Melittin Inhibits the Expression of Key Genes Involved in Tumor Microenvironment Formation by Suppressing HIF-1α Signaling in Breast Cancer Cells

Melittin Inhibits the Expression of Key Genes Involved in Tumor Microenvironment Formation by Suppressing HIF-1α Signaling in Breast Cancer Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Melittin Inhibits the Expression of Key Genes Involved in Tumor Microenvironment Formation by Suppressing HIF-1α Signaling in Breast Cancer Cells Zabih Mir Hassani, Mohammad Nabiuni, Kazem Parivar, Somayeh Abdirad, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-395664/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 2 You are reading this latest preprint version Abstract Purpose: HIF-1α has critical roles in formation of Tumor microenvironment by regulating genes involved in angiogenesis and anaerobic respiration. TME fuels tumors growth and metastasis and presents therapy with several challenges. Therefore, we aimed to investigate if Melittin disrupts HIF-1α signaling pathway in breast adenocarcinoma cell line MDA-MB-231. Methods: breast adenocarcinoma cell line MDA-MB-231 was cultured in presence of different doses of Melittin and MTT assay was carried out to measure Melittin’s cytotoxic. Cells were exposed to 5% C 2 to mimic hypoxic conditions and Melittin. Western blot was used to measure HIF-1α protein levels. Gene expression analysis was performed using real-time PCR to measure relative mRNA abundance of genes involved in tumor microenvironment formation. Findings: Our results revealed that Melittin effectively inhibits HIF-1α at transcriptional and translation/post-translational level. HIF-1α protein and mRNA level was significantly decreased in Melittin-treated groups. It is found that inhibition of HIF-1α by Melittin is through downregulation of NFκB gene expression. Furthermore, gene expression analysis showed a downregulation in VEGFA and LDHA expression due to inhibition of HIF-1α protein by Melittin. In addition, cell toxicity assay showed that Melittin inhibits the growth of MDA-MB-231 cell line through activation of extrinsic and intrinsic apoptotic pathways by upregulating TNF and BAX expression. Conclusions: Melittin suppresses the expression of genes responsible for formation of TME physiological hallmarks by suppressing HIF-1α signaling pathway. Our results suggest that Melittin can modulate tumor microenvironment by inhibition of VEGFA and LDHA. Cancer Biology Oncology tumor microenvironment HIF-1α NFκB Melittin angiogenesis anaerobic respiration Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Hypoxia is the imbalance between oxygen consumption and supply[ 1 ]. Hypoxic regions within tumor is a common characteristic to a vast variety of solid tumors[ 2 ]. Hypoxia-inducible factor 1(HIF-1) is the main regulator of O 2 homeostasis in mammalian cells[ 3 ]. HIF1 activity is dependent on stabilization of its alpha subunit(HIF-1α) which is under tight control of O 2 availability in the cytosol. Even though, HIF-1α gene transcription is mainly regulated in an O 2 -independent manner by NF-kB and STAT3. NF-kB interacts with HIF-1α promoter at -197/-188 bp through its p50 and p65 subunits[ 4 ]. Moreover, it has been shown that HIF-1α expression is regulated by JAK/Stat signaling through a binding motif at -363/-355 bp of the HIF-1 α promoter[ 5 ]. Under normoxic conditions, HIF-1α is constantly synthesized and degraded. When oxygenation is sufficient, von Hippel–Lindau (VHL) binds HIF-1α and through interaction with Elongin C, recruits an E3 ubiquitin-protein ligase complex that ubiquitinates HIF-1 α and targets it for degradation by the 26S proteasome. In order to bind HIF-1α, VHL needs to be hydroxylated on proline residue 402 or 564 or both by prolyl hydroxylase PHD2. VHL uses O 2 and α-ketoglutarate as substrates[ 6 ]. During hypoxia, this degradation mechanism is disturbed, resulting in accumulation of HIF-1α in cytoplasm. Upon stabilization of HIF-1α, it dimerizes with HIF-1β, HIF1 transcription factor forms in the nucleus and triggers the expression of more than 1500 genes[ 7 ]. HIF-1 is a major driver of tumor microenvironment(TME) formation. Elevated expression of glycolytic genes[ 8 ]–[ 11 ], and HIF1 induction of pyruvate dehydrogenase kinase 1(PDK1)[ 12 ] and lactate dehydrogenase A(LDHA)[ 10 ], drives tumor cell’s metabolism through anaerobic respiration, resulting in declined pH of solid tumor microenvironment[ 13 ], [ 14 ]. HIF1 upregulates carbonic anhydrase IX (CAIX)[ 15 ] which also has a role in decreased TME acidity[ 16 ], [ 17 ]. On the other hand, HIF1 upregulates proangiogenic genes Ang-1 and − 2, Tie-2 and VEGF[ 18 ], [ 19 ]. High permeability of newly formed vasculature and lack of lymphatics result in elevated interstitial fluid pressure (IFP) of tumors, another hallmark of TME[ 20 ]. This environment favors tumor cells with resistance to current chemotherapy and radiotherapy strategies[ 21 ]. Crucial involvement of HIF1 in several steps of carcinogenesis and tumor invasion and metastasis has made it a great target for cancer therapy. Though resistance to current therapeutic reagents has been a sustaining challenge. Melittin(MEL) is a short polypeptide of 26 aminoacids and constitutes about 50% of total dried weight of honey bee venom[ 22 ]. Several studies have reported anti-inflammatory, anti-arthritic, and anti-viral effects of MEL in various cell types. It also induces apoptosis, cell cycle arrest and growth inhibition in several cancer cell types[ 23 ]. it has been shown that MEL can inhibit angiogenesis through downregulation of VEGF in cervical cancer. MEL specifically suppressed EGF-induced VEGF secretion and new blood vessel formation by inhibiting HIF1 signaling pathway[ 24 ]. Nevertheless, there are no previous reports on how MEL can affect HIF-1α in breast cancer. in this study, we have investigated the effect of MEL on breast cancer cell line MDA-MB-231, and its inhibitory effect on HIF-1α mRNA expression and protein level. Also, the expression of genes involved in the formation of TME and downstream to HIF1 signaling has been investigated. Materials And Methods Cell and materials Human triple negative breast adenocarcinoma cell line MDA-MB-231 was obtained from Pasteur Institute of Iran Cell Bank (Tehran, Iran) and cultured in RPMI 1640 medium(GIBCO) supplemented with 1% penicillin-rapamycin antibiotic mixture and 10% fetal bovine serum(FBS). Cultures were incubated at 37°C in presence of 5% CO 2 . To mimic hypoxic conditions, cells were cultured at 37°C in presence of 5% CO 2 and 5% O 2 as described by Bakmiwewa et al[ 25 ].All reagents used were purchased from Sigma (St. Louis, US) except otherwise mentioned. Cell toxicity assay Cell toxicity effects of MEL on MDA-MB-231 cell lines was evaluated by MTT assay. Cells were seeded in a 96-well plate at 2*10 4 cell/well in RPMI 1640 and incubated for 24 hours to attach. Then media was removed, cell were washed with phosphate buffer saline (PBS) once, and new RPMI 1640 containing MEL at 1, 2 and 4 µg/ml concentrations were added to corresponding wells. Cells were incubated for 24 hours. Then 100 µl MTT reagent was added to each well and incubated for 4 hours. Finally, formazan deposits were resolved by adding Dimethyl sulfoxide (DMSO) to each well. Absorbance was measured at 570nm using Epoch™ Microplate Spectrophotometer (Vermont, US). Western Blot Analysis To measure relative protein levels of HIF-1α, western blotting analysis was used. Total protein was extracted using NP40 buffer. Briefly, cells were resuspended in 50 µl NP40 lysis buffer (10mM Tris, 10mM NaCl, 5 mM EDTA, 1 mM DTT, 0.5% Nonidet P-40, 0.1mM phenylmethylsulfonyl fluoride, 2 µM aprotinin, and 2 µM leupeptin) and vortexed and then incubated on ice for 30 minutes followed by centrifugation at 13000rpm at 4°C. Supernatant was collected and stored at -20°C. Total protein was quantified using Bradford’s method. 