The Dopaminergic Spinal Trigeminal Nucleus Caudalis-Hippocampus Pathway Modulates TMD-Associated Depression via the DRD2/NF-κB/LEPR Signaling Axis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The Dopaminergic Spinal Trigeminal Nucleus Caudalis-Hippocampus Pathway Modulates TMD-Associated Depression via the DRD2/NF-κB/LEPR Signaling Axis Jiefei Shen, Muyun Wang, Dexin Zhu, Yating Yi, Yueyan Cen, Suying Zhan, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7857810/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Temporomandibular disorders (TMD), prevalent orofacial conditions with complex etiologies, are frequently accompanied by emotional disturbances whose central nervous mechanisms remain poorly understood. Here, using a unilateral anterior crossbite (UAC) mouse model combined with hippocampal neuronal cultures, we investigated the neural substrates underlying TMD-associated depression. Behavioral analyses revealed that UAC mice exhibited significant depressive-like behaviors. Viral tracing and chemogenetic approaches identified a novel dopaminergic pathway from the spinal trigeminal nucleus caudalis (SpVc) to the hippocampus (HPC). Functional manipulation of this circuit demonstrated that chemogenetic inhibition of SpVc dopaminergic neurons (hM4Di activation) induced depressive-like behaviors, while post-TMD activation (hM3Dq) reversed these behavioral deficits. Additionally, UAC mice exhibited reduced hippocampal expression of dopamine receptor D2 (DRD2) and leptin receptor (LEPR). In vitro experiments established that DRD2 overexpression upregulated LEPR through nuclear factor kappa-B (NF-κB) phosphorylation, while DRD2 inhibition downregulated LEPR, defining a functional DRD2-NF-κB-LEPR signaling axis. Critically, adeno-associated virus (AAV)-mediated DRD2/LEPR overexpression in the hippocampus ameliorated depressive-like behaviors in UAC mice. These findings collectively reveal a previously unrecognized SpVc-HPC dopaminergic circuit that modulates TMD-related depression through the DRD2-NF-κB-LEPR axis, offering new insights into potential therapeutic strategies for TMD-associated neuropsychiatric comorbidities. Biological sciences/Neuroscience Health sciences/Diseases/Psychiatric disorders/Depression Biological sciences/Molecular biology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Highlights UAC modeling induced TMD and depressive behaviors. SpVc-HPC dopaminergic pathway regulated TMD-associated depression, and activating this pathway alleviated depression in UAC mice. The DRD2-NF-κB-LEPR axis was downregulated in UAC mice, and upregulation of DRD2 or LEPR ameliorated depressive behaviors. Introduction Temporomandibular disorder (TMD), characterized by orofacial system dysfunction with increasing global prevalence (1, 2), demonstrate significant comorbidity with depression beyond their classical symptoms of joint/muscle pain and restricted mandibular movement (3, 4). This depressive comorbidity adversely impacts treatment outcomes and promotes disease chronicity (5). Emerging neuroimaging evidence reveals central nervous system (CNS) alterations in TMD patients, particularly in brain networks mediating pain and emotional processing (6, 7). The spinal trigeminal nucleus caudalis (SpVc) serves as a crucial relay station for orofacial nociceptive integration (8, 9). Notably, the hippocampus (HPC), a structure frequently exhibits depression-related abnormalities including volume loss and synaptic dysfunction (10, 11). Studies in temporomandibular joint osteoarthritis (TMJ-OA) rat models reveal hippocampal pathological changes concurrent with heightened anxiety-like behaviors (12). Mechanistic studies suggest functional SpVc-HPC interactions, where suppression of HPC glial activation alleviates trigeminal injury-induced depression (13), while orofacial stimulation enhances HPC neuronal activity (14). Recent whole-brain mapping further confirms trigeminal-HPC connectivity (15), and chronic migraine models reveal abnormal SpVc-HPC metabolic coupling (16). However, the existence of direct SpVc-HPC neural projections and their specific contribution to TMD-associated depression remain to be fully elucidated. Anhedonia, the diminished capacity to experience pleasure, represents a core symptom of depression with particular relevance to dopaminergic system dysfunction (17). Dopamine, a monoamine catecholamine neurotransmitter, acts via dopamine receptors (DRDs), which belong to the family of 7-transmembrane G protein-coupled receptors (GPCRs). As one of the principal neuromodulators of emotional processing, dopamine regulates synaptic transmission and plasticity via DRD activation, thereby influencing critical brain functions including motivation, reward processing, and affective regulation (17, 18). The DRD2, abundantly expressed throughout the CNS, plays a particularly important role in modulating dopaminergic signaling pathways (19, 20). Studies demonstrate that impaired DRD2/β-arrestin2 signaling pathway in the HPC leads to astrocytic dysfunction and subsequent development of depression-like behaviors under chronic stress conditions (21, 22). In multiple sclerosis mouse model, DRD2 has been shown to regulate neuroinflammatory processes through modulation of nuclear factor kappa-B (NF-κB) activity via 6-pyruvoyl-tetrahydropterin synthase expression (23). However, the potential involvement of dopaminergic mechanisms within the SpVc-HPC circuit in TMD-associated depression remain to be further explored. The adipokine leptin, after crossing the blood-brain barrier (BBB), binds to its receptor (LEPR) in multiple brain regions and has emerged as an important regulator of hippocampal function (24, 25). It regulates hippocampal neuronal excitability and synaptic plasticity, playing significant roles in mood disorder, inflammatory, and neurodegenerative diseases (26, 27). LEPR, a class I cytokine receptor, shows widespread distribution in limbic structures including the HPC (28, 29), where it influences neurogenesis and synaptic function through brain-derived neurotrophic factor (BDNF)-dependent mechanisms (30, 31). Notably, LEPR-deficient mice exhibit prominent depressive-like phenotypes (32), while age-related declines in the HPC leptin sensitivity have been associated with accelerated cognitive and emotional dysfunction (33). However, whether hippocampal LEPR participates in the central neural regulation of TMD-associated depression remains unclear. Taking all these into account, this study aimed to investigate the functional organization of SpVc-HPC dopaminergic projections, and the involvement of DRD2-NF-κB-LEPR signaling in TMD-associated depression. Using tissue-clearing combined with immunofluorescence (IF), we demonstrated the existence of a dopaminergic projection from the SpVc to the HPC firstly. Furthermore, chemogenetic approaches established the critical involvement of this circuit in TMD-associated depression. Our results demonstrated that TMD conditions lead to functional suppression of the SpVc-HPC dopaminergic pathway, resulting in impaired DRD2 signaling, reduced NF-κB phosphorylation, and downregulated LEPR activity, ultimately contributing to depression-like behaviors. These findings elucidated novel mechanistic insights into TMD-associated affective comorbidities and identified potential therapeutic targets for intervention. Materials and Methods Animal Preparation C57BL/6 wild type (WT) mice (6–8 weeks) from Sichuan University, transgenic dopamine transporter (DAT)-Cre mice (purchased from GemPharmatech Co., Ltd Laboratory), and Ai140 mice (JAX# 030220, purchased from The Jackson Lab) were used in all experiments. Mice were housed at a stable temperature (23–25°C) on a constant 12 h light/dark cycle with ad libitum access to standard food and sterile water. All animal procedures in this study were approved by the Ethics Committee of West China Hospital of Stomatology Sichuan University (NO: WCHSIRB-AT-2025-530). Unilateral Anterior Crossbite (UAC) Model The UAC model is an established modeling approach for inducing TMD(34, 35). Mice were randomly assigned to the UAC group and the control (CTL) group. To establish the UAC model, metal tubes were bonded to the right mandibular incisors of mice under isoflurane anesthesia. The metal tubes, fabricated from syringe needles, were curved to form 135° labially inclined occlusal plates. (Fig. S1 ) After drying the tooth surface, glass ionomer cement was applied for fixation. Excess adhesive material was carefully removed after curing. Daily inspections were conducted to confirm the retention of metal tubes (36). For the control group, the mice went through similar procedures without bonding the metal tubes. Under conditions of unrestricted access to food and water, no significant alteration in body weight was observed in the modeled mice (Fig. S2, P > 0.05). Forced Swimming Test (FST) The FST is a widely used behavioral assay designed to evaluate depression-like states and antidepressant efficacy in rodent models (37). Mice were gently placed into a transparent glass cylinder (height: 300 mm, diameter: 110 mm) containing water at a depth of 200 mm, maintained at 22–25°C, under bright lighting conditions. Mouse behavior was recorded for 6 min, and immobility was defined as the cessation of all movement except for the minimal motions required to keep the head above the water (38, 39). In chemogenetic experiments, behavioral testing was initiated 30 min after intraperitoneal injection of either Clozapine N-oxide (CNO) or normal saline (NS). Sucrose Preference Test (SPT) The SPT is a core behavioral assay for assessing anhedonia in rodents by measuring the relative preference for a sucrose solution over plain water (40). Prior to the experiment, all mice underwent a 48-h pre-adaptation period with two-bottle access, receiving both 1% sucrose solution and plain water throughout. The positions of the two bottles were switched every 24 h. This was followed by a 24-h period of water deprivation. During the formal test, each mouse was individually housed and simultaneously provided with pre-weighed bottles containing sucrose solution and plain water. The test lasted for 6 h, with the positions of the two bottles being switched every 2 h. The sucrose preference index (%) was determined based on the percentage of sucrose intake relative to total liquid consumption (41). Open Field Test (OFT) The OFT, an established and widely used method for assessing depression-like behaviors in rodents (39, 42), was performed at baseline (BL), 7 days, and 10 days post-modeling to assess behavioral changes. At least 1 h before behavioral tests, mice were transported to the testing room to acclimatize to environmental changes. During the experiment, each mouse was placed in a rectangular arena (500 mm × 500 mm × 350 mm) and allowed to freely explore. The arena was divided into a center zone (250 mm × 250 mm) and an edge zone. The movement trajectories of mice were recorded for 5 min using EthoVision XT software, which quantified the center cumulative duration as an indicator of depressive phenotypes (43, 44). The arena was thoroughly cleaned with 75% ethanol between trials to eliminate residual odors. Micro-Computed Tomography (Micro-CT) To examine morphological alterations in the temporomandibular joints (TMJ) of the UAC and the CTL group mice post-modeling, mice were perfused intracardially with 4% paraformaldehyde (PFA) under deep anesthesia. TMJs were dissected intact and fixed in 4% PFA at 4°C for 48 h. Fixed TMJs for micro-CT were rinsed in PBS and stored in 75% ethanol at 4°C until scanning. TMJs were scanned using a µCT45 micro-CT system (Scanco Medical AG, Switzerland). Following three-dimensional (3D) reconstruction of the condylar process with imaging software (IPL/HPM, Scanco Medical), morphometric analyses were performed to quantify the bone volume/tissue volume (BV/TV, %) and trabecular thickness (Tb.Th, µm). Hematoxylin-Eosin (HE) Staining To evaluate histological changes in the TMJ tissues of the UAC and the CTL group, TMJ tissues were decalcified in 10% EDTA (pH 7.4) for 30 days, with daily solution replacement. Decalcified tissues underwent graded ethanol dehydration, xylene clearing, and paraffin embedding. Serial sections (10 µm thickness) were cut using a rotary microtome (Leica, Germany). For HE staining, tissue sections were deparaffinized and rehydrated through a graded ethanol series, followed by immersion in hematoxylin solution for 3 min and rinsing under running tap water for 3 min to remove residual stain. Subsequently, sections were counterstained with eosin solution for 30 s, briefly rinsed with tap water for 5 s, air-dried in a fume hood, cleared in xylene, and mounted with neutral resin. Digitized images were acquired using a slide scanning system (Olympus SLIDEVIEW VS200, Japan) for morphological analysis. Tartrate-Resistant Acid Phosphatase (TRAP) Staining TRAP staining was performed to visualize osteoclasts within the TMJ tissues in both groups (45, 46). Deparaffinized sections were processed through hydration and incubated with freshly prepared TRAP staining solution (Sigma-Aldrich TRAP kit) in a light-protected humidified chamber at 37°C for 1 h. After three 3-min washes with distilled water, nuclei were counterstained with hematoxylin for 50 s, rinsed with tap water for bluing, air-dried, cleared in xylene, and resin-mounted. TRAP-positive osteoclasts and tissue architecture were analyzed using the same slide scanning system (Olympus SLIDEVIEW VS200, Japan). Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR) The mRNA levels of DRD2 and LEPR in mice and mouse hippocampal neuronal cell line (HT) 22 were quantified using RT-qPCR. Mice were anesthetized and then decapitated at designated time points to collect HPC tissues. Cultured HT22 cells were harvested following experimental treatments. Total RNA was extracted from HPC tissues and HT22 cells using RNA Extraction Kit (Takara, Beijing, China). cDNA was synthesized with the PrimeScript™ Fast RT reagent kit (Takara, Beijing, China). The primers (Table 1 ) were purchased from TsingkeBiotechnologyCo., Ltd. The RT-qPCR reaction mixture (total volume: 10 µL) underwent initial incubation at 95°C for 30 s, followed by 40 cycles of 5 s at 95°C, 31 s at 60°C, using a CFX Opus 96 RT-qPCR system (Bio-Rad, USA). All results were normalized to the housekeeping gene GAPDH values. Relative expression was calculated using the 2 −ΔΔ Ct method. Table 1 Details of primer sequences used for RT-qPCR. Gene Sequence 5’-3’ DRD2 Forward ACCTGTCCTGGTACGATGATG Reverse GCATGGCATAGTAGTTGTAGTGG LEPR Forward TGGTCCCAGCAGCTATGGT Reverse ACCCAGAGAAGTTAGCACTGT GADPH Forward GGCACAGTCAAGGCTGAGAATG Reverse ATGGTGGTGAAGACGCCAGTA Western Blot (WB) Assay WB analysis was performed to quantify protein expression levels of DRD2 and LEPR in the HPC, as well as DRD2, LEPR, NF-κB, and phospho-NF-κB (p-NF-κB) in HT22 cells. Following tissue homogenization and centrifugation, protein concentrations were determined using a BCA assay. Equal amounts of protein lysates were resolved by 10% SDS-PAGE and electrophoretically transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, USA). Membranes were blocked with skim milk powder (concentration 2.5–5% w/v) for 60 min, then incubated overnight at 4°C with primary antibodies (Table 2). Membranes were washed in TBST and then incubated with HRP-conjugated secondary antibodies (goat anti-rabbit IgG, BA1054; 1:5000, Boster, Wuhan, China) at room temperature (RT) for 2 h. Immunoreactive bands were visualized using the ECL reagent (Millipore, USA) and imaged with a GelView 1500Plus imaging system (BLT, China). Band optical density ratios were quantified using ImageJ software and normalized to endogenous controls GAPDH and α-tubulin. IF Assays IF testing was performed to examine the spatial localization of DRD2, LEPR, and NeuN in the HPC of mice, as well as tyrosine hydroxylase (TH), DAT and microtubule–associated protein 2 (MAP2) in both the SpVc and HPC. Under deep anesthesia of isoflurane, mice were perfused intracardially with 4% paraformaldehyde. The SpVc and HPC tissues were dissected, post-fixed in 4% PFA at 4°C for 8 h, and incubated in 30% sucrose (w/v) at 4°C until complete infiltration (24–48 h). Tissues were embedded in Tissue-Tek O.C.T. compound (Sakura Finetek, Japan) and stored at − 20°C prior to sectioning. The sections of tissues were prepared in 10 µm on a cryostat microtome (Leica, Germany). Sections underwent permeabilization with 0.25% Triton X-100 (Solarbio, China) in PBS for 15 min at RT, followed by blocking in 10% normal goat serum (Solarbio, China) diluted in PBS for 30 min at RT. Primary antibodies (see Table 2 for details) were applied and incubated overnight at 4°C. Sections were washed by PBS and subsequently incubated with the following secondary antibodies (Alexa Fluor® 594 and Alexa Fluor® 488, goat anti-rabbit or anti-mouse, 1:400; Abcam, Cambridge, UK, and donkey-anti-guinea pig IgG, AF594, 1:500; Asis Biofarm, China) at 37°C for 1 h. Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI, 1:1000; Beyotime, China) for 5 min at RT. The slides were sealed with the anti-fluorescent quencher (Solarbio, Beijing, China). Images were acquired using a confocal laser scanning microscope system (Olympus FV3000, Japan). Virus Injection and Chemogenetic Manipulation Before surgery, the mice were fixed in a stereotactic frame (RWD) under isoflurane anesthesia. A heating pad was used to maintain the core body temperature of mice at 36°C. The virus was injected using calibrated glass microelectrodes connected to an infusion pump (micro 4, WPI) at a rate of 30 nL/min. The coordinates were defined as dorso-ventral (DV) from the brain surface, anterior-posterior (AP) from bregma, and medio-lateral (ML) from the midline (in mm). For anterograde tracing of the SpVc-HPC pathway, adeno-associated virus serotype 2/1 AAV2/1-hSyn-double-floxed inverse orientation (DIO)-EGFP (XUANZUN Bioscience, China; 1 × 10 8 TU/mL) was injected into the right SpVc (AP: 8.00-8.50 mm, ML: 1.80 ~ 2.00 mm, DV: 3.50 mm; 1 µL; Fig. S3) of DAT-Cre mice. AAV2/1-hSyn-Cre , provided by the Vector Engineering Core of CIBR (Beijing, China), was injected into the right SpVc of Ai140 mice to further comfirm the pathway. For overexpression in the HPC, adeno-associated virus serotype 2/9 (AAV2/9) vectors expressing DRD2 ( AAV2/9-CMV-DRD2-EGFP ) or LEPR ( AAV2/9-CMV-LEPR-EGFP , XUANZUN Bioscience, China; 1 × 10 8 TU/mL) were delivered into the right HPC (AP: −1.80~-2.50 mm, ML: 2.00 mm, DV: 1.50 ~ 2.00 mm; 1µL; Fig. S4) under identical surgical conditions. Viral expression was validated 21 days later via fluorescence microscopy (Olympus FV3000, Japan). Chemogenetic manipulation was conducted by injecting either inhibitory AAV2/1-hSyn-DIO-hM4Di-EGFP or excitatory AAV2/1-hSyn-DIO-hM3Dq-EGFP into the right SpVc of DAT-Cre mice, while the CTL group received AAV2/1-hSyn-DIO-EGFP (XUANZUN Bioscience, China; 1 × 10 8 TU/mL; 1 µL). After a 21-day recovery period to permit viral expression, mice underwent behavior tests 30 min following intraperitoneal administration of CNO (3 mg/kg in NS with 5% DMSO) or NS vehicle. Tissue Clearing To comprehensively validate the SpVc—HPC neural pathway, we implemented whole-brain tissue clearing on Ai140 transgenic mice, which presented EGFP fluorescence when exposed to Cre recombinase (47). Mice were stereotaxically injected with AAV2/1-hSyn-Cre into the SpVc under anesthesia. 21 days post-injection, transcardial perfusion with 4% paraformaldehyde (PFA) was performed, followed by dissection of intact brains and medulla oblongata. Tissues were post-fixed in 4% PFA at 4°C overnight and rinsed in PBS (3 × 30 min). Subsequent tissue clearing was processed following our previous protocol (47, 48). Decolorization was performed with 25% (w/v) Quadrol (Sigma-Aldrich, 122262) at 37°C with gentle shaking. Afterwards, samples were processed with gradient tert-butanol (tB, Sigma‐Aldrich, 471712) solutions (30% for 4 h, 50% for 6 h, 70% for 12 h) on a shaker at 37°C, followed by tB-Q (70% v/v tB and 30% w/v Quadrol) dehydration treatment for 1 day. For final clearing and sample preservation, we immersed tissues in the BB-BED clearing medium (47% v/v Benzyl Benzoate + 48% v/v BED468 + 5% w/v Quadrol) in a 37°C shaker for 1 day until final transparency was achieved. 