atRA mitigates high salt-driven EAE by stabilizing Treg cell mediated the inhibition of IL- 23R and the repairment of compromised endogenous RA signaling

atRA mitigates high salt-driven EAE by stabilizing Treg cell mediated the inhibition of IL- 23R and the repairment of compromised endogenous RA signaling | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article atRA mitigates high salt-driven EAE by stabilizing Treg cell mediated the inhibition of IL- 23R and the repairment of compromised endogenous RA signaling Jiale Tian, Yong Wang, Haolin Li, Yating Li, Xiaofeng Wei, Youquan Gu, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4186387/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 21 Aug, 2024 Read the published version in Inflammation → Version 1 posted 10 You are reading this latest preprint version Abstract High salt diet (HSD) is implicated in numerous disorders. HSD boosts Th17 development, compromises the immunosuppressive function of thymic Treg cells leading to the exacerbation of EAE. However, little is known regarding the harness of excessive proinflammatory responses evoked by HSD. Here we show that atRA, a key vitamin A metabolite with multifaceted immunoregulatory properties has the potential to harness the HSD-provoked EAE pathogenesis. Treatment with atRA in vivo elicited the Treg generation in cervical and axillary lymph nodes (CALs) and in CNS, thus attenuated the HSD-aggravated EAE disease. In-vitro mechanistic studies were also performed by several FACS- and MACS-sorting experiments, followed by cell coculture assays, and the related western blotting or qPCR verification. The final protective mechanism of IL-23R inhibition was studied by administration with anti-IL-23R mAb. atRA reverses the compromised function of high-salt modified tTreg cells contributing to the mitigation of HSD-provoked EAE. atRA protects Treg cell against high-salt modification via the repression of IL-23R but not SGK1 signaling. atRA also repairs the perturbed endogenous retinoic acid metabolic signaling under HSD, whereas systematic inhibition of IL-23R had a moderate therapeutic potential in inhibiting inflammatory effects of high salt. In conclusion, administration of atRA might be a way to combat the proinflammatory effects of HSD. Meanwhile, the identification of IL-23R as a ‘natural inhibitor’ of high salt-compromised Treg cells in mice could serve as a basis for the identification of novel therapeutic strategies against HSD-driven autoimmune disorders. Thymic regulatory T cells (tTreg cells) All-trans retinoid acid (atRA) Experimental autoimmune encephalomyelitis (EAE) Interleukin-23 receptor (IL-23R) Th17 cells dendritic cells Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 INTRODUCTION High-salt intake is a well-established cause of morbidity and mortality worldwide, especially which is a major culprit in cardiovascular disease, hypertension, et al [ 1 ] . In particular, the significant rise in the incidence of high salt intake promotes autoimmunity through pro-inflammatory responses suggests an important contribution of changing environmental factors rather than genetics [ 2 , 3 ] . Based on these convincing evidences, the limitation of table salt (NaCl) intake has long been recognized as an important means of preventing some diseases. However, it is not easy to curb the consumption of salt in the general population or a call for changing the eating habits [ 4 ] . Therefore, exploring salt-resistant therapies will be a longstanding means to combat with the effects of high-salt intake in people. Previous studies have established that excessive salt enhance the differentiation of T helper 17 cells (Th17), resulting in the onset and progress of autoimmune conditions in animal models of EAE, colitis, lupus nephritis, et al [ 5 – 7 ] . Mechanically, HSD activates Th17 cells via the serum/glucocorticoid-regulated kinase 1 (SGK1) and its downstream target IL-23R [ 8 ] . Furthermore, HSD has been elucidated to impair functioning of regulatory T cells (Treg cells), giving rise to the exacerbation of graft-versus-host disease model [ 9 ] . It is well-known that T-helper cell subsets are reciprocally regulated, which enables the transition between pro- and anti-inflammatory states. Meanwhile, silencing SGK1 significantly reduce the production of Th17 cells under high salt condition [ 10 ] . However, whether other compound could target SGK1 and/or IL-23R contributing to reshaping the imbalance of Th17 and Treg cells under HSD milieu remains unknown. Retinoic acid (RA), the active metabolite of vitamin A is known to regulate immunity and ameliorate various models of autoimmune diseases such as rheumatoid arthritis, colitis, ischemic stroke via one of its active metabolites all-trans retinoic acid (RA) [ 11 – 13 ] . Insufficient vitamin A intake or abnormal metabolism of endogenous retinoic acid can cause organ damage, hyperinflammatory responses, et.al [ 14 ] . RA is also a key regulator of CD4 + T- cell homeostasis, where maintenance of self-tolerance, particularly in the gut. In addition, RA strongly suppress the pathogenic Th17 cells function via down-regulation of RORc and RARα [ 15 ] . Moreover, we and others have demonstrated that RA greatly elicit TGF-β-induced Treg cell (iTregs) conversion and enhance the suppressive function of thymus-derived Treg cells (tTregs) [ 16 ] . In contrast to the aggravation of hyperinflammation by HSD, retinoic acid/atRA induces a strong anti-inflammatory effect. However, to date, there no studies exploring the role of atRA in the high salt-disturbed immune system, particularly during T-helper cell functional execution. Hence, given that atRA has the multifaceted immunoregulatory properties, whether atRA administration can mitigate HSD-accelerated EAE pathogenesis, and whether this inhibitory effect is contributed via the modulation of SGK1-IL-23R signaling by atRA. The current study explores that atRA treatment counteracts the high salt mediated proinflammatory responses in EAE mice, reverses the compromised immunosuppressive function of Treg cells, which the molecular mechanism is dependent of IL-23R and independent of SGK1 inhibition. Meanwhile, our study also unveiled that the impaired endogenous retinoic acid signaling may be repaired by the atRA administration, which additionally opens up a novel field of “Nutritional Therapeutics” against the salt rich diet. MATERIALS AND METHODS Mice C57BL/6 (B6)-Foxp3 − GFP knock-in mice were purchased from Jackson Laboratory. WT B6 mice were purchased from Lanzhou Veterinary Research Institute. All the mice were bred under specific pathogen-free conditions and maintained according to the Animal Care regulations of Penn State Hershey Medical Center and Lanzhou University. Sex-matched 6- to 10-week-old female mice were co-housed for every EAE experiment. Animal handling and procedures were in accordance with the Penn State Hershey Medical Center and Lanzhou University Institutional Animal Care and Use Committee. EAE induction Isoflurane (2% in carbogen gas) anesthetized mice were immunized s.c. at two sides on the flank with 250µg of MOG 35 − 55 (Proteimax) fully emulsified in an equivalent volume of Complete Freund's Adjuvant (CFA, Sigma, St Louis, MO, USA) emulsified in CFA containing 4 mg/ml (0.4 mg/mouse) heat-killed Mycobacterium tuberculosis (Chondrex). 0 to 1 hour thereafter, and again 24 h later, mice were injected i.p. with 500 ng pertussis toxin (Alexis). The high salt diet (HSD) protocol was that as previously described (Yang luo et al., 2019; Nomura et al., 2019). Mice received a sodium-rich chow containing 6% NaCl (Jiangsu Xietong, Nanjing, China) and tap water containing 1% NaCl ad libitum for 2 weeks before EAE induction. HSD continued until the mice were sacrificed. Drug administration To investigate the therapeutic effect of all-trans retinoic acid (Sigma, St. Louis, MO, USA. R2625) on EAE, mice were administered i.p. with atRA (0.5 mg/kg) or cottonseed oil (vehicle) as a control every three days, beginning on day 6 after the primary immunization. Mice were monitored for 28 days with total 7 times injection, ending on day 24 for the last injection. In most experiments, there were six mice per group, experiments were repeated at least two or three times with similar results and the data came from one of them. To investigate the therapeutic effect of anti-IL-23R mAb (R&D System, Minneapolis, MN, USA) on EAE, 20 µg per mice of anti-IL-23R mAb was injected i.p. every three days, starting at day 6 after the primary immunization. The other groups were given the same dose of isotype control Ab IgG (vehicle). At the day 28 after MOG injection, mice were sacrificed, cells from brains, spinal cords, and lamina propria (LPs) were harvested. EAE evaluation The clinical scores were assessed as follows: 0: normal; 0.5, partial limp tail; 1: limp tail or waddling gait with tail tonicity; 1.5, hind limb ataxia; 2: waddling gait with limp tail (ataxia) or hind limb paresis; 2.5: ataxia with partial limb paralysis; 3: full paralysis of one limb; 3.5: full paralysis of one limb with partial paralysis of second limb; 4: full paralysis of 2 limbs; 4.5: tetraplegia/moribund and 5: death. The mean scores were recorded every two or three days [ 32 ] . Tissue sampling and cell pooling Mice were sacrificed and transcardiac perfusion were performed at day 28. Brains, spinal cords, LPs, or cervical and axillary lymph nodes (CALs) were collected for postprocessing. Briefly, for CALs, they were put in cell strainers (70 µm) (BD Biosciences) and grinded with syringe plungers, then washed with PBS. For single brain and SC cells, brains and spinal cords were subjected to digestion with 0.25% trypsin-EDTA (Thermo Fisher, Carlsbad, CA, USA) at 37°C for 20 min, and then digested by collagenase IV (Sigma Aldrich) at 37°C with shaking for 40 min. The digested tissues were filtered through cell strainers (70 µm) to obtain cell suspensions and then centrifugated in 30%/70% Percoll solution (GE Healthcare Biosciences AB, Uppsala, Sweden) for obtaining single- lymphocytes. For LPs (lamina propria), tissues were opened longitudinally after excising fat tissues and washed with PBS to remove luminal feces, then were minced and digested with RIPA 1640 medium (Thermo Fisher Scientific) containing 2% NCS, penicillin and streptomycin (100 U/mL), collagenase IV (1 mg/mL) for 40 min at 37°C in a shaking water bath. LP mononuclear cells were filtered and counted finally prior to staining. Histology Animals were killed using the perfusion with 4% (w/v) paraformaldehyde under deep anesthesia (10% chloralhydrate, 0.2ml/mouse, i.p.). Brains and spinal cords were removed, immersed in 10% formalin, and then embedded in paraffin. Sections were then dissected and stained with hematoxylin & eosin (H&E) to assess degree of inflammatory cell infiltration according to standard protocols. Scores were in a semiquantitative fashion for inflammation graded: 0, none; 1, a few inflammatory cells; 2, organization of perivascular infiltrates; and 3, perivascular cuffing with extension into the adjacent tissue [ 32 ] . GFP + T cell evaluation in naïve mice Naïve Foxp3 − GFP reporter mice were injected i.p. with atRA (0.5 mg/kg) for every three days. On day 7 and 15, eyeball blood samples were obtained, and red blood cells were lysed by ACK buffer (Thermo Fisher Scientific). Then GFP + CD4 + T cells were detected by flow cytometry. Mice were sacrificed on day 15, cervical and axillary lymphoid (CALs) compartments were removed and fresh cells were stimulated with PMA and ionomycin followed by the intracellular staining and FACS detection. Thymic Treg cell expansion and conversion in vitro FACS-sorted thymic Treg cells (CD4 + CD25 high or CD4 + GFP + cells with 99% purity) from WT B6 or Foxp3 GFP B6 mice were firstly expanded with anti-CD3/CD28–coated beads (1 bead: 2 cells) (Invitrogen) and IL-2 (100 U/ml; R&D Systems) for 72h. For in-vitro experiments, Treg cells used in the paper were all from the expanded thymic Treg cells. For Treg cell conversion, these expanded Treg cells were cultured in 96-well U-bound plates in X-VIVO 15 medium (LONZA) in the presence or absence of NaCl (40 mM, Sigma-Aldrich) and IL-6 (100ng/ml) for 48h with the stimulation of anti-CD3/CD28–coated beads (1 bead: 2 cells), which all supplemented with 10% (v/v) fetal bovine serum (FBS) (Gibco, 10099-141), penicillin (100 units/mL) and streptomycin (100 µg/ml). All cells were maintained in a humidified 5% CO2 incubator at 37°C. In-vitro suppression assay Naive CD4 + T effectors (2 × 10 5 ) were stained with carboxyfluorescein succinimidyl ester (CFSE) at 2 µM and cultured with expanded Treg cells (2 × 10 5 , titrated down as described) in 96-round-bottom wells in X-VIVO 15 medium (terms as standard media, SM), or with the addition of physiologically relevant 40 mM NaCl (Sigma-Aldrich) in the presence or absence of IL-6 (100ng/ml) for 72h as indicated. Co-cultured cells were also stimulated with anti-CD3/CD28 microbeads (5 cells per bead). The proliferative levels of CFSE-CD4 + T cell were judged by the rates and intensity of CFSE dilution measured with the flow cytometry. Flow-cytometric analysis Cells from indicated compartments of EAE mice were stained with monoclonal Abs (mAbs) and isotype control. For surface staining, cells were stained with the respective antibodies (anti-mouse CD4, CD25, CD11c, CD86, CD103, IL-23R) for 20 minutes in PBS (eBioscience). For intracellular staining, cells were stimulated with Phorbol 12-Myristate 13-Acetate (PMA) and ionomycin (both 0.25ug/ml; Sigma-Aldrich) for five hours at 37℃ in the presence of brefeldin A (5ug/ml; BioLegend) for the last 4 hours. Cells were fixed and made permeable (Fix/Perm, eBioscience) according to the manufacturer’s instructions, and