30µg of total protein was electrophoresed and transferred onto a nitrocellulose membrane. β-actin was used as housekeeping protein. Primary antibody against HIF-1α was obtained from Abcam (Cambridge, UK). Primary antibody for β-actin and HRP-labelled secondary antibody was purchased from Biorad (California, US). Detection of specific target proteins was carried out using Biorad Clarity Western ECL Substrate (California, US), as instructed by manufacturer. Quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR) Total RNA was extracted using Invitrogen TRIzol reagent (California, US) as described by supplier. First strand cDNA was synthesized using 1µg of total RNA using Geneall’s Hyperscript™ first strand synthesis kit (Seoul, Korea). Quantitative realtime PCR was performed in triplicates using Ampliqon’s RealQ Plus 2x Master Mix Green (Odense, Denamark). β-2 microglobulin (B2M) was used as reference gene. Primer sequences used for realtime PCR are presented in Table 1 . Table 1 Sequence of primers used for gene expression analysis Gene Sequence(5' to 3') Product size HIF-1α CCAGCAGACTCAAATACAAGAACC 138 bps TGTATGTGGGTAGGAGATGGAGAT NFκB CACAAGGCAGCAAATAGACGAG 133 bps CATTTTGTTGAGAGTTAGCAGTGAG VEGFA CTTGTTCAGAGCGGAGAAAGC 125 bps ACATCTGCAAGTACGTTCGTT LDHA GTTTGTTCACCTCATAAGCACTCTC 104 bps CTCTCTGAAGACTCTCCACCC BAX GGAAACTGGTGCTCAAGGC 161 bps GGTCATCAGTCGCTTCAGTG BCL2 GGATAACGGAGGCTGGGATG 165 bps CAGGGATGTTGACTTCTCTTGTG TNF TCCACCCATGTGCTCCTCAC 97 bps TCTGGCAGGGGCTCTTGATG β-2M AGATGAGTATGCCTGCCGTG 104 bps CGGCATCTTCAAACCTCCA Statistical Analysis Data are drawn from triplicate experiments. Analysis was performed using R package dplyr on R Studio version 1.3 platform. Realtime PCR data were analyzed using 2 −∆∆Ct method. One-way ANOVA has been used to detect statistically significant differences. P values less than 0.05 was considered as significant. Results Melitin inhibits the proliferation of breast cancer cell line MDA-MB-231 through induction of apoptosis by upregulating BAX and TNF expression In order to understand how MEL can modulate the growth of MDA-MB-231 cell line, we first evaluated its cytotoxic effects using MTT assay. The viability of MDA-MB-231 cells did not change at 1 and 2 µg/ml of MEL, but a significant change in viability was observed at 4 mg/ml (Fig. 1A). Melittin’s IC 50 for MDA-MB-231 cell line was measured 3.8 µg/ml. To find the mechanism of growth inhibition by Melittin, expression of BAX, BCL2 and TNF was measured using real-time PCR. Melittin treatment at dose of 4 µg/ml induced a 4.4-fold increase in expression level of BAX(p < 0.001), where no significant change in the expression level of BCL2 was observed (Fig. 1B). On the other hand, TNF expression increased with different doses of MEL constantly (Fig. 1C). Our findings suggest that growth inhibitory effect of MEL is primarily exerted through induction of TNF expression and subsequent activation of extrinsic apoptotic cascade, while it triggers the intrinsic cascade by upregulating the expression of pro-apoptotic gene BAX, too. Melittin is not toxic to MDA-MB-231 cells at concentrations 1 and 2 µg/ml and thus further experiments were performed using these concentrations. Melittin inhibits HIF-1α protein level by downregulating its mRNA expression through inhibition of NF-kB expression To induce HIF-1α protein, cells were cultured in 5%O 2 for 6 hours. Low oxygen concentration resulted in significant elevated levels of HIF-1α protein (Fig. 2A). In order to investigate effect of MEL on HIF-1α, cells were treated with different concentrations of MEL and incubated at 5%O 2 for 6 hours. Melittin reverted the elevated levels of HIF-1α protein in a dose-dependent manner presenting approximately a 10-fold decrease in levels of hypoxia-induced HIF-1α protein at 2 µg/ml (Fig. 2B). Real-time PCR experiment showed that Melittin inhibits the expression of HIF-1α mRNA compared to untreated and hypoxic groups (FC = 0.1, p < 0.001 and FC = 0.2, p < 0.001 at 1µg/ml and 2 µg/ml respectively; Fig. 2C). This suggests that during hypoxia, HIF-1α is induced at transcriptional and translational/post-translational level. This upregulation was reverted significantly when cells were treated with different doses of MEL compared to untreated and hypoxia-treated group (Fig. 2C), indicating that Melittin inhibits HIF-1α protein levels by downregulating its mRNA transcription. Further analysis of NF-kB gene expression, direct regulator HIF-1α transcription, showed decreased expression levels when cells were treated with 2 µg/ml of Melittin (Fig. 2D). These findings show that Melittin inhibits HIF-1α through downregulation of its transcription by NF-kB. Melittin controls the expression of key players of tumor microenvironment formation by modulating HIF-1α signaling HIF-1α plays a crucial role in formation of tumor microenvironment by regulating expression of genes involved in different steps of development of TME. Thus we further analyzed the expression of genes that are down-stream to HIF-1α and are involved in angiogenesis and anaerobic respiration. HIF-1α mediated anti-angiogenic effect of MEL was investigated by analyzing the expression of VEGF-A, the leading character of the angiogenesis story. Declined O 2 concentration induced a 2.2-fold increase in expression of VEGFA gene compared to untreated group (Fig. 3A, p < 0.05) where MEL treatment at concentrations of 1 and 2 µg/ml reverted the change and induced significant downregulation of VEGFA (FC = 0.1, p < 0.05 and FC = 0.07, p < 0.05, respectively). This observation indicates that MEL can inhibit angiogenesis by inhibition of VEGFA expression through downregulation of HIF-1α protein level (Fig. 3A). For evaluation of effect of declined HIF-1α protein levels by MEL on anaerobic respiration, gene expression of lactate dehydrogenase A(LDHA), the key driver of anaerobic respiration switch was measured. Elevated levels of HIF-1α induced by low O2 concentration, upregulated expression level of LDHA mRNA slightly, compared to untreated group (Fig. 3B). Subsequently, MEL treatment reduced the expression level of LDHA significantly in comparison to hypoxia-treated group (FC = 0.4 and FC = 0.3 at 1µg/ml and 2 µg/ml respectively, p < 0.05; Fig. 3B). This suggests that MEL can inhibit anaerobic respiration through downregulation of LDHA. These data suggest inhibitory effects of Melittin against physiological characteristics of TME through regulation of angiogenesis and anaerobic respiration. Discussion Emerging evidences have refined the definition of cancer as complex heterotypic multicellular interactions between transformed tumor cells and the neighboring universe, termed as tumor microenvironment, which favors the development and growth of a malignancy. TME contains physiochemical and cellular microenvironment and changes in its composition have profound effects on cancer progression[ 26 ]. In this study, we have put a key regulator of TME under investigation. As results of uncontrolled proliferation of O 2 -consuming tumor cells and inefficiency of newly formed vasculature, chronic and cycling(intermittent) hypoxia is a prominent feature of solid tumors microenvironment[ 27 ]. Mammalian cells respond to any fluctuation in oxygen concentration by HIF1[ 3 ]. HIF1 is a transcription factor and controls the expression of more than 1500 genes at transcriptional level. Many of these genes are involved in tumor cell proliferation, immune evasion, angiogenesis, EMT, invasion and metastasis[ 7 ]. HIF1 is a dimer of HIF-1β and O2-regulated HIF-1α. In normoxia, HIF-1α is immediately targeted for proteasomal degradation by VHL that needs O 2 as a cofactor, while during hypoxia it accumulates in cytoplasm, enters the nucleus where it dimerizes with HIF-1β and HIF1 complex is formed[ 7 ]. This makes HIF-1α an ideal target for cancer therapy. In current study we have investigated the pharmacological effects of Melittin from honey bee venom on HIF-1α function in breast cancer cell line MDA-MB-231. Previous studies have demonstrated anti-proliferative effects of Melittin on cervix and non-small cell lung cancer cell lines[ 24 ], [ 28 ]. We found that Melittin inhibits the growth of breast cancer cell line MDA-MB-231 (Fig. 1 A). An IC 50 of 3.8 µg/ml was measured. Melittin exerts its inhibitory effect on proliferation of MDA-MB-231 cell line primarily through upregulation of TNF and subsequent activation of extrinsic apoptosis pathway (Fig. 1 C). Furthermore, anti-proliferative effect of Melittin may be attributed to upregulation of pro-apoptotic gene BAX (Fig. 1 B). Shu et al. reported a similar mechanism for growth inhibition by Melittin in renal tubule epithelial cells in mouse model of acute kidney injuries; Upregulation of TNF corresponding to elevated levels of TNF in mouse serum indicative of TNF signaling pathway activation and upregulation of BAX/BCL2 expression ratio[ 29 ]. Besides, it has been reported that Melittin inhibits cell growth and induces apoptosis by inhibiting the MAPK, Akt, and NF-kB pathways in cancer cells[ 24 ]. In another study, it has been suggested that anti-proliferative effects of Melittin include activation of caspases and matrix metalloproteinases[ 28 ]. Nevertheless, no previous reports regarding modulation of breast cancer TME by Melittin are available. HIF-1α is a crucial modulator of TME physiology. Declined pH and high interstitial fluid pressure in TME due to anaerobic respiration and leaky vasculature provide a barrier to current therapy strategies. HIF-1α regulates genes responsible for anaerobic respiration and angiogenesis. In current study we examined effects of Melittin treatment