA and DHA, were ligated into the \u003cem\u003eHin\u003c/em\u003edIII site of pWHU2653-sgRNA using Gibson assembly methods as described by Gibson et al. [41], yielding plasmid pWHU2653-\u0026Delta;\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e for gene knock out.\u003c/p\u003e\n\u003cp\u003eThe constructed pWHU2653-\u0026Delta;\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e was introduced into the wild-type strain \u003cem\u003eS. rimosus \u003c/em\u003eM527 by intergeneric conjugation as described by Song et al. [16]. Single apramycin-resistant exconjugants were patched on 2CMC agar, containing apramycin and nalidixic acid (300 and 100 \u0026micro;g/mL, respectively), and grown at 28 \u0026deg;C for four or five generations. Genomic DNA was extracted from mycelium grown on the plate and amplified by PCR using primers P9/P10 to verify the deletion of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e. To obtain plasmid-free progeny, single exconjugants were picked and streaked on 2CMC agar containing 800 \u0026mu;g/mL 5FC and grown in the dark at 28 \u0026deg;C for 3 or 4 days. The 5FC\u003csup\u003eR\u003c/sup\u003e colonies were then replicated to 2CMC with and without apramycin to confirm plasmid loss. The \u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e mutants were named \u003cem\u003eS. rimosus\u003c/em\u003e M527-\u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e.\u003c/p\u003e\n\u003cp\u003eFor complementation of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e in \u003cem\u003eS. rimosus\u003c/em\u003e M527-\u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e, a 1776 bp DNA fragment containing the coding region of \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e and its 300 bp upstream promoter region was amplified by PCR using P11 and P10 as primers. The DNA fragment was inserted into the \u003cem\u003eNde\u003c/em\u003eI and \u003cem\u003eXba\u003c/em\u003eI sites of pSET152 to obtain pSET152::\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e. Introduction of pSET152::\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e and the empty vector pSET152 as a control into mutant M527-\u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e by conjugation resulted in the complemented strain \u003cem\u003eS. rimosus\u003c/em\u003e M527-\u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e/pSET152::\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e and the control strain \u003cem\u003eS. rimosus\u003c/em\u003e M527- \u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e/pSET152, respectively.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOver-expression/Heterologous expression of \u003cem\u003ensdA\u003csub\u003esr \u003c/sub\u003e\u003c/em\u003ein\u003cem\u003e S. rimosus\u003c/em\u003e M527/\u003cem\u003eS. coelicolor \u003c/em\u003eM145 and \u003cem\u003eS.\u003c/em\u003e \u003c/strong\u003e\u003cstrong\u003e\u003cem\u003ediastatochromogenes \u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e1628\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll recombinant DNA techniques were performed as described by Sambrook and Russell [42]. Plasmid pIB139 [43, 44] is a shuttle vector that replicates in \u003cem\u003eE. coli \u003c/em\u003eand integrates site-specifically into \u003cem\u003eStreptomyces\u003c/em\u003e chromosomes. Using \u003cem\u003eS. rimosus\u003c/em\u003e M527 genomic DNA as a template, a 1476 bp \u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e open reading frame (ORF) was amplified by PCR using primers P9 and P10 (Table 1). The PCR product was then digested with \u003cem\u003eNde\u003c/em\u003eI and \u003cem\u003eXba\u003c/em\u003eI and inserted into the corresponding sites of pIB139, yielding plasmid pIB139-\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e. Sequencing of the inserted gene fragment confirmed that the gene did not contain any mutations.