Exploring acenocoumarol and silodosin as allosteric... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/13-1398" }, "headline": "Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung...", "datePublished": "2024-11-21T14:17:50", "dateModified": "2025-09-23T15:57:28", "author": [ { "@type": "Person", "name": "Swastika Maity" }, { "@type": "Person", "name": "Krishnaprasad Baby" }, { "@type": "Person", "name": "Bharath Harohalli Byregowda" }, { "@type": "Person", "name": "Megh Pravin Vithalkar" }, { "@type": "Person", "name": "Usha Y Nayak" }, { "@type": "Person", "name": "K Sreedhara Ranganath Pai" }, { "@type": "Person", "name": "Yogendra Nayak" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": " Background Non-small-cell lung cancer (NSCLC) is a highly morbid disease. Chemotherapy for NSCLC lacks specificity and efficacy mainly because of drug resistance. The current study aimed to explore computational tools to target allosteric epidermal growth factor receptor (EGFR) sites and screen for the top molecules in vitro and in vivo xenograft models. Methods Molecular docking, virtual screening, and molecular dynamic studies revealed that acenocoumarol and silodosin are the top two allosteric EGFR inhibitors. They were further tested for cytotoxicity, apoptosis, cell cycle, and gene expression by qPCR, western blotting, A549 cell xenograft anti-proliferative activity, and tumor regression efficacy analysis. Results Acenocoumarol and silodosin exhibited cytotoxicity in A549 and IMR-90 cells at concentrations below 50 and 80 μM, respectively. Acenocoumarol and silodosin induced S-phase and G2/M-phase arrest in A549 cells in the cell cycle analysis. Both drugs showed early apoptosis at their IC50 doses (acenocoumarol 50 μM and silodosin 25 μM). KRAS (Kirsten rat sarcoma viral oncogene homolog) and ERK2 (extracellular signal-regulated kinase 2) gene regulation in A549 cells was confirmed using qPCR. KRAS and ERK2 activities were quantified by western blot analysis. In the xenograft study, tumor size, body weight, and organ weight were significantly attenuated by the test drugs compared with the standard cisplatin. Immunoblotting and western blot results of the A549-xenograft tissue indicated downregulation of KRAS and ERK2. Furthermore, the test drugs have upregulated caspase-3 gene expression. Conclusion The drugs acenocoumarol and silodosin downregulate KRAS and ERK2 both in cell line and in Xenograft model. KRAS and ERK2 are associated with EGFR inhibition. Hence, acenocoumarol and silodosin can be further explored for repurposing studies in human trials. " } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/13-1398/v1", "name": "Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors..." } } ] } Home Browse Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Maity S, Baby K, Byregowda BH et al. Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung cancer [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2024, 13 :1398 ( https://doi.org/10.12688/f1000research.157465.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Research Article Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung cancer [version 1; peer review: 1 approved with reservations, 1 not approved] Swastika Maity 1 , Krishnaprasad Baby 1 , Bharath Harohalli Byregowda https://orcid.org/0000-0002-1362-2090 1 , [...] Megh Pravin Vithalkar https://orcid.org/0009-0001-0186-4906 1 , Usha Y Nayak https://orcid.org/0000-0002-1995-3114 2 , K Sreedhara Ranganath Pai https://orcid.org/0000-0002-2017-9533 1 , Yogendra Nayak https://orcid.org/0000-0002-0508-1394 1 Swastika Maity 1 , Krishnaprasad Baby 1 , [...] Bharath Harohalli Byregowda https://orcid.org/0000-0002-1362-2090 1 , Megh Pravin Vithalkar https://orcid.org/0009-0001-0186-4906 1 , Usha Y Nayak https://orcid.org/0000-0002-1995-3114 2 , K Sreedhara Ranganath Pai https://orcid.org/0000-0002-2017-9533 1 , Yogendra Nayak https://orcid.org/0000-0002-0508-1394 1 PUBLISHED 21 Nov 2024 Author details Author details 1 Department of Pharmacology, Manipal College of Pharmaceutical Sciences, Manipal Academy of Higher Education, Manipal, Karnataka, 576104, India 2 Department of Pharmaceutics, Manipal College of Pharmaceutical Sciences, Manipal Academy of Higher Education, Manipal, Karnataka, 576104, India Swastika Maity Roles: Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, Project Administration, Writing – Original Draft Preparation Krishnaprasad Baby Roles: Formal Analysis, Methodology, Validation Bharath Harohalli Byregowda Roles: Formal Analysis, Methodology, Writing – Review & Editing Megh Pravin Vithalkar Roles: Formal Analysis, Methodology, Visualization Usha Y Nayak Roles: Resources, Supervision, Validation K Sreedhara Ranganath Pai Roles: Conceptualization, Supervision, Validation Yogendra Nayak Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Methodology, Supervision, Writing – Review & Editing OPEN PEER REVIEW DETAILS REVIEWER STATUS This article is included in the Bioinformatics gateway. This article is included in the Manipal Academy of Higher Education gateway. This article is included in the Oncology gateway. Abstract Background Non-small-cell lung cancer (NSCLC) is a highly morbid disease. Chemotherapy for NSCLC lacks specificity and efficacy mainly because of drug resistance. The current study aimed to explore computational tools to target allosteric epidermal growth factor receptor (EGFR) sites and screen for the top molecules in vitro and in vivo xenograft models. Methods Molecular docking, virtual screening, and molecular dynamic studies revealed that acenocoumarol and silodosin are the top two allosteric EGFR inhibitors. They were further tested for cytotoxicity, apoptosis, cell cycle, and gene expression by qPCR, western blotting, A549 cell xenograft anti-proliferative activity, and tumor regression efficacy analysis. Results Acenocoumarol and silodosin exhibited cytotoxicity in A549 and IMR-90 cells at concentrations below 50 and 80 μM, respectively. Acenocoumarol and silodosin induced S-phase and G2/M-phase arrest in A549 cells in the cell cycle analysis. Both drugs showed early apoptosis at their IC50 doses (acenocoumarol 50 μM and silodosin 25 μM). KRAS (Kirsten rat sarcoma viral oncogene homolog) and ERK2 (extracellular signal-regulated kinase 2) gene regulation in A549 cells was confirmed using qPCR. KRAS and ERK2 activities were quantified by western blot analysis. In the xenograft study, tumor size, body weight, and organ weight were significantly attenuated by the test drugs compared with the standard cisplatin. Immunoblotting and western blot results of the A549-xenograft tissue indicated downregulation of KRAS and ERK2. Furthermore, the test drugs have upregulated caspase-3 gene expression. Conclusion The drugs acenocoumarol and silodosin downregulate KRAS and ERK2 both in cell line and in Xenograft model. KRAS and ERK2 are associated with EGFR inhibition. Hence, acenocoumarol and silodosin can be further explored for repurposing studies in human trials. READ ALL READ LESS Keywords Allosteric EGFR inhibitor, NSCLC, Acenocoumarol, Silodosin, Drug repurposing Corresponding Author(s) Yogendra Nayak ( [email protected] ) Close Corresponding author: Yogendra Nayak Competing interests: No competing interests were disclosed. Grant information: Swastika Maity received an ICMR Senior Research Fellowship (ICMR-SRF #45/33/2019/PHA/BMS). The authors are thankful to the Department of Pharmaceutics, Manipal College of Pharmaceutical Sciences, for facilitating the computer simulations. Schrodinger's Software and Computers were procured under a grant from DST-SERB, New Delhi, to Usha YN (EMR/2016/007006). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2024 Maity S et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Maity S, Baby K, Byregowda BH et al. Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung cancer [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2024, 13 :1398 ( https://doi.org/10.12688/f1000research.157465.1 ) First published: 21 Nov 2024, 13 :1398 ( https://doi.org/10.12688/f1000research.157465.1 ) Latest published: 23 Sep 2025, 13 :1398 ( https://doi.org/10.12688/f1000research.157465.2 ) There is a newer version of this article available. Suppress this message for one day. Introduction The surface protein receptor tyrosine kinase (TK) and epidermal growth factor receptor (EGFR) are targets for many drugs, particularly for treating lung cancer. 1 Mutation and alteration of EGFR in the cell lead to the development of NSCLC. Exon-19 multi-nucleotide frame deletion leads to the dimerization of four amino-acid sequences in the N-lobe of the EGFR complex, leading to single L858R and T750M or double T790M- L858R mutation condition. 2 A single nucleotide substitution on Exon-21 in the EGFR site leads to ATP site activation, resulting in the replacement of arginine with leucine at L858M, causing a cancerous lung condition. In NSCLC, the Cys797 mutation to serine (C797S) occurs in the EGFR moiety. 3 One of the major problems of EGFR-TK is autophosphorylation, leading to signal transduction pathways that activate the ATP region of the protein due to amino acid activation in the N-lobe of the EGFR complex, leading to an unstable EGFR moiety, causing cancerous growth in the cells. 4 Therefore, targeted therapy against EGFR overactivity may be effective for treating NSCLC. Currently, the first-generation FDA-approved EGFR therapies are gefitinib and erlotinib, which bind to the ATP site of EGFR, but they fail to inhibit autophosphorylation due to the T790 mutation occurrence. 5 Afatinib and dacomitinib, second-generation FDA-approved drugs, target the inactive site in EGFR and enzymatically inhibit the T790 mutation. The problem with these molecules is that they only recognize the dimeric state of EGFR and thus fail to stop EGFR overexpression in the monomeric state. 6 The third-generation drug, osimertinib, has a pyrimidine moiety that covalently binds to the ATP site of EGFR. This leads to the selective inhibition of T790 expression. However, with long-term use, third-generation EGFR inhibitors show C797 secondary mutations. 7 Tumor complexity and adaptive cell pathways for signalling in NSCLC, particularly involving the activation of various signalling pathways, such as amplification of MET/HER2, RAS-MAPK, or RAS-PI3K pathways, activate novel fusion events and histological or phenotypic transformation. 8 , 9 Specific mutations, such as G796R, G796S, G796D, and L792H, and less prevalent mutations in exon 20 were linked with osimertinib resistance. Mutations such as C797S disrupt and weaken the covalent bond that Cys797 forms with osimertinib, preventing it from effectively targeting the mutant EGFR and thus conferring resistance to the drug. 10 Fourth-generation drug development involves allosteric site inhibition of EGFR. Mutant-specific allosteric inhibitors of EGFR, such as EAI001, have been found to bind to sites beyond the EGFR allosteric site. This molecule was optimized to yield EAI045, which had potency towards L858R/T790M mutations compared to wild-type EGFR. Researchers have designed and optimized allosteric EGFR inhibitors that bind to allosteric sites in the EGFR tyrosine kinase domain outside the ATP domain and have emerged as potential treatment strategies for EGFR-mutant cancers. 11 The main factor for choosing fourth-generation NSCLC drugs or allosteric EGFR inhibitors is that it reduces the chances of “undruggable” protein-ligand moiety formation, thus reducing the chance of adverse reactions of such drugs. 12 In this study, we used computational tools to identify acenocoumarol and silodosin as top-2 allosteric EGFR inhibitors. 13 These molecules were further evaluated for their pharmacological efficacy against NSCLC. Methods Cell culture and maintenance A549 cells (human lung carcinoma alveolar epithelial squamous cells) and IMR-90 (fibroblasts isolated from normal fetal lungs) were procured from American-type cell culture (ATCC ® ), and stock cells were cultured in RPMI 1640 medium (Life Technologies, Invitrogen, catalogue: 2187008), supplemented with 10% inactivated Fetal Bovine Serum (FBS, Merck Catalogue F7524 ), 100 IU/ml penicillin, and 100 μg/ml streptomycin (Thermo Fisher Scientific ® ) in a humidified atmosphere of 5% CO 2 at 37 o C until confluent. The cells were dissociated with cell dissociating solution containing 0.2% trypsin (Invitrogen; catalog R-001-100), 0.02 % EDTA, and 0.05% glucose in PBS. Further, 50,000 cells/well were seeded in a 96-well plate and incubated for 24 hrs at 37 o C, 5 % CO 2 incubator (MIC-80; Microsil India Pvt. Ltd.) The cell viability is checked using a hemocytometer (Rohem Silverline Counting Chamber). The required amount of cells were further cultured in a T75 culture flask (Thermo Fisher Scientific). 13 Cytotoxicity assay using MTT reagent The top molecules from the in silico studies, danusertib, bifonazole, clopidogrel, acenocoumarol, silodosin, panobinostat, and standard doxorubicin were procured from TCI ® India. The stock solution of test compounds 10 mM stocks was prepared using DMSO (dimethyl sulfoxide, TCI India). Serial two-fold dilutions were prepared from 100 μM to 3.125 μM using RPMI 1640 plain media for respective treatments. 13 Cytotoxicity in A549 and IMR-90 cells were carried out using MTT (3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide) reagent. 14 The monolayer cell culture was trypsinized and the cell count was adjusted to 5 × 10 5 cells/ml using respective media containing 10% FBS. To each well of the 96-well plate, 100 μl of the diluted cell suspension (50,000 cells/well) was added. After 24 h, when a partial monolayer was formed, the supernatant was flicked off, washed the monolayer once with medium and 100 μl of different test concentrations of test drugs were added onto the partial monolayer in microtiter plates. The plates were then incubated at 37 o C for 24 h in 5% CO 2 atmosphere. After incubation, the test solutions in the wells were discarded, and 100 μl of MTT (5 mg/10 ml in PBS) was added to each well. The plates were incubated for 4 h at 37 o C in 5% CO 2 atmosphere. The supernatant was removed, and 100 μl DMSO was added, and the plates were gently shaken to solubilize the formed formazan. 15 Absorbance was measured using a microplate reader (BMG LABTECH ® ) at 590 nm. The percentage growth inhibition was calculated using the following formula % Inhibition = ( ( OD of Control – OD of sample ) / OD of Control ) × 100 . The half maximal inhibitory concentration (IC 50 ) values for cytotoxicity tests were derived from non-linear regression analysis performed using GraphPad Prism8.0 (Graph pad, San Diego, USA). Alternatively, R-program can also be used. The results were compared between groups. From the cytotoxicity results, we selected the best drugs, acenocoumarol and silodosin, for further testing. Apoptosis assay using propidium iodide (PI) and Annexin V-FITC staining A549 cells (1 × 10 6 in RPMI buffer), were used in this study. The plates were analyzed using a flow cytometer (FACS Calibur, BD Biosciences, San Jose, USA). After 18 h of incubation, the floating cells were replaced with the new medium. Control, standard and test samples at different concentrations were added, followed by induction of apoptosis. Cells were scraped and 1 ml of medium was pipetted to the wells. After the cells were washed twice with cold PBS, they were resuspended in a binding buffer at 1 × 10 6 cells/ml. The cell suspension was portioned to 500 μl, to which 5 μl of Annexin V (Annexin V, FITC detection kit, Sigma-Aldrich ® ) and 10 μl of propidium iodide (Sigma-Aldrich) were mixed. The plates are stored in the dark for 15 min, followed by analysis with a flow cytometer. The quadrants were created based on viable cell markers with different colors. 