on HIF-1α and its downstream genes required for the formation of TME. Melittin treatment suppressed hypoxia-induced HIF-1α protein and mRNA levels (Fig. 2 B and 2 C). Gene expression analysis of NF-kB revealed that Melittin inhibits NF-kB expression (Fig. 2 D). NF-kB is a direct regulator of HIF-1α expression[ 30 ]. Our finding suggests that Melittin inhibits HIF-1α primarily at transcriptional level through inhibition of NF-kB expression. This is in contrast to a previous study by shin et al., that reported that Melittin inhibits HIF-1α at translational level but not its mRNA, by Inhibition of ERK and mTOR/p70S6K Pathway in Human Cervical Carcinoma Cells. Mitogen-activated protein (MAP) kinases and phosphatidylinositol 3-kinases (PI3K)/Akt pathways are involved in translation of HIF-1α[ 24 ]. STAT3, another regulator of HIF-1α transcription, enhances HIF-1α expression through PKM2/HIF-1α positive feedback loop[ 31 ]. Several studies have reported that Melittin suppresses STAT3 signaling pathway. Kim and colleagues demonstrated that Melittin inhibits STAT3 activation and translocation of NFκB into the nucleus in human fibroblast-like synoviocytes[ 32 ]. In another study, it was reported that Melittin inhibits phosphorylation of JAK2 and STAT3 in SKOV3 and PA-1 ovarian cancer cell[ 33 ]. Inhibition of HIF-1α protein level by Melittin resulted in downregulation of VEGFA and LDHA (Fig. 3 A and 3 B). Several studies have reported VEGFA downregulation by Melittin in human cervical carcinoma cells[ 24 ], hepatocellular carcinoma cell lines[ 34 ], bladder cancer cells[ 35 ], lung cancer cells[ 36 ] and ehrlich carcinoma mouse model[ 37 ]. Inhibition of ERK and mTOR/p70S6K, VEGFR-2 and the COX-2-mediated MAPK signaling pathways has been implicated in these studies. Putting these together, Melittin can disrupt the formation of TME by suppressing HIF-1α protein in hypoxic conditions (Fig. 4 ). Conclusion In conclusion, we report for the first time that Melittin inhibits the growth of breast cancer cells by upregulation of extrinsic and intrinsic apoptotic pathway genes. Moreover, we demonstrate that Melittin can disrupt tumor microenvironment formation by suppressing the expression of genes responsible for anaerobic respiration and angiogenesis through inhibition of HIF-1α at transcriptional and translational/post-translational level in breast cancer cells. This is of importance as TME has been established as a barrier to cancer therapy during recent years. Our study provides further evidence on anti-cancer effects of Melittin. Declarations Conflict of interest The authors declare that they have no conflict of interest. Acknowledgement The authors thank the Faculty of Biological Sciences, Kharazmi University, Tehran, Iran. Availability of data Not applicable. References Höckel M, Vaupel P. “Tumor hypoxia: definitions and current clinical, biologic, and molecular aspects. ” J Natl Cancer Inst. Feb. 2001;93(4):266–76. Vaupel P, Mayer A. Hypoxia in cancer: significance and impact on clinical outcome. Cancer Metastasis Rev. 2007;26:225–39. Semenza L. Hypoxia-inducible factor 1: master regulator of O2 homeostasis. Curr Opin Genet Dev. 1998;8(5):588–94. Bonello S, et al., “Reactive oxygen species activate the HIF-1α promoter via a functional NFκB site,” Arterioscler. Thromb. Vasc. Biol. , vol. 27, no. 4, pp. 755–761, Apr. 2007. Niu G, et al., “Signal transducer and activator of transcription 3 is required for hypoxia-inducible factor-1α RNA expression in both tumor cells and tumor-associated myeloid cells,” Mol. Cancer Res. , vol. 6, no. 7, pp. 1099–1105, Jul. 2008. Semenza GL. “Life with oxygen,” Science , vol. 318, no. 5847. Science, pp. 62–64, 05-Oct-2007. Semenza GL. The hypoxic tumor microenvironment: A driving force for breast cancer progression. Biochim Biophys Acta - Mol Cell Res. 2015;1863(3):382–91. Chen C, Pore N, Behrooz A, Ismail-Beigi F, Maity A. Regulation of glut1 mRNA by Hypoxia-inducible Factor-1. J Biol Chem. 2001;276(12):9519–25. O’rourke JF, Pugh CW, Bartlett SM, Ratcliffe PJ, “Identification of Hypoxically Inducible mRNAs in HeLa Cells Using Differential-Display PCR.,” Eur. J. Biochem. , vol. 241, no. 2, pp. 403–410, Oct. 1996. Semenza GL, et al., “Hypoxia Response Elements in the Aldolase A, Enolase 1, and Lactate Dehydrogenase A Gene Promoters Contain Essential Binding Sites for Hypoxia-inducible Factor 1,” J. Biol. Chem. , vol. 271, no. 51, pp. 32529–32537, Dec. 1996. Mathupala SP, Rempel A, Pedersen PL. Glucose Catabolism in Cancer Cells. J Biol Chem. 2001;276(46):43407–12. Papandreou I, et al., “HIF-1 mediates adaptation to hypoxia by actively downregulating mitochondrial oxygen consumption.,” Cell Metab. , vol. 3, no. 3, pp. 187–97, Mar. 2006. Helmlinger G, Yuan F, Dellian M, Jain RK. Interstitial pH and pO2 gradients in solid tumors in vivo: high-resolution measurements reveal a lack of correlation. ” Nat Med. Feb. 1997;3(2):177–82. Newell K, Franchi A, Pouysségur J, Tannock I, “Studies with glycolysis-deficient cells suggest that production of lactic acid is not the only cause of tumor acidity.,” Proc. Natl. Acad. Sci. U. S. A. , vol. 90, no. 3, pp. 1127–31, 1993. Wykoff CC, et al. Hypoxia-inducible Expression of Tumor-associated Carbonic Anhydrases. Cancer Res. 2000;60:no. 24. Helmlinger G, Sckell A, Dellian M, Forbes NS, Jain RK. “Acid Production in Glycolysis-impaired Tumors Provides New Insights into Tumor Metabolism,” Clin. Cancer Res. , vol. 8, no. 4, 2002. Swietach P, Vaughan-Jones RD, Harris AL, “Regulation of tumor pH and the role of carbonic anhydrase 9,” Cancer Metastasis Rev. , vol. 26, no. 2, pp. 299–310, Jul. 2007. Krock BL, Skuli N, Simon MC, “Hypoxia-induced angiogenesis: good and evil.,” Genes Cancer , vol. 2, no. 12, pp. 1117–33, Dec. 2011. Forsythe JA, et al., “Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1.,” Mol. Cell. Biol. , vol. 16, no. 9, pp. 4604–13, Sep. 1996. Fukumura D, Jain RK. “Tumor microenvironment abnormalities: Causes, consequences, and strategies to normalize,” Journal of Cellular Biochemistry . 2007. Cairns R, Papandreou I, Denko N, “Overcoming Physiologic Barriers to Cancer Treatment by Molecularly Targeting the Tumor Microenvironment,” Mol. Cancer Reasearch , vol. 4, no. February, pp. 61–71, 2006. Raghuraman ACH. Melittin: a Membrane-active Peptide with Diverse Functions. Biosci Rep. 2007;27:189–223. Gajski G, Garaj-Vrhovac V. Melittin: A lytic peptide with anticancer properties. Environ Toxicol Pharmacol. 2013;36(2):697–705. Shin J-M, et al., “Melittin Suppresses HIF-1α/VEGF Expression through Inhibition of ERK and mTOR/p70S6K Pathway in Human Cervical Carcinoma Cells,” PLoS One , vol. 8, no. 7, p. e69380, Jul. 2013. Bakmiwewa SM, Heng B, Guillemin GJ, Ball HJ, Hunt NH. An effective, low-cost method for achieving and maintaining hypoxia during cell culture studies. Biotechniques. 2015;59(4):223–9. Michiels C, Tellier C, Feron O. “Cycling hypoxia: A key feature of the tumor microenvironment,” Biochimica et Biophysica Acta - Reviews on Cancer , vol. 1866, no. 1. Elsevier B.V., pp. 76–86, 01-Aug-2016. Delprat V, Tellier C, Demazy C, Raes M, Feron O, Michiels C. Cycling hypoxia promotes a pro-inflammatory phenotype in macrophages via JNK/p65 signaling pathway. Sci Rep. 2020;10(1):1–13. Zhang SF, Chen Z. Melittin exerts an antitumor effect on non-small celllung cancer cells. Mol Med Rep. 2017;16(3):3581–6. Shu Y, et al., “Melittin inducing the apoptosis of renal tubule epithelial cells through upregulation of Bax/Bcl-2 expression and activation of TNF- Signaling pathway,” Biomed Res. Int. , vol. 2019, 2019. D’Ignazio L, Batie M, Rocha S. “Hypoxia and inflammation in cancer, focus on HIF and NF-κB,” Biomedicines , vol. 5, no. 2. MDPI AG, 01-Jun-2017. Demaria M, Poli V. PKM2, STAT3 and HIF-1α. Jak-Stat. 2012;1(3):194–6. Kim SK, et al., “Melittin enhances apoptosis through suppression of IL-6/sIL-6R complex-induced NF-κB and STAT3 activation and Bcl-2 expression for human fibroblast-like synoviocytes in rheumatoid arthritis,” Jt. Bone Spine , vol. 78, no. 5, pp. 471–477, Oct. 2011. Jo M, et al. Anti-cancer effect of bee venom toxin and melittin in ovarian cancer cells through induction of death receptors and inhibition of JAK2/STAT3 pathway. Toxicol Appl Pharmacol. Jan. 2012;258(1):72–81. Zhang Z, Zhang H, Peng T, Li D, Xu J. Melittin suppresses cathepsin S-induced invasion and angiogenesis via blocking of the VEGF-A/VEGFR-2/MEK1/ERK1/2 pathway in human hepatocellular carcinoma. Oncol Lett. Jan. 2016;11(1):610–8. Jin Z, et al., “Melittin constrains the expression of identified key genes associated with bladder cancer,” J. Immunol. Res. , vol. 2018, 2018. Huh JE, et al. Melittin suppresses VEGF-A-induced tumor growth by blocking VEGFR-2 and the COX-2-mediated MAPK signaling pathway. J Nat Prod. 2012;75(11):1922–9. El