stained with anti-IL-17A-APC (TC11-18H10) and anti-IFNγ-PE. Data were acquired on a FACS Fortessa and analyzed with FlowJo×10 software. Western blotting Treated or untreated Treg cells were collected for protein extraction using lysis buffer. Protein was blotted onto PVDF membranes via Trans-Blot Turbo Transfer Pack (Bio-Rad), which were then blocked in 5% BSA or 5% non-fat milk in TBST for 1h. The membranes were incubated overnight at 4°C with antibodies against IL-23R (1:1000 ThermoFisher), SGK1 (1:1000 Millipore), p-SGK1 (1:1000 Cell Signaling Technology), and GAPDH (1:1000 Santa Cruz Biotechnology). The following day, the membranes were incubated with HRP-conjugated secondary antibodies for 1h. Immunoreactivities then were visualized by ECL reagent (Beyotime, Shanghai, China). Films were digitally scanned for protein quantification using the NIH Image J software. Real-Time Quantitative PCR (qPCR) Total RNA was extracted from mouse intestines or from expanded Treg cells using RNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. RNA was then quantified using NanoDrop 2000/2000c spectrophotometer (ThermoFisher). Next, 1mg cDNA was generated from each RNA sample using the PrimeScript RT reagent kit (TaKaRa, China). One microliter of cDNA was amplified via real-time PCR using GoTaq qPCR Master Mix (Promega) and 10 pmol of primers specific for SGK1 and IL-23R. Both levels of mRNA were normalized to the expression of GAPDH, and were detected with a Bio-Rad CFX96 Touch Real-Time Detection System under the following conditions: initial denaturation for 3 minutes at 95°C, followed by 40 cycles of 10 seconds at 95°C and 1 minute at 57°C. The specificity of the PCR products was determined via melting curve analysis. The fold changes were calculated using the 2 -△△Ct method. The primer sequences are shown in Table 1 . Table 1 Gene Forward sequence Reverse sequence IL-23R 5′-GGTCCAAGCTGTCAATTCCCTAGG-3′ 5′-AGCCCTGGAAATGATGGACGCA-3′ SGK1 TGGAAAGGTTCTTCTGGCTAGG CACCAGGAAAGGGTGCTTCA Aldh1a1 AGGCCCTCAGATTGACAAGGAACA AACACTGTGGGCTGCACAAAGAAG Rdh10 ATGGTTCGCCACATCTACCG CTCCTCACCTTTTCCAGCTTGC Cyp26a1 GCACAAGCAGCGAAGAAGGTGAT ACTGCTCCAGACAACTGCTGACTT Cyp26b1 GGCGGCTACCGCACTGT TGTCTCGGATGCTATCATGACACT GAPDH 5′-GGCCCCTCTGGAAAGCTGTGG-3′ 5′-CCCGGCATCGAAGGTGGAAGA-3′ Statistical analysis . Statistical analysis was performed using Graph Pad Prism Version 5 software and presented if not indicated elsewhere as Mean ± SEM. To calculate differences between groups, student’s T test was used. One-way ANOVA analysis was performed for three or more groups. A value of p < 0.05 was considered to be statistically significant (* p < 0.05; ** p < 0.01; *** p < 0.001; ns, not significant). RESULTS atRA harnesses the proinflammatory effect of tTreg cells modified by the combination of high salt and IL-6 . We and others reported that atRA can prevent thymus-derived Treg cells (tTreg cells) from converting to IFNγ- and/or IL-17A-producing T-helper cells, along with the sustained Foxp3 expression and suppressive capacity following encounters with various proinflammatory cytokines [ 16 , 17 ] . Meanwhile, NaCl increased IFNγ secretion in tTreg cells, which in turn markedly impairs the immunosuppressive function of these cells [ 9 ] . However, TGFβ-induced Treg cells (iTreg cells) are completely stable and fully functional under high salt milieu [ 18 ] . Hence, whether atRA capably reverses the compromised capacity of tTreg cells driven by high salt is still unclear. tTreg cells (CD4 + GFP + ) were sorted from Foxp3 − GFP knock-in mice and expanded for 3 days. Then cells were divided into four groups: standard media group (SM), high-salt (40 mM NaCl) media group (control), high-salt media group added with DMSO (DMSO) or added with atRA (atRA) for another 48h activation. GFP, IFNγ and IL-17A expression on these cells were examined by flow cytometry. First, we observed that there was no significant GFP loss in each group ( Fig. S1 A ). Meanwhile, the barely detectable cytokine levels of IFNγ and IL-17A expression also have no evident changes among the four groups ( Fig. S1 B ). Next, using the unchanged culture system and grouping, we tested the influence of the combined stimulation of NaCl with IL-6 (100 ng/mL) on tTreg cells. As shown in Fig. 1A , after 48 hours culture, tTreg cells from SM group shown 88% GFP expression. When it turns to NaCl plus IL-6 culture system, only 81% of the GFP was maintained (control group), indicating that NaCl plus IL-6 may have synergistic effect on destabilizing Foxp3 expression. Additionally, cells from DMSO added groups have minimum GFP% changing when compared to the cells from control group. However, atRA addition carried out striking retainment or even increase the GFP expression in comparison to the control ( Fig. 1A ). Then, IFNγ and IL-17A expression of these cells stimulated with NaCl plus IL-6 were detected by FACS ( Fig. 1B ). As expected, the two combined stimulants markedly promote the increase of IL-17A expression on total tTreg cells, compared to SM group. The obviously different IL-17A-postive cell proportion were not seen between the control and DMSO group. Identically, atRA addition significantly suppressed IL-17A expression ( Fig. 1B, C ). Additionally, there was little difference in total cell number from each plate (data not shown), which suggested that inhibitory effect of atRA on IL-17A expression was not related to the cell death, which may be a cell-intrinsic manner. We did not find significant change of the frequency of IFNγ expression in tTreg cells compared within the four groups ( Fig. 1B, C ). Previous studies demonstrated that atRA not only sustained the Foxp3 expression but also enhanced the suppressive activities. Therefore, cells from separate well were harvested after 48h culture, and the immunosuppressive function was examined using a standard CFSE-labeled co-culture assay. As shown in Fig. 1D , SM-tTreg cells displayed a strong suppression of T-cell proliferation, while (NaCl + IL-6)-tTreg had a nearly two-fold loss of their immunosuppression at the ratio of Treg cells : T responder cells is 1:1 and 1:2. However, tTreg cells from the atRA-added group almost maintained their suppressive activity, which the most significant difference occurred when the ratio was at 1:3 ( Fig. 1D, E ). Taken together, these results clearly indicate that atRA significantly diminished the pro-inflammatory modifications on tTreg cells loaded by the synergistic effect of high salt and IL-6. atRA infusion increases the frequency of Treg cells and inhibits the conversion to Th17-like cells in naïve mice. To examine whether atRA infusion in high salt diet (HSD) fed naïve mice alters the peripheral Treg population in vivo , atRA was intraperitoneally (i.p.) injected into naïve Foxp3 − GFP reporter mice. HSD group received a sodium-rich chow containing 6% NaCl and tap water containing 1%NaCl. CD4 + GFP + T cell frequency in blood was measured on day 7 and 15. DMSO- infused mice are as a control. As shown in Fig. 2 A, there is no significant change of the GFP + Treg cell proportion from the peripheral blood in each group on day 7. However, we found that the markedly increase of GFP proportion in atRA-infused group on day 15 compared to that HSD only or DMSO-infused group (Fig. 2 A, B). Meanwhile, HSD does not influence the Foxp3-GFP expression in relation to the normal salt diet (NSD). We next examined the effects of atRA on other T cell responses from cervical and axillary lymph nodes (CALs). CD4 + GFP − T cells (Teffs) are one of the fastest cell subsets to respond to the immune response. Compared to NSD fed mice, a significant increased frequency of IL-17A and IFN-γ expression in Teffs were determined in HSD fed mice. However, IL-17A expression was remarkedly diminished by atRA infusion (Fig. 2 , D). Meanwhile, IFN-γ expression did not seem to respond significantly to atRA infusion (Fig. 2 C, E). CD44 expression is an indicative marker for effector-memory T cells. We here detected that whether atRA infusion affects the IL-17A expression on memory T cells. Similarly, we found the significant IL-17A expression in HSD- CALs compared to that NSD- controls. Nonetheless, this effect was apparently inhibited by the atRA infusion (Fig. 2 F). Finally, IL-17A- and/or IFN-γ- positive Treg cells was evaluated. As we expected, HSD group showed significant IL-17A-positve Treg cells compared to NSD group. Like above, atRA also statistically reduced the IL-17A expression in CAL-Treg cells (Fig. 2 G). IFN-γ expression was not significantly affected (statistical data not shown). Other T helper cells like Th2, Th9 are undetectable. These results indicate that treatment with atRA increases the frequency of Treg cells and decreases IL-17A expression in these cells from nearby lymphoid organs around the brain. atRA administration suppresses HSD-provoked EAE. The above finding that higher proportions and fully function of Treg cells were induced systemically in atRA-treated naïve mice under high salt diet prompted us to investigate the therapeutic ability of atRA to prevent HSD-provoked EAE. NSD-fed or HSD-fed EAE mice were conducted and were treated with either atRA or PBS every three days. Disease was firstly observed on day 9 after immunization only in HSD-fed group, but the progression of HSD-EAE was remarkedly reduced in mice treated with atRA, as determined by the assess of amelioration of the clinical scores. HSD-EAE presented significant accelerated clinical severity when compared to NSD-EAE. As with other studies, we also confirmed that atRA significantly ameliorates the NSD-fed EAE progress (Fig. 3 A). Histopathological analysis revealed that under normal salt diet, atRA-treated mice had various degrees of reduced brain-inflammation compared to models. However, this reduction was much statistical significance in HSD-fed groups (Fig. 3 B). We similarly observed much fewer cellular infiltrates in the spinal cords (SCs) from atRA-treated mice compared to PBS-treated mice in both NSD and HSD groups (Fig. 3 C). To address how atRA administration shaped T-helper cell immune responses and mitigated EAE, cells in the brains and SCs were analyzed by FACS. HSD significantly promotes both brain-infiltrating (Fig. 3 D, E) and SC-infiltrating (Fig. 3 G, H) Th17 cell differentiation in comparison to NSD group. Furthermore, Th17 population in brains and SCs was dramatically decreased in that mice administrated with atRA not only in NSD-fed but also in HSD-fed group compared to those diet paired models respectively (Fig. 3 D, E, G, H). We did not observe the increased proportion of brain-infiltrating (Fig. 3 D, F) and SC-infiltrating (Fig. 3 G, I) Th1 cells in HSD models compared to NSD controls. Nonetheless, the decreased Th1 proportion was detected in both brains and SCs in HSD or NSD fed atRA-treated groups compared to that diet-paired models ( p < 0.05) (Fig. 3 D, F, G, I). Given that Treg cells are critical for harnessing the CNS inflammation in EAE, we then analyzed CD4 + GFP + cells in brains and SCs. On the one hand, we did not find the significant promotion of Treg cells in brains (Fig. 3 J, K) and spinal cords (Fig. 3 L, M) from HSD-EAE mice, but only observed an increasing trend compared to NSD-EAE controls. On the other hands, under normal salt diet, atRA increases Treg cell proportion in both brains and SCs compared to model group, but not reaching statistical significance. However, atRA significantly enhances Treg cell frequency in both brains (Fig. 3 J, K) and SCs (Fig. 3 L, M) under high salt diet compared to that model mice. These results suggest that systemic atRA treatment ameliorates EAE, particularly the HSD-provoked EAE by decreasing Th17, Th1 cells and increasing Treg cells. atRA treatment inhibited the Th17-like Treg cell development in cervical and axillary lymph nodes from the HSD-fed EAE mice . The cervical and axillary lymph nodes (CALs) are nodes where the CNS and peripheral immune cells flow. Hence, we explored whether atRA administration in vivo can increasing the CAL-Treg cell population and weaken their plasticity. As shown in Fig. 4 A, the NSD-fed EAE mice treated with atRA showed profoundly increased expressions of CD4 + GFP + cells in CALs compared with the NSD-fed mice treated with vehicle. Also, atRA-treated HSD-fed EAE mice showed the significantly rising proportions of CD4 + GFP + cells compared with the HSD-fed controls (Fig. 4 A). Whether the increased number of CAL-Treg cells accompanied with increased stability? The total pooled NAL-cells were stimulated ex vivo followed by the intracellular detection of IL-17A and IFN-γ by FACS. We clearly determined that although HSD significantly promote IL-17A production in GFP-positive Treg cells, atRA treatment markedly inhibited IL-17A + Treg cell development, whereas the most obvious difference was between the HSD-fed two groups (Fig. 4 B, C). Similarly, proportion of Th1-like Treg cells was higher in NSD-fed than in HSD-fed models. Unlike the Th17-like Treg cells, atRA failed to suppress IFN-γ-positive tTreg cell development under normal salt diet. However, this suppressive effect was strikingly reversed under high salt diet, whereas proportion of IFN-γ-positive tTreg cell was sharply decreased from atRA-administrated HSD- fed EAE mice compared to that HSD-fed controls (Fig. 4 B, D). To deeply address how atRA treatment may have shaped Treg cell immune responses and ameliorated EAE, we analyzed RORγt and granulocyte-macrophage colony stimulating factor (GM-CSF) expression in CAL-Tregs, which the key pro-encephalomyelitic molecules both are essential for the pathogenicity of Th17 cells by FACS. As we expected, significant increased proportion of RORγt-positive Treg cells was examined in HSD models compared to NSD controls. Treatment