\u003c/p\u003e\n\u003cp\u003eSubsequently, the introduction of the constructed pIB139-\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e into\u003cem\u003e S. rimosus\u003c/em\u003e M527, \u003cem\u003eS. coelicolor \u003c/em\u003eM145, and \u003cem\u003eS. diastatochromogenes\u003c/em\u003e 1628 was conducted by intergeneric conjugation to yield recombinant strains \u003cem\u003eS. rimosus\u003c/em\u003e M527-NA\u003csub\u003esr\u003c/sub\u003e, \u003cem\u003eS. coelicolor\u003c/em\u003e M145-NA\u003csub\u003esr\u003c/sub\u003e and \u003cem\u003eS. diastatochromogenes\u003c/em\u003e 1628-NA\u003csub\u003esr\u003c/sub\u003e, respectively. Recombinant strains were confirmed using apramycin resistance and PCR.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMorphological observation \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate morphological differentiation, wild-type strain \u003cem\u003eS. rimosus\u003c/em\u003e M527, the \u003cem\u003ensdA\u003csub\u003esr-\u003c/sub\u003e\u003c/em\u003edisrupted mutant M527-\u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e, the complemented strain M527-\u0026Delta;nsdA\u003csub\u003esr\u003c/sub\u003e/pSET152::\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e, and the recombinant strain M527-NA\u003csub\u003esr\u003c/sub\u003e were streaked on solid MS medium; the wild-type \u003cem\u003eS.\u003c/em\u003e \u003cem\u003ediastatochromogenes\u003c/em\u003e 1628 and recombinant strain 1628-NA\u003csub\u003esr\u003c/sub\u003e were streaked on solid YMG medium; and the wild-type \u003cem\u003eS. coelicolor\u003c/em\u003e M145 and recombinant strain M145-NA\u003csub\u003esr\u003c/sub\u003e were streaked on Gauze\u0026rsquo;s No. 1 medium. The morphology of all strains was observed after incubation for 6-7 days at 28\u0026deg;C. Morphological characteristics of the mycelia surface were examined under SEM (JSM-5410LV, JEOL, Tokyo, Japan).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnalysis of gene transcriptional levels by qRT-PCR \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExtraction of RNA and analysis of transcriptional levels of \u003cem\u003erim\u003c/em\u003e genes were performed as described previously [17, 36]. Extraction of RNA, design of primers, and analysis of the transcription of \u003cem\u003etoy\u003c/em\u003e genes were performed as described by Xu et al. [35]. Extraction of RNA, design of primers, and analysis of transcription of \u003cem\u003eactII-orf4\u003c/em\u003e gene were performed as described by Zhao et al. [38].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFermentation of antibiotic\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eProduction of rimocidin by \u003cem\u003eS.\u003c/em\u003e \u003cem\u003erimosus\u003c/em\u003e M527 was achieved using the method of Zhao et al. [17]. Production of TM by \u003cem\u003eS.\u003c/em\u003e \u003cem\u003ediastatochromogenes\u003c/em\u003e 1628 was achieved using the method of Ma et al. [36].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnalysis of antibiotic \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRimocidin was analyzed using high-performance liquid chromatography (HPLC) (Varian, USA) method described previously [17]. HPLC analysis of TM used the method of Ma et al. [36]. Gauze\u0026rsquo;s No. 1 medium was used to identify the production of Act on agar media by directly evaluating the density of the blue color characteristic of this antibiotic.