Bakary NM, Alsharkawy AZ, Shouaib ZA, Barakat EMS. Role of Bee Venom and Melittin on Restraining Angiogenesis and Metastasis in γ-Irradiated Solid Ehrlich Carcinoma-Bearing Mice. Integr Cancer Ther. Jan. 2020;19:153473542094447. Cite Share Download PDF Status: Under Review Version 1 posted Reviewers invited by journal 03 Apr, 2021 First submitted to journal 24 Mar, 2021 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-395664","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":19937196,"identity":"f8420e19-f2ff-49b5-9684-d5280b378223","order_by":0,"name":"Zabih Mir Hassani","email":"","orcid":"","institution":"Kharazmi University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zabih","middleName":"Mir","lastName":"Hassani","suffix":""},{"id":19937197,"identity":"175c7353-9a72-4ca2-acfb-d18b36e55eee","order_by":1,"name":"Mohammad Nabiuni","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/ElEQVRIiWNgGAWjYDCCAwxsDAkMCQkQnoENkGBsPECKljSQlgbCWhjgWhgOQwXxAL7jPWYPHlSk5fHPPvz4042C83Zr2w8DbamxicalRfLMGXODhDM5xRLn0gyMcwxuJ287kwjUciwttwGHFoMbaWkSiW0ViQ1nGAySQVrMDgC1MDYcxq3l/jOIlvln2D8czjE4l2x2/iEBLTeYjwG15CRuOMNj2JxjcMDO7AYBWyTPJB8H+iUtceMZnmLmHIPkBLMbQFsS8PiF7/jBtoc/KpIT551h3/w554+dvdn59IcPPtTY4NSCARLBKhOIVQ4C9qQoHgWjYBSMgpEBADAJa2o6yAbsAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-0349-6676","institution":"Kharazmi University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"","lastName":"Nabiuni","suffix":""},{"id":19937198,"identity":"e5ed7308-3101-4383-9f2f-44ee7b8bd55e","order_by":2,"name":"Kazem Parivar","email":"","orcid":"","institution":"Kharazmi University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Kazem","middleName":"","lastName":"Parivar","suffix":""},{"id":19937199,"identity":"a0581613-92c2-41e6-9bf5-a9aeec559c17","order_by":3,"name":"Somayeh Abdirad","email":"","orcid":"","institution":"Kharazmi University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Somayeh","middleName":"","lastName":"Abdirad","suffix":""},{"id":19937200,"identity":"13773e5d-38cb-45af-8ed8-b806a54e8952","order_by":4,"name":"Latifeh Karimzadeh","email":"","orcid":"","institution":"Tehran University: University of Tehran","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Latifeh","middleName":"","lastName":"Karimzadeh","suffix":""}],"badges":[],"createdAt":"2021-04-05 15:09:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-395664/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-395664/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":7758521,"identity":"bf24aa7b-d6d8-4fd6-9e3a-1a2030a2fddb","added_by":"auto","created_at":"2021-04-07 15:14:32","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":170854,"visible":true,"origin":"","legend":"Melitin inhibits the proliferation of breast cancer cell line MDA-MB-231 through induction of apoptosis by upregulating BAX and TNFα expression. (A)Cells were treated with deiiferent doses of MEL for 24 hours. viability was measured using MTT assay. significant change in viability was observed at 4 µg/ml. (B) Gene expression analysis of BAX and BCL2 showed that MEL treatment upregulated the expression of BAX, while no significant change was observed for BCL2. (C) TNF expression was upregulated with different doses of MEL, suggestive of induction of extrinsic apoptotic pathway (**, p\u003c0.01; ***, p\u003c0.001).","description":"","filename":"figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-395664/v1/0650aa5e2b3bddf4327934a9.jpg"},{"id":7758769,"identity":"e96dbe77-7ef3-4e41-997a-fbfff2a1d344","added_by":"auto","created_at":"2021-04-07 15:17:33","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":213346,"visible":true,"origin":"","legend":"Melittin inhibits HIF-1α protein level by downregulating its mRNA expression through inhibition of NF-kB expression. (A) Cells were incubated at 5% O2 for 6 hours and HIF-1α protein level was measured using western blotting. HIF-1α protein level increased approximately 20 times. (B) cells were treated with different doses of MEL and incubated at 5% O2 for 6 hours. MEL decreased HIF-1α protein level significantly in comparison to hyopia-treated group at 2 µg/ml. (C) mRNA levels of hif-1α gene did not change in hypoxic group compared to untreated control. Significant decrease was observed when treated with different doses of MEL. (D) further analysis of NF-kB showed no significant change in its expression in hypoxia-treated group in comparison to untreated control. NF-kB expression was downregulated at presence of 2 µg/ml MEL, sugeestive of HIF-1α downregulation as a result of declined expression of NF-kB (**, p\u003c0.01; ***, p\u003c0.001).","description":"","filename":"figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-395664/v1/0d25792bb867036223f0f1de.jpg"},{"id":7758524,"identity":"d472c0df-da24-4eb6-a124-efb127049b21","added_by":"auto","created_at":"2021-04-07 15:14:33","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":80937,"visible":true,"origin":"","legend":"Melittin controls the expression of key players of tumor microenvironment formation by modulating HIF-1α signaling. Cells were incubated at 5% O2 for 6 hours and gene expression analysis was performed using realtime PCR. (A) hypoxic treatment induced expression of VEGFA compared to untreated control. MEL inhibited expression of hypoxia-induced VEGFA expression significantly. (B) low concentration of O2 upregulated LDHA slightly, though it was not significant. MEL treatment supressed LDHA expression significantly. These observations implicate inhibitory effect of MEL on TME physiological hallmarks (*, p\u003c0.05; **, p\u003c0.01).","description":"","filename":"figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-395664/v1/dadeecc9cfdaed8d27815c43.jpg"},{"id":7758770,"identity":"7b8453ef-b970-44f1-8acc-f7aa3f2be73d","added_by":"auto","created_at":"2021-04-07 15:17:34","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":20481,"visible":true,"origin":"","legend":"Melittin and TME. HIF-1α drives the formation of TME by regulating the expression of key genes involved in the process. Melittin disrupts the cascade by inhibiting HIF-1α at transcriptional and translational/post-translational level.","description":"","filename":"figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-395664/v1/c129aa6a3dddda6975a47dc9.jpg"},{"id":13684353,"identity":"92896432-9700-478e-b7fe-f6af69d09183","added_by":"auto","created_at":"2021-09-17 12:07:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":552999,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-395664/v1/36dd6103-c9a0-41fe-a6b4-06a545f4e4b4.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eMelittin Inhibits the Expression of Key Genes Involved in Tumor Microenvironment Formation by Suppressing HIF-1α Signaling in Breast Cancer Cells\u003c/p\u003e","fulltext":[{"header":"Introduction","content":" \u003cp\u003eHypoxia is the imbalance between oxygen consumption and supply[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Hypoxic regions within tumor is a common characteristic to a vast variety of solid tumors[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Hypoxia-inducible factor 1(HIF-1) is the main regulator of O\u003csub\u003e2\u003c/sub\u003e homeostasis in mammalian cells[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. HIF1 activity is dependent on stabilization of its alpha subunit(HIF-1α) which is under tight control of O\u003csub\u003e2\u003c/sub\u003e availability in the cytosol. Even though, HIF-1α gene transcription is mainly regulated in an O\u003csub\u003e2\u003c/sub\u003e-independent manner by NF-kB and STAT3. NF-kB interacts with HIF-1α promoter at -197/-188 bp through its p50 and p65 subunits[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Moreover, it has been shown that HIF-1α expression is regulated by JAK/Stat signaling through a binding motif at -363/-355 bp of the HIF-1 α promoter[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Under normoxic conditions, HIF-1α is constantly synthesized and degraded. When oxygenation is sufficient, von Hippel\u0026ndash;Lindau (VHL) binds HIF-1α and through interaction with Elongin C, recruits an E3 ubiquitin-protein ligase complex that ubiquitinates HIF-1 α and targets it for degradation by the 26S proteasome. In order to bind HIF-1α, VHL needs to be hydroxylated on proline residue 402 or 564 or both by prolyl hydroxylase PHD2. VHL uses O\u003csub\u003e2\u003c/sub\u003e and α-ketoglutarate as substrates[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. During hypoxia, this degradation mechanism is disturbed, resulting in accumulation of HIF-1α in cytoplasm. Upon stabilization of HIF-1α, it dimerizes with HIF-1β, HIF1 transcription factor forms in the nucleus and triggers the expression of more than 1500 