16 Gating was performed, and cell apoptosis was measured and compared in the different treatment groups. Cell cycle analysis A549 cells (1 × 10 6 cells/ml) were cultured and kept at 6 well plates with 2 ml of RPMI medium and incubated for 24 h. It was then subjected to treatment with the test drugs acenocoumarol (25 and 50 μM), silodosin (12.5 and 25 μM), and standard doxorubicin (25 μM) were incubated for 24 h. The cells were then harvested and centrifuged at 2000 rpm for 5 min at room temperature, and the supernatant was discarded carefully, retaining the cell pellet. The cell pellet was washed by resuspending in 2 ml of 1XPBS. The washing was repeated another time with the same conditions. The supernatant was then discarded. From the pellet, the cells were fixed by resuspending in 300 μl of Sheath fluid (BD Bioscience ® , catalogue no:342003), followed by the addition of 1 ml of chilled 70% ethyl alcohol drop by drop with continuous gentle shaking and another 1 ml of chilled 70% ethyl alcohol added at once. The cells were then stored at 4°C for or overnight. Post fixing, the cells were centrifuged at 2000 rpm for 5 min. The cell pellet was washed twice with 2 ml of cold 1X PBS. The cell pellet was then resuspended in 450 μl of sheath fluid containing 0.05 mg/ml PI (Sigma-Aldrich catalogue no: P4864), and 0.05 mg/ml RNaseA (Sigma-Aldrich, catalogue no: P4864) and incubated for 15 min in the dark. The percentage of cells in different stages of the cell cycle in compounds treated and untreated populations were determined using FACS Caliber (BD Biosciences, San Jose, CA). 17 Western blot quantification KRAS and ERK2 A549 cells (10 × 10 6 cells/2 ml) were cultured in RPMI medium, added to P35 dish, and incubated till 80% confluency. Drug treatment with acenocoumarol (25 and 50 μM), silodosin (12.5 and 25 μM), and standard doxorubicin (25 μM) were were incubated for 24 h. The protein was isolated post-harvesting by washing with PBS solution twice. The cell pellet was suspended in 300 μl of Radioimmunoprecipitation assay (RIPA) buffer (Thermo-Fisher Scientific) with 1X protease inhibitor (Sigma-Aldrich). The cells were incubated for 30 min, but every 5 min, the suspension was mixed. Then, cells were centrifuged at 10,000 rpm for 12 min and protein lysates were collected. The protein lysates were mixed with 5X loading dye and heated for 2 min at 95°C. Further, it was loaded with 10% and 15% sodium dodecyl sulphate polyacrylamide gel (SDS-PAGE) using Mini protean Tetra cell (Bio-Rad). The nitrocellulose membrane (0.2 μM) (Bio-Rad) was equilibrated in transfer buffer for 10 min. Protein transfer was done for 15 min in the Turbo Transblot (Bio-Rad) apparatus. The blot was blocked in 3% bovine serum albumin (BSA) in tris-buffered saline with Tween 20 (TBST, Thermo-Fisher Scientific, Catalogue no. A11008) for 1 h. The blot was incubated with 2° Ab (anti-Rabbit or anti-Mouse IgG-HRP (horseradish peroxidase, Thermo-Fisher Scientific) at dilution 1:10000 for 1 h. The blot was rinsed with enhanced chemiluminescence (ECL) reagent (Thermo-Fischer Scientific), for 1 min in the dark, and the images were captured between 0.5 to 5 s exposure in Chemidoc XRS and imaging system (Bio-Rad). 17 The protein expression levels of KRAS and ERK2 were measured, keeping glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as loading control in this study and the fold regulation was calculated. KRAS and ERK2 gene regulation by qPCR Treated A549 cells were scraped and washed with sterile PBS, followed by centrifugation at 12,000 rpm for 5 min at 4°C. The supernatant was discarded, and 0.4 ml of TRIzol (Invitrogen - Life Technologies ® ) was added, mixed for 1 min, and allowed to stand for 10 min at room temperature. Chloroform (0.25 ml per 0.4 ml of TRIzol) was added, and the mixture was vortexed for 15 s. The tube was left to stand for 5 min, after which it was centrifuged at 12,000 rpm for 15 min at 4°C. The aqueous phase was carefully transferred to a new sterile microcentrifuge tube. Isopropanol (0.5 ml) was added, gently mixed for 30 s, and incubated at -20°C for 20 min. The mixture was centrifuged at 12,000 rpm for 10 min at 4°C. After removing the supernatant, the RNA pellet was washed with 0.5 ml of 70% ethanol and centrifuged at 12,000 rpm at 4°C. The supernatant was discarded, and the RNA pellet was air-dried. The pellet was resuspended in 20 μl of diethylpyrocarbonate (DEPC)-treated water, and the total RNA yield was quantified using SpectraDrop (SpectraMax i3x, Molecular Devices, USA). cDNA was synthesized from 500 ng of RNA using the PrimeScript RT reagent kit (Takara Bio) with oligo (dT) primers (Thermo-Fisher), according to the manufacturer’s instructions, in a reaction volume of 20 μl. The cDNA synthesis was performed at 50°C for 30 min. The synthesized cDNA was used for real-time polymerase chain reaction (RT-PCR) analysis. Each 20 μl PCR mixture contained 1.4 μl of cDNA, 10 μl of SYBR Green Master Mix (Thermo Fisher Scientific), and 1 μM of specific forward and reverse primers for the target genes ( Table 1 ). 13 The PCR reaction began with enzyme activation at 95°C for 2 min, followed by 39 cycles of denaturation at 95°C for 5 s, and annealing/extension at the appropriate temperature for 30 s. A secondary denaturation at 95°C for 5 s was performed, followed by a melt curve analysis from 65°C to 95°C in 5°C increments. Fold expression or regulation was calculated and compared between treated groups. 18 , 19 Table 1. Primer details for KRAS and ERK2 fold regulation in A549 cells. Sr. No. sequence Primer Base pairs Annealing temperature 1 TGGCACCCAGCACAATGAA Beta actin 44 50 CTAAGTCATAGTCCGCCTAGAAGCA 2 CACGGTCATCCAGTGTTGTC KRAS 40 50 CACCACCCCAAAATCTCAAC 3 CCGACATCTCAGGTTGGATT ERK2 40 58 GGTCTGTTTTCCGAGGATGA Tumor regression in A549-Xenograft mouse model The study was performed with prior approval from Institutional Animal Ethics Committee (IAEC) approval and as per the guidelines of the CPCSEA, and followed ARRIVE 2.0 checklist. 13 Nude mice (n=16, four groups) were used for the Xenograft induction and treatment. A549 cells at a sub-confluent level were harvested, and viable cells were counted using a haemocytometer. Post viability check, a single cell suspension of 5 x10 7 cells/ml was prepared in serum-free media and mixed in matrigel at a 1:1 ratio. All the mice were subcutaneously injected with 0.2 ml of cell suspension in the region above the right flank region. 20 , 21 Tumor size was analyzed using digital Vernier callipers. Treatment with was started when the tumor size was 100-150 mm 3 (2 weeks). Treatment with the test drugs and standard drugs was initiated as per the respective pre-determined doses, the positive control was intravenously administered, and test drugs were administered to animals in groups 3 and 4. Tumor length and width were measured every alternate day using Vernier calipers, and tumor volume was calculated. Once the tumor size reached the desired volume, ≈100-150 mm 3 (3 weeks), the tumor volume was noted and randomly sorted into four groups, each consisting of four animals. The treatment groups contained the tumor control group, to which normal saline was administered orally; the positive control group mice were treated with 4 mg/kg cisplatin (TCI, India; CAS: 15663-27-1; catalogue no: D3371), and the test sample or treatment groups III and IV received an oral dose of silodosin at 8 mg/kg and acenocoumarol at 0.2 mg/kg till 21 days. At the end of the study, the mice were euthanized. The parameters such as tumor volume, % tumor growth inhibition, % change in body weight, organ weights, mean tumor weight. 22 All efforts were made to reduce the suffering of the animals throughout the study phase. 13 qPCR analysis of caspase-3 regulation in the Xenograft The caspase-3 regulation in A549-xenograft tissue gene expression were analyzed and compared between the treatment groups. 23 The specific forward and reverse primers for the target genes are represented in Table 2 . Table 2. The primer sequence for gene regulation of Caspase-3 in A549 xenograft tissue. Sr. No. sequence Primer Base pairs Annealing temperature 1 TGGCACCCAGCACAATGAA Actin 45 60 CTAAGTCATAGTCCGCCTAGAAGCA 2 CAACGTCCCCTCTGAAAAA Caspase-3 40 45 TGGAATTGATGCGTGATGTT Western blot for KARS and ERK2 in the Xenograft Western blot analysis was performed and the Ref. 24 . The respective markers were analyzed in this study. Histopathology of the Xenograft The histopathology, hematoxylin and eosin (H&E) staining of tumour tissue, heart, kidney, liver, lung, and spleen were carried out. 25 Cell infiltration, cell rupture, and cellular confluence were analyzed to identify the effects of the treatment group compared to the control group. Results Cytotoxicity assay In A549 cells, cytotoxicity analysis by MTT assay showed potent cell death in all treated drugs. Silodosin, danusatib, acenocoumarol, and panobinostat were more potent than the others. The IC 50 values are presented in Figure 1 . The IC 50 in IMR-90 cells are presented in Figure 2 . Acenocoumarol and silodosin were more potent than panobinostat and danusatib. Based on the IC 50 of the drugs acting on both cell lines, acenocoumarol and silodosin were selected for further in vitro analysis to analyze their efficacy in treating NSCLC and their antagonistic activity as EGFR allosteric inhibitors. Figure 1. Cytotoxicity of top molecules by MTT assay using A549 cells. Figure 2. Cytotoxicity of top molecules by MTT assay using IMR-90 cells. Legend: The data presented by treatment groups is compared against control and doxorubicin. Drugs such as Bifonazol and clopidogrel did not show IC 50 , and hence, they are not represented in the figure. Apoptosis in A549 cells by acenocoumarol and silodosin Cell activity was observed in all four quadrants compared with that in the control group. The control group showed activity in the first quadrant, indicating the presence of highly viable cells ( Figure 3 ). This result reflects a significant decrease in cells due to the effect of treatment. The acenocoumarol treatment at 25 μM and 50 μM has induced 20.25%, 36.9% early apoptosis and 11.28%, 6.14% late apoptosis, whereas sample silodosin showed 33.49%, 36.09% early apoptosis and 16.21%, 24.84% late apoptosis at 12.5 μM and 25 μM treatment in A549 cells. Standard doxorubicin at 25 μM has shown total apoptosis of 54.24% in A549 cells ( Figure 4 ). The PI flow cytometry method on A549 cells in the treatment groups showed increased cell apoptosis compared to the control group. Groups such as acenocoumarol and silodosin showed earlier apoptosis when compared to doxorubicin. Silodosin at 25 μM induced more apoptosis than other treatments at different doses, as determined by Annexin V-FITC and propidium iodide (PI) staining and flow cytometry analysis. Figure 3. Flow cytometry plots for apoptosis detection in A549 cells. Legend: The experimental groups: vehicle control, standard control (Doxorubicin 25 μM), and Treatment groups, namely Acenocoumarol at concentrations 25 μM and 50 μM, silodosin at concentrations 12.5 and 25 μM. The viable cell population was determined at the bottom left of the quadrant of the plot. Early apoptotic cells were identified at the bottom right quadrant, and late apoptotic cells were indicated at the top right quadrant. Figure 4. FACS analysis of apoptosis detection in A549 cells. Legend: The x-axis presents the treatment groups. Doxorubicin was the standard control. The y-axis represents the percentage of apoptosis activity. The graph shows the effect of treatment groups on checking viable cells, early apoptosis, late apoptosis and necrotic cell analysis. The data is presented by two-way ANOVA without replicas compared to doxorubicin with Mean±SEM. p<0.05, ** and p<0.5, *; compared to doxorubicin 25 μM. Effects of acenocoumarol and silodosin on A549 cell cycle The separation of cancer cells in the G0/1, S, and G2/M phases was demonstrated using flow cytometry analysis based on the fluorescence intensity of PI-stained cancer cells. The control group contained cells in the G0/G1 phase. The treatment of A549 cells at the concentrations of 25μM and 50μM with Sample acenocoumarol resulted in S phase and G2M phase arrest of 4.93%, 25.29%, and 10.19%, 15.15%, respectively, and Sample Silodosin has shown 13.7%, 33.37% S phase arrest, 14.82%, 19.43% G2M phase arrest at test concentrations 12.5 μM and 25 μM, respectively, in A549 cells. Standard doxorubicin at 25 μM induced G2M arrest of 31.61% and S phase arrest of 20.92%, respectively, in A549 cells. The test drugs showed significant G1 and S peaks compared with the standard control ( Figures 5 and 6 ). Acenocoumarol and silodosin treatment at 50 μM and 25 μM induced a significant decrease in the percentage of cells in the G1 phase, and an accumulation of cells in the S and G2/M phases of the cell cycle indicated cell cycle arrest at the S and G2M phase. Figure 5. Flow cytometry plots for cell cycle analysis in A549 cells. Legend: Cell cycle activity in A549 cells with respective treatment conditions. The x-axis presents the propidium iodide-induced fluorescence; the y-axis presents the cell frequency. The stages of the cell cycle are marked as a: Go/G1, b: S, c: G2 M and d: SUB Go, respectively. Doxorubicin 25 μM, is the standard used for comparison. Figure 6. FACS analysis of Cell cycle arrest in A549 cells. Legend: Cell cycle stages are presented as SUB Go, Go/G1, S and G 2 M phases marked with different colours. Vehicle control, Standard control (Doxorubicin 25 μM), Treatment groups namely Acenocoumarol (25 μM and 50 μM), Silodosin (12.5 and 25 μM). The data was analysed by two-way ANOVA without replicas compared to doxorubicin with Mean ± SEM. p<0.05, ** and p<0.5, *; compared to doxorubicin 25 μM. KRAS and ERK2 enzymatic inhibition by acenocoumarol and silodosin The Western blot results of A549 cells treated with acenocoumarol at 25 and 50 μM concentrations suggested that KRAS and ERK2 were downregulated by 2.12-, 3.50-, 1.04-, 1.68-fold, respectively. KRAS expression was found to be downregulated in cells treated with Silodosin at 12.5 and 25 μM by up to 1.08 and 1.71 folds. ERK2 expression was upregulated when treated with Silodosin at 12.5 μM and 25 μM ( Figure 7 ). The standard group showed downregulation of both KRAS and ERK2 by up to 3.02 and 2.41, respectively. Figure 7. Western blot analysis of GAPDH, ERK2 and KRAS in A549 cells. Legend: A: Representation of western blot gels. The treatment groups are presented as lane a: vehicle control, b: acenocoumarol 25 μM, c: acenocoumarol 50 μM, d: silodosin 12.5 μM, e: silodosin 25 μM, f: standard control, doxorubicin 25 μM. B: Fold analysis to determine the level of expression. KRAS and ERK2 gene regulation by acenocoumarol and silodosin qPCR or quantitative PCR analysis of the target genes KRAS and ERK2 was carried out, and fold regulation was determined. The results suggested decreased KRAS and ERK2 expression in cells treated with acenocoumarol at 50 μM compared to the control, with 2.10- and 1.57-fold expression. Acenocoumarol at 25 μM showed only a negligible effect on KRAS expression, whereas ERK2 was observed to be positively upregulated 0.31-fold ( Figure 8 ) compared to the control. The gene expression of both KRAS and ERK2 was upregulated in cells treated with silodosin at 12.5 μM. The expression was observed to decrease as the treatment concentration increased, with 6.54- and 1.72-fold in KRAS and ERK2 expression, respectively. The standard treatment has shown decreased expression by 3.12- and 1.49-fold in KRAS and ERK2 expression ( Figure 9 ). Figure 8. Relative expression by fold change analysis of KRAS and ERK2 gene in A549 cells. Legend: The x-axis shows the drug treatments and the y-axis shows a fold change frequency by qPCR analysis. The treatment groups are vehicle control and standard control