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments were performed at least three times, and results were expressed as mean \u0026plusmn; standard deviations (SD). Statistical analysis was performed with Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eqRT-PCR: quantitative RT-PCR; TM: toyocamycin; Act: actinorhodin; SEM: scanning electron microscopy; sgRNA: single guide RNA; 5FC:5-Fluorocytosine; CCTCC: China Center for Type Culture Collection; CGMCC: China General Microbiological Culture Collection Center; PAM: protospacer adjacent motif; UHA: upstream homologous arm; DHA: downstream homologous arm; ORF: open reading frame; HPLC: high-performance liquid chromatography; SD: standard deviations. CRISPR/Cas: clustered regularly interspaced short palindromic repeats(CRISPR) /CRISPR-associated\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate: \u003c/strong\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication: \u003c/strong\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials: \u003c/strong\u003eAll data generated or analyzed during this study are included in this published article [and its supplementary information files].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests: \u003c/strong\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding: \u003c/strong\u003eThis work was supported by the National Natural Science Foundation of China (31972320, 31772213), and the excellent youth fund of Zhejiang province, China (LR17C140002).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions: \u003c/strong\u003eZ Ma designed research wrote this article. ZQ Song and J Xu conducted experiments. A Bechthold revised this article. XP Yu checked the final version. All authors read and approved the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments: \u003c/strong\u003eThe authors are grateful to Prof. Yuhui Sun (Wuhan University) for kindly providing the pWHU2653.\u003c/p\u003e"},{"header":"Additional File Information","content":"\u003cp\u003e\u003cstrong\u003eAdditional file 1: Figure S1.\u003c/strong\u003e Phylogenetic analysis of NsdA\u003csub\u003esr\u003c/sub\u003e using NCBI BLASTP.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional file 2: Figure S2.\u003c/strong\u003e HPLC-analysis to measure the influence of NsdA\u003csub\u003esr\u003c/sub\u003e on rimocidin production.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional file 3: Figure S3.\u003c/strong\u003e Map of constructed plasmid pIB139-\u003cem\u003ensdA\u003csub\u003esr\u003c/sub\u003e\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional file 4: Figure S4. \u003c/strong\u003ePhenotypic\u0026nbsp;verification of recombinant strains \u003cem\u003eS. rimosus\u003c/em\u003e M527-NA\u003csub\u003esr\u003c/sub\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional file 5: Figure S5. \u003c/strong\u003ePCR analysis of apramycin (\u003cem\u003eap\u003csup\u003er\u003c/sup\u003e\u003c/em\u003e) gene from recombinant strains \u003cem\u003eS. rimosus\u003c/em\u003e M527- NA\u003csub\u003esr\u003c/sub\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional file 6: Figure S6. \u003c/strong\u003ePCR analysis of apramycin (\u003cem\u003eap\u003csup\u003er\u003c/sup\u003e\u003c/em\u003e) gene from recombinant strains \u003cem\u003eS. coelicolor\u003c/em\u003e M145- NA\u003csub\u003esr\u003c/sub\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional file 7: Figure S7. \u003c/strong\u003ePCR analysis of apramycin (\u003cem\u003eap\u003csup\u003er\u003c/sup\u003e\u003c/em\u003e) gene from recombinant strains \u003cem\u003eS. diastatochromogenes \u003c/em\u003e1628-NA\u003csub\u003esr\u003c/sub\u003e.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKemung HM, Tan LT, Khan TM, Chan KG, Pusparajah P, Goh BH, Lee LH. \u003cem\u003eStreptomyces \u003c/em\u003eas a prominent resource of future anti-MRSA drugs. Front Microbiol. 2018;9:2221.