NOD2 reduces the chemoresistance of melanoma by inhibiting the TYMS/PLK1 signaling axis

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Nucleotide-binding oligomerization domain 2 (NOD2) is an immune sensor crucial for eliciting the innate immune responses. Nevertheless, discrepancies exist regarding the effect of NOD2 on different types of cancer. The aim of this study was to investigate the function of NOD2 in melanoma and its underlying mechanisms. We have validated the tumor suppressor effect of NOD2 in melanoma. NOD2 inhibited the proliferation of melanoma cells, hindering their migration and invasion while promoting the onset of apoptosis. Our study showed that NOD2 expression is closely related to folate metabolism, and its mechanism of action is to inhibit TYMS expression by promoting ubiquitination modification of thymidylate synthase (TYMS), thereby decreasing the resistance of melanoma cells to 5-fluorouracil (5-FU) and capecitabine (CAP). TYMS was identified to form a complex with Polo-like Kinase 1 (PLK1) and activate the PLK1 signaling pathway. Furthermore, we revealed that the combination of the PLK1 inhibitor volasertib (BI6727) with 5-FU or CAP had a synergistic effect repressing the proliferation and migration of melanoma cells. Overall, our research highlights the protective role of NOD2 in melanoma and suggests that targeting NOD2 and the TYMS/PLK1 signaling axis is a high-profile therapy that could be a prospect for melanoma treatment.
Full text 167,418 characters · extracted from preprint-html · click to expand
NOD2 reduces the chemoresistance of melanoma by inhibiting the TYMS/PLK1 signaling axis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article NOD2 reduces the chemoresistance of melanoma by inhibiting the TYMS/PLK1 signaling axis chun Zhu, Fang Yun, Na Wu, Xiao Yi, Xue Zhang, Yu Feng, Qin Ni, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4324307/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 01 Oct, 2024 Read the published version in Cell Death & Disease → Version 1 posted 9 You are reading this latest preprint version Abstract Nucleotide-binding oligomerization domain 2 (NOD2) is an immune sensor crucial for eliciting the innate immune responses. Nevertheless, discrepancies exist regarding the effect of NOD2 on different types of cancer. The aim of this study was to investigate the function of NOD2 in melanoma and its underlying mechanisms. We have validated the tumor suppressor effect of NOD2 in melanoma. NOD2 inhibited the proliferation of melanoma cells, hindering their migration and invasion while promoting the onset of apoptosis. Our study showed that NOD2 expression is closely related to folate metabolism, and its mechanism of action is to inhibit TYMS expression by promoting ubiquitination modification of thymidylate synthase (TYMS), thereby decreasing the resistance of melanoma cells to 5-fluorouracil (5-FU) and capecitabine (CAP). TYMS was identified to form a complex with Polo-like Kinase 1 (PLK1) and activate the PLK1 signaling pathway. Furthermore, we revealed that the combination of the PLK1 inhibitor volasertib (BI6727) with 5-FU or CAP had a synergistic effect repressing the proliferation and migration of melanoma cells. Overall, our research highlights the protective role of NOD2 in melanoma and suggests that targeting NOD2 and the TYMS/PLK1 signaling axis is a high-profile therapy that could be a prospect for melanoma treatment. Biological sciences/Cancer/Skin cancer/Melanoma Biological sciences/Cell biology/Mechanisms of disease Biological sciences/Chemical biology/Post-translational modifications/Ubiquitylation Biological sciences/Molecular biology/Transcriptomics NOD2 TYMS PLK1 melanoma chemoresistance proliferation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction Melanoma is one of the top ten most dangerous tumors because of its rapid progression, ease of metastasis, and poor prognosis. According to statistics, the number of new cutaneous melanomas is estimated to reach 100,640 cases and 8290 deaths globally in 2024 1 . Although targeted therapies and immunotherapies represented by BRAF/MEK inhibitors and anti-PD1 have improved the therapeutic efficacy of melanoma treatment to a certain extent, their toxic side effects and chemoresistance have not yet been effectively resolved 2 , 3 , 4 . However, several clinical studies have shown that combination therapy can exert an excellent synergistic effect and effectively reduce tumor resistance to drugs, thus significantly improving the anti-tumor effect 5 , 6 , 7 . Therefore, exploring the molecular mechanisms of melanoma development and chemoresistance, as well as the impact of combination therapy, would facilitate the identification of new therapeutic strategies for melanoma treatment. Nucleotide-binding oligomerization domain 2 (NOD2) is an intracellular pattern recognition receptor in the immune response 8 . Reported studies have clarified the critical function of NOD2 in controlling inflammatory diseases and invasion of host microorganisms, like Crohn's disease 9 , colitis 10 , Blau syndrome 11 , and meningitis 12 . Recent investigations have pointed out that aberrant NOD2 expression is tied to cancer progression. NOD2 was reported to inhibit the proliferation of esophageal adenocarcinoma cells via autophagy 13 , whereas its deficiency promoted colorectal tumorigenesis 14 . In addition, the upregulation of NOD2 enhanced the proliferation, invasion, and migration of cervical squamous cell carcinoma 15 . By the mechanism of DNA damage-induced autophagy, NOD2 could also promote hepatocellular carcinoma development 16 . This series of findings reveals that NOD2 plays a rather intricate role in the field of cancer and that there may be specific manifestations across different tissues. In addition, earlier evidence exists that NOD2 agonists or antagonists exert adjuvant effects in immune checkpoint inhibitor therapy. Combining NOD2 agonists with PD-1/ PD-L1 immune checkpoint inhibitors for Alzheimer's disease has revealed their synergistic impact 17 . Covalently coupled NOD2 and toll-like receptor 7 (TLR7) agonists showed potent immunostimulatory activity on immune cells 18 . In addition, the coupling of NOD2 antagonist and paclitaxel (PTX) enhanced the growth inhibitory effect of PTX on Lewis lung carcinoma (LLC)-loaded mice 19 . Overall, NOD2 has diverse biological functions and therapeutic potential in disease. Still, much remains unknown about the more profound understanding of the role and mechanism of NOD2 in melanoma, and more in-depth studies are needed to unravel this mystery. Thymidylate synthase (TYMS) has been spotlighted as an essential target for tumor chemotherapeutic agents 20 , 21 , 22 . TYMS maintains the stability of the thymidine-5-prime monophosphate (dTMP) pool, a key dTMP in DNA replication and repair, by catalyzing the methylation of deoxyuridylate to deoxythymidylate using N5, N10-methylenetetrahydrofolate (methylene-THF) as a cofactor 23 . In addition, TYMS is the site of action of chemotherapeutic agents such as 5-fluorouracil (5-FU), 5-fluoro-2-prime-deoxyuridine (FdUMP) and certain folate analogs 24 , 25 , 26 . Thus, TYMS is believed to play a central part in cancer development. Initial studies have indicated that reducing TYMS expression may increase sensitivity to 5-FU chemotherapy in colorectal cancer patients 27 , 28 . Conversely, increased expression of TYMS in hepatocellular carcinoma cells and patient samples was associated with hepatocellular carcinoma progression and resistance to 5-FU 29 . Furthermore, the in vivo decrease of TYMS expression lowered tumor occurrence, slowed tumor progression, and extended survival time in mice 30 . However, the reasons for the dysregulation of TYMS in melanoma and its underlying mechanisms remain unclear. In this work, we observed a trend towards a reduced degree of NOD2 expression in melanoma cells. Melanoma growth was successfully inhibited by upregulating the expression of NOD2 in vivo and in vitro . In addition, we established that NOD2 effectively diminished melanoma's ability to resist chemotherapeutic drugs by reducing TYMS's level and activity. Further studies revealed that NOD2 downregulated TYMS expression by affecting the proteasomal degradation pathway of TYMS and subsequently increasing the level of ubiquitination of TYMS. Altered TYMS expression and activity subsequently affect Polo-like Kinase 1 (PLK1) expression and activity, and this regulatory relationship occurs through a direct binding interaction of TYMS with PLK1. PLK1 is a critical cell cycle regulatory protein of the serine/threonine kinase family, closely related to melanoma development and growth 31 , 32 . NOD2 suppresses melanoma development by inhibiting the TYMS/PLK1 signaling axis. The results of this study offer clues that unravel the mechanisms of melanoma progression and chemoresistance. Also, the significance of implementing NOD2 and the TYMS/PLK1 signaling axis was evaluated as targets for therapeutic intervention in melanoma. Materials and methods Cell culture and transfection Human melanoma cells (A875 and SK-MEL-110) were obtained from the Cell Bank of the Chinese Academy of Sciences. All cells were cultured in high-glucose DMEM medium supplemented with 10% fetal bovine serum at 37°C with 5% CO2. Using NOD2 (shNOD2-1 ,5′-GGGCAAGACTTCCAGGAATTT-3′; shNOD2-2, 5′- GTGCTTCTTTGCCGCGTTCTA-3′; shNOD2-3, 5′-GGACTACAACTCTGTGGGTGA-3′) and its control (CON313) and NOD2 overexpression and its control (CON335) lentiviruses infected A875 and SK-MEL-110 cells. These viruses were obtained from GeneChem Co., Ltd. (Shanghai, China). After 48 hours of transfection, the cell transfection efficiency was observed under a fluorescence microscope, and the cells were continuously screened by puromycin (Solarbio, #P8230) pressurization until the infection rate reached more than 95%. Real-time PCR and Western blot assessed the effect of gene transfection. Real-time PCR TRIzol reagent (Takara, #9109) was used to extract total RNA from cells and tumor tissues. Synthesize cDNA by reverse transcription of mRNA following the instructions of the Reverse Transcription Kit (Thermo Scientific, #K1622). cDNA was analyzed by Real-time PCR using SYBR Green Master mix (Roche, #04913914001); U6 served as an internal reference gene. The specific primer sequences are detailed in Table 1 . Table 1 Gene primer NOD2 F: 5’- 3’: TGGTTCAGCCTCTCACGATGA R: 5’- 3’: CAGGACACTCTCGAAGCCTT TYMS F: 5’- 3’: CTGCTGACAACCAAACGTGTG R: 5’- 3’: GCATCCCAGATTTTCACTCCCTT PLK1 F: 5’- 3’: AAGTGGGTGGACTATTCG R: 5’- 3’: GCCGTCACGCTCTATGTA Cyclin E1 F: 5’- 3’: ACTCAACGTGCAAGCCTCG R: 5’- 3’: GCTCAAGAAAGTGCTGATCCC CDK2 F: 5’- 3’: CCAGGAGTTACTTCTATGCCTGA R: 5’- 3’: TTCATCCAGGGGAGGTACAAC Cyclin D1 F: 5’- 3’: GCTGCGAAGTGGAAACCATC R: 5’- 3’: CCTCCTTCTGCACACATTTGAA CDK4 F: 5’- 3’: TCAGCCAGCTTGACTGTTCCA R: 5’- 3’: GCCTAGATTTCCTTCATGCCA P16 F: 5’- 3’: GGGTTTTCGTGGTTCACATCC R: 5’- 3’: CTAGACGCTGGCTCCTCAGTA Bax F: 5’- 3’: CCCGAGAGGTCTTTTTCCGAG R: 5’- 3’: CCAGCCCATGATGGTTCTGAT Bcl2 F: 5’- 3’: GGTGGGGTCATGTGTGTGG R: 5’- 3’: CGGTTCAGGTACTCAGTCATCC Caspase 3 F: 5’- 3’: CATGGAAGCGAATCAATGGACT R: 5’- 3’: CTGTACCAGACCGAGATGTCA U6 F: 5’- 3’:CTCGCTTCGGCAGCACA R: 5’- 3’: AACGCTTCACGAATTTGCGT Western blot Cells and tissues can be effectively lysed using a RIPA lysis buffer (Solarbio, #R0020) containing protease and phosphatase (Solarbio, #P0100) inhibitors. Proteins were quantified by BCA, separated via SDS-PAGE gel electrophoresis, and transferred onto PVDF membranes (Millipore, #IPVH00010), sealed with 5% skimmed milk or 5% BSA (Bio Froxx, #4240GR500) for two hours then incubated overnight with a primary antibody at 4°C. The next day, the secondary antibody of the same genus was used and incubated at room temperature for two hours. ELC chemiluminescence was performed to observe the target bands, and ImageJ software was used to scan the gray values. The following antibodies were used: anti-NOD2 (Abcam, #ab36836), anti-TYMS (Proteintech, #15047-1-AP), anti-PLK1 (Santa Cruz, #sc-17783), anti-p-PLK1(T210) (Abcam, #ab155095), anti-Cyclin E1 (Proteintech, #11554-1-AP), anti-Cyclin D1 (Proteintech, #60186-1-Ig), anti-CDK2 (Proteintech, #10122-1-AP), anti-CDK4 (Proteintech, #11026-1-AP), anti-P27 (Proteintech, #25614-1-AP), anti-Bcl2 (Proteintech, #68103-1-Ig), anti-Bax (Proteintech, #60267-1-Ig), anti-Caspase 3 (Proteintech, #66470-2-Ig), anti-MMP2 (Proteintech, #10373-2-AP), anti-MMP9 (Proteintech, #10375-2-AP), anti-N-cadherin (Proteintech, #22018-1-AP), anti-E-Cadherin (Proteintech, #20874-1-AP), anti-vimentin ( Proteintech, #60330-1-Ig), anti-Ubiquitin (CST, #43124), anti- Myc-tag (MCE, HY-P80232), anti- GST-Tag (MCE, HY-P80148), anti-β-actin (Proteintech, #66009-1-Ig), anti-rabbit IgG (CST, #7074), and anti-mouse IgG (Santa Cruz, #sc2005). Cell proliferation assay (MTS, colony formation, and EdU staining) To determine cell viability by MTS assay, cells with NOD2 overexpression and knockdown of A875 and SK-MEL-110 were cultured in 96-well plates (1000 cells/well). MTS (Promega, #CTB169) working solution formulated according to 1:5 (DMEM: MTS) was added at different time points. The absorbance value was detected at 490 nm after one hour of dark culture. Cells were inoculated into six-well plates (800 cells/well), and fresh medium was replaced every three days. Discontinue the culture when cell colony formation was observed. Cells were washed with PBS, fixed in paraformaldehyde, stained with 0.5% crystal violet for 20 minutes each, and photographed for counting. In the EdU incorporation determination, cells were first grown in 24-well plates, and the next day, an EdU Kit (Beyotime, # C0078S) was used to stain the cells. Hoechst 33342 was utilized for nuclear staining. Pictures were obtained using a fluorescence microscope (Leica, # DM4B) to determine the percentage of EdU-positive cells. IC50 assay Cells were inoculated in 96-well plates at 5000 cells/well density. The next day, cells were exposed to various fluorouracil (5-FU) (MCE, #HY-90006) and capecitabine (CAP) (MCE, #HY-B0016) treatment concentrations. The IC50 was calculated by detecting the absorbance values at 490 nm obtained in the MTS assay described above after 48-hour exposure. Wound healing assay Cells were inoculated into a six-well plate and incubated to reach confluence after overnight incubation with serum-free DMEM. Further, the cells were scratched with the tip of a 200-uL pipette, and the separated cells were washed using PBS. Images were taken under an inverted microscope at 0 and 24 hours after wounding. Calculate the wound closure area as follows: wound closure area (fold) = (initial wound area - unhealed wound area 24 hours after scratching)/initial wound area. Transwell migration and invasion assays Cells were digested with trypsin, suspended in DMEM, and later cultured into the top Chamber in Transwell chambers (Corning, #3524). When performing Transwell invasion experiments, 40 µl of matrix gel (BD, #356234) diluted 1:3 (matrix gel: DMEM) was applied to the upper chamber of the Transwell chamber two hours in advance. Next, 600 uL of medium containing 10% fetal bovine serum was injected into the lower chamber of the Transwell, and cells that had migrated and invaded the bottom of the Transwell were removed after 24 hours. Finally, the migrated and invaded cells were fixed, crystal violet-stained, and counted. Flow cytometry Cell cycle assays are performed by inoculating cells into a 6-well plate, digesting, and centrifuging. Then, they were slowly added dropwise to 75% pre-cooled ethanol and fixed at 4°C for 24 hours. Cells were collected by centrifugation the next day, stained with a cycle kit (4A Biotech, #FXP0211), and subjected to flow cytometry detection (BD, BD FACSCCelestaTM flow cytometry) and analyzed using FlowJo software. In apoptosis analysis, cells were inoculated in 6-well plates and treated for apoptosis induction. After staining with Annexin V, 633/PI Staining Kit (Dojindo, #AD11) according to the manufacturer's instructions, assessed apoptic content through flow cytometry (BD, BD FACS Celesta TM flow cytometer) and analyzed using FlowJo software. Co-immunoprecipitation (CO-IP) The cells were lysed for 30 minutes on a shaker at 4°C using weak RIPA lysis buffer (Beyotime, #P0013D), adding protease and protease phosphatase (Solarbio, #P0100) inhibitors. Following centrifugation, the supernatant was divided into three parts. The input tube was frozen at minus 20°C, and the corresponding primary antibody was mixed in the IgG and IP tubes. After incubation on a shaking table at low temperatures for 8 hours, protein A/G-Agarose beads (Roche, #11243233001) were added and gently shaken at 4°C overnight. After centrifugation, the liquid above the sediment was removed, and the sample was subsequently rinsed thrice with PBS. Finally, PBS and protein loading buffer were added, followed by boiling and eluting the combined protein. Western blot analysis was performed using SDS-PAGE. Cellular immunofluorescence (IF) After inoculating the cells in a slide culture, they were removed and fixed in 4% paraformaldehyde for 15 min, followed by exposure to 0.3% Triton X-100 for 20 min. Next, blocking with BSA (Bio Froxx, #4240GR500) for 2 hours, followed by the addition of the primary antibody for overnight incubation at 4°C. Samples with a fluorescent secondary antibody were incubated in the dark for one hour, and the slide was sealed with an anti-fluorescence quencher containing DAPI (Sigma, #F6057). Finally, the cell slides were photographed using a fluorescence microscope (Zeiss, #LSM800) observation. The following fluorescent secondary antibodies were utilized: 488 (Proteintech, #SA00013-1) and 594 (Proteintech, #SA00013-4). GST Pull-down assay The GST-TYMS and myc-PLK1 genes were first cloned and synthesized and then inserted into the pGEX-4T-1 vector and pET28a (+) vector, respectively, and then expressed individually in E. coli TOP10, which was purchased from Wuhan Jinkai Rui Biological. For the in vitro pull-down assay, performed according to the illustrated procedure (Fitgene, #FI88807), after the bacteria were broken by ultrasonication in lysis buffer, the protein samples of 2 mg of GST (control) or GST-TYMS (experimental) were incubated with 50 µl of glutathione agarose resin for 5 h at 4°C. The samples were washed with rinse buffer three times and then washed with rinsing buffer. After washing three times with rinse buffer, 2 mg of myc-PLK1 protein was mixed into each control and experimental group and incubated at 4°C overnight. Then, the samples from both groups were centrifuged, washed three times with rinse solution, and eluted by adding elution buffer for 15 min. Add protein loading buffer to the eluted proteins and heat at 