of mice under HSD with atRA have much lowered number of CD4 + RORγt + cells in relation to the HSD models ( p < 0.05). We did not find significant decrease in atRA-treated mice in comparison to the controls both were under normal salt diet (Fig. 4 E, F). Next, proportions of GM-CSF-positive CAL-Treg cells were evaluated in each group. atRA treatment significant inhibited GM-CSF expression in CAL-Treg cells compared to the controls, both from the NSD fed groups, whereas the difference was even greater from the HSD fed groups (Fig. 4 G). Co-expression of RORγt and GM-CSF in Treg cells is critically required for the pathogenic lineage commitment of Th 17 subset [ 19 ] . We here finally evaluated the frequency of RORγt + GM-CSF + CAL-Treg cells in these EAE mice. The results indicated that the HSD-fed EAE mice showed the significant increase of these cells compared to NSD-fed EAE controls. However, treatment with atRA suppressed RORγt + GM-CSF + CAL-Treg cell expansion under NSD. The profound suppression was found in HSD-fed groups, which atRA treatment resulted in a substantial reduction in these Treg cells (Fig. 4 H). The striking reduction of RORγt + GM-CSF + CAL-Treg cells likely explains why a high-salt diet does not produce an excessive central and peripheral inflammatory responses to atRA administration. atRA mediates anti-inflammatory activity largely through an IL-23R-dependent but SGK1-independent manner . SGK1 activated by high salt plays a critical role in the regulation of Th17/Treg cell balance by regulating its downstream target, IL-23R expression [ 8 ] . Although the links among high salt, SGK1 and Treg cell differentiation remain well defined, there are little studies focus on exploring whether some known drugs can modulate these context-dependent regulatory functions mediated weaken the high salt-induced excessive inflammation. Our next experiments were done to examine whether the suppressive effect of atRA on high salt-evoked inflammatory damage is through the inhibition of these key molecules. We first examined SGK1 and p-SGK1 expression in Treg cells. Expanded thymic Treg cells were harvested and put into the normal salt (NS) or high salt (HS) culture medium for another 48h whereas some wells atRA or DMSO control were initially added in the presence of anti-CD3/CD28 microbeads stimulation and IL-2 addition. As shown in Figure S2 A , high salt apparently promoted Sgk1 mRNA expression in HS-Treg cells compared to HS-Treg cells, which was consistent with previous reports. Beyond our thought, the Sgk1 mRNA was not only decreased but increased to some extent after the addition of atRA ( Fig. S2 A ). In rapid sequence, the levels of total and phosphorylated SGK1 proteins were quantified by Western Blot. In line with the mRNA expression, the obviously increased SGK1 and pSGK1 expression were found in HS group compared to NS group ( p < 0.05). However, neither atRA-added NS nor HS group showed the decreased expression of the two molecules. Conversely, atRA increased the expression of total SGK1 in some degrees ( Fig. S2 B, C ). Furthermore, atRA significantly increased the level pSGK1 both from the NS-cultured or HS-cultured medium in relation to that control respectively ( Fig. S2 B, D ). These data promoted us to evaluate IL-23R expression, one of the downstream targets of SGK1. Interestingly, HS-Treg cells displayed much elevated il-23r expression in relation to NS-Treg cells. However, atRA addition significantly downregulated il23r mRNA expression in either high-salt or normal-salt environment ( Fig. 5A ). Consistent with the quantitative PCR data, WB also corroborates the protein of IL-23R expression was markedly upregulated in HS-Treg cells in comparision to the NS-controls. Identically, atRA strongly inhibited IL-23R protein expression under normal salt condition ( p < 0.05). Even under the high salt milieu, atRA also exhibited profound inhibition to IL-23R expression ( Fig. 5B, C ). At last, whether atRA administration can inhibit IL-23R expression in Treg cells in vivo . CAL-Treg cells were polled from the model or treated mice on day 28 as indicated in Fig. 4 . Proportions of IL-23R-positive CAL-Treg cells were assessed by FACS. The results showed that HSD significantly increase IL-23R + CAL-Treg cell development compared to NSD. Treatment with atRA decreased the frequency of these cells in CALs from NSD-fed groups. Meanwhile, there was a pronounced decline of IL-23R + CAL-Treg cells in atRA-treated HSD-fed EAE mice compared to that HSD-fed controls ( Fig. 5D, E ). Together, these data strongly suggest that atRA significantly attenuated the effect of high salt on the instability of Treg cells, of which the underlying mechanism was possibly IL-23R but not SGK1 dependent. Anti-IL-23R antibody ameliorates high salt-driven EAE progress in vivo . To further examine whether IL-23 receptor blockade has the therapeutic impact on high salt-provoked EAE pathogenesis. Anti-IL-23R mAb or the control vehicle was administered intraperitoneally into mice, and the whole disease process was monitored. As shown in Fig. S3A , under normal salt diet we only observed the significant clinical remission by anti-IL-23R mAb administration on day 22 and 25. Next, The CNS-infiltrating Th1 and Th17 cell proportion were examined on day 28. There were no significant differences of Th1 or Th17 cells in the brains from the anti-IL-23R mAb administration group in relation to that model or vehicle-treated group (data not shown). However, we still determined that the SC-infiltrating Th17 cell frequency was significantly reduced in the administrated group compared to model and vehicle- administrated control ( Fig. S4B, C ). Synchronously, the treatment effect of anti-IL-23R mAb was evaluated under high salt diet. As shown in Fig. 6A , the anti-IL-23R mAb-treated groups showed the significant alleviation in the EAE remission period on day 22, 25, 28 compared to model or vehicle-treated groups. Furthermore, there was a significant reduction of brain-Th17 cells from the mAb-treated mice in comparison to other two groups ( Fig. 6B, C ). The brian-Th1 cells from the mAb-treated mice showed a certain downward trend ( Fig. 6B, C ). Cells from spinal cord were next analyzed. Both Th17 and Th1 cells had a significant decrease in mAb-treated groups compared to other two groups ( Fig. 6D, E ). Taken together, these data suggest that IL-23R blockade does have the therapeutic potential in treating EAE, which the effect seemed to be evident in HSD-exacerbated EAE model. In other words, IL-23R blockade may be a means of specific resistance to high salt. atRA ameliorates high salt-driven intestinal immune responses in EAE mice . It has been well-established that vitamin A and its endogenous metabolites, such as atRA are crucial for normal metabolism, resistance to infection, and enhanced immunity [ 8 ] . Endogenous atRA is most produced by different cell types in the intestine, especially the CD103 + CD11c + dendritic cells (CD103 + DCs) [ 20 ] . High salt diet has been shown to exacerbate experimental colitis, which is associated with reduction in Lactobacillus , one of the gut microbiota that produces atRA [ 21 , 22 ] . Collectively, we hypothesized that high salt diet can impact the intestinal CD103 + DCs and/or the genes associated with retinoic acid metabolic pathway. Therefore, we analyzed the frequency of CD103 + DCs and Treg cells in the lamina propria (LP) on day 28. Using the gating strategy outlined in Fig. 7 A, we confirmed that HSD-fed EAE mice show an increased frequency of CD103 + DCs compared to the NSD-fed mice, but the difference was not significant. However, atRA intraperitoneal injection increased the ratio of these DCs both in HSD- and NSD-fed mice compared to that respective model controls, from which the more significant difference was showed in the HSD groups (Fig. 7 B). Given that intestinal CD103 + DCs are probably tolerogenic and with decreased antigen presenting function, the expression of CD80, CD86 and CD40 were examined by FACS. The similar result was observed that atRA treatment apparently decreased CD86 expression in CD103 + DCs compared to the indicated controls, from which the difference was more pronounced in HSD-fed two groups than in NSD-fed groups (Fig. 7 C). LP-Treg cells were also analyzed simultaneously. There was no significant difference between HSD-fed and NSD-fed model mice. However, atRA administration not only increased the CD4 + GFP + cells in NSD-fed but also in these HSD-fed mice ( p < 0.05) (Fig. 7 D). Furthermore, IL-23R expression in the LP-Treg cells was also examined. In contrast to the CD103 + DCs, HSD induced much more IL-23R + Treg cells than NSD. There was a significant increase of these cell proportion from the atRA-treated NSD-fed mice in relation to NSD-fed controls ( p < 0.05). Additionally, this phenomenon was of great significance between HSD-fed two groups (Fig. 7 E). We also confirmed that IL-23R + LP-Treg cells was positively correlated to IL-23R + CAL-Treg cells (Fig. 7 F). At last, the mRNA expression levels of the key genes of atRA metabolism-related pathways, such as Aldh1a1, Rdh10, Cyp26a1, Cyp26b1 in the small intestines were evaluated. The data showed that high salt significantly downregulated Aldh1a1 and Rdh10 expression compared to NSD (Fig. 7 G). However, atRA treatment obviously upregulated the expression of the two genes in both NSD and HSD group. We did not find significant differences of Cyp26a1 and Cyp26b1 mRNA expression from the groups (data not shown). Taken together, these data suggest that high salt might impair the intestinal retinoic acid metabolism process in the EAE mice. This abnormality may link to the increased IL-23R expression in Treg cells from the LPs and CALs, resulting in significant aggravation of their pathogenic function in vivo . Thus, exogenous atRA supplementation may directly or indirectly repair the retinoic acid metabolic signaling pathway, contributing to impeding the HSD-enhanced IL-23R expression in Treg cells. Anti-IL-23R inhibits high salt-increased IL-23R expression in Treg cells and enhances retinoic acid metabolism-related genes . As the impact of Anti-IL-23R mAb may seem particularly striking on HSD-induced Th17 cell development and EAE severity, we next examined more closely the effect of Anti-IL-23R on the IL-23R + Treg cells and the restoration of retinoic acid signaling in the intestine from the EAE mice under high salt diet. The frequency of Treg cells and CD11c + CD103 + DCs in the intestine was firstly analyzed. Comparison of anti-IL-23R treated recipients and model controls demonstrated a significant increase in GFP + LP-Treg cells (Fig. 8 A, B). Meanwhile, there were distinct lower IL-23R-positive Treg populations in the LPs from anti-IL-23R treatment mice than vehicle or model controls (Fig. 8 C, D). Similarly, IL-23R-positive Treg cells were also found in CALs, which had a significant increase from the anti-IL-23R-treated group compared to the cells from model or vehicle-treated group (Fig. 8 E). Moreover, CAL-Treg cells from the anti-IL-23R but not vehicle treated recipients significantly reduced IL-17A production (Fig. 8 F), whereas IFN-γ expression was not significantly altered (data not shown). Consistent with the result from the atRA-treated HSD-fed mice showed in Fig. 7 F, significant positive correlation was also discovered between the IL-23R + LP-Treg cells and IL-23R + CAL-Treg cells (Fig. 8 G). Moreover, the number of CD11c + CD103 + DCs was significantly increased in the LPs from anti-IL-23R-treated recipients when compared with those of vehicle-treated or model mice (Fig. 8 H). The antigen presenting molecules, such as CD80, CD86, CD40 were also examined. As we expected, CD86 expression was much decreased in CD11c + DCs from anti-IL-23R-treated mice ( p < 0.05) (Fig. 8 I). No significant differences were observed from the CD80 and CD40 expression (data not shown). In the end, whether anti-IL-23R treatment has the effect on the genes-related to retinoic acid metabolic pathway, we measured Aldh1a1, Rdh10 expression from the small intestinal tissue by qPCR. The results revealed the significant lower expression of the two genes in HSD-fed EAE mice than NSD-fed controls. However, anti-IL-23R treatment strikingly enhanced Aldh1a1 level compared with model group under high salt diet (Fig. 8 J). Rdh10 expression was slightly increased (data not shown). Thus, systematically down-regulation of the IL-23R may assist in repairing retinoic acid metabolic pathway, suppressing Th17-like Treg cells development, and ultimately reducing HSD-accelerated EAE severity overall. DISCUSSION It is increasingly recognized that aberrant Treg cell responses can develop within CNS and, as a consequence, can cause neuroinflammation, demyelination, and dysfunction [ 23 ] . Various stimulants can impair the immunosuppressive function of Treg cells, which are known to be several proinflammatory cytokines, traffic-related PM (2.5), glucose intake, and high salt diet, etc [ 18 , 24 , 25 ] . High salt diet aggravates neuroinflammation and accelerates the development of experimental autoimmune encephalomyelitis (EAE) via initiating Th17 responses and compromising thymic Treg cell activities [ 8 ] . Treg cells are vulnerable and can be switched to other T effector cell subsets, including Th1, Th2, and Th17 cells, accompanied by the downregulation of Foxp3 and a decrease in their inhibitory function [ 16 ] . In a previous work, we elucidated that atRA, the active derivative of vitamin A, has a pivotal role in maintaining the stability and functionality of Treg cells in the presence of IL-6 mediated by the inhibition of IL-6R /CD126 expression and its related signaling by Treg cells [ 17 ] . The current study demonstrates that