\u003c/li\u003e\n\u003cli\u003eLiu R, Deng Z, Liu T. \u003cem\u003eStreptomyces\u003c/em\u003e species: Ideal chassis for natural product discovery and overproduction. Metab Eng. 2018;50:74-84.\u003c/li\u003e\n\u003cli\u003eOlanrewaju OS, Babalola OO. \u003cem\u003eStreptomyces\u003c/em\u003e: implications and interactions in plant growth promotion. Appl Microbiol Biotechnol. 2019;103:1179-88.\u003c/li\u003e\n\u003cli\u003eMart\u0026iacute;n JF, Ramos A, Liras P. Regulation of geldanamycin biosynthesis by cluster-situated transcription factors and the master regulator PhoP. Antibiotics (Basel). 2019;8. pii: E87.\u003c/li\u003e\n\u003cli\u003eKang Y, Wang Y, Hou B, Wang R, Ye J, Zhu X, Wu H, Zhang H. AdpA\u003csub\u003elin\u003c/sub\u003e, a pleiotropic transcriptional regulator, is involved in the cascade regulation of lincomycin biosynthesis in \u003cem\u003eStreptomyces lincolnensis\u003c/em\u003e. Front Microbiol. 2019;10:2428.\u003c/li\u003e\n\u003cli\u003eHou B, Tao L, Zhu X, Wu W, Guo M, Ye J, Wu H, Zhang H. Global regulator BldA regulates morphological differentiation and lincomycin production in \u003cem\u003eStreptomyces lincolnensis\u003c/em\u003e. Appl Microbiol Biotechnol. 2018;102:4101-15.\u003c/li\u003e\n\u003cli\u003eLi W, Ying X, Guo Y, Yu Z, Zhou X, Deng Z, Kieser H, Chater KF, Tao M. Identification of a gene negatively affecting antibiotic production and morphological differentiation in \u003cem\u003eStreptomyces coelicolor\u003c/em\u003e A3(2). J Bacteriol. 2006;188:8368-75.\u003c/li\u003e\n\u003cli\u003eWang XJ, Guo SL, Guo WQ, Xi D, Xiang WS. Role of \u003cem\u003ensdA\u003c/em\u003e in negative regulation of antibiotic production and morphological differentiation in \u003cem\u003eStreptomyces bingchengensis\u003c/em\u003e. J Antibiot (Tokyo). 2009;62:309-13.\u003c/li\u003e\n\u003cli\u003eWu H, Liu W, Shi L, Si K, Liu T, Dong D, Zhang T, Zhao J, Liu D, Tian Z, Yue Y, Zhang H, Xuelian B, Liang Y. Comparative genomic and regulatory analyses of natamycin production of \u003cem\u003eStreptomyces lydicus \u003c/em\u003e Sci Rep. 2017;7:9114.\u003c/li\u003e\n\u003cli\u003eSowiński P, Pawlak J, Borowski E, Gariboldi P. Stereostructure of rimocidin. J Antibiot (Tokyo). 1995;48:1288-91.\u003c/li\u003e\n\u003cli\u003eSeco EM, P\u0026eacute;rez-Z\u0026uacute;\u0026ntilde;iga FJ, Rol\u0026oacute;n MS, Malpartida F. Starter unit choice determines the production of two tetraene macrolides, rimocidin and CE-108, in \u003cem\u003eStreptomyces diastaticus \u003c/em\u003e 108. Chem Biol. 2004;11:357-66.\u003c/li\u003e\n\u003cli\u003eCaffrey P, Aparicio JF, Malpartida F, Zotchev SB. Biosynthetic engineering of polyene macrolides towards generation of improved antifungal and antiparasitic agents. Curr Top Med Chem. 2008;8:639-53.\u003c/li\u003e\n\u003cli\u003eJeon BJ, Kim JD, Han JW, Kim BS. Antifungal activity of rimocidin and a new rimocidin derivative BU16 produced by \u003cem\u003eStreptomyces mauvecolor\u003c/em\u003e BU16 and their effects on pepper anthracnose. J Appl Microbiol. 2016;120:1219-28.\u003c/li\u003e\n\u003cli\u003eYu J, Liu Q, Chen C, Qi X. Antifungal activity change of \u003cem\u003eStreptomyces rimosus\u003c/em\u003e MY02 mediated by confront culture with other microorganism. J Basic Microbiol. 2017;57:276-82.\u003c/li\u003e\n\u003cli\u003eLu D, Ma Z, Xu X, Yu X. Isolation and identification of biocontrol agent \u003cem\u003eStreptomyces rimosus \u003c/em\u003eM527 against \u003cem\u003eFusarium\u0026nbsp;oxysporum\u003c/em\u003esp.\u0026nbsp;\u003cem\u003ecucumerinum\u003c/em\u003e. J Basic Microbiol. 2016;56: 929-33.\u003c/li\u003e\n\u003cli\u003eSong ZQ, Liao ZJ, Hu YF, Ma Z, Bechthold A, Yu XP. Development and optimization of an intergeneric conjugation system and analysis of promoter activity in \u003cem\u003eStreptomyces rimosus \u003c/em\u003e J Zhejiang Univ Sci B. 2019;20:891-900.