95°C for 10 minutes. Finally, the samples were analyzed by immunoblotting. TYMS activity assay Total proteins were extracted with RIPA lysis buffer to determine intracellular TYMS enzyme activity, followed by concentration determination using the BCA method. Following guidelines provided by the manufacturer, TYMS activity was assayed using the TYMS Activity ELISA Kit (MEIMIAN, #MM-0328H1). Hematoxylin-eosin (HE) staining and immunohistochemistry (IHC) analysis Animal tumors were fixed in 4% paraformaldehyde, embedded in paraffin, cut into 5-µm sections, and stored after baking at 65°C for three hours. HE staining was performed per the manufacturer's established protocol (Solarbio, #G1120). For IHC, antigen repair was performed under high pressure using citrate buffer. The endogenous peroxidase activity was inactivated with 3% H2O2, and 5% BSA was blocked, followed by the addition of the primary antibody and overnight incubation at 4°C. Staining Sections using the DAB Substrate Kit (Biosharp, #BL732A) and hematoxylin staining solution (Biosharp, #517-28-2). Sections were dehydrated again, cleared by a gradient of ethanol and xylene, sealed with neutral glue, and photographed under the microscope (Teksqray, #SQS-1000). Bioinformatics analysis Data mining Mining was conducted for data normalization, and computational analysis was performed of the NOD2 gene expression values obtained from the Gene Expression Omnibus (GEO) database ( https://www.ncbi.nlm.nih.gov/geo ) for the mRNA expression dataset GSE15605, as well as for normal and primary melanoma tissues and metastatic melanoma tissues in the TCGA database ( https://portal.gdc.cancer.gov/ ). The GEPIA database ( http://gepia2.cancer-pku.cn/ ) was used for the differential analysis of the NOD2, TYMS, and PLK1 genes in melanoma and normal tissues, as well as the correlation between TYMS and PLK1 in melanoma patients. The UALCAN database ( https://ualcan.path.uab.edu/ ) was used for survival prognosis analysis of NOD2 expression and melanoma patients. For transcriptome sequencing (RNA-seq), SK-MEL-110 cells with NOD2 overexpression and control were collected for RNA-seq by Zhongke New Life in Shanghai, China. After selecting the high-throughput sequencing data according to the screening threshold of | log2FC | > 1 and Padj < 0.05, differentially expressed genes (DEGs) were obtained and enriched for analysis. Animal models Six-week-old female BALB / c nude mice were obtained from the Department of Laboratory Animals, Kunming Medical University, and all animal experiments followed animal ethical standards. For the no administration of chemotherapeutic drugs treatment group, 1 × 10 7 of A875-shCAD and its control cells were implanted into the subcutaneous regions on both sides of the nude mice., respectively. After two weeks, measure tumor diameters with a vernier caliper every 5 days. For the group treated with chemotherapeutic agents, 1 × 10 7 A875 cells were implanted into the axilla of nude mice. After two weeks, the nude mice were injected intraperitoneally with saline or chemotherapeutic drugs 5-Fu (25 mg/kg) and BI6727 (10 mg/kg) every three days, and the diameter of the tumors was measured using vernier calipers every five days the treatment period. The tumor volume was calculated using the formula: volume = 1/2 × long diameter × wide diameter × wide diameter. In the final stage of the tumor experiment, we euthanized the nude mice and removed tumors for subsequent experiments. Statistical analysis Data were analyzed using GraphPad Prism 2 software. All data were shown as means ± standard deviation (SD) of at least three independent experiments. Independent-sample t-tests were used to compare differences between two specific groups, and one-way analysis of variance (ANOVA) was used to compare differences between multiple groups. P < 0.05 was considered to indicate statistically significant differences in the results. Results NOD2 expression is downregulated in human melanoma, and low expression is associated with poor prognosis for melanoma patients The GEPIA and TCGA databases were used to analyze the role of NOD2 in the development of melanoma, and it was found that the expression of NOD2 was significantly down-regulated in melanoma compared to normal tissue, especially in metastatic melanoma patients with lower expression levels (Fig. 1 A, B). Moreover, low expression of NOD2 predicts a poor prognosis in melanoma patients (Fig. 1 C). Then, we examined NOD2’s expression in HEM and four melanoma cell lines. The experimental results revealed a significant decrease in the mRNA expression (Fig. 1 D) and protein expression (Fig. 1 E) of NOD2 in A375 cells, A875, SK-MEL-28, and SK-MEL-110 cell lines. To further explore the NOD2 function, we successfully constructed stably transfected cell lines with NOD2 knockdown and overexpression in A875 and SK-MEL-110 cells (Fig. 1 F), with the sh-NOD2-3 sequence having the best knockdown efficiency. Therefore, this knockdown sequence cell line will be used in our subsequent experiments. NOD2 inhibits the proliferation of human melanoma cells in vitro We validated the anti-tumor effect of NOD2 in melanoma cells. Specifically, the NOD2 impact on the proliferation of melanoma cells was evaluated by MTS, cell colony formation, and EdU staining. The MTS results indicated that NOD2 overexpression decreased the proliferative viability of melanoma cells, whereas it was increased by NOD2 knockdown (Fig. 2 A). NOD2 overexpression reduced melanoma cells' ability to form colonies, whereas the opposite results were obtained after NOD2 knockdown (Fig. 2 B). Using EdU staining, we found that the DNA synthesis rate of melanoma cells after NOD2 overexpression was accelerated compared to controls, whereas NOD2 knockdown slowed down the rate of DNA synthesis (Fig. 2 C). These results suggest that NOD2 overexpression inhibits melanoma cell proliferation, whereas its knockdown promotes melanoma cell proliferation. In further studies, we explored the mechanism of NOD2 action in melanoma cell proliferation. Flow cytometry analysis revealed that in A875 cells, NOD2 overexpression led to an increase in G0/G1 phase cells and a decrease in S and G2/M phase cells; NOD2 knockdown led to a decrease in G0/G1 phase cells and an increase in S and G2/M phase cells. In SK-MEL-110 cells, NOD2 overexpression increased G0/G1-phase cells and decreased G2/M-phase cells, whereas the opposite trend was observed when NOD2 was knocked down. However, the number of S-phase cells remained constant. Next, we detected the mRNA (Fig. 2 E) and protein expression levels (Fig. 2 F) of cell cycle-related factors by real-time PCR and Western blot. Our data revealed that in melanoma cells with NOD2 overexpression, Cyclin E1/D1 and CDK2/4 expression levels were upregulated, accompanied by the expression of P27 was inhibited. In contrast, there is an opposite trend in NOD2 knockdown melanoma cells. All of the data obtained further highlight the critical role of NOD2 in inhibiting the proliferation of human melanoma cells. NOD2 promotes the cellular apoptosis To determine the influence of NOD2 on melanoma cell apoptosis, we examined apoptosis after NOD2 overexpression and knockdown by flow cytometry. The findings proved that NOD2 overexpression increased the apoptosis rate in melanoma cells, whereas NOD2 knockdown decreased it (Fig. 3 A). To prove the cause of induced apoptosis, the mRNA (Fig. 3 B) and protein (Fig. 3 C) levels of apoptosis-promoting related factors Bax and Caspase 3 and the anti-apoptotic protein Bcl2 were detected. Furthermore, the expression of Bax and Caspase 3 was upregulated after NOD2 overexpression, whereas the expression of Bcl2 was downregulated. In contrast, the opposite result was obtained after NOD2 knockdown. NOD2 inhibits the migration and invasion of human melanoma cells We studied the influence of NOD2 on the migration and invasion ability in human melanoma cells. Scratch and Transwell migration assays were employed to assess cell migration ability, and a Transwell invasion assay was used to evaluate cell invasion ability. The findings indicated that NOD2 overexpression suppressed melanoma cells' migration (Fig. 4 A, B) and invasion (Fig. 4 C) ability, whereas NOD2 knockdown increased these abilities. In addition, Western blot analyzed the levels of proteins associated with EMT to measure the implications of NOD2 in the EMT process. The results revealed that NOD2 overexpression decreased MMP2, MMP9, N-cadherin, and vimentin while increasing E-cadherin expression. The opposite result was obtained after NOD2 knockdown (Fig. 4 D). NOD2 inhibits human melanoma growth in vivo To verify if targeting NOD2 inhibited melanoma development in vivo , we implanted A875 cells with NOD2 overexpression, knockdown, and its control group subcutaneously in nude mice to observe tumor formation. In contrast to the control group, the implanted NOD2 overexpression cell group more effectively suppressed the tumor growth rate and size (Fig. 5 A–C). In contrast, accelerated proliferation and larger tumor growth were measured in the tumors implanted into the NOD2 knockdown group of cells (Fig. 5 D–F). Additionally, Western blot analysis was performed to determine the expression of NOD2 and its associated cyclin proteins in the tumor tissues of both groups. As depicted in Fig. 7 G, the NOD2 overexpression group exhibited significantly higher levels of NOD2 expression in the tumor bodies compared to the control group. A downregulation of Cyclin E1, CDK2, Cyclin D1, and CDK4 accompanied this elevated NOD2 expression. Conversely, the knockdown group displayed the opposite results. Also, the tumor was stained with Hematoxylin-eosin (HE) and immunohistochemical (IHC) (Fig. 5 H). Inhibition of TYMS and PLK1 expression and activity is critical for the role of NOD2 in melanoma To investigate the biological function and mechanism of action of NOD2 in melanoma. We performed transcriptome sequencing of NOD2 overexpressing SK-MEL-110 melanoma cells. This study identified 1583 differentially expressed genes, including 914 upregulated and 669 downregulated genes (Fig. 6 A). To better understand the functions of downregulated genes, we screened the top 30 downregulated genes and performed GO analysis (Fig. 6 B). We also focused on the top 20 downregulated genes and performed KEGG enrichment analysis (Fig. 6 C). We specifically focused on the biological processes of the cell cycle, pyrimidine metabolism, antifolate resistance, and one-carbon pool by folate. PLK1 is a critical gene in the cell cycle 33 , whereas TYMS plays essential roles in pyrimidine metabolism 34 , antifolate resistance, and one-carbon pool by folate. To establish whether TYMS and PLK1 are regulated by NOD2 expression, we analyzed the TYMS and PLK1 expression levels in melanoma using the GEPIA online database. The results showed that the expression of TYMS and PLK1 was significantly upregulated in melanoma compared with normal tissues (Fig. 6 D, E). In addition, we examined the expression of TYMS and PLK1 in A875 and SK-MEL-110 cells with NOD2 overexpression and knockdown by real-time PCR and Western blot. The results showed that NOD2 overexpression inhibited the mRNA expression of TYMS and PLK1 (Fig. 6 F) and decreased the protein expression level (Fig. 6 G). In addition, we observed that NOD2 overexpression suppressed p-PLK1 expression, the activated form of PLK1, whereas NOD2 knockdown increased p-PLK1 expression (Fig. 6 G). Considering whether the enzymatic activity of TYMS was also affected by NOD2, we examined TYMS activity. We identified that overexpression of NOD2 in A875 and SK-MEL-110 cells suppressed TYMS activity, whereas knockdown of NOD2 increased TYMS activity (Fig. 6 H). In conclusion, our present results suggest that NOD2 may function in melanoma by regulating the expression and activities of TYMS and PLK1. NOD2 negatively regulates TYMS expression by affecting TYMS ubiquitination As suggested in our results (Fig. 6 ), NOD2 not only plays a role in adjusting the expression of TYMS at the mRNA level but also significantly affects the expression of TYMS at the protein level. In order to explore the regulatory mechanism of NOD2 on TYMS more deeply, it was suggested that TYMS might be degraded through the proteasome pathway according to a previous study 35 . In our experiments, we added Cycloheximide (CHX) and proteasome inhibitor MG-132 to NOD2 knockdown and overexpression A875 and SK-MEL-110 cells to verify whether NOD2 affects TYMS protein stability in melanoma cells. The results showed that after CHX treatment, the NOD2 overexpression accelerated TYMS degradation in melanoma cells, whereas the knockdown of NOD2 slowed down TYMS degradation (Fig. 7 A). This effect was reversed after CHX combined with MG132 treatment (Fig. 7 B), implying that NOD2 plays an important role in the TYMS proteasome degradation pathway. Furthermore, it was found that changes in NOD2 expression affected the overall ubiquitination level of TYMS. With overexpression of NOD2, the ubiquitination level of TYMS increased, whereas knockdown of NOD2 led to a decrease in the ubiquitination level of TYMS (Fig. 7 C). Thus, the results suggest that NOD2 regulates TYMS expression in melanoma by promoting the degradation of TYMS and modulating its ubiquitination level. TYMS regulates PLK1 expression and activation through interaction with PLK1 Based on the above studies, NOD2 may regulate the biological behavior of melanoma cells by influencing the expression levels and activation status of TYMS and PLK1. Since PLK1 is a direct checkpoint of the cell cycle, we hypothesized that NOD2 regulation of the biological behavior of melanoma cells through TYMS ultimately depends on the alteration of PLK1. To investigate the relationship between the roles of TYMS and PLK1, we performed a correlation analysis of TYMS and PLK1 in melanoma using the GEPIA database, which revealed a significant positive correlation between TYMS and PLK1 (Fig. 8 A). We added 5-FU, a target inhibitor of TYMS 24 , to melanoma cells A875 and SK-MEL-110, the results of the TYMS activity assay showed a continuous decrease in TYMS activity at 4 and 24 h post-5-FU addition. However, at 48 h, we found that the TYMS activity was higher than that at 24 h (Fig. 8 B). Next, we added 5-FU to A875 and SK-MEL-110, which resulted in the presence of TYMS in two forms 36 , most of which were captured by 5-fluorodeoxyuridine monophosphate (FdUMP), a major metabolite of 5-FU, to form an inactive form (FdUMP-TYMS), while the remaining small amount of free TYMS constituted the active form (free-TYMS). We observed a continuous incremental trend in FdUMP-TYMS content with increasing exposure time to 5-FU. In contrast, free-TYMS content decreased significantly until 48 h, which tended to increase when the exposure time reached 48 h. The FdUMP-TYMS content increased with extending exposure time to 5-FU (Fig. 8 C). This phenomenon is consistent with the results of the TYMS activity assay. We speculate that this may be due to the prolonged exposure of human melanoma cells to 5-FU, resulting in resistance to 5-FU treatment and diminished inhibition of TYMS. Notably, we observed that the expression of PLK1 and p-PLK1 was also downregulated by adding 5-FU (Fig. 8 C). This also suggests that PLK1 acts as a downstream effector molecule of TYMS, and TYMS positively regulates the activity and expression of PLK1. To further investigate the mode of action between TYMS and PLK1, we performed cellular immunofluorescence (IF) staining and co-immunoprecipitation (CO-IP) experiments in A875 and SK-MEL-110 cells. The staining results showed that TYMS was expressed in both cytoplasm and nucleus, PLK1 was expressed in the nucleus, and TYMS and PLK1 showed co-localized expression in the nucleus (Fig. 8 D). The results of the CO-IP experiments showed a direct interaction between TYMS and PLK1 (Fig. 8 E). Moreover, the GST Pull-down assay showed that TYMS and PLK1 also interacted directly in vitro (Fig. 8 F). IHC assay of subcutaneous transplanted tumors injected with NOD2 overexpressing and knockdown A875 cells showed that TYMS and PLK1 expression were consistently negatively regulated by NOD2 (Fig. 8 G). Based on these findings, we can infer that TYMS and PLK1 form a signaling axis of action in a direct reciprocal manner and that NOD2 exerts its biological functions by regulating the TYMS/PLK1 signaling axis. NOD2 reduces chemoresistance targeting TYMS in melanoma Since TYMS is an essential target of tumor chemotherapeutic agents based on 5-FU 24 and some folate analogs 37 , its expression directly correlates with tumor chemoresistance. Based on this evidence, we conjectured that NOD2 may affect chemoresistance in melanoma through the TYMS/PLK1 signaling axis. We examined the IC50 values of the clinically targeted chemotherapeutic drugs 5-FU and CAP for TYMS in NOD2 overexpressed and knockdown A875 and SK-MEL-110 cells to verify this conjecture. The results showed that the IC50 values of 5-FU and CAP were decreased in NOD2 overexpressing cells compared to controls, while NOD2 knockdown increased the IC50 values of 5-FU and CAP (Fig. 9 A, B). In the following study, we used A875 and SK-MEL-110 cells with overexpression and knockdown of NOD2 and treated them with the chemotherapeutic agents 5-FU and CAP. The MTS results showed that in cells with NOD2 overexpression, 5-FU and CAP treatment could inhibit cell proliferation more significantly, whereas this inhibitory effect was attenuated in cells with NOD2 knockdown (Fig. 9 C, D). In addition, using 5-FU to treat A875 cells with NOD2 overexpression and CAP to treat SK-MEL-110 cells with NOD2 overexpression was also able to significantly reduce the migration ability of cells (Fig. 9 E). Combination therapy targeting inhibition of TYMS and PLK1 suppresses melanoma progression Melanoma is complex and prone to drug resistance, limiting the efficacy of monotherapy. Next, the study evaluated the effectiveness of targeting TYMS and PLK1 as therapeutic targets. A875 and SK-MEL-110 cells were treated with volasertib (BI6727), a targeted inhibitor of PLK1, and 5-FU, CAP alone, as well as BI6727 combined with 5-FU and BI6727 combined with CAP treated cells. MTS results showed that compared to treatment alone, BI6727 combined with 5-FU and BI6727 combined with CAP treatment exerted a synergistic inhibitory effect on cell proliferation (Fig. 10 A). The synergistic inhibitory effect of combination treatment on cell migration was also observed in the cell migration assay (Fig. 10 B). Moreover, in the post-tumorigenic treatment experiments in nude mice subcutaneously injected with A875 cells, compared with the control group, the tumor was significantly reduced in the group treated with 