atRA treatment are able to exert a significant effect on harnessing the high salt-induced inflammatory responses, whereas IL-23R serves as an indispensable link between the efficacy of atRA treatment and the restraint of high salt-provoked inflammatory responses in the context of CNS inflammation. Firstly, we investigated that systemic administration of atRA induced Treg cell differentiation and downregulated the infiltration of inflammatory T helper cells in the CNS from both naïve mice and MOG 35 − 55 -induced EAE. From an immune-functional point of view, atRA in vitro completely repairs high salt diminished functional activities of Treg cells, and significantly maintains the stability of Treg cells which are resistant to the expression of IL-17A and IFN-γ. Our in vivo data illustrated that atRA administration ameliorates high salt exacerbated EAE development, which is characterized by decreased clinical scores and less lymphocytic infiltrates in the brains and spinal cords by HE staining. The possible mechanisms could be attributed to decreased encephalitogenic Th17 and/or increased Treg cell proportion in CNS. On the other hand, encephalitogenic Treg cells were not studied here in this paper due to the technique difficulties and not enough cells mount. Nonetheless, lymphatic drainage of the CNS is associated with lymph nodes in the neck and axillary (NALs). Next, by examining the T helper cell responses in NALs, we indeed found that in the atRA administration groups more Treg cells were generated in both normal salt diet (NSD)-fed and high salt diet (HSD)-fed mice along with markedly reduction of Th17 cells, whereas Th1 cells only diminished from the HSD-fed mice. Meanwhile, atRA-treated NALs-polled Treg cells showed strikingly decreased GM-CSF and RORγt expression, of which the co-expression of the two molecules are identified as pathogenic Th17 cells [ 19 ] . These results clearly provide cellular mechanisms atRA administration can markedly reverses the destructive effects of HSD on EAE, and this efficacy may be related to the stabilization of Treg cells by atRA. Initial studies have revealed that excessive salt enhances Th17 cell differentiation through the SGK1-IL-23R signaling pathway, and SGK1 is also critical for destabilizing the Treg cell stability [ 18 ] . Hence, we hypothesize that atRA possibly inhibits SGK1 and/or its downstream target IL-23R. Unexpectedly, our in vitro data show that both the Treg cells and atRA-pretreated Treg cells has the elevated SGK1 expression transcriptionally and translationally. And this changed are more significant under the high salt condition. Growing evidences have indicated that as a hub of multiple signal transduction pathways, SGK1 plays essential roles in cell proliferation, corticoid metabolism, autoimmune inflammation responses, etc [ 26 ] . In addition, atRA also plays a variety of powerful roles in cell growth and the cell development cycle. So that may explain why atRA promotes SGK1 expression due to the identical function of the promotion of cell proliferation. Since SGK1 was not an option, we then focused on its downstream regulatory molecule, IL-23R. Although previous study demonstrated that retinoic acid inhibits the expression of IL-6Rα, IL-23R and thus inhibits Th17 differentiation, the molecular and regulatory mechanism by which atRA inhibits high salt-driven Treg cell conversion via IL-23R signaling has not been addressed [ 27 ] . Our further mechanism study showed that atRA rescues the compromised suppressive function of Treg cells by high salt, which might be via the inhibition of IL-23R expression in Treg cells. Several pieces of experimental evidence support this view. First, atRA did decrease IL-23R mRNA and protein expression in murine Treg cells in vitro. This efficacy is rather apparent, when the culture system is with additional NaCl. Second, the in vivo therapeutic results also confirmed that anti-IL-23R mAb administration attenuates the clinical scores of EAE. Intriguingly, this phenomenon is also obviously presented under high salt diet rather than normal salt diet. Moreover, we further correlated the IL-23R expression in VAL-Treg cells with that in intestinal-Treg cells which showed a significant positive correlation with each other. These elucidations of atRA -repaired the compromised Treg cell capacity through the inhibition of IL-23R in Treg cells provides a previously unrecognized potential therapeutic targets for high salt-mediated exacerbation of autoimmunity. Next, we seek whether high salt disturbs the endogenous vitamin A metabolism pathway in the intestine, leading to the pathogenesis of EAE. Several pieces of previous experimental evidence support this view. First, studies have shown that the level of endogenous vitamin A was reduced in ulcerative colitis, which was negatively associated with the colonic IL-23R expression and was positively correlated with the disease activity [ 28 ] . Second, high salt intake affects the gut microbiome in mice, particularly by depleting Lactobacillus murinus, leading to the worsening EAE course [ 21 ] . However, oral administration of L. murinus ameliorates high salt-induced exacerbation of actively-induced EAE [ 21 ] . Meanwhile, it is known that gut bacteria Lactobacillus intestinalis metabolized vitamin A and specifically restored retinoic acid levels in the mice gut [ 29 ] . Third, intestinal CD103 + dendritic cells are known to drive the differentiation of gut-homing Treg cells by metabolizing vitamin A and producing retinoic acid [ 30 ] . In line with these findings, we found that high salt increased CD86 and IL-23R expression in CD11c + DC and Treg cells in lamina propria. However, atRA decreased CD86 and increased CD103 expression in CD11c + DCs, and promoted Treg cell development but inhibits IL-23R expression in the LPs. Importantly, the two key enzymes ( Aldh1a1 and Rdh10 ) that regulate the retinoic acid synthesis were decreased in high salt-fed EAE mice [ 31 ] . However, atRA significantly reversed and even enhanced the levels of the genes. These results suggest that atRA may convert antigen-presenting into tolerogenic function of LP-CD11c + DC, and that conversion may link to the decreased IL-23R expression in LP-Treg cells. Additionally, we further demonstrated that IL-23R blockade did inhibit high salt-driven EAE process, which may result from the increased proportions of CD103 + CD11c + DC and Treg cells, and also the diminished IL-23R expression in Treg cells. Whether and, if so, anti-IL-23R blockade can ameliorate the EAE development, especially the high salt-evoked EAE remains unclear. The current study clearly shows that the anti-IL-23R mAb administration partially attenuates EAE progress, but markedly decreased the severity of high salt-driven EAE. Additionally, the increased proportion of Treg cell and CD103 + CD11c + DC in the LPs, and the decreased IL-23R expression in LP-Treg cell possibly contribute to the therapeutic effect of anti-IL-23R mAb. And the key enzymes Aldh1a2 , decreased by high salt was also reversed via the anti-IL-23R blockade. Our data highlight the compromised retinoic acid signaling in high salt-driven EAE mice leads to the IL-23R expression in Treg cells. In other words, IL-23R as a salt-sensitive target contributes to the therapeutic potential of systematic atRA supplementation. But the experiment is still limited in depth and precision and needs to be validated using the transgenic mouse. Although IL-23R may systematically influence the Treg stability and function in vivo , not excluding the possibility that other immune cells may be contributors of similar importance. Additionally, we demonstrated that atRA repaired the compromised intestinal retinoic acid signaling, a finding that needs to be addressed in more detail in vivo . Considering this limitation, it suggests that the interaction between endogenous RA metabolic signaling and IL-23/IL-23R signaling under high salt diet need to be thoroughly investigated. In conclusion, high salt consumption not only leads to hypertension, cardia-cerebrovascular disease but also additionally drive autoimmunity. There is still a long way to go to promote low salt diet in the population. Therefore, the development of discovering ways to combat the proinflammatory effects of a high-salt diet is an intriguing new avenue for many aberrant Treg/Th17 cell-associated autoimmune diseases. Our experimental data suggest that one of the active metabolites of vitamin A, atRA might serve as a potential resistant agent to counteract salt-sensitive conditions. Meanwhile, the identification of IL-23R as a ‘natural inhibitor’ of high salt-compromised Treg cells in mice could serve as a basis for the development of novel prevention and treatment strategies. Declarations AUTHORS’ CONTRIBUTIONS JT, YW, HL and YL jointly completed the experiment of this study. JT and YL wrote the original draft. XW and YG processed the data. JT and YW collected the data. HW edited the draft. HW and YL designed the study. YG and YL contributed to the project administration. All authors read and approved the final manuscript. FUNDING This work was supported by the National Natural Science Foundation of China (81960293); the Natural Science Foundation of Gansu Province (20JR5RA3); the Joint Research Fund of Gansu Province (23JRRA1495), the China Postdoctoral Foundation project (2023M731460); the Lanzhou Chengguan District talent innovation and entrepreneurship project (2023RCCX0021), the Hui-Chun Chin and Tsung-Dao Lee Chinese Undergraduate Research Endowment (LZU-JZH2634) and the First Hospital of Lanzhou University excellent doctoral research start-up fund (ldyyyn2018-23). AVAILABILITY OF DATA AND MATERIALS The data that support the findings of this study are available from the corresponding author upon reasonable request. Acknowledgements We would like to thank all the participants in the study. Ethics Approval and Consent to Participate All animal experiments in this study were approved by the Institutional Animal Care and Use Committee and the Laboratory Animal Ethics Committee of Lanzhou University First Hospital (No. LDYYLL-2024-199). Consent to Participate Not applicable. Consent to Publish Not applicable. Competing Interests The authors declare that they have no financial or non-financial competing interests related to this work. References YAN X, JIN J, SU X, et al. Intestinal Flora Modulates Blood Pressure by Regulating the Synthesis of Intestinal-Derived Corticosterone in High Salt-Induced Hypertension [J]. Circ Res, 2020, 126(7): 839-53. GAO P, YOU M, LI L, et al. Salt-Induced Hepatic Inflammatory Memory Contributes to Cardiovascular Damage Through Epigenetic Modulation of SIRT3 [J]. Circulation, 2022, 145(5): 375-91. ZHANG W C, ZHENG X J, DU L J, et al. High salt primes a specific activation state of macrophages, M(Na) [J]. Cell Res, 2015, 25(8): 893-910. LUO T, JI W J, YUAN F, et al. Th17/Treg Imbalance Induced by Dietary Salt Variation Indicates Inflammation of Target Organs in Humans [J]. Sci Rep, 2016, 6: 26767. KLEINEWIETFELD M, MANZEL A, TITZE J, et al. Sodium chloride drives autoimmune disease by the induction of pathogenic TH17 cells [J]. Nature, 2013, 496(7446): 518-22. YANG X, YAO G, CHEN W, et al. Exacerbation of lupus nephritis by high sodium chloride related to activation of SGK1 pathway [J]. Int Immunopharmacol, 2015, 29(2): 568-73. WANG D, JIN H, SHENG J, et al. A high salt diet protects interleukin 10-deficient mice against chronic colitis by improving the mucosal barrier function [J]. Mol Immunol, 2022, 150: 39-46. WU C, YOSEF N, THALHAMER T, et al. Induction of pathogenic TH17 cells by inducible salt-sensing kinase SGK1 [J]. Nature, 2013, 496(7446): 513-7. HERNANDEZ A L, KITZ A, WU C, et al. Sodium chloride inhibits the suppressive function of FOXP3+ regulatory T cells [J]. J Clin Invest, 2015, 125(11): 4212-22. WU C, CHEN Z, XIAO S, et al. SGK1 Governs the Reciprocal Development of Th17 and Regulatory T Cells [J]. Cell Rep, 2018, 22(3): 653-65. ZHANG Y, LUO Y, SHI J, et al. All-trans retinoic acid alleviates collagen-induced arthritis and promotes intestinal homeostasis [J]. Sci Rep, 2024, 14(1): 1811. HONG K, ZHANG Y, GUO Y, et al. All-trans retinoic acid attenuates experimental colitis through inhibition of NF-κB signaling [J]. Immunol Lett, 2014, 162(1 Pt A): 34-40. CAI W, WANG J, HU M, et al. All trans-retinoic acid protects against acute ischemic stroke by modulating neutrophil functions through STAT1 signaling [J]. J Neuroinflammation, 2019, 16(1): 175. LI Y, SHENG L, JENA P K, et al. Retinoic Acid Signaling Is Compromised in DSS-Induced Dysbiosis [J]. Nutrients, 2022, 14(14). TERATANI T, MIKAMI Y, NAKAMOTO N, et al. The liver-brain-gut neural arc maintains the T(reg) cell niche in the gut [J]. Nature, 2020, 585(7826): 591-6. ZHOU X, KONG N, WANG J, et al. Cutting edge: all-trans retinoic acid sustains the stability and function of natural regulatory T cells in an inflammatory milieu [J]. J Immunol, 2010, 185(5): 2675-9. LU L, LAN Q, LI Z, et al. Critical role of all-trans retinoic acid in stabilizing human natural regulatory T cells under inflammatory conditions [J]. Proc Natl Acad Sci U S A, 2014, 111(33): E3432-40. LUO Y, XUE Y, WANG J, et al. Negligible Effect of Sodium Chloride on the Development and Function of TGF-β-Induced CD4(+) Foxp3(+) Regulatory T Cells [J]. Cell Rep, 2019, 26(7): 1869-79.e3. LEE H G, LEE J U, KIM D H, et al. Pathogenic function of bystander-activated memory-like CD4(+) T cells in autoimmune encephalomyelitis [J]. Nat Commun, 2019, 10(1): 709. YAMAZAKI S, MORITA A. Dendritic cells in the periphery control antigen-specific natural and induced regulatory T cells [J]. Front Immunol, 2013, 4: 151. WILCK N, MATUS M G, KEARNEY S M, et al. Salt-responsive gut commensal