\u003c/li\u003e\n\u003cli\u003eZhao Y, Song Z, Ma Z, Bechthold A, Yu X. Sequential improvement of rimocidin production in \u003cem\u003eStreptomyces rimosus\u003c/em\u003e M527 by introduction of cumulative drug-resistance mutations. J Ind Microbiol Biotechnol. 2019;46:697-708.\u003c/li\u003e\n\u003cli\u003eEscudero L, Al-Refai M, Nieto C, Laatsch H, Malpartida F, Seco EM. New rimocidin/CE-108 derivatives obtained by a crotonyl-CoA carboxylase/reductase gene disruption in \u003cem\u003eStreptomyces diastaticus\u003c/em\u003e 108: substrates for the polyene carboxamide synthase PcsA. PLoS One. 2015;10:e0135891.\u003c/li\u003e\n\u003cli\u003eSeco EM, Miranzo D, Nieto C, Malpartida F. The \u003cem\u003epcsA\u003c/em\u003e gene from \u003cem\u003eStreptomyces diastaticus\u003c/em\u003e 108 encodes a polyene carboxamide synthase with broad substrate specificity for polyene amides biosynthesis. Appl Microbiol Biotechnol. 2010;85:1797-807.\u003c/li\u003e\n\u003cli\u003eBednarz B, Kotowska M, Pawlik KJ. Multi-level regulation of coelimycin synthesis in \u003cem\u003eStreptomyces coelicolor\u003c/em\u003e A3(2). Appl Microbiol Biotechnol. 2019;103:6423-34.\u003c/li\u003e\n\u003cli\u003eXia H, Zhan X, Mao XM, Li YQ. The regulatory cascades of antibiotic production in \u003cem\u003eStreptomyces\u003c/em\u003e. World J Microbiol Biotechnol. 2020;36:13.\u003c/li\u003e\n\u003cli\u003eLuo S, Chen XA, Mao XM, Li YQ. Transposon-based identification of a negative regulator for the antibiotic hyper-production in \u003cem\u003eStreptomyces\u003c/em\u003e. Appl Microbiol Biotechnol. 2018;102:6581-92.\u003c/li\u003e\n\u003cli\u003eBruheim P, Sletta H, Bibb MJ, White J, Levine DW. High-yield actinorhodin production in fed-batch culture by a \u003cem\u003eStreptomyces lividans\u003c/em\u003e strain overexpressing the pathway-specific activator gene \u003cem\u003eact\u003c/em\u003eII-ORF4. J Ind Microbiol Biotechnol. 2002;28:103-11.\u003c/li\u003e\n\u003cli\u003eImai Y, Sato S, Tanaka Y, Ochi K, Hosaka T. Lincomycin at subinhibitory concentrations potentiates secondary metabolite production by \u003cem\u003eStreptomyces\u003c/em\u003e Appl Environ Microbiol. 2015;81:3869-79.\u003c/li\u003e\n\u003cli\u003eSohoni SV, Fazio A, Workman CT, Mijakovic I, Lantz AE. Synthetic promoter library for modulation of actinorhodin production in \u003cem\u003eStreptomyces coelicolor\u003c/em\u003e A3(2). PLoS One. 2014;9:e99701.\u003c/li\u003e\n\u003cli\u003eWei J, Tian J, Pan G, Xie J, Bao J, Zhou Z. Development and application of a T7 RNA polymerase-dependent expression system for antibiotic production improvement in \u003cem\u003eStreptomyces\u003c/em\u003e. Biotechnol Lett. 2017;39:857-64.\u003c/li\u003e\n\u003cli\u003eKieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA. Practical \u003cem\u003eStreptomyces\u003c/em\u003e Norwich: John Innes Centre; 2000.\u003c/li\u003e\n\u003cli\u003eNovakova R, N\u0026uacute;\u0026ntilde;ez LE, Homerova D, Knirschova R, Feckova L, Rezuchova B, Sevcikova B, Men\u0026eacute;ndez N, Mor\u0026iacute;s F, Cort\u0026eacute;s J, Kormanec J. Increased heterologous production of the antitumoral polyketide mithramycin A by engineered \u003cem\u003eStreptomyces lividans\u003c/em\u003e TK24 strains. Appl Microbiol Biotechnol. 2018;102:857-69.\u003c/li\u003e\n\u003cli\u003eRezuchova B, Homerova D, Sevcikova B, N\u0026uacute;\u0026ntilde;ez LE, Novakova R, Feckova L, Skultety L, Cort\u0026eacute;s J, Kormanec J. An efficient blue-white screening system for markerless deletions and stable integrations in \u003cem\u003eStreptomyces\u003c/em\u003e chromosomes based on the blue pigment indigoidine biosynthetic gene \u003cem\u003ebpsA\u003c/em\u003e. Appl Microbiol Biotechnol. 2018;102:10231-44.