5-FU and BI6727, respectively, and the tumor reduction was even more significant in the group treated with the combination of 5-FU and BI6727 (Fig. 10 C). In summary, combination therapy for melanoma cell progression is an effective therapeutic strategy that can enhance the therapeutic effect by targeting NOD2, TYMS, and PLK1. Discussion The role of NOD2 in immune response 38 and inflammation 39 , 40 has been extensively studied. However, its involvement in tumors is diverse and remains incompletely elucidated. Previous research has revealed that NOD2 functions as an immunosurveillance factor in certain types of cancers, such as colorectal 14 and esophageal adenocarcinomas 13 , where it is considered protective. Conversely, aberrant activation of NOD2 has been implicated in liver 16 and cervical 15 cancers, leading to excessive inflammation that promotes tumor development. In this study, we aimed to investigate the role of NOD2 in melanoma. Our findings suggest that NOD2 has a protective function in this particular type of cancer. The upregulation of NOD2 inhibited melanoma cell proliferation and migratory invasion while promoting apoptosis. Moreover, NOD2 upregulation reduced chemoresistance, enhancing its effectiveness in combating melanoma cells. To better understand the mechanism of NOD2's role in melanoma development and treatment, we conducted a screening study and found that TYMS is a crucial gene regulated by NOD2. TYMS is involved in DNA synthesis and cell proliferation processes 23 . Some chemotherapeutic agents targeting TYMS, such as 5-FU and CAP, treat tumors by inhibiting the biosynthetic activity of TYMS. In cancer, TYMS's expression level and activity are closely associated with the malignant progression of tumors and resistance to chemotherapeutic drugs 29 , 41 , 42 , 43 . Therefore, reducing TYMS expression and activity may inhibit melanoma cell proliferation, promote apoptosis, inhibit epithelial-mesenchymal transition, and reduce resistance to chemotherapeutic agents. In addition, TYMS expression is affected by multiple regulatory mechanisms. For example, the transcription factor FOXM1 can directly promote the transcription of TYMS, which can lead to the resistance of hepatocellular carcinoma cells to chemotherapeutic agents such as 5-FU 29 . Non-coding RNAs, such as miRNAs and lncRNAs, are also involved in the regulation of TYMS. MiR-330-5p 41 and miR-140-3p 42 have been shown to inhibit tumor proliferation by suppressing the expression of TYMS. The long non-coding RNA SNHG15 promotes TYMS expression, leading to colorectal cancer resistance to 5-FU chemotherapeutic agents 43 . On the other hand, TYMS can inhibit the growth of human hepatocellular carcinoma cells and trigger DNA damage through proteasome-dependent pathway degradation 35 . Our present study found that TYMS expression and activity in melanoma are negatively regulated by NOD2, which increases the protein degradation of TYMS through the "ubiquitin-proteasome system". These findings fill a research gap regarding the protein factors that regulate TYMS expression and activity. However, further studies are needed to identify the specific proteasome that binds to TYMS and the specific site of ubiquitination of TYMS. Our results indicate that overexpression of NOD2 in melanoma inhibits the resistance of melanoma cells to chemotherapeutic drugs by reducing the expression level and activity of TYMS. Moreover, NOD2 activation and combined with 5-FU and CAP, synergistically inhibits melanoma proliferation and migration in vitro. Understanding the regulatory mechanisms of TYMS and its interactions with other factors can provide more insights into the intricacies of tumor biology. Our research has specifically shown that TYMS has a regulatory role in the expression and activity of PLK1. Through IF, CO-IP, and GST Pull-down experiments, we have demonstrated that TYMS directly binds to PLK1, forming a complex and exerting its regulatory effect. The significance of this finding lies in the well-documented role of PLK1 in cell cycle regulation, mitosis 44 , and tumorigenesis 45 . PLK1 is a driver protein in tumor DNA repair 46 , cell death pathways 47 , and epithelial-to-mesenchymal transition 48 . By disrupting cell cycle progression and inducing DNA damage, TYMS may lead to changes in PLK1 expression and activity, affecting processes such as proliferation, apoptosis, and EMT in tumor cells. Previous studies have suggested that TYMS and PLK1 may serve as prognostic markers for certain tumors 49 , 50 , but little is known about their specific roles and mechanisms of interaction. Therefore, our study is the first to provide evidence of TYMS's direct positive regulatory effect on PLK1 expression and activity. In addition, PLK1 is considered an attractive target for overcoming chemoresistance and immune checkpoints in clinical cancer therapy 51 , 52 . Studies have shown that PLK1 inhibitors, combined with radiotherapy and chemotherapeutic agents, exhibit excellent anticancer effects in laboratory experiments and animal models 53 , 54 , 55 , 56 . For instance, targeted inhibition of PLK1 has been proven to significantly hinder the progression of esophageal squamous cell carcinoma (ESCC) and reduce the resistance to doxorubicin, a commonly used chemotherapeutic drug 54 . Similarly, targeted inhibition of PLK1 has been found to inhibit the proliferation of laryngeal squamous cell carcinoma and decrease resistance to cisplatin 55 . To further explore the potential of the TYMS/PLK1 signaling axis in combination therapy, we have investigated the effects of combining a PLK1 inhibitor (BI6727) with 5-FU and CAP in melanoma. The aim was to determine the synergistic relationship between the combination treatments. The results showed that the combination treatment significantly suppressed melanoma proliferation and migration in vitro and inhibited melanoma growth in vivo compared to the individual treatments of 5-FU, CAP, and BI6727. These findings highlight the effectiveness of inhibiting TYMS and PLK1 in impeding melanoma progression and reducing chemoresistance. They also suggest that a combination of therapies could potentially overcome the susceptibility to resistance observed with 5-FU and CAP chemotherapy. Combining these treatments may improve melanoma patients' survival rates and overall outcomes. This study elucidates the role of NOD2 in inhibiting the malignant progression of melanoma and reducing chemoresistance. Our findings are consistent with previous studies that reported the inhibitory effect of NOD2 agonists and interferon combination therapy on melanoma growth by inducing an immune response, as reported, for example, by Fujimura et al. 57 . Furthermore, studies on tumor microparticle vaccines have shown that activation of NOD2 signaling can generate an anti-tumor immune response and inhibit melanoma growth 58 . Notably, previous research has primarily focused on the immunomodulatory role of NOD2 and its involvement in anti-tumor immune responses. In contrast, our study provides insights into the protective role of NOD2 in melanoma from a genetic standpoint. NOD2 exhibits different mechanisms of action in various diseases. NOD2 inhibits inflammation by activating NF-κB and MAPK signaling pathways 14 , 16 . In hepatocellular carcinoma, NOD2 activates AMPK, MAPK, NF-κB, STAT3, and ERK pathways and induces nuclear autophagy directly through lamin A/C 16, 59 , 60 . In melanoma, NOD2 acts by regulating the TYMS/PLK1 signaling axis. In summary, our study results evidence that NOD2 inhibits melanoma progression and reduces chemoresistance. Our findings also reveal the regulatory relationship between NOD2 and the TYMS/PLK1 signaling axis. Interestingly, NOD2 negatively regulates TYMS expression and activity in melanoma and accelerates the degradation of TYMS proteins via the ubiquitination-proteasome pathway. When TYMS expression and activity are altered, TYMS regulates PLK1 and p-PLK1 expression through direct binding to PLK1. Furthermore, combining NOD2 overexpression with TYMS inhibition and targeting TYMS and PLK1 combination therapy in our investigation exerted a synergistic suppressive effect on melanoma proliferation and migration. These findings provide potential avenues for further research and the development of melanoma treatment strategies. However, challenges such as the heterogeneity of NOD2 in tumors may limit the generalizability of these findings beyond melanoma. Moreover, additional research and clinical trials are necessary to ensure the safety and effectiveness of the suggested combination therapy. Declarations Conflict of Interest Statement The authors declare no conflict of interest. Ethics Statement All animal procedures were approved by the Ethical Review Committee for Animal Experiments of Kunming Medical University. Funding Statement This work was supported by the National Natural Science Foundation of China Nos. 82160540; 31960200; 81960462; 81760455; 31960145; 82103388. Author contributions Fang Yun completed most experiments and data analysis and drafted the manuscript. Na Wu, Xiaojia Yi, Xuedan Zhang, Yu Feng, Qinxuan Ni, Yanlong Gai, and Enjiang Li helped with in vivo experiments, data analysis and immunohistochemical staning. Zhe Yang, Qiao Zhang, and Buqing Sai assisted with experimental design and data analysis. Yingmin Kuang and Yuechun Zhu directed the study and edited the manuscript. All authors read and approved the manuscript for publication. Data Availability Statement All data generated during this study are available from the corresponding author upon reasonable request. References Siegel RL, Giaquinto AN, Jemal A. Cancer statistics, 2024. CA Cancer J Clin 2024, 74(1): 12–49. Mai R, Zhou S, Zhong W, Rong S, Cong Z, Li Y, et al. Therapeutic efficacy of combined BRAF and MEK inhibition in metastatic melanoma: a comprehensive network meta-analysis of randomized controlled trials. Oncotarget 2015, 6(29): 28502–28512. Wang L, Leite de Oliveira R, Huijberts S, Bosdriesz E, Pencheva N, Brunen D, et al. An Acquired Vulnerability of Drug-Resistant Melanoma with Therapeutic Potential. Cell 2018, 173(6): 1413–1425.e1414. Cowey CL, Boyd M, Aguilar KM, Beeks A, Krepler C, Scherrer E. An observational study of drug utilization and associated outcomes among adult patients diagnosed with BRAF-mutant advanced melanoma treated with first-line anti-PD-1 monotherapies or BRAF/MEK inhibitors in a community-based oncology setting. Cancer Med 2020, 9(21): 7863–7878. Ferrucci PF, Lens M, Cocorocchio E. Combined BRAF-Targeted Therapy with Immunotherapy in BRAF-Mutated Advanced Melanoma Patients. Curr Oncol Rep 2021, 23(12): 138. Nassar KW, Hintzsche JD, Bagby SM, Espinoza V, Langouët-Astrié C, Amato CM, et al. Targeting CDK4/6 Represents a Therapeutic Vulnerability in Acquired BRAF/MEK Inhibitor-Resistant Melanoma. Mol Cancer Ther 2021, 20(10): 2049–2060. Buchbinder EI, Giobbie-Hurder A, Ott PA. A phase I/II study of MCS110 with BRAF/MEK inhibition in patients with melanoma after progression on BRAF/MEK inhibition. Invest New Drugs 2023, 41(3): 365–370. Inohara, Chamaillard, McDonald C, Nuñez G. NOD-LRR proteins: role in host-microbial interactions and inflammatory disease. Annu Rev Biochem 2005, 74: 355–383. Gao J, Zhao X, Hu S, Huang Z, Hu M, Jin S, et al. Gut microbial DL-endopeptidase alleviates Crohn's disease via the NOD2 pathway. Cell Host Microbe 2022, 30(10): 1435–1449.e1439. Luo X, Wang X, Huang S, Xu B, Luo S, Li Y, et al. Paeoniflorin ameliorates experimental colitis by inhibiting gram-positive bacteria-dependent MDP-NOD2 pathway. Int Immunopharmacol 2021, 90: 107224. Mao L, Dhar A, Meng G, Fuss I, Montgomery-Recht K, Yang Z, et al. Blau syndrome NOD2 mutations result in loss of NOD2 cross-regulatory function. Front Immunol 2022, 13: 988862. Wang G, Zhang C, Jiang F, Zhao M, Xie S, Liu X. NOD2-RIP2 signaling alleviates microglial ROS damage and pyroptosis via ULK1-mediated autophagy during Streptococcus pneumonia infection. Neurosci Lett 2022, 783: 136743. Li X, Liu S, Jin L, Ma Y, Liu T. NOD2 inhibits the proliferation of esophageal adenocarcinoma cells through autophagy. J Cancer Res Clin Oncol 2023, 149(2): 639–652. Udden SMN, Peng L, Gan JL, Shelton JM, Malter JS, Hooper LV, et al. NOD2 Suppresses Colorectal Tumorigenesis via Downregulation of the TLR Pathways. Cell Rep 2017, 19(13): 2756–2770. Zhang Y, Li N, Yuan G, Yao H, Zhang D, Li N, et al. Upregulation of NOD1 and NOD2 contribute to cancer progression through the positive regulation of tumorigenicity and metastasis in human squamous cervical cancer. BMC Med 2022, 20(1): 55. Zhou Y, Hu L, Tang W, Li D, Ma L, Liu H, et al. Hepatic NOD2 promotes hepatocarcinogenesis via a RIP2-mediated proinflammatory response and a novel nuclear autophagy-mediated DNA damage mechanism. J Hematol Oncol 2021, 14(1): 9. Ghareghani M, Rivest S. The Synergistic Potential of Combining PD-1/PD-L1 Immune Checkpoint Inhibitors with NOD2 Agonists in Alzheimer's Disease Treatment. Int J Mol Sci 2023, 24(13). Guzelj S, Weiss M, Slütter B, Frkanec R, Jakopin Ž. Covalently Conjugated NOD2/TLR7 Agonists Are Potent and Versatile Immune Potentiators. J Med Chem 2022, 65(22): 15085–15101. Dong Y, Wang S, Wang C, Li Z, Ma Y, Liu G. Antagonizing NOD2 Signaling with Conjugates of Paclitaxel and Muramyl Dipeptide Derivatives Sensitizes Paclitaxel Therapy and Significantly Prevents Tumor Metastasis. J Med Chem 2017, 60(3): 1219–1224. Weekes CD, Nallapareddy S, Rudek MA, Norris-Kirby A, Laheru D, Jimeno A, et al. Thymidylate synthase (TYMS) enhancer region genotype-directed phase II trial of oral capecitabine for 2nd line treatment of advanced pancreatic cancer. Invest New Drugs 2011, 29(5): 1057–1065. Zhao M, Tan B, Dai X, Shao Y, He Q, Yang B, et al. DHFR/TYMS are positive regulators of glioma cell growth and modulate chemo-sensitivity to temozolomide. Eur J Pharmacol 2019, 863: 172665. Kumar A, Singh AK, Singh H, Thareja S, Kumar P. Regulation of thymidylate synthase: an approach to overcome 5-FU resistance in colorectal cancer. Med Oncol 2022, 40(1): 3. Carreras CW, Santi DV. The catalytic mechanism and structure of thymidylate synthase. Annu Rev Biochem 1995, 64: 721–762. Longley DB, Harkin DP, Johnston PG. 5-fluorouracil: mechanisms of action and clinical strategies. Nat Rev Cancer 2003, 3(5): 330–338. Tsukihara H, Tsunekuni K, Takechi T. Folic Acid-Metabolizing Enzymes Regulate the Antitumor Effect of 5-Fluoro-2'-Deoxyuridine in Colorectal Cancer Cell Lines. PLoS One 2016, 11(9): e0163961. Guijarro MV, Kellish PC, Dib PE, Paciaroni NG, Nawab A, Andring J, et al. First-in-class multifunctional TYMS nonclassical antifolate inhibitor with potent in vivo activity that prolongs survival. JCI Insight 2023, 8(10). Xu F, Ye ML, Zhang YP, Li WJ, Li MT, Wang HZ, et al. MicroRNA-375-3p enhances chemosensitivity to 5-fluorouracil by targeting thymidylate synthase in colorectal cancer. Cancer Sci 2020, 111(5): 1528–1541. Kim N, Yang C. Sodium Butyrate Inhibits the Expression of Thymidylate Synthase and Induces Cell Death in Colorectal Cancer Cells. Int J Mol Sci 2024, 25(3). Wang L, Shi C, Yu J, Xu Y. FOXM1-induced TYMS upregulation promotes the progression of hepatocellular carcinoma. Cancer Cell Int 2022, 22(1): 47. Guijarro MV, Nawab A, Dib P, Burkett S, Luo X, Feely M, et al. TYMS promotes genomic instability and tumor progression in Ink4a/Arf null background. Oncogene 2023, 42(23): 1926–1939. Gutteridge RE, Singh CK, Ndiaye MA, Ahmad N. Targeted knockdown of polo-like kinase 1 alters metabolic regulation in melanoma. Cancer Lett 2017, 394: 13–21. Su S, Chhabra G, Ndiaye MA, Singh CK, Ye T, Huang W, et al. PLK1 and NOTCH Positively Correlate in Melanoma and Their Combined Inhibition Results in Synergistic Modulations of Key Melanoma Pathways. Mol Cancer Ther 2021, 20(1): 161–172. Kalous J, Aleshkina D. Multiple Roles of PLK1 in Mitosis and Meiosis. Cells 2023, 12(1). Anderson DD, Quintero CM, Stover PJ. Identification of a de novo thymidylate biosynthesis pathway in mammalian mitochondria. Proc Natl Acad Sci U S A 2011, 108(37): 15163–15168. Yang A, Wu Q, Chen Q, Yang J, Li H, Tao Y, et al. Cinobufagin restrains the growth and triggers DNA damage of human hepatocellular carcinoma cells via proteasome-dependent degradation of thymidylate synthase. Chem Biol Interact 2022, 360: 109938. Kurasaka C, Nishizawa N, Ogino Y, Sato A. Trapping of 5-Fluorodeoxyuridine Monophosphate by Thymidylate Synthase Confers Resistance to 5-Fluorouracil. ACS Omega 2022, 7(7): 6046–6052. Goldman ID, Zhao R. Molecular, biochemical, and cellular pharmacology of pemetrexed. Semin Oncol 2002, 29(6 Suppl 18): 3–17. Napier RJ, Lee EJ, Davey MP, Vance EE, Furtado JM, Snow PE, et al. T cell-intrinsic role for Nod2 in protection against Th17-mediated uveitis. Nat Commun 2020, 11(1): 5406. Rochereau N, Roblin X, Michaud E, Gayet R, Chanut B, Jospin F, et al. NOD2 deficiency increases retrograde transport of secretory IgA complexes in Crohn's disease. Nat Commun 2021, 12(1): 261. Watson A, Satter LF, Reiland Sauceda A, Kellermayer R, Karam LB. NOD2 polymorphisms may direct a Crohn's disease phenotype in patients with Very EarlyOnset Inflammatory Bowel Disease. J Pediatr Gastroenterol Nutr 2023. Karimi L, Jaberi M, Asadi M, Zarredar H, Zafari V, Bornehdeli S, et al. Significance of microRNA-330-5p/TYMS Expression Axis in the Pathogenesis of Colorectal Tumorigenesis. J Gastrointest Cancer 2022, 53(4): 965–970. Wan S, Liu Z, Chen Y, Mai Z, Jiang M, Di Q, et al. MicroRNA-140-3p represses the proliferation, migration, invasion and angiogenesis of lung adenocarcinoma cells via targeting TYMS (thymidylate synthetase). Bioengineered 2021, 12(2): 11959–11977. Li M, Sun S, Bian Z, Yao S, Liu M, You X, et al. SNHG15 promotes chemoresistance and glycolysis in colorectal cancer. Pathol Res Pract 2023, 246: 154480. Dalvi PS, Macheleidt IF, Lim SY, Meemboor S, Müller M, Eischeid-Scholz H, et al. LSD1 Inhibition Attenuates Tumor Growth by Disrupting PLK1 Mitotic Pathway. Mol Cancer Res 2019, 17(6): 1326–1337. Gheghiani L, Wang L, Zhang Y, Moore XTR, Zhang J, Smith SC, et al. PLK1 Induces Chromosomal Instability and Overrides Cell-Cycle Checkpoints to Drive Tumorigenesis. Cancer Res 2021, 81(5): 1293–1307. De Blasio C, Zonfrilli A, Franchitto M, Mariano G, Cialfi S, Verma N, et al. PLK1 targets NOTCH1 during DNA damage and mitotic progression. J Biol Chem 2019, 294(47): 17941–17950. Li X, Chen G, Liu B, Tao Z, Wu Y, Zhang K, et al. PLK1 inhibition promotes apoptosis and DNA damage in glioma stem cells by regulating the nuclear translocation of YBX1. Cell Death Discov 2023, 9(1): 68. Shin SB, Jang HR, Xu R, Won JY, Yim H. Active PLK1-driven metastasis is amplified by TGF-β signaling that forms a positive feedback loop in non-small cell lung cancer. Oncogene 