3D fluorescence images of the cleared tissues were acquired using a Nuohai LS 18 Tiling Light Sheet Microscope (Nuohai Life Science (Shanghai) Co., Ltd, laser lines: 561, 637mm). Samples were illuminated with a 4-tile tiling light sheet (49), and fluorescence signals were captured through a 1×/0.25NA objective (Olympus MVPLAPO). Imaging was performed at 4× magnification, yielding a spatial resolution of approximately 3.3×3.3×7 µm³ under the selected conditions. The collected images were processed with the LS 18 ImageCombine software (Nuohai Life Science (Shanghai) Co., Ltd) and rendered using Amira (Thermo Fisher Scientific, USA). HT22 Culture and Treatments Mouse hippocampal HT22 neuronal cells (Millipore, #SCC129) were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, #11995065) supplemented with 10% fetal bovine serum (FBS; Gibco, #10099141) and 1% penicillin/streptomycin (Gibco, #15140122). Cells were maintained at 37°C in a humidified 5% CO 2 atmosphere and passaged 3 times a week. To inhibit DRD2 in vitro , four small interfering RNAs (siRNAs) targeting mouse DRD2 (si DRD2 -371, -554, -759, -1529), siFAM, and si CTL were synthesized by (GenePharma, Beijing, China). siRNA sequences are provided in Table 3 . HT22 cells were seeded in plates and transfected with 30 nM siRNA using siRNA mate plus (GenePharma, Beijing, China). Drd2 mRNA levels were quantified by RT-qPCR at 48 h post-transfection to determine the optimal siRNA sequences. Table 2 Details of antibodies used for WB and IF Name Product Code Host Dilution Company DRD2 DF10211 Rabbit 1:1000 (WB) 1:100 (IF) Affinity, USA LEPR #49554 Rabbit 1:1000 (WB) 1:100 (IF) Signalway Antibody, USA NeuN ab104224 Mouse 1:150(IF) Abcam, Cambridge, UK Phospho-NF-κB ET1604-27 Rabbit 1:1000 (WB) HUABIO, Hangzhou, China NF-κB 80979–1-RR Rabbit 1:2000 (WB) Proteintech, China Phospho-PKC ET1702-17 Rabbit 1:1000 (WB) HUABIO, Hangzhou, China PKC ET1608-15 Rabbit 1:1000 (WB) HUABIO, Hangzhou, China TH #53432 Rabbit 1:100 (IF) Signalway Antibody, USA DAT #HA601476 Mouse 1:200 (IF) HUABIO, Hangzhou, China MAP2 ab254144 Mouse 1:50 (IF) Abcam, Cambridge, UK MAP2 OB-PGP079 Guinea Pig 1:500(IF) Asis Biofarm, China GADPH ET1601-4 Rabbit 1:5000 (WB) HUABIO, Hangzhou, China α-tubulin 11224–1-AP Rabbit 1:5000 (WB) Proteintech, China Table 3: siRNA sequence siRNA Sequence 5’-3’ si DRD2 -371 CCUGGUACGAUGAUGAUCUTT si DRD2 -554 CCACCAACUACCUGAUAGUTT si DRD2 -759 GGCCAUGCCUAUGUUGUAUTT si DRD2 -1529 CGCACAUCCUGAAUAUACATT si CTL UUCUCCGAACGUGUCACGUTT Notes: DRD2, dopamine receptor D2; CTL: control To overexpress DRD2 in vitro , Lentivirus (LV) carrying mouse DRD2 under a CMV promoter ( LV-DRD2 ) and empty vector controls ( LV-CTL ) were purchased from XUANZUN Bioscience, China. HT22 cells were seeded and transduced with LV-DRD2 at multiplicities of infection (MOIs). After 48 h, cell viability was assessed using a CCK-8 assay (APExBIO Technology, USA), and DRDD2 mRNA levels were quantified via RT-qPCR to determine the optimal MOI. Functional overexpression was validated by RT-qPCR and WB. In order to investigate the role of NF-kB signaling pathway in DRD2-induced LEPR overexpression, 30 min before transduction of LV, cells were treated with Verbascoside (VB, B3379, APExBIO Technology, USA), a dual PKC/NF-κB inhibitor, at 25 µM diluted in dimethyl sulfoxide (DMSO, 0.5%), and DMSO (0.5%) in FBS-containing medium served as the LV- DRD2 + VB group and the LV- DRD2 + DMSO group. Successful transfection of LV and siRNA was confirmed via a confocal laser scanning microscope system (Olympus FV3000, Japan) for mCherry expression and FAM-labeled siRNA fluorescence. Statistical Analysis All quantitative data are expressed as mean ± standard deviation (SD). Statistical analyses were performed using SPSS Statistics 25.0 (IBM, Version 25.0). Continuous variables were analyzed for between-group comparisons via the two-tailed unpaired Student’s t-test assuming equal variances. A threshold of P < 0.05 was applied to determine statistical significance. Results UAC mice exhibited TMD and depressive behaviors TMJ samples were harvested for micro-CT analysis and histological staining at 10 days after modeling (Fig. 1 A). Micro-CT reconstruction revealed significant alterations in TMJ morphology in the UAC group, including decreased BV/TV ratio ( P < 0.001) and reduced Tb.Th ( P < 0.001) compared to the CTL group (Fig. 1 B-E). Meanwhile, histological evaluation on HE staining of TMJ sections revealed osteoarthritic pathology in the UAC group, including decreased chondrocyte density with disorganized cellular arrangement, subchondral bone degradation, and enhanced inflammatory cell infiltration (Fig. 1 F, green arrow). TRAP staining further confirmed elevated osteoclast activity in the UAC group (Fig. 1 F, black arrows). These alterations from micro-CT and histology confirmed the successful induction of TMJ osteoarthritis, which represents a principal subtype of TMD. FST results showed that the CTL group maintained stable immobile time at BL, day 7, and 10, whereas the UAC group exhibited a significant increase in immobile time (Fig. 1 G, P < 0.01). In the sucrose preference test, the CTL group showed a consistent preference level across all time points. Conversely, the UAC group demonstrated significant reductions in sucrose preference at both day 7 and 10 (Fig. 1 H, P < 0.01 at day 7; P < 0.05 at day 10). OFT results of the CTL group exhibited consistent central zone cumulative duration at BL, day 7, and 10. In contrast, the UAC group displayed progressive reductions at day 7 and 10 (Fig. 1 I-J, P < 0.01). Female mice also exhibited analogous alterations in these tests (Fig. S5-7). These marked alterations in behavior tests suggested the emergence of depression in the UAC group. SpVc-HPC dopaminergic pathway regulated depression-like behaviors in UAC mice Co-localization of TH (a catecholaminergic neuron marker) and DAT with MAP2 (a pan-neuronal marker) (Fig. S8-S11, white arrows), as well as co-localization of TH with DAT (Fig. 2 A-B, white arrows), was observed in the SpVc and HPC, respectively. This confirmed the existence of dopaminergic neurons in these two brain regions. AAV2/1-hSyn-DIO-EGFP was stereotaxically injected into the SpVc of DAT-Cre mice (Fig. 2 C-D). EGFP expression in the SpVc confirmed accurate targeting and local dopaminergic neuron transfection, while EGFP in the HPC provided direct anatomical evidence of functional SpVc-HPC connectivity (Fig. 2 E). Similarly, AAV2/1-hSyn-Cre was stereotaxically injected into the SpVc of Ai140 mice, and tissues were harvested for IF staining and tissue clearing analysis 21 days post-injection (Fig. 2 F-G). Co-localization of DAPI and EGFP confirmed successful viral transduction and revealed anterograde projections from SpVc to HPC (Fig. 2 H, white arrows). Tissue-cleared whole-mount imaging further validated this connectivity, with EGFP⁺ fluorescence visibly spanning SpVc and HPC regions (Fig. 2 I, white arrows). Collectively, viral anterograde tracing in DAT-Cre and Ai140 mice, coupled with multimodal visualization via IF and tissue clearing, substantiated the existence of the SpVc-HPC neural pathway. To further investigate the regulatory role of this neural pathway, DAT-Cre mice received stereotaxic injections of AAV2/1-hSyn-DIO-hM4Di-EGFP into the SpVc, followed by behavior tests 30 min after i.p. injection of CNO or NS at 21 days post-injection (Fig. 2 J-K). In all three tests, both the AAV2/1-hM4Di-injected and control virus-injected groups exhibited no significant changes under pre-injection condition and after NS administration ( P > 0.05). Similarly, the control virus group showed no behavioral changes across pre-injection, NS, or CNO conditions ( P > 0.05). Strikingly, hM4Di-injected mice exhibited significantly increased immobile time and decreased sucrose preference after CNO activation compared to pre-injection ( P < 0.01), NS ( P < 0.01), and CNO-treated control group ( P < 0.01) (Fig. 2 L-M). Similarly, hM4Di-injected mice displayed significantly reduced center cumulation duration after CNO activation compared to pre-injection ( P < 0.01), NS ( P < 0.01), and CNO-treated control group ( P < 0.001) (Fig. 2 N-O). In parallel experiments, DAT-Cre mice, injected with AAV2/1-hSyn-DIO-hM3Dq-EGFP , underwent UAC modeling at day 11 and behavior tests at day 21 (Fig. 2 P-Q). In all tests, both AAV2/1-hM3Dq and control virus groups remained comparable at pre-injection and NS conditions ( P > 0.05). No significant differences were observed in the control group across pre-injection, NS, and CNO conditions ( P > 0.05). CNO administration reversed UAC-induced depressive-like behaviors, as evidenced by less immobile time and higher sucrose preference compared to the pre-injection (Pre, P < 0.05), NS ( P < 0.05), and CNO-treated control group ( P < 0.01) (Fig. 2 R-S). Restored central cumulative duration in hM3Dq-injected mice compared to the pre-injection (Pre, P < 0.01), NS ( P < 0.01), and CNO-treated control group ( P < 0.01) also indicated the improvement of depressive-like behaviors after CNO injection (Fig. 2 T-U). The current study identified a potential dopaminergic pathway from the SpVc to the HPC and demonstrated its functional involvement in regulating depression in UAC mice. The reduced DRD2 in the HPC regulated depression-like behaviors in UAC mice To investigate molecular alterations in the HPC, tissues from both experimental groups were subjected to RT-qPCR and WB analyses on post-modeling day 10. RT-qPCR revealed significantly lower DRD2 mRNA levels in the male UAC group compared to the CTL group (Fig. 3 A, P < 0.001), with no sex-specific differences observed (Fig. S12, P < 0.001). WB results further corroborated the transcriptional changes, demonstrating decreased DRD2 protein expression in the UAC group (Fig. 3 B-C, P < 0.01). IF results demonstrated the co-localization of DRD2 with NeuN (a neuronal marker), suggesting that DRD2 was predominantly expressed in hippocampal neurons (Fig. 3 D, white arrows). Collectively, these results demonstrated that DRD2 was mainly expressed in hippocampal neurons, and was downregulated in UAC mice correlating with behavioral alterations, which suggested that this receptor might play a crucial role in regulating TMD-related depression. To further validate the functional role of DRD2 in vivo , AAV2/9 overexpressing DRD2 was stereotaxically injected into the HPC. UAC modeling was initiated at post-injection day 11, followed by protein extraction for WB and behavior tests at day 21 (Fig. 3 E-F). EGFP and DAPI fluorescence in the HPC confirmed successful viral transduction (Fig. S13, white arrows). WB analysis revealed that DRD2-overexpressing vectors significantly elevated DRD2 protein levels (Fig. 3 G-H, P < 0.001). FST results demonstrated a significant reduction in immobile time in DRD2-overexpression group relative to the controls (Fig. 3 I, P < 0.05). Similarly, SPT showed a markedly higher sucrose preference in the overexpression group compared to controls (Fig. 3 J, P < 0.05). OFT results demonstrated that DRD2-overexpressing groups exhibited increased center cumulative duration compared to the CTL group (Fig. 3 K-L, P < 0.01). The downregulated LEPR in the HPC mediated depression-like behaviors in UAC mice Alteration of hippocampal LEPR gene expression was also validated. RT-qPCR showed significantly lower LEPR mRNA levels in the male UAC group compared to the CTL group (Fig. 4 A, P < 0.001), with no sex-specific differences observed (Fig. S14, P < 0.001). WB results confirmed these transcriptional changes, showing reduced LEPR protein expression in the UAC group (Fig. 4 B-C, P < 0.001). IF analysis demonstrated co-localization of LEPR with NeuN, indicating predominant neuronal expression of LEPR in the HPC (Fig. 4 D, white arrows). Collectively, these findings established that LEPR was primarily expressed in hippocampal neurons and exhibited downregulation in UAC mice, correlating with behavioral deficits. To further investigate the functional role of LEPR in vivo , AAV2/9 overexpressing LEPR was stereotaxically delivered to HPC. UAC modeling commenced on post-injection day 11, followed by protein extraction and behavioral assessments at day 21 (Fig. 4 E-F). WB quantification demonstrated that LEPR-overexpressing vectors significantly increased LEPR protein levels (Fig. 4 G-H, P < 0.01). FST results indicated that LEPR-overexpressing group displayed less immobile time compared to controls (Fig. 4 I, P < 0.01), and SPT revealed that LEPR-overexpression group exhibited a significant increase in sucrose preference (Fig. 4 J, P < 0.01). OFT results showed that LEPR-overexpressing mice displayed prolonged central cumulative duration compared to controls (Fig. 4 K-L, P < 0.01). DRD2 regulated the expression of LEPR in vivo and in vitro To elucidate the functional interplay between DRD2 and LEPR, both in vivo and in vitro experiments were implemented. WB analysis revealed that DRD2-overexpressing vectors significantly increased LEPR protein levels in vivo (Fig. 5 A-B, P < 0.001). To validate the DRD2-LEPR axis in vitro , siRNA-mediated DRD2 knockdown and LV-mediated DRD2 overexpression were conducted in HT22 cells (Fig. 5 C-D). Successful siRNA transfection was validated by FAM-labeled siRNA fluorescence (Fig. 5 E), LV transduction was verified by mCherry fluorescence as well (Fig. 5 F). Four candidate siRNA sequences were designed and screened, and RT-qPCR analysis at 48 h post-transfection identified si DRD2 -554 as the most effective one (Fig. 5 G, P < 0.01). RT-qPCR results demonstrated that the si DRD2 group exhibited decreased DRD2 mRNA (Fig. 5 H, P < 0.001) and reduced LEPR mRNA (Fig. 5 I, P < 0.01) compared to the si CTL group. WB results corroborated these changes at the protein level (Fig. 5 J-M, P < 0.001 for DRD2 and P < 0.01 for LEPR). These results revealed that downregulation of DRD2 inhibited LEPR expression. HT22 cells were transfected with LV to overexpress DRD2 at varying multiplicities of infection (MOIs) for 48 h. RT-qPCR analysis of DRD2 mRNA levels and CCK-8 viability assays identified an optimal MOI of 5 for subsequent experiments (Fig. 5 N and Fig. S15). RT-qPCR demonstrated that the LV- DRD2 group exhibited significantly elevated DRD2 mRNA levels and concomitant LEPR mRNA upregulation (Fig. 5 O-P, P < 0.001). WB results also corroborated these findings at the protein level (Fig. 5 Q-T, P < 0.001). These data indicated that DRD2 overexpression induced LEPR upregulation. The bidirectional correlation between DRD2 manipulation (overexpression/knockdown) and LEPR expression established a causal regulatory cascade within hippocampal neurons. NF-κB signal pathway participated in the mediation of DRD2 on LEPR in vitro To elucidate the regulatory axis between DRD2 and LEPR, pathway-specific inhibitors were administered 30 min before transduction of LV (Fig. 6 A). RT-qPCR results revealed that VB, a dual PKC/NF-κB inhibitor, significantly attenuated LEPR mRNA elevation in transfected cells (Fig. 6 B and Fig. S16, P < 0.001). WB results confirmed the downregulation of LEPR after VB treatment (Fig. 6 C-D, P < 0.001). The mechanism investigation demonstrated that VB selectively suppressed NF-κB phosphorylation without affecting PKC activation. P-NF-κB levels in LV- DRD2 + VB group were reduced significantly compared to LV- DRD2 + DMSO group (Fig. 6 E-F, P 0.05). Moreover, p-NF-κB levels in the si DRD2 group were lower than in the si CTL group (Fig. 6 I-J, P < 0.01). The LV-DRD2 group increased p-NF-κB levels significantly compared to the LV- CTL group (Fig. 6 K-L, P < 0.001). These findings implicated NF-κB phosphorylation as the predominant pathway mediating DRD2-driven LEPR alteration. Discussion The prevalence rate of TMD varies widely, affecting 4%-10% of adults with pain or dysfunction-related symptoms (50). Some studies report that up to 15% of adults may be impacted by TMD (51). TMD patients frequently present with facial pain, TMJ discomfort, or masticatory muscle pain, accompanied by restricted mouth opening, mandibular deviation during movement, joint clicking, and associated symptoms such as headaches or tinnitus. These manifestations severely impair essential functions, including mastication, speech, and sleep, significantly reducing patients' quality of life (52, 53). The pathogenesis of TMD involves multifactorial interactions, including biomechanical factors, inflammatory and immune responses, sex and genetic predisposition, as well as psychological and neurological components (54, 55). Various methods exist for establishing TMD animal models, such as surgical disc displacement or resection, intra-articular injections of inflammatory mediators, and unilateral occlusal interference (56, 57). In this study, the TMD mouse model was established by bonding a metal tube to unilateral lower incisors to induce anterior crossbite malocclusion, thereby creating occlusal dysfunction. Post-modeling histological and morphological analyses confirmed successful disease induction. Behavioral assessments further revealed that modeled mice exhibited depression. Although previous studies have reported that UAC modeling reduced feeding frequency in mice, but increased feeding duration, and body weight changes were not documented. In our experiment, body weight tracking revealed no significant reduction in the UAC mice, thereby ruling out the confounding effect of weight change on the behavioral test results (58). TMD-related depression exhibits a high prevalence rate, which may reciprocally exacerbate TMD symptoms, compromise therapeutic efficacy, and profoundly impair both physical and mental health (3, 59). The underlying mechanisms primarily involve neurotransmitter dysregulation (60), sex hormone modulation (61), bidirectional pain-emotion interplay (3), and structural brain alterations, among other factors (62). This study elucidated a novel neurobiological mechanism underlying the comorbidity of TMD and depression, centered on the dopaminergic SpVc-HPC pathway and its downstream DRD2-NF-κB-LEPR signaling axis. SpVc serves as the primary relay station for orofacial nociceptive signals, responsible for transmitting pain information from the trigeminal nerve to higher centers such as the thalamus (63, 64). As a pivotal component of the pain-processing pathway, under inflammatory conditions, SpVc neurons exhibit hyperexcitability characterized by increased spontaneous firing and reduced mechanical thresholds. Pharmacological interventions can reverse these alterations, demonstrating the critical role of SpVc in neural plasticity underlying chronic pain (65, 66). The HPC, a key brain region intricately involved in learning, memory, and emotional regulation, continuously generates newborn neurons and maintains synaptic plasticity through BDNF/cAMP-response element binding protein (CREB) signaling pathways. Animal studies reveal that chronic stress induces reduced dendritic complexity in hippocampal granule cells and aberrant synaptophysin expression, with such structural plasticity impairments directly correlating with depression-like behaviors (67, 68). Simultaneously, as a central regulator of the hypothalamic-pituitary-adrenal (HPA) axis, the HPC suppresses excessive stress responses via glucocorticoid receptors (GR). Impaired GR function observed in depression is associated with abnormal phosphorylation of glycogen synthase inase 3β (GSK3β), leading to dysregulated stress responses (69). Hippocampal volume reduction (averaging 8–10%) is prevalent in depressed patients. Notably, anterior hippocampal atrophy shows stronger associations with emotional symptoms, whereas posterior volume loss correlates with cognitive deficits (70, 71). Fat mass and obesity (FTO) gene-mediated dysregulation of RNA methylation contributes to hippocampal neuronal dysfunction, and restoring FTO expression in animal models reverses depression-like phenotypes (72). Endoplasmic reticulum stress-induced overproduction of superoxide anion (O⁻) in the HPC constitutes a molecular trigger mechanism for depressive pathogenesis (73). Dopaminergic neural pathways are primarily categorized into three major systems: the mesolimbic pathway (MLP), mesocortical pathway (MCP), and nigrostriatal pathway (NSP) (74, 75). The mesolimbic pathway originates from the ventral tegmental area (VTA) and projects to limbic structures including the nucleus accumbens (NAc), amygdala, and HPC. This pathway regulates reward processing, motivation, and emotional valence, and is critically implicated in hedonic experiences (76, 77). Previous studies have revealed that dopaminergic neurons in the hypothalamic A11 nucleus project to the SpVc and, by activating the DRD2 pathway, significantly alleviate trigeminal neuropathic pain (78, 79). To investigate potential dopaminergic pathways from the SpVc to the HPC, we employed DAT-Cre transgenic mice, utilizing the Cre-lox system to genetically label dopaminergic neurons. DAT, localized presynaptically on dopaminergic neurons, terminates dopaminergic signaling via extracellular dopamine reuptake, thereby regulating synaptic dopamine concentration and temporal dynamics (80, 81).In DAT-Cre mice, the Cre recombinase gene is inserted into the DAT locus, enabling selective labeling or manipulation of dopaminergic neurons (81, 82). We stereotaxically injected AAV2/1 vectors carrying the DIO sequence and EGFP into the SpVc of DAT-Cre mice, achieving Cre-dependent EGFP expression restricted to dopaminergic neurons. Robust EGFP fluorescence observed in SpVc confirmed successful viral transduction. AAV serotype 1 exhibits anterograde trans-synaptic trafficking capabilities (83–85). Detection of EGFP + terminals in the HPC provided anatomical evidence supporting the existence of a SpVc-to-HPC dopaminergic pathway. To further validate the existence of this neural pathway, we employed Ai140 transgenic mice combined with tissue-clearing technology for three-dimensional imaging. In Ai140 mice, injection of Cre -dependent viral vectors induces EGFP fluorescence expression(47, 86, 87). Tissue-clearing methodology involves chemical or physical processing to render biological specimens optically transparent, enabling comprehensive 3D visualization. When integrated with viral tracing tools, this technique permits 3D reconstruction of neural circuits within intact tissues(88–91). In this experiment, anterograde-tracing AAV2/1 were injected into the SpVc of Ai140 mice. Building upon conventional immunofluorescence observations in tissue sections, tissue-clearing-based 3D imaging revealed continuous EGFP⁺ fluorescence spanning SpVc and HPC regions, thereby corroborating the SpVc-HPC connectivity. Dopaminergic insufficiency may underlie anhedonia, while enhancing dopamine transmission could alleviate such reward-processing deficits (92, 93). To validate the functional role of the SpVc-HPC dopaminergic pathway, we employed a combinatorial strategy integrating the Cre-lox system with chemogenetic viral vectors to achieve precise manipulation of dopaminergic circuitry. The hM3Dq activates Gq-coupled signaling to enhance neuronal excitability, whereas hM4Di engages Gi-mediated pathways to suppress neuronal activity (94, 95). Following intraperitoneal CNO administration and subsequent behavioral tests, we observed that chemogenetic inhibition of the SpVc-HPC dopaminergic pathway via hM4Di precipitated emotional disturbances. Conversely, post-modeling activation of this pathway using hM3Dq significantly ameliorated TMD-associated depression. DRD2, a dopamine receptor, functions as a downstream component of neural circuits to regulate emotional processing. Reduced DRD2 expression in the HPC is strongly associated with depression-like behaviors. Studies demonstrate that upregulating hippocampal DRD2 protein levels (e.g., via fasting or pharmacological interventions) alleviates depressive phenotypes, whereas DRD2 antagonists antagonize such antidepressant effects (96). Emerging evidence indicates that DRD2 modulates astrocytic function via the β-arrestin2 signaling pathway. In chronic stress models, downregulated DRD2/β-arrestin2 signaling induces hippocampal neuroinflammation and synaptic dysfunction, while pathway activation rescues depression-like behaviors (21). In our modeled mice, we observed downregulated DRD2 expression in the HPC, consistent with these experimental findings. Combining in vitro approaches, we demonstrated that DRD2 overexpression upregulates LEPR expression via NF-κB phosphorylation, while DRD2 inhibition exerts the opposite effect, suggesting a potential regulatory role of DRD2 on LEPR. The association between hippocampal leptin/LEPR signaling and emotional disorders has been extensively characterized through multi-faceted investigations (31). Leptin enhances synaptic plasticity, the cellular cornerstone of learning, memory, and emotional regulation, by activating hippocampal LEPR. Animal experiments reveal that leptin deficiency or LEPR dysfunction induces hippocampal synaptic maldevelopment, impaired long-term potentiation, and comorbid depressive-like behaviors and cognitive deficits (97, 98). Leptin and LEPR are also critical for neurogenesis. Leptin rescues chronic stress- and glucocorticoid-induced suppression of hippocampal neurogenesis by activating the GSK-3β/β-catenin signaling pathway, thereby normalizing behavioral deficits (99). Furthermore, leptin/LEPR signaling modulates emotional states by regulating BDNF expression. Leptin administration elevates hippocampal BDNF mRNA levels, whereas leptin deficiency reduces BDNF expression, a phenomenon strongly linked to BDNF signaling impairment in depressive pathology (100). These findings delineate three plausible mechanisms underlying LEPR-mediated emotional dysregulation and explain the behavioral alterations observed following LEPR downregulation in our study, implicating LEPR deficiency in depression. Intrahippocampal injection of DRD2- and LEPR-overexpressing viruses activated the DRD2-NF-κB-LEPR signaling axis and ameliorated TMD-related depression in modeled mice, highlighting this pathway as a novel therapeutic target for TMD-associated affective comorbidities. Conclusion In conclusion, under TMD conditions, the dopaminergic pathway from the SpVc to the HPC became functionally suppressed, downregulating the DRD2-NF-κB-LEPR signaling axis and contributing to the development of depression-like behaviors. This study elucidated critical mechanisms underlying TMD-associated depression and identified potential therapeutic targets for intervening in this pathological process. Declarations Ethics approval and consent to participate All animal procedures in this study were approved by the Ethics Committee of West China Hospital of Stomatology Sichuan University (NO: WCHSIRB-AT-2025-530). Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Funding This work was supported by the National Natural Science Foundation of China [Grant Numbers 82271014, 82501189, 82101059], Science and Technology Department of Sichuan Province [Grant Numbers 2024NSFSC1599, 2024NSFTD0027, 2025NSFSC2371, 2024NSFSC0683], and special financial aid to post-doctor research fellow of Sichuan province [Grant Number TB2024043]. The materials in graphics in this article were supported by Figdraw. Authors' contributions Muyun Wang : Writing–original draft, Validation, Methodology, Investigation, Formal analysis, Conceptualization. Dexin Zhu : Validation, Methodology, Investigation, Formal analysis, Conceptualization. Yating Yi : Methodology, Investigation, Formal analysis, Funding acquisition, Conceptualization. Yueyan Cen : Validation, Investigation. Suying Zhan : Visualization, Investigation. Liu Fei : Methodology, Investigation. Qinxuan Song : Methodology, Investigation. Xinlin Gao : Investigation. Chunjie Li : Validation, Methodology. Cheng Zhou : Methodology, Conceptualization. Hang Wang : Funding acquisition, Conceptualization. Yanyan Zhang : Writing–original draft, Validation, Methodology, Investigation, Formal analysis, Funding acquisition, Conceptualization. Jiefei Shen : Writing-review&editing, Supervision, Resources, Project administration, Funding acquisition, Conceptualization. Acknowledgements We acknowledge all those who helped us with this research. Availability of data and materials All data generated or analysed during this study are included in this published article [and its supplementary information files]. References Voß LC, Basedau H, Svensson P, May A. Bruxism, temporomandibular disorders, and headache: a narrative review of correlations and causalities. Pain. 2024;165(11):2409-18. Zhao R, Ye Z, Lv X, Li Z, Xiong X. Imaging Brain Networks: Insights into Mechanisms of Temporomandibular Disorders. J Dent Res. 2025;104(4):380-8. Wan J, Lin J, Zha T, Ciruela F, Jiang S, Wu Z, et al. Temporomandibular disorders and mental health: shared etiologies and treatment approaches. J Headache Pain. 2025;26(1):52. Penlington C, Bowes C, Taylor G, Otemade AA, Waterhouse P, Durham J, Ohrbach R. Psychological therapies for temporomandibular disorders (TMDs). Cochrane Database Syst Rev. 2022;8(8):Cd013515. Liou YJ, Bai YM, Tsai SJ, Chen TJ, Chen MH, Lo WL. Bidirectional Associations of Temporomandibular Joint Disorders with Major Depressive and Anxiety Disorders. J Evid Based Dent Pract. 2023;23(2):101860. Yin Y, He S, He N, Zhang W, Luo L, Chen L, et al. Brain alterations in sensorimotor and emotional regions associated with temporomandibular disorders. Oral Dis. 2024;30(3):1367-78. Cheng X, Li X, Chen J, Qin X, Kang K, Zhang T, et al. Assessing the causal role of the structural connectome in temporomandibular disorders: A Mendelian randomization study. Cranio. 2024:1–11. Song QX, Zhang YY, Li YL, Liu F, Liu YJ, Li YK, et al. The crucial role of NR2A mediating the activation of satellite glial cells in the trigeminal ganglion contributes to orofacial inflammatory pain during TMJ inflammation. Neuropharmacology. 2024;261:110173. Li YL, Zhang YY, Song QX, Liu F, Liu YJ, Li YK, et al. N-methyl-D-aspartate Receptor Subunits 2A and 2B Mediate Connexins and Pannexins in the Trigeminal Ganglion Involved in Orofacial Inflammatory Allodynia during Temporomandibular Joint Inflammation. Mol Neurobiol. 2025;62(1):1247-65. Shi HJ, Wang S, Wang XP, Zhang RX, Zhu LJ. Hippocampus: Molecular, Cellular, and Circuit Features in Anxiety. Neurosci Bull. 2023;39(6):1009-26. Pimpinella D, Mastrorilli V, Giorgi C, Coemans S, Lecca S, Lalive AL, et al. Septal cholinergic input to CA2 hippocampal region controls social novelty discrimination via nicotinic receptor-mediated disinhibition. Elife. 2021;10. Shen Z, Fan C, Ding C, Xu M, Wu X, Wang Y, Xing T. Loss of Slc39a12 in hippocampal neurons is responsible for anxiety-like behavior caused by temporomandibular joint osteoarthritis. Heliyon. 2024;10(4):e26271. Lv XJ, Lv SS, Wang GH, Chang Y, Cai YQ, Liu HZ, et al. Glia-derived adenosine in the ventral hippocampus drives pain-related anxiodepression in a mouse model resembling trigeminal neuralgia. Brain Behav Immun. 2024;117:224 − 41. Chen LQ, Lv XJ, Guo QH, Lv SS, Lv N, Xu WD, et al. Asymmetric activation of microglia in the hippocampus drives anxiodepressive consequences of trigeminal neuralgia in rodents. Br J Pharmacol. 2023;180(8):1090 − 113. Qiu S, Hu Y, Huang Y, Gao T, Wang X, Wang D, et al. Whole-brain spatial organization of hippocampal single-neuron projectomes. Science. 2024;383(6682):eadj9198. Gao J, Wang D, Zhu C, Wang J, Wang T, Xu Y, et al. (1)H-MRS reveals abnormal energy metabolism and excitatory-inhibitory imbalance in a chronic migraine-like state induced by nitroglycerin in mice. J Headache Pain. 2024;25(1):163. Zhang YQ, Lin WP, Huang LP, Zhao B, Zhang CC, Yin DM. Dopamine D2 receptor regulates cortical synaptic pruning in rodents. Nat Commun. 2021;12(1):6444. Edelmann E, Lessmann V. Dopaminergic innervation and modulation of hippocampal networks. Cell Tissue Res. 2018;373(3):711 − 27. Yin J, Chen KM, Clark MJ, Hijazi M, Kumari P, Bai XC, et al. Structure of a D2 dopamine receptor-G-protein complex in a lipid membrane. Nature. 2020;584(7819):125-9. Fan L, Tan L, Chen Z, Qi J, Nie F, Luo Z, et al. Haloperidol bound D(2) dopamine receptor structure inspired the discovery of subtype selective ligands. Nat Commun. 2020;11(1):1074. Liu Y, Song N, Yao H, Jiang S, Wang Y, Zheng Y, et al. β-Arrestin2-biased Drd2 agonist UNC9995 alleviates astrocyte inflammatory injury via interaction between β-arrestin2 and STAT3 in mouse model of depression. J Neuroinflammation. 2022;19(1):240. Zhu J, Hu Z, Han X, Wang D, Jiang Q, Ding J, et al. Dopamine D2 receptor restricts astrocytic NLRP3 inflammasome activation via enhancing the interaction of β-arrestin2 and NLRP3. Cell Death Differ. 2018;25(11):2037-49. Lu SZ, Wu Y, Guo YS, Liang PZ, Yin S, Yin YQ, et al. Inhibition of astrocytic DRD2 suppresses CNS inflammation in an animal model of multiple sclerosis. J Exp Med. 2022;219(9). Barone I, Giordano C. Leptin and Beyond: Actors in Cancer. Biomolecules. 2021;11(12). Torres DJ, Pitts MW. Pericytic porters: helping leptin step in. Trends Endocrinol Metab. 2021;32(12):958-9. Zou X, Zhong L, Zhu C, Zhao H, Zhao F, Cui R, et al. Role of Leptin in Mood Disorder and Neurodegenerative Disease. Front Neurosci. 2019;13:378. Fujita Y, Yamashita T. The Effects of Leptin on Glial Cells in Neurological Diseases. Front Neurosci. 2019;13:828. de Lima RMS, Barth B, Mar Arcego D, de Mendonça Filho EJ, Patel S, Wang Z, et al. Leptin receptor co-expression gene network moderates the effect of early life adversity on eating behavior in children. Commun Biol. 2022;5(1):1092. Münzberg H, Heymsfield SB, Berthoud HR, Morrison CD. History and future of leptin: Discovery, regulation and signaling. Metabolism. 2024;161:156026. Wang F, Li Z, Li B, Xu M, Wang Y, Wang J, et al. Xiaochaihutang ameliorates depression-like behaviors induced via chronic social defeat stress by regulating exon-specific Bdnf transcription through H3K18 acetylation in the hippocampus of mice. Phytomedicine. 2025;140:156567. Ge T, Fan J, Yang W, Cui R, Li B. Leptin in depression: a potential therapeutic target. Cell Death Dis. 2018;9(11):1096. Liu W, Liu J, Xia J, Xue X, Wang H, Qi Z, Ji L. Leptin receptor knockout-induced depression-like behaviors and attenuated antidepressant effects of exercise are associated with STAT3/SOCS3 signaling. Brain Behav Immun. 2017;61:297–305. Irving A, Harvey J. Regulation of hippocampal synaptic function by the metabolic hormone leptin: Implications for health and disease. Prog Lipid Res. 2021;82:101098. Liu Q, Yang H, Zhang M, Zhang J, Lu L, Yu S, et al. Initiation and progression of dental-stimulated temporomandibular joints osteoarthritis. Osteoarthritis Cartilage. 2021;29(5):633 − 42. Zhang HY, Xie MJ, Yang HX, Liu X, Ren HT, Zhang M, et al. Catabolic changes of rat temporomandibular joint discs induced by unilateral anterior crossbite. J Oral Rehabil. 2019;46(4):340-8. Xu X, Chu Y, Zhang Y, Li G, Yang P, Zhang J, et al. Chondrocyte Adipogenic Differentiation in Softening Osteoarthritic Cartilage. J Dent Res. 2022;101(6):655 − 63. Armario A. The forced swim test: Historical, conceptual and methodological considerations and its relationship with individual behavioral traits. Neurosci Biobehav Rev. 2021;128:74–86. Yue N, Huang H, Zhu X, Han Q, Wang Y, Li B, et al. Activation of P2X7 receptor and NLRP3 inflammasome assembly in hippocampal glial cells mediates chronic stress-induced depressive-like behaviors. J Neuroinflammation. 2017;14(1):102. Kuang XJ, Zhang CY, Yan BY, Cai WZ, Lu CL, Xie LJ, et al. P2X2 receptors in pyramidal neurons are critical for regulating vulnerability to chronic stress. Theranostics. 2022;12(8):3703-18. Verharen JPH, de Jong JW, Zhu Y, Lammel S. A computational analysis of mouse behavior in the sucrose preference test. Nat Commun. 2023;14(1):2419. Li XY, Zhang SY, Hong YZ, Chen ZG, Long Y, Yuan DH, et al. TGR5-mediated lateral hypothalamus-dCA3-dorsolateral septum circuit regulates depressive-like behavior in male mice. Neuron. 2024;112(11):1795 − 814.e10. Hatton-Jones KM, Christie C, Griffith TA, Smith AG, Naghipour S, Robertson K, et al. A YOLO based software for automated detection and analysis of rodent behaviour in the open field arena. Comput Biol Med. 2021;134:104474. Zhang JQ, Li SY, Yin C, Ji Y, Zhang X, Liu DY, et al. Dysfunction of subthalamic dopaminergic circuitry contributes to anxiety- and depression-like behaviors in 6-OHDA lesion-induced hemiparkinsonian mice. Acta Pharmacol Sin. 2025. Bian LH, Wang SQ, Li WJ, Li J, Yin Y, Ye FF, Guo JY. Cryptotanshinone regulates gut microbiota and PI3K-AKT pathway in rats to alleviate CUMS induced depressive symptoms. Biomed Pharmacother. 2023;169:115921. Ma L, Zhang L, Liao Z, Xiu C, Luo X, Luo N, et al. Pharmacological inhibition of protein S-palmitoylation suppresses osteoclastogenesis and ameliorates ovariectomy-induced bone loss. J Orthop Translat. 2023;42:1–14. Lu J, Shi X, Fu Q, Han Y, Zhu L, Zhou Z, et al. New mechanistic understanding of osteoclast differentiation and bone resorption mediated by P2X7 receptors and PI3K-Akt-GSK3β signaling. Cell Mol Biol Lett. 2024;29(1):100. Yi Y, Li Y, Zhang S, Men Y, Wang Y, Jing D, et al. Mapping of individual sensory nerve axons from digits to spinal cord with the transparent embedding solvent system. Cell Res. 2024;34(2):124 − 39. Jing D, Zhang S, Luo W, Gao X, Men Y, Ma C, et al. Tissue clearing of both hard and soft tissue organs with the PEGASOS method. Cell Res. 2018;28(8):803 − 18. Chen Y, Li X, Zhang D, Wang C, Feng R, Li X, et al. A Versatile Tiling Light Sheet Microscope for Imaging of Cleared Tissues. Cell Rep. 2020;33(5):108349. Ribeiro-Dasilva MC, Fillingim RB, Wallet SM. Estrogen-Induced Monocytic Response Correlates with TMD Pain: A Case Control Study. J Dent Res. 2017;96(3):285 − 91. List T, Jensen RH. Temporomandibular disorders: Old ideas and new concepts. Cephalalgia. 2017;37(7):692–704. Koparal M, Sirik M, Yavuz GY, Ege B. Evaluation of the relationship between temporomandibular joint disorders and tinnitus with computed tomography. J Stomatol Oral Maxillofac Surg. 2022;123(4):e199-e205. Wang X, Yang Y, Lin L, Yao Q, Zhang J. Obesity and temporomandibular joint disorders: a systematic review and meta-analysis. BMC Oral Health. 2023;23(1):607. Bayındır Ş, Yılmaz Asan C, Demirbaş AE, Keti DB, Kütük N. Evaluation of aggrecan and adipokine levels in temporomandibular joint synovial fluid. J Craniomaxillofac Surg. 2022;50(5):432-8. Minervini G, Franco R, Marrapodi MM, Crimi S, Badnjević A, Cervino G, et al. Correlation between Temporomandibular Disorders (TMD) and Posture Evaluated trough the Diagnostic Criteria for Temporomandibular Disorders (DC/TMD): A Systematic Review with Meta-Analysis. J Clin Med. 2023;12(7). Xiang T, Tao ZY, Liao LF, Wang S, Cao DY. Animal Models of Temporomandibular Disorder. J Pain Res. 2021;14:1415-30. Xing L, Qi X, Wu J, Liu Y, Zhang L, Jiang B. Histopathological characterization of mandibular condyles in four temporomandibular joint osteoarthritis mouse models. Arch Oral Biol. 2025;170:106129. Li J, Ma K, Yi D, Oh CD, Chen D. Nociceptive behavioural assessments in mouse models of temporomandibular joint disorders. Int J Oral Sci. 2020;12(1):26. Zhang Z, Luo X, Li X, Shi B, Tan L. The preliminary study of the effects of individual musculoskeletally stable position in the treatment of temporomandibular disorders. BMC Oral Health. 2024;24(1):1083. de Sousa BM, López-Valverde A, Caramelo F, Rodrigues MJ, López-Valverde N. Use of antidepressants in the treatment of chronic orofacial pain caused by temporomandibular disorders: A randomized controlled clinical trial. Med Clin (Barc). 2024;163(2):74 − 7. Yazici H, Taskin MI, Guney G, Hismiogullari AA, Arslan E, Tulaci KG. The novel relationship between polycystic ovary syndrome and temporomandibular joint disorders. J Stomatol Oral Maxillofac Surg. 2021;122(6):544-8. Lin J, Cao DY. Associations Between Temporomandibular Disorders and Brain Imaging-Derived Phenotypes. Int Dent J. 2024;74(4):784 − 93. Uchino M, Sashide Y, Takeda M. Suppression of the excitability of rat nociceptive secondary sensory neurons following local administration of the Phytochemical, (-)-Epigallocatechin-3-gallate. Brain Res. 2023;1813:148426. Papotto N, Reithofer S, Baumert K, Carr R, Möhrlen F, Frings S. Olfactory stimulation Inhibits Nociceptive Signal Processing at the Input Stage of the Central Trigeminal System. Neuroscience. 2021;479:35–47. Okubo N, Ishikawa H, Sano R, Shimazu Y, Takeda M. Effect of resveratrol on the hyperexcitability of nociceptive neurons associated with ectopic hyperalgesia induced by experimental tooth movement. Eur J Oral Sci. 2020;128(4):275 − 83. Arakawa S, Inoue M, Kinouchi R, Morizumi S, Yamaguchi M, Shimazu Y, Takeda M. Dietary constituent genistein inhibits the hyperexcitability of trigeminal nociceptive neurons associated with mechanical hyperalgesia following orofacial inflammation. J Oral Biosci. 2019;61(4):215 − 20. Yang W, Liu M, Zhang Q, Zhang J, Chen J, Chen Q, Suo L. Knockdown of miR-124 Reduces Depression-like Behavior by Targeting CREB1 and BDNF. Curr Neurovasc Res. 2020;17(2):196–203. Nakajima K, Oiso S, Kariyazono H. Brain-Derived Neurotrophic Factor Up-Regulation by the Methanol Extract of Foxtail Millet in Human Peripheral Cells. J Nutr Sci Vitaminol (Tokyo). 2020;66(3):284-8. Yang Y, Jiang W, Feng Y, Liu J, Chen H, Wang D, Zhao R. Melatonin alleviates hippocampal GR inhibition and depression-like behavior induced by constant light exposure in mice. Ecotoxicol Environ Saf. 2021;228:112979. Hurtado H, Hansen M, Strack J, Vainik U, Decker AL, Khundrakpam B, et al. Polygenic risk for depression and anterior and posterior hippocampal volume in children and adolescents. J Affect Disord. 2024;344:619 − 27. Zhou H, Li R, Ma Z, Rossi S, Zhu X, Li J. Smaller gray matter volume of hippocampus/parahippocampus in elderly people with subthreshold depression: a cross-sectional study. BMC Psychiatry. 2016;16:219. Liu S, Xiu J, Zhu C, Meng K, Li C, Han R, et al. Fat mass and obesity-associated protein regulates RNA methylation associated with depression-like behavior in mice. Nat Commun. 2021;12(1):6937. Dong B, Wang J, Wang M, Chen Q, Kong X, Chang J, et al. An FRET-based and ER-targeting fluorescent probe for tracking superoxide anion (O(2)(•-)) in the hippocampus of the depressive mouse. Talanta. 2024;268(Pt 1):125272. Terauchi A, Yee P, Johnson-Venkatesh EM, Seiglie MP, Kim L, Pitino JC, et al. The projection-specific signals that establish functionally segregated dopaminergic synapses. Cell. 2023;186(18):3845-61.e24. Terauchi A, Johnson-Venkatesh EM, Umemori H. Establishing functionally segregated dopaminergic circuits. Trends Neurosci. 2025;48(2):156 − 70. Pannu A, Goyal RK. The Potential Role of Dopamine Pathways in the Pathophysiology of Depression: Current Advances and Future Aspects. CNS Neurol Disord Drug Targets. 2024. Li H, Jacob MA, Cai M, Kessels RPC, Norris DG, Duering M, et al. Meso-cortical pathway damage in cognition, apathy and gait in cerebral small vessel disease. Brain. 2024;147(11):3804-16. Liu S, Tang Y, Shu H, Tatum D, Bai Q, Crawford J, et al. Dopamine receptor D2, but not D1, mediates descending dopaminergic pathway-produced analgesic effect in a trigeminal neuropathic pain mouse model. Pain. 2019;160(2):334 − 44. Li C, Li Y, Zhang W, Ma Z, Xiao S, Xie W, et al. Dopaminergic Projections from the Hypothalamic A11 Nucleus to the Spinal Trigeminal Nucleus Are Involved in Bidirectional Migraine Modulation. Int J Mol Sci. 2023;24(23). Nielsen JC, Salomon K, Kalenderoglou IE, Bargmeyer S, Pape T, Shahsavar A, Loland CJ. Structure of the human dopamine transporter in complex with cocaine. Nature. 2024;632(8025):678 − 85. Ambigapathy G, McCowan TJ, Carvelli L. Amphetamine exposure during embryogenesis changes expression and function of the dopamine transporter in Caenorhabditis elegans offspring. J Neurochem. 2024;168(9):2989-98. Kuzumaki N, Suda Y, Iwasawa C, Narita M, Sone T, Watanabe M, et al. Cell-specific overexpression of COMT in dopaminergic neurons of Parkinson's disease. Brain. 2019;142(6):1675-89. Kimura K, Nagai Y, Hatanaka G, Fang Y, Tanabe S, Zheng A, et al. A mosaic adeno-associated virus vector as a versatile tool that exhibits high levels of transgene expression and neuron specificity in primate brain. Nat Commun. 2023;14(1):4762. Do JP, Xu M, Lee SH, Chang WC, Zhang S, Chung S, et al. Cell type-specific long-range connections of basal forebrain circuit. Elife. 2016;5. Kitanishi T, Tashiro M, Kitanishi N, Mizuseki K. Intersectional, anterograde transsynaptic targeting of neurons receiving monosynaptic inputs from two upstream regions. Commun Biol. 2022;5(1):149. Yao Z, van Velthoven CTJ, Nguyen TN, Goldy J, Sedeno-Cortes AE, Baftizadeh F, et al. A taxonomy of transcriptomic cell types across the isocortex and hippocampal formation. Cell. 2021;184(12):3222-41.e26. Wang Q, Ding SL, Li Y, Royall J, Feng D, Lesnar P, et al. The Allen Mouse Brain Common Coordinate Framework: A 3D Reference Atlas. Cell. 2020;181(4):936 − 53.e20. Jing D, Yi Y, Luo W, Zhang S, Yuan Q, Wang J, et al. Tissue Clearing and Its Application to Bone and Dental Tissues. J Dent Res. 2019;98(6):621 − 31. Lai MS, Sørensen MH, Lee K, Chu JM, Chang RC. 3D mapping of direct VTA-CA2 circuit with potential involvement in Parkinson's disease degeneration. Neurobiol Dis. 2024;202:106723. Sorkaç A, Moșneanu RA, Crown AM, Savaş D, Okoro AM, Memiş E, et al. retro-Tango enables versatile retrograde circuit tracing in Drosophila. Elife. 2023;12. Ueda HR, Ertürk A, Chung K, Gradinaru V, Chédotal A, Tomancak P, Keller PJ. Tissue clearing and its applications in neuroscience. Nat Rev Neurosci. 2020;21(2):61–79. Li Y, Zhang B, Pan X, Wang Y, Xu X, Wang R, Liu Z. Dopamine-Mediated Major Depressive Disorder in the Neural Circuit of Ventral Tegmental Area-Nucleus Accumbens-Medial Prefrontal Cortex: From Biological Evidence to Computational Models. Front Cell Neurosci. 2022;16:923039. Admon R, Kaiser RH, Dillon DG, Beltzer M, Goer F, Olson DP, et al. Dopaminergic Enhancement of Striatal Response to Reward in Major Depression. Am J Psychiatry. 2017;174(4):378 − 86. Yi MH, Liu YU, Liu K, Chen T, Bosco DB, Zheng J, et al. Chemogenetic manipulation of microglia inhibits neuroinflammation and neuropathic pain in mice. Brain Behav Immun. 2021;92:78–89. Miyakawa N, Nagai Y, Hori Y, Mimura K, Orihara A, Oyama K, et al. Chemogenetic attenuation of cortical seizures in nonhuman primates. Nat Commun. 2023;14(1):971. Cheng Z, Zhang C, Zhao F, Piao J, Cui R, Li B. Rasd2 Mediates Acute Fasting-Induced Antidepressant-Like Effects via Dopamine D2 Receptor Activation in Ovariectomized Mice. Int J Neuropsychopharmacol. 2023;26(3):217 − 29. Bland T, Zhu M, Dillon C, Sahin GS, Rodriguez-Llamas JL, Appleyard SM, Wayman GA. Leptin Controls Glutamatergic Synaptogenesis and NMDA-Receptor Trafficking via Fyn Kinase Regulation of NR2B. Endocrinology. 2020;161(2). Mainardi M, Spinelli M, Scala F, Mattera A, Fusco S, D'Ascenzo M, Grassi C. Loss of Leptin-Induced Modulation of Hippocampal Synaptic Trasmission and Signal Transduction in High-Fat Diet-Fed Mice. Front Cell Neurosci. 2017;11:225. Garza JC, Guo M, Zhang W, Lu XY. Leptin restores adult hippocampal neurogenesis in a chronic unpredictable stress model of depression and reverses glucocorticoid-induced inhibition of GSK-3β/β-catenin signaling. Mol Psychiatry. 2012;17(8):790–808. Li C, Meng F, Lei Y, Liu J, Liu J, Zhang J, et al. Leptin regulates exon-specific transcription of the Bdnf gene via epigenetic modifications mediated by an AKT/p300 HAT cascade. Mol Psychiatry. 