modulates T(H)17 axis and disease [J]. Nature, 2017, 551(7682): 585-9. CHEN S, REN Z, HUO Y, et al. Targeting the gut microbiota to investigate the mechanism of Lactiplantibacillus plantarum 1201 in negating colitis aggravated by a high-salt diet [J]. Food Res Int, 2022, 162(Pt A): 112010. XIAO Z X, MILLER J S, ZHENG S G. An updated advance of autoantibodies in autoimmune diseases [J]. Autoimmun Rev, 2021, 20(2): 102743. WANG C, WANG J, ZHENG X, et al. Epigenetic regulation is involved in traffic-related PM(2.5) aggravating allergic airway inflammation in rats [J]. Clin Immunol, 2022, 234: 108914. ZHANG D, CHIA C, JIAO X, et al. D-mannose induces regulatory T cells and suppresses immunopathology [J]. Nat Med, 2017, 23(9): 1036-45. LU R Q, ZHANG Y Y, ZHAO H Q, et al. SGK1, a Critical Regulator of Immune Modulation and Fibrosis and a Potential Therapeutic Target in Chronic Graft-Versus-Host Disease [J]. Front Immunol, 2022, 13: 822303. XIAO S, JIN H, KORN T, et al. Retinoic acid increases Foxp3+ regulatory T cells and inhibits development of Th17 cells by enhancing TGF-beta-driven Smad3 signaling and inhibiting IL-6 and IL-23 receptor expression [J]. J Immunol, 2008, 181(4): 2277-84. VERMA P, SUBODH S, TIWARI V, et al. Correlation of Serum Vitamin A Levels with Disease Activity Indices and Colonic IL-23R and FOXP3 mRNA Expression in Ulcerative Colitis Patients [J]. Scand J Immunol, 2016, 84(2): 110-7. BONAKDAR M, CZUBA L C, HAN G, et al. Gut commensals expand vitamin A metabolic capacity of the mammalian host [J]. Cell Host Microbe, 2022, 30(8): 1084-92.e5. SCOTT C L, AUMEUNIER A M, MOWAT A M. Intestinal CD103+ dendritic cells: master regulators of tolerance? [J]. Trends Immunol, 2011, 32(9): 412-9. FENG R, FANG L, CHENG Y, et al. Retinoic acid homeostasis through aldh1a2 and cyp26a1 mediates meiotic entry in Nile tilapia (Oreochromis niloticus) [J]. Sci Rep, 2015, 5: 10131. LU K, LIU L, XU X, et al. ADAMTS13 ameliorates inflammatory responses in experimental autoimmune encephalomyelitis [J]. J Neuroinflammation, 2020, 17(1): 67. Additional Declarations No competing interests reported. Supplementary Files supplementarymaterialinflammation.docx uncroppedGels.pptx Cite Share Download PDF Status: Published Journal Publication published 21 Aug, 2024 Read the published version in Inflammation → Version 1 posted Reviews received at journal 22 Apr, 2024 Reviews received at journal 19 Apr, 2024 Reviews received at journal 18 Apr, 2024 Reviewers agreed at journal 01 Apr, 2024 Reviewers agreed at journal 31 Mar, 2024 Reviewers agreed at journal 30 Mar, 2024 Reviewers invited by journal 29 Mar, 2024 Submission checks completed at journal 29 Mar, 2024 Editor assigned by journal 29 Mar, 2024 First submitted to journal 29 Mar, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4186387","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":286082028,"identity":"a3181dbb-9346-48a1-8ade-80664e14a294","order_by":0,"name":"Jiale Tian","email":"","orcid":"","institution":"Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Jiale","middleName":"","lastName":"Tian","suffix":""},{"id":286082029,"identity":"d19d5d34-cc91-45f6-bec9-c49195c74336","order_by":1,"name":"Yong Wang","email":"","orcid":"","institution":"Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Wang","suffix":""},{"id":286082030,"identity":"ab251449-ee74-4d4f-a4f8-89c76b526c03","order_by":2,"name":"Haolin Li","email":"","orcid":"","institution":"Gansu Hospital of Traditional Chinese Medicine, Gansu University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Haolin","middleName":"","lastName":"Li","suffix":""},{"id":286082031,"identity":"3481c2df-9e90-443f-93fa-af018752c59e","order_by":3,"name":"Yating Li","email":"","orcid":"","institution":"Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Yating","middleName":"","lastName":"Li","suffix":""},{"id":286082033,"identity":"51adf08d-7548-4e5b-8098-2e2e3d0b1cba","order_by":4,"name":"Xiaofeng Wei","email":"","orcid":"","institution":"The First Hospital of Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Xiaofeng","middleName":"","lastName":"Wei","suffix":""},{"id":286082036,"identity":"9279d618-b5a3-4a4c-8376-116cb531aefa","order_by":5,"name":"Youquan Gu","email":"","orcid":"","institution":"The First Hospital of Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Youquan","middleName":"","lastName":"Gu","suffix":""},{"id":286082037,"identity":"e988586c-86da-42a1-8da0-351a426cdcdd","order_by":6,"name":"Haidong Wang","email":"","orcid":"","institution":"Gansu Hospital of Traditional Chinese Medicine, Gansu University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Haidong","middleName":"","lastName":"Wang","suffix":""},{"id":286082039,"identity":"762f0b67-b27c-4eec-9b09-ac0812b03750","order_by":7,"name":"Yang Luo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1klEQVRIiWNgGAWjYBACPoYEEGXBwMDe3ABiMTYQ0sIG0SLBwMBzkGQtEonEamHPMZNgbJNI7Jd82PyZh8FGdsMB5mcP8GrheQPRMnN2YoMxD0Oa8YYDbOYGeLVIQG3ZcDuxIZmH4XDihgM8bBLEabl5sOEwD8N/UrTcYGxs5mE4QIQWnmfFFgznJIxn9iQ2M84xSDaeeZjNDK8WfvbkjTcYymxk+9kPH/7wpsJOtu948zO8WhgYOEyk/7LBOKCgYsavHgjYH39g+ENQ1SgYBaNgFIxkAABBXUOlGivaGwAAAABJRU5ErkJggg==","orcid":"","institution":"Lanzhou University","correspondingAuthor":true,"prefix":"","firstName":"Yang","middleName":"","lastName":"Luo","suffix":""}],"badges":[],"createdAt":"2024-03-29 07:42:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4186387/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4186387/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10753-024-02130-2","type":"published","date":"2024-08-21T15:57:01+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":54030229,"identity":"e53a8ac3-b4bb-427e-bca2-20c78893703c","added_by":"auto","created_at":"2024-04-03 15:50:04","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2270333,"visible":true,"origin":"","legend":"\u003cp\u003eatRA reversed the compromised activity of thymic Treg cells stimulated by NaCl combined with IL-6. Expanded tTreg cells were cultured in the standard media (SM) or in high salt condition (NaCl 40mM) combined with IL-6 (100 ng/mL), some wells were also added DMSO or atRA as indicated for 48h. GFP% maintenance in each group are shown \u003cstrong\u003e(A)\u003c/strong\u003e. IL-17A and IFN-γ expression were also examined by flow cytometry and statistically analyzed\u003cstrong\u003e (B, C)\u003c/strong\u003e. tTreg cells were stimulated as in (A) and cocultured with CFSE-labeled naïve CD4\u003csup\u003e+\u003c/sup\u003e T cells for 3 days, which the grouping and stimulation conditions were exactly the same as in figure 1A \u003cstrong\u003e(D)\u003c/strong\u003e. The proliferation of cycling CFSE were evaluated by FACS \u003cstrong\u003e(E)\u003c/strong\u003e. Data are presented as mean ± SEM from one of three experiments. ∗\u003cem\u003ep\u003c/em\u003e \u0026lt; 0:05, ∗∗\u003cem\u003ep\u003c/em\u003e \u0026lt; 0:01, and ∗∗∗\u003cem\u003ep\u003c/em\u003e \u0026lt; 0:001 (one-way ANOVA followed by Tukey’s multiple comparison test).\u003c/p\u003e","description":"","filename":"atRAFig1.png","url":"https://assets-eu.researchsquare.com/files/rs-4186387/v1/8b784daf97caad3b92db86b9.png"},{"id":54030228,"identity":"3f74c99a-8fb0-4cab-b44e-b8033f06c919","added_by":"auto","created_at":"2024-04-03 15:50:04","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3404191,"visible":true,"origin":"","legend":"\u003cp\u003eAdministration of atRA increases Treg cell proportion in naïve Foxp3-GFP reporter mice. atRA was injected i.p. (0.5 mg/kg) every other day for total 15 days. On days 7 and 15, blood was sampled from mice eyes, CD4\u003csup\u003e+\u003c/sup\u003eGFP\u003csup\u003e+\u003c/sup\u003e cells were examined by FACS \u003cstrong\u003e(A)\u003c/strong\u003e. Statistical analysis of the percentage of GFP\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003e T cells on day 15 was shown \u003cstrong\u003e(B)\u003c/strong\u003e. Lymphocytes pooled from cervical and axillary lymphoid compartments (NALs). Flow cytometric analysis and frequencies of CD4\u003csup\u003e+\u003c/sup\u003eIL-17A\u003csup\u003e+\u003c/sup\u003e \u003cstrong\u003e(C, D)\u003c/strong\u003e and CD4\u003csup\u003e+\u003c/sup\u003eIFN-γ\u003csup\u003e+\u003c/sup\u003e \u003cstrong\u003e(C, E)\u003c/strong\u003e T cells were examined in the respective mouse groups. Frequency of CD4\u003csup\u003e+\u003c/sup\u003eGFP\u003csup\u003e-\u003c/sup\u003eCD44\u003csup\u003e+\u003c/sup\u003e T effector cells are shown in each group by FACS \u003cstrong\u003e(F)\u003c/strong\u003e. Flow cytometric analysis showed the frequency of IL-17A- and IFN-γ-expressing Treg cells in each group \u003cstrong\u003e(G)\u003c/strong\u003e. Bars are mean + SEM; Representative data from 3 independent experiments. Statistical analyses were performed using one-way ANOVA. ns, not significant. *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"atRAFig2.png","url":"https://assets-eu.researchsquare.com/files/rs-4186387/v1/c201fa9976783bd50af2419b.png"},{"id":54030230,"identity":"e3eb27e3-64cd-4b7a-8b5f-a770e590db2c","added_by":"auto","created_at":"2024-04-03 15:50:04","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":8192973,"visible":true,"origin":"","legend":"\u003cp\u003eatRA administration exhibits superior anti-inflammatory activity in both the NSD-fed and HSD-fed EAE mice. atRA was intraperitoneal injected on day 4 after MOG35-55/CFA immunization and was repeated every other day. Clinical scores of the recipient mice were presented at various time points after immunization \u003cstrong\u003e(A)\u003c/strong\u003e. H\u0026amp;E staining of the brain and spinal cord (SC) from each group (20x), and the histologic scores of brain \u003cstrong\u003e(B)\u003c/strong\u003e and SC \u003cstrong\u003e(C) \u003c/strong\u003ewere analyzed. Data are presented as the mean ± SEM. NS means no significance, *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, NSD vs NSD+atRA, NSD vs HSD, HSD vs HSD+atRA. Experiments were terminated on day 28. Cells from brains and SCs were harvested and followed by the indicated stimulation and staining. IL-17A- and INFγ- producing CD4+ T cells from brains \u003cstrong\u003e(D-F)\u003c/strong\u003e and spinal cords \u003cstrong\u003e(G-I)\u003c/strong\u003e were analyzed by flow cytometry. Data are representative of at least six mice per group. Staining and flow cytometric analysis of indicated brain- \u003cstrong\u003e(J, K)\u003c/strong\u003e and spinal cord-\u003cstrong\u003e(L, M)\u003c/strong\u003e infiltrating CD4\u003csup\u003e+\u003c/sup\u003eGFP\u003csup\u003e+\u003c/sup\u003e cells by flow cytometry are shown. Statistical analyses were performed using one-way ANOVA. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001. ns, not significant.\u003c/p\u003e","description":"","filename":"atTAFig3.png","url":"https://assets-eu.researchsquare.com/files/rs-4186387/v1/cf1c9d6e34c30f54f362e247.png"},{"id":54030234,"identity":"70767eee-92b9-423f-ad55-19b753777572","added_by":"auto","created_at":"2024-04-03 15:50:05","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3366812,"visible":true,"origin":"","legend":"\u003cp\u003eatRA treatment increases CNL-Treg cell development and inhibits the Th17-like phenotype in Treg cells. CNL cells were pooled and stimulated followed by the surface staining with CD4 and GM-CSF, and intracellular staining with IL-17A and IFN-γ. The flow cytometric data showed the frequency of CD4\u003csup\u003e+\u003c/sup\u003eGFP\u003csup\u003e+\u003c/sup\u003e cells in CNLs \u003cstrong\u003e(A)\u003c/strong\u003e. The representative flow diagram and the statistical quantitation of IL-17A- and IFN-γ-expressing Treg cells in CNLs\u003cstrong\u003e (B)\u003c/strong\u003e. Some pooled CNL cells were freshly stained with CD4 and GM-CSF surface antibodies followed by the nuclear staining with Rorγt. Data were gated on GFP\u003csup\u003e+\u003c/sup\u003e cells, the representative flow diagram \u003cstrong\u003e(C)\u003c/strong\u003e and related statistical quantitations \u003cstrong\u003e(D, E)\u003c/strong\u003e were shown. The statistical frequency of Rorγt and GM-CSF double positive Treg cells were shown \u003cstrong\u003e(F)\u003c/strong\u003e. Representative data from 3 independent experiments. Data were performed using one-way ANOVA. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001. ns, not significant.\u003c/p\u003e","description":"","filename":"atRAFig4.png","url":"https://assets-eu.researchsquare.com/files/rs-4186387/v1/a1d5ec20eefd06c7d70fa273.png"},{"id":54030235,"identity":"12a16759-f77d-40cc-a079-5ca5fd06dff3","added_by":"auto","created_at":"2024-04-03 15:50:05","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1736477,"visible":true,"origin":"","legend":"\u003cp\u003eIL-23R expression is increased in Treg Cells after atRA stimulation. mRNA level of \u003cem\u003eil-23r\u003c/em\u003e gene \u003cstrong\u003e(A) \u003c/strong\u003eand the protein expression of IL-23R \u003cstrong\u003e(B, C)\u003c/strong\u003e are shown. Error bars represent SEM. *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001 (Student’s t test, error bars, SD). Total CALs cells were pooled from NSD- or HSD-fed EAE mice with or without atRA administration. IL-23R expression is examined by FACS. The representative flow diagram and the statistical quantitation of IL-23R-expressing Treg cells are shown \u003cstrong\u003e(D, E)\u003c/strong\u003e. Representative data from 3 independent experiments. Data were performed using one-way ANOVA. See also Figure S2.