2020, 39(4): 767–785. Zhang YQ, Yuan Y, Zhang J, Lin CY, Guo JL, Liu HS, et al. Evaluation of the roles and regulatory mechanisms of PD-1 target molecules in NSCLC progression. Ann Transl Med 2021, 9(14): 1168. Reza MS, Hossen MA, Harun-Or-Roshid M, Siddika MA, Kabir MH, Mollah MNH. Metadata analysis to explore hub of the hub-genes highlighting their functions, pathways and regulators for cervical cancer diagnosis and therapies. Discov Oncol 2022, 13(1): 79. Zhang Z, Cheng L, Li J, Qiao Q, Karki A, Allison DB, et al. Targeting Plk1 Sensitizes Pancreatic Cancer to Immune Checkpoint Therapy. Cancer Res 2022, 82(19): 3532–3548. Jang HR, Shin SB, Kim CH, Won JY, Xu R, Kim DE, et al. PLK1/vimentin signaling facilitates immune escape by recruiting Smad2/3 to PD-L1 promoter in metastatic lung adenocarcinoma. Cell Death Differ 2021, 28(9): 2745–2764. Wang D, Veo B, Pierce A, Fosmire S, Madhavan K, Balakrishnan I, et al. A novel PLK1 inhibitor onvansertib effectively sensitizes MYC-driven medulloblastoma to radiotherapy. Neuro Oncol 2022, 24(3): 414–426. Zeng TT, Deng TH, Liu Z, Zhan JR, Ma YZ, Yan YY, et al. HN1L/AP-2γ/PLK1 signaling drives tumor progression and chemotherapy resistance in esophageal squamous cell carcinoma. Cell Death Dis 2022, 13(12): 1026. Gao W, Zhang Y, Luo H, Niu M, Zheng X, Hu W, et al. Targeting SKA3 suppresses the proliferation and chemoresistance of laryngeal squamous cell carcinoma via impairing PLK1-AKT axis-mediated glycolysis. Cell Death Dis 2020, 11(10): 919. Zhang S, Yu J, Tan X, Cheng S, Liu H, Li Z, et al. A novel L-shaped ortho-quinone analog as PLK1 inhibitor blocks prostate cancer cells in G(2) phase. Biochem Pharmacol 2024, 219: 115960. Fujimura T, Yamasaki K, Hidaka T, Ito Y, Aiba S. A synthetic NOD2 agonist, muramyl dipeptide (MDP)-Lys (L18) and IFN-β synergistically induce dendritic cell maturation with augmented IL-12 production and suppress melanoma growth. J Dermatol Sci 2011, 62(2): 107–115. Dong W, Zhang H, Yin X, Liu Y, Chen D, Liang X, et al. Oral delivery of tumor microparticle vaccines activates NOD2 signaling pathway in ileac epithelium rendering potent antitumor T cell immunity. Oncoimmunology 2017, 6(3): e1282589. Ma X, Qiu Y, Sun Y, Zhu L, Zhao Y, Li T, et al. NOD2 inhibits tumorigenesis and increases chemosensitivity of hepatocellular carcinoma by targeting AMPK pathway. Cell Death Dis 2020, 11(3): 174. Gurses SA, Banskar S, Stewart C, Trimoski B, Dziarski R, Gupta D. Nod2 protects mice from inflammation and obesity-dependent liver cancer. Sci Rep 2020, 10(1): 20519. Additional Declarations (Not answered) Cite Share Download PDF Status: Published Journal Publication published 01 Oct, 2024 Read the published version in Cell Death & Disease → Version 1 posted Editorial decision: revise 28 Jun, 2024 Review # 1 received at journal 20 Jun, 2024 Review # 2 received at journal 19 Jun, 2024 Reviewer # 2 agreed at journal 06 Jun, 2024 Reviewer # 1 agreed at journal 06 Jun, 2024 Reviewers invited by journal 02 Jun, 2024 Submission checks completed at journal 29 Apr, 2024 Editor assigned by journal 25 Apr, 2024 First submitted to journal 25 Apr, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4324307","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":309636275,"identity":"03d0db84-5875-44a3-ae89-ba1975af0c3b","order_by":0,"name":"chun Zhu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4klEQVRIiWNgGAWjYDACCQiVwMDAfJgBziZSC1syyVp4jInTIj+7x0yap8Iuz+B2z2ejmzmHGfjZcwwYfu7ArYVxzhmgljPJxQZ3zm5Ozt12mEGy540BY+8Z3FqYJXLMpHnbDiRuuJG7+TBIi8GNHANmxjbcWtjAWv6BtOQ8BmuxJ6SFB6ylAayFGewwAwkCWiQk0oot5xxLTpx5I83YOHdbOo/EmWcFB3vxaJGfkbzxxpsau8S+G8mPpXO3WcvxtydvfPATjxYgYJFAcSmIOIBXAzDQPhBQMApGwSgYBSMdAAABBVBj0Nag4AAAAABJRU5ErkJggg==","orcid":"","institution":"Kunming Medical University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"chun","middleName":"","lastName":"Zhu","suffix":""},{"id":309636276,"identity":"d159b9b3-e9da-434b-b6f2-f677454c134f","order_by":1,"name":"Fang Yun","email":"","orcid":"","institution":"Kunming Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fang","middleName":"","lastName":"Yun","suffix":""},{"id":309636277,"identity":"6434545e-84a4-4c34-bbb1-3175eff7254f","order_by":2,"name":"Na Wu","email":"","orcid":"","institution":"Kunming Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Na","middleName":"","lastName":"Wu","suffix":""},{"id":309636278,"identity":"5971dd93-92a2-45da-8287-1f70553edf65","order_by":3,"name":"Xiao Yi","email":"","orcid":"","institution":"The Second Affiliated Hospital of Kunming Medical University, Kunming","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiao","middleName":"","lastName":"Yi","suffix":""},{"id":309636279,"identity":"2e86ba55-30b5-41fe-9d74-723b60e77635","order_by":4,"name":"Xue Zhang","email":"","orcid":"","institution":"Kunming Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xue","middleName":"","lastName":"Zhang","suffix":""},{"id":309636280,"identity":"dd6a4d6b-8cd1-4e53-89b8-8c4bfe24b3b3","order_by":5,"name":"Yu Feng","email":"","orcid":"","institution":"Kunming Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Feng","suffix":""},{"id":309636281,"identity":"6f71d12a-7e8d-476e-8097-575e012e9d90","order_by":6,"name":"Qin Ni","email":"","orcid":"","institution":"Kunming Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qin","middleName":"","lastName":"Ni","suffix":""},{"id":309636282,"identity":"745c1fde-20d4-4275-a300-fd9b242504c3","order_by":7,"name":"Yan Gai","email":"","orcid":"","institution":"Kunming Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Gai","suffix":""},{"id":309636283,"identity":"73461cd2-8999-4eaa-b900-3759cc2853b8","order_by":8,"name":"En Li","email":"","orcid":"","institution":"Kunming Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"En","middleName":"","lastName":"Li","suffix":""},{"id":309636284,"identity":"89f47251-a470-45c2-acd4-08d0762af998","order_by":9,"name":"Zhe Yang","email":"","orcid":"","institution":"The First Affiliated Hospital of Kunming Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhe","middleName":"","lastName":"Yang","suffix":""},{"id":309636285,"identity":"4ebb85f3-13a8-416e-bcf8-570726a02527","order_by":10,"name":"Qiao Zhang","email":"","orcid":"","institution":"Kunming Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qiao","middleName":"","lastName":"Zhang","suffix":""},{"id":309636286,"identity":"0caefa18-48a2-4bcc-b2b2-e30a514d653f","order_by":11,"name":"Buqing Sai","email":"","orcid":"","institution":"Kunming Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Buqing","middleName":"","lastName":"Sai","suffix":""},{"id":309636287,"identity":"43a8fd6a-aa32-4b03-a7a4-3bc6666bf68c","order_by":12,"name":"Ying Kuang","email":"","orcid":"","institution":"The First Affiliated Hospital of Kunming Medical University, Kunming","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Kuang","suffix":""}],"badges":[],"createdAt":"2024-04-25 13:02:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4324307/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4324307/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41419-024-07104-8","type":"published","date":"2024-10-01T04:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":58330809,"identity":"eb56704b-21b6-45c3-b9aa-842b3afd6ed8","added_by":"auto","created_at":"2024-06-14 03:52:05","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":470006,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNOD2 is lowly expressed in melanoma and suggests a poor prognosis for melanoma patients\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) GEPIA database analysis of NOD2 mRNA expression levels in normal and melanoma tissues.\u003c/p\u003e\n\u003cp\u003e(B) TCGA database analysis of NOD2 mRNA expression levels in normal, primary, and metastatic melanoma tissues.\u003c/p\u003e\n\u003cp\u003e(C) Correlation between NOD2 expression in the UALCAN database and prognosis of melanoma patients.\u003c/p\u003e\n\u003cp\u003e(D, E) mRNA of NOD2 in human melanocytes HEM and melanoma cells A375, A875, SK-MEL-28, and SK-MEL-110 was detected by real-time PCR (D), and the protein expression level was detected by Western blot (E).\u003c/p\u003e\n\u003cp\u003e(F-H) Construction of stably transfected cells with NOD2 knockdown and overexpression in A875 and SK-MEL-110. Protein expression levels were detected by Western blot (F, G), and mRNA expression levels were detected by real-time PCR (H).\u003c/p\u003e\n\u003cp\u003eData are expressed as the mean ± SD. Student’s t-test and one-way ANOVA were used to compare the differences. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4324307/v1/3b1e7547596d78084e62983f.png"},{"id":58330343,"identity":"c25effcf-517d-42b9-9edb-68136fa1c1e0","added_by":"auto","created_at":"2024-06-14 03:44:05","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1239785,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNOD2 inhibits the proliferation of melanoma cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-F) demonstrate the impact of NOD2 overexpression and knockdown on proliferation, colony formation ability, DNA synthesis rate, cell cycle distribution, and expression of mRNA and protein related cyclins in A875 and SK-MEL-110 cells as determined by different experimental methods. These experimental methods included MTS assay for cell proliferation rate (Figure A), colony formation assay for colony size (Figure B), and EdU staining for DNA synthesis rate (Figure C) (scale bar = 75 μm). The distribution of the cell cycle phase was detected by flow cytometry (Figure D). Cyclin expression level was detected using real-time PCR (Figure E) and Western blot (Figure F). Data were expressed as the mean ± SD and analyzed by Student’s t-test. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4324307/v1/f09a1570c182d20f086c28ff.png"},{"id":58330344,"identity":"ac2a55f9-3e8c-40e0-9b5e-e54d46b1e285","added_by":"auto","created_at":"2024-06-14 03:44:05","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":602879,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNOD2 promotes apoptosis in human melanoma cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Apoptosis after overexpression and knockdown of NOD2 in A875 and SK-MEL-110 cells was determined by flow cytometry. (B, C) Real-time PCR (B) and Western blot (C) assays were used to determine the mRNA and protein expression levels of the apoptotic proteins Bax and Caspase 3 and the anti-apoptotic protein Bcl2 after NOD2 overexpression and knockdown in A875 and SK-MEL-110 cells. Data were expressed as the mean ± SD and analyzed by Student’s t-test. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4324307/v1/7c600cc7279c86bf519e5653.png"},{"id":58330814,"identity":"a5212e70-883b-4639-a83c-d9a2672df891","added_by":"auto","created_at":"2024-06-14 03:52:05","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2691260,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNOD2 inhibits melanoma cell migration and invasion\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Scratch assay was used to determine wound healing at 0h and 24h after NOD2 overexpression and knockdown in A875 and SK-MEL-110 cells. (B, C)\u003c/p\u003e\n\u003cp\u003eTranswell migration assay was used to assess the migration ability of cells, and Transwell invasive assay was used to evaluate the invasive ability of cells. A875 and SK-MEL-110 cells were divided into NOD2 overexpression and knockdown groups, and the quantity of cells in the lower section was tallied at 24h. Scale bar = 50 μm. (D) Western blot was used to determine the expression level of EMT protein in NOD2 overexpression and knockdown cells. Data were expressed as the mean ± SD and analyzed by Student’s t-test. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4324307/v1/ff4454431bf6c404bcf87bd3.png"},{"id":58331233,"identity":"560afc86-ce98-4535-9a9e-deae4f762cc4","added_by":"auto","created_at":"2024-06-14 04:00:05","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3107462,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNOD2 inhibits human melanoma growth in vivo\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-C) 1×107 of A875 cells with NOD2 overexpression and control (OE-NC) were injected into the left (OE-NC) and right (OE-NOD2) sides of BALB/c nude mice. After tumor formation, mice were euthanized, and photographs of the tumors were taken (A). Tumor volume was monitored, and growth curves were plotted (B). Tumor weight was measured (C).\u003c/p\u003e\n\u003cp\u003e(D-F) 1×107 of A875 cells with NOD2 knockdown and control (sh-NC) were injected into the left (sh-NC) and right (sh-NOD2) sides of BALB/c nude mice. After tumor formation, mice were euthanized, and photographs of the tumors were taken (D). Tumor volume was monitored, and growth curves were plotted (E). Tumor weight was measured (F).\u003c/p\u003e\n\u003cp\u003e(G) NOD2 expression and related cyclins was detected by Western blot.\u003c/p\u003e\n\u003cp\u003e(H) HE staining and IHC staining of the tumor.\u003c/p\u003e\n\u003cp\u003eData were expressed as the mean ± SD and analyzed by Student’s t-test. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4324307/v1/11f161f20566b64ee3147d3a.png"},{"id":58330811,"identity":"c0e51de2-93dd-4a57-bd63-1f675a1124d4","added_by":"auto","created_at":"2024-06-14 03:52:05","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":779546,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNOD2 negatively regulates the expression and activities of TYMS and PLK1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Volcano plot of differential gene distribution after NOD2 overexpression in SK-MEL-110 melanoma cells.\u003c/p\u003e\n\u003cp\u003e(B, C) GO analysis of the top 30 down-regulated genes (B) and KEGG analysis of the top 20 down-regulated genes (C) in NOD2 overexpressing SK-MEL-110 melanoma cells.\u003c/p\u003e\n\u003cp\u003e(D, E) GEPIA database analysis of mRNA expression of TYMS and PLK1 in melanoma and normal tissues.\u003c/p\u003e\n\u003cp\u003e(F, G) Real-time PCR determination of mRNA expression of TYMS, PLK1 after NOD2 overexpression and knockdown in A875 and SK-MEL-110 cells (F) and Western blot determination of protein levels of TYMS, PLK1, and p-PLK1 (G).\u003c/p\u003e\n\u003cp\u003e(H) ELISA kit evaluates TYMS activity after NOD2 overexpressing and knockdown in A875 and SK-MEL-110 cells.\u003c/p\u003e\n\u003cp\u003eData were expressed as the mean ± SD and analyzed by Student’s t-test. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4324307/v1/560ae5d79996a62cbd1f5799.png"},{"id":58330347,"identity":"cd870d68-8d1c-4a77-b137-7ebeb6f7dafe","added_by":"auto","created_at":"2024-06-14 03:44:05","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1893341,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNOD2 promotes proteasomal degradation of TYMS and ubiquitination of TYMS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-B) Western blot detection of protein levels of TYMS in stably transfected A875 and SK-MEL-110 cells treated with cycloheximide (CHX) (100 μg/mL) with or without MG132 (10 μg/mL) for 0, 3, 6, and 9 hours.\u003c/p\u003e\n\u003cp\u003e(C) CO-IP assay detected the ubiquitination expression level of TYMS in stably transfected A875 and SK-MEL-110 cells.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4324307/v1/eb4c680dc159c17850fa21ff.png"},{"id":58330352,"identity":"899593b5-55d0-4e07-88b0-eee754c144f7","added_by":"auto","created_at":"2024-06-14 03:44:05","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1611734,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTYMS regulates PLK1 expression and activation through interaction with PLK1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Correlation analysis of TYMS and PLK1 in melanoma in the GEPIA database.\u003c/p\u003e\n\u003cp\u003e(B) A875 and SK-MEL-110 cells were treated with 5-FU (5 μg/ml) for 0, 4, 24, and 48 h, then evaluated for TYMS activity by ELISA kit.\u003c/p\u003e\n\u003cp\u003e(C) A875 and SK-MEL-110 cells were treated with 5-FU (5 μg/ml) for 0, 4, 8, 16, 24, and 48 h. Western blot assays to detect the expression of TYMS, PLK1, and p-PLK1.\u003c/p\u003e\n\u003cp\u003e(D) IF assay to analyze the localization of TYMS and PLK1 in A875 and SK-MEL-110 cells. Scale=20 μm\u003c/p\u003e\n\u003cp\u003e(E) CO-IP assay to detect the interaction between TYMS and PLK1 in A875 and SK-MEL-110 cells.\u003c/p\u003e\n\u003cp\u003e(F) GST Pull-down assay detects direct interaction between TYMS and PLK1.\u003c/p\u003e\n\u003cp\u003e(G) IHC staining of TYMS and P-PLK1 in NOD2 overexpressing and knockdown tumors. Scale=50 μm\u003c/p\u003e\n\u003cp\u003eData were expressed as the mean ± SD and analyzed by Student’s t-test. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-4324307/v1/49d6752c5e1968fbf80e8385.png"},{"id":58330810,"identity":"bbdd695e-fe1c-41d1-baed-4af20161e9c2","added_by":"auto","created_at":"2024-06-14 03:52:05","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":756453,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNOD2 reduces chemoresistance targeting TYMS in melanoma\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A, B) MTS assay to determine the IC50 values of NOD2 knockdown and overexpression in A875 and SK-MEL-110 cells after 48h treatment with 5-FU (5 μg/ml) and CAP (2 mM).\u003c/p\u003e\n\u003cp\u003e(C, D) MTS assay was performed to determine the proliferation of A875 and SK-MEL-110 cells with overexpression and knockdown of NOD2 after treatment with 5-FU and CAP.\u003c/p\u003e\n\u003cp\u003e(E) Transwell migration assay was used to assess the migration ability of A875 cells with overexpression of NOD2 after 5-FU treatment and SK-MEL-110 cells with overexpression of NOD2 after CAP treatment.\u003c/p\u003e","description":"","filename":"Figure9.png","url":"https://assets-eu.researchsquare.com/files/rs-4324307/v1/79fa3b2bcc6e442d904b46e8.png"},{"id":58331795,"identity":"d2178aa8-7d74-453f-bafa-7903c0d481db","added_by":"auto","created_at":"2024-06-14 04:08:05","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":1646159,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCombination therapy targeting inhibition of TYMS and PLK1 suppresses melanoma progression both in vitro and in vivo\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) MTS assay was used to determine the proliferation of A875 and SK-MEL-110 cells after treatment with BI6727, 5-FU, and CAP, respectively, as well as combined treatment with BI6727 and 5-FU, BI6727, and CAP for 24 hours.\u003c/p\u003e\n\u003cp\u003e(B) Transwell migration assay was used to determine the 24-hour cell migration capacity of A875 cells after treatment with BI6727 combined with 5-FU and SK-MEL-110 cells after treatment with BI6727 combined with CAP. 5-FU (5 μg/ml), CAP (2 mM), BI6727 (100 nM).