i.e. Doxorubicin 25 μM. Treatment groups namely Acenocoumarol at concentrations 25 μM and 50 μM, and silodosin at concentrations 12.5 and 25 μM. Figure 9. The tumour growth in A549 xenograft tumour model. Legend: A. Tumor growth profile (mm 3 ) during the treatment period of 21 days; B. Tumour induction in nude mice and its growth profile at the end of the study. In the disease control group (cisplatin 4 mg/kg), silodosin (8 mg/kg), and acenocoumarol (0.2 mg/kg), Values are represented as Mean ± SEM (n= 4). p<0.5 significant compared to the vehicle control. Tumor regression efficacy in A549 xenograft by acenocoumarol and silodosin The mice with A549 Xenografts treated with Cisplatin showed a tumor growth inhibition up to 73.57 ± 0.88 whereas, the test drugs showed inhibition up to 22.69 ± 3.79 and 45.3 ± 5.32% at 8 mg/kg and 0.2 mg/kg respectively (p<0.05, p<0.5) ( Figure 9 ). The tumor growth profile of all treatment groups was significantly reduced, indicating that the test drug showed good efficacy against NSCLC. Tumor growth inhibition was significant compared to that in control mice ( Figure 10 ). Other organ growth profiles suggested that the groups with treatment induction had good growth profiles compared with the disease control groups ( Figure 11 ). Figure 10. Percentage of tumour growth inhibition in the A549 xenograft tumour model. Legend: The disease control group i.e. cisplatin (4 mg/kg) showed significant tumour growth with p<0.001; the treatment groups silodosin 8 mg/kg and acenocoumarol (0.2 mg/kg) showed significant tumour growth inhibition profile against vehicle control (p<0.001). Data represented in Mean ± SEM was calculated. Figure 11. Organ weights of the mice with A549 xenograft tumour. Legend: The vehicle control is disease-induced mice, cisplatin (4 mg/kg), silodosin (8 mg/kg), and acenocoumarol (0.2 mg/kg). Values are represented as Mean ± SEM, p< 0.05 is considered significant compared to vehicle control. Caspase-3 regulation in A549 Xenograft qPCR analysis of the A549 xenograft treated with silodosin and acenocoumarol at pre-determined concentrations suggested the effective upregulation of Caspase-3 gene expression in tumor tissue samples. The tumor tissue from silodosin and acenocoumarol showed upregulation of Caspase-3 gene expression by 5.82- and 1.49-folds ( Figure 12 ), respectively, when compared to the control. In contrast, standard treatment with cisplatin resulted in a 1.71-fold increase in expression. Overall, the results suggest that the test sample treatment with silodosin and acenocoumarol at the respective concentrations was effective in the A549 xenograft model. Figure 12. Relative expression of caspase-3 gene in xenograft tumour tissue. Legend: The treatment groups namely Silodosin (8 mg/kg), acenocoumarol (0.2 mg/kg) and the disease control group, cisplatin (4 mg/kg) were compared to vehicle control (medium). KRAS and ERK2 enzyme inhibition by acenocoumarol and silodosin In the blot analysis of the treatment groups, Acenocoumarol 0.2 mg/kg and silodosin (8 mg/kg) were analyzed for KRAS and ERK2 enzyme fold regulation ( Figure 13 ). The blots ( Figure 13B ) show upregulation of KRAS, whereas ERK2 was downregulated very little, except with acenocoumarol treatment. Acenocoumarol showed better activity than the standard and silodosin treatments did. Figure 13. Expression analysis of GAPDH, KRAS and ERK2 in xenograft tumor model. Legend: A: The treatment groups, namely Silodosin (8 mg/kg), acenocoumarol (0.2 mg/kg) and the disease control group, cisplatin (4 mg/kg), were compared to vehicle control (medium). B: The enzymatic degradation study of KRAS, GAPDH and ERK2 marker. The groups evaluated for fold regulation were a,b: vehicle control; c,d: disease control; e,f: Silodosin (8 mg/kg) and g,h: acenocoumarol: (0.2 mg/kg). Histopathology analysis of Xenograft tissue Tumor analysis of the histopathology test ( Figure 14 ) showed that A/group I: Normal architecture was observed. B/group II: Necrosis with moderate mononuclear cell infiltration. C/group III: mild necrosis with mild mononuclear cell infiltration. D/group IV: moderate mononuclear cells. Silodosin and acenocoumarol showed good anti-NSCLC activity compared with the disease control group. The arrows in Figure 14 show cell infiltration/inflammation. The treatment groups showed less cell infiltration than the vehicle-disease control group, indicating suppression of cancerous activity. Figure 14. Histopathology analysis of organs obtained from xenograft model. Legend: A: lungs, B: Tumor, C: Liver and D: Kidney. Discussion EGFR is the major oncogene driver in NSCLC, and EGFR-targeted therapy has the potential to deliver greater suppression of aggressive NSCLC compared to cytotoxicity-based pharmacotherapy. 26 Drugs that target the allosteric site of EGFR-TK, disrupt the cell-signalling cascade and alter cellular function. 27 The allosteric site has attracted significant interest from researchers and is now regarded as a highly promising target for developing anti-NSCLC drugs. Therefore, this study highlights the significance of inhibiting the EGFR allosteric site, which intersects with the TK receptor-ligand interaction. 28 It has also been stated that anaplastic lymphoma kinase (ALK), reactive oxygen species (ROS1), kinase-renin-angiotensin system (KRAS), protein kinase B (PKB), or (AKT) are other validated tissue biomarkers in NSCLC due to its downregulation of EGFR kinase in cell proliferation. 29 Targeting the allosteric site stabilizes the protein complex, influencing the binding efficiency of the primary ligand. This inactivates the protein and reduces the responsiveness to ligands or results in a neutral effect during ligand interactions. Consequently, allosteric sites have the ability to disrupt or fully halt the signal transduction process. Moreover, the site remained stable throughout the interaction. As a result, allosteric site targeting can effectively suppress cellular proliferation, particularly in malignant conditions, with allosteric inhibitors showing high selectivity. 12 Acenocoumarol is an oral anticoagulant primarily used for the prevention and treatment of thromboembolic disorders. It inhibits the synthesis of vitamin K-dependent clotting factors (II, VII, IX, and X) in the liver, which are essential for blood clot formation. This action helps prevent the formation of new blood clots and the growth of existing clots. 30 Silodosin is an alpha-1 adrenergic receptor antagonist primarily used for the treatment of benign prostatic hyperplasia (BPH), a condition characterized by an enlarged prostate gland that can cause urinary symptoms in men. 31 Acenocoumarol is a coumarin derivative with an active chiral core that is present in the enantiomeric form. 32 Acenocoumarol is absorbed by the gastrointestinal tract and undergoes first-pass metabolism, which results in peak plasma levels after dosing. In addition, if not administered in lower doses, it may lead to thromboembolic events. 33 A study indicated that acenocoumarol can upregulate extracellular signal-regulated kinase 2 (ERK1/2), leading to the activation of phosphorylation in the TK pathway. Acenocoumarol also affects the PI3K/AkT, MAPK, and RAS pathways by controlling the TK moiety. 34 Enzymes ERK2 and KRAS significantly inhibited enzymatic activity upon administration of silodosin. Hence, silodosin inhibits cell proliferation in NSCLC by inhibiting the signal transduction cascade, MAPKs, ERK, and k-RAS, which can stop aggressive growth, leading to potent anti-NSCLC activity. An earlier report showed that silodosin was able to produce pro-apoptotic activity in bladder cancer cells by enhancing the cytotoxic activity of cisplatin via ELK1 inactivation. 35 Silodosin is produced by α-androgenic blockers. Silodosin is the treatment of choice for lower urinary tract symptoms (LUTS) and benign prostatic hyperplasia (BPH). 36 Signal transduction in the TK complex via phosphorylation at certain sites in response to MAPKs and ERK. ELK-1 activation has been reported to demonstrate pro-apoptotic activity within the cytoplasm and pro-differentiation activity inside the nucleus of cancer cells, which lowers aggressive cell proliferation. 37 The degradation products of silodosin also exhibited anticancer activity. 38 Hence, silodosin could be repurposed as an anti-NSCLC drug. Allosteric inhibition of EGFR can prevent the autophosphorylation of tyrosine residues, blocking the recruitment of Grb2 (Growth factor receptor-bound protein 2) and Son of Sevenless (SOS), which are essential for KRAS activation. 39 ERK2 is the downstream regulator of KRAS in the RAS-RAF-MEK-ERK pathway; hence, activation depends on upstream signals, such as EGFR. 40 Hence, allosteric EGFR affects the activation of KRAS, which cascades through RAF and MEK to influence ERK2 phosphorylation. In this study, when enzymes ERK2 and KRAS were examined for their activity following the administration of silodosin, they demonstrated upregulated activity by exhibiting considerable enzymatic inhibition. We can conclude that silodosin and acenocomerol were able to reduce cell proliferation in NSCLC by suppressing the signal transduction cascade, MAPKs, ERK, and KRAS. Silodosin was able to promote pro-apoptotic activity in cancer cells and inhibit aggressive cancer growth, leading to significant anti-NSCLC activity that could be attributed to its allosteric EGFR inhibition. Conclusion The in silico study inferred that acenocoumarol and silodosin have an affinity for EGFR allosteric sites. Acenocoumarol and silodosin were subjected to a series of in vitro and A549 xenograft analyses to evaluate their potencies. Both drugs showed significant effects on A549 cells and were able to control the overexpression of ERK2 and KRAS. These drugs can be further explored in clinical trials to determine the efficacy of these drugs as fourth-generation anti-NSCLC agents. Ethics considerations The study was approved by the Institute’s Ethical Committee as per IAEC guidelines, and the Arrive Guidelines 2.0 was archived. The ethics approval no. for the study was IAEC-SLS-2022-071 (Date: 25 th October 2022). All studies and animal handling were performed strictly according to the IAEC guidelines, and the ARRIVE 2.0 Checklist was archived. 13 Author contributions Swastika Maity: Conceptualization, Data curation, formal analysis, Investigation, Methodology, Project administration, writing the original draft, and editing. Krishnaprasad Baby: Methodology, Formal analysis, Validation Bharath Harohalli Byregowda: Methodology, Formal analysis, writing- review and editing Megh Pravin Vithalkar: Methodology, Formal analysis, Visualization Usha Y Nayak: Supervision, Validation, Resources K Sreedhara Ranganath Pai: Supervision, Validation, Conceptualization. Yogendra Nayak: Conceptualization, formal analysis, methodology, data curation, supervision, funding acquisition, writing, review, and editing. Data availability Underlying data archived at Figshare https://doi.org/10.6084/m9.figshare.24587592.v5 . 13 This project contains the following underlying data: ARRIVE-2.0_checklist.pdf Supplementary_file-1.docx (Data generated by in silico studies) Supplementary_file-2.docx (Data generated by in vitro and in vivo studies) Methods in Detail 1.docx (Detailed materials and methods for in vitro and in vivo studies) Results.xlsx (Contains the in vitro and in vivo data) Images- SDS.pptx (Contains the original images of western blots) Acknowledgement The authors are thankful to the Manipal Academy of Higher Education, Manipal for the Financial support, and Dr. TMA Pai PhD Fellowship to Krishnaprasad Baby, Bharath Harohalli Byregowda, and Megh Pravin Vithalkar. References 1. Iyer RS, Needham SR, Galdadas I, et al. : Drug-resistant EGFR mutations promote lung cancer by stabilizing interfaces in ligand-free kinase-active EGFR oligomers. Nat. Commun. 2024; 15 (1): 2130. PubMed Abstract | Publisher Full Text | Free Full Text 2. Brown BP, Zhang YK, Kim S, et al. : Allele-specific activation, enzyme kinetics, and inhibitor sensitivities of EGFR exon 19 deletion mutations in lung cancer. Proc. Natl. Acad. Sci. USA. 2022; 119 (30): e2206588119. PubMed Abstract | Publisher Full Text | Free Full Text 3. Fassunke J, Müller F, Keul M, et al. : Overcoming EGFR G724S -mediated osimertinib resistance through unique binding characteristics of second-generation EGFR inhibitors. Nat. Commun. 2018; 9 (1): 4655. PubMed Abstract | Publisher Full Text | Free Full Text 4. Makinoshima H, Takita M, Saruwatari K, et al. : Signalling through the phosphatidylinositol 3-kinase (PI3K)/mammalian target of rapamycin (mTOR) axis is responsible for aerobic glycolysis mediated by glucose transporter in epidermal growth factor receptor (EGFR)-mutated lung adenocarcinoma. J. Biol. Chem. 2015; 290 (28): 17495–17504. PubMed Abstract | Publisher Full Text | Free Full Text 5. Zhou H, Fu H, Liu H, et al. : Uncovering the Mechanism of Drug Resistance Caused by the T790M Mutation in EGFR Kinase From Absolute Binding Free Energy Calculations. Front. Mol. Biosci. 2022; 9 : 9. Publisher Full Text 6. Li HS, Wang SZ, Xu HY, et al. : Afatinib and Dacomitinib Efficacy, Safety, Progression Patterns, and Resistance Mechanisms in Patients with Non-Small Cell Lung Cancer Carrying Uncommon EGFR Mutations: A Comparative Cohort Study in China (AFANDA Study). Cancers (Basel). 2022; 14 (21). PubMed Abstract | Publisher Full Text | Free Full Text 7. Shaikh M, Shinde Y, Pawara R, et al. : Emerging Approaches to Overcome Acquired Drug Resistance Obstacles to Osimertinib in Non-Small-Cell Lung Cancer. J. Med. Chem. 2022; 65 (2): 1008–1046. PubMed Abstract | Publisher Full Text 8. Alam M, Hasan GM, Eldin SM, et al. : Investigating regulated signalling pathways in therapeutic targeting of non-small cell lung carcinoma. Biomed. Pharmacother. 2023; 161 (March): 114452. Publisher Full Text 9. Bahar ME, Kim HJ, Kim DR: Targeting the RAS/RAF/MAPK pathway for cancer therapy: from mechanism to clinical studies. Signal Transduct. Target. Ther. 2023; 8 (1): 455. PubMed Abstract | Publisher Full Text | Free Full Text 10. Leonetti A, Sharma S, Minari R, et al. : Resistance mechanisms to osimertinib in EGFR-mutated non-small cell lung cancer. Br. J. Cancer. 2019; 121 (9): 725–737. PubMed Abstract | Publisher Full Text | Free Full Text 11. To C, Beyett TS, Jang J, et al. : An allosteric inhibitor against the therapy-resistant mutant forms of EGFR in non-small cell lung cancer. Nat. Can. 2022; 3 (4): 402–417. 12. Maity S, Pai KSR, Nayak Y: Advances in targeting EGFR allosteric site as anti-NSCLC therapy to overcome the drug resistance. Pharmacol. Rep. 2020; 72 (4): 799–813. PubMed Abstract | Publisher Full Text | Free Full Text 13. Maity S, Baby K, Bharath HB, et al. : Targeting EGFR Allosteric Site - An In Silico, in vitro and in vivo Drug Repurposing Study for Treating Non-Small Cell Lung Cancer.2024. Publisher Full Text Reference Source 14. Ghasemi M, Turnbull T, Sebastian S, et al. : The mtt assay: Utility, limitations, pitfalls, and interpretation in bulk and single-cell analysis. Int. J. Mol. Sci. 2021; 22 (23). PubMed Abstract | Publisher Full Text | Free Full Text 15. Riss TL, Moravec RA, Niles AL, et al. : Cell Viability Assays. Assay Guidance Manual. Bethesda (MD): Eli Lilly & Company and the National Center for Advancing Translational Sciences; 2004. 2013 May 1 [updated 2016 Jul 1]; pp: 1–25. Bookshelf ID: NBK144065. PubMed Abstract 16. Lakshmanan I, Batra SK: Protocol for Apoptosis Assay by Flow Cytometry Using Annexin V Staining Method. Bio Protoc. 2013; 3 (6): e374. Publisher Full Text 17. Siddiqui S, Livák F: Principles of Advanced Flow Cytometry: A Practical Guide. Methods Mol. Biol. 2023; 2580 : 89–114. PubMed Abstract | Publisher Full Text | Free Full Text 18. Li J, Wang R, Hu X, et al. : Activated MEK/ERK Pathway Drives Widespread and Coordinated Overexpression of UHRF1 and DNMT1 in Cancer cells. Sci. Rep. 2019; 9 (1): 1–15. 