\u003c/p\u003e","description":"","filename":"atRAFig5.png","url":"https://assets-eu.researchsquare.com/files/rs-4186387/v1/38ac0cb2b4fcf801b03f4a62.png"},{"id":54030923,"identity":"a9f69e7a-0da2-4b0c-a8ba-a0867f503e9c","added_by":"auto","created_at":"2024-04-03 15:58:05","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1740374,"visible":true,"origin":"","legend":"\u003cp\u003eanti-IL-23R mAb prevents the development of EAE in HSD-fed EAE mice. Wild-type mice were given a high-salt diet two weeks prior to active immunization. The experimental scheme and procedure are completely consistent with Figure S4. Clinical scores were assessed dynamically \u003cstrong\u003e(A)\u003c/strong\u003e. IL-17A- and INFγ- positive CD4\u003csup\u003e+\u003c/sup\u003e T cells from brains \u003cstrong\u003e(B)\u003c/strong\u003e and spinal cords \u003cstrong\u003e(D)\u003c/strong\u003e are detected by flow cytometry. Data are representative of at least six mice per group, \u003cstrong\u003e(C)\u003c/strong\u003e are from the brains and \u003cstrong\u003e(E) \u003c/strong\u003eare from the spinal cords. Staining of indicated statistical analyses were performed using one-way ANOVA. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001. ns, not significant.\u003c/p\u003e","description":"","filename":"atRAFig6.png","url":"https://assets-eu.researchsquare.com/files/rs-4186387/v1/86d1492f3e4608fe6389b618.png"},{"id":54030238,"identity":"745fa529-b80e-4fb6-8e60-11b83c18ed37","added_by":"auto","created_at":"2024-04-03 15:50:05","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":3709581,"visible":true,"origin":"","legend":"\u003cp\u003ePhenotypes of CD11c\u003csup\u003e+\u003c/sup\u003eDC and IL-23R\u003csup\u003e+\u003c/sup\u003e Treg cells are changed during atRA administration. Wild-type mice were given a high-salt diet two weeks prior to active immunization. The grouping, experimental scheme and procedure are completely consistent with Figure 3. Flow cytometric analysis of intestinal CD11c\u003csup\u003e+\u003c/sup\u003e DC in NSD or HSD fed EAE mice compared with that atRA treated mice respectively.\u0026nbsp; Representative plots showed the gating strategy for identifying CD11c\u003csup\u003e+\u003c/sup\u003e MHCII\u003csup\u003e+\u003c/sup\u003e DC from the intestine \u003cstrong\u003e(A)\u003c/strong\u003e. Histograms showed the CD103 \u003cstrong\u003e(B)\u003c/strong\u003e and CD86 \u003cstrong\u003e(C)\u003c/strong\u003e. The intestinal proportion and the statistical quantitation of CD4\u003csup\u003e+\u003c/sup\u003eGFP\u003csup\u003e+\u003c/sup\u003e Treg cells \u003cstrong\u003e(D)\u003c/strong\u003e and IL-23R-positive Treg cells \u003cstrong\u003e(E)\u003c/strong\u003e are shown. Correlation between the frequency of CNL-pooled IL-23R\u003csup\u003e+\u003c/sup\u003e Treg cells and intestinal IL-23R\u003csup\u003e+\u003c/sup\u003e Treg cells are shown, and the data is a combination from two separate experiments of the three \u003cstrong\u003e(F)\u003c/strong\u003e. The mRNA expression level of retinol metabolism-related genes in the intestine from each group were determined by a RT-PCR, which are expressed as relative quantities normalized to the corresponding expression level of GAPDH mRNA. Representative data from 3 independent experiments. Staining of indicated statistical analyses were performed using one-way ANOVA. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001. ns, not significant.\u003c/p\u003e","description":"","filename":"atRAHSDFig7.png","url":"https://assets-eu.researchsquare.com/files/rs-4186387/v1/07219c605aa531a52510e70c.png"},{"id":54030924,"identity":"47841880-7100-4212-b7fb-85f4c40db10a","added_by":"auto","created_at":"2024-04-03 15:58:05","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":2526320,"visible":true,"origin":"","legend":"\u003cp\u003eanti-IL-23R mAb administration increased intestinal Treg cell frequency and repaired the compromised retinol metabolism signaling. Experimental scheme, anti-IL-23R mAb administration and mice grouping are exactly followed as figure 6. Flow cytometric analysis of the frequency of intestinal Treg cells \u003cstrong\u003e(A, B)\u003c/strong\u003e, and the IL-23R-positive Treg cells in the intestine \u003cstrong\u003e(C)\u003c/strong\u003e. Statistical data showed proportions of intestinal CD103\u003csup\u003e+\u003c/sup\u003e CD11c\u003csup\u003e+\u003c/sup\u003e DC \u003cstrong\u003e(D)\u003c/strong\u003e, CD86\u003csup\u003e+\u003c/sup\u003e CD11c\u003csup\u003e+\u003c/sup\u003e DC \u003cstrong\u003e(E)\u003c/strong\u003e, and IL-23R\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003eGFP\u003csup\u003e+\u003c/sup\u003e T cell \u003cstrong\u003e(F)\u003c/strong\u003e. Pooled CAL cells were stimulated and detected by FACS. Flow cytometric data of IL-17A expression in CAL-Treg cells were shown \u003cstrong\u003e(G)\u003c/strong\u003e. Correlative analyses of IL-23R\u003csup\u003e+\u003c/sup\u003e Treg cells in CAL with these cells in the intestine \u003cstrong\u003e(H)\u003c/strong\u003e. RNA from intestines was analyzed by real-time PCR for expression of retinol metabolism‐related genes, relative level of \u003cem\u003ealdh1a1\u003c/em\u003e is shown \u003cstrong\u003e(I)\u003c/strong\u003e. Representative data from 3 independent experiments. Data were performed using one-way ANOVA.\u003c/p\u003e","description":"","filename":"atRAHSDFig8.png","url":"https://assets-eu.researchsquare.com/files/rs-4186387/v1/51ffceb6d62ceff6cd362ecf.png"},{"id":63300605,"identity":"fd1198c4-ca56-4261-b5e2-c037b6185c18","added_by":"auto","created_at":"2024-08-26 16:15:28","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":36484598,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4186387/v1/513cd2e7-0448-42e8-960b-3a5be7c31c99.pdf"},{"id":54030237,"identity":"db578429-6fe0-4c2d-8aba-188a6e5db5e1","added_by":"auto","created_at":"2024-04-03 15:50:05","extension":"docx","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":500952,"visible":true,"origin":"","legend":"","description":"","filename":"supplementarymaterialinflammation.docx","url":"https://assets-eu.researchsquare.com/files/rs-4186387/v1/7fff209b2c706b8e357a6f19.docx"},{"id":54030232,"identity":"7a2d9818-03e0-45ef-a5f0-23a1470689ce","added_by":"auto","created_at":"2024-04-03 15:50:05","extension":"pptx","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":147835,"visible":true,"origin":"","legend":"","description":"","filename":"uncroppedGels.pptx","url":"https://assets-eu.researchsquare.com/files/rs-4186387/v1/ab12f3dac5a75c56f36dd140.pptx"}],"financialInterests":"No competing interests reported.","formattedTitle":"atRA mitigates high salt-driven EAE by stabilizing Treg cell mediated the inhibition of IL- 23R and the repairment of compromised endogenous RA signaling","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eHigh-salt intake is a well-established cause of morbidity and mortality worldwide, especially which is a major culprit in cardiovascular disease, hypertension, et al\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. In particular, the significant rise in the incidence of high salt intake promotes autoimmunity through pro-inflammatory responses suggests an important contribution of changing environmental factors rather than genetics\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. Based on these convincing evidences, the limitation of table salt (NaCl) intake has long been recognized as an important means of preventing some diseases. However, it is not easy to curb the consumption of salt in the general population or a call for changing the eating habits\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. Therefore, exploring salt-resistant therapies will be a longstanding means to combat with the effects of high-salt intake in people. Previous studies have established that excessive salt enhance the differentiation of T helper 17 cells (Th17), resulting in the onset and progress of autoimmune conditions in animal models of EAE, colitis, lupus nephritis, et al\u003csup\u003e[\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Mechanically, HSD activates Th17 cells via the serum/glucocorticoid-regulated kinase 1 (SGK1) and its downstream target IL-23R\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Furthermore, HSD has been elucidated to impair functioning of regulatory T cells (Treg cells), giving rise to the exacerbation of graft-versus-host disease model\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. It is well-known that T-helper cell subsets are reciprocally regulated, which enables the transition between pro- and anti-inflammatory states. Meanwhile, silencing SGK1 significantly reduce the production of Th17 cells under high salt condition\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. However, whether other compound could target SGK1 and/or IL-23R contributing to reshaping the imbalance of Th17 and Treg cells under HSD milieu remains unknown.\u003c/p\u003e \u003cp\u003eRetinoic acid (RA), the active metabolite of vitamin A is known to regulate immunity and ameliorate various models of autoimmune diseases such as rheumatoid arthritis, colitis, ischemic stroke via one of its active metabolites all-trans retinoic acid (RA)\u003csup\u003e[\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. Insufficient vitamin A intake or abnormal metabolism of endogenous retinoic acid can cause organ damage, hyperinflammatory responses, et.al\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. RA is also a key regulator of CD4\u003csup\u003e+\u003c/sup\u003e T- cell homeostasis, where maintenance of self-tolerance, particularly in the gut. In addition, RA strongly suppress the pathogenic Th17 cells function via down-regulation of RORc and RARα\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. Moreover, we and others have demonstrated that RA greatly elicit TGF-β-induced Treg cell (iTregs) conversion and enhance the suppressive function of thymus-derived Treg cells (tTregs)\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. In contrast to the aggravation of hyperinflammation by HSD, retinoic acid/atRA induces a strong anti-inflammatory effect. However, to date, there no studies exploring the role of atRA in the high salt-disturbed immune system, particularly during T-helper cell functional execution. Hence, given that atRA has the multifaceted immunoregulatory properties, whether atRA administration can mitigate HSD-accelerated EAE pathogenesis, and whether this inhibitory effect is contributed via the modulation of SGK1-IL-23R signaling by atRA. The current study explores that atRA treatment counteracts the high salt mediated proinflammatory responses in EAE mice, reverses the compromised immunosuppressive function of Treg cells, which the molecular mechanism is dependent of IL-23R and independent of SGK1 inhibition. Meanwhile, our study also unveiled that the impaired endogenous retinoic acid signaling may be repaired by the atRA administration, which additionally opens up a novel field of \u0026ldquo;Nutritional Therapeutics\u0026rdquo; against the salt rich diet.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMice\u003c/h2\u003e \u003cp\u003eC57BL/6 (B6)-Foxp3\u003csup\u003e\u0026minus;\u0026thinsp;GFP\u003c/sup\u003e knock-in mice were purchased from Jackson Laboratory. WT B6 mice were purchased from Lanzhou Veterinary Research Institute. All the mice were bred under specific pathogen-free conditions and maintained according to the Animal Care regulations of Penn State Hershey Medical Center and Lanzhou University. Sex-matched 6- to 10-week-old female mice were co-housed for every EAE experiment. Animal handling and procedures were in accordance with the Penn State Hershey Medical Center and Lanzhou University Institutional Animal Care and Use Committee.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eEAE induction\u003c/h2\u003e \u003cp\u003eIsoflurane (2% in carbogen gas) anesthetized mice were immunized s.c. at two sides on the flank with 250\u0026micro;g of MOG\u003csub\u003e35\u0026thinsp;\u0026minus;\u0026thinsp;55\u003c/sub\u003e (Proteimax) fully emulsified in an equivalent volume of Complete Freund's Adjuvant (CFA, Sigma, St Louis, MO, USA) emulsified in CFA containing 4 mg/ml (0.4 mg/mouse) heat-killed Mycobacterium tuberculosis (Chondrex). 0 to 1 hour thereafter, and again 24 h later, mice were injected i.p. with 500 ng pertussis toxin (Alexis).\u003c/p\u003e \u003cp\u003eThe high salt diet (HSD) protocol was that as previously described (Yang luo et al., 2019; Nomura et al., 2019). Mice received a sodium-rich chow containing 6% NaCl (Jiangsu Xietong, Nanjing, China) and tap water containing 1% NaCl ad libitum for 2 weeks before EAE induction. HSD continued until the mice were sacrificed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eDrug administration\u003c/h2\u003e \u003cp\u003eTo investigate the therapeutic effect of all-trans retinoic acid (Sigma, St. Louis, MO, USA. R2625) on EAE, mice were administered i.p. with atRA (0.5 mg/kg) or cottonseed oil (vehicle) as a control every three days, beginning on day 6 after the primary immunization. Mice were monitored for 28 days with total 7 times injection, ending on day 24 for the last injection. In most experiments, there were six mice per group, experiments were repeated at least two or three times with similar results and the data came from one of them.\u003c/p\u003e \u003cp\u003eTo investigate the therapeutic effect of anti-IL-23R mAb (R\u0026amp;D System, Minneapolis, MN, USA) on EAE, 20 \u0026micro;g per mice of anti-IL-23R mAb was injected i.p. every three days, starting at day 6 after the primary immunization. The other groups were given the same dose of isotype control Ab IgG (vehicle). At the day 28 after MOG injection, mice were sacrificed, cells from brains, spinal cords, and lamina propria (LPs) were harvested.