\u003c/p\u003e\n\u003cp\u003e(C-E) Nude mice were injected subcutaneously with 1×107 of A875 cells. After tumor formation, they were injected intraperitoneally with saline, 5-FU (25 mg/kg), BI6727 (10 mg/kg), and combined 5-FU and BI6727, respectively. Mice were euthanized, and the tumors were peeled off and photographed (C). Tumor volume was monitored, and growth curves were plotted (D). Tumor weight was measured (E).\u003c/p\u003e\n\u003cp\u003e(F) Model diagram of the role and mechanism of NOD2 in melanoma.\u003c/p\u003e\n\u003cp\u003eData were expressed as the mean ± SD and analyzed by Student’s t-test. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001\u003c/p\u003e","description":"","filename":"Figure10.png","url":"https://assets-eu.researchsquare.com/files/rs-4324307/v1/0cba34531987805d6fc64931.png"},{"id":65751010,"identity":"3f719c32-4918-43a4-a99e-8ef6f0920ede","added_by":"auto","created_at":"2024-10-02 07:07:47","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":16980120,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4324307/v1/6e2e0d8c-5eb4-48e3-86dd-88d8d78a1611.pdf"}],"financialInterests":"(Not answered)","formattedTitle":"NOD2 reduces the chemoresistance of melanoma by \r\ninhibiting the TYMS/PLK1 signaling axis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMelanoma is one of the top ten most dangerous tumors because of its rapid progression, ease of metastasis, and poor prognosis. According to statistics, the number of new cutaneous melanomas is estimated to reach 100,640 cases and 8290 deaths globally in 2024\u003csup\u003e1\u003c/sup\u003e. Although targeted therapies and immunotherapies represented by BRAF/MEK inhibitors and anti-PD1 have improved the therapeutic efficacy of melanoma treatment to a certain extent, their toxic side effects and chemoresistance have not yet been effectively resolved\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. However, several clinical studies have shown that combination therapy can exert an excellent synergistic effect and effectively reduce tumor resistance to drugs, thus significantly improving the anti-tumor effect\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Therefore, exploring the molecular mechanisms of melanoma development and chemoresistance, as well as the impact of combination therapy, would facilitate the identification of new therapeutic strategies for melanoma treatment.\u003c/p\u003e \u003cp\u003eNucleotide-binding oligomerization domain 2 (NOD2) is an intracellular pattern recognition receptor in the immune response\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Reported studies have clarified the critical function of NOD2 in controlling inflammatory diseases and invasion of host microorganisms, like Crohn's disease\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e, colitis\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e, Blau syndrome\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e, and meningitis\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Recent investigations have pointed out that aberrant NOD2 expression is tied to cancer progression. NOD2 was reported to inhibit the proliferation of esophageal adenocarcinoma cells via autophagy\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e, whereas its deficiency promoted colorectal tumorigenesis\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. In addition, the upregulation of NOD2 enhanced the proliferation, invasion, and migration of cervical squamous cell carcinoma\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. By the mechanism of DNA damage-induced autophagy, NOD2 could also promote hepatocellular carcinoma development\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. This series of findings reveals that NOD2 plays a rather intricate role in the field of cancer and that there may be specific manifestations across different tissues. In addition, earlier evidence exists that NOD2 agonists or antagonists exert adjuvant effects in immune checkpoint inhibitor therapy. Combining NOD2 agonists with PD-1/ PD-L1 immune checkpoint inhibitors for Alzheimer's disease has revealed their synergistic impact\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. Covalently coupled NOD2 and toll-like receptor 7 (TLR7) agonists showed potent immunostimulatory activity on immune cells\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. In addition, the coupling of NOD2 antagonist and paclitaxel (PTX) enhanced the growth inhibitory effect of PTX on Lewis lung carcinoma (LLC)-loaded mice\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. Overall, NOD2 has diverse biological functions and therapeutic potential in disease. Still, much remains unknown about the more profound understanding of the role and mechanism of NOD2 in melanoma, and more in-depth studies are needed to unravel this mystery.\u003c/p\u003e \u003cp\u003eThymidylate synthase (TYMS) has been spotlighted as an essential target for tumor chemotherapeutic agents\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. TYMS maintains the stability of the thymidine-5-prime monophosphate (dTMP) pool, a key dTMP in DNA replication and repair, by catalyzing the methylation of deoxyuridylate to deoxythymidylate using N5, N10-methylenetetrahydrofolate (methylene-THF) as a cofactor\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. In addition, TYMS is the site of action of chemotherapeutic agents such as 5-fluorouracil (5-FU), 5-fluoro-2-prime-deoxyuridine (FdUMP) and certain folate analogs\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Thus, TYMS is believed to play a central part in cancer development. Initial studies have indicated that reducing TYMS expression may increase sensitivity to 5-FU chemotherapy in colorectal cancer patients\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Conversely, increased expression of TYMS in hepatocellular carcinoma cells and patient samples was associated with hepatocellular carcinoma progression and resistance to 5-FU\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Furthermore, the in vivo decrease of TYMS expression lowered tumor occurrence, slowed tumor progression, and extended survival time in mice\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. However, the reasons for the dysregulation of TYMS in melanoma and its underlying mechanisms remain unclear.\u003c/p\u003e \u003cp\u003eIn this work, we observed a trend towards a reduced degree of NOD2 expression in melanoma cells. Melanoma growth was successfully inhibited by upregulating the expression of NOD2 \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e. In addition, we established that NOD2 effectively diminished melanoma's ability to resist chemotherapeutic drugs by reducing TYMS's level and activity. Further studies revealed that NOD2 downregulated TYMS expression by affecting the proteasomal degradation pathway of TYMS and subsequently increasing the level of ubiquitination of TYMS. Altered TYMS expression and activity subsequently affect Polo-like Kinase 1 (PLK1) expression and activity, and this regulatory relationship occurs through a direct binding interaction of TYMS with PLK1. PLK1 is a critical cell cycle regulatory protein of the serine/threonine kinase family, closely related to melanoma development and growth\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. NOD2 suppresses melanoma development by inhibiting the TYMS/PLK1 signaling axis. The results of this study offer clues that unravel the mechanisms of melanoma progression and chemoresistance. Also, the significance of implementing NOD2 and the TYMS/PLK1 signaling axis was evaluated as targets for therapeutic intervention in melanoma.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and transfection\u003c/h2\u003e \u003cp\u003eHuman melanoma cells (A875 and SK-MEL-110) were obtained from the Cell Bank of the Chinese Academy of Sciences. All cells were cultured in high-glucose DMEM medium supplemented with 10% fetal bovine serum at 37\u0026deg;C with 5% CO2. Using NOD2 (shNOD2-1 ,5\u0026prime;-GGGCAAGACTTCCAGGAATTT-3\u0026prime;; shNOD2-2, 5\u0026prime;- GTGCTTCTTTGCCGCGTTCTA-3\u0026prime;; shNOD2-3, 5\u0026prime;-GGACTACAACTCTGTGGGTGA-3\u0026prime;) and its control (CON313) and NOD2 overexpression and its control (CON335) lentiviruses infected A875 and SK-MEL-110 cells. These viruses were obtained from GeneChem Co., Ltd. (Shanghai, China). After 48 hours of transfection, the cell transfection efficiency was observed under a fluorescence microscope, and the cells were continuously screened by puromycin (Solarbio, #P8230) pressurization until the infection rate reached more than 95%. Real-time PCR and Western blot assessed the effect of gene transfection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eReal-time PCR\u003c/h2\u003e \u003cp\u003eTRIzol reagent (Takara, #9109) was used to extract total RNA from cells and tumor tissues. Synthesize cDNA by reverse transcription of mRNA following the instructions of the Reverse Transcription Kit (Thermo Scientific, #K1622). cDNA was analyzed by Real-time PCR using SYBR Green Master mix (Roche, #04913914001); U6 served as an internal reference gene. The specific primer sequences are detailed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e\u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eprimer\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNOD2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: 5\u0026rsquo;- 3\u0026rsquo;: TGGTTCAGCCTCTCACGATGA\u003c/p\u003e \u003cp\u003eR: 5\u0026rsquo;- 3\u0026rsquo;: CAGGACACTCTCGAAGCCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTYMS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: 5\u0026rsquo;- 3\u0026rsquo;: CTGCTGACAACCAAACGTGTG\u003c/p\u003e \u003cp\u003eR: 5\u0026rsquo;- 3\u0026rsquo;: GCATCCCAGATTTTCACTCCCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePLK1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: 5\u0026rsquo;- 3\u0026rsquo;: AAGTGGGTGGACTATTCG\u003c/p\u003e \u003cp\u003eR: 5\u0026rsquo;- 3\u0026rsquo;: GCCGTCACGCTCTATGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCyclin E1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: 5\u0026rsquo;- 3\u0026rsquo;: ACTCAACGTGCAAGCCTCG\u003c/p\u003e \u003cp\u003eR: 5\u0026rsquo;- 3\u0026rsquo;: GCTCAAGAAAGTGCTGATCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCDK2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: 5\u0026rsquo;- 3\u0026rsquo;: CCAGGAGTTACTTCTATGCCTGA\u003c/p\u003e \u003cp\u003eR: 5\u0026rsquo;- 3\u0026rsquo;: TTCATCCAGGGGAGGTACAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCyclin D1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: 5\u0026rsquo;- 3\u0026rsquo;: GCTGCGAAGTGGAAACCATC\u003c/p\u003e \u003cp\u003eR: 5\u0026rsquo;- 3\u0026rsquo;: CCTCCTTCTGCACACATTTGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCDK4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: 5\u0026rsquo;- 3\u0026rsquo;: TCAGCCAGCTTGACTGTTCCA\u003c/p\u003e \u003cp\u003eR: 5\u0026rsquo;- 3\u0026rsquo;: GCCTAGATTTCCTTCATGCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: 5\u0026rsquo;- 3\u0026rsquo;: GGGTTTTCGTGGTTCACATCC\u003c/p\u003e \u003cp\u003eR: 5\u0026rsquo;- 3\u0026rsquo;: CTAGACGCTGGCTCCTCAGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBax\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: 5\u0026rsquo;- 3\u0026rsquo;: CCCGAGAGGTCTTTTTCCGAG\u003c/p\u003e \u003cp\u003eR: 5\u0026rsquo;- 3\u0026rsquo;: CCAGCCCATGATGGTTCTGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBcl2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: 5\u0026rsquo;- 3\u0026rsquo;: GGTGGGGTCATGTGTGTGG\u003c/p\u003e \u003cp\u003eR: 5\u0026rsquo;- 3\u0026rsquo;: CGGTTCAGGTACTCAGTCATCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCaspase 3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: 5\u0026rsquo;- 3\u0026rsquo;: CATGGAAGCGAATCAATGGACT\u003c/p\u003e \u003cp\u003eR: 5\u0026rsquo;- 3\u0026rsquo;: CTGTACCAGACCGAGATGTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eU6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: 5\u0026rsquo;- 3\u0026rsquo;:CTCGCTTCGGCAGCACA\u003c/p\u003e \u003cp\u003eR: 5\u0026rsquo;- 3\u0026rsquo;: AACGCTTCACGAATTTGCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot\u003c/h2\u003e \u003cp\u003eCells and tissues can be effectively lysed using a RIPA lysis buffer (Solarbio, #R0020) containing protease and phosphatase (Solarbio, #P0100) inhibitors. Proteins were quantified by BCA, separated via SDS-PAGE gel electrophoresis, and transferred onto PVDF membranes (Millipore, #IPVH00010), sealed with 5% skimmed milk or 5% BSA (Bio Froxx, #4240GR500) for two hours then incubated overnight with a primary antibody at 4\u0026deg;C. The next day, the secondary antibody of the same genus was used and incubated at room temperature for two hours. ELC chemiluminescence was performed to observe the target bands, and ImageJ software was used to scan the gray values.\u003c/p\u003e \u003cp\u003eThe following antibodies were used: anti-NOD2 (Abcam, #ab36836), anti-TYMS (Proteintech, #15047-1-AP), anti-PLK1 (Santa Cruz, #sc-17783), anti-p-PLK1(T210) (Abcam, #ab155095), anti-Cyclin E1 (Proteintech, #11554-1-AP), anti-Cyclin D1 (Proteintech, #60186-1-Ig), anti-CDK2 (Proteintech, #10122-1-AP), anti-CDK4 (Proteintech, #11026-1-AP), anti-P27 (Proteintech, #25614-1-AP), anti-Bcl2 (Proteintech, #68103-1-Ig), anti-Bax (Proteintech, #60267-1-Ig), anti-Caspase 3 (Proteintech, #66470-2-Ig), anti-MMP2 (Proteintech, #10373-2-AP), anti-MMP9 (Proteintech, #10375-2-AP), anti-N-cadherin (Proteintech, #22018-1-AP), anti-E-Cadherin (Proteintech, #20874-1-AP), anti-vimentin ( Proteintech, #60330-1-Ig), anti-Ubiquitin (CST, #43124), anti- Myc-tag (MCE, HY-P80232), anti- GST-Tag (MCE, HY-P80148), anti-β-actin (Proteintech, #66009-1-Ig), anti-rabbit IgG (CST, #7074), and anti-mouse IgG (Santa Cruz, #sc2005).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eCell proliferation assay (MTS, colony formation, and EdU staining)\u003c/h2\u003e \u003cp\u003eTo determine cell viability by MTS assay, cells with NOD2 overexpression and knockdown of A875 and SK-MEL-110 were cultured in 96-well plates (1000 cells/well). MTS (Promega, #CTB169) working solution formulated according to 1:5 (DMEM: MTS) was added at different time points. The absorbance value was detected at 490 nm after one hour of dark culture.\u003c/p\u003e \u003cp\u003eCells were inoculated into six-well plates (800 cells/well), and fresh medium was replaced every three days. Discontinue the culture when cell colony formation was observed. Cells were washed with PBS, fixed in paraformaldehyde, stained with 0.5% crystal violet for 20 minutes each, and photographed for counting.\u003c/p\u003e \u003cp\u003eIn the EdU incorporation determination, cells were first grown in 24-well plates, and the next day, an EdU Kit (Beyotime, # C0078S) was used to stain the cells. Hoechst 33342 was utilized for nuclear staining. Pictures were obtained using a fluorescence microscope (Leica, # DM4B) to determine the percentage of EdU-positive cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eIC50 assay\u003c/h2\u003e \u003cp\u003eCells were inoculated in 96-well plates at 5000 cells/well density. The next day, cells were exposed to various fluorouracil (5-FU) (MCE, #HY-90006) and capecitabine (CAP) (MCE, #HY-B0016) treatment concentrations. The IC50 was calculated by detecting the absorbance values at 490 nm obtained in the MTS assay described above after 48-hour exposure.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eWound healing assay\u003c/h2\u003e \u003cp\u003eCells were inoculated into a six-well plate and incubated to reach confluence after overnight incubation with serum-free DMEM. Further, the cells were scratched with the tip of a 200-uL pipette, and the separated cells were washed using PBS. Images were taken under an inverted microscope at 0 and 24 hours after wounding. Calculate the wound closure area as follows: wound closure area (fold) = (initial wound area - unhealed wound area 24 hours after scratching)/initial wound area.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eTranswell migration and invasion assays\u003c/h2\u003e \u003cp\u003eCells were digested with trypsin, suspended in DMEM, and later cultured into the top Chamber in Transwell chambers (Corning, #3524). When performing Transwell invasion experiments, 40 \u0026micro;l of matrix gel (BD, #356234) diluted 1:3 (matrix gel: DMEM) was applied to the upper chamber of the Transwell chamber two hours in advance. Next, 600 uL of medium containing 10% fetal bovine serum was injected into the lower chamber of the Transwell, and cells that had migrated and invaded the bottom of the Transwell were removed after 24 hours. Finally, the migrated and invaded cells were fixed, crystal violet-stained, and counted.\u003c/p\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003eFlow cytometry\u003c/h2\u003e \u003cp\u003eCell cycle assays are performed by inoculating cells into a 6-well plate, digesting, and centrifuging. Then, they were slowly added dropwise to 75% pre-cooled ethanol and fixed at 4\u0026deg;C for 24 hours. Cells were collected by centrifugation the next day, stained with a cycle kit (4A Biotech, #FXP0211), and subjected to flow cytometry detection (BD, BD FACSCCelestaTM flow cytometry) and analyzed using FlowJo software.\u003c/p\u003e \u003cp\u003eIn apoptosis analysis, cells were inoculated in 6-well plates and treated for apoptosis induction. After staining with Annexin V, 633/PI Staining Kit (Dojindo, #AD11) according to the manufacturer's instructions, assessed apoptic content through flow cytometry (BD, BD FACS Celesta TM flow cytometer) and analyzed using FlowJo software.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eCo-immunoprecipitation (CO-IP)\u003c/h2\u003e \u003cp\u003eThe cells were lysed for 30 minutes on a shaker at 4\u0026deg;C using weak RIPA lysis buffer (Beyotime, #P0013D), adding protease and protease phosphatase (Solarbio, #P0100) inhibitors. Following centrifugation, the supernatant was divided into three parts. The input tube was frozen at minus 20\u0026deg;C, and the corresponding primary antibody was mixed in the IgG and IP tubes. After incubation on a shaking table at low temperatures for 8 hours, protein A/G-Agarose beads (Roche, #11243233001) were added and gently shaken at 4\u0026deg;C overnight. After centrifugation, the liquid above the sediment was removed, and the sample was subsequently rinsed thrice with PBS. Finally, PBS and protein loading buffer were added, followed by boiling and eluting the combined protein. Western blot analysis was performed using SDS-PAGE.