19. Orue A, Rieber M: Optimized multiplex detection of 7 KRAS Mutations by Taqman Allele-SpecificqPCR. PLoS One. 2016; 11 (9): 1–13. Publisher Full Text 20. Zhao C, Li Y, Qiu W, et al. : C5a induces A549 cell proliferation of non-small cell lung cancer via GDF15 gene activation mediated by GCN5-dependent KLF5 acetylation. Oncogene. 2018; 37 (35): 4821–4837. PubMed Abstract | Publisher Full Text | Free Full Text 21. Ding H, Wang J, Jia FP, et al. : Research on the A549 cell apoptosis mechanism of the nude mouse model using MenSC-sTRAIL. Eur. Rev. Med. Pharmacol. Sci. 2017; 21 (14): 3218–3222. PubMed Abstract 22. Zavrakidis I, Jóźwiak K, Hauptmann M: Statistical analysis of longitudinal data on tumour growth in mice experiments. Sci. Rep. 2020; 10 (1): 1–11. 23. Ponder KG, Boise LH: The prodomain of caspase-3 regulates its own removal and caspase activation. Cell Death Dis. 2019; 5 (1): 1–10. 24. Wiesner R, Scheller C, Krebs F, et al. : A comparative study of CE-SDS, SDS-PAGE, and Simple Western: Influences of sample preparation on molecular weight determination of proteins. Electrophoresis. 2021; 42 (3): 206–218. PubMed Abstract | Publisher Full Text 25. Cooper JR, Abdullatif MB, Burnett EC, et al. : Long term culture of the a549 cancer cell line promotes multilamellar body formation and differentiation towards an alveolar type II Pneumocyte phenotype. PLoS One. 2016; 11 (10): 1–20. Publisher Full Text 26. O’Leary C, Gasper H, Sahin KB, et al. : Epidermal growth factor receptor (EGFR)-mutated non-small-cell lung cancer (NSCLC). Pharmaceuticals. 2020; 13 (10): 1–16. Publisher Full Text 27. To C, Jang J, Chen T, et al. : Single and dual targeting of mutant EGFR with an allosteric inhibitor. Cancer Discov. 2019; 9 : 926–943. PubMed Abstract | Publisher Full Text | Free Full Text 28. Wittlinger F, Ogboo BC, Shevchenko E, et al. : Linking ATP and allosteric sites to achieve superadditive binding with bivalent EGFR kinase inhibitors. Commun. Chem. 2024; 7 (1): 38. PubMed Abstract | Publisher Full Text | Free Full Text 29. Parums DV: Current status of targeted therapy in non-small cell lung cancer. Drugs Today (Barc.). 2014 Jul; 50 (7): 503–525. Publisher Full Text 30. Karthik Rao N, Patil N, Avinash A, et al. : Acenocoumarol or warfarin: Which is the clinician’s ally? Asian J. Pharm. Clin. Res. 2016; 9 (2): 4–5. 31. Roehrborn CG, Cruz F, Fusco F: α1-Blockers in Men with Lower Urinary Tract Symptoms Suggestive of Benign Prostatic Obstruction: Is Silodosin Different? Adv. Ther. 2017; 33 (12): 2110–2121. PubMed Abstract 32. Kasperkiewicz K, Ponczek MB, Owczarek J, et al. : and New Synthetic and Natural Coumarin Derivatives. Molecules. 2020; 25 : 1–24. Publisher Full Text 33. Verhoef TI, Redekop WK, Daly AK, et al. : Pharmacogenetic-guided dosing of coumarin anticoagulants: Algorithms for warfarin, acenocoumarol and phenprocoumon. Br. J. Clin. Pharmacol. 2014; 77 (4): 626–641. PubMed Abstract | Publisher Full Text | Free Full Text 34. Han H, Hyun C: Acenocoumarol, an Anticoagulant Drug, Prevents Melanogenesis in B16F10 Melanoma Cells. Pharmaceuticals. 2023; 16 (4). PubMed Abstract | Publisher Full Text | Free Full Text 35. Kawahara T, Ide H, Kashiwagi E, et al. : Silodosin inhibits the growth of bladder cancer cells and enhances the cytotoxic activity of cisplatin via ELK1 inactivation. Am. J. Cancer Res. 2015; 5 (10): 2959–2968. PubMed Abstract 36. Jindan L, Xiao W, Liping X: Evolving Role of Silodosin for the Treatment of Urological Disorders – A Narrative Review. Drug Des. Devel. Ther. 2022; 16 : 2861–2884. PubMed Abstract | Publisher Full Text | Free Full Text 37. Besnard A, Galan-Rodriguez B, Vanhoutte P, et al. : Elk-1 a transcription factor with multiple facets in the brain. Front. Neurosci. 2011; 5 : 1–11. 38. Vishnuvardhan C, Saibaba B, Allakonda L, et al. : LC–ESI–MS/MS evaluation of forced degradation behaviour of silodosin: in vitro anti cancer activity evaluation of silodosin and major degradation products. J. Pharm. Biomed. Anal. 2017; 134 : 1–10. PubMed Abstract | Publisher Full Text 39. Gupta K, Jones JC, Farias VDA, et al. : Identification of Synergistic Drug Combinations to Target KRAS-Driven Chemoradioresistant Cancers Utilizing Tumoroid Models of Colorectal Adenocarcinoma and Recurrent Glioblastoma. Front. Oncol. 2022; 12 . PubMed Abstract | Publisher Full Text | Free Full Text 40. Liang Y, Zhang T, Jing S, et al. : 20(S)-Ginsenoside Rg3 Inhibits Lung Cancer Cell Proliferation by Targeting EGFR-Mediated Ras/Raf/MEK/ERK Pathway. Am. J. Chin. Med. 2021; 49 (3): 753–765. PubMed Abstract | Publisher Full Text Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 21 Nov 2024 ADD YOUR COMMENT Comment Author details Author details 1 Department of Pharmacology, Manipal College of Pharmaceutical Sciences, Manipal Academy of Higher Education, Manipal, Karnataka, 576104, India 2 Department of Pharmaceutics, Manipal College of Pharmaceutical Sciences, Manipal Academy of Higher Education, Manipal, Karnataka, 576104, India Swastika Maity Roles: Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, Project Administration, Writing – Original Draft Preparation Krishnaprasad Baby Roles: Formal Analysis, Methodology, Validation Bharath Harohalli Byregowda Roles: Formal Analysis, Methodology, Writing – Review & Editing Megh Pravin Vithalkar Roles: Formal Analysis, Methodology, Visualization Usha Y Nayak Roles: Resources, Supervision, Validation K Sreedhara Ranganath Pai Roles: Conceptualization, Supervision, Validation Yogendra Nayak Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Methodology, Supervision, Writing – Review & Editing Competing interests No competing interests were disclosed. Grant information Swastika Maity received an ICMR Senior Research Fellowship (ICMR-SRF #45/33/2019/PHA/BMS). The authors are thankful to the Department of Pharmaceutics, Manipal College of Pharmaceutical Sciences, for facilitating the computer simulations. Schrodinger's Software and Computers were procured under a grant from DST-SERB, New Delhi, to Usha YN (EMR/2016/007006). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Article Versions (2) version 2 Revised Published: 23 Sep 2025, 13:1398 https://doi.org/10.12688/f1000research.157465.2 version 1 Published: 21 Nov 2024, 13:1398 https://doi.org/10.12688/f1000research.157465.1 Copyright © 2024 Maity S et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Maity S, Baby K, Byregowda BH et al. Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung cancer [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2024, 13 :1398 ( https://doi.org/10.12688/f1000research.157465.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 1 VERSION 1 PUBLISHED 21 Nov 2024 Views 0 Cite How to cite this report: Shivamallu C. Reviewer Report For: Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung cancer [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2024, 13 :1398 ( https://doi.org/10.5256/f1000research.172916.r347134 ) The direct URL for this report is: https://f1000research.com/articles/13-1398/v1#referee-response-347134 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 03 Jan 2025 Chandan Shivamallu , Department of Biotechnology and Bioinformatics, JSS Academy of Higher Education and Research, Mysuru, India Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.172916.r347134 This manuscript presents an innovative approach to repurpose acenocoumarol and silodosin as allosteric inhibitors targeting EGFR for non-small-cell lung cancer (NSCLC). The combination of computational tools, in vitro analyses, and in vivo xenograft studies offers a vigorous frame for evaluating ... Continue reading READ ALL This manuscript presents an innovative approach to repurpose acenocoumarol and silodosin as allosteric inhibitors targeting EGFR for non-small-cell lung cancer (NSCLC). The combination of computational tools, in vitro analyses, and in vivo xenograft studies offers a vigorous frame for evaluating the potential of these drugs in a therapeutic context. The repurposing of clinically approved drugs as EGFR allosteric inhibitors provides a promising pathway to overcome drug resistance in NSCLC. This approach leverages known safety profiles, accelerating clinical translation. For this, the comprehensive methodology applied such as in silico, in vitro and in vivo is commendable. The molecular docking and dynamic studies are detailed and provide strong evidence of binding affinity for the EGFR allosteric site. Cytotoxicity, apoptosis, cell cycle arrest, and gene expression studies are systematically performed, showcasing the drugs’ mechanisms of action. The inclusion of tumor regression and histopathological analysis strengthens the translational relevance of the findings. The significant findings include both acenocoumarol and silodosin demonstrated effective inhibition of KRAS and ERK2, key players in EGFR signaling. The observed upregulation of caspase-3 and tumor growth inhibition validates the anti-NSCLC activity of these drugs. Further, the manuscript adheres to ethical guidelines, and all experimental procedures are well-documented, reflecting the integrity of the research. The findings in this work warrant publishing of this manuscript, however few suggestions for improvement are 1) While the data are extensive, certain figures and tables lack concise labeling and clarity, which could hinder understanding for readers who are unfamiliar with the subject. 2) In the discussion part, readers could benefit from a more detailed comparison with existing EGFR inhibitors, emphasizing the advantages of acenocoumarol and silodosin in terms of efficacy, selectivity, and safety. 3) Although the study concludes with a call for clinical trials, the discussion could elaborate on the specific challenges, such as pharmacokinetics and potential side effects, that need addressing for these drugs. 4) Minor grammatical inconsistencies and redundancies could be refined to enhance the readability and professionalism of the manuscript. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Microbiology, Cancer Biology, Computational Biology I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Shivamallu C. Reviewer Report For: Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung cancer [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2024, 13 :1398 ( https://doi.org/10.5256/f1000research.172916.r347134 ) The direct URL for this report is: https://f1000research.com/articles/13-1398/v1#referee-response-347134 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 23 Sep 2025 Yogendra Nayak , Department of Pharmacology, Manipal College of Pharmaceutical Sciences, Manipal Academy of Higher Education, Manipal, 576104, India 23 Sep 2025 Author Response We thank the reviewer for the encouraging and insightful comments. The following revisions have been made based on the suggestions: Figures and Tables : All figures have been relabeled ... Continue reading We thank the reviewer for the encouraging and insightful comments. The following revisions have been made based on the suggestions: Figures and Tables : All figures have been relabeled for clarity. Figure legends are now more detailed, and axis labels/treatments are standardized. Comparison with existing EGFR inhibitors : A paragraph comparing our findings with allosteric inhibitors like EAI045 and JBJ-09-063 has been added to the discussion. Discussion on clinical translation : We now include a note on challenges related to pharmacokinetics, metabolism, and dosage limitations of repurposed drugs, particularly acenocoumarol (bleeding risk) and silodosin (hypotension). Language revision : The manuscript has undergone thorough proofreading to remove redundancies and grammatical inconsistencies. We thank the reviewer for the encouraging and insightful comments. The following revisions have been made based on the suggestions: Figures and Tables : All figures have been relabeled for clarity. Figure legends are now more detailed, and axis labels/treatments are standardized. Comparison with existing EGFR inhibitors : A paragraph comparing our findings with allosteric inhibitors like EAI045 and JBJ-09-063 has been added to the discussion. Discussion on clinical translation : We now include a note on challenges related to pharmacokinetics, metabolism, and dosage limitations of repurposed drugs, particularly acenocoumarol (bleeding risk) and silodosin (hypotension). Language revision : The manuscript has undergone thorough proofreading to remove redundancies and grammatical inconsistencies. Competing Interests: Authors declare that there is no Financial and Non-Financial Competing Interest in publishing this manuscript. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 23 Sep 2025 Yogendra Nayak , Department of Pharmacology, Manipal College of Pharmaceutical Sciences, Manipal Academy of Higher Education, Manipal, 576104, India 23 Sep 2025 Author Response We thank the reviewer for the encouraging and insightful comments. The following revisions have been made based on the suggestions: Figures and Tables : All figures have been relabeled ... Continue reading We thank the reviewer for the encouraging and insightful comments. The following revisions have been made based on the suggestions: Figures and Tables : All figures have been relabeled for clarity. Figure legends are now more detailed, and axis labels/treatments are standardized. Comparison with existing EGFR inhibitors : A paragraph comparing our findings with allosteric inhibitors like EAI045 and JBJ-09-063 has been added to the discussion. Discussion on clinical translation : We now include a note on challenges related to pharmacokinetics, metabolism, and dosage limitations of repurposed drugs, particularly acenocoumarol (bleeding risk) and silodosin (hypotension). Language revision : The manuscript has undergone thorough proofreading to remove redundancies and grammatical inconsistencies. We thank the reviewer for the encouraging and insightful comments. The following revisions have been made based on the suggestions: Figures and Tables : All figures have been relabeled for clarity. Figure legends are now more detailed, and axis labels/treatments are standardized. Comparison with existing EGFR inhibitors : A paragraph comparing our findings with allosteric inhibitors like EAI045 and JBJ-09-063 has been added to the discussion. Discussion on clinical translation : We now include a note on challenges related to pharmacokinetics, metabolism, and dosage limitations of repurposed drugs, particularly acenocoumarol (bleeding risk) and silodosin (hypotension). Language revision : The manuscript has undergone thorough proofreading to remove redundancies and grammatical inconsistencies. Competing Interests: Authors declare that there is no Financial and Non-Financial Competing Interest in publishing this manuscript. Close Report a concern COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Beyett T. Reviewer Report For: Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung cancer [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2024, 13 :1398 ( https://doi.org/10.5256/f1000research.172916.r343035 ) The direct URL for this report is: https://f1000research.com/articles/13-1398/v1#referee-response-343035 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 03 Dec 2024 Tyler Beyett , Department of Pharmacology and Chemical Biology, Emory University School of Medicine, Atlanta, USA Not Approved VIEWS 0 https://doi.org/10.5256/f1000research.172916.r343035 In this article, Maity et al. explore the effects of acenocoumarol and silodosin treatment on primarily on A549 cells. They show that high doses of either molecule induce apoptosis in cell culture and have a slight, but significant, effect in ... Continue reading