genes[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHIF-1 is a major driver of tumor microenvironment(TME) formation. Elevated expression of glycolytic genes[\u003cspan additionalcitationids=\"CR9 CR10\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u0026ndash;[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], and HIF1 induction of pyruvate dehydrogenase kinase 1(PDK1)[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] and lactate dehydrogenase A(LDHA)[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], drives tumor cell\u0026rsquo;s metabolism through anaerobic respiration, resulting in declined pH of solid tumor microenvironment[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. HIF1 upregulates carbonic anhydrase IX (CAIX)[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] which also has a role in decreased TME acidity[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. On the other hand, HIF1 upregulates proangiogenic genes Ang-1 and \u0026minus;\u0026thinsp;2, Tie-2 and VEGF[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. High permeability of newly formed vasculature and lack of lymphatics result in elevated interstitial fluid pressure (IFP) of tumors, another hallmark of TME[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. This environment favors tumor cells with resistance to current chemotherapy and radiotherapy strategies[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCrucial involvement of HIF1 in several steps of carcinogenesis and tumor invasion and metastasis has made it a great target for cancer therapy. Though resistance to current therapeutic reagents has been a sustaining challenge. Melittin(MEL) is a short polypeptide of 26 aminoacids and constitutes about 50% of total dried weight of honey bee venom[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Several studies have reported anti-inflammatory, anti-arthritic, and anti-viral effects of MEL in various cell types. It also induces apoptosis, cell cycle arrest and growth inhibition in several cancer cell types[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. it has been shown that MEL can inhibit angiogenesis through downregulation of VEGF in cervical cancer. MEL specifically suppressed EGF-induced VEGF secretion and new blood vessel formation by inhibiting HIF1 signaling pathway[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNevertheless, there are no previous reports on how MEL can affect HIF-1α in breast cancer. in this study, we have investigated the effect of MEL on breast cancer cell line MDA-MB-231, and its inhibitory effect on HIF-1α mRNA expression and protein level. Also, the expression of genes involved in the formation of TME and downstream to HIF1 signaling has been investigated.\u003c/p\u003e "},{"header":"Materials And Methods","content":" \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell and materials\u003c/h2\u003e \u003cp\u003eHuman triple negative breast adenocarcinoma cell line MDA-MB-231 was obtained from Pasteur Institute of Iran Cell Bank (Tehran, Iran) and cultured in RPMI 1640 medium(GIBCO) supplemented with 1% penicillin-rapamycin antibiotic mixture and 10% fetal bovine serum(FBS). Cultures were incubated at 37\u0026deg;C in presence of 5% CO\u003csub\u003e2\u003c/sub\u003e. To mimic hypoxic conditions, cells were cultured at 37\u0026deg;C in presence of 5% CO\u003csub\u003e2\u003c/sub\u003e and 5% O\u003csub\u003e2\u003c/sub\u003e as described by Bakmiwewa et al[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].All reagents used were purchased from Sigma (St. Louis, US) except otherwise mentioned.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCell toxicity assay\u003c/h2\u003e \u003cp\u003eCell toxicity effects of MEL on MDA-MB-231 cell lines was evaluated by MTT assay. Cells were seeded in a 96-well plate at 2*10\u003csup\u003e4\u003c/sup\u003e cell/well in RPMI 1640 and incubated for 24 hours to attach. Then media was removed, cell were washed with phosphate buffer saline (PBS) once, and new RPMI 1640 containing MEL at 1, 2 and 4 \u0026micro;g/ml concentrations were added to corresponding wells. Cells were incubated for 24 hours. Then 100 \u0026micro;l MTT reagent was added to each well and incubated for 4 hours. Finally, formazan deposits were resolved by adding Dimethyl sulfoxide (DMSO) to each well. Absorbance was measured at 570nm using Epoch\u0026trade; Microplate Spectrophotometer (Vermont, US).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eWestern Blot Analysis\u003c/h2\u003e \u003cp\u003eTo measure relative protein levels of HIF-1α, western blotting analysis was used. Total protein was extracted using NP40 buffer. Briefly, cells were resuspended in 50 \u0026micro;l NP40 lysis buffer (10mM Tris, 10mM NaCl, 5 mM EDTA, 1 mM DTT, 0.5% Nonidet P-40, 0.1mM phenylmethylsulfonyl fluoride, 2 \u0026micro;M aprotinin, and 2 \u0026micro;M leupeptin) and vortexed and then incubated on ice for 30 minutes followed by centrifugation at 13000rpm at 4\u0026deg;C. Supernatant was collected and stored at -20\u0026deg;C. Total protein was quantified using Bradford\u0026rsquo;s method. 30\u0026micro;g of total protein was electrophoresed and transferred onto a nitrocellulose membrane. β-actin was used as housekeeping protein. Primary antibody against HIF-1α was obtained from Abcam (Cambridge, UK). Primary antibody for β-actin and HRP-labelled secondary antibody was purchased from Biorad (California, US). Detection of specific target proteins was carried out using Biorad Clarity Western ECL Substrate (California, US), as instructed by manufacturer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted using Invitrogen TRIzol reagent (California, US) as described by supplier. First strand cDNA was synthesized using 1\u0026micro;g of total RNA using Geneall\u0026rsquo;s Hyperscript\u0026trade; first strand synthesis kit (Seoul, Korea). Quantitative realtime PCR was performed in triplicates using Ampliqon\u0026rsquo;s RealQ Plus 2x Master Mix Green (Odense, Denamark). β-2 microglobulin (B2M) was used as reference gene. Primer sequences used for realtime PCR are presented in Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequence of primers used for gene expression analysis\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence(5' to 3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProduct size\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHIF-1α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAGCAGACTCAAATACAAGAACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e138 bps\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTATGTGGGTAGGAGATGGAGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNFκB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACAAGGCAGCAAATAGACGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e133 bps\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATTTTGTTGAGAGTTAGCAGTGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eVEGFA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTGTTCAGAGCGGAGAAAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e125 bps\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACATCTGCAAGTACGTTCGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eLDHA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTTTGTTCACCTCATAAGCACTCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e104 bps\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCTCTGAAGACTCTCCACCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBAX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAAACTGGTGCTCAAGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e161 bps\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTCATCAGTCGCTTCAGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBCL2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGATAACGGAGGCTGGGATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e165 bps\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGGGATGTTGACTTCTCTTGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTNF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCACCCATGTGCTCCTCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e97 bps\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTGGCAGGGGCTCTTGATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eβ-2M\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGATGAGTATGCCTGCCGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e104 bps\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGCATCTTCAAACCTCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eData are drawn from triplicate experiments. Analysis was performed using R package dplyr on R Studio version 1.3 platform. Realtime PCR data were analyzed using 2\u003csup\u003e\u0026minus;∆∆Ct\u003c/sup\u003e method. One-way ANOVA has been used to detect statistically significant differences. P values less than 0.05 was considered as significant.