2021;26(8):3701-22. Additional Declarations The authors have declared there is NO conflict of interest to disclose Supplementary Files SupplementaryFigures.docx Supplementary Figures graphicabstract.tif Figure Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7857810","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":557913308,"identity":"51561592-1179-4934-9286-0d699815e3f6","order_by":0,"name":"Jiefei Shen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7klEQVRIiWNgGAWjYDACCRA2YOBnYGY+ABE5QKQWyQZmtgQStACBZAMDjwFxWuRnNx97YFFgI8HPzvP5w882Bjm+GwmMnwvwaDG4cyzdQMIgTUKymXebZG8bg7HkjQRm6Rn4tEjkmElIGByuMzjMu42ZsY0hccONBDZmHnwOm5H/Dajlv4T9YZ7Hn4Fa6glqYbiRwwbUckDCAKhMGqglwYCQFoMbaSCHJUtIHGYzk+w5J2E488zDZmn8Dkt+Ji3xx06Cv//w4w8/ymzk+Y4nH/yM12FAwCyBYIOYjA0ENACVfCCoZBSMglEwCkY0AAASA0MofOM+0QAAAABJRU5ErkJggg==","orcid":"","institution":"West China School of Stomatology, Sichuan University,","correspondingAuthor":true,"prefix":"","firstName":"Jiefei","middleName":"","lastName":"Shen","suffix":""},{"id":557913309,"identity":"f65ee628-951f-48f2-86d4-21dfe8f1a970","order_by":1,"name":"Muyun Wang","email":"","orcid":"https://orcid.org/0009-0002-8422-0723","institution":"West China School of Stomatology, Sichuan University","correspondingAuthor":false,"prefix":"","firstName":"Muyun","middleName":"","lastName":"Wang","suffix":""},{"id":557913310,"identity":"33390469-2feb-4044-b6e9-08fc829e10f6","order_by":2,"name":"Dexin Zhu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Dexin","middleName":"","lastName":"Zhu","suffix":""},{"id":557913311,"identity":"2001bf91-cff0-4d4e-9bb3-4a1340de2da2","order_by":3,"name":"Yating Yi","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yating","middleName":"","lastName":"Yi","suffix":""},{"id":557913312,"identity":"da98e6b9-55b3-4513-8bb6-de89cb8a4151","order_by":4,"name":"Yueyan Cen","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yueyan","middleName":"","lastName":"Cen","suffix":""},{"id":557913313,"identity":"2924ec64-b465-403c-9d5b-fff254b3fb61","order_by":5,"name":"Suying Zhan","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Suying","middleName":"","lastName":"Zhan","suffix":""},{"id":557913314,"identity":"2b731ca8-7f0e-4f71-a27a-30ef4aef55a5","order_by":6,"name":"Fei Liu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Fei","middleName":"","lastName":"Liu","suffix":""},{"id":557913315,"identity":"188e7401-076f-43dc-a897-3d08f3ab85f8","order_by":7,"name":"Qinxuan Song","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Qinxuan","middleName":"","lastName":"Song","suffix":""},{"id":557913316,"identity":"5752087c-e168-4841-906f-64e52f923b4b","order_by":8,"name":"Xinlin Gao","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Xinlin","middleName":"","lastName":"Gao","suffix":""},{"id":557913317,"identity":"887c43f6-f855-4081-9f4d-ffef4fc0e59e","order_by":9,"name":"Chunjie Li","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Chunjie","middleName":"","lastName":"Li","suffix":""},{"id":557913318,"identity":"6f33829f-32d7-452e-a6cf-3f80bf58b36b","order_by":10,"name":"Cheng Zhou","email":"","orcid":"https://orcid.org/0000-0002-5005-2285","institution":"West China Hospital of Sichuan University","correspondingAuthor":false,"prefix":"","firstName":"Cheng","middleName":"","lastName":"Zhou","suffix":""},{"id":557913319,"identity":"fcba3715-7d19-4c4c-809d-383133978a2a","order_by":11,"name":"Hang Wang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Hang","middleName":"","lastName":"Wang","suffix":""},{"id":557913320,"identity":"f1d0d5dd-6964-4422-9cc0-a7b424747257","order_by":12,"name":"Yanyan Zhang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yanyan","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2025-10-14 11:06:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7857810/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7857810/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":98235860,"identity":"55197e0c-15c0-4023-9c04-61cbd42556e0","added_by":"auto","created_at":"2025-12-15 14:25:34","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":228949,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/3f9e7f0106c9be3d9ca3637d.docx"},{"id":98434382,"identity":"c8a701d7-3245-4491-b425-139c8d1ffe63","added_by":"auto","created_at":"2025-12-17 16:52:03","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7593590,"visible":true,"origin":"","legend":"","description":"","filename":"fig1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/97aa156250e1860c2aea3d36.tif"},{"id":98235869,"identity":"b45e48dd-c0ca-488c-9c10-c18844df99a2","added_by":"auto","created_at":"2025-12-15 14:25:35","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22220456,"visible":true,"origin":"","legend":"","description":"","filename":"fig2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/f5957e3e49b6a7ffccf88c80.tif"},{"id":98432706,"identity":"1cc47f56-46fd-4764-94c3-63d7d81d7051","added_by":"auto","created_at":"2025-12-17 16:49:49","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11311590,"visible":true,"origin":"","legend":"","description":"","filename":"fig3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/42e23cb2d8ff96acfb3618b6.tif"},{"id":98235877,"identity":"5561c8ef-b69e-41b7-a096-74b0006eeb82","added_by":"auto","created_at":"2025-12-15 14:25:35","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10759166,"visible":true,"origin":"","legend":"","description":"","filename":"fig4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/131bd6a97bcd4bfaf1780ce5.tif"},{"id":98235873,"identity":"3b6c976b-adf8-44e1-a4cb-01cefc53f470","added_by":"auto","created_at":"2025-12-15 14:25:35","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9015570,"visible":true,"origin":"","legend":"","description":"","filename":"fig5.tif","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/433e5a7ddf1e453e73e65660.tif"},{"id":98432673,"identity":"f7f1bdc3-39f2-4ca4-b78e-731ef0334ffc","added_by":"auto","created_at":"2025-12-17 16:49:47","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4467850,"visible":true,"origin":"","legend":"","description":"","filename":"fig6.tif","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/14465256b18720bb153bb844.tif"},{"id":98433313,"identity":"415298a9-6b0a-4a95-8dd8-36005f4d45d1","added_by":"auto","created_at":"2025-12-17 16:50:35","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15555128,"visible":true,"origin":"","legend":"","description":"","filename":"graphicabstract.tif","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/b85e29d31cb1ed58d5c82b15.tif"},{"id":98235874,"identity":"53655dad-e580-40fd-b1d1-520d1000230c","added_by":"auto","created_at":"2025-12-15 14:25:35","extension":"json","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14877,"visible":true,"origin":"","legend":"","description":"","filename":"2025MP002577.json","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/0726e95336fa33ff9d696e7f.json"},{"id":98432720,"identity":"a7389954-09d5-4264-a110-398b8b594228","added_by":"auto","created_at":"2025-12-17 16:49:50","extension":"docx","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":17692620,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigures.docx","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/4f30f00efe44e48c6026bdf4.docx"},{"id":98433699,"identity":"47497e02-e99c-46ae-bdb4-0cb09fe0450a","added_by":"auto","created_at":"2025-12-17 16:51:03","extension":"xml","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":153800,"visible":true,"origin":"","legend":"","description":"","filename":"2025MP0025770enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/39dd8eb01ea7defab69d71cc.xml"},{"id":98432572,"identity":"b02b8bd1-b1cd-47d9-b44a-a02836146d2d","added_by":"auto","created_at":"2025-12-17 16:49:43","extension":"tif","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7593590,"visible":true,"origin":"","legend":"","description":"","filename":"fig1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/294b6906098154c2c0e455ad.tif"},{"id":98433391,"identity":"53f5064d-b1f3-4f61-a93e-a725113d2889","added_by":"auto","created_at":"2025-12-17 16:50:42","extension":"tif","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22220456,"visible":true,"origin":"","legend":"","description":"","filename":"fig2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/9b82c85e3da89d459b8ec50a.tif"},{"id":98235887,"identity":"65e439d3-a48f-4238-a458-c41e39e6e843","added_by":"auto","created_at":"2025-12-15 14:25:35","extension":"tif","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11311590,"visible":true,"origin":"","legend":"","description":"","filename":"fig3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/a600989dc5eeab86179d2670.tif"},{"id":98235893,"identity":"bcece843-e713-4d11-8b6b-ffb49974647d","added_by":"auto","created_at":"2025-12-15 14:25:35","extension":"tif","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10759166,"visible":true,"origin":"","legend":"","description":"","filename":"fig4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/cbb45c7276fbd722d6f48571.tif"},{"id":98432714,"identity":"a3390bcf-46a9-4fa9-9dd0-0fda30bba73d","added_by":"auto","created_at":"2025-12-17 16:49:50","extension":"tif","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9015570,"visible":true,"origin":"","legend":"","description":"","filename":"fig5.tif","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/428dcbca07adf5653c169fc5.tif"},{"id":98235880,"identity":"f30d7191-8691-491f-82f0-b8fed855a084","added_by":"auto","created_at":"2025-12-15 14:25:35","extension":"tif","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4467850,"visible":true,"origin":"","legend":"","description":"","filename":"fig6.tif","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/581cb9cb44bb4a803b2506df.tif"},{"id":98433659,"identity":"806ee483-d430-431c-819a-1bdef63c8a76","added_by":"auto","created_at":"2025-12-17 16:51:00","extension":"tif","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15555128,"visible":true,"origin":"","legend":"","description":"","filename":"graphicabstract.tif","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/03f1438c09c26c4bf35ad834.tif"},{"id":98235885,"identity":"a61a08ed-43a7-4d13-8aea-39d3409c6dd0","added_by":"auto","created_at":"2025-12-15 14:25:35","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":815755,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig1.png","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/cfa0ee1c738dade3389a0bb4.png"},{"id":98235884,"identity":"9356e44c-97ad-4f37-8550-41f75b0a6dd8","added_by":"auto","created_at":"2025-12-15 14:25:35","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2036464,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig2.png","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/a4eaff3c405ea54157396b44.png"},{"id":98235882,"identity":"1d2302f0-12fd-4413-8097-c4951ca5262c","added_by":"auto","created_at":"2025-12-15 14:25:35","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1105937,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig3.png","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/5f42c3b894c57a80328bc1af.png"},{"id":98235888,"identity":"26245d0a-ca1b-4f00-980a-ef92671d4c7d","added_by":"auto","created_at":"2025-12-15 14:25:35","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":889279,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig4.png","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/cf43d507f7b2393e937d2d38.png"},{"id":98235878,"identity":"a85e41e4-f1c9-45c8-82a1-e656cbe273cb","added_by":"auto","created_at":"2025-12-15 14:25:35","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":823259,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig5.png","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/d72121bd1ee83208faa19c85.png"},{"id":98433240,"identity":"14ee07df-14a5-4e07-80ad-7680445684f7","added_by":"auto","created_at":"2025-12-17 16:50:30","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":384138,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefig6.png","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/ad4d9ebfb0177ddc235ed359.png"},{"id":98434229,"identity":"9f66557a-e2fd-4062-8863-c3512c369ad1","added_by":"auto","created_at":"2025-12-17 16:51:44","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":99827,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegraphicabstract.png","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/f07014371690c350b0c0fa04.png"},{"id":98235889,"identity":"519bc391-d6d4-4cb6-b61b-d56e049d4962","added_by":"auto","created_at":"2025-12-15 14:25:35","extension":"xml","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":152120,"visible":true,"origin":"","legend":"","description":"","filename":"2025MP0025770structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/0184af701efcd0b0c13748f1.xml"},{"id":98235891,"identity":"389a7af4-8849-4cda-850f-41e64835b034","added_by":"auto","created_at":"2025-12-15 14:25:35","extension":"html","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":165437,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/4457cd7ec05e41ca1673fef6.html"},{"id":98235858,"identity":"2f77b66a-aa16-4fd9-8305-4e2543182104","added_by":"auto","created_at":"2025-12-15 14:25:34","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":471606,"visible":true,"origin":"","legend":"\u003cp\u003eStructural and behavioral alterations in UAC-induced TMD mice. \u003cstrong\u003eA,\u003c/strong\u003e Timeline depicting the sequence of modeling, behavior tests, micro-CT, and tissue section staining. \u003cstrong\u003eB-C,\u003c/strong\u003e Representative 3D micro-CT reconstruction images of TMJ morphology in CTL and UAC groups. Scale bars: 100 μm. \u003cstrong\u003eD-E,\u003c/strong\u003e Significant reduction in BV/TV ratio and Tb.Th in the UAC group versus the CTL group. Data were expressed as means ± SD. (n = 4; BV/TV ***\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.001; Tb.Th ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; two-tailed unpaired Student’s t-test). \u003cstrong\u003eF, \u003c/strong\u003eHistopathological alterations of TMJ in both groups. The green arrow revealed subchondral bone degradationin HE staining, and black arrows indicated osteoclasts in TRAP staining. Scale bars: 50 μm. \u003cstrong\u003eG,\u003c/strong\u003e Immobile time in CTL and UAC groups at BL, day 7, and 10 in FST. Data were expressed as means ± SD. (ns, \u003cem\u003eP\u003c/em\u003e\u0026gt; 0.05 at BL; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 at day 7, and 10; two-tailed unpaired Student’s t-test). \u003cstrong\u003eH,\u003c/strong\u003e Sucrose preference index of both groups. Data were expressed as means ± SD. (ns, \u003cem\u003eP\u003c/em\u003e \u0026gt; 0.05 at BL; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 at day 7; *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 at day 10; two-tailed unpaired Student’s t-test). \u003cstrong\u003eI,\u003c/strong\u003eCenter cumulative duration of both groups in OFT. Data were expressed as means ± SD. (ns, \u003cem\u003eP\u003c/em\u003e\u0026gt; 0.05 at BL; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 at day 7, and 10; two-tailed unpaired Student’s t-test). \u003cstrong\u003eJ,\u003c/strong\u003e Movement trajectory patterns in OFT. The centrally positioned small square demarcated the predefined center zone for quantifying behavior in the OFT.\u003c/p\u003e","description":"","filename":"fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/ba11fa0bb071c2eaf6aae616.png"},{"id":98235862,"identity":"22ee7e83-12af-4170-8246-7b0b12be306f","added_by":"auto","created_at":"2025-12-15 14:25:34","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":11316473,"visible":true,"origin":"","legend":"\u003cp\u003eStructural mapping and functional investigation of SpVc-HPC dopaminergic pathway. \u003cstrong\u003eA-B,\u003c/strong\u003eTH and DAT co-localized on SpVc and HPC neurons. (red: TH; green: DAT; blue: DAPI). Scale bars: 50 μm. \u003cstrong\u003eC,\u003c/strong\u003e Timeline depicting AAV2/1 injection and tissue sections observation. \u003cstrong\u003eD,\u003c/strong\u003e Schematic of Cre-dependent anterograde trans-synaptic AAV2/1 tracing strategy on \u003cem\u003eDAT-Cre\u003c/em\u003emice. \u003cstrong\u003eE,\u003c/strong\u003e EGFP in both SpVc and HPC sections. Scale bars: 20 μm (left and right) and 100 μm (middle). \u003cstrong\u003eF,\u003c/strong\u003e Timeline depicting AAV2/1 injection, IF, and tissue clearing. \u003cstrong\u003eG,\u003c/strong\u003e Schematic of AAV2/1 tracing strategy on \u003cem\u003eAi140\u003c/em\u003e mice. \u003cstrong\u003eH,\u003c/strong\u003e EGFP in both SpVc and HPC. (green: EGFP; blue: DAPI). Scale bars: 50 μm. \u003cstrong\u003eI,\u003c/strong\u003e 3-D image volume of the whole sample. White arrows indicated the EGFP fluorescence. Scale bars: 1000 μm. \u003cstrong\u003eJ,\u003c/strong\u003e Timeline depicting the sequence of AAV2/1 injection and behavior tests. \u003cstrong\u003eK,\u003c/strong\u003eSchematic of AAV2/1-hM4Di injection into the SpVc of \u003cem\u003eDAT-Cre\u003c/em\u003e mice, and injection of CNO before behavior tests at day 21. \u003cstrong\u003eL,\u003c/strong\u003e In FST, the EGFP-hM4Di group exhibited statistically significant changes following CNO administration. Data were expressed as means ± SD. (**\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs. before injection; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs. NS injection; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs. CNO-treated control; two-tailed unpaired Student’s t-test). \u003cstrong\u003eM,\u003c/strong\u003eA marked reduction in sucrose preference was observed in the EGFP-hM4Di group after CNO injection. Data were expressed as means ± SD. (**\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs. before injection; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs. NS injection; **\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01 vs. CNO-treated control; two-tailed unpaired Student’s t-test). \u003cstrong\u003eN,\u003c/strong\u003e OFT results revealed significant alterations in the EGFP-hM4Di group after CNO injection. Data were expressed as means ± SD. (**\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs. before injection; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs. NS injection; ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 vs. CNO-treated control; two-tailed unpaired Student’s t-test). \u003cstrong\u003eO,\u003c/strong\u003e Movement trajectory patterns in OFT for two groups before and after injection of NS or CNO. \u003cstrong\u003eP,\u003c/strong\u003e Timeline depicting the sequence of AAV2/1 injection, UAC modeling, and OFT. \u003cstrong\u003eQ,\u003c/strong\u003e Schematic of AAV2/1-hM3Dq injection into the SpVc, modeling at day 11, and injection of CNO before OFT at day 21. \u003cstrong\u003eR,\u003c/strong\u003eFST results demonstrated significant behavioral alterations in the UAC+EGFP-hM4Di group post-CNO injection. Data were expressed as means ± SD. (*\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 vs. before injection; *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 vs. NS injection; **\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01 vs. CNO-treated control; two-tailed unpaired Student’s t-test). \u003cstrong\u003eS,\u003c/strong\u003eUAC+EGFP-hM4Di group exhibited higher sucrose preference after CNO injection. Data were expressed as means ± SD. (*\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 vs. before injection; *\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05 vs. NS injection; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs. CNO-treated control; two-tailed unpaired Student’s t-test). \u003cstrong\u003eT,\u003c/strong\u003e OFT results indicated significant alterations in the UAC+EGFP-hM4Di group after CNO injection. Data were expressed as means ± SD. (**\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs. before injection; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs. NS injection; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 vs. CNO-treated control; two-tailed unpaired Student’s t-test). \u003cstrong\u003eU,\u003c/strong\u003eMovement trajectory patterns in OFT for two groups before and after injection of NS or CNO.\u003c/p\u003e","description":"","filename":"fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/4499178860786f7474429573.png"},{"id":98433599,"identity":"dd51a71c-07a2-43dd-b984-ebda550f8bb9","added_by":"auto","created_at":"2025-12-17 16:50:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":11269690,"visible":true,"origin":"","legend":"\u003cp\u003eFunction role of hippocampal DRD2 in depression-like behaviors of UAC mice. \u003cstrong\u003eA,\u003c/strong\u003eRT-qPCR analysis depicted significant downregulation of DRD2 mRNA in the UAC group. Data were expressed as means ± SD. (***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; two-tailed unpaired Student’s t-test). \u003cstrong\u003eB-C,\u003c/strong\u003e WB graphs and images confirmed DRD2 protein expression in the UAC group. Data were expressed as means ± SD. (**\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; two-tailed unpaired Student’s t-test). \u003cstrong\u003eD,\u003c/strong\u003eIF staining indicated that DRD2 and NeuN co-localized on neurons. (Red: DRD2; green: NeuN; blue: DAPI). Scale bars: 50 μm. \u003cstrong\u003eE-F,\u003c/strong\u003e Experimental timeline: Stereotaxic injection of AAV2/9-\u003cem\u003eDRD2\u003c/em\u003e or AAV2/9-\u003cem\u003eCTL\u003c/em\u003e into the HPC, followed by UAC modeling at day 11 and behavioral/protein analyses at day 21. \u003cstrong\u003eG-H,\u003c/strong\u003e WB graphs and corresponding images quantified alterations of DRD2 protein levels in DRD2-overexpressing UAC mice. Data were expressed as means ± SD. (***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; two-tailed unpaired Student’s t-test). \u003cstrong\u003eI,\u003c/strong\u003e DRD2-overexpressing group showed significantly different immobile time in FST. Data were expressed as means ± SD. (*\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; two-tailed unpaired Student’s t-test). \u003cstrong\u003eJ,\u003c/strong\u003eIn SPT, DRD2-overexpressing group exhibited higher sucrose preference. Data were expressed as means ± SD. (*\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; two-tailed unpaired Student’s t-test). \u003cstrong\u003eK-L,\u003c/strong\u003eThe significant differences in center cumulative duration and movement trajectory patterns in DRD2-overexpressing group. Data were expressed as means ± SD. (**\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; two-tailed unpaired Student’s t-test).\u003c/p\u003e","description":"","filename":"fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/d471e950c3e81386c704f7fa.png"},{"id":98235866,"identity":"45939ca5-e506-45db-ad6e-b07d1048484f","added_by":"auto","created_at":"2025-12-15 14:25:34","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":10378743,"visible":true,"origin":"","legend":"\u003cp\u003eFunction role of hippocampal LEPR in depression-like behaviors of UAC mice. \u003cstrong\u003eA,\u003c/strong\u003e RT-qPCR analysis revealed significant inhibition of DRD2 mRNA in the UAC group. Data were expressed as means ± SD. (***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; two-tailed unpaired Student’s t-test). \u003cstrong\u003eB-C,\u003c/strong\u003e WB graphs and images confirmed DRD2 protein expression in the UAC group. Data were expressed as means ± SD. (***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; two-tailed unpaired Student’s t-test). \u003cstrong\u003eD,\u003c/strong\u003eIF staining indicated that LEPR and NeuN co-localized on neurons. (Red: LEPR; green: NeuN; blue: DAPI). Scale bars: 50 μm. \u003cstrong\u003eE-F,\u003c/strong\u003eExperimental timeline: Stereotaxic injection of AAV2/9-\u003cem\u003eLEPR \u003c/em\u003eor AAV2/9-\u003cem\u003eCTL\u003c/em\u003einto the HPC, followed by UAC modeling at day 11 and behavioral/protein analyses at day 21. \u003cstrong\u003eG-H,\u003c/strong\u003e WB graphs and images quantifiedalterations of LEPR protein levels in LEPR-overexpressing UAC mice. Data were expressed as means ± SD. (**\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; two-tailed unpaired Student’s t-test). \u003cstrong\u003eI,\u003c/strong\u003e LEPR-overexpressing group showed significantly different immobile time in FST. Data were expressed as means ± SD. (**\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; two-tailed unpaired Student’s t-test). \u003cstrong\u003eJ,\u003c/strong\u003eIn SPT, LEPR-overexpressing group exhibited higher sucrose preference. Data were expressed as means ± SD. (**\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; two-tailed unpaired Student’s t-test). \u003cstrong\u003eK-L,\u003c/strong\u003eThe significant differences in center cumulative duration and movement trajectory patterns in LEPR-overexpressing group. Data were expressed as means ± SD. (**\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; two-tailed unpaired Student’s t-test).\u003c/p\u003e","description":"","filename":"fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/5194bdc332d5c64abda49b05.png"},{"id":98432319,"identity":"0daf2cb4-7aa9-4c0b-956f-dd2067a56f16","added_by":"auto","created_at":"2025-12-17 16:49:23","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":7814774,"visible":true,"origin":"","legend":"\u003cp\u003eDRD2 regulated LEPR both \u003cem\u003ein vivo \u003c/em\u003eand \u003cem\u003ein vitro\u003c/em\u003e. \u003cstrong\u003eA-B, \u003c/strong\u003eWB graphs and corresponding images quantifiedalterations of LEPR protein levels in DRD2-overexpressing UAC mice. Data were expressed as means ± SD. (***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; two-tailed unpaired Student’s t-test). \u003cstrong\u003eC-D\u003c/strong\u003e, Schematic representation of the experimental groups and their respective treatments. \u003cstrong\u003eE\u003c/strong\u003e, FAM-labeled siRNA fluorescence confirmed transfection efficiency. Scale bar: 100 μm. \u003cstrong\u003eF\u003c/strong\u003e, The mCherry fluorescence confirmedlentiviral transduction efficiency. Scale bar: 100 μm. \u003cstrong\u003eG\u003c/strong\u003e, RT-qPCR analysis of DRD2 mRNA identified si\u003cem\u003eDRD2\u003c/em\u003e-554 for subsequent studies. Data were expressed as means ± SD. (**\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; two-tailed unpaired Student’s t-test). \u003cstrong\u003eH-I\u003c/strong\u003e, RT-qPCR quantified the alterations ofDRD2 and LEPR mRNA levels. Data were expressed as means ± SD. (***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 for DRD2; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 for LEPR; two-tailed unpaired Student’s t-test). \u003cstrong\u003eJ-M\u003c/strong\u003e, WB graphs and images validated DRD2 and LEPR protein downregulation. Data were expressed as means ± SD. (***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 for DRD2; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 for LEPR; two-tailed unpaired Student’s t-test). \u003cstrong\u003eN\u003c/strong\u003e, RT-qPCR analysis of DRD2 mRNA identified MOI = 5 for subsequent studies. Data were expressed as means ± SD. (***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; two-tailed unpaired Student’s t-test). \u003cstrong\u003eO-P\u003c/strong\u003e, RT-qPCR detected DRD2 and LEPR mRNA level changes in the LV-\u003cem\u003eDRD2\u003c/em\u003e group. Data were expressed as means ± SD. (***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; two-tailed unpaired Student’s t-test). \u003cstrong\u003eQ-T\u003c/strong\u003e, WB graphs and images quantified DRD2 and LEPR protein alterations. Data were expressed as means ± SD. (***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; two-tailed unpaired Student’s t-test).