READ ALL In this article, Maity et al. explore the effects of acenocoumarol and silodosin treatment on primarily on A549 cells. They show that high doses of either molecule induce apoptosis in cell culture and have a slight, but significant, effect in xenograft models. Overall, I have major concerns about the interpretation of the results. While I believe the data showing that these molecules are cytotoxic, I am not convinced that it is through inhibition of EGFR. Specific major points: My biggest concern with this manuscript is the multiple references to these molecules as allosteric EGFR inhibitors. For example, in the manuscript title and the last sentence of the discussion. No data are presented in this study showing inhibition of EGFR by acenocoumarol or silodosin. There are also no data showing that they work through an allosteric mechanism of action. No allosteric inhibition data are provided in the reference prior work (reference 13) either. This reference only describes docking of the molecules and is lacking controls/reference molecules such as known allosteric EGFR inhibitors like EAI045 and JBJ-09-063. Docking is only a prediction that still requires experimental validation (protein-ligand binding analysis, biochemical kinase inhibition assay, cellular inhibition by phospho-EGFR western blot, etc.). Confirming an allosteric mechanism of action requires a crystal structure or enzymatic inhibition assays with varying ATP concentrations. For these reasons, the multiple claims that these molecules are allosteric EGFR inhibitors cannot be made, and this study must be presented/worded differently as a result. Related to the previous point, since inhibition of EGFR has not been shown, it cannot be assumed that the cytotoxic effects observed are related to EGFR. Performing a target engagement assay would aid in showing the effects are on target rather than working through another mechanism/pathway to induce apoptosis. Many compounds will induce cell death. Throughout the manuscript, critical details about experimental replicate (n) number are missing. The number of biological and technical replicates must be noted for all experiments. This is especially important since SEM is being reported, which is affected by n. Throughout the manuscript, relevant controls including known EGFR inhibitors, ATP-competitive and allosteric, are missing. Cisplatin is not the standard of care for the vast majority of EGFR-driven cancers and thus is not an ideal reference compound. As A549 cells are do not express mutant EGFR (they overexpress wild-type EGFR), a pan-EGFR inhibitor like afatinib is an ideal positive control. In the MTT cytotoxicity assay it is difficult to see where the IC50s are being derived from for some molecules. IC50 is defined as the inflection point of a sigmoidal curve, but many of these curves do not have such a point and do not appear to encompass enough of the dose-response curve to accurately report an IC50. Inclusion of EGFR inhibitors as controls, especially allosteric inhibitors, is needed for a frame of reference since IC50s are condition dependent. Additionally, it is not clear why acenocoumarol and silodosin were chosen. It is claimed that “From the cytotoxicity results, we selected the best drugs, acenocoumarol and silodosin, for further testing.” These molecules were not consistently more potent than the others. What wasn’t danusertib selected? It is most potent against the cancer cell line and least potent against the healthy cell line, which is typically the desired profile of a targeted therapy. The section titled “KRAS and ERK2 enzymatic inhibition by acenocoumarol and silodosin” is misleading as no inhibition data are presented. That section only provides data on total protein levels. Furthermore, it appears as if this experiment was only performed once. Given the potential for bias in quantifying western blot bands by densitometry, especially weak bands, this experiment must be performed multiple times and error bars reported. Related to the previous point, in the discussion it is stated that “Enzymes ERK2 and KRAS significantly inhibited enzymatic activity upon administration of silodosin” and “suppressing the signal transduction cascade.” This and related statements need to be removed, as enzymatic activity and signal transduction of ERK2 (typically assessed by phospho-ERK blotting) or activation of RAS (assaying for GTP bound state or GTPase activity) are not assessed. Furthermore, the use of “significantly” is inappropriate given that no statistical analyses were performed in the relevant figures 7 and 8. Information on the statistical tests used in Figures 9, 10, and 11 are missing. The related figures 7 and 8 do not make sense. For example, 12.5 uM silodosin greatly decreases expression, but the protein levels are not dramatically decreased. Similarly, for 25 uM acenocoumarol, expression is decreased for ERK2, but the protein level is normal. In the same group, KRAS expression is comparable to the controls, but protein levels are greatly increased. What is the explanation for this disconnect? In figure 9, are statistical tests only performed for the last treatment point (day 21)? If so, this must be stated. Other time points are likely significant if also considered. In the figure legend, I hope that p<0.5 is a typo meant to be p<0.05. The former significance cutoff is not stringent enough. In figure 11, what are the statistical significances for? And what statistical test was employed? Are you saying that all of the organs from a treatment group are significantly different than their corresponding values in the vehicle group? What about comparisons between treatment groups? Such analyses may require a multiple comparisons post hoc correction be used in the statistical analysis. Numerous typos throughout including, but not limited to, T750M and L858M (page 3). There are also red underlines in the text for figure 14 that should be removed. Antibodies used in western blots must be noted with their source and catalog number since they can vary widely. Source data should include the individual replicates for each experiment in addition to just the mean ± SEM Is the work clearly and accurately presented and does it cite the current literature? Partly Is the study design appropriate and is the work technically sound? No Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? No Are all the source data underlying the results available to ensure full reproducibility? Partly Are the conclusions drawn adequately supported by the results? No Competing Interests: No competing interests were disclosed. Reviewer Expertise: EGFR pharmacology including allosteric inhibitor discovery and development I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Beyett T. Reviewer Report For: Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung cancer [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2024, 13 :1398 ( https://doi.org/10.5256/f1000research.172916.r343035 ) The direct URL for this report is: https://f1000research.com/articles/13-1398/v1#referee-response-343035 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 23 Sep 2025 Yogendra Nayak , Department of Pharmacology, Manipal College of Pharmaceutical Sciences, Manipal Academy of Higher Education, Manipal, 576104, India 23 Sep 2025 Author Response Major Comment 1: Claim of allosteric EGFR inhibition without experimental validation. Response: We sincerely acknowledge this concern. The claim that acenocoumarol and silodosin are allosteric EGFR inhibitors was primarily based ... Continue reading Major Comment 1: Claim of allosteric EGFR inhibition without experimental validation. Response: We sincerely acknowledge this concern. The claim that acenocoumarol and silodosin are allosteric EGFR inhibitors was primarily based on in silico docking studies and prior literature suggesting possible interaction with the allosteric site. However, we recognize that docking studies alone do not suffice to label them as "allosteric inhibitors." We have accordingly: Revised the manuscript title, abstract, conclusion, and discussion to reflect a more evidence-aligned interpretation of the findings. The drugs are now presented as repurposed candidates with predicted interactions at EGFR-associated signaling levels, based on computational docking and preclinical evaluation. The title has been changed to: “ Exploring acenocoumarol and silodosin in non-small cell lung cancer: Insights into EGFR-linked signaling mechanisms ”. This updated title avoids asserting mechanistic inhibition, emphasizes pathway-level relevance, and accurately reflects the scope and limitations of the study. Removed definitive language such as "allosteric inhibitor" and replaced it with "computationally predicted to bind to allosteric sites of EGFR." Cited the lack of direct evidence as a limitation and proposed further biochemical studies (e.g., kinase assays, phospho-EGFR western blots) in the future. Major Comment 2: No direct evidence that cytotoxicity is related to EGFR inhibition. Response: We agree. While we observed apoptosis and downregulation of KRAS and ERK2 components downstream of EGFR signaling, our current dataset does not establish a causal link between drug activity and EGFR inhibition. We have removed statements that imply a direct mechanistic link and instead suggest that the observed effects may be associated with EGFR signaling pathways, pending further validation. This clarification is incorporated into the discussion. Major Comment 3: Missing replicate (n) numbers and statistical clarity. Response: We apologize for the oversight. The manuscript has been revised to: Explicitly mention the number of biological replicates (n=3) for in vitro studies and n=4 mice per group for xenograft experiments. Clearly indicate technical duplicates where applicable. Ensure all SEM values are tied to biological replicates, not technical ones. Major Comment 4: Use of inappropriate controls in EGFR assays. Response: We acknowledge the point regarding the use of cisplatin instead of a known EGFR inhibitor. Our intention was to benchmark general anticancer activity rather than EGFR-specific inhibition, given the exploratory nature of this study. This rationale is now mentioned in the Methods and Limitations sections. We agree that future studies must incorporate controls like afatinib or osimertinib to provide a valid comparative frame. Major Comment 5: Concerns with IC50 calculations and molecule selection. Response: The IC50 values were calculated using nonlinear regression via GraphPad Prism. While sigmoidal fitting may not be ideal for all curves due to cell line-specific response variability, the curve fitting and R² values are considered. Regarding molecule selection, danusertib was excluded from further testing due to known off-target cytotoxicity and poor pharmacokinetic properties in pilot studies, though it showed high potency. This is now clarified in the Results section. Major Comment 6: Mislabeling of Western blot data as enzyme inhibition. Response: We regret the terminology used. The sections titled “enzymatic inhibition” now read “protein expression levels” via Western blot. No enzymatic activity assay was performed. All conclusions based on these blots have been modified accordingly to describe expression rather than inhibition. Major Comment 7: Inaccurate claims of signaling pathway inhibition. Response: We have removed all claims of direct inhibition of KRAS and ERK2 enzymatic activity or pathway signaling. All references to "significant inhibition" have been qualified to reflect expression changes , not enzyme activity or pathway suppression, and we note the need for phospho-ERK or GTP-RAS assays in future studies. Major Comment 8: Incomplete statistical test descriptions. Response: Statistical tests have now been specified as ANOVA with Tukey’s post hoc test or unpaired t-test , as appropriate. Significance values and p-values have been revised throughout the figure legends. The p<0.5 error has been corrected to p<0.05 . Major Comment 9: Disconnect between mRNA and protein levels. Response: This is a valid observation. We have acknowledged in the discussion that post-transcriptional or translational regulation may cause such discrepancies, and that one-time point assessments without time-course validation may limit interpretability. These are now added to the limitations. Major Comment 10: Clarification in Figures 9–11 and statistical interpretations. Response: Clarifications have been added regarding Statistical tests in tumor volume measurements (Figure 9), Significance at multiple time points (but analyzed at day 21), The error in p-value notation has been corrected. Organ weight data (Figure 11) now includes the statistical method and indicates whether post hoc corrections were applied. Minor Comments (combined response): All antibody sources and catalog numbers have now been added to the Methods section. Typos including T750M/L858M (corrected to T790M/L858R) have been fixed. All red underlines and formatting errors in figures have been corrected. Raw data files now include individual replicates and are available on Figshare [ https://doi.org/10.6084/m9.figshare.24587592.v5 ]. Major Comment 1: Claim of allosteric EGFR inhibition without experimental validation. Response: We sincerely acknowledge this concern. The claim that acenocoumarol and silodosin are allosteric EGFR inhibitors was primarily based on in silico docking studies and prior literature suggesting possible interaction with the allosteric site. However, we recognize that docking studies alone do not suffice to label them as "allosteric inhibitors." We have accordingly: Revised the manuscript title, abstract, conclusion, and discussion to reflect a more evidence-aligned interpretation of the findings. The drugs are now presented as repurposed candidates with predicted interactions at EGFR-associated signaling levels, based on computational docking and preclinical evaluation. The title has been changed to: “ Exploring acenocoumarol and silodosin in non-small cell lung cancer: Insights into EGFR-linked signaling mechanisms ”. This updated title avoids asserting mechanistic inhibition, emphasizes pathway-level relevance, and accurately reflects the scope and limitations of the study. Removed definitive language such as "allosteric inhibitor" and replaced it with "computationally predicted to bind to allosteric sites of EGFR." Cited the lack of direct evidence as a limitation and proposed further biochemical studies (e.g., kinase assays, phospho-EGFR western blots) in the future. Major Comment 2: No direct evidence that cytotoxicity is related to EGFR inhibition. Response: We agree. While we observed apoptosis and downregulation of KRAS and ERK2 components downstream of EGFR signaling, our current dataset does not establish a causal link between drug activity and EGFR inhibition. We have removed statements that imply a direct mechanistic link and instead suggest that the observed effects may be associated with EGFR signaling pathways, pending further validation. This clarification is incorporated into the discussion. Major Comment 3: Missing replicate (n) numbers and statistical clarity. Response: We apologize for the oversight. The manuscript has been revised to: Explicitly mention the number of biological replicates (n=3) for in vitro studies and n=4 mice per group for xenograft experiments. Clearly indicate technical duplicates where applicable. Ensure all SEM values are tied to biological replicates, not technical ones. Major Comment 4: Use of inappropriate controls in EGFR assays. Response: We acknowledge the point regarding the use of cisplatin instead of a known EGFR inhibitor. Our intention was to benchmark general anticancer activity rather than EGFR-specific inhibition, given the exploratory nature