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eCellular immunofluorescence (IF)\u003c/h2\u003e \u003cp\u003eAfter inoculating the cells in a slide culture, they were removed and fixed in 4% paraformaldehyde for 15 min, followed by exposure to 0.3% Triton X-100 for 20 min. Next, blocking with BSA (Bio Froxx, #4240GR500) for 2 hours, followed by the addition of the primary antibody for overnight incubation at 4\u0026deg;C. Samples with a fluorescent secondary antibody were incubated in the dark for one hour, and the slide was sealed with an anti-fluorescence quencher containing DAPI (Sigma, #F6057). Finally, the cell slides were photographed using a fluorescence microscope (Zeiss, #LSM800) observation. The following fluorescent secondary antibodies were utilized: 488 (Proteintech, #SA00013-1) and 594 (Proteintech, #SA00013-4).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eGST Pull-down assay\u003c/h2\u003e \u003cp\u003eThe GST-TYMS and myc-PLK1 genes were first cloned and synthesized and then inserted into the pGEX-4T-1 vector and pET28a (+) vector, respectively, and then expressed individually in E. coli TOP10, which was purchased from Wuhan Jinkai Rui Biological. For the in vitro pull-down assay, performed according to the illustrated procedure (Fitgene, #FI88807), after the bacteria were broken by ultrasonication in lysis buffer, the protein samples of 2 mg of GST (control) or GST-TYMS (experimental) were incubated with 50 \u0026micro;l of glutathione agarose resin for 5 h at 4\u0026deg;C. The samples were washed with rinse buffer three times and then washed with rinsing buffer. After washing three times with rinse buffer, 2 mg of myc-PLK1 protein was mixed into each control and experimental group and incubated at 4\u0026deg;C overnight. Then, the samples from both groups were centrifuged, washed three times with rinse solution, and eluted by adding elution buffer for 15 min. Add protein loading buffer to the eluted proteins and heat at 95\u0026deg;C for 10 minutes. Finally, the samples were analyzed by immunoblotting.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eTYMS activity assay\u003c/h2\u003e \u003cp\u003eTotal proteins were extracted with RIPA lysis buffer to determine intracellular TYMS enzyme activity, followed by concentration determination using the BCA method. Following guidelines provided by the manufacturer, TYMS activity was assayed using the TYMS Activity ELISA Kit (MEIMIAN, #MM-0328H1).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eHematoxylin-eosin (HE) staining and immunohistochemistry (IHC) analysis\u003c/h2\u003e \u003cp\u003eAnimal tumors were fixed in 4% paraformaldehyde, embedded in paraffin, cut into 5-\u0026micro;m sections, and stored after baking at 65\u0026deg;C for three hours. HE staining was performed per the manufacturer's established protocol (Solarbio, #G1120).\u003c/p\u003e \u003cp\u003eFor IHC, antigen repair was performed under high pressure using citrate buffer. The endogenous peroxidase activity was inactivated with 3% H2O2, and 5% BSA was blocked, followed by the addition of the primary antibody and overnight incubation at 4\u0026deg;C. Staining Sections using the DAB Substrate Kit (Biosharp, #BL732A) and hematoxylin staining solution (Biosharp, #517-28-2). Sections were dehydrated again, cleared by a gradient of ethanol and xylene, sealed with neutral glue, and photographed under the microscope (Teksqray, #SQS-1000).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics analysis\u003c/h2\u003e \u003cdiv id=\"Sec17\" class=\"Section3\"\u003e \u003ch2\u003eData mining\u003c/h2\u003e \u003cp\u003eMining was conducted for data normalization, and computational analysis was performed of the NOD2 gene expression values obtained from the Gene Expression Omnibus (GEO) database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/geo\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/geo\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) for the mRNA expression dataset GSE15605, as well as for normal and primary melanoma tissues and metastatic melanoma tissues in the TCGA database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://portal.gdc.cancer.gov/\u003c/span\u003e\u003cspan address=\"https://portal.gdc.cancer.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The GEPIA database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://gepia2.cancer-pku.cn/\u003c/span\u003e\u003cspan address=\"http://gepia2.cancer-pku.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used for the differential analysis of the NOD2, TYMS, and PLK1 genes in melanoma and normal tissues, as well as the correlation between TYMS and PLK1 in melanoma patients. The UALCAN database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://ualcan.path.uab.edu/\u003c/span\u003e\u003cspan address=\"https://ualcan.path.uab.edu/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used for survival prognosis analysis of NOD2 expression and melanoma patients.\u003c/p\u003e \u003cp\u003eFor transcriptome sequencing (RNA-seq), SK-MEL-110 cells with NOD2 overexpression and control were collected for RNA-seq by Zhongke New Life in Shanghai, China. After selecting the high-throughput sequencing data according to the screening threshold of | log2FC | \u0026gt; 1 and Padj\u0026thinsp;\u0026lt;\u0026thinsp;0.05, differentially expressed genes (DEGs) were obtained and enriched for analysis.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eAnimal models\u003c/h2\u003e \u003cp\u003e Six-week-old female BALB / c nude mice were obtained from the Department of Laboratory Animals, Kunming Medical University, and all animal experiments followed animal ethical standards. For the no administration of chemotherapeutic drugs treatment group, 1 \u0026times; 10\u003csup\u003e7\u003c/sup\u003e of A875-shCAD and its control cells were implanted into the subcutaneous regions on both sides of the nude mice., respectively. After two weeks, measure tumor diameters with a vernier caliper every 5 days. For the group treated with chemotherapeutic agents, 1 \u0026times; 10\u003csup\u003e7\u003c/sup\u003e A875 cells were implanted into the axilla of nude mice. After two weeks, the nude mice were injected intraperitoneally with saline or chemotherapeutic drugs 5-Fu (25 mg/kg) and BI6727 (10 mg/kg) every three days, and the diameter of the tumors was measured using vernier calipers every five days the treatment period. The tumor volume was calculated using the formula: volume\u0026thinsp;=\u0026thinsp;1/2 \u0026times; long diameter \u0026times; wide diameter \u0026times; wide diameter. In the final stage of the tumor experiment, we euthanized the nude mice and removed tumors for subsequent experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData were analyzed using GraphPad Prism 2 software. All data were shown as means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) of at least three independent experiments. Independent-sample t-tests were used to compare differences between two specific groups, and one-way analysis of variance (ANOVA) was used to compare differences between multiple groups. P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered to indicate statistically significant differences in the results.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eNOD2 expression is downregulated in human melanoma, and low expression is associated with poor prognosis for melanoma patients\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe GEPIA and TCGA databases were used to analyze the role of NOD2 in the development of melanoma, and it was found that the expression of NOD2 was significantly down-regulated in melanoma compared to normal tissue, especially in metastatic melanoma patients with lower expression levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, B). Moreover, low expression of NOD2 predicts a poor prognosis in melanoma patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Then, we examined NOD2\u0026rsquo;s expression in HEM and four melanoma cell lines. The experimental results revealed a significant decrease in the mRNA expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD) and protein expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE) of NOD2 in A375 cells, A875, SK-MEL-28, and SK-MEL-110 cell lines. To further explore the NOD2 function, we successfully constructed stably transfected cell lines with NOD2 knockdown and overexpression in A875 and SK-MEL-110 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF), with the sh-NOD2-3 sequence having the best knockdown efficiency. Therefore, this knockdown sequence cell line will be used in our subsequent experiments.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eNOD2 inhibits the proliferation of human melanoma cells in vitro\u003c/h2\u003e \u003cp\u003eWe validated the anti-tumor effect of NOD2 in melanoma cells. Specifically, the NOD2 impact on the proliferation of melanoma cells was evaluated by MTS, cell colony formation, and EdU staining. The MTS results indicated that NOD2 overexpression decreased the proliferative viability of melanoma cells, whereas it was increased by NOD2 knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). NOD2 overexpression reduced melanoma cells' ability to form colonies, whereas the opposite results were obtained after NOD2 knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Using EdU staining, we found that the DNA synthesis rate of melanoma cells after NOD2 overexpression was accelerated compared to controls, whereas NOD2 knockdown slowed down the rate of DNA synthesis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). These results suggest that NOD2 overexpression inhibits melanoma cell proliferation, whereas its knockdown promotes melanoma cell proliferation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn further studies, we explored the mechanism of NOD2 action in melanoma cell proliferation. Flow cytometry analysis revealed that in A875 cells, NOD2 overexpression led to an increase in G0/G1 phase cells and a decrease in S and G2/M phase cells; NOD2 knockdown led to a decrease in G0/G1 phase cells and an increase in S and G2/M phase cells. In SK-MEL-110 cells, NOD2 overexpression increased G0/G1-phase cells and decreased G2/M-phase cells, whereas the opposite trend was observed when NOD2 was knocked down. However, the number of S-phase cells remained constant. Next, we detected the mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE) and protein expression levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF) of cell cycle-related factors by real-time PCR and Western blot. Our data revealed that in melanoma cells with NOD2 overexpression, Cyclin E1/D1 and CDK2/4 expression levels were upregulated, accompanied by the expression of P27 was inhibited. In contrast, there is an opposite trend in NOD2 knockdown melanoma cells. All of the data obtained further highlight the critical role of NOD2 in inhibiting the proliferation of human melanoma cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eNOD2 promotes the cellular apoptosis\u003c/h2\u003e \u003cp\u003eTo determine the influence of NOD2 on melanoma cell apoptosis, we examined apoptosis after NOD2 overexpression and knockdown by flow cytometry. The findings proved that NOD2 overexpression increased the apoptosis rate in melanoma cells, whereas NOD2 knockdown decreased it (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). To prove the cause of induced apoptosis, the mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB) and protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC) levels of apoptosis-promoting related factors Bax and Caspase 3 and the anti-apoptotic protein Bcl2 were detected. Furthermore, the expression of Bax and Caspase 3 was upregulated after NOD2 overexpression, whereas the expression of Bcl2 was downregulated. In contrast, the opposite result was obtained after NOD2 knockdown.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eNOD2 inhibits the migration and invasion of human melanoma cells\u003c/h2\u003e \u003cp\u003eWe studied the influence of NOD2 on the migration and invasion ability in human melanoma cells. Scratch and Transwell migration assays were employed to assess cell migration ability, and a Transwell invasion assay was used to evaluate cell invasion ability. The findings indicated that NOD2 overexpression suppressed melanoma cells' migration (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B) and invasion (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC) ability, whereas NOD2 knockdown increased these abilities. In addition, Western blot analyzed the levels of proteins associated with EMT to measure the implications of NOD2 in the EMT process. The results revealed that NOD2 overexpression decreased MMP2, MMP9, N-cadherin, and vimentin while increasing E-cadherin expression. The opposite result was obtained after NOD2 knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eNOD2 inhibits human melanoma growth\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo verify if targeting NOD2 inhibited melanoma development \u003cem\u003ein vivo\u003c/em\u003e, we implanted A875 cells with NOD2 overexpression, knockdown, and its control group subcutaneously in nude mice to observe tumor formation. In contrast to the control group, the implanted NOD2 overexpression cell group more effectively suppressed the tumor growth rate and size (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA\u0026ndash;C). In contrast, accelerated proliferation and larger tumor growth were measured in the tumors implanted into the NOD2 knockdown group of cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD\u0026ndash;F). Additionally, Western blot analysis was performed to determine the expression of NOD2 and its associated cyclin proteins in the tumor tissues of both groups. As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eG, the NOD2 overexpression group exhibited significantly higher levels of NOD2 expression in the tumor bodies compared to the control group. A downregulation of Cyclin E1, CDK2, Cyclin D1, and CDK4 accompanied this elevated NOD2 expression. Conversely, the knockdown group displayed the opposite results. Also, the tumor was stained with Hematoxylin-eosin (HE) and immunohistochemical (IHC) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eInhibition of TYMS and PLK1 expression and activity is critical for the role of NOD2 in melanoma\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo investigate the biological function and mechanism of action of NOD2 in melanoma. We performed transcriptome sequencing of NOD2 overexpressing SK-MEL-110 melanoma cells. This study identified 1583 differentially expressed genes, including 914 upregulated and 669 downregulated genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). To better understand the functions of downregulated genes, we screened the top 30 downregulated genes and performed GO analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). We also focused on the top 20 downregulated genes and performed KEGG enrichment analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). We specifically focused on the biological processes of the cell cycle, pyrimidine metabolism, antifolate resistance, and one-carbon pool by folate. PLK1 is a critical gene in the cell cycle\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e, whereas TYMS plays essential roles in pyrimidine metabolism\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e, antifolate resistance, and one-carbon pool by folate.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo establish whether TYMS and PLK1 are regulated by NOD2 expression, we analyzed the TYMS and PLK1 expression levels in melanoma using the GEPIA online database. The results showed that the expression of TYMS and PLK1 was significantly upregulated in melanoma compared with normal tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eD, E). In addition, we examined the expression of TYMS and PLK1 in A875 and SK-MEL-110 cells with NOD2 overexpression and knockdown by real-time PCR and Western blot. The results showed that NOD2 overexpression inhibited the mRNA expression of TYMS and PLK1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eF) and decreased the protein expression level (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eG). In addition, we observed that NOD2 overexpression suppressed p-PLK1 expression, the activated form of PLK1, whereas NOD2 knockdown increased p-PLK1 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eG). Considering whether the enzymatic activity of TYMS was also affected by NOD2, we examined TYMS activity. We identified that overexpression of NOD2 in A875 and SK-MEL-110 cells suppressed TYMS activity, whereas knockdown of NOD2 increased TYMS activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eH). In conclusion, our present results suggest that NOD2 may function in melanoma by regulating the expression and activities of TYMS and PLK1.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eNOD2 negatively regulates TYMS expression by affecting TYMS ubiquitination\u003c/h2\u003e \u003cp\u003eAs suggested in our results (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003e), NOD2 not only plays a role in adjusting the expression of TYMS at the mRNA level but also significantly affects the expression of TYMS at the protein level. In order to explore the regulatory mechanism of NOD2 on TYMS more deeply, it was suggested that TYMS might be degraded through the proteasome pathway according to a previous study\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. In our experiments, we added Cycloheximide (CHX) and proteasome inhibitor MG-132 to NOD2 knockdown and overexpression A875 and SK-MEL-110 cells to verify whether NOD2 affects TYMS protein stability in melanoma cells. The results showed that after CHX treatment, the NOD2 overexpression accelerated TYMS degradation in melanoma cells, whereas the knockdown of NOD2 slowed down TYMS degradation (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). This effect was reversed after CHX combined with MG132 treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eB), implying that NOD2 plays an important role in the TYMS proteasome degradation pathway. Furthermore, it was found that changes in NOD2 expression affected the overall ubiquitination level of TYMS. With overexpression of NOD2, the ubiquitination level of TYMS increased, whereas knockdown of NOD2 led to a decrease in the ubiquitination level of TYMS (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). Thus, the results suggest that NOD2 regulates TYMS expression in melanoma by promoting the degradation of TYMS and modulating its ubiquitination level.