\u003c/p\u003e","description":"","filename":"fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/183198d862b81a7314ba4e30.png"},{"id":98235864,"identity":"406f2ed6-55ae-407e-a849-ddf40dde019e","added_by":"auto","created_at":"2025-12-15 14:25:34","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":4120346,"visible":true,"origin":"","legend":"\u003cp\u003eDRD2 modulated LEPR expression via NF-κB signaling. \u003cstrong\u003eA,\u003c/strong\u003e Schematic representation of the experimental groups and their respective treatments. \u003cstrong\u003eB-D,\u003c/strong\u003e VB (PKC/NF-κB inhibitor) attenuated LV-\u003cem\u003eDRD2\u003c/em\u003e-induced LEPR mRNA and protein upregulation. Data were expressed as means ± SD. (***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; two-tailed unpaired Student’s t-test). \u003cstrong\u003eE-F,\u003c/strong\u003eWB graphs and images showed the quantification of p-NF-κB after VB treatment. Data were expressed as means ± SD. (***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; two-tailed unpaired Student’s t-test). \u003cstrong\u003eG-H,\u003c/strong\u003eWB results revealed the quantification of p-PKC after VB treatment. Data were expressed as means ± SD. (ns \u003cem\u003eP\u003c/em\u003e \u0026gt; 0.05; two-tailed unpaired Student’s t-test). \u003cstrong\u003eI-J,\u003c/strong\u003eWB graphs and images revealed NF-κB phosphorylation levels in both si\u003cem\u003eDRD2\u003c/em\u003eand si\u003cem\u003eCTL\u003c/em\u003e groups. Data were expressed as means ± SD. (**\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; two-tailed unpaired Student’s t-test). \u003cstrong\u003eK-L,\u003c/strong\u003eWB graphs and images presented NF-κB phosphorylation levels in both LV-\u003cem\u003eDRD2\u003c/em\u003eand LV-\u003cem\u003eCTL\u003c/em\u003e groups. Data were expressed as means ± SD. (***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; two-tailed unpaired Student’s t-test).\u003c/p\u003e","description":"","filename":"fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/117628d22ea0ea37a586e505.png"},{"id":100359215,"identity":"2562b22f-67ea-4864-bbf8-f282c58b4bd4","added_by":"auto","created_at":"2026-01-16 07:21:51","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":50963052,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/b09102d2-f212-40f1-9120-e3ef7b3c1622.pdf"},{"id":98434352,"identity":"0ad88f2a-8280-49c6-8703-bb24b274d377","added_by":"auto","created_at":"2025-12-17 16:51:59","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":17692620,"visible":true,"origin":"","legend":"Supplementary Figures","description":"","filename":"SupplementaryFigures.docx","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/c82e3080c9783ea70c060dcd.docx"},{"id":98434139,"identity":"39b9b740-2315-4b10-b8d3-0428ab1d95a9","added_by":"auto","created_at":"2025-12-17 16:51:34","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":822007,"visible":true,"origin":"","legend":"Figure","description":"","filename":"graphicabstract.tif","url":"https://assets-eu.researchsquare.com/files/rs-7857810/v1/b118e25c857945c03949663f.tif"}],"financialInterests":"The authors have declared there is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose","formattedTitle":"The Dopaminergic Spinal Trigeminal Nucleus Caudalis-Hippocampus Pathway Modulates TMD-Associated Depression via the DRD2/NF-κB/LEPR Signaling Axis","fulltext":[{"header":"Highlights","content":"\u003cul\u003e\n\u003cli\u003eUAC modeling induced TMD and depressive behaviors.\u003c/li\u003e\n\u003cli\u003eSpVc-HPC dopaminergic pathway regulated TMD-associated depression, and activating this pathway alleviated depression in UAC mice.\u003c/li\u003e\n\u003cli\u003eThe DRD2-NF-\u0026kappa;B-LEPR axis was downregulated in UAC mice, and upregulation of DRD2 or LEPR ameliorated depressive behaviors.\u003c/li\u003e\n\u003c/ul\u003e"},{"header":"Introduction","content":"\u003cp\u003eTemporomandibular disorder (TMD), characterized by orofacial system dysfunction with increasing global prevalence (1, 2), demonstrate significant comorbidity with depression beyond their classical symptoms of joint/muscle pain and restricted mandibular movement (3, 4). This depressive comorbidity adversely impacts treatment outcomes and promotes disease chronicity (5). Emerging neuroimaging evidence reveals central nervous system (CNS) alterations in TMD patients, particularly in brain networks mediating pain and emotional processing (6, 7). The spinal trigeminal nucleus caudalis (SpVc) serves as a crucial relay station for orofacial nociceptive integration (8, 9). Notably, the hippocampus (HPC), a structure frequently exhibits depression-related abnormalities including volume loss and synaptic dysfunction (10, 11). Studies in temporomandibular joint osteoarthritis (TMJ-OA) rat models reveal hippocampal pathological changes concurrent with heightened anxiety-like behaviors (12). Mechanistic studies suggest functional SpVc-HPC interactions, where suppression of HPC glial activation alleviates trigeminal injury-induced depression (13), while orofacial stimulation enhances HPC neuronal activity (14). Recent whole-brain mapping further confirms trigeminal-HPC connectivity (15), and chronic migraine models reveal abnormal SpVc-HPC metabolic coupling (16). However, the existence of direct SpVc-HPC neural projections and their specific contribution to TMD-associated depression remain to be fully elucidated.\u003c/p\u003e\u003cp\u003eAnhedonia, the diminished capacity to experience pleasure, represents a core symptom of depression with particular relevance to dopaminergic system dysfunction (17). Dopamine, a monoamine catecholamine neurotransmitter, acts via dopamine receptors (DRDs), which belong to the family of 7-transmembrane G protein-coupled receptors (GPCRs). As one of the principal neuromodulators of emotional processing, dopamine regulates synaptic transmission and plasticity via DRD activation, thereby influencing critical brain functions including motivation, reward processing, and affective regulation (17, 18). The DRD2, abundantly expressed throughout the CNS, plays a particularly important role in modulating dopaminergic signaling pathways (19, 20). Studies demonstrate that impaired DRD2/β-arrestin2 signaling pathway in the HPC leads to astrocytic dysfunction and subsequent development of depression-like behaviors under chronic stress conditions (21, 22). In multiple sclerosis mouse model, DRD2 has been shown to regulate neuroinflammatory processes through modulation of nuclear factor kappa-B (NF-κB) activity via 6-pyruvoyl-tetrahydropterin synthase expression (23). However, the potential involvement of dopaminergic mechanisms within the SpVc-HPC circuit in TMD-associated depression remain to be further explored.\u003c/p\u003e\u003cp\u003eThe adipokine leptin, after crossing the blood-brain barrier (BBB), binds to its receptor (LEPR) in multiple brain regions and has emerged as an important regulator of hippocampal function (24, 25). It regulates hippocampal neuronal excitability and synaptic plasticity, playing significant roles in mood disorder, inflammatory, and neurodegenerative diseases (26, 27). LEPR, a class I cytokine receptor, shows widespread distribution in limbic structures including the HPC (28, 29), where it influences neurogenesis and synaptic function through brain-derived neurotrophic factor (BDNF)-dependent mechanisms (30, 31). Notably, LEPR-deficient mice exhibit prominent depressive-like phenotypes (32), while age-related declines in the HPC leptin sensitivity have been associated with accelerated cognitive and emotional dysfunction (33). However, whether hippocampal LEPR participates in the central neural regulation of TMD-associated depression remains unclear.\u003c/p\u003e\u003cp\u003eTaking all these into account, this study aimed to investigate the functional organization of SpVc-HPC dopaminergic projections, and the involvement of DRD2-NF-κB-LEPR signaling in TMD-associated depression. Using tissue-clearing combined with immunofluorescence (IF), we demonstrated the existence of a dopaminergic projection from the SpVc to the HPC firstly. Furthermore, chemogenetic approaches established the critical involvement of this circuit in TMD-associated depression. Our results demonstrated that TMD conditions lead to functional suppression of the SpVc-HPC dopaminergic pathway, resulting in impaired DRD2 signaling, reduced NF-κB phosphorylation, and downregulated LEPR activity, ultimately contributing to depression-like behaviors. These findings elucidated novel mechanistic insights into TMD-associated affective comorbidities and identified potential therapeutic targets for intervention.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eAnimal Preparation\u003c/h2\u003e\n \u003cp\u003eC57BL/6 wild type (WT) mice (6\u0026ndash;8 weeks) from Sichuan University, transgenic dopamine transporter \u003cem\u003e(DAT)-Cre\u003c/em\u003e mice (purchased from GemPharmatech Co., Ltd Laboratory), and \u003cem\u003eAi140\u003c/em\u003e mice (JAX# 030220, purchased from The Jackson Lab) were used in all experiments. Mice were housed at a stable temperature (23\u0026ndash;25\u0026deg;C) on a constant 12 h light/dark cycle with ad libitum access to standard food and sterile water. All animal procedures in this study were approved by the Ethics Committee of West China Hospital of Stomatology Sichuan University (NO: WCHSIRB-AT-2025-530).\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eUnilateral Anterior Crossbite (UAC) Model\u003c/h3\u003e\n\u003cp\u003eThe UAC model is an established modeling approach for inducing TMD(34, 35). Mice were randomly assigned to the UAC group and the control (CTL) group. To establish the UAC model, metal tubes were bonded to the right mandibular incisors of mice under isoflurane anesthesia. The metal tubes, fabricated from syringe needles, were curved to form 135\u0026deg; labially inclined occlusal plates. (Fig. \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003e) After drying the tooth surface, glass ionomer cement was applied for fixation. Excess adhesive material was carefully removed after curing. Daily inspections were conducted to confirm the retention of metal tubes (36). For the control group, the mice went through similar procedures without bonding the metal tubes. Under conditions of unrestricted access to food and water, no significant alteration in body weight was observed in the modeled mice (Fig. S2, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e\n\u003ch3\u003eForced Swimming Test (FST)\u003c/h3\u003e\n\u003cp\u003eThe FST is a widely used behavioral assay designed to evaluate depression-like states and antidepressant efficacy in rodent models (37). Mice were gently placed into a transparent glass cylinder (height: 300 mm, diameter: 110 mm) containing water at a depth of 200 mm, maintained at 22\u0026ndash;25\u0026deg;C, under bright lighting conditions. Mouse behavior was recorded for 6 min, and immobility was defined as the cessation of all movement except for the minimal motions required to keep the head above the water (38, 39). In chemogenetic experiments, behavioral testing was initiated 30 min after intraperitoneal injection of either Clozapine N-oxide (CNO) or normal saline (NS).\u003c/p\u003e\n\u003ch3\u003eSucrose Preference Test (SPT)\u003c/h3\u003e\n\u003cp\u003eThe SPT is a core behavioral assay for assessing anhedonia in rodents by measuring the relative preference for a sucrose solution over plain water (40). Prior to the experiment, all mice underwent a 48-h pre-adaptation period with two-bottle access, receiving both 1% sucrose solution and plain water throughout. The positions of the two bottles were switched every 24 h. This was followed by a 24-h period of water deprivation. During the formal test, each mouse was individually housed and simultaneously provided with pre-weighed bottles containing sucrose solution and plain water. The test lasted for 6 h, with the positions of the two bottles being switched every 2 h. The sucrose preference index (%) was determined based on the percentage of sucrose intake relative to total liquid consumption (41).\u003c/p\u003e\n\u003ch3\u003eOpen Field Test (OFT)\u003c/h3\u003e\n\u003cp\u003eThe OFT, an established and widely used method for assessing depression-like behaviors in rodents (39, 42), was performed at baseline (BL), 7 days, and 10 days post-modeling to assess behavioral changes. At least 1 h before behavioral tests, mice were transported to the testing room to acclimatize to environmental changes. During the experiment, each mouse was placed in a rectangular arena (500 mm \u0026times; 500 mm \u0026times; 350 mm) and allowed to freely explore. The arena was divided into a center zone (250 mm \u0026times; 250 mm) and an edge zone. The movement trajectories of mice were recorded for 5 min using EthoVision XT software, which quantified the center cumulative duration as an indicator of depressive phenotypes (43, 44). The arena was thoroughly cleaned with 75% ethanol between trials to eliminate residual odors.\u003c/p\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003eMicro-Computed Tomography (Micro-CT)\u003c/h2\u003e\n \u003cp\u003eTo examine morphological alterations in the temporomandibular joints (TMJ) of the UAC and the CTL group mice post-modeling, mice were perfused intracardially with 4% paraformaldehyde (PFA) under deep anesthesia. TMJs were dissected intact and fixed in 4% PFA at 4\u0026deg;C for 48 h. Fixed TMJs for micro-CT were rinsed in PBS and stored in 75% ethanol at 4\u0026deg;C until scanning. TMJs were scanned using a \u0026micro;CT45 micro-CT system (Scanco Medical AG, Switzerland). Following three-dimensional (3D) reconstruction of the condylar process with imaging software (IPL/HPM, Scanco Medical), morphometric analyses were performed to quantify the bone volume/tissue volume (BV/TV, %) and trabecular thickness (Tb.Th, \u0026micro;m).\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eHematoxylin-Eosin (HE) Staining\u003c/h3\u003e\n\u003cp\u003eTo evaluate histological changes in the TMJ tissues of the UAC and the CTL group, TMJ tissues were decalcified in 10% EDTA (pH 7.4) for 30 days, with daily solution replacement. Decalcified tissues underwent graded ethanol dehydration, xylene clearing, and paraffin embedding. Serial sections (10 \u0026micro;m thickness) were cut using a rotary microtome (Leica, Germany). For HE staining, tissue sections were deparaffinized and rehydrated through a graded ethanol series, followed by immersion in hematoxylin solution for 3 min and rinsing under running tap water for 3 min to remove residual stain. Subsequently, sections were counterstained with eosin solution for 30 s, briefly rinsed with tap water for 5 s, air-dried in a fume hood, cleared in xylene, and mounted with neutral resin. Digitized images were acquired using a slide scanning system (Olympus SLIDEVIEW VS200, Japan) for morphological analysis.\u003c/p\u003e\n\u003ch3\u003eTartrate-Resistant Acid Phosphatase (TRAP) Staining\u003c/h3\u003e\n\u003cp\u003eTRAP staining was performed to visualize osteoclasts within the TMJ tissues in both groups (45, 46). Deparaffinized sections were processed through hydration and incubated with freshly prepared TRAP staining solution (Sigma-Aldrich TRAP kit) in a light-protected humidified chamber at 37\u0026deg;C for 1 h. After three 3-min washes with distilled water, nuclei were counterstained with hematoxylin for 50 s, rinsed with tap water for bluing, air-dried, cleared in xylene, and resin-mounted. TRAP-positive osteoclasts and tissue architecture were analyzed using the same slide scanning system (Olympus SLIDEVIEW VS200, Japan).\u003c/p\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003eReverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR)\u003c/h2\u003e\n \u003cp\u003eThe mRNA levels of DRD2 and LEPR in mice and mouse hippocampal neuronal cell line (HT) 22 were quantified using RT-qPCR. Mice were anesthetized and then decapitated at designated time points to collect HPC tissues. Cultured HT22 cells were harvested following experimental treatments. Total RNA was extracted from HPC tissues and HT22 cells using RNA Extraction Kit (Takara, Beijing, China). cDNA was synthesized with the PrimeScript\u0026trade; Fast RT reagent kit (Takara, Beijing, China). The primers (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e) were purchased from TsingkeBiotechnologyCo., Ltd. The RT-qPCR reaction mixture (total volume: 10 \u0026micro;L) underwent initial incubation at 95\u0026deg;C for 30 s, followed by 40 cycles of 5 s at 95\u0026deg;C, 31 s at 60\u0026deg;C, using a CFX Opus 96 RT-qPCR system (Bio-Rad, USA). All results were normalized to the housekeeping gene GAPDH values. Relative expression was calculated using the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;\u003c/sup\u003eCt method.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eDetails of primer sequences used for RT-qPCR.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eSequence 5\u0026rsquo;-3\u0026rsquo;\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eDRD2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACCTGTCCTGGTACGATGATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCATGGCATAGTAGTTGTAGTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eLEPR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGGTCCCAGCAGCTATGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACCCAGAGAAGTTAGCACTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eGADPH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCACAGTCAAGGCTGAGAATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATGGTGGTGAAGACGCCAGTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eWestern Blot (WB) Assay\u003c/h2\u003e\n \u003cp\u003eWB analysis was performed to quantify protein expression levels of DRD2 and LEPR in the HPC, as well as DRD2, LEPR, NF-\u0026kappa;B, and phospho-NF-\u0026kappa;B (p-NF-\u0026kappa;B) in HT22 cells. Following tissue homogenization and centrifugation, protein concentrations were determined using a BCA assay. Equal amounts of protein lysates were resolved by 10% SDS-PAGE and electrophoretically transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, USA). Membranes were blocked with skim milk powder (concentration 2.5\u0026ndash;5% w/v) for 60 min, then incubated overnight at 4\u0026deg;C with primary antibodies (Table\u0026nbsp;2). Membranes were washed in TBST and then incubated with HRP-conjugated secondary antibodies (goat anti-rabbit IgG, BA1054; 1:5000, Boster, Wuhan, China) at room temperature (RT) for 2 h. Immunoreactive bands were visualized using the ECL reagent (Millipore, USA) and imaged with a GelView 1500Plus imaging system (BLT, China). Band optical density ratios were quantified using ImageJ software and normalized to endogenous controls GAPDH and \u0026alpha;-tubulin.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eIF Assays\u003c/h2\u003e\n \u003cp\u003eIF testing was performed to examine the spatial localization of DRD2, LEPR, and NeuN in the HPC of mice, as well as tyrosine hydroxylase (TH), DAT and microtubule\u0026ndash;associated protein 2 (MAP2) in both the SpVc and HPC. Under deep anesthesia of isoflurane, mice were perfused intracardially with 4% paraformaldehyde. The SpVc and HPC tissues were dissected, post-fixed in 4% PFA at 4\u0026deg;C for 8 h, and incubated in 30% sucrose (w/v) at 4\u0026deg;C until complete infiltration (24\u0026ndash;48 h). Tissues were embedded in Tissue-Tek O.C.T. compound (Sakura Finetek, Japan) and stored at \u0026minus;\u0026thinsp;20\u0026deg;C prior to sectioning. The sections of tissues were prepared in 10 \u0026micro;m on a cryostat microtome (Leica, Germany). Sections underwent permeabilization with 0.25% Triton X-100 (Solarbio, China) in PBS for 15 min at RT, followed by blocking in 10% normal goat serum (Solarbio, China) diluted in PBS for 30 min at RT. Primary antibodies (see Table\u0026nbsp;2 for details) were applied and incubated overnight at 4\u0026deg;C. Sections were washed by PBS and subsequently incubated with the following secondary antibodies (Alexa Fluor\u0026reg; 594 and Alexa Fluor\u0026reg; 488, goat anti-rabbit or anti-mouse, 1:400; Abcam, Cambridge, UK, and donkey-anti-guinea pig IgG, AF594, 1:500; Asis Biofarm, China) at 37\u0026deg;C for 1 h. Nuclei were stained with 4\u0026prime;,6-diamidino-2-phenylindole (DAPI, 1:1000; Beyotime, China) for 5 min at RT. The slides were sealed with the anti-fluorescent quencher (Solarbio, Beijing, China). Images were acquired using a confocal laser scanning microscope system (Olympus FV3000, Japan).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003eVirus Injection and Chemogenetic Manipulation\u003c/h2\u003e\n \u003cp\u003eBefore surgery, the mice were fixed in a stereotactic frame (RWD) under isoflurane anesthesia. A heating pad was used to maintain the core body temperature of mice at 36\u0026deg;C. The virus was injected using calibrated glass microelectrodes connected to an infusion pump (micro 4, WPI) at a rate of 30 nL/min. The coordinates were defined as dorso-ventral (DV) from the brain surface, anterior-posterior (AP) from bregma, and medio-lateral (ML) from the midline (in mm).\u003c/p\u003e\n \u003cp\u003eFor anterograde tracing of the SpVc-HPC pathway, adeno-associated virus serotype 2/1 \u003cem\u003eAAV2/1-hSyn-double-floxed inverse orientation (DIO)-EGFP\u003c/em\u003e (XUANZUN Bioscience, China; 1 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e TU/mL) was injected into the right SpVc (AP: 8.00-8.50 mm, ML: 1.80\u0026thinsp;~\u0026thinsp;2.00 mm, DV: 3.50 mm; 1 \u0026micro;L; Fig. S3) of \u003cem\u003eDAT-Cre\u003c/em\u003e mice. \u003cem\u003eAAV2/1-hSyn-Cre\u003c/em\u003e, provided by the Vector Engineering Core of CIBR (Beijing, China), was injected into the right SpVc of \u003cem\u003eAi140\u003c/em\u003e mice to further comfirm the pathway. For overexpression in the HPC, adeno-associated virus serotype 2/9 (AAV2/9) vectors expressing DRD2 (\u003cem\u003eAAV2/9-CMV-DRD2-EGFP\u003c/em\u003e) or LEPR (\u003cem\u003eAAV2/9-CMV-LEPR-EGFP\u003c/em\u003e, XUANZUN Bioscience, China; 1 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e TU/mL) were delivered into the right HPC (AP: \u0026minus;1.80~-2.50 mm, ML: 2.00 mm, DV: 1.50\u0026thinsp;~\u0026thinsp;2.00 mm; 1\u0026micro;L; Fig. S4) under identical surgical conditions. Viral expression was validated 21 days later via fluorescence microscopy (Olympus FV3000, Japan).