\u003c/li\u003e\n\u003cli\u003eNeldeborg S, Lin L, Stougaard M, Luo Y. Rapid and efficient gene deletion by CRISPR/Cas9. Methods Mol Biol. 2019;1961:233-47.\u003c/li\u003e\n\u003cli\u003eZhang MM, Wong FT, Wang Y, Luo S, Lim YH, Heng E, Yeo WL, Cobb RE, Enghiad B, Ang EL, Zhao H. CRISPR-Cas9 strategy for activation of silent \u003cem\u003eStreptomyces\u003c/em\u003e biosynthetic gene clusters. Nat Chem Biol. 2017. doi: 1038/nchembio.2341.\u003c/li\u003e\n\u003cli\u003eTong Y, Charusanti P, Zhang L, Weber T, Lee SY. CRISPR-Cas9 based engineering of actinomycetal genomes. ACS Synth Biol. 2015;4:1020-9.\u003c/li\u003e\n\u003cli\u003eCobb RE, Wang Y, Zhao H. High-efficiency multiplex genome editing of \u003cem\u003eStreptomyces\u003c/em\u003e species using an engineered CRISPR/Cas system. ACS Synth Biol. 2015;4:723-8.\u003c/li\u003e\n\u003cli\u003eZeng H, Wen S, Xu W, He Z, Zhai G, Liu Y, Deng Z, Sun Y. Highly efficient editing of the actinorhodin polyketide chain length factor gene in \u003cem\u003eStreptomyces coelicolor\u003c/em\u003e M145 using CRISPR/Cas9-CodA(sm) combined system. Appl Microbiol Biotechnol. 2015;99:10575-85.\u003c/li\u003e\n\u003cli\u003eXu J, Song Z, Xu X, Ma Z, Bechthold A, Yu X. ToyA, a positive pathway-specific regulator for toyocamycin biosynthesis in \u003cem\u003eStreptomyces diastatochromogenes\u003c/em\u003e Appl Microbiol Biotechnol. 2019;103:7071-84.\u003c/li\u003e\n\u003cli\u003eMa Z, Tao L, Bechthold A, Shentu X, Bian Y, Yu X. Overexpression of ribosome recycling factor is responsible for improvement of nucleotide antibiotic-toyocamycin in \u003cem\u003eStreptomyces diastatochromogenes \u003c/em\u003e Appl Microbiol Biotechnol. 2014;98:5051-8.\u003c/li\u003e\n\u003cli\u003eMa Z, Liu J, Bechthold A, Tao L, Shentu X, Bian Y, Yu X. Development of intergeneric conjugal gene transfer system in \u003cem\u003eStreptomyces diastatochromogenes\u003c/em\u003e 1628 and its application for improvement of toyocamycin production. Curr Microbiol. 2014;68:180-5.\u003c/li\u003e\n\u003cli\u003eZhao YF, Lu DD, Bechthold A, Ma Z, Yu XP. Impact of \u003cem\u003eotrA\u003c/em\u003eexpression\u0026nbsp;on morphological\u0026nbsp; differentiation,\u0026nbsp;actinorhodin\u0026nbsp;production, and\u0026nbsp;resistance\u0026nbsp;to\u0026nbsp;aminoglycosides\u0026nbsp;in\u0026nbsp;\u003cem\u003eStreptomyces coelicolor\u003c/em\u003e J Zhejiang Univ Sci B. 2018;19:708-17.\u003c/li\u003e\n\u003cli\u003eQiu J, Zhuo Y, Zhu D, Zhou X, Zhang L, Bai L, Deng Z. Overexpression of the ABC transporter AvtAB increases avermectin production in \u003cem\u003eStreptomyces avermitilis\u003c/em\u003e. Appl Microbiol Biotechnol. 2011;92:337-45.\u003c/li\u003e\n\u003cli\u003eMo J, Wang S, Zhang W, Li C, Deng Z, Zhang L, Qu X. Efficient editing DNA regions with high sequence identity in actinomycetal genomes by a CRISPR-Cas9 system. Synth Syst Biotechnol. 2019;4:86-91.\u003c/li\u003e\n\u003cli\u003eGibson DG, Benders GA, Axelrod KC, Zaveri J, Algire MA, Moodie M, Montague MG, Venter JC, Smith HO, Hutchison CA. One-step assembly in yeast of 25 overlapping DNA fragments to form a complete synthetic \u003cem\u003eMycoplasma genitalium\u003c/em\u003e Proc Natl Acad Sci U S A. 2008;105:20404-9.\u003c/li\u003e\n\u003cli\u003eSambrook J, Russel DW. Molecular cloning: a laboratory manual. New York: Cold Spring Harbor Laboratory; 2001.\u003c/li\u003e\n\u003cli\u003eWang T, Bai L, Zhu D, Lei X, Liu G, Deng Z, You D. Enhancing macrolide production in \u003cem\u003eStreptomyces\u003c/em\u003e by coexpressing three heterologous genes. Enzyme Microb Technol. 2012;50:5-9.\u003c/li\u003e\n\u003cli\u003eXu X, Wang J, Bechthold A, Ma Z, Yu X. Selection of an efficient promoter and its application in toyocamycin production improvement in \u003cem\u003eStreptomyces diastatochromogenes\u003c/em\u003e World J Microbiol Biotechnol. 