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eEAE evaluation\u003c/h2\u003e \u003cp\u003eThe clinical scores were assessed as follows: 0: normal; 0.5, partial limp tail; 1: limp tail or waddling gait with tail tonicity; 1.5, hind limb ataxia; 2: waddling gait with limp tail (ataxia) or hind limb paresis; 2.5: ataxia with partial limb paralysis; 3: full paralysis of one limb; 3.5: full paralysis of one limb with partial paralysis of second limb; 4: full paralysis of 2 limbs; 4.5: tetraplegia/moribund and 5: death. The mean scores were recorded every two or three days\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eTissue sampling and cell pooling\u003c/h2\u003e \u003cp\u003eMice were sacrificed and transcardiac perfusion were performed at day 28. Brains, spinal cords, LPs, or cervical and axillary lymph nodes (CALs) were collected for postprocessing. Briefly, for CALs, they were put in cell strainers (70 \u0026micro;m) (BD Biosciences) and grinded with syringe plungers, then washed with PBS. For single brain and SC cells, brains and spinal cords were subjected to digestion with 0.25% trypsin-EDTA (Thermo Fisher, Carlsbad, CA, USA) at 37\u0026deg;C for 20 min, and then digested by collagenase IV (Sigma Aldrich) at 37\u0026deg;C with shaking for 40 min. The digested tissues were filtered through cell strainers (70 \u0026micro;m) to obtain cell suspensions and then centrifugated in 30%/70% Percoll solution (GE Healthcare Biosciences AB, Uppsala, Sweden) for obtaining single- lymphocytes. For LPs (lamina propria), tissues were opened longitudinally after excising fat tissues and washed with PBS to remove luminal feces, then were minced and digested with RIPA 1640 medium (Thermo Fisher Scientific) containing 2% NCS, penicillin and streptomycin (100 U/mL), collagenase IV (1 mg/mL) for 40 min at 37\u0026deg;C in a shaking water bath. LP mononuclear cells were filtered and counted finally prior to staining.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eHistology\u003c/h2\u003e \u003cp\u003eAnimals were killed using the perfusion with 4% (w/v) paraformaldehyde under deep anesthesia (10% chloralhydrate, 0.2ml/mouse, i.p.). Brains and spinal cords were removed, immersed in 10% formalin, and then embedded in paraffin. Sections were then dissected and stained with hematoxylin \u0026amp; eosin (H\u0026amp;E) to assess degree of inflammatory cell infiltration according to standard protocols. Scores were in a semiquantitative fashion for inflammation graded: 0, none; 1, a few inflammatory cells; 2, organization of perivascular infiltrates; and 3, perivascular cuffing with extension into the adjacent tissue\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eGFP\u003csup\u003e+\u003c/sup\u003e T cell evaluation in na\u0026iuml;ve mice\u003c/h2\u003e \u003cp\u003eNa\u0026iuml;ve Foxp3\u003csup\u003e\u0026minus;\u0026thinsp;GFP\u003c/sup\u003e reporter mice were injected i.p. with atRA (0.5 mg/kg) for every three days. On day 7 and 15, eyeball blood samples were obtained, and red blood cells were lysed by ACK buffer (Thermo Fisher Scientific). Then GFP\u003csup\u003e+\u003c/sup\u003e CD4\u003csup\u003e+\u003c/sup\u003e T cells were detected by flow cytometry. Mice were sacrificed on day 15, cervical and axillary lymphoid (CALs) compartments were removed and fresh cells were stimulated with PMA and ionomycin followed by the intracellular staining and FACS detection.\u003c/p\u003e \u003cp\u003e \u003cb\u003eThymic Treg cell expansion and conversion\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e\u003c/p\u003e \u003cp\u003eFACS-sorted thymic Treg cells (CD4\u003csup\u003e+\u003c/sup\u003eCD25\u003csup\u003ehigh\u003c/sup\u003e or CD4\u003csup\u003e+\u003c/sup\u003eGFP\u003csup\u003e+\u003c/sup\u003e cells with 99% purity) from WT B6 or Foxp3\u003csup\u003eGFP\u003c/sup\u003e B6 mice were firstly expanded with anti-CD3/CD28\u0026ndash;coated beads (1 bead: 2 cells) (Invitrogen) and IL-2 (100 U/ml; R\u0026amp;D Systems) for 72h. For in-vitro experiments, Treg cells used in the paper were all from the expanded thymic Treg cells.\u003c/p\u003e \u003cp\u003eFor Treg cell conversion, these expanded Treg cells were cultured in 96-well U-bound plates in X-VIVO 15 medium (LONZA) in the presence or absence of NaCl (40 mM, Sigma-Aldrich) and IL-6 (100ng/ml) for 48h with the stimulation of anti-CD3/CD28\u0026ndash;coated beads (1 bead: 2 cells), which all supplemented with 10% (v/v) fetal bovine serum (FBS) (Gibco, 10099-141), penicillin (100 units/mL) and streptomycin (100 \u0026micro;g/ml). All cells were maintained in a humidified 5% CO2 incubator at 37\u0026deg;C.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn-vitro\u003c/b\u003e \u003cb\u003esuppression assay\u003c/b\u003e\u003c/p\u003e \u003cp\u003eNaive CD4\u003csup\u003e+\u003c/sup\u003e T effectors (2 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e) were stained with carboxyfluorescein succinimidyl ester (CFSE) at 2 \u0026micro;M and cultured with expanded Treg cells (2 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e, titrated down as described) in 96-round-bottom wells in X-VIVO 15 medium (terms as standard media, SM), or with the addition of physiologically relevant 40 mM NaCl (Sigma-Aldrich) in the presence or absence of IL-6 (100ng/ml) for 72h as indicated. Co-cultured cells were also stimulated with anti-CD3/CD28 microbeads (5 cells per bead). The proliferative levels of CFSE-CD4\u003csup\u003e+\u003c/sup\u003e T cell were judged by the rates and intensity of CFSE dilution measured with the flow cytometry.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eFlow-cytometric analysis\u003c/h2\u003e \u003cp\u003eCells from indicated compartments of EAE mice were stained with monoclonal Abs (mAbs) and isotype control. For surface staining, cells were stained with the respective antibodies (anti-mouse CD4, CD25, CD11c, CD86, CD103, IL-23R) for 20 minutes in PBS (eBioscience). For intracellular staining, cells were stimulated with Phorbol 12-Myristate 13-Acetate (PMA) and ionomycin (both 0.25ug/ml; Sigma-Aldrich) for five hours at 37℃ in the presence of brefeldin A (5ug/ml; BioLegend) for the last 4 hours. Cells were fixed and made permeable (Fix/Perm, eBioscience) according to the manufacturer\u0026rsquo;s instructions, and stained with anti-IL-17A-APC (TC11-18H10) and anti-IFNγ-PE. Data were acquired on a FACS Fortessa and analyzed with FlowJo\u0026times;10 software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eTreated or untreated Treg cells were collected for protein extraction using lysis buffer. Protein was blotted onto PVDF membranes via Trans-Blot Turbo Transfer Pack (Bio-Rad), which were then blocked in 5% BSA or 5% non-fat milk in TBST for 1h. The membranes were incubated overnight at 4\u0026deg;C with antibodies against IL-23R (1:1000 ThermoFisher), SGK1 (1:1000 Millipore), p-SGK1 (1:1000 Cell Signaling Technology), and GAPDH (1:1000 Santa Cruz Biotechnology). The following day, the membranes were incubated with HRP-conjugated secondary antibodies for 1h. Immunoreactivities then were visualized by ECL reagent (Beyotime, Shanghai, China). Films were digitally scanned for protein quantification using the NIH Image J software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eReal-Time Quantitative PCR (qPCR)\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from mouse intestines or from expanded Treg cells using RNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer\u0026rsquo;s instructions. RNA was then quantified using NanoDrop 2000/2000c spectrophotometer (ThermoFisher). Next, 1mg cDNA was generated from each RNA sample using the PrimeScript RT reagent kit (TaKaRa, China). One microliter of cDNA was amplified via real-time PCR using GoTaq qPCR Master Mix (Promega) and 10 pmol of primers specific for SGK1 and IL-23R. Both levels of mRNA were normalized to the expression of GAPDH, and were detected with a Bio-Rad CFX96 Touch Real-Time Detection System under the following conditions: initial denaturation for 3 minutes at 95\u0026deg;C, followed by 40 cycles of 10 seconds at 95\u0026deg;C and 1 minute at 57\u0026deg;C. The specificity of the PCR products was determined via melting curve analysis. The fold changes were calculated using the 2\u003csup\u003e-△△Ct\u003c/sup\u003e method. The primer sequences are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e\u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward sequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse sequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-23R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026prime;-GGTCCAAGCTGTCAATTCCCTAGG-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026prime;-AGCCCTGGAAATGATGGACGCA-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSGK1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGAAAGGTTCTTCTGGCTAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACCAGGAAAGGGTGCTTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAldh1a1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGCCCTCAGATTGACAAGGAACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAACACTGTGGGCTGCACAAAGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRdh10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGTTCGCCACATCTACCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCCTCACCTTTTCCAGCTTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCyp26a1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCACAAGCAGCGAAGAAGGTGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACTGCTCCAGACAACTGCTGACTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCyp26b1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCGGCTACCGCACTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTCTCGGATGCTATCATGACACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026prime;-GGCCCCTCTGGAAAGCTGTGG-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026prime;-CCCGGCATCGAAGGTGGAAGA-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003eStatistical analysis\u003c/b\u003e.\u003c/h2\u003e \u003cp\u003eStatistical analysis was performed using Graph Pad Prism Version 5 software and presented if not indicated elsewhere as Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. To calculate differences between groups, student\u0026rsquo;s \u003cem\u003eT\u003c/em\u003e test was used. One-way ANOVA analysis was performed for three or more groups. A value of \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered to be statistically significant (*\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; **\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01; ***\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001; ns, not significant).\u003c/p\u003e \u003c/div\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cstrong\u003eatRA harnesses the proinflammatory effect of tTreg cells modified by the combination of high salt and IL-6\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eWe and others reported that atRA can prevent thymus-derived Treg cells (tTreg cells) from converting to IFN\u0026gamma;- and/or IL-17A-producing T-helper cells, along with the sustained Foxp3 expression and suppressive capacity following encounters with various proinflammatory cytokines\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. Meanwhile, NaCl increased IFN\u0026gamma; secretion in tTreg cells, which in turn markedly impairs the immunosuppressive function of these cells \u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. However, TGF\u0026beta;-induced Treg cells (iTreg cells) are completely stable and fully functional under high salt milieu\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. Hence, whether atRA capably reverses the compromised capacity of tTreg cells driven by high salt is still unclear. tTreg cells (CD4\u003csup\u003e+\u003c/sup\u003eGFP\u003csup\u003e+\u003c/sup\u003e) were sorted from Foxp3\u003csup\u003e\u0026minus;\u0026thinsp;GFP\u003c/sup\u003e knock-in mice and expanded for 3 days. Then cells were divided into four groups: standard media group (SM), high-salt (40 mM NaCl) media group (control), high-salt media group added with DMSO (DMSO) or added with atRA (atRA) for another 48h activation. GFP, IFN\u0026gamma; and IL-17A expression on these cells were examined by flow cytometry. First, we observed that there was no significant GFP loss in each group (\u003cstrong\u003eFig. \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003eA\u003c/strong\u003e). Meanwhile, the barely detectable cytokine levels of IFN\u0026gamma; and IL-17A expression also have no evident changes among the four groups (\u003cstrong\u003eFig. \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003eB\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eNext, using the unchanged culture system and grouping, we tested the influence of the combined stimulation of NaCl with IL-6 (100 ng/mL) on tTreg cells. As shown in \u003cstrong\u003eFig.\u0026nbsp;1A\u003c/strong\u003e, after 48 hours culture, tTreg cells from SM group shown 88% GFP expression. When it turns to NaCl plus IL-6 culture system, only 81% of the GFP was maintained (control group), indicating that NaCl plus IL-6 may have synergistic effect on destabilizing Foxp3 expression. Additionally, cells from DMSO added groups have minimum GFP% changing when compared to the cells from control group. However, atRA addition carried out striking retainment or even increase the GFP expression in comparison to the control (\u003cstrong\u003eFig.\u0026nbsp;1A\u003c/strong\u003e). Then, IFN\u0026gamma; and IL-17A expression of these cells stimulated with NaCl plus IL-6 were detected by FACS (\u003cstrong\u003eFig.\u0026nbsp;1B\u003c/strong\u003e). As expected, the two combined stimulants markedly promote the increase of IL-17A expression on total tTreg cells, compared to SM group. The obviously different IL-17A-postive cell proportion were not seen between the control and DMSO group. Identically, atRA addition significantly suppressed IL-17A expression (\u003cstrong\u003eFig.