\u003c/p\u003e \u003c/div\u003e "},{"header":"Results","content":"\u003ch2\u003eMelitin inhibits the proliferation of breast cancer cell line MDA-MB-231 through induction of apoptosis by upregulating BAX and TNF expression\u003c/h2\u003e\n\u003cp\u003eIn order to understand how MEL can modulate the growth of MDA-MB-231 cell line, we first evaluated its cytotoxic effects using MTT assay. The viability of MDA-MB-231 cells did not change at 1 and 2 \u0026micro;g/ml of MEL, but a significant change in viability was observed at 4 mg/ml (Fig.\u0026nbsp;1A). Melittin\u0026rsquo;s IC\u003csub\u003e50\u003c/sub\u003e for MDA-MB-231 cell line was measured 3.8 \u0026micro;g/ml. To find the mechanism of growth inhibition by Melittin, expression of BAX, BCL2 and TNF was measured using real-time PCR. Melittin treatment at dose of 4 \u0026micro;g/ml induced a 4.4-fold increase in expression level of BAX(p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), where no significant change in the expression level of BCL2 was observed (Fig.\u0026nbsp;1B). On the other hand, TNF expression increased with different doses of MEL constantly (Fig.\u0026nbsp;1C). Our findings suggest that growth inhibitory effect of MEL is primarily exerted through induction of TNF expression and subsequent activation of extrinsic apoptotic cascade, while it triggers the intrinsic cascade by upregulating the expression of pro-apoptotic gene BAX, too. Melittin is not toxic to MDA-MB-231 cells at concentrations 1 and 2 \u0026micro;g/ml and thus further experiments were performed using these concentrations.\u0026nbsp;\u003c/p\u003e\n\u003cdiv\u003e\n\u003ch2\u003eMelittin inhibits HIF-1\u0026alpha; protein level by downregulating its mRNA expression through inhibition of NF-kB expression\u003c/h2\u003e\n\u003cp\u003eTo induce HIF-1\u0026alpha; protein, cells were cultured in 5%O\u003csub\u003e2\u003c/sub\u003e for 6 hours. Low oxygen concentration resulted in significant elevated levels of HIF-1\u0026alpha; protein (Fig.\u0026nbsp;2A). In order to investigate effect of MEL on HIF-1\u0026alpha;, cells were treated with different concentrations of MEL and incubated at 5%O\u003csub\u003e2\u003c/sub\u003e for 6 hours. Melittin reverted the elevated levels of HIF-1\u0026alpha; protein in a dose-dependent manner presenting approximately a 10-fold decrease in levels of hypoxia-induced HIF-1\u0026alpha; protein at 2 \u0026micro;g/ml (Fig.\u0026nbsp;2B). Real-time PCR experiment showed that Melittin inhibits the expression of HIF-1\u0026alpha; mRNA compared to untreated and hypoxic groups (FC\u0026thinsp;=\u0026thinsp;0.1, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 and FC\u0026thinsp;=\u0026thinsp;0.2, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 at 1\u0026micro;g/ml and 2 \u0026micro;g/ml respectively; Fig.\u0026nbsp;2C). This suggests that during hypoxia, HIF-1\u0026alpha; is induced at transcriptional and translational/post-translational level. This upregulation was reverted significantly when cells were treated with different doses of MEL compared to untreated and hypoxia-treated group (Fig.\u0026nbsp;2C), indicating that Melittin inhibits HIF-1\u0026alpha; protein levels by downregulating its mRNA transcription. Further analysis of NF-kB gene expression, direct regulator HIF-1\u0026alpha; transcription, showed decreased expression levels when cells were treated with 2 \u0026micro;g/ml of Melittin (Fig.\u0026nbsp;2D). These findings show that Melittin inhibits HIF-1\u0026alpha; through downregulation of its transcription by NF-kB.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv\u003e\n\u003ch2\u003eMelittin controls the expression of key players of tumor microenvironment formation by modulating HIF-1\u0026alpha; signaling\u003c/h2\u003e\n\u003cp\u003eHIF-1\u0026alpha; plays a crucial role in formation of tumor microenvironment by regulating expression of genes involved in different steps of development of TME. Thus we further analyzed the expression of genes that are down-stream to HIF-1\u0026alpha; and are involved in angiogenesis and anaerobic respiration. HIF-1\u0026alpha; mediated anti-angiogenic effect of MEL was investigated by analyzing the expression of VEGF-A, the leading character of the angiogenesis story. Declined O\u003csub\u003e2\u003c/sub\u003e concentration induced a 2.2-fold increase in expression of VEGFA gene compared to untreated group (Fig.\u0026nbsp;3A, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) where MEL treatment at concentrations of 1 and 2 \u0026micro;g/ml reverted the change and induced significant downregulation of VEGFA (FC\u0026thinsp;=\u0026thinsp;0.1, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and FC\u0026thinsp;=\u0026thinsp;0.07, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, respectively). This observation indicates that MEL can inhibit angiogenesis by inhibition of VEGFA expression through downregulation of HIF-1\u0026alpha; protein level (Fig.\u0026nbsp;3A). For evaluation of effect of declined HIF-1\u0026alpha; protein levels by MEL on anaerobic respiration, gene expression of lactate dehydrogenase A(LDHA), the key driver of anaerobic respiration switch was measured. Elevated levels of HIF-1\u0026alpha; induced by low O2 concentration, upregulated expression level of LDHA mRNA slightly, compared to untreated group (Fig.\u0026nbsp;3B). Subsequently, MEL treatment reduced the expression level of LDHA significantly in comparison to hypoxia-treated group (FC\u0026thinsp;=\u0026thinsp;0.4 and FC\u0026thinsp;=\u0026thinsp;0.3 at 1\u0026micro;g/ml and 2 \u0026micro;g/ml respectively, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;3B). This suggests that MEL can inhibit anaerobic respiration through downregulation of LDHA. These data suggest inhibitory effects of Melittin against physiological characteristics of TME through regulation of angiogenesis and anaerobic respiration.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":" \u003cp\u003eEmerging evidences have refined the definition of cancer as complex heterotypic multicellular interactions between transformed tumor cells and the neighboring universe, termed as tumor microenvironment, which favors the development and growth of a malignancy. TME contains physiochemical and cellular microenvironment and changes in its composition have profound effects on cancer progression[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In this study, we have put a key regulator of TME under investigation. As results of uncontrolled proliferation of O\u003csub\u003e2\u003c/sub\u003e-consuming tumor cells and inefficiency of newly formed vasculature, chronic and cycling(intermittent) hypoxia is a prominent feature of solid tumors microenvironment[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Mammalian cells respond to any fluctuation in oxygen concentration by HIF1[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. HIF1 is a transcription factor and controls the expression of more than 1500 genes at transcriptional level. Many of these genes are involved in tumor cell proliferation, immune evasion, angiogenesis, EMT, invasion and metastasis[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. HIF1 is a dimer of HIF-1β and O2-regulated HIF-1α. In normoxia, HIF-1α is immediately targeted for proteasomal degradation by VHL that needs O\u003csub\u003e2\u003c/sub\u003e as a cofactor, while during hypoxia it accumulates in cytoplasm, enters the nucleus where it dimerizes with HIF-1β and HIF1 complex is formed[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. This makes HIF-1α an ideal target for cancer therapy.