\u003c/p\u003e\n \u003cp\u003eChemogenetic manipulation was conducted by injecting either inhibitory \u003cem\u003eAAV2/1-hSyn-DIO-hM4Di-EGFP\u003c/em\u003e or excitatory \u003cem\u003eAAV2/1-hSyn-DIO-hM3Dq-EGFP\u003c/em\u003e into the right SpVc of \u003cem\u003eDAT-Cre\u003c/em\u003e mice, while the CTL group received \u003cem\u003eAAV2/1-hSyn-DIO-EGFP\u003c/em\u003e (XUANZUN Bioscience, China; 1 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e TU/mL; 1 \u0026micro;L). After a 21-day recovery period to permit viral expression, mice underwent behavior tests 30 min following intraperitoneal administration of CNO (3 mg/kg in NS with 5% DMSO) or NS vehicle.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003eTissue Clearing\u003c/h2\u003e\n \u003cp\u003eTo comprehensively validate the SpVc\u0026mdash;HPC neural pathway, we implemented whole-brain tissue clearing on \u003cem\u003eAi140\u003c/em\u003e transgenic mice, which presented EGFP fluorescence when exposed to Cre recombinase (47). Mice were stereotaxically injected with \u003cem\u003eAAV2/1-hSyn-Cre\u003c/em\u003e into the SpVc under anesthesia. 21 days post-injection, transcardial perfusion with 4% paraformaldehyde (PFA) was performed, followed by dissection of intact brains and medulla oblongata. Tissues were post-fixed in 4% PFA at 4\u0026deg;C overnight and rinsed in PBS (3 \u0026times; 30 min). Subsequent tissue clearing was processed following our previous protocol (47, 48). Decolorization was performed with 25% (w/v) Quadrol (Sigma-Aldrich, 122262) at 37\u0026deg;C with gentle shaking. Afterwards, samples were processed with gradient tert-butanol (tB, Sigma‐Aldrich, 471712) solutions (30% for 4 h, 50% for 6 h, 70% for 12 h) on a shaker at 37\u0026deg;C, followed by tB-Q (70% v/v tB and 30% w/v Quadrol) dehydration treatment for 1 day. For final clearing and sample preservation, we immersed tissues in the BB-BED clearing medium (47% v/v Benzyl Benzoate\u0026thinsp;+\u0026thinsp;48% v/v BED468\u0026thinsp;+\u0026thinsp;5% w/v Quadrol) in a 37\u0026deg;C shaker for 1 day until final transparency was achieved. 3D fluorescence images of the cleared tissues were acquired using a Nuohai LS 18 Tiling Light Sheet Microscope (Nuohai Life Science (Shanghai) Co., Ltd, laser lines: 561, 637mm). Samples were illuminated with a 4-tile tiling light sheet (49), and fluorescence signals were captured through a 1\u0026times;/0.25NA objective (Olympus MVPLAPO). Imaging was performed at 4\u0026times; magnification, yielding a spatial resolution of approximately 3.3\u0026times;3.3\u0026times;7 \u0026micro;m\u0026sup3; under the selected conditions. The collected images were processed with the LS 18 ImageCombine software (Nuohai Life Science (Shanghai) Co., Ltd) and rendered using Amira (Thermo Fisher Scientific, USA).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003eHT22 Culture and Treatments\u003c/h2\u003e\n \u003cp\u003eMouse hippocampal HT22 neuronal cells (Millipore, #SCC129) were cultured in Dulbecco\u0026rsquo;s Modified Eagle Medium (DMEM; Gibco, #11995065) supplemented with 10% fetal bovine serum (FBS; Gibco, #10099141) and 1% penicillin/streptomycin (Gibco, #15140122). Cells were maintained at 37\u0026deg;C in a humidified 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere and passaged 3 times a week.\u003c/p\u003e\n \u003cp\u003eTo inhibit DRD2 \u003cem\u003ein vitro\u003c/em\u003e, four small interfering RNAs (siRNAs) targeting mouse DRD2 (si\u003cem\u003eDRD2\u003c/em\u003e-371, -554, -759, -1529), siFAM, and si\u003cem\u003eCTL\u003c/em\u003e were synthesized by (GenePharma, Beijing, China). siRNA sequences are provided in Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e. HT22 cells were seeded in plates and transfected with 30 nM siRNA using siRNA mate plus (GenePharma, Beijing, China). Drd2 mRNA levels were quantified by RT-qPCR at 48 h post-transfection to determine the optimal siRNA sequences.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003cdiv align=\"left\" class=\"colspec\"\u003e\u003cbr\u003e\u003c/div\u003e\n \u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eDetails of antibodies used for WB and IF\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eName\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eProduct Code\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHost\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDilution\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCompany\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDRD2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDF10211\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000 (WB)\u003c/p\u003e\n \u003cp\u003e1:100 (IF)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAffinity, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLEPR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e#49554\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000 (WB)\u003c/p\u003e\n \u003cp\u003e1:100 (IF)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSignalway Antibody, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNeuN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eab104224\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:150(IF)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAbcam, Cambridge, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePhospho-NF-\u0026kappa;B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eET1604-27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000 (WB)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHUABIO, Hangzhou, China\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNF-\u0026kappa;B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e80979\u0026ndash;1-RR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:2000 (WB)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eProteintech, China\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePhospho-PKC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eET1702-17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000 (WB)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHUABIO, Hangzhou, China\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePKC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eET1608-15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000 (WB)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHUABIO, Hangzhou, China\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e#53432\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:100 (IF)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSignalway Antibody, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e#HA601476\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:200 (IF)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHUABIO, Hangzhou, China\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMAP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eab254144\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:50 (IF)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAbcam, Cambridge, UK\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMAP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eOB-PGP079\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGuinea Pig\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:500(IF)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAsis Biofarm, China\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGADPH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eET1601-4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:5000 (WB)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHUABIO, Hangzhou, China\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026alpha;-tubulin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11224\u0026ndash;1-AP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRabbit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:5000 (WB)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eProteintech, China\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003eTable 3: siRNA sequence\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Taba\" border=\"1\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003esiRNA\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence 5\u0026rsquo;-3\u0026rsquo;\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003esi\u003cem\u003eDRD2\u003c/em\u003e-371\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCUGGUACGAUGAUGAUCUTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003esi\u003cem\u003eDRD2\u003c/em\u003e-554\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCACCAACUACCUGAUAGUTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003esi\u003cem\u003eDRD2\u003c/em\u003e-759\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCCAUGCCUAUGUUGUAUTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003esi\u003cem\u003eDRD2\u003c/em\u003e-1529\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGCACAUCCUGAAUAUACATT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003esi\u003cem\u003eCTL\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUUCUCCGAACGUGUCACGUTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eNotes: DRD2, dopamine receptor D2; CTL: control\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003eTo overexpress DRD2 \u003cem\u003ein vitro\u003c/em\u003e, Lentivirus (LV) carrying mouse DRD2 under a CMV promoter (\u003cem\u003eLV-DRD2\u003c/em\u003e) and empty vector controls (\u003cem\u003eLV-CTL\u003c/em\u003e) were purchased from XUANZUN Bioscience, China. HT22 cells were seeded and transduced with \u003cem\u003eLV-DRD2\u003c/em\u003e at multiplicities of infection (MOIs). After 48 h, cell viability was assessed using a CCK-8 assay (APExBIO Technology, USA), and DRDD2 mRNA levels were quantified via RT-qPCR to determine the optimal MOI. Functional overexpression was validated by RT-qPCR and WB.\u003c/p\u003e\n \u003cp\u003eIn order to investigate the role of NF-kB signaling pathway in DRD2-induced LEPR overexpression, 30 min before transduction of LV, cells were treated with Verbascoside (VB, B3379, APExBIO Technology, USA), a dual PKC/NF-\u0026kappa;B inhibitor, at 25 \u0026micro;M diluted in dimethyl sulfoxide (DMSO, 0.5%), and DMSO (0.5%) in FBS-containing medium served as the LV-\u003cem\u003eDRD2\u003c/em\u003e\u0026thinsp;+\u0026thinsp;VB group and the LV-\u003cem\u003eDRD2\u003c/em\u003e\u0026thinsp;+\u0026thinsp;DMSO group.\u003c/p\u003e\n \u003cp\u003eSuccessful transfection of LV and siRNA was confirmed via a confocal laser scanning microscope system (Olympus FV3000, Japan) for mCherry expression and FAM-labeled siRNA fluorescence.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003eStatistical Analysis\u003c/h2\u003e\n \u003cp\u003eAll quantitative data are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Statistical analyses were performed using SPSS Statistics 25.0 (IBM, Version 25.0). Continuous variables were analyzed for between-group comparisons via the two-tailed unpaired Student\u0026rsquo;s t-test assuming equal variances. A threshold of \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was applied to determine statistical significance.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eUAC mice exhibited TMD and depressive behaviors\u003c/h2\u003e\u003cp\u003eTMJ samples were harvested for micro-CT analysis and histological staining at 10 days after modeling (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Micro-CT reconstruction revealed significant alterations in TMJ morphology in the UAC group, including decreased BV/TV ratio (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and reduced Tb.Th (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) compared to the CTL group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-E). Meanwhile, histological evaluation on HE staining of TMJ sections revealed osteoarthritic pathology in the UAC group, including decreased chondrocyte density with disorganized cellular arrangement, subchondral bone degradation, and enhanced inflammatory cell infiltration (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF, green arrow). TRAP staining further confirmed elevated osteoclast activity in the UAC group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF, black arrows). These alterations from micro-CT and histology confirmed the successful induction of TMJ osteoarthritis, which represents a principal subtype of TMD.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eFST results showed that the CTL group maintained stable immobile time at BL, day 7, and 10, whereas the UAC group exhibited a significant increase in immobile time (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). In the sucrose preference test, the CTL group showed a consistent preference level across all time points. Conversely, the UAC group demonstrated significant reductions in sucrose preference at both day 7 and 10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 at day 7; \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 at day 10). OFT results of the CTL group exhibited consistent central zone cumulative duration at BL, day 7, and 10. In contrast, the UAC group displayed progressive reductions at day 7 and 10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eI-J, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Female mice also exhibited analogous alterations in these tests (Fig. S5-7). These marked alterations in behavior tests suggested the emergence of depression in the UAC group.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eSpVc-HPC dopaminergic pathway regulated depression-like behaviors in UAC mice\u003c/h2\u003e\u003cp\u003eCo-localization of TH (a catecholaminergic neuron marker) and DAT with MAP2 (a pan-neuronal marker) (Fig. S8-S11, white arrows), as well as co-localization of TH with DAT (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-B, white arrows), was observed in the SpVc and HPC, respectively. This confirmed the existence of dopaminergic neurons in these two brain regions. \u003cem\u003eAAV2/1-hSyn-DIO-EGFP\u003c/em\u003e was stereotaxically injected into the SpVc of \u003cem\u003eDAT-Cre\u003c/em\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-D). EGFP expression in the SpVc confirmed accurate targeting and local dopaminergic neuron transfection, while EGFP in the HPC provided direct anatomical evidence of functional SpVc-HPC connectivity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eE).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eSimilarly, \u003cem\u003eAAV2/1-hSyn-Cre\u003c/em\u003e was stereotaxically injected into the SpVc of \u003cem\u003eAi140\u003c/em\u003e mice, and tissues were harvested for IF staining and tissue clearing analysis 21 days post-injection (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eF-G). Co-localization of DAPI and EGFP confirmed successful viral transduction and revealed anterograde projections from SpVc to HPC (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eH, white arrows). Tissue-cleared whole-mount imaging further validated this connectivity, with EGFP⁺ fluorescence visibly spanning SpVc and HPC regions (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eI, white arrows). Collectively, viral anterograde tracing in \u003cem\u003eDAT-Cre\u003c/em\u003e and \u003cem\u003eAi140\u003c/em\u003e mice, coupled with multimodal visualization via IF and tissue clearing, substantiated the existence of the SpVc-HPC neural pathway.\u003c/p\u003e\u003cp\u003eTo further investigate the regulatory role of this neural pathway, \u003cem\u003eDAT-Cre\u003c/em\u003e mice received stereotaxic injections of \u003cem\u003eAAV2/1-hSyn-DIO-hM4Di-EGFP\u003c/em\u003e into the SpVc, followed by behavior tests 30 min after i.p. injection of CNO or NS at 21 days post-injection (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ-K). In all three tests, both the AAV2/1-hM4Di-injected and control virus-injected groups exhibited no significant changes under pre-injection condition and after NS administration (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Similarly, the control virus group showed no behavioral changes across pre-injection, NS, or CNO conditions (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Strikingly, hM4Di-injected mice exhibited significantly increased immobile time and decreased sucrose preference after CNO activation compared to pre-injection (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), NS (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and CNO-treated control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eL-M). Similarly, hM4Di-injected mice displayed significantly reduced center cumulation duration after CNO activation compared to pre-injection (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), NS (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and CNO-treated control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eN-O). In parallel experiments, \u003cem\u003eDAT-Cre\u003c/em\u003e mice, injected with \u003cem\u003eAAV2/1-hSyn-DIO-hM3Dq-EGFP\u003c/em\u003e, underwent UAC modeling at day 11 and behavior tests at day 21 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eP-Q). In all tests, both AAV2/1-hM3Dq and control virus groups remained comparable at pre-injection and NS conditions (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). No significant differences were observed in the control group across pre-injection, NS, and CNO conditions (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). CNO administration reversed UAC-induced depressive-like behaviors, as evidenced by less immobile time and higher sucrose preference compared to the pre-injection (Pre, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), NS (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and CNO-treated control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eR-S). Restored central cumulative duration in hM3Dq-injected mice compared to the pre-injection (Pre, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), NS (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and CNO-treated control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) also indicated the improvement of depressive-like behaviors after CNO injection (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eT-U).\u003c/p\u003e\u003cp\u003eThe current study identified a potential dopaminergic pathway from the SpVc to the HPC and demonstrated its functional involvement in regulating depression in UAC mice.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eThe reduced DRD2 in the HPC regulated depression-like behaviors in UAC mice\u003c/h2\u003e\u003cp\u003eTo investigate molecular alterations in the HPC, tissues from both experimental groups were subjected to RT-qPCR and WB analyses on post-modeling day 10. RT-qPCR revealed significantly lower DRD2 mRNA levels in the male UAC group compared to the CTL group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, P\u0026thinsp;\u003cem\u003e\u0026lt;\u003c/em\u003e\u0026thinsp;0.001), with no sex-specific differences observed (Fig. S12, \u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.001). WB results further corroborated the transcriptional changes, demonstrating decreased DRD2 protein expression in the UAC group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eB-C, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). IF results demonstrated the co-localization of DRD2 with NeuN (a neuronal marker), suggesting that DRD2 was predominantly expressed in hippocampal neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eD, white arrows). Collectively, these results demonstrated that DRD2 was mainly expressed in hippocampal neurons, and was downregulated in UAC mice correlating with behavioral alterations, which suggested that this receptor might play a crucial role in regulating TMD-related depression.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo further validate the functional role of DRD2 \u003cem\u003ein vivo\u003c/em\u003e, AAV2/9 overexpressing DRD2 was stereotaxically injected into the HPC. UAC modeling was initiated at post-injection day 11, followed by protein extraction for WB and behavior tests at day 21 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eE-F). EGFP and DAPI fluorescence in the HPC confirmed successful viral transduction (Fig. S13, white arrows). WB analysis revealed that DRD2-overexpressing vectors significantly elevated DRD2 protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eG-H, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). FST results demonstrated a significant reduction in immobile time in DRD2-overexpression group relative to the controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eI, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Similarly, SPT showed a markedly higher sucrose preference in the overexpression group compared to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eJ, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). OFT results demonstrated that DRD2-overexpressing groups exhibited increased center cumulative duration compared to the CTL group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eK-L, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003eThe downregulated LEPR in the HPC mediated depression-like behaviors in UAC mice\u003c/h2\u003e\u003cp\u003eAlteration of hippocampal LEPR gene expression was also validated. RT-qPCR showed significantly lower LEPR mRNA levels in the male UAC group compared to the CTL group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001), with no sex-specific differences observed (Fig. S14, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). WB results confirmed these transcriptional changes, showing reduced LEPR protein expression in the UAC group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eB-C, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). IF analysis demonstrated co-localization of LEPR with NeuN, indicating predominant neuronal expression of LEPR in the HPC (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eD, white arrows). Collectively, these findings established that LEPR was primarily expressed in hippocampal neurons and exhibited downregulation in UAC mice, correlating with behavioral deficits.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo further investigate the functional role of LEPR \u003cem\u003ein vivo\u003c/em\u003e, AAV2/9 overexpressing LEPR was stereotaxically delivered to HPC. UAC modeling commenced on post-injection day 11, followed by protein extraction and behavioral assessments at day 21 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eE-F). WB quantification demonstrated that LEPR-overexpressing vectors significantly increased LEPR protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eG-H, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). FST results indicated that LEPR-overexpressing group displayed less immobile time compared to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eI, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and SPT revealed that LEPR-overexpression group exhibited a significant increase in sucrose preference (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). OFT results showed that LEPR-overexpressing mice displayed prolonged central cumulative duration compared to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eK-L, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e\u003cp\u003e\u003cb\u003eDRD2 regulated the expression of LEPR\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo elucidate the functional interplay between DRD2 and LEPR, both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e experiments were implemented. WB analysis revealed that DRD2-overexpressing vectors significantly increased LEPR protein levels \u003cem\u003ein vivo\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-B, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e\u003cp\u003eTo validate the DRD2-LEPR axis \u003cem\u003ein vitro\u003c/em\u003e, siRNA-mediated DRD2 knockdown and LV-mediated DRD2 overexpression were conducted in HT22 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-D). Successful siRNA transfection was validated by FAM-labeled siRNA fluorescence (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e5\u003c/span\u003eE), LV transduction was verified by mCherry fluorescence as well (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e5\u003c/span\u003eF).