of this study. This rationale is now mentioned in the Methods and Limitations sections. We agree that future studies must incorporate controls like afatinib or osimertinib to provide a valid comparative frame. Major Comment 5: Concerns with IC50 calculations and molecule selection. Response: The IC50 values were calculated using nonlinear regression via GraphPad Prism. While sigmoidal fitting may not be ideal for all curves due to cell line-specific response variability, the curve fitting and R² values are considered. Regarding molecule selection, danusertib was excluded from further testing due to known off-target cytotoxicity and poor pharmacokinetic properties in pilot studies, though it showed high potency. This is now clarified in the Results section. Major Comment 6: Mislabeling of Western blot data as enzyme inhibition. Response: We regret the terminology used. The sections titled “enzymatic inhibition” now read “protein expression levels” via Western blot. No enzymatic activity assay was performed. All conclusions based on these blots have been modified accordingly to describe expression rather than inhibition. Major Comment 7: Inaccurate claims of signaling pathway inhibition. Response: We have removed all claims of direct inhibition of KRAS and ERK2 enzymatic activity or pathway signaling. All references to "significant inhibition" have been qualified to reflect expression changes , not enzyme activity or pathway suppression, and we note the need for phospho-ERK or GTP-RAS assays in future studies. Major Comment 8: Incomplete statistical test descriptions. Response: Statistical tests have now been specified as ANOVA with Tukey’s post hoc test or unpaired t-test , as appropriate. Significance values and p-values have been revised throughout the figure legends. The p<0.5 error has been corrected to p<0.05 . Major Comment 9: Disconnect between mRNA and protein levels. Response: This is a valid observation. We have acknowledged in the discussion that post-transcriptional or translational regulation may cause such discrepancies, and that one-time point assessments without time-course validation may limit interpretability. These are now added to the limitations. Major Comment 10: Clarification in Figures 9–11 and statistical interpretations. Response: Clarifications have been added regarding Statistical tests in tumor volume measurements (Figure 9), Significance at multiple time points (but analyzed at day 21), The error in p-value notation has been corrected. Organ weight data (Figure 11) now includes the statistical method and indicates whether post hoc corrections were applied. Minor Comments (combined response): All antibody sources and catalog numbers have now been added to the Methods section. Typos including T750M/L858M (corrected to T790M/L858R) have been fixed. All red underlines and formatting errors in figures have been corrected. Raw data files now include individual replicates and are available on Figshare [ https://doi.org/10.6084/m9.figshare.24587592.v5 ]. Competing Interests: Authors declare that there is no Financial and Non-Financial Competing Interest in publishing this manuscript Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 23 Sep 2025 Yogendra Nayak , Department of Pharmacology, Manipal College of Pharmaceutical Sciences, Manipal Academy of Higher Education, Manipal, 576104, India 23 Sep 2025 Author Response Major Comment 1: Claim of allosteric EGFR inhibition without experimental validation. Response: We sincerely acknowledge this concern. The claim that acenocoumarol and silodosin are allosteric EGFR inhibitors was primarily based ... Continue reading Major Comment 1: Claim of allosteric EGFR inhibition without experimental validation. Response: We sincerely acknowledge this concern. The claim that acenocoumarol and silodosin are allosteric EGFR inhibitors was primarily based on in silico docking studies and prior literature suggesting possible interaction with the allosteric site. However, we recognize that docking studies alone do not suffice to label them as "allosteric inhibitors." We have accordingly: Revised the manuscript title, abstract, conclusion, and discussion to reflect a more evidence-aligned interpretation of the findings. The drugs are now presented as repurposed candidates with predicted interactions at EGFR-associated signaling levels, based on computational docking and preclinical evaluation. The title has been changed to: “ Exploring acenocoumarol and silodosin in non-small cell lung cancer: Insights into EGFR-linked signaling mechanisms ”. This updated title avoids asserting mechanistic inhibition, emphasizes pathway-level relevance, and accurately reflects the scope and limitations of the study. Removed definitive language such as "allosteric inhibitor" and replaced it with "computationally predicted to bind to allosteric sites of EGFR." Cited the lack of direct evidence as a limitation and proposed further biochemical studies (e.g., kinase assays, phospho-EGFR western blots) in the future. Major Comment 2: No direct evidence that cytotoxicity is related to EGFR inhibition. Response: We agree. While we observed apoptosis and downregulation of KRAS and ERK2 components downstream of EGFR signaling, our current dataset does not establish a causal link between drug activity and EGFR inhibition. We have removed statements that imply a direct mechanistic link and instead suggest that the observed effects may be associated with EGFR signaling pathways, pending further validation. This clarification is incorporated into the discussion. Major Comment 3: Missing replicate (n) numbers and statistical clarity. Response: We apologize for the oversight. The manuscript has been revised to: Explicitly mention the number of biological replicates (n=3) for in vitro studies and n=4 mice per group for xenograft experiments. Clearly indicate technical duplicates where applicable. Ensure all SEM values are tied to biological replicates, not technical ones. Major Comment 4: Use of inappropriate controls in EGFR assays. Response: We acknowledge the point regarding the use of cisplatin instead of a known EGFR inhibitor. Our intention was to benchmark general anticancer activity rather than EGFR-specific inhibition, given the exploratory nature of this study. This rationale is now mentioned in the Methods and Limitations sections. We agree that future studies must incorporate controls like afatinib or osimertinib to provide a valid comparative frame. Major Comment 5: Concerns with IC50 calculations and molecule selection. Response: The IC50 values were calculated using nonlinear regression via GraphPad Prism. While sigmoidal fitting may not be ideal for all curves due to cell line-specific response variability, the curve fitting and R² values are considered. Regarding molecule selection, danusertib was excluded from further testing due to known off-target cytotoxicity and poor pharmacokinetic properties in pilot studies, though it showed high potency. This is now clarified in the Results section. Major Comment 6: Mislabeling of Western blot data as enzyme inhibition. Response: We regret the terminology used. The sections titled “enzymatic inhibition” now read “protein expression levels” via Western blot. No enzymatic activity assay was performed. All conclusions based on these blots have been modified accordingly to describe expression rather than inhibition. Major Comment 7: Inaccurate claims of signaling pathway inhibition. Response: We have removed all claims of direct inhibition of KRAS and ERK2 enzymatic activity or pathway signaling. All references to "significant inhibition" have been qualified to reflect expression changes , not enzyme activity or pathway suppression, and we note the need for phospho-ERK or GTP-RAS assays in future studies. Major Comment 8: Incomplete statistical test descriptions. Response: Statistical tests have now been specified as ANOVA with Tukey’s post hoc test or unpaired t-test , as appropriate. Significance values and p-values have been revised throughout the figure legends. The p<0.5 error has been corrected to p<0.05 . Major Comment 9: Disconnect between mRNA and protein levels. Response: This is a valid observation. We have acknowledged in the discussion that post-transcriptional or translational regulation may cause such discrepancies, and that one-time point assessments without time-course validation may limit interpretability. These are now added to the limitations. Major Comment 10: Clarification in Figures 9–11 and statistical interpretations. Response: Clarifications have been added regarding Statistical tests in tumor volume measurements (Figure 9), Significance at multiple time points (but analyzed at day 21), The error in p-value notation has been corrected. Organ weight data (Figure 11) now includes the statistical method and indicates whether post hoc corrections were applied. Minor Comments (combined response): All antibody sources and catalog numbers have now been added to the Methods section. Typos including T750M/L858M (corrected to T790M/L858R) have been fixed. All red underlines and formatting errors in figures have been corrected. Raw data files now include individual replicates and are available on Figshare [ https://doi.org/10.6084/m9.figshare.24587592.v5 ]. Major Comment 1: Claim of allosteric EGFR inhibition without experimental validation. Response: We sincerely acknowledge this concern. The claim that acenocoumarol and silodosin are allosteric EGFR inhibitors was primarily based on in silico docking studies and prior literature suggesting possible interaction with the allosteric site. However, we recognize that docking studies alone do not suffice to label them as "allosteric inhibitors." We have accordingly: Revised the manuscript title, abstract, conclusion, and discussion to reflect a more evidence-aligned interpretation of the findings. The drugs are now presented as repurposed candidates with predicted interactions at EGFR-associated signaling levels, based on computational docking and preclinical evaluation. The title has been changed to: “ Exploring acenocoumarol and silodosin in non-small cell lung cancer: Insights into EGFR-linked signaling mechanisms ”. This updated title avoids asserting mechanistic inhibition, emphasizes pathway-level relevance, and accurately reflects the scope and limitations of the study. Removed definitive language such as "allosteric inhibitor" and replaced it with "computationally predicted to bind to allosteric sites of EGFR." Cited the lack of direct evidence as a limitation and proposed further biochemical studies (e.g., kinase assays, phospho-EGFR western blots) in the future. Major Comment 2: No direct evidence that cytotoxicity is related to EGFR inhibition. Response: We agree. While we observed apoptosis and downregulation of KRAS and ERK2 components downstream of EGFR signaling, our current dataset does not establish a causal link between drug activity and EGFR inhibition. We have removed statements that imply a direct mechanistic link and instead suggest that the observed effects may be associated with EGFR signaling pathways, pending further validation. This clarification is incorporated into the discussion. Major Comment 3: Missing replicate (n) numbers and statistical clarity. Response: We apologize for the oversight. The manuscript has been revised to: Explicitly mention the number of biological replicates (n=3) for in vitro studies and n=4 mice per group for xenograft experiments. Clearly indicate technical duplicates where applicable. Ensure all SEM values are tied to biological replicates, not technical ones. Major Comment 4: Use of inappropriate controls in EGFR assays. Response: We acknowledge the point regarding the use of cisplatin instead of a known EGFR inhibitor. Our intention was to benchmark general anticancer activity rather than EGFR-specific inhibition, given the exploratory nature of this study. This rationale is now mentioned in the Methods and Limitations sections. We agree that future studies must incorporate controls like afatinib or osimertinib to provide a valid comparative frame. Major Comment 5: Concerns with IC50 calculations and molecule selection. Response: The IC50 values were calculated using nonlinear regression via GraphPad Prism. While sigmoidal fitting may not be ideal for all curves due to cell line-specific response variability, the curve fitting and R² values are considered. Regarding molecule selection, danusertib was excluded from further testing due to known off-target cytotoxicity and poor pharmacokinetic properties in pilot studies, though it showed high potency. This is now clarified in the Results section. Major Comment 6: Mislabeling of Western blot data as enzyme inhibition. Response: We regret the terminology used. The sections titled “enzymatic inhibition” now read “protein expression levels” via Western blot. No enzymatic activity assay was performed. All conclusions based on these blots have been modified accordingly to describe expression rather than inhibition. Major Comment 7: Inaccurate claims of signaling pathway inhibition. Response: We have removed all claims of direct inhibition of KRAS and ERK2 enzymatic activity or pathway signaling. All references to "significant inhibition" have been qualified to reflect expression changes , not enzyme activity or pathway suppression, and we note the need for phospho-ERK or GTP-RAS assays in future studies. Major Comment 8: Incomplete statistical test descriptions. Response: Statistical tests have now been specified as ANOVA with Tukey’s post hoc test or unpaired t-test , as appropriate. Significance values and p-values have been revised throughout the figure legends. The p<0.5 error has been corrected to p<0.05 . Major Comment 9: Disconnect between mRNA and protein levels. Response: This is a valid observation. We have acknowledged in the discussion that post-transcriptional or translational regulation may cause such discrepancies, and that one-time point assessments without time-course validation may limit interpretability. These are now added to the limitations. Major Comment 10: Clarification in Figures 9–11 and statistical interpretations. Response: Clarifications have been added regarding Statistical tests in tumor volume measurements (Figure 9), Significance at multiple time points (but analyzed at day 21), The error in p-value notation has been corrected. Organ weight data (Figure 11) now includes the statistical method and indicates whether post hoc corrections were applied. Minor Comments (combined response): All antibody sources and catalog numbers have now been added to the Methods section. Typos including T750M/L858M (corrected to T790M/L858R) have been fixed. All red underlines and formatting errors in figures have been corrected. Raw data files now include individual replicates and are available on Figshare [ https://doi.org/10.6084/m9.figshare.24587592.v5 ]. Competing Interests: Authors declare that there is no Financial and Non-Financial Competing Interest in publishing this manuscript Close Report a concern COMMENT ON THIS REPORT Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 21 Nov 2024 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 3 4 5 Version 2 (revision) 23 Sep 25 read read read Version 1 21 Nov 24 read read Tyler Beyett , Emory University School of Medicine, Atlanta, USA Chandan Shivamallu , JSS Academy of Higher Education and Research, Mysuru, India Jigna Samir Shah , Nirma University, Ahmedabad, India Navjot Kanwar , Maharaja Ranjit Singh Technical University, Bathinda, India Abhijeet Rajendra Joshi , Birla Institute of Technology and Sciences Pilani, Hyderabad, India Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Joshi A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 29 Dec 2025 | for Version 2 Abhijeet Rajendra Joshi , Birla Institute of Technology and Sciences Pilani, Hyderabad, Hyderabad, India 0 Views copyright © 2026 Joshi A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Citation #17 in the Western blot methods is not correct. The citation is for flow cytometry. Citation #25 for the histopathology is not correct. For the cytotoxicity assay in the results, the authors mention “Acenocoumarol and silodosin were more potent than panobinostat and danusatib.”