\u003c/p\u003e \u003cp\u003eIn current study we have investigated the pharmacological effects of Melittin from honey bee venom on HIF-1α function in breast cancer cell line MDA-MB-231. Previous studies have demonstrated anti-proliferative effects of Melittin on cervix and non-small cell lung cancer cell lines[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. We found that Melittin inhibits the growth of breast cancer cell line MDA-MB-231 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). An IC\u003csub\u003e50\u003c/sub\u003e of 3.8 \u0026micro;g/ml was measured. Melittin exerts its inhibitory effect on proliferation of MDA-MB-231 cell line primarily through upregulation of TNF and subsequent activation of extrinsic apoptosis pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Furthermore, anti-proliferative effect of Melittin may be attributed to upregulation of pro-apoptotic gene BAX (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Shu et al. reported a similar mechanism for growth inhibition by Melittin in renal tubule epithelial cells in mouse model of acute kidney injuries; Upregulation of TNF corresponding to elevated levels of TNF in mouse serum indicative of TNF signaling pathway activation and upregulation of BAX/BCL2 expression ratio[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Besides, it has been reported that Melittin inhibits cell growth and induces apoptosis by inhibiting the MAPK, Akt, and NF-kB pathways in cancer cells[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In another study, it has been suggested that anti-proliferative effects of Melittin include activation of caspases and matrix metalloproteinases[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNevertheless, no previous reports regarding modulation of breast cancer TME by Melittin are available. HIF-1α is a crucial modulator of TME physiology. Declined pH and high interstitial fluid pressure in TME due to anaerobic respiration and leaky vasculature provide a barrier to current therapy strategies. HIF-1α regulates genes responsible for anaerobic respiration and angiogenesis. In current study we examined effects of Melittin treatment on HIF-1α and its downstream genes required for the formation of TME. Melittin treatment suppressed hypoxia-induced HIF-1α protein and mRNA levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Gene expression analysis of NF-kB revealed that Melittin inhibits NF-kB expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). NF-kB is a direct regulator of HIF-1α expression[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Our finding suggests that Melittin inhibits HIF-1α primarily at transcriptional level through inhibition of NF-kB expression. This is in contrast to a previous study by shin et al., that reported that Melittin inhibits HIF-1α at translational level but not its mRNA, by Inhibition of ERK and mTOR/p70S6K Pathway in Human Cervical Carcinoma Cells. Mitogen-activated protein (MAP) kinases and phosphatidylinositol 3-kinases (PI3K)/Akt pathways are involved in translation of HIF-1α[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. STAT3, another regulator of HIF-1α transcription, enhances HIF-1α expression through PKM2/HIF-1α positive feedback loop[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Several studies have reported that Melittin suppresses STAT3 signaling pathway. Kim and colleagues demonstrated that Melittin inhibits STAT3 activation and translocation of NFκB into the nucleus in human fibroblast-like synoviocytes[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. In another study, it was reported that Melittin inhibits phosphorylation of JAK2 and STAT3 in SKOV3 and PA-1 ovarian cancer cell[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Inhibition of HIF-1α protein level by Melittin resulted in downregulation of VEGFA and LDHA (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Several studies have reported VEGFA downregulation by Melittin in human cervical carcinoma cells[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], hepatocellular carcinoma cell lines[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], bladder cancer cells[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], lung cancer cells[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] and ehrlich carcinoma mouse model[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Inhibition of ERK and mTOR/p70S6K, VEGFR-2 and the COX-2-mediated MAPK signaling pathways has been implicated in these studies. Putting these together, Melittin can disrupt the formation of TME by suppressing HIF-1α protein in hypoxic conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e "},{"header":"Conclusion","content":" \u003cp\u003eIn conclusion, we report for the first time that Melittin inhibits the growth of breast cancer cells by upregulation of extrinsic and intrinsic apoptotic pathway genes. Moreover, we demonstrate that Melittin can disrupt tumor microenvironment formation by suppressing the expression of genes responsible for anaerobic respiration and angiogenesis through inhibition of HIF-1α at transcriptional and translational/post-translational level in breast cancer cells. This is of importance as TME has been established as a barrier to cancer therapy during recent years. Our study provides further evidence on anti-cancer effects of Melittin.\u003c/p\u003e "},{"header":"Declarations","content":"\u003ch2\u003eConflict of interest\u003c/h2\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\n\u003ch2\u003eAcknowledgement\u003c/h2\u003e\n\u003cp\u003eThe authors thank the Faculty of Biological Sciences, Kharazmi University, Tehran, Iran.\u003c/p\u003e\n\u003ch2\u003eAvailability of data\u003c/h2\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eH\u0026ouml;ckel M, Vaupel P. \u0026ldquo;Tumor hypoxia: definitions and current clinical, biologic, and molecular aspects. \u0026rdquo; J Natl Cancer Inst. Feb. 2001;93(4):266\u0026ndash;76.\u003c/li\u003e\n\u003cli\u003eVaupel P, Mayer A. Hypoxia in cancer: significance and impact on clinical outcome. Cancer Metastasis Rev. 2007;26:225\u0026ndash;39.\u003c/li\u003e\n\u003cli\u003eSemenza L. Hypoxia-inducible factor 1: master regulator of O2 homeostasis. Curr Opin Genet Dev. 1998;8(5):588\u0026ndash;94.\u003c/li\u003e\n\u003cli\u003eBonello S, et al., \u0026ldquo;Reactive oxygen species activate the HIF-1\u0026alpha; promoter via a functional NF\u0026kappa;B site,\u0026rdquo; \u003cem\u003eArterioscler. Thromb. Vasc. Biol.\u003c/em\u003e, vol.\u0026nbsp;27, no. 4, pp.\u0026nbsp;755\u0026ndash;761, Apr. 2007.\u003c/li\u003e\n\u003cli\u003eNiu G, et al., \u0026ldquo;Signal transducer and activator of transcription 3 is required for hypoxia-inducible factor-1\u0026alpha; RNA expression in both tumor cells and tumor-associated myeloid cells,\u0026rdquo; \u003cem\u003eMol. Cancer Res.\u003c/em\u003e, vol.\u0026nbsp;6, no. 7, pp.\u0026nbsp;1099\u0026ndash;1105, Jul. 2008.\u003c/li\u003e\n\u003cli\u003eSemenza GL. \u0026ldquo;Life with oxygen,\u0026rdquo; \u003cem\u003eScience\u003c/em\u003e, vol.\u0026nbsp;318, no. 5847. Science, pp.\u0026nbsp;62\u0026ndash;64, 05-Oct-2007.\u003c/li\u003e\n\u003cli\u003eSemenza GL. The hypoxic tumor microenvironment: A driving force for breast cancer progression. Biochim Biophys Acta - Mol Cell Res. 2015;1863(3):382\u0026ndash;91.\u003c/li\u003e\n\u003cli\u003eChen C, Pore N, Behrooz A, Ismail-Beigi F, Maity A. Regulation of glut1 mRNA by Hypoxia-inducible Factor-1. J Biol Chem. 2001;276(12):9519\u0026ndash;25.\u003c/li\u003e\n\u003cli\u003eO\u0026rsquo;rourke JF, Pugh CW, Bartlett SM, Ratcliffe PJ, \u0026ldquo;Identification of Hypoxically Inducible mRNAs in HeLa Cells Using Differential-Display PCR.,\u0026rdquo; \u003cem\u003eEur. J. Biochem.\u003c/em\u003e, vol.\u0026nbsp;241, no. 2, pp.\u0026nbsp;403\u0026ndash;410, Oct. 1996.\u003c/li\u003e\n\u003cli\u003eSemenza GL, et al., \u0026ldquo;Hypoxia Response Elements in the Aldolase A, Enolase 1, and Lactate Dehydrogenase A Gene Promoters Contain Essential Binding Sites for Hypoxia-inducible Factor 1,\u0026rdquo; \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e, vol.\u0026nbsp;271, no. 51, pp.\u0026nbsp;32529\u0026ndash;32537, Dec. 1996.\u003c/li\u003e\n\u003cli\u003eMathupala SP, Rempel A, Pedersen PL. Glucose Catabolism in Cancer Cells. J Biol Chem. 2001;276(46):43407\u0026ndash;12.\u003c/li\u003e\n\u003cli\u003ePapandreou I, et al., \u0026ldquo;HIF-1 mediates adaptation to hypoxia by actively downregulating mitochondrial oxygen consumption.,\u0026rdquo; \u003cem\u003eCell Metab.\u003c/em\u003e, vol.\u0026nbsp;3, no. 3, pp.\u0026nbsp;187\u0026ndash;97, Mar. 2006.\u003c/li\u003e\n\u003cli\u003eHelmlinger G, Yuan F, Dellian M, Jain RK. Interstitial pH and pO2 gradients in solid tumors in vivo: high-resolution measurements reveal a lack of correlation. \u0026rdquo; Nat Med. Feb. 1997;3(2):177\u0026ndash;82.\u003c/li\u003e\n\u003cli\u003eNewell K, Franchi A, Pouyss\u0026eacute;gur J, Tannock I, \u0026ldquo;Studies with glycolysis-deficient cells suggest that production of lactic acid is not the only cause of tumor acidity.,\u0026rdquo; \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e, vol.\u0026nbsp;90, no. 3, pp.\u0026nbsp;1127\u0026ndash;31, 1993.\u003c/li\u003e\n\u003cli\u003eWykoff CC, et al. Hypoxia-inducible Expression of Tumor-associated Carbonic Anhydrases. Cancer Res. 2000;60:no. 24.\u003c/li\u003e\n\u003cli\u003eHelmlinger G, Sckell A, Dellian M, Forbes NS, Jain RK. \u0026ldquo;Acid Production in Glycolysis-impaired Tumors Provides New Insights into Tumor Metabolism,\u0026rdquo; \u003cem\u003eClin. Cancer Res.\u003c/em\u003e, vol.\u0026nbsp;8, no. 4, 2002.\u003c/li\u003e\n\u003cli\u003eSwietach P, Vaughan-Jones RD, Harris AL, \u0026ldquo;Regulation of tumor pH and the role of carbonic anhydrase 9,\u0026rdquo; \u003cem\u003eCancer Metastasis Rev.\u003c/em\u003e, vol.\u0026nbsp;26, no. 2, pp.