\u003c/p\u003e\u003cp\u003eFour candidate siRNA sequences were designed and screened, and RT-qPCR analysis at 48 h post-transfection identified si\u003cem\u003eDRD2\u003c/em\u003e-554 as the most effective one (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e5\u003c/span\u003eG, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). RT-qPCR results demonstrated that the si\u003cem\u003eDRD2\u003c/em\u003e group exhibited decreased DRD2 mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e5\u003c/span\u003eH, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and reduced LEPR mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e5\u003c/span\u003eI, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) compared to the si\u003cem\u003eCTL\u003c/em\u003e group. WB results corroborated these changes at the protein level (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e5\u003c/span\u003eJ-M, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001 for DRD2 and \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 for LEPR). These results revealed that downregulation of DRD2 inhibited LEPR expression.\u003c/p\u003e\u003cp\u003eHT22 cells were transfected with LV to overexpress DRD2 at varying multiplicities of infection (MOIs) for 48 h. RT-qPCR analysis of DRD2 mRNA levels and CCK-8 viability assays identified an optimal MOI of 5 for subsequent experiments (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e5\u003c/span\u003eN and Fig. S15). RT-qPCR demonstrated that the LV-\u003cem\u003eDRD2\u003c/em\u003e group exhibited significantly elevated DRD2 mRNA levels and concomitant LEPR mRNA upregulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e5\u003c/span\u003eO-P, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). WB results also corroborated these findings at the protein level (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e5\u003c/span\u003eQ-T, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). These data indicated that DRD2 overexpression induced LEPR upregulation.\u003c/p\u003e\u003cp\u003eThe bidirectional correlation between DRD2 manipulation (overexpression/knockdown) and LEPR expression established a causal regulatory cascade within hippocampal neurons.\u003c/p\u003e\u003cp\u003e\u003cb\u003eNF-κB signal pathway participated in the mediation of DRD2 on LEPR\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo elucidate the regulatory axis between DRD2 and LEPR, pathway-specific inhibitors were administered 30 min before transduction of LV (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). RT-qPCR results revealed that VB, a dual PKC/NF-κB inhibitor, significantly attenuated LEPR mRNA elevation in transfected cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e6\u003c/span\u003eB and Fig. S16, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). WB results confirmed the downregulation of LEPR after VB treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e6\u003c/span\u003eC-D, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e\u003cp\u003eThe mechanism investigation demonstrated that VB selectively suppressed NF-κB phosphorylation without affecting PKC activation. P-NF-κB levels in LV-\u003cem\u003eDRD2\u003c/em\u003e\u0026thinsp;+\u0026thinsp;VB group were reduced significantly compared to LV-\u003cem\u003eDRD2\u003c/em\u003e\u0026thinsp;+\u0026thinsp;DMSO group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e6\u003c/span\u003eE-F, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001), while p-PKC/total PKC ratios remained unperturbed (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e6\u003c/span\u003eG-H, P\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003eMoreover, p-NF-κB levels in the si\u003cem\u003eDRD2\u003c/em\u003e group were lower than in the si\u003cem\u003eCTL\u003c/em\u003e group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e6\u003c/span\u003eI-J, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). The LV-DRD2 group increased p-NF-κB levels significantly compared to the LV-\u003cem\u003eCTL\u003c/em\u003e group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e6\u003c/span\u003eK-L, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). These findings implicated NF-κB phosphorylation as the predominant pathway mediating DRD2-driven LEPR alteration.\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe prevalence rate of TMD varies widely, affecting 4%-10% of adults with pain or dysfunction-related symptoms (50). Some studies report that up to 15% of adults may be impacted by TMD (51). TMD patients frequently present with facial pain, TMJ discomfort, or masticatory muscle pain, accompanied by restricted mouth opening, mandibular deviation during movement, joint clicking, and associated symptoms such as headaches or tinnitus. These manifestations severely impair essential functions, including mastication, speech, and sleep, significantly reducing patients' quality of life (52, 53). The pathogenesis of TMD involves multifactorial interactions, including biomechanical factors, inflammatory and immune responses, sex and genetic predisposition, as well as psychological and neurological components (54, 55). Various methods exist for establishing TMD animal models, such as surgical disc displacement or resection, intra-articular injections of inflammatory mediators, and unilateral occlusal interference (56, 57). In this study, the TMD mouse model was established by bonding a metal tube to unilateral lower incisors to induce anterior crossbite malocclusion, thereby creating occlusal dysfunction. Post-modeling histological and morphological analyses confirmed successful disease induction. Behavioral assessments further revealed that modeled mice exhibited depression. Although previous studies have reported that UAC modeling reduced feeding frequency in mice, but increased feeding duration, and body weight changes were not documented. In our experiment, body weight tracking revealed no significant reduction in the UAC mice, thereby ruling out the confounding effect of weight change on the behavioral test results (58).\u003c/p\u003e\u003cp\u003eTMD-related depression exhibits a high prevalence rate, which may reciprocally exacerbate TMD symptoms, compromise therapeutic efficacy, and profoundly impair both physical and mental health (3, 59). The underlying mechanisms primarily involve neurotransmitter dysregulation (60), sex hormone modulation (61), bidirectional pain-emotion interplay (3), and structural brain alterations, among other factors (62). This study elucidated a novel neurobiological mechanism underlying the comorbidity of TMD and depression, centered on the dopaminergic SpVc-HPC pathway and its downstream DRD2-NF-κB-LEPR signaling axis.\u003c/p\u003e\u003cp\u003eSpVc serves as the primary relay station for orofacial nociceptive signals, responsible for transmitting pain information from the trigeminal nerve to higher centers such as the thalamus (63, 64). As a pivotal component of the pain-processing pathway, under inflammatory conditions, SpVc neurons exhibit hyperexcitability characterized by increased spontaneous firing and reduced mechanical thresholds. Pharmacological interventions can reverse these alterations, demonstrating the critical role of SpVc in neural plasticity underlying chronic pain (65, 66). The HPC, a key brain region intricately involved in learning, memory, and emotional regulation, continuously generates newborn neurons and maintains synaptic plasticity through BDNF/cAMP-response element binding protein (CREB) signaling pathways. Animal studies reveal that chronic stress induces reduced dendritic complexity in hippocampal granule cells and aberrant synaptophysin expression, with such structural plasticity impairments directly correlating with depression-like behaviors (67, 68). Simultaneously, as a central regulator of the hypothalamic-pituitary-adrenal (HPA) axis, the HPC suppresses excessive stress responses via glucocorticoid receptors (GR). Impaired GR function observed in depression is associated with abnormal phosphorylation of glycogen synthase inase 3β (GSK3β), leading to dysregulated stress responses (69). Hippocampal volume reduction (averaging 8\u0026ndash;10%) is prevalent in depressed patients. Notably, anterior hippocampal atrophy shows stronger associations with emotional symptoms, whereas posterior volume loss correlates with cognitive deficits (70, 71). Fat mass and obesity (FTO) gene-mediated dysregulation of RNA methylation contributes to hippocampal neuronal dysfunction, and restoring FTO expression in animal models reverses depression-like phenotypes (72). Endoplasmic reticulum stress-induced overproduction of superoxide anion (O⁻) in the HPC constitutes a molecular trigger mechanism for depressive pathogenesis (73).\u003c/p\u003e\u003cp\u003eDopaminergic neural pathways are primarily categorized into three major systems: the mesolimbic pathway (MLP), mesocortical pathway (MCP), and nigrostriatal pathway (NSP) (74, 75). The mesolimbic pathway originates from the ventral tegmental area (VTA) and projects to limbic structures including the nucleus accumbens (NAc), amygdala, and HPC. This pathway regulates reward processing, motivation, and emotional valence, and is critically implicated in hedonic experiences (76, 77). Previous studies have revealed that dopaminergic neurons in the hypothalamic A11 nucleus project to the SpVc and, by activating the DRD2 pathway, significantly alleviate trigeminal neuropathic pain (78, 79). To investigate potential dopaminergic pathways from the SpVc to the HPC, we employed \u003cem\u003eDAT-Cre\u003c/em\u003e transgenic mice, utilizing the Cre-lox system to genetically label dopaminergic neurons. DAT, localized presynaptically on dopaminergic neurons, terminates dopaminergic signaling via extracellular dopamine reuptake, thereby regulating synaptic dopamine concentration and temporal dynamics (80, 81).In \u003cem\u003eDAT-Cre\u003c/em\u003e mice, the Cre recombinase gene is inserted into the DAT locus, enabling selective labeling or manipulation of dopaminergic neurons (81, 82). We stereotaxically injected AAV2/1 vectors carrying the DIO sequence and EGFP into the SpVc of \u003cem\u003eDAT-Cre\u003c/em\u003e mice, achieving Cre-dependent EGFP expression restricted to dopaminergic neurons. Robust EGFP fluorescence observed in SpVc confirmed successful viral transduction. AAV serotype 1 exhibits anterograde trans-synaptic trafficking capabilities (83\u0026ndash;85). Detection of EGFP\u0026thinsp;+\u0026thinsp;terminals in the HPC provided anatomical evidence supporting the existence of a SpVc-to-HPC dopaminergic pathway. To further validate the existence of this neural pathway, we employed \u003cem\u003eAi140\u003c/em\u003e transgenic mice combined with tissue-clearing technology for three-dimensional imaging. In \u003cem\u003eAi140\u003c/em\u003e mice, injection of \u003cem\u003eCre\u003c/em\u003e-dependent viral vectors induces EGFP fluorescence expression(47, 86, 87). Tissue-clearing methodology involves chemical or physical processing to render biological specimens optically transparent, enabling comprehensive 3D visualization. When integrated with viral tracing tools, this technique permits 3D reconstruction of neural circuits within intact tissues(88\u0026ndash;91). In this experiment, anterograde-tracing AAV2/1 were injected into the SpVc of \u003cem\u003eAi140\u003c/em\u003e mice. Building upon conventional immunofluorescence observations in tissue sections, tissue-clearing-based 3D imaging revealed continuous EGFP⁺ fluorescence spanning SpVc and HPC regions, thereby corroborating the SpVc-HPC connectivity.\u003c/p\u003e\u003cp\u003eDopaminergic insufficiency may underlie anhedonia, while enhancing dopamine transmission could alleviate such reward-processing deficits (92, 93). To validate the functional role of the SpVc-HPC dopaminergic pathway, we employed a combinatorial strategy integrating the Cre-lox system with chemogenetic viral vectors to achieve precise manipulation of dopaminergic circuitry. The hM3Dq activates Gq-coupled signaling to enhance neuronal excitability, whereas hM4Di engages Gi-mediated pathways to suppress neuronal activity (94, 95). Following intraperitoneal CNO administration and subsequent behavioral tests, we observed that chemogenetic inhibition of the SpVc-HPC dopaminergic pathway via hM4Di precipitated emotional disturbances. Conversely, post-modeling activation of this pathway using hM3Dq significantly ameliorated TMD-associated depression.\u003c/p\u003e\u003cp\u003eDRD2, a dopamine receptor, functions as a downstream component of neural circuits to regulate emotional processing. Reduced DRD2 expression in the HPC is strongly associated with depression-like behaviors. Studies demonstrate that upregulating hippocampal DRD2 protein levels (e.g., via fasting or pharmacological interventions) alleviates depressive phenotypes, whereas DRD2 antagonists antagonize such antidepressant effects (96). Emerging evidence indicates that DRD2 modulates astrocytic function via the β-arrestin2 signaling pathway. In chronic stress models, downregulated DRD2/β-arrestin2 signaling induces hippocampal neuroinflammation and synaptic dysfunction, while pathway activation rescues depression-like behaviors (21). In our modeled mice, we observed downregulated DRD2 expression in the HPC, consistent with these experimental findings.\u003c/p\u003e\u003cp\u003eCombining \u003cem\u003ein vitro\u003c/em\u003e approaches, we demonstrated that DRD2 overexpression upregulates LEPR expression via NF-κB phosphorylation, while DRD2 inhibition exerts the opposite effect, suggesting a potential regulatory role of DRD2 on LEPR. The association between hippocampal leptin/LEPR signaling and emotional disorders has been extensively characterized through multi-faceted investigations (31). Leptin enhances synaptic plasticity, the cellular cornerstone of learning, memory, and emotional regulation, by activating hippocampal LEPR. Animal experiments reveal that leptin deficiency or LEPR dysfunction induces hippocampal synaptic maldevelopment, impaired long-term potentiation, and comorbid depressive-like behaviors and cognitive deficits (97, 98). Leptin and LEPR are also critical for neurogenesis. Leptin rescues chronic stress- and glucocorticoid-induced suppression of hippocampal neurogenesis by activating the GSK-3β/β-catenin signaling pathway, thereby normalizing behavioral deficits (99). Furthermore, leptin/LEPR signaling modulates emotional states by regulating BDNF expression. Leptin administration elevates hippocampal BDNF mRNA levels, whereas leptin deficiency reduces BDNF expression, a phenomenon strongly linked to BDNF signaling impairment in depressive pathology (100). These findings delineate three plausible mechanisms underlying LEPR-mediated emotional dysregulation and explain the behavioral alterations observed following LEPR downregulation in our study, implicating LEPR deficiency in depression. Intrahippocampal injection of DRD2- and LEPR-overexpressing viruses activated the DRD2-NF-κB-LEPR signaling axis and ameliorated TMD-related depression in modeled mice, highlighting this pathway as a novel therapeutic target for TMD-associated affective comorbidities.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, under TMD conditions, the dopaminergic pathway from the SpVc to the HPC became functionally suppressed, downregulating the DRD2-NF-κB-LEPR signaling axis and contributing to the development of depression-like behaviors. This study elucidated critical mechanisms underlying TMD-associated depression and identified potential therapeutic targets for intervening in this pathological process.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003cp\u003eAll animal procedures in this study were approved by the Ethics Committee of West China Hospital of Stomatology Sichuan University (NO: WCHSIRB-AT-2025-530).\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003cp\u003eNot applicable.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003ch2\u003eCompeting interests\u003c/h2\u003e\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThis work was supported by the National Natural Science Foundation of China [Grant Numbers 82271014, 82501189, 82101059], Science and Technology Department of Sichuan Province [Grant Numbers 2024NSFSC1599, 2024NSFTD0027, 2025NSFSC2371, 2024NSFSC0683], and special financial aid to post-doctor research fellow of Sichuan province [Grant Number TB2024043]. The materials in graphics in this article were supported by Figdraw.\u003c/p\u003e\u003ch2\u003eAuthors' contributions\u003c/h2\u003e\u003cp\u003e\u003cb\u003eMuyun Wang\u003c/b\u003e: Writing\u0026ndash;original draft, Validation, Methodology, Investigation, Formal analysis, Conceptualization. \u003cb\u003eDexin Zhu\u003c/b\u003e: Validation, Methodology, Investigation, Formal analysis, Conceptualization. \u003cb\u003eYating Yi\u003c/b\u003e: Methodology, Investigation, Formal analysis, Funding acquisition, Conceptualization. \u003cb\u003eYueyan Cen\u003c/b\u003e: Validation, Investigation. \u003cb\u003eSuying Zhan\u003c/b\u003e: Visualization, Investigation. \u003cb\u003eLiu Fei\u003c/b\u003e: Methodology, Investigation. \u003cb\u003eQinxuan Song\u003c/b\u003e: Methodology, Investigation. \u003cb\u003eXinlin Gao\u003c/b\u003e: Investigation. \u003cb\u003eChunjie Li\u003c/b\u003e: Validation, Methodology. \u003cb\u003eCheng Zhou\u003c/b\u003e: Methodology, Conceptualization. \u003cb\u003eHang Wang\u003c/b\u003e: Funding acquisition, Conceptualization. \u003cb\u003eYanyan Zhang\u003c/b\u003e: Writing\u0026ndash;original draft, Validation, Methodology, Investigation, Formal analysis, Funding acquisition, Conceptualization. \u003cb\u003eJiefei Shen\u003c/b\u003e: Writing-review\u0026amp;editing, Supervision, Resources, Project administration, Funding acquisition, Conceptualization.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e\u003cp\u003eWe acknowledge all those who helped us with this research.\u003c/p\u003e\u003ch2\u003eAvailability of data and materials\u003c/h2\u003e\u003cp\u003eAll data generated or analysed during this study are included in this published article [and its supplementary information files].\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003e Vo\u0026szlig; LC, Basedau H, Svensson P, May A. Bruxism, temporomandibular disorders, and headache: a narrative review of correlations and causalities. Pain. 2024;165(11):2409-18.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Zhao R, Ye Z, Lv X, Li Z, Xiong X. Imaging Brain Networks: Insights into Mechanisms of Temporomandibular Disorders. J Dent Res. 2025;104(4):380-8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Wan J, Lin J, Zha T, Ciruela F, Jiang S, Wu Z, et al. Temporomandibular disorders and mental health: shared etiologies and treatment approaches. J Headache Pain. 2025;26(1):52.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Penlington C, Bowes C, Taylor G, Otemade AA, Waterhouse P, Durham J, Ohrbach R. Psychological therapies for temporomandibular disorders (TMDs). Cochrane Database Syst Rev. 2022;8(8):Cd013515.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Liou YJ, Bai YM, Tsai SJ, Chen TJ, Chen MH, Lo WL. Bidirectional Associations of Temporomandibular Joint Disorders with Major Depressive and Anxiety Disorders. J Evid Based Dent Pract. 2023;23(2):101860.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Yin Y, He S, He N, Zhang W, Luo L, Chen L, et al. Brain alterations in sensorimotor and emotional regions associated with temporomandibular disorders. Oral Dis. 2024;30(3):1367-78.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Cheng X, Li X, Chen J, Qin X, Kang K, Zhang T, et al. Assessing the causal role of the structural connectome in temporomandibular disorders: A Mendelian randomization study. Cranio. 2024:1\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Song QX, Zhang YY, Li YL, Liu F, Liu YJ, Li YK, et al. The crucial role of NR2A mediating the activation of satellite glial cells in the trigeminal ganglion contributes to orofacial inflammatory pain during TMJ inflammation. Neuropharmacology. 2024;261:110173.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Li YL, Zhang YY, Song QX, Liu F, Liu YJ, Li YK, et al. N-methyl-D-aspartate Receptor Subunits 2A and 2B Mediate Connexins and Pannexins in the Trigeminal Ganglion Involved in Orofacial Inflammatory Allodynia during Temporomandibular Joint Inflammation. Mol Neurobiol. 2025;62(1):1247-65.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Shi HJ, Wang S, Wang XP, Zhang RX, Zhu LJ. Hippocampus: Molecular, Cellular, and Circuit Features in Anxiety. Neurosci Bull. 2023;39(6):1009-26.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Pimpinella D, Mastrorilli V, Giorgi C, Coemans S, Lecca S, Lalive AL, et al. Septal cholinergic input to CA2 hippocampal region controls social novelty discrimination via nicotinic receptor-mediated disinhibition. Elife. 2021;10.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Shen Z, Fan C, Ding C, Xu M, Wu X, Wang Y, Xing T. Loss of Slc39a12 in hippocampal neurons is responsible for anxiety-like behavior caused by temporomandibular joint osteoarthritis. Heliyon. 2024;10(4):e26271.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Lv XJ, Lv SS, Wang GH, Chang Y, Cai YQ, Liu HZ, et al. Glia-derived adenosine in the ventral hippocampus drives pain-related anxiodepression in a mouse model resembling trigeminal neuralgia. Brain Behav Immun. 2024;117:224\u0026thinsp;\u0026minus;\u0026thinsp;41.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Chen LQ, Lv XJ, Guo QH, Lv SS, Lv N, Xu WD, et al. Asymmetric activation of microglia in the hippocampus drives anxiodepressive consequences of trigeminal neuralgia in rodents. Br J Pharmacol. 2023;180(8):1090\u0026thinsp;\u0026minus;\u0026thinsp;113.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Qiu S, Hu Y, Huang Y, Gao T, Wang X, Wang D, et al. Whole-brain spatial organization of hippocampal single-neuron projectomes. Science. 2024;383(6682):eadj9198.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Gao J, Wang D, Zhu C, Wang J, Wang T, Xu Y, et al. (1)H-MRS reveals abnormal energy metabolism and excitatory-inhibitory imbalance in a chronic migraine-like state induced by nitroglycerin in mice. J Headache Pain. 2024;25(1):163.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Zhang YQ, Lin WP, Huang LP, Zhao B, Zhang CC, Yin DM. Dopamine D2 receptor regulates cortical synaptic pruning in rodents. Nat Commun. 2021;12(1):6444.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Edelmann E, Lessmann V. Dopaminergic innervation and modulation of hippocampal networks. Cell Tissue Res. 2018;373(3):711\u0026thinsp;\u0026minus;\u0026thinsp;27.