. Without a proper statistical analysis, the statement is inappropriate. Fig 7: The blots for both GAPDH are same. They blot of GAPDH should be different for different proteins. Same for Fig 13. Also, there is no statistical test applied for the quantification. It is not appropriate to demonstrate the changes in the protein expression without proper statistics. Same for Fig 8. No statistical tests applied. Fig 10: There is some dot on the graph. Please rectify. Fig 11: The * values are not clear. Which organ is being compared here? Which difference is being shown by * and ** is not clear. Fig 14: What are the arrows pointing is not clear in the captions. Is the work clearly and accurately presented and does it cite the current literature? Partly Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Partly Competing Interests No competing interests were disclosed. Reviewer Expertise Neuroscience, Immunology I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Joshi AR. Peer Review Report For: Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung cancer [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2024, 13 :1398 ( https://doi.org/10.5256/f1000research.188258.r434404) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/13-1398/v2#referee-response-434404 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2025 Kanwar N. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 23 Dec 2025 | for Version 2 Navjot Kanwar , Maharaja Ranjit Singh Technical University, Bathinda, Punjab, India 0 Views copyright © 2025 Kanwar N. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The authors should update the abstract to exclude the repetitive references to EGF-linked signalling pathways, the same mechanism principle appears several times and reducing all of these into a single brief description improves clarity and readability. In the introduction, the authors must explain the limitations of existing EGFR inhibitors. The author had already discussed non-allosteric EGFR inhibitors (such as EAI001, EAI045, JNJ-09-063, or other fourth-generation inhibitors). The authors make scientific claims but don’t provide enough references to support these statements. The author must explain How previous inhibitors work, Type of mutation they target, Their potency Mechanism of action Limitations Must include relevant citations. 4. Although the authors defend the use of acenocoumarol and silodosin, this justification would be strengthened if more detailed docking metrics, such as docking scores, MM-GBSA energies, and comparative ranking among all screen compounds, were provided. 5. The rationale for selecting the specific in vitro concentrations (e.g., 25 and 50 μM for acenocoumarol, 12.5 and 25 μM for silodosin) and the in vivo doses (0.2 mg/kg acenocoumarol, 8mg/kg silodosin) could be explained more clearly. The author should indicate whether these exposures are within, above, or far beyond clinically achievable plasma concentration, and briefly explain how this impacts translational feasibility. 6. Since cisplatin was used as a general antitumour benchmark rather than an EGFR-specific control, the authors could add a short paragraph explaining how the relative magnitudes of tumour inhibition (cisplatin vs test drug) should be interpreted. 7.The manuscript currently lacks direct measurement of key signalling markers such as phosphor-EGFR, phosphor-ERK1/2 and active GTP-bound RAS. The authors must provide this in the limitations section and indicate that future work will incorporate phospho-protein assays (e.g., p-EGFR, p-ERK1/2), RAS GDP pulldown experiments or broader phosphor-proteomics to more definitively characterise pathway modulation. 8. There is a clear conflict between the qPCR or (mRNA) data and the corresponding protein levels for KRAS and ERK2. The authors should briefly discuss possible biological reasons for this mismatch and indicate that time-course studies for proteomic analysis would be required to resolve these differences. 9. The authors should briefly discuss potential roles of post-translational regulation, protein turnover, and feedback from upstream or parallel pathways (e.g., PI3K/AKT/MET/HER2) that could account for partial uncoupling of transcript and protein levels at a single time point. 10.The flow cytometry procedures are explained appropriately; however, the authors must include how they selected specific populations (e.g., FSC/SSC, singlet gating and final analysis gates) and adding those gating strategy images would enhance clarity and ensure reproducibility of apoptosis and cell cycle results. 11.The small sample size n = 4 per group, statistical power and make it difficult to generate strong outcomes, the authors should acknowledge this limitation and indicate that the in vivo findings should be interpreted as preliminary and hypothesis‑generating rather than definitive efficacy data. 12. The authors must include key limitations of their study, including pharmacokinetic concerns and the absence of direct biochemical evidence confirming EGFR inhibition, which helps to maintain a balanced and scientifically updated interpretation of their outcomes. 13. The xenograft data indicate meaningful tumour suppression; however, the authors must include clinically relevant EGFR inhibitors such as a positive control would significantly improve the evaluation and contextual interpretation of treatment efficacy. 14. The histopathological findings support the anti-cancer activity of the compounds; however, the authors must provide higher resolution micrographs with clear scale bars and magnification to ensure adequate visualisation of tissue morphology. 15. For the Western blots figures, the author should clarify in the figure description how bad intensities were normalised (e.g., to GAPDH or another loading control) and confirmed that the blots represent independent biological replicates rather than reprobing of the same membrane, this information is necessary to ensure proper interpretation and reproducibility of the result. 16. For multi endpoint figures (apoptosis cell cycle xenograft tumour volumes) the statistical comparison would be clearer if exact P value were included. 17. The authors must provide more detail in quantitative graphs such as access labelling to improve interpretation and presentation quality. For example, Percentage of apoptotic cells Early vs late apoptosis Treatment groups Concentration units 18. The authors state that one-way ANOVA with Tukey’s post hoc tests were used and the data are presented as mean ± SEM, it would be helpful to specify for each figure whether n refers to biological replicate (independent experiments or animals) and to clarify how many technical replicates were included and this information is present in parts of methods but should be included in figure description. 19.The authors must include software versions, grid definitions, scoring functions, ligand preparation steps, selected force fields, solvation models, equilibrium protocols, and simulation length in the computational method for docking and MD stimulation. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? No source data required Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Drug discovery and formulation development I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Kanwar N. Peer Review Report For: Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung cancer [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2024, 13 :1398 ( https://doi.org/10.5256/f1000research.188258.r434405) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/13-1398/v2#referee-response-434405 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2025 Shah J. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 11 Nov 2025 | for Version 2 Jigna Samir Shah , Nirma University, Ahmedabad, Gujarat, India 0 Views copyright © 2025 Shah J. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions This revised manuscript presents an integrative exploration into the repositioning of acenocoumarol and silodosin for the treatment of non-small cell lung cancer (NSCLC), with a particular focus on their modulation of EGFR-associated signaling cascades. The study draws strength from its translational workflow, blending computational docking, cellular assays, and in vivo xenograft investigations, which adds both depth and multidimensionality to its findings. The authors have responded judiciously to previous reviewer comments, demonstrating considerable effort in refining the manuscript structure, improving scientific phrasing, and moderating interpretative assertions. The most commendable revision is the recalibration of the central claim: the manuscript now appropriately frames these compounds as putative binders at EGFR-associated regions rather than confirmed allosteric inhibitors. This responsible repositioning respects the bounds of evidence while preserving scientific enthusiasm. The experimental design is logical and builds progressively. The in silico molecular docking data suggest favorable binding affinities for acenocoumarol and silodosin at sites adjacent to the canonical ATP-binding pocket of EGFR. These insights are augmented by in vitro studies , which demonstrate downregulation of KRAS and ERK2 in A549 cells, two key downstream regulators in the EGFR-RAS-RAF-MEK-ERK axis. Furthermore, the in vivo xenograft findings in mice corroborate these effects, lending preliminary yet meaningful validation to the biological relevance of the compounds under investigation. In the revised version, the conclusion has been carefully moderated . The revised phrasing avoids prematurely positioning these agents as clinical candidates and instead articulates the need for further mechanistic and translational research. Additionally, the keywords have been updated to more accurately reflect the refined scientific scope of the study. The discussion section has been significantly improved , now offering a thoughtful comparison with known allosteric EGFR inhibitors such as EAI045 and JBJ-09-063. The authors clearly articulate that while experimental validation of EGFR binding is not yet available for the test compounds, the predicted interaction profile opens up possibilities for future analog development or combination therapies. A brief but important discussion on the pharmacokinetics and safety limitations of acenocoumarol and silodosin has been thoughtfully included. The authors responsibly note the bleeding risks, metabolic concerns, and drug interaction profiles of these agents, offering a realistic assessment of their translational feasibility. From a scholarly standpoint, the manuscript is now more cohesive, restrained in tone, and aligned with the principles of hypothesis-driven science. While experimental limitations exist, as is common in early-stage repositioning research, the work sets a solid foundation for further inquiry and is likely to benefit researchers engaged in EGFR-targeted therapy development. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Oncology, neurodegenerative disorders, metabolic disorders. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Shah JS. Peer Review Report For: Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung cancer [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2024, 13 :1398 ( https://doi.org/10.5256/f1000research.188258.r423555) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/13-1398/v2#referee-response-423555 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2025 Shivamallu C. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 03 Jan 2025 | for Version 1 Chandan Shivamallu , Department of Biotechnology and Bioinformatics, JSS Academy of Higher Education and Research, Mysuru, India 0 Views copyright © 2025 Shivamallu C. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions This manuscript presents an innovative approach to repurpose acenocoumarol and silodosin as allosteric inhibitors targeting EGFR for non-small-cell lung cancer (NSCLC). The combination of computational tools, in vitro analyses, and in vivo xenograft studies offers a vigorous frame for evaluating the potential of these drugs in a therapeutic context. The repurposing of clinically approved drugs as EGFR allosteric inhibitors provides a promising pathway to overcome drug resistance in NSCLC. This approach leverages known safety profiles, accelerating clinical translation. For this, the comprehensive methodology applied such as in silico, in vitro and in vivo is commendable. The molecular docking and dynamic studies are detailed and provide strong evidence of binding affinity for the EGFR allosteric site. Cytotoxicity, apoptosis, cell cycle arrest, and gene expression studies are systematically performed, showcasing the drugs’ mechanisms of action. The inclusion of tumor regression and histopathological analysis strengthens the translational relevance of the findings. The significant findings include both acenocoumarol and silodosin demonstrated effective inhibition of KRAS and ERK2, key players in EGFR signaling. The observed upregulation of caspase-3 and tumor growth inhibition validates the anti-NSCLC activity of these drugs. Further, the manuscript adheres to ethical guidelines, and all experimental procedures are well-documented, reflecting the integrity of the research. The findings in this work warrant publishing of this manuscript, however few suggestions for improvement are 1) While the data are extensive, certain figures and tables lack concise labeling and clarity, which could hinder understanding for readers who are unfamiliar with the subject. 2) In the discussion part, readers could benefit from a more detailed comparison with existing EGFR inhibitors, emphasizing the advantages of acenocoumarol and silodosin in terms of efficacy, selectivity, and safety. 3) Although the study concludes with a call for clinical trials, the discussion could elaborate on the specific challenges, such as pharmacokinetics and potential side effects, that need addressing for these drugs. 4) Minor grammatical inconsistencies and redundancies could be refined to enhance the readability and professionalism of the manuscript. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Microbiology, Cancer Biology, Computational Biology I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (1) Author Response 23 Sep 2025 Yogendra Nayak, Department of Pharmacology, Manipal College of Pharmaceutical Sciences, Manipal Academy of Higher Education, Manipal, 576104, India We thank the reviewer for the encouraging and insightful comments. The following revisions have been made based on the suggestions: Figures and Tables : All figures have been relabeled for clarity. Figure legends are now more detailed, and axis labels/treatments are standardized. Comparison with existing EGFR inhibitors : A paragraph comparing our findings with allosteric inhibitors like EAI045 and JBJ-09-063 has been added to the discussion. Discussion on clinical translation : We now include a note on challenges related to pharmacokinetics, metabolism, and dosage limitations of repurposed drugs, particularly acenocoumarol (bleeding risk) and silodosin (hypotension). Language revision : The manuscript has undergone thorough proofreading to remove redundancies and grammatical inconsistencies. View more View less Competing Interests Authors declare that there is no Financial and Non-Financial Competing Interest in publishing this manuscript. reply Respond Report a concern Shivamallu C. Peer Review Report For: Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung cancer [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2024, 13 :1398 ( https://doi.org/10.5256/f1000research.172916.r347134) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/13-1398/v1#referee-response-347134 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2024 Beyett T. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 03 Dec 2024 | for Version 1 Tyler Beyett , Department of Pharmacology and Chemical Biology, Emory University School of Medicine, Atlanta, USA 0 Views copyright © 2024 Beyett T. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Not Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions In this article, Maity et al. explore the effects of acenocoumarol and silodosin treatment on primarily on A549 cells. They show that high doses of either molecule induce apoptosis in cell culture and have a slight, but significant, effect in xenograft models. Overall, I have major concerns about the interpretation of the results. While I believe the data showing that these molecules are cytotoxic, I am not convinced that it is through inhibition of EGFR. Specific major points: My biggest concern with this manuscript is the multiple references to these molecules as allosteric EGFR inhibitors. For example, in the manuscript title and the last sentence of the discussion. No data are presented in this study showing inhibition of EGFR by acenocoumarol or silodosin. There are also no data showing that they work through an allosteric mechanism of action. No allosteric inhibition data are provided in the reference prior work (reference 13) either. This reference only describes docking of the molecules and is lacking controls/reference molecules such as known allosteric EGFR inhibitors like EAI045 and JBJ-09-063. Docking is only a prediction that still requires experimental validation (protein-ligand binding analysis, biochemical kinase inhibition assay, cellular inhibition by phospho-EGFR western blot, etc.). Confirming an allosteric mechanism of action requires a crystal structure or enzymatic inhibition assays with varying ATP concentrations. For these reasons, the multiple claims that these molecules are allosteric EGFR inhibitors cannot be made, and this study must be presented/worded differently as a result. Related to the previous point, since inhibition of EGFR has not been shown, it cannot be assumed that the cytotoxic effects observed are related to EGFR. Performing a target engagement assay would aid in showing the effects are on target rather than working through another mechanism/pathway to induce apoptosis. Many compounds will induce cell death. Throughout the manuscript, critical details about experimental replicate (n) number are missing. The number of biological and technical replicates must be noted for all experiments. This is especially important since SEM is being reported, which is affected by n. Throughout the manuscript, relevant controls including known EGFR inhibitors, ATP-competitive and allosteric, are missing. Cisplatin is not the standard of care for the vast majority of EGFR-driven cancers and thus is not an ideal reference compound. As A549 cells are do not express mutant EGFR (they overexpress wild-type EGFR), a pan-EGFR inhibitor like afatinib is an ideal positive control. In the MTT cytotoxicity assay it is difficult to see where the IC50s are being derived from for some molecules. IC50 is defined as the inflection point of a sigmoidal curve, but many of these curves do not have such a point and do not appear to encompass enough of the dose-response curve to accurately report an IC50. Inclusion of EGFR inhibitors as controls, especially allosteric inhibitors, is needed for a frame of reference since IC50s are condition dependent. Additionally, it is not clear why acenocoumarol and silodosin were chosen. It is claimed that “From the cytotoxicity results, we selected the best drugs, acenocoumarol and silodosin, for further testing.” These molecules were not consistently more potent than the others. What wasn’t danusertib selected? It is most potent against the cancer cell line and least potent against the healthy cell line, which is typically the desired profile of a targeted therapy. The section titled “KRAS and ERK2 enzymatic inhibition by acenocoumarol and silodosin” is misleading as no inhibition data are presented. That section only provides data on total protein levels. Furthermore, it appears as if this experiment was only performed once. Given the potential for bias in quantifying western blot bands by densitometry, especially weak bands, this experiment must be performed multiple times and error bars reported. Related to the previous point, in the discussion it is stated that “Enzymes ERK2 and KRAS significantly inhibited enzymatic activity upon administration of silodosin” and “suppressing the signal transduction cascade.” This and related statements need to be removed, as enzymatic activity and signal transduction of ERK2 (typically assessed by phospho-ERK blotting) or activation of RAS (assaying for GTP bound state or GTPase activity) are not assessed. Furthermore, the use of “significantly” is inappropriate given that no statistical analyses were performed in the relevant figures 7 and 8. Information on the statistical tests used in Figures 9, 10, and 11 are missing. The related figures 7 and 8 do not make sense. For example, 12.5 uM silodosin greatly decreases expression, but the protein levels are not dramatically decreased. Similarly, for 25 uM acenocoumarol, expression is decreased for ERK2, but the protein level is normal. In the same group, KRAS expression is comparable to the controls, but protein levels are greatly increased. What is the explanation for this disconnect? In figure 9, are statistical tests only performed for the last treatment point (day 21)? If so, this must be stated. Other time points are likely significant if also considered. In the figure legend, I hope that p<0.5 is a typo meant to be p<0.05. The former significance cutoff is not stringent enough. In figure 11, what are the statistical significances for? And what statistical test was employed? Are you saying that all of the organs from a treatment group are significantly different than their corresponding values in the vehicle group? What about comparisons between treatment groups? Such analyses may require a multiple comparisons post hoc correction be used in the statistical analysis. Numerous typos throughout including, but not limited to, T750M and L858M (page 3). There are also red underlines in the text for figure 14 that should be removed. Antibodies used in western blots must be noted with their source and catalog number since they can vary widely. Source data should include the individual replicates for each experiment in addition to just the mean ± SEM Is the work clearly and accurately presented and does it cite the current literature? Partly Is the study design appropriate and is the work technically sound? No Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? No Are all the source data underlying the results available to ensure full reproducibility? Partly Are the conclusions drawn adequately supported by the results? No Competing Interests No competing interests were disclosed. Reviewer Expertise EGFR pharmacology including allosteric inhibitor discovery and development I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above. reply Respond to this report Responses (1) Author Response 23 Sep 2025 Yogendra Nayak, Department of Pharmacology, Manipal College of Pharmaceutical Sciences, Manipal Academy of Higher Education, Manipal, 576104, India Major Comment 1: Claim of allosteric EGFR inhibition without experimental validation. Response: We sincerely acknowledge this concern. The claim that acenocoumarol and silodosin are allosteric EGFR inhibitors was primarily based on in silico docking studies and prior literature suggesting possible interaction with the allosteric site. However, we recognize that docking studies alone do not suffice to label them as "allosteric inhibitors." We have accordingly: Revised the manuscript title, abstract, conclusion, and discussion to reflect a more evidence-aligned interpretation of the findings. The drugs are now presented as repurposed candidates with predicted interactions at EGFR-associated signaling levels, based on computational docking and preclinical evaluation. The title has been changed to: “ Exploring acenocoumarol and silodosin in non-small cell lung cancer: Insights into EGFR-linked signaling mechanisms ”. This updated title avoids asserting mechanistic inhibition, emphasizes pathway-level relevance, and accurately reflects the scope and limitations of the study. Removed definitive language such as "allosteric inhibitor" and replaced it with "computationally predicted to bind to allosteric sites of EGFR." Cited the lack of direct evidence as a limitation and proposed further biochemical studies (e.g., kinase assays, phospho-EGFR western blots) in the future. Major Comment 2: No direct evidence that cytotoxicity is related to EGFR inhibition. Response: We agree. While we observed apoptosis and downregulation of KRAS and ERK2 components downstream of EGFR signaling, our current dataset does not establish a causal link between drug activity and EGFR inhibition. We have removed statements that imply a direct mechanistic link and instead suggest that the observed effects may be associated with EGFR signaling pathways, pending further validation. This clarification is incorporated into the discussion. Major Comment 3: Missing replicate (n) numbers and statistical clarity. Response: We apologize for the oversight. The manuscript has been revised to: Explicitly mention the number of biological replicates (n=3) for in vitro studies and n=4 mice per group for xenograft experiments. Clearly indicate technical duplicates where applicable. Ensure all SEM values are tied to biological replicates, not technical ones. Major Comment 4: Use of inappropriate controls in EGFR assays. Response: We acknowledge the point regarding the use of cisplatin instead of a known EGFR inhibitor. Our intention was to benchmark general anticancer activity rather than EGFR-specific inhibition, given the exploratory nature of this study. This rationale is now mentioned in the Methods and Limitations sections. We agree that future studies must incorporate controls like afatinib or osimertinib to provide a valid comparative frame. Major Comment 5: Concerns with IC50 calculations and molecule selection. Response: The IC50 values were calculated using nonlinear regression via GraphPad Prism. While sigmoidal fitting may not be ideal for all curves due to cell line-specific response variability, the curve fitting and R² values are considered. Regarding molecule selection, danusertib was excluded from further testing due to known off-target cytotoxicity and poor pharmacokinetic properties in pilot studies, though it showed high potency. This is now clarified in the Results section. Major Comment 6: Mislabeling of Western blot data as enzyme inhibition. Response: We regret the terminology used. The sections titled “enzymatic inhibition” now read “protein expression levels” via Western blot. No enzymatic activity assay was performed. All conclusions based on these blots have been modified accordingly to describe expression rather than inhibition. Major Comment 7: Inaccurate claims of signaling pathway inhibition. Response: We have removed all claims of direct inhibition of KRAS and ERK2 enzymatic activity or pathway signaling. All references to "significant inhibition" have been qualified to reflect expression changes , not enzyme activity or pathway suppression, and we note the need for phospho-ERK or GTP-RAS assays in future studies. Major Comment 8: Incomplete statistical test descriptions. Response: Statistical tests have now been specified as ANOVA with Tukey’s post hoc test or unpaired t-test , as appropriate. Significance values and p-values have been revised throughout the figure legends. The p<0.5 error has been corrected to p<0.05 . Major Comment 9: Disconnect between mRNA and protein levels. Response: This is a valid observation. We have acknowledged in the discussion that post-transcriptional or translational regulation may cause such discrepancies, and that one-time point assessments without time-course validation may limit interpretability. These are now added to the limitations. Major Comment 10: Clarification in Figures 9–11 and statistical interpretations. Response: Clarifications have been added regarding Statistical tests in tumor volume measurements (Figure 9), Significance at multiple time points (but analyzed at day 21), The error in p-value notation has been corrected. Organ weight data (Figure 11) now includes the statistical method and indicates whether post hoc corrections were applied. Minor Comments (combined response): All antibody sources and catalog numbers have now been added to the Methods section. Typos including T750M/L858M (corrected to T790M/L858R) have been fixed. All red underlines and formatting errors in figures have been corrected. Raw data files now include individual replicates and are available on Figshare [ https://doi.org/10.6084/m9.figshare.24587592.v5 ]. View more View less Competing Interests Authors declare that there is no Financial and Non-Financial Competing Interest in publishing this manuscript reply Respond Report a concern Beyett T. Peer Review Report For: Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung cancer [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2024, 13 :1398 ( https://doi.org/10.5256/f1000research.172916.r343035) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/13-1398/v1#referee-response-343035 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "Exploring acenocoumarol and silodosin as...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/13-1398/v1" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/13-1398/v1&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/13-1398/v1" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Maity S et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/13-1398/v1/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/13-1398", templates : { twitter : "Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors.... Maity S et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/13-1398/v1" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/157465/172916") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "172916"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "423558": 0, "343044": 0, "423559": 0, "423556": 0, "423557": 0, "343041": 0, "423554": 0, "343040": 0, "423555": 11, "343043": 0, "343042": 0, "423562": 0, "423563": 0, "423560": 0, "423561": 0, "416790": 0, "416791": 0, "420518": 0, "420519": 0, "420516": 0, "420517": 0, "420514": 0, "420515": 0, "420513": 0, "417582": 0, "417583": 0, "420522": 0, "420520": 0, "420521": 0, "417590": 0, "417591": 0, "417588": 0, "417589": 0, "417586": 0, "417587": 0, "417584": 0, "417585": 0, "434398": 0, "434399": 0, "427487": 0, "434397": 0, "434406": 0, "427494": 0, "427495": 0, "427492": 0, "434404": 8, "434405": 9, "427493": 0, "434402": 0, "427490": 0, "434403": 0, "427491": 0, "434400": 0, "427488": 0, "434401": 0, "427489": 0, "347125": 0, "347127": 0, "347126": 0, "343037": 0, "347133": 0, "343036": 0, "347132": 0, "343039": 0, "343038": 0, "347134": 26, "347129": 0, "347128": 0, "347131": 0, "343035": 45, "347130": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "3cf7dde4-c130-462e-83f8-318febaa7c7c"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "
[email protected]", infoEmail: "
[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.