2017;33:30.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"NsdAsr, Streptomyces rimosus, Rimocidin, CRISPR/Cas9","lastPublishedDoi":"10.21203/rs.3.rs-17670/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-17670/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e The polyene macrolide rimocidin, produced by \u003cem\u003eStreptomyces rimosus \u003c/em\u003eM527, was found to be highly effective against a broad range of fungal plant pathogens. Current understanding of the regulatory mechanism of rimocidin biosynthesis and morphological differentiation in \u003cem\u003eS. rimosus\u003c/em\u003e M527 is limited. NsdA is considered as a negative regulator involved in morphological differentiation and biosynthesis of secondary metabolites in some \u003cem\u003eStreptomyces\u003c/em\u003e.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eIn this study, \u003cem\u003ensdA\u003c/em\u003e\u003csub\u003e\u003cem\u003esr\u003c/em\u003e\u003c/sub\u003e was cloned from \u003cem\u003eS. rimosus\u003c/em\u003e M527. The role of \u003cem\u003ensdA\u003c/em\u003e\u003csub\u003e\u003cem\u003esr\u003c/em\u003e\u003c/sub\u003e in rimocidin biosynthesis and morphological differentiation was investigated by gene deletion, complementation, and over-expression. A ΔnsdA\u003csub\u003esr\u003c/sub\u003e mutant was obtained using CRISPR/Cas9. The mutant produced more rimocidin (46%) and generated more spores than the wild-type strain. Over-expression of \u003cem\u003ensdA\u003c/em\u003e\u003csub\u003e\u003cem\u003esr\u003c/em\u003e\u003c/sub\u003e led to a decrease in rimocidin production and impairment of sporulation. Quantitative reverse transcription-PCR (qRT-PCR) analysis revealed that transcription of \u003cem\u003erim\u003c/em\u003e genes responsible for rimocidin biosynthesis was up-regulated in the ΔnsdA\u003csub\u003esr\u003c/sub\u003e mutant but down-regulated in the \u003cem\u003ensdA\u003c/em\u003e\u003csub\u003e\u003cem\u003esr \u003c/em\u003e\u003c/sub\u003eover-expression strain. Similar effects have been described for \u003cem\u003eStreptomyces coelicolor\u003c/em\u003e M145 and the industrial toyocamycin-producing strain \u003cem\u003eStreptomyces diastatochromogenes \u003c/em\u003e1628.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003e\u003cem\u003eNsdA\u003c/em\u003e\u003csub\u003e\u003cem\u003esr\u003c/em\u003e\u003c/sub\u003e is identified as a negative regulator of sporluation and antibiotic biosynthesis as well as the transcription of biosynthetic genes both in its host \u003cem\u003eS. rimosus\u003c/em\u003e M527 and in model strain \u003cem\u003eS. coelicolor\u003c/em\u003e and industrial producer strain \u003cem\u003eS. diastatochromogenes\u003c/em\u003e 1628. This work will provide further information for understanding regulatory mechanisms controlling rimocidin biosynthesis in\u003cem\u003e S. rimosus\u003c/em\u003e M527.\u003c/p\u003e","manuscriptTitle":"Identification of a gene from Streptomyces rimosus M527 negatively affecting antibiotic biosynthesis and morphological differentiation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2020-03-18 15:12:46","doi":"10.21203/rs.3.rs-17670/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"315912f9-0305-4867-82e8-8fe7a53fcb3d","owner":[],"postedDate":"March 18th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":71645,"name":"Applied \u0026 Industrial Microbiology"}],"tags":[],"updatedAt":"2020-04-15T11:44:51+00:00","versionOfRecord":[],"versionCreatedAt":"2020-03-18 15:12:46","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-17670","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-17670","identity":"rs-17670","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}