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Yin J, Chen KM, Clark MJ, Hijazi M, Kumari P, Bai XC, et al. Structure of a D2 dopamine receptor-G-protein complex in a lipid membrane. Nature. 2020;584(7819):125-9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Fan L, Tan L, Chen Z, Qi J, Nie F, Luo Z, et al. Haloperidol bound D(2) dopamine receptor structure inspired the discovery of subtype selective ligands. Nat Commun. 2020;11(1):1074.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Liu Y, Song N, Yao H, Jiang S, Wang Y, Zheng Y, et al. β-Arrestin2-biased Drd2 agonist UNC9995 alleviates astrocyte inflammatory injury via interaction between β-arrestin2 and STAT3 in mouse model of depression. J Neuroinflammation. 2022;19(1):240.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Zhu J, Hu Z, Han X, Wang D, Jiang Q, Ding J, et al. Dopamine D2 receptor restricts astrocytic NLRP3 inflammasome activation via enhancing the interaction of β-arrestin2 and NLRP3. Cell Death Differ. 2018;25(11):2037-49.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Lu SZ, Wu Y, Guo YS, Liang PZ, Yin S, Yin YQ, et al. Inhibition of astrocytic DRD2 suppresses CNS inflammation in an animal model of multiple sclerosis. J Exp Med. 2022;219(9).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Barone I, Giordano C. Leptin and Beyond: Actors in Cancer. Biomolecules. 2021;11(12).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Torres DJ, Pitts MW. Pericytic porters: helping leptin step in. Trends Endocrinol Metab. 2021;32(12):958-9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Zou X, Zhong L, Zhu C, Zhao H, Zhao F, Cui R, et al. Role of Leptin in Mood Disorder and Neurodegenerative Disease. Front Neurosci. 2019;13:378.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Fujita Y, Yamashita T. The Effects of Leptin on Glial Cells in Neurological Diseases. Front Neurosci. 2019;13:828.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e de Lima RMS, Barth B, Mar Arcego D, de Mendon\u0026ccedil;a Filho EJ, Patel S, Wang Z, et al. Leptin receptor co-expression gene network moderates the effect of early life adversity on eating behavior in children. Commun Biol. 2022;5(1):1092.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e M\u0026uuml;nzberg H, Heymsfield SB, Berthoud HR, Morrison CD. History and future of leptin: Discovery, regulation and signaling. Metabolism. 2024;161:156026.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Wang F, Li Z, Li B, Xu M, Wang Y, Wang J, et al. Xiaochaihutang ameliorates depression-like behaviors induced via chronic social defeat stress by regulating exon-specific Bdnf transcription through H3K18 acetylation in the hippocampus of mice. Phytomedicine. 2025;140:156567.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Ge T, Fan J, Yang W, Cui R, Li B. Leptin in depression: a potential therapeutic target. Cell Death Dis. 2018;9(11):1096.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Liu W, Liu J, Xia J, Xue X, Wang H, Qi Z, Ji L. Leptin receptor knockout-induced depression-like behaviors and attenuated antidepressant effects of exercise are associated with STAT3/SOCS3 signaling. Brain Behav Immun. 2017;61:297\u0026ndash;305.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Irving A, Harvey J. Regulation of hippocampal synaptic function by the metabolic hormone leptin: Implications for health and disease. Prog Lipid Res. 2021;82:101098.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Liu Q, Yang H, Zhang M, Zhang J, Lu L, Yu S, et al. Initiation and progression of dental-stimulated temporomandibular joints osteoarthritis. Osteoarthritis Cartilage. 2021;29(5):633\u0026thinsp;\u0026minus;\u0026thinsp;42.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Zhang HY, Xie MJ, Yang HX, Liu X, Ren HT, Zhang M, et al. Catabolic changes of rat temporomandibular joint discs induced by unilateral anterior crossbite. J Oral Rehabil. 2019;46(4):340-8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Xu X, Chu Y, Zhang Y, Li G, Yang P, Zhang J, et al. Chondrocyte Adipogenic Differentiation in Softening Osteoarthritic Cartilage. J Dent Res. 2022;101(6):655\u0026thinsp;\u0026minus;\u0026thinsp;63.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Armario A. The forced swim test: Historical, conceptual and methodological considerations and its relationship with individual behavioral traits. Neurosci Biobehav Rev. 2021;128:74\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Yue N, Huang H, Zhu X, Han Q, Wang Y, Li B, et al. Activation of P2X7 receptor and NLRP3 inflammasome assembly in hippocampal glial cells mediates chronic stress-induced depressive-like behaviors. J Neuroinflammation. 2017;14(1):102.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Kuang XJ, Zhang CY, Yan BY, Cai WZ, Lu CL, Xie LJ, et al. P2X2 receptors in pyramidal neurons are critical for regulating vulnerability to chronic stress. Theranostics. 2022;12(8):3703-18.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Verharen JPH, de Jong JW, Zhu Y, Lammel S. A computational analysis of mouse behavior in the sucrose preference test. Nat Commun. 2023;14(1):2419.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Li XY, Zhang SY, Hong YZ, Chen ZG, Long Y, Yuan DH, et al. TGR5-mediated lateral hypothalamus-dCA3-dorsolateral septum circuit regulates depressive-like behavior in male mice. Neuron. 2024;112(11):1795\u0026thinsp;\u0026minus;\u0026thinsp;814.e10.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Hatton-Jones KM, Christie C, Griffith TA, Smith AG, Naghipour S, Robertson K, et al. A YOLO based software for automated detection and analysis of rodent behaviour in the open field arena. Comput Biol Med. 2021;134:104474.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Zhang JQ, Li SY, Yin C, Ji Y, Zhang X, Liu DY, et al. Dysfunction of subthalamic dopaminergic circuitry contributes to anxiety- and depression-like behaviors in 6-OHDA lesion-induced hemiparkinsonian mice. Acta Pharmacol Sin. 2025.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Bian LH, Wang SQ, Li WJ, Li J, Yin Y, Ye FF, Guo JY. Cryptotanshinone regulates gut microbiota and PI3K-AKT pathway in rats to alleviate CUMS induced depressive symptoms. Biomed Pharmacother. 2023;169:115921.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Ma L, Zhang L, Liao Z, Xiu C, Luo X, Luo N, et al. Pharmacological inhibition of protein S-palmitoylation suppresses osteoclastogenesis and ameliorates ovariectomy-induced bone loss. J Orthop Translat. 2023;42:1\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Lu J, Shi X, Fu Q, Han Y, Zhu L, Zhou Z, et al. New mechanistic understanding of osteoclast differentiation and bone resorption mediated by P2X7 receptors and PI3K-Akt-GSK3β signaling. Cell Mol Biol Lett. 2024;29(1):100.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Yi Y, Li Y, Zhang S, Men Y, Wang Y, Jing D, et al. Mapping of individual sensory nerve axons from digits to spinal cord with the transparent embedding solvent system. Cell Res. 2024;34(2):124\u0026thinsp;\u0026minus;\u0026thinsp;39.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Jing D, Zhang S, Luo W, Gao X, Men Y, Ma C, et al. Tissue clearing of both hard and soft tissue organs with the PEGASOS method. Cell Res. 2018;28(8):803\u0026thinsp;\u0026minus;\u0026thinsp;18.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Chen Y, Li X, Zhang D, Wang C, Feng R, Li X, et al. A Versatile Tiling Light Sheet Microscope for Imaging of Cleared Tissues. Cell Rep. 2020;33(5):108349.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Ribeiro-Dasilva MC, Fillingim RB, Wallet SM. Estrogen-Induced Monocytic Response Correlates with TMD Pain: A Case Control Study. J Dent Res. 2017;96(3):285\u0026thinsp;\u0026minus;\u0026thinsp;91.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e List T, Jensen RH. Temporomandibular disorders: Old ideas and new concepts. Cephalalgia. 2017;37(7):692\u0026ndash;704.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Koparal M, Sirik M, Yavuz GY, Ege B. Evaluation of the relationship between temporomandibular joint disorders and tinnitus with computed tomography. J Stomatol Oral Maxillofac Surg. 2022;123(4):e199-e205.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Wang X, Yang Y, Lin L, Yao Q, Zhang J. Obesity and temporomandibular joint disorders: a systematic review and meta-analysis. BMC Oral Health. 2023;23(1):607.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Bayındır Ş, Yılmaz Asan C, Demirbaş AE, Keti DB, K\u0026uuml;t\u0026uuml;k N. Evaluation of aggrecan and adipokine levels in temporomandibular joint synovial fluid. J Craniomaxillofac Surg. 2022;50(5):432-8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Minervini G, Franco R, Marrapodi MM, Crimi S, Badnjević A, Cervino G, et al. Correlation between Temporomandibular Disorders (TMD) and Posture Evaluated trough the Diagnostic Criteria for Temporomandibular Disorders (DC/TMD): A Systematic Review with Meta-Analysis. J Clin Med. 2023;12(7).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Xiang T, Tao ZY, Liao LF, Wang S, Cao DY. Animal Models of Temporomandibular Disorder. J Pain Res. 2021;14:1415-30.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Xing L, Qi X, Wu J, Liu Y, Zhang L, Jiang B. Histopathological characterization of mandibular condyles in four temporomandibular joint osteoarthritis mouse models. Arch Oral Biol. 2025;170:106129.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Li J, Ma K, Yi D, Oh CD, Chen D. Nociceptive behavioural assessments in mouse models of temporomandibular joint disorders. Int J Oral Sci. 2020;12(1):26.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Zhang Z, Luo X, Li X, Shi B, Tan L. The preliminary study of the effects of individual musculoskeletally stable position in the treatment of temporomandibular disorders. BMC Oral Health. 2024;24(1):1083.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e de Sousa BM, L\u0026oacute;pez-Valverde A, Caramelo F, Rodrigues MJ, L\u0026oacute;pez-Valverde N. Use of antidepressants in the treatment of chronic orofacial pain caused by temporomandibular disorders: A randomized controlled clinical trial. Med Clin (Barc). 2024;163(2):74\u0026thinsp;\u0026minus;\u0026thinsp;7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Yazici H, Taskin MI, Guney G, Hismiogullari AA, Arslan E, Tulaci KG. The novel relationship between polycystic ovary syndrome and temporomandibular joint disorders. J Stomatol Oral Maxillofac Surg. 2021;122(6):544-8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Lin J, Cao DY. Associations Between Temporomandibular Disorders and Brain Imaging-Derived Phenotypes. Int Dent J. 2024;74(4):784\u0026thinsp;\u0026minus;\u0026thinsp;93.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Uchino M, Sashide Y, Takeda M. Suppression of the excitability of rat nociceptive secondary sensory neurons following local administration of the Phytochemical, (-)-Epigallocatechin-3-gallate. Brain Res. 2023;1813:148426.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Papotto N, Reithofer S, Baumert K, Carr R, M\u0026ouml;hrlen F, Frings S. Olfactory stimulation Inhibits Nociceptive Signal Processing at the Input Stage of the Central Trigeminal System. Neuroscience. 2021;479:35\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Okubo N, Ishikawa H, Sano R, Shimazu Y, Takeda M. Effect of resveratrol on the hyperexcitability of nociceptive neurons associated with ectopic hyperalgesia induced by experimental tooth movement. Eur J Oral Sci. 2020;128(4):275\u0026thinsp;\u0026minus;\u0026thinsp;83.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Arakawa S, Inoue M, Kinouchi R, Morizumi S, Yamaguchi M, Shimazu Y, Takeda M. Dietary constituent genistein inhibits the hyperexcitability of trigeminal nociceptive neurons associated with mechanical hyperalgesia following orofacial inflammation. J Oral Biosci. 2019;61(4):215\u0026thinsp;\u0026minus;\u0026thinsp;20.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Yang W, Liu M, Zhang Q, Zhang J, Chen J, Chen Q, Suo L. Knockdown of miR-124 Reduces Depression-like Behavior by Targeting CREB1 and BDNF. Curr Neurovasc Res. 2020;17(2):196\u0026ndash;203.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Nakajima K, Oiso S, Kariyazono H. Brain-Derived Neurotrophic Factor Up-Regulation by the Methanol Extract of Foxtail Millet in Human Peripheral Cells. J Nutr Sci Vitaminol (Tokyo). 2020;66(3):284-8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Yang Y, Jiang W, Feng Y, Liu J, Chen H, Wang D, Zhao R. Melatonin alleviates hippocampal GR inhibition and depression-like behavior induced by constant light exposure in mice. Ecotoxicol Environ Saf. 2021;228:112979.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Hurtado H, Hansen M, Strack J, Vainik U, Decker AL, Khundrakpam B, et al. Polygenic risk for depression and anterior and posterior hippocampal volume in children and adolescents. J Affect Disord. 2024;344:619\u0026thinsp;\u0026minus;\u0026thinsp;27.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Zhou H, Li R, Ma Z, Rossi S, Zhu X, Li J. Smaller gray matter volume of hippocampus/parahippocampus in elderly people with subthreshold depression: a cross-sectional study. BMC Psychiatry. 2016;16:219.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Liu S, Xiu J, Zhu C, Meng K, Li C, Han R, et al. Fat mass and obesity-associated protein regulates RNA methylation associated with depression-like behavior in mice. Nat Commun. 2021;12(1):6937.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Dong B, Wang J, Wang M, Chen Q, Kong X, Chang J, et al. An FRET-based and ER-targeting fluorescent probe for tracking superoxide anion (O(2)(\u0026bull;-)) in the hippocampus of the depressive mouse. Talanta. 2024;268(Pt 1):125272.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Terauchi A, Yee P, Johnson-Venkatesh EM, Seiglie MP, Kim L, Pitino JC, et al. The projection-specific signals that establish functionally segregated dopaminergic synapses. Cell. 2023;186(18):3845-61.e24.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Terauchi A, Johnson-Venkatesh EM, Umemori H. Establishing functionally segregated dopaminergic circuits. Trends Neurosci. 2025;48(2):156\u0026thinsp;\u0026minus;\u0026thinsp;70.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Pannu A, Goyal RK. The Potential Role of Dopamine Pathways in the Pathophysiology of Depression: Current Advances and Future Aspects. CNS Neurol Disord Drug Targets. 2024.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Li H, Jacob MA, Cai M, Kessels RPC, Norris DG, Duering M, et al. Meso-cortical pathway damage in cognition, apathy and gait in cerebral small vessel disease. Brain. 2024;147(11):3804-16.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Liu S, Tang Y, Shu H, Tatum D, Bai Q, Crawford J, et al. Dopamine receptor D2, but not D1, mediates descending dopaminergic pathway-produced analgesic effect in a trigeminal neuropathic pain mouse model. Pain. 2019;160(2):334\u0026thinsp;\u0026minus;\u0026thinsp;44.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Li C, Li Y, Zhang W, Ma Z, Xiao S, Xie W, et al. Dopaminergic Projections from the Hypothalamic A11 Nucleus to the Spinal Trigeminal Nucleus Are Involved in Bidirectional Migraine Modulation. Int J Mol Sci. 2023;24(23).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Nielsen JC, Salomon K, Kalenderoglou IE, Bargmeyer S, Pape T, Shahsavar A, Loland CJ. Structure of the human dopamine transporter in complex with cocaine. Nature. 2024;632(8025):678\u0026thinsp;\u0026minus;\u0026thinsp;85.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Ambigapathy G, McCowan TJ, Carvelli L. Amphetamine exposure during embryogenesis changes expression and function of the dopamine transporter in Caenorhabditis elegans offspring. J Neurochem. 2024;168(9):2989-98.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Kuzumaki N, Suda Y, Iwasawa C, Narita M, Sone T, Watanabe M, et al. Cell-specific overexpression of COMT in dopaminergic neurons of Parkinson's disease. Brain. 2019;142(6):1675-89.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Kimura K, Nagai Y, Hatanaka G, Fang Y, Tanabe S, Zheng A, et al. A mosaic adeno-associated virus vector as a versatile tool that exhibits high levels of transgene expression and neuron specificity in primate brain. Nat Commun. 2023;14(1):4762.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Do JP, Xu M, Lee SH, Chang WC, Zhang S, Chung S, et al. Cell type-specific long-range connections of basal forebrain circuit. Elife. 2016;5.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Kitanishi T, Tashiro M, Kitanishi N, Mizuseki K. Intersectional, anterograde transsynaptic targeting of neurons receiving monosynaptic inputs from two upstream regions. Commun Biol. 2022;5(1):149.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Yao Z, van Velthoven CTJ, Nguyen TN, Goldy J, Sedeno-Cortes AE, Baftizadeh F, et al. A taxonomy of transcriptomic cell types across the isocortex and hippocampal formation. Cell. 2021;184(12):3222-41.e26.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Wang Q, Ding SL, Li Y, Royall J, Feng D, Lesnar P, et al. The Allen Mouse Brain Common Coordinate Framework: A 3D Reference Atlas. Cell. 2020;181(4):936\u0026thinsp;\u0026minus;\u0026thinsp;53.e20.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Jing D, Yi Y, Luo W, Zhang S, Yuan Q, Wang J, et al. Tissue Clearing and Its Application to Bone and Dental Tissues. J Dent Res. 2019;98(6):621\u0026thinsp;\u0026minus;\u0026thinsp;31.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Lai MS, S\u0026oslash;rensen MH, Lee K, Chu JM, Chang RC. 3D mapping of direct VTA-CA2 circuit with potential involvement in Parkinson's disease degeneration. Neurobiol Dis. 2024;202:106723.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Sorka\u0026ccedil; A, Moșneanu RA, Crown AM, Savaş D, Okoro AM, Memiş E, et al. retro-Tango enables versatile retrograde circuit tracing in Drosophila. Elife. 2023;12.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Ueda HR, Ert\u0026uuml;rk A, Chung K, Gradinaru V, Ch\u0026eacute;dotal A, Tomancak P, Keller PJ. Tissue clearing and its applications in neuroscience. Nat Rev Neurosci. 2020;21(2):61\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Li Y, Zhang B, Pan X, Wang Y, Xu X, Wang R, Liu Z. Dopamine-Mediated Major Depressive Disorder in the Neural Circuit of Ventral Tegmental Area-Nucleus Accumbens-Medial Prefrontal Cortex: From Biological Evidence to Computational Models. Front Cell Neurosci. 2022;16:923039.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Admon R, Kaiser RH, Dillon DG, Beltzer M, Goer F, Olson DP, et al. Dopaminergic Enhancement of Striatal Response to Reward in Major Depression. Am J Psychiatry. 2017;174(4):378\u0026thinsp;\u0026minus;\u0026thinsp;86.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Yi MH, Liu YU, Liu K, Chen T, Bosco DB, Zheng J, et al. Chemogenetic manipulation of microglia inhibits neuroinflammation and neuropathic pain in mice. Brain Behav Immun. 2021;92:78\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Miyakawa N, Nagai Y, Hori Y, Mimura K, Orihara A, Oyama K, et al. Chemogenetic attenuation of cortical seizures in nonhuman primates. Nat Commun. 2023;14(1):971.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Cheng Z, Zhang C, Zhao F, Piao J, Cui R, Li B. Rasd2 Mediates Acute Fasting-Induced Antidepressant-Like Effects via Dopamine D2 Receptor Activation in Ovariectomized Mice. Int J Neuropsychopharmacol. 2023;26(3):217\u0026thinsp;\u0026minus;\u0026thinsp;29.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Bland T, Zhu M, Dillon C, Sahin GS, Rodriguez-Llamas JL, Appleyard SM, Wayman GA. Leptin Controls Glutamatergic Synaptogenesis and NMDA-Receptor Trafficking via Fyn Kinase Regulation of NR2B. Endocrinology. 2020;161(2).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Mainardi M, Spinelli M, Scala F, Mattera A, Fusco S, D'Ascenzo M, Grassi C. Loss of Leptin-Induced Modulation of Hippocampal Synaptic Trasmission and Signal Transduction in High-Fat Diet-Fed Mice. Front Cell Neurosci. 2017;11:225.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Garza JC, Guo M, Zhang W, Lu XY. Leptin restores adult hippocampal neurogenesis in a chronic unpredictable stress model of depression and reverses glucocorticoid-induced inhibition of GSK-3β/β-catenin signaling. Mol Psychiatry. 2012;17(8):790\u0026ndash;808.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e Li C, Meng F, Lei Y, Liu J, Liu J, Zhang J, et al. Leptin regulates exon-specific transcription of the Bdnf gene via epigenetic modifications mediated by an AKT/p300 HAT cascade. Mol Psychiatry. 2021;26(8):3701-22.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7857810/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7857810/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eTemporomandibular disorders (TMD), prevalent orofacial conditions with complex etiologies, are frequently accompanied by emotional disturbances whose central nervous mechanisms remain poorly understood. Here, using a unilateral anterior crossbite (UAC) mouse model combined with hippocampal neuronal cultures, we investigated the neural substrates underlying TMD-associated depression. Behavioral analyses revealed that UAC mice exhibited significant depressive-like behaviors. Viral tracing and chemogenetic approaches identified a novel dopaminergic pathway from the spinal trigeminal nucleus caudalis (SpVc) to the hippocampus (HPC). Functional manipulation of this circuit demonstrated that chemogenetic inhibition of SpVc dopaminergic neurons (hM4Di activation) induced depressive-like behaviors, while post-TMD activation (hM3Dq) reversed these behavioral deficits. Additionally, UAC mice exhibited reduced hippocampal expression of dopamine receptor D2 (DRD2) and leptin receptor (LEPR). \u003cem\u003eIn vitro\u003c/em\u003e experiments established that DRD2 overexpression upregulated LEPR through nuclear factor kappa-B (NF-κB) phosphorylation, while DRD2 inhibition downregulated LEPR, defining a functional DRD2-NF-κB-LEPR signaling axis. Critically, adeno-associated virus (AAV)-mediated DRD2/LEPR overexpression in the hippocampus ameliorated depressive-like behaviors in UAC mice. These findings collectively reveal a previously unrecognized SpVc-HPC dopaminergic circuit that modulates TMD-related depression through the DRD2-NF-κB-LEPR axis, offering new insights into potential therapeutic strategies for TMD-associated neuropsychiatric comorbidities.\u003c/p\u003e","manuscriptTitle":"The Dopaminergic Spinal Trigeminal Nucleus Caudalis-Hippocampus Pathway Modulates TMD-Associated Depression via the DRD2/NF-κB/LEPR Signaling Axis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-15 14:25:23","doi":"10.21203/rs.3.rs-7857810/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"11de4459-cc15-4bbb-a40c-b04adbc6d857","owner":[],"postedDate":"December 15th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":59383420,"name":"Biological sciences/Neuroscience"},{"id":59383421,"name":"Health sciences/Diseases/Psychiatric disorders/Depression"},{"id":59383422,"name":"Biological sciences/Molecular biology"}],"tags":[],"updatedAt":"2026-01-09T11:15:57+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-15 14:25:23","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7857810","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7857810","identity":"rs-7857810","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.