\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eTYMS regulates PLK1 expression and activation through interaction with PLK1\u003c/h2\u003e \u003cp\u003eBased on the above studies, NOD2 may regulate the biological behavior of melanoma cells by influencing the expression levels and activation status of TYMS and PLK1. Since PLK1 is a direct checkpoint of the cell cycle, we hypothesized that NOD2 regulation of the biological behavior of melanoma cells through TYMS ultimately depends on the alteration of PLK1. To investigate the relationship between the roles of TYMS and PLK1, we performed a correlation analysis of TYMS and PLK1 in melanoma using the GEPIA database, which revealed a significant positive correlation between TYMS and PLK1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). We added 5-FU, a target inhibitor of TYMS\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e, to melanoma cells A875 and SK-MEL-110, the results of the TYMS activity assay showed a continuous decrease in TYMS activity at 4 and 24 h post-5-FU addition. However, at 48 h, we found that the TYMS activity was higher than that at 24 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). Next, we added 5-FU to A875 and SK-MEL-110, which resulted in the presence of TYMS in two forms\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e, most of which were captured by 5-fluorodeoxyuridine monophosphate (FdUMP), a major metabolite of 5-FU, to form an inactive form (FdUMP-TYMS), while the remaining small amount of free TYMS constituted the active form (free-TYMS). We observed a continuous incremental trend in FdUMP-TYMS content with increasing exposure time to 5-FU. In contrast, free-TYMS content decreased significantly until 48 h, which tended to increase when the exposure time reached 48 h. The FdUMP-TYMS content increased with extending exposure time to 5-FU (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). This phenomenon is consistent with the results of the TYMS activity assay. We speculate that this may be due to the prolonged exposure of human melanoma cells to 5-FU, resulting in resistance to 5-FU treatment and diminished inhibition of TYMS. Notably, we observed that the expression of PLK1 and p-PLK1 was also downregulated by adding 5-FU (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). This also suggests that PLK1 acts as a downstream effector molecule of TYMS, and TYMS positively regulates the activity and expression of PLK1. To further investigate the mode of action between TYMS and PLK1, we performed cellular immunofluorescence (IF) staining and co-immunoprecipitation (CO-IP) experiments in A875 and SK-MEL-110 cells. The staining results showed that TYMS was expressed in both cytoplasm and nucleus, PLK1 was expressed in the nucleus, and TYMS and PLK1 showed co-localized expression in the nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD). The results of the CO-IP experiments showed a direct interaction between TYMS and PLK1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE). Moreover, the GST Pull-down assay showed that TYMS and PLK1 also interacted directly in vitro (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eF). IHC assay of subcutaneous transplanted tumors injected with NOD2 overexpressing and knockdown A875 cells showed that TYMS and PLK1 expression were consistently negatively regulated by NOD2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eG). Based on these findings, we can infer that TYMS and PLK1 form a signaling axis of action in a direct reciprocal manner and that NOD2 exerts its biological functions by regulating the TYMS/PLK1 signaling axis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eNOD2 reduces chemoresistance targeting TYMS in melanoma\u003c/h2\u003e \u003cp\u003eSince TYMS is an essential target of tumor chemotherapeutic agents based on 5-FU\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e and some folate analogs\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e, its expression directly correlates with tumor chemoresistance. Based on this evidence, we conjectured that NOD2 may affect chemoresistance in melanoma through the TYMS/PLK1 signaling axis. We examined the IC50 values of the clinically targeted chemotherapeutic drugs 5-FU and CAP for TYMS in NOD2 overexpressed and knockdown A875 and SK-MEL-110 cells to verify this conjecture. The results showed that the IC50 values of 5-FU and CAP were decreased in NOD2 overexpressing cells compared to controls, while NOD2 knockdown increased the IC50 values of 5-FU and CAP (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA, B). In the following study, we used A875 and SK-MEL-110 cells with overexpression and knockdown of NOD2 and treated them with the chemotherapeutic agents 5-FU and CAP. The MTS results showed that in cells with NOD2 overexpression, 5-FU and CAP treatment could inhibit cell proliferation more significantly, whereas this inhibitory effect was attenuated in cells with NOD2 knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eC, D). In addition, using 5-FU to treat A875 cells with NOD2 overexpression and CAP to treat SK-MEL-110 cells with NOD2 overexpression was also able to significantly reduce the migration ability of cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003eCombination therapy targeting inhibition of TYMS and PLK1 suppresses melanoma progression\u003c/h2\u003e \u003cp\u003eMelanoma is complex and prone to drug resistance, limiting the efficacy of monotherapy. Next, the study evaluated the effectiveness of targeting TYMS and PLK1 as therapeutic targets. A875 and SK-MEL-110 cells were treated with volasertib (BI6727), a targeted inhibitor of PLK1, and 5-FU, CAP alone, as well as BI6727 combined with 5-FU and BI6727 combined with CAP treated cells. MTS results showed that compared to treatment alone, BI6727 combined with 5-FU and BI6727 combined with CAP treatment exerted a synergistic inhibitory effect on cell proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eA). The synergistic inhibitory effect of combination treatment on cell migration was also observed in the cell migration assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eB). Moreover, in the post-tumorigenic treatment experiments in nude mice subcutaneously injected with A875 cells, compared with the control group, the tumor was significantly reduced in the group treated with 5-FU and BI6727, respectively, and the tumor reduction was even more significant in the group treated with the combination of 5-FU and BI6727 (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn summary, combination therapy for melanoma cell progression is an effective therapeutic strategy that can enhance the therapeutic effect by targeting NOD2, TYMS, and PLK1.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe role of NOD2 in immune response\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e and inflammation\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e has been extensively studied. However, its involvement in tumors is diverse and remains incompletely elucidated. Previous research has revealed that NOD2 functions as an immunosurveillance factor in certain types of cancers, such as colorectal\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e and esophageal adenocarcinomas\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e, where it is considered protective. Conversely, aberrant activation of NOD2 has been implicated in liver\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e and cervical\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e cancers, leading to excessive inflammation that promotes tumor development. In this study, we aimed to investigate the role of NOD2 in melanoma. Our findings suggest that NOD2 has a protective function in this particular type of cancer. The upregulation of NOD2 inhibited melanoma cell proliferation and migratory invasion while promoting apoptosis. Moreover, NOD2 upregulation reduced chemoresistance, enhancing its effectiveness in combating melanoma cells.\u003c/p\u003e \u003cp\u003eTo better understand the mechanism of NOD2's role in melanoma development and treatment, we conducted a screening study and found that TYMS is a crucial gene regulated by NOD2. TYMS is involved in DNA synthesis and cell proliferation processes\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Some chemotherapeutic agents targeting TYMS, such as 5-FU and CAP, treat tumors by inhibiting the biosynthetic activity of TYMS. In cancer, TYMS's expression level and activity are closely associated with the malignant progression of tumors and resistance to chemotherapeutic drugs\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. Therefore, reducing TYMS expression and activity may inhibit melanoma cell proliferation, promote apoptosis, inhibit epithelial-mesenchymal transition, and reduce resistance to chemotherapeutic agents. In addition, TYMS expression is affected by multiple regulatory mechanisms. For example, the transcription factor FOXM1 can directly promote the transcription of TYMS, which can lead to the resistance of hepatocellular carcinoma cells to chemotherapeutic agents such as 5-FU\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Non-coding RNAs, such as miRNAs and lncRNAs, are also involved in the regulation of TYMS. MiR-330-5p\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e and miR-140-3p\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e have been shown to inhibit tumor proliferation by suppressing the expression of TYMS. The long non-coding RNA SNHG15 promotes TYMS expression, leading to colorectal cancer resistance to 5-FU chemotherapeutic agents\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. On the other hand, TYMS can inhibit the growth of human hepatocellular carcinoma cells and trigger DNA damage through proteasome-dependent pathway degradation\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Our present study found that TYMS expression and activity in melanoma are negatively regulated by NOD2, which increases the protein degradation of TYMS through the \"ubiquitin-proteasome system\". These findings fill a research gap regarding the protein factors that regulate TYMS expression and activity. However, further studies are needed to identify the specific proteasome that binds to TYMS and the specific site of ubiquitination of TYMS. Our results indicate that overexpression of NOD2 in melanoma inhibits the resistance of melanoma cells to chemotherapeutic drugs by reducing the expression level and activity of TYMS. Moreover, NOD2 activation and combined with 5-FU and CAP, synergistically inhibits melanoma proliferation and migration in vitro.\u003c/p\u003e \u003cp\u003eUnderstanding the regulatory mechanisms of TYMS and its interactions with other factors can provide more insights into the intricacies of tumor biology. Our research has specifically shown that TYMS has a regulatory role in the expression and activity of PLK1. Through IF, CO-IP, and GST Pull-down experiments, we have demonstrated that TYMS directly binds to PLK1, forming a complex and exerting its regulatory effect. The significance of this finding lies in the well-documented role of PLK1 in cell cycle regulation, mitosis\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e, and tumorigenesis\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. PLK1 is a driver protein in tumor DNA repair\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e, cell death pathways\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e, and epithelial-to-mesenchymal transition\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. By disrupting cell cycle progression and inducing DNA damage, TYMS may lead to changes in PLK1 expression and activity, affecting processes such as proliferation, apoptosis, and EMT in tumor cells. Previous studies have suggested that TYMS and PLK1 may serve as prognostic markers for certain tumors\u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e, but little is known about their specific roles and mechanisms of interaction. Therefore, our study is the first to provide evidence of TYMS's direct positive regulatory effect on PLK1 expression and activity.\u003c/p\u003e \u003cp\u003eIn addition, PLK1 is considered an attractive target for overcoming chemoresistance and immune checkpoints in clinical cancer therapy\u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. Studies have shown that PLK1 inhibitors, combined with radiotherapy and chemotherapeutic agents, exhibit excellent anticancer effects in laboratory experiments and animal models\u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e. For instance, targeted inhibition of PLK1 has been proven to significantly hinder the progression of esophageal squamous cell carcinoma (ESCC) and reduce the resistance to doxorubicin, a commonly used chemotherapeutic drug\u003csup\u003e\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u003c/sup\u003e. Similarly, targeted inhibition of PLK1 has been found to inhibit the proliferation of laryngeal squamous cell carcinoma and decrease resistance to cisplatin\u003csup\u003e\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u003c/sup\u003e. To further explore the potential of the TYMS/PLK1 signaling axis in combination therapy, we have investigated the effects of combining a PLK1 inhibitor (BI6727) with 5-FU and CAP in melanoma. The aim was to determine the synergistic relationship between the combination treatments. The results showed that the combination treatment significantly suppressed melanoma proliferation and migration in vitro and inhibited melanoma growth in vivo compared to the individual treatments of 5-FU, CAP, and BI6727. These findings highlight the effectiveness of inhibiting TYMS and PLK1 in impeding melanoma progression and reducing chemoresistance. They also suggest that a combination of therapies could potentially overcome the susceptibility to resistance observed with 5-FU and CAP chemotherapy. Combining these treatments may improve melanoma patients' survival rates and overall outcomes.\u003c/p\u003e \u003cp\u003eThis study elucidates the role of NOD2 in inhibiting the malignant progression of melanoma and reducing chemoresistance. Our findings are consistent with previous studies that reported the inhibitory effect of NOD2 agonists and interferon combination therapy on melanoma growth by inducing an immune response, as reported, for example, by Fujimura et al.\u003csup\u003e\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e. Furthermore, studies on tumor microparticle vaccines have shown that activation of NOD2 signaling can generate an anti-tumor immune response and inhibit melanoma growth\u003csup\u003e\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u003c/sup\u003e. Notably, previous research has primarily focused on the immunomodulatory role of NOD2 and its involvement in anti-tumor immune responses. In contrast, our study provides insights into the protective role of NOD2 in melanoma from a genetic standpoint. NOD2 exhibits different mechanisms of action in various diseases. NOD2 inhibits inflammation by activating NF-κB and MAPK signaling pathways\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. In hepatocellular carcinoma, NOD2 activates AMPK, MAPK, NF-κB, STAT3, and ERK pathways and induces nuclear autophagy directly through lamin A/C\u003csup\u003e16, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u003c/sup\u003e. In melanoma, NOD2 acts by regulating the TYMS/PLK1 signaling axis.\u003c/p\u003e \u003cp\u003eIn summary, our study results evidence that NOD2 inhibits melanoma progression and reduces chemoresistance. Our findings also reveal the regulatory relationship between NOD2 and the TYMS/PLK1 signaling axis. Interestingly, NOD2 negatively regulates TYMS expression and activity in melanoma and accelerates the degradation of TYMS proteins via the ubiquitination-proteasome pathway. When TYMS expression and activity are altered, TYMS regulates PLK1 and p-PLK1 expression through direct binding to PLK1. Furthermore, combining NOD2 overexpression with TYMS inhibition and targeting TYMS and PLK1 combination therapy in our investigation exerted a synergistic suppressive effect on melanoma proliferation and migration. These findings provide potential avenues for further research and the development of melanoma treatment strategies. However, challenges such as the heterogeneity of NOD2 in tumors may limit the generalizability of these findings beyond melanoma. Moreover, additional research and clinical trials are necessary to ensure the safety and effectiveness of the suggested combination therapy.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eConflict of Interest Statement\u003c/h2\u003e \u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eEthics Statement\u003c/h2\u003e \u003cp\u003e All animal procedures were approved by the Ethical Review Committee for Animal Experiments of Kunming Medical University.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding Statement\u003c/h2\u003e \u003cp\u003eThis work was supported by the National Natural Science Foundation of China Nos. 82160540; 31960200; 81960462; 81760455; 31960145; 82103388.\u003c/p\u003e\u003ch2\u003eAuthor contributions\u003c/h2\u003e \u003cp\u003eFang Yun completed most experiments and data analysis and drafted the manuscript. Na Wu, Xiaojia Yi, Xuedan Zhang, Yu Feng, Qinxuan Ni, Yanlong Gai, and Enjiang Li helped with \u003cem\u003ein vivo\u003c/em\u003e experiments, data analysis and immunohistochemical staning. Zhe Yang, Qiao Zhang, and Buqing Sai assisted with experimental design and data analysis. Yingmin Kuang and Yuechun Zhu directed the study and edited the manuscript. All authors read and approved the manuscript for publication.\u003c/p\u003e\u003ch2\u003eData Availability Statement\u003c/h2\u003e \u003cp\u003eAll data generated during this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSiegel RL, Giaquinto AN, Jemal A. Cancer statistics, 2024. CA Cancer J Clin 2024, 74(1): 12\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMai R, Zhou S, Zhong W, Rong S, Cong Z, Li Y, \u003cem\u003eet al.\u003c/em\u003e Therapeutic efficacy of combined BRAF and MEK inhibition in metastatic melanoma: a comprehensive network meta-analysis of randomized controlled trials. Oncotarget 2015, 6(29): 28502\u0026ndash;28512.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Leite de Oliveira R, Huijberts S, Bosdriesz E, Pencheva N, Brunen D, \u003cem\u003eet al.\u003c/em\u003e An Acquired Vulnerability of Drug-Resistant Melanoma with Therapeutic Potential. Cell 2018, 173(6): 1413\u0026ndash;1425.e1414.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCowey CL, Boyd M, Aguilar KM, Beeks A, Krepler C, Scherrer E. An observational study of drug utilization and associated outcomes among adult patients diagnosed with BRAF-mutant advanced melanoma treated with first-line anti-PD-1 monotherapies or BRAF/MEK inhibitors in a community-based oncology setting. Cancer Med 2020, 9(21): 7863\u0026ndash;7878.