\u0026nbsp;299\u0026ndash;310, Jul. 2007.\u003c/li\u003e\n\u003cli\u003eKrock BL, Skuli N, Simon MC, \u0026ldquo;Hypoxia-induced angiogenesis: good and evil.,\u0026rdquo; \u003cem\u003eGenes Cancer\u003c/em\u003e, vol.\u0026nbsp;2, no. 12, pp.\u0026nbsp;1117\u0026ndash;33, Dec. 2011.\u003c/li\u003e\n\u003cli\u003eForsythe JA, et al., \u0026ldquo;Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1.,\u0026rdquo; \u003cem\u003eMol. Cell. Biol.\u003c/em\u003e, vol.\u0026nbsp;16, no. 9, pp.\u0026nbsp;4604\u0026ndash;13, Sep. 1996.\u003c/li\u003e\n\u003cli\u003eFukumura D, Jain RK. \u0026ldquo;Tumor microenvironment abnormalities: Causes, consequences, and strategies to normalize,\u0026rdquo; \u003cem\u003eJournal of Cellular Biochemistry\u003c/em\u003e. 2007.\u003c/li\u003e\n\u003cli\u003eCairns R, Papandreou I, Denko N, \u0026ldquo;Overcoming Physiologic Barriers to Cancer Treatment by Molecularly Targeting the Tumor Microenvironment,\u0026rdquo; \u003cem\u003eMol. Cancer Reasearch\u003c/em\u003e, vol.\u0026nbsp;4, no. February, pp.\u0026nbsp;61\u0026ndash;71, 2006.\u003c/li\u003e\n\u003cli\u003eRaghuraman ACH. Melittin: a Membrane-active Peptide with Diverse Functions. Biosci Rep. 2007;27:189\u0026ndash;223.\u003c/li\u003e\n\u003cli\u003eGajski G, Garaj-Vrhovac V. Melittin: A lytic peptide with anticancer properties. Environ Toxicol Pharmacol. 2013;36(2):697\u0026ndash;705.\u003c/li\u003e\n\u003cli\u003eShin J-M, et al., \u0026ldquo;Melittin Suppresses HIF-1\u0026alpha;/VEGF Expression through Inhibition of ERK and mTOR/p70S6K Pathway in Human Cervical Carcinoma Cells,\u0026rdquo; \u003cem\u003ePLoS One\u003c/em\u003e, vol.\u0026nbsp;8, no. 7, p. e69380, Jul. 2013.\u003c/li\u003e\n\u003cli\u003eBakmiwewa SM, Heng B, Guillemin GJ, Ball HJ, Hunt NH. An effective, low-cost method for achieving and maintaining hypoxia during cell culture studies. Biotechniques. 2015;59(4):223\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eMichiels C, Tellier C, Feron O. \u0026ldquo;Cycling hypoxia: A key feature of the tumor microenvironment,\u0026rdquo; \u003cem\u003eBiochimica et Biophysica Acta - Reviews on Cancer\u003c/em\u003e, vol.\u0026nbsp;1866, no. 1. Elsevier B.V., pp.\u0026nbsp;76\u0026ndash;86, 01-Aug-2016.\u003c/li\u003e\n\u003cli\u003eDelprat V, Tellier C, Demazy C, Raes M, Feron O, Michiels C. Cycling hypoxia promotes a pro-inflammatory phenotype in macrophages via JNK/p65 signaling pathway. Sci Rep. 2020;10(1):1\u0026ndash;13.\u003c/li\u003e\n\u003cli\u003eZhang SF, Chen Z. Melittin exerts an antitumor effect on non-small celllung cancer cells. Mol Med Rep. 2017;16(3):3581\u0026ndash;6.\u003c/li\u003e\n\u003cli\u003eShu Y, et al., \u0026ldquo;Melittin inducing the apoptosis of renal tubule epithelial cells through upregulation of Bax/Bcl-2 expression and activation of TNF- Signaling pathway,\u0026rdquo; \u003cem\u003eBiomed Res. Int.\u003c/em\u003e, vol. 2019, 2019.\u003c/li\u003e\n\u003cli\u003eD\u0026rsquo;Ignazio L, Batie M, Rocha S. \u0026ldquo;Hypoxia and inflammation in cancer, focus on HIF and NF-\u0026kappa;B,\u0026rdquo; \u003cem\u003eBiomedicines\u003c/em\u003e, vol.\u0026nbsp;5, no. 2. MDPI AG, 01-Jun-2017.\u003c/li\u003e\n\u003cli\u003eDemaria M, Poli V. PKM2, STAT3 and HIF-1\u0026alpha;. Jak-Stat. 2012;1(3):194\u0026ndash;6.\u003c/li\u003e\n\u003cli\u003eKim SK, et al., \u0026ldquo;Melittin enhances apoptosis through suppression of IL-6/sIL-6R complex-induced NF-\u0026kappa;B and STAT3 activation and Bcl-2 expression for human fibroblast-like synoviocytes in rheumatoid arthritis,\u0026rdquo; \u003cem\u003eJt. Bone Spine\u003c/em\u003e, vol.\u0026nbsp;78, no. 5, pp.\u0026nbsp;471\u0026ndash;477, Oct. 2011.\u003c/li\u003e\n\u003cli\u003eJo M, et al. Anti-cancer effect of bee venom toxin and melittin in ovarian cancer cells through induction of death receptors and inhibition of JAK2/STAT3 pathway. Toxicol Appl Pharmacol. Jan. 2012;258(1):72\u0026ndash;81.\u003c/li\u003e\n\u003cli\u003eZhang Z, Zhang H, Peng T, Li D, Xu J. Melittin suppresses cathepsin S-induced invasion and angiogenesis via blocking of the VEGF-A/VEGFR-2/MEK1/ERK1/2 pathway in human hepatocellular carcinoma. Oncol Lett. Jan. 2016;11(1):610\u0026ndash;8.\u003c/li\u003e\n\u003cli\u003eJin Z, et al., \u0026ldquo;Melittin constrains the expression of identified key genes associated with bladder cancer,\u0026rdquo; \u003cem\u003eJ. Immunol. Res.\u003c/em\u003e, vol. 2018, 2018.\u003c/li\u003e\n\u003cli\u003eHuh JE, et al. Melittin suppresses VEGF-A-induced tumor growth by blocking VEGFR-2 and the COX-2-mediated MAPK signaling pathway. J Nat Prod. 2012;75(11):1922\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eEl Bakary NM, Alsharkawy AZ, Shouaib ZA, Barakat EMS. Role of Bee Venom and Melittin on Restraining Angiogenesis and Metastasis in \u0026gamma;-Irradiated Solid Ehrlich Carcinoma-Bearing Mice. Integr Cancer Ther. Jan. 2020;19:153473542094447.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"medical-oncology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"medo","sideBox":"Learn more about [Medical Oncology](https://www.springer.com/journal/12032)","snPcode":"12032","submissionUrl":"https://submission.nature.com/new-submission/12032/3","title":"Medical Oncology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"tumor microenvironment, HIF-1α, NFκB, Melittin, angiogenesis, anaerobic respiration","lastPublishedDoi":"10.21203/rs.3.rs-395664/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-395664/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePurpose: HIF-1α has critical roles in formation of Tumor microenvironment by regulating genes involved in angiogenesis and anaerobic respiration. TME fuels tumors growth and metastasis and presents therapy with several challenges. Therefore, we aimed to investigate if Melittin disrupts HIF-1α signaling pathway in breast adenocarcinoma cell line MDA-MB-231.\u003c/p\u003e\u003cp\u003eMethods: breast adenocarcinoma cell line MDA-MB-231 was cultured in presence of different doses of Melittin and MTT assay was carried out to measure Melittin’s cytotoxic. Cells were exposed to 5% C\u003csub\u003e2\u003c/sub\u003e to mimic hypoxic conditions and Melittin. Western blot was used to measure HIF-1α protein levels. Gene expression analysis was performed using real-time PCR to measure relative mRNA abundance of genes involved in tumor microenvironment formation.\u003c/p\u003e\u003cp\u003eFindings: Our results revealed that Melittin effectively inhibits HIF-1α at transcriptional and translation/post-translational level. HIF-1α protein and mRNA level was significantly decreased in Melittin-treated groups. It is found that inhibition of HIF-1α by Melittin is through downregulation of NFκB gene expression. Furthermore, gene expression analysis showed a downregulation in VEGFA and LDHA expression due to inhibition of HIF-1α protein by Melittin. In addition, cell toxicity assay showed that Melittin inhibits the growth of MDA-MB-231 cell line through activation of extrinsic and intrinsic apoptotic pathways by upregulating TNF and BAX expression.\u0026nbsp;\u003c/p\u003e\u003cp\u003eConclusions: Melittin suppresses the expression of genes responsible for formation of TME physiological hallmarks by suppressing HIF-1α signaling pathway. Our results suggest that Melittin can modulate tumor microenvironment by inhibition of VEGFA and LDHA.\u003c/p\u003e","manuscriptTitle":"Melittin Inhibits the Expression of Key Genes Involved in Tumor Microenvironment Formation by Suppressing HIF-1α Signaling in Breast Cancer Cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-04-07 15:14:31","doi":"10.21203/rs.3.rs-395664/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewersInvited","content":"","date":"2021-04-04T00:00:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"Medical Oncology","date":"2021-03-24T06:14:17+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"medical-oncology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"medo","sideBox":"Learn more about [Medical Oncology](https://www.springer.com/journal/12032)","snPcode":"12032","submissionUrl":"https://submission.nature.com/new-submission/12032/3","title":"Medical Oncology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"0aa9ca2c-27c4-44c5-a24f-8c4d77a46e86","owner":[],"postedDate":"April 7th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":3461317,"name":"Cancer Biology"},{"id":3461318,"name":"Oncology"}],"tags":[],"updatedAt":"2021-05-21T14:48:34+00:00","versionOfRecord":[],"versionCreatedAt":"2021-04-07 15:14:31","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-395664","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-395664","identity":"rs-395664","version":["v1"]},"buildId":"FbvkV6FR0MCFSLy54lSbu","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}