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerrucci PF, Lens M, Cocorocchio E. Combined BRAF-Targeted Therapy with Immunotherapy in BRAF-Mutated Advanced Melanoma Patients. Curr Oncol Rep 2021, 23(12): 138.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNassar KW, Hintzsche JD, Bagby SM, Espinoza V, Langou\u0026euml;t-Astri\u0026eacute; C, Amato CM, \u003cem\u003eet al.\u003c/em\u003e Targeting CDK4/6 Represents a Therapeutic Vulnerability in Acquired BRAF/MEK Inhibitor-Resistant Melanoma. Mol Cancer Ther 2021, 20(10): 2049\u0026ndash;2060.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuchbinder EI, Giobbie-Hurder A, Ott PA. A phase I/II study of MCS110 with BRAF/MEK inhibition in patients with melanoma after progression on BRAF/MEK inhibition. Invest New Drugs 2023, 41(3): 365\u0026ndash;370.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eInohara, Chamaillard, McDonald C, Nu\u0026ntilde;ez G. NOD-LRR proteins: role in host-microbial interactions and inflammatory disease. Annu Rev Biochem 2005, 74: 355\u0026ndash;383.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao J, Zhao X, Hu S, Huang Z, Hu M, Jin S, \u003cem\u003eet al.\u003c/em\u003e Gut microbial DL-endopeptidase alleviates Crohn's disease via the NOD2 pathway. Cell Host Microbe 2022, 30(10): 1435\u0026ndash;1449.e1439.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo X, Wang X, Huang S, Xu B, Luo S, Li Y, \u003cem\u003eet al.\u003c/em\u003e Paeoniflorin ameliorates experimental colitis by inhibiting gram-positive bacteria-dependent MDP-NOD2 pathway. Int Immunopharmacol 2021, 90: 107224.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMao L, Dhar A, Meng G, Fuss I, Montgomery-Recht K, Yang Z, \u003cem\u003eet al.\u003c/em\u003e Blau syndrome NOD2 mutations result in loss of NOD2 cross-regulatory function. Front Immunol 2022, 13: 988862.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang G, Zhang C, Jiang F, Zhao M, Xie S, Liu X. NOD2-RIP2 signaling alleviates microglial ROS damage and pyroptosis via ULK1-mediated autophagy during Streptococcus pneumonia infection. Neurosci Lett 2022, 783: 136743.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X, Liu S, Jin L, Ma Y, Liu T. NOD2 inhibits the proliferation of esophageal adenocarcinoma cells through autophagy. J Cancer Res Clin Oncol 2023, 149(2): 639\u0026ndash;652.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUdden SMN, Peng L, Gan JL, Shelton JM, Malter JS, Hooper LV, \u003cem\u003eet al.\u003c/em\u003e NOD2 Suppresses Colorectal Tumorigenesis via Downregulation of the TLR Pathways. Cell Rep 2017, 19(13): 2756\u0026ndash;2770.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Li N, Yuan G, Yao H, Zhang D, Li N, \u003cem\u003eet al.\u003c/em\u003e Upregulation of NOD1 and NOD2 contribute to cancer progression through the positive regulation of tumorigenicity and metastasis in human squamous cervical cancer. BMC Med 2022, 20(1): 55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou Y, Hu L, Tang W, Li D, Ma L, Liu H, \u003cem\u003eet al.\u003c/em\u003e Hepatic NOD2 promotes hepatocarcinogenesis via a RIP2-mediated proinflammatory response and a novel nuclear autophagy-mediated DNA damage mechanism. J Hematol Oncol 2021, 14(1): 9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhareghani M, Rivest S. The Synergistic Potential of Combining PD-1/PD-L1 Immune Checkpoint Inhibitors with NOD2 Agonists in Alzheimer's Disease Treatment. Int J Mol Sci 2023, 24(13).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuzelj S, Weiss M, Sl\u0026uuml;tter B, Frkanec R, Jakopin Ž. Covalently Conjugated NOD2/TLR7 Agonists Are Potent and Versatile Immune Potentiators. J Med Chem 2022, 65(22): 15085\u0026ndash;15101.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong Y, Wang S, Wang C, Li Z, Ma Y, Liu G. Antagonizing NOD2 Signaling with Conjugates of Paclitaxel and Muramyl Dipeptide Derivatives Sensitizes Paclitaxel Therapy and Significantly Prevents Tumor Metastasis. J Med Chem 2017, 60(3): 1219\u0026ndash;1224.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeekes CD, Nallapareddy S, Rudek MA, Norris-Kirby A, Laheru D, Jimeno A, \u003cem\u003eet al.\u003c/em\u003e Thymidylate synthase (TYMS) enhancer region genotype-directed phase II trial of oral capecitabine for 2nd line treatment of advanced pancreatic cancer. Invest New Drugs 2011, 29(5): 1057\u0026ndash;1065.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao M, Tan B, Dai X, Shao Y, He Q, Yang B, \u003cem\u003eet al.\u003c/em\u003e DHFR/TYMS are positive regulators of glioma cell growth and modulate chemo-sensitivity to temozolomide. Eur J Pharmacol 2019, 863: 172665.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar A, Singh AK, Singh H, Thareja S, Kumar P. Regulation of thymidylate synthase: an approach to overcome 5-FU resistance in colorectal cancer. Med Oncol 2022, 40(1): 3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarreras CW, Santi DV. The catalytic mechanism and structure of thymidylate synthase. Annu Rev Biochem 1995, 64: 721\u0026ndash;762.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLongley DB, Harkin DP, Johnston PG. 5-fluorouracil: mechanisms of action and clinical strategies. Nat Rev Cancer 2003, 3(5): 330\u0026ndash;338.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsukihara H, Tsunekuni K, Takechi T. Folic Acid-Metabolizing Enzymes Regulate the Antitumor Effect of 5-Fluoro-2'-Deoxyuridine in Colorectal Cancer Cell Lines. PLoS One 2016, 11(9): e0163961.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuijarro MV, Kellish PC, Dib PE, Paciaroni NG, Nawab A, Andring J, \u003cem\u003eet al.\u003c/em\u003e First-in-class multifunctional TYMS nonclassical antifolate inhibitor with potent in vivo activity that prolongs survival. JCI Insight 2023, 8(10).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu F, Ye ML, Zhang YP, Li WJ, Li MT, Wang HZ, \u003cem\u003eet al.\u003c/em\u003e MicroRNA-375-3p enhances chemosensitivity to 5-fluorouracil by targeting thymidylate synthase in colorectal cancer. Cancer Sci 2020, 111(5): 1528\u0026ndash;1541.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim N, Yang C. Sodium Butyrate Inhibits the Expression of Thymidylate Synthase and Induces Cell Death in Colorectal Cancer Cells. Int J Mol Sci 2024, 25(3).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Shi C, Yu J, Xu Y. FOXM1-induced TYMS upregulation promotes the progression of hepatocellular carcinoma. Cancer Cell Int 2022, 22(1): 47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuijarro MV, Nawab A, Dib P, Burkett S, Luo X, Feely M, \u003cem\u003eet al.\u003c/em\u003e TYMS promotes genomic instability and tumor progression in Ink4a/Arf null background. Oncogene 2023, 42(23): 1926\u0026ndash;1939.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGutteridge RE, Singh CK, Ndiaye MA, Ahmad N. Targeted knockdown of polo-like kinase 1 alters metabolic regulation in melanoma. Cancer Lett 2017, 394: 13\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSu S, Chhabra G, Ndiaye MA, Singh CK, Ye T, Huang W, \u003cem\u003eet al.\u003c/em\u003e PLK1 and NOTCH Positively Correlate in Melanoma and Their Combined Inhibition Results in Synergistic Modulations of Key Melanoma Pathways. Mol Cancer Ther 2021, 20(1): 161\u0026ndash;172.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKalous J, Aleshkina D. Multiple Roles of PLK1 in Mitosis and Meiosis. Cells 2023, 12(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnderson DD, Quintero CM, Stover PJ. Identification of a de novo thymidylate biosynthesis pathway in mammalian mitochondria. Proc Natl Acad Sci U S A 2011, 108(37): 15163\u0026ndash;15168.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang A, Wu Q, Chen Q, Yang J, Li H, Tao Y, \u003cem\u003eet al.\u003c/em\u003e Cinobufagin restrains the growth and triggers DNA damage of human hepatocellular carcinoma cells via proteasome-dependent degradation of thymidylate synthase. Chem Biol Interact 2022, 360: 109938.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKurasaka C, Nishizawa N, Ogino Y, Sato A. Trapping of 5-Fluorodeoxyuridine Monophosphate by Thymidylate Synthase Confers Resistance to 5-Fluorouracil. ACS Omega 2022, 7(7): 6046\u0026ndash;6052.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoldman ID, Zhao R. Molecular, biochemical, and cellular pharmacology of pemetrexed. Semin Oncol 2002, 29(6 Suppl 18): 3\u0026ndash;17.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNapier RJ, Lee EJ, Davey MP, Vance EE, Furtado JM, Snow PE, \u003cem\u003eet al.\u003c/em\u003e T cell-intrinsic role for Nod2 in protection against Th17-mediated uveitis. Nat Commun 2020, 11(1): 5406.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRochereau N, Roblin X, Michaud E, Gayet R, Chanut B, Jospin F, \u003cem\u003eet al.\u003c/em\u003e NOD2 deficiency increases retrograde transport of secretory IgA complexes in Crohn's disease. Nat Commun 2021, 12(1): 261.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWatson A, Satter LF, Reiland Sauceda A, Kellermayer R, Karam LB. NOD2 polymorphisms may direct a Crohn's disease phenotype in patients with Very EarlyOnset Inflammatory Bowel Disease. J Pediatr Gastroenterol Nutr 2023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarimi L, Jaberi M, Asadi M, Zarredar H, Zafari V, Bornehdeli S, \u003cem\u003eet al.\u003c/em\u003e Significance of microRNA-330-5p/TYMS Expression Axis in the Pathogenesis of Colorectal Tumorigenesis. J Gastrointest Cancer 2022, 53(4): 965\u0026ndash;970.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWan S, Liu Z, Chen Y, Mai Z, Jiang M, Di Q, \u003cem\u003eet al.\u003c/em\u003e MicroRNA-140-3p represses the proliferation, migration, invasion and angiogenesis of lung adenocarcinoma cells via targeting TYMS (thymidylate synthetase). Bioengineered 2021, 12(2): 11959\u0026ndash;11977.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi M, Sun S, Bian Z, Yao S, Liu M, You X, \u003cem\u003eet al.\u003c/em\u003e SNHG15 promotes chemoresistance and glycolysis in colorectal cancer. Pathol Res Pract 2023, 246: 154480.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDalvi PS, Macheleidt IF, Lim SY, Meemboor S, M\u0026uuml;ller M, Eischeid-Scholz H, \u003cem\u003eet al.\u003c/em\u003e LSD1 Inhibition Attenuates Tumor Growth by Disrupting PLK1 Mitotic Pathway. Mol Cancer Res 2019, 17(6): 1326\u0026ndash;1337.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGheghiani L, Wang L, Zhang Y, Moore XTR, Zhang J, Smith SC, \u003cem\u003eet al.\u003c/em\u003e PLK1 Induces Chromosomal Instability and Overrides Cell-Cycle Checkpoints to Drive Tumorigenesis. Cancer Res 2021, 81(5): 1293\u0026ndash;1307.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Blasio C, Zonfrilli A, Franchitto M, Mariano G, Cialfi S, Verma N, \u003cem\u003eet al.\u003c/em\u003e PLK1 targets NOTCH1 during DNA damage and mitotic progression. J Biol Chem 2019, 294(47): 17941\u0026ndash;17950.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X, Chen G, Liu B, Tao Z, Wu Y, Zhang K, \u003cem\u003eet al.\u003c/em\u003e PLK1 inhibition promotes apoptosis and DNA damage in glioma stem cells by regulating the nuclear translocation of YBX1. Cell Death Discov 2023, 9(1): 68.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShin SB, Jang HR, Xu R, Won JY, Yim H. Active PLK1-driven metastasis is amplified by TGF-β signaling that forms a positive feedback loop in non-small cell lung cancer. Oncogene 2020, 39(4): 767\u0026ndash;785.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang YQ, Yuan Y, Zhang J, Lin CY, Guo JL, Liu HS, \u003cem\u003eet al.\u003c/em\u003e Evaluation of the roles and regulatory mechanisms of PD-1 target molecules in NSCLC progression. Ann Transl Med 2021, 9(14): 1168.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReza MS, Hossen MA, Harun-Or-Roshid M, Siddika MA, Kabir MH, Mollah MNH. Metadata analysis to explore hub of the hub-genes highlighting their functions, pathways and regulators for cervical cancer diagnosis and therapies. Discov Oncol 2022, 13(1): 79.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Z, Cheng L, Li J, Qiao Q, Karki A, Allison DB, \u003cem\u003eet al.\u003c/em\u003e Targeting Plk1 Sensitizes Pancreatic Cancer to Immune Checkpoint Therapy. Cancer Res 2022, 82(19): 3532\u0026ndash;3548.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJang HR, Shin SB, Kim CH, Won JY, Xu R, Kim DE, \u003cem\u003eet al.\u003c/em\u003e PLK1/vimentin signaling facilitates immune escape by recruiting Smad2/3 to PD-L1 promoter in metastatic lung adenocarcinoma. Cell Death Differ 2021, 28(9): 2745\u0026ndash;2764.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang D, Veo B, Pierce A, Fosmire S, Madhavan K, Balakrishnan I, \u003cem\u003eet al.\u003c/em\u003e A novel PLK1 inhibitor onvansertib effectively sensitizes MYC-driven medulloblastoma to radiotherapy. Neuro Oncol 2022, 24(3): 414\u0026ndash;426.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng TT, Deng TH, Liu Z, Zhan JR, Ma YZ, Yan YY, \u003cem\u003eet al.\u003c/em\u003e HN1L/AP-2γ/PLK1 signaling drives tumor progression and chemotherapy resistance in esophageal squamous cell carcinoma. Cell Death Dis 2022, 13(12): 1026.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao W, Zhang Y, Luo H, Niu M, Zheng X, Hu W, \u003cem\u003eet al.\u003c/em\u003e Targeting SKA3 suppresses the proliferation and chemoresistance of laryngeal squamous cell carcinoma via impairing PLK1-AKT axis-mediated glycolysis. Cell Death Dis 2020, 11(10): 919.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang S, Yu J, Tan X, Cheng S, Liu H, Li Z, \u003cem\u003eet al.\u003c/em\u003e A novel L-shaped ortho-quinone analog as PLK1 inhibitor blocks prostate cancer cells in G(2) phase. Biochem Pharmacol 2024, 219: 115960.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFujimura T, Yamasaki K, Hidaka T, Ito Y, Aiba S. A synthetic NOD2 agonist, muramyl dipeptide (MDP)-Lys (L18) and IFN-β synergistically induce dendritic cell maturation with augmented IL-12 production and suppress melanoma growth. J Dermatol Sci 2011, 62(2): 107\u0026ndash;115.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong W, Zhang H, Yin X, Liu Y, Chen D, Liang X, \u003cem\u003eet al.\u003c/em\u003e Oral delivery of tumor microparticle vaccines activates NOD2 signaling pathway in ileac epithelium rendering potent antitumor T cell immunity. Oncoimmunology 2017, 6(3): e1282589.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa X, Qiu Y, Sun Y, Zhu L, Zhao Y, Li T, \u003cem\u003eet al.\u003c/em\u003e NOD2 inhibits tumorigenesis and increases chemosensitivity of hepatocellular carcinoma by targeting AMPK pathway. Cell Death Dis 2020, 11(3): 174.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGurses SA, Banskar S, Stewart C, Trimoski B, Dziarski R, Gupta D. Nod2 protects mice from inflammation and obesity-dependent liver cancer. Sci Rep 2020, 10(1): 20519.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"NOD2, TYMS, PLK1, melanoma, chemoresistance, proliferation","lastPublishedDoi":"10.21203/rs.3.rs-4324307/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4324307/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eNucleotide-binding oligomerization domain 2 (NOD2) is an immune sensor crucial for eliciting the innate immune responses. Nevertheless, discrepancies exist regarding the effect of NOD2 on different types of cancer. The aim of this study was to investigate the function of NOD2 in melanoma and its underlying mechanisms. We have validated the tumor suppressor effect of NOD2 in melanoma. NOD2 inhibited the proliferation of melanoma cells, hindering their migration and invasion while promoting the onset of apoptosis. Our study showed that NOD2 expression is closely related to folate metabolism, and its mechanism of action is to inhibit TYMS expression by promoting ubiquitination modification of thymidylate synthase (TYMS), thereby decreasing the resistance of melanoma cells to 5-fluorouracil (5-FU) and capecitabine (CAP). TYMS was identified to form a complex with Polo-like Kinase 1 (PLK1) and activate the PLK1 signaling pathway. Furthermore, we revealed that the combination of the PLK1 inhibitor volasertib (BI6727) with 5-FU or CAP had a synergistic effect repressing the proliferation and migration of melanoma cells. Overall, our research highlights the protective role of NOD2 in melanoma and suggests that targeting NOD2 and the TYMS/PLK1 signaling axis is a high-profile therapy that could be a prospect for melanoma treatment.\u003c/p\u003e","manuscriptTitle":"NOD2 reduces the chemoresistance of melanoma by \ninhibiting the TYMS/PLK1 signaling axis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-14 03:44:00","doi":"10.21203/rs.3.rs-4324307/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2024-06-28T08:58:32+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-06-20T16:53:52+00:00","index":1,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-06-19T22:12:03+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-06-06T20:05:32+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-06-06T09:12:40+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2024-06-02T15:24:15+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-04-29T10:27:24+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-04-25T12:57:31+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Death \u0026 Disease","date":"2024-04-25T12:57:31+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3581c60a-675d-45c6-aa80-2b696b7a1b70","owner":[],"postedDate":"June 14th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":32714984,"name":"Biological sciences/Cancer/Skin cancer/Melanoma"},{"id":32714985,"name":"Biological sciences/Cell biology/Mechanisms of disease"},{"id":32714986,"name":"Biological sciences/Chemical biology/Post-translational modifications/Ubiquitylation"},{"id":32714987,"name":"Biological sciences/Molecular biology/Transcriptomics"}],"tags":[],"updatedAt":"2024-10-02T07:07:33+00:00","versionOfRecord":{"articleIdentity":"rs-4324307","link":"https://doi.org/10.1038/s41419-024-07104-8","journal":{"identity":"cell-death-and-disease","isVorOnly":false,"title":"Cell Death \u0026 Disease"},"publishedOn":"2024-10-01 04:00:00","publishedOnDateReadable":"October 1st, 2024"},"versionCreatedAt":"2024-06-14 03:44:00","video":"","vorDoi":"10.1038/s41419-024-07104-8","vorDoiUrl":"https://doi.org/10.1038/s41419-024-07104-8","workflowStages":[]},"version":"v1","identity":"rs-4324307","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4324307","identity":"rs-4324307","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00