\u0026nbsp;1B, C\u003c/strong\u003e). Additionally, there was little difference in total cell number from each plate (data not shown), which suggested that inhibitory effect of atRA on IL-17A expression was not related to the cell death, which may be a cell-intrinsic manner. We did not find significant change of the frequency of IFN\u0026gamma; expression in tTreg cells compared within the four groups (\u003cstrong\u003eFig.\u0026nbsp;1B, C\u003c/strong\u003e). Previous studies demonstrated that atRA not only sustained the Foxp3 expression but also enhanced the suppressive activities. Therefore, cells from separate well were harvested after 48h culture, and the immunosuppressive function was examined using a standard CFSE-labeled co-culture assay. As shown in \u003cstrong\u003eFig.\u0026nbsp;1D\u003c/strong\u003e, SM-tTreg cells displayed a strong suppression of T-cell proliferation, while (NaCl\u0026thinsp;+\u0026thinsp;IL-6)-tTreg had a nearly two-fold loss of their immunosuppression at the ratio of Treg cells : T responder cells is 1:1 and 1:2. However, tTreg cells from the atRA-added group almost maintained their suppressive activity, which the most significant difference occurred when the ratio was at 1:3 (\u003cstrong\u003eFig.\u0026nbsp;1D, E\u003c/strong\u003e). Taken together, these results clearly indicate that atRA significantly diminished the pro-inflammatory modifications on tTreg cells loaded by the synergistic effect of high salt and IL-6.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eatRA infusion increases the frequency of Treg cells and inhibits the conversion to Th17-like cells in na\u0026iuml;ve mice.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo examine whether atRA infusion in high salt diet (HSD) fed na\u0026iuml;ve mice alters the peripheral Treg population \u003cem\u003ein vivo\u003c/em\u003e, atRA was intraperitoneally (i.p.) injected into na\u0026iuml;ve Foxp3\u003csup\u003e\u0026minus;\u0026thinsp;GFP\u003c/sup\u003e reporter mice. HSD group received a sodium-rich chow containing 6% NaCl and tap water containing 1%NaCl. CD4\u003csup\u003e+\u003c/sup\u003eGFP\u003csup\u003e+\u003c/sup\u003e T cell frequency in blood was measured on day 7 and 15. DMSO- infused mice are as a control. As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA, there is no significant change of the GFP\u003csup\u003e+\u003c/sup\u003e Treg cell proportion from the peripheral blood in each group on day 7. However, we found that the markedly increase of GFP proportion in atRA-infused group on day 15 compared to that HSD only or DMSO-infused group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA, B). Meanwhile, HSD does not influence the Foxp3-GFP expression in relation to the normal salt diet (NSD). We next examined the effects of atRA on other T cell responses from cervical and axillary lymph nodes (CALs). CD4\u003csup\u003e+\u003c/sup\u003eGFP\u003csup\u003e\u0026minus;\u003c/sup\u003e T cells (Teffs) are one of the fastest cell subsets to respond to the immune response. Compared to NSD fed mice, a significant increased frequency of IL-17A and IFN-\u0026gamma; expression in Teffs were determined in HSD fed mice. However, IL-17A expression was remarkedly diminished by atRA infusion (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, D). Meanwhile, IFN-\u0026gamma; expression did not seem to respond significantly to atRA infusion (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC, E). CD44 expression is an indicative marker for effector-memory T cells. We here detected that whether atRA infusion affects the IL-17A expression on memory T cells. Similarly, we found the significant IL-17A expression in HSD- CALs compared to that NSD- controls. Nonetheless, this effect was apparently inhibited by the atRA infusion (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eF). Finally, IL-17A- and/or IFN-\u0026gamma;- positive Treg cells was evaluated. As we expected, HSD group showed significant IL-17A-positve Treg cells compared to NSD group. Like above, atRA also statistically reduced the IL-17A expression in CAL-Treg cells (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eG). IFN-\u0026gamma; expression was not significantly affected (statistical data not shown). Other T helper cells like Th2, Th9 are undetectable. These results indicate that treatment with atRA increases the frequency of Treg cells and decreases IL-17A expression in these cells from nearby lymphoid organs around the brain.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eatRA administration suppresses HSD-provoked EAE.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe above finding that higher proportions and fully function of Treg cells were induced systemically in atRA-treated na\u0026iuml;ve mice under high salt diet prompted us to investigate the therapeutic ability of atRA to prevent HSD-provoked EAE. NSD-fed or HSD-fed EAE mice were conducted and were treated with either atRA or PBS every three days. Disease was firstly observed on day 9 after immunization only in HSD-fed group, but the progression of HSD-EAE was remarkedly reduced in mice treated with atRA, as determined by the assess of amelioration of the clinical scores. HSD-EAE presented significant accelerated clinical severity when compared to NSD-EAE. As with other studies, we also confirmed that atRA significantly ameliorates the NSD-fed EAE progress (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA). Histopathological analysis revealed that under normal salt diet, atRA-treated mice had various degrees of reduced brain-inflammation compared to models. However, this reduction was much statistical significance in HSD-fed groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB). We similarly observed much fewer cellular infiltrates in the spinal cords (SCs) from atRA-treated mice compared to PBS-treated mice in both NSD and HSD groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC). To address how atRA administration shaped T-helper cell immune responses and mitigated EAE, cells in the brains and SCs were analyzed by FACS. HSD significantly promotes both brain-infiltrating (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD, E) and SC-infiltrating (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eG, H) Th17 cell differentiation in comparison to NSD group. Furthermore, Th17 population in brains and SCs was dramatically decreased in that mice administrated with atRA not only in NSD-fed but also in HSD-fed group compared to those diet paired models respectively (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD, E, G, H). We did not observe the increased proportion of brain-infiltrating (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD, F) and SC-infiltrating (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eG, I) Th1 cells in HSD models compared to NSD controls. Nonetheless, the decreased Th1 proportion was detected in both brains and SCs in HSD or NSD fed atRA-treated groups compared to that diet-paired models (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD, F, G, I). Given that Treg cells are critical for harnessing the CNS inflammation in EAE, we then analyzed CD4\u003csup\u003e+\u003c/sup\u003eGFP\u003csup\u003e+\u003c/sup\u003e cells in brains and SCs. On the one hand, we did not find the significant promotion of Treg cells in brains (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eJ, K) and spinal cords (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eL, M) from HSD-EAE mice, but only observed an increasing trend compared to NSD-EAE controls. On the other hands, under normal salt diet, atRA increases Treg cell proportion in both brains and SCs compared to model group, but not reaching statistical significance. However, atRA significantly enhances Treg cell frequency in both brains (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eJ, K) and SCs (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eL, M) under high salt diet compared to that model mice. These results suggest that systemic atRA treatment ameliorates EAE, particularly the HSD-provoked EAE by decreasing Th17, Th1 cells and increasing Treg cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eatRA treatment inhibited the Th17-like Treg cell development in cervical and axillary lymph nodes from the HSD-fed EAE mice\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eThe cervical and axillary lymph nodes (CALs) are nodes where the CNS and peripheral immune cells flow. Hence, we explored whether atRA administration \u003cem\u003ein vivo\u003c/em\u003e can increasing the CAL-Treg cell population and weaken their plasticity. As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA, the NSD-fed EAE mice treated with atRA showed profoundly increased expressions of CD4\u003csup\u003e+\u003c/sup\u003eGFP\u003csup\u003e+\u003c/sup\u003e cells in CALs compared with the NSD-fed mice treated with vehicle. Also, atRA-treated HSD-fed EAE mice showed the significantly rising proportions of CD4\u003csup\u003e+\u003c/sup\u003eGFP\u003csup\u003e+\u003c/sup\u003e cells compared with the HSD-fed controls (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA). Whether the increased number of CAL-Treg cells accompanied with increased stability? The total pooled NAL-cells were stimulated \u003cem\u003eex vivo\u003c/em\u003e followed by the intracellular detection of IL-17A and IFN-\u0026gamma; by FACS. We clearly determined that although HSD significantly promote IL-17A production in GFP-positive Treg cells, atRA treatment markedly inhibited IL-17A\u0026thinsp;+\u0026thinsp;Treg cell development, whereas the most obvious difference was between the HSD-fed two groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB, C). Similarly, proportion of Th1-like Treg cells was higher in NSD-fed than in HSD-fed models. Unlike the Th17-like Treg cells, atRA failed to suppress IFN-\u0026gamma;-positive tTreg cell development under normal salt diet. However, this suppressive effect was strikingly reversed under high salt diet, whereas proportion of IFN-\u0026gamma;-positive tTreg cell was sharply decreased from atRA-administrated HSD- fed EAE mice compared to that HSD-fed controls (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB, D). To deeply address how atRA treatment may have shaped Treg cell immune responses and ameliorated EAE, we analyzed ROR\u0026gamma;t and granulocyte-macrophage colony stimulating factor (GM-CSF) expression in CAL-Tregs, which the key pro-encephalomyelitic molecules both are essential for the pathogenicity of Th17 cells by FACS.\u003c/p\u003e\n\u003cp\u003eAs we expected, significant increased proportion of ROR\u0026gamma;t-positive Treg cells was examined in HSD models compared to NSD controls. Treatment of mice under HSD with atRA have much lowered number of CD4\u003csup\u003e+\u003c/sup\u003eROR\u0026gamma;t\u003csup\u003e+\u003c/sup\u003e cells in relation to the HSD models (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). We did not find significant decrease in atRA-treated mice in comparison to the controls both were under normal salt diet (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eE, F). Next, proportions of GM-CSF-positive CAL-Treg cells were evaluated in each group. atRA treatment significant inhibited GM-CSF expression in CAL-Treg cells compared to the controls, both from the NSD fed groups, whereas the difference was even greater from the HSD fed groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eG). Co-expression of ROR\u0026gamma;t and GM-CSF in Treg cells is critically required for the pathogenic lineage commitment of Th 17 subset\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. We here finally evaluated the frequency of ROR\u0026gamma;t\u003csup\u003e+\u003c/sup\u003e GM-CSF\u003csup\u003e+\u003c/sup\u003e CAL-Treg cells in these EAE mice. The results indicated that the HSD-fed EAE mice showed the significant increase of these cells compared to NSD-fed EAE controls. However, treatment with atRA suppressed ROR\u0026gamma;t\u003csup\u003e+\u003c/sup\u003e GM-CSF\u003csup\u003e+\u003c/sup\u003e CAL-Treg cell expansion under NSD. The profound suppression was found in HSD-fed groups, which atRA treatment resulted in a substantial reduction in these Treg cells (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eH). The striking reduction of ROR\u0026gamma;t\u003csup\u003e+\u003c/sup\u003e GM-CSF\u003csup\u003e+\u003c/sup\u003e CAL-Treg cells likely explains why a high-salt diet does not produce an excessive central and peripheral inflammatory responses to atRA administration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eatRA mediates anti-inflammatory activity largely through an IL-23R-dependent but SGK1-independent manner\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eSGK1 activated by high salt plays a critical role in the regulation of Th17/Treg cell balance by regulating its downstream target, IL-23R expression\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Although the links among high salt, SGK1 and Treg cell differentiation remain well defined, there are little studies focus on exploring whether some known drugs can modulate these context-dependent regulatory functions mediated weaken the high salt-induced excessive inflammation. Our next experiments were done to examine whether the suppressive effect of atRA on high salt-evoked inflammatory damage is through the inhibition of these key molecules. We first examined SGK1 and p-SGK1 expression in Treg cells. Expanded thymic Treg cells were harvested and put into the normal salt (NS) or high salt (HS) culture medium for another 48h whereas some wells atRA or DMSO control were initially added in the presence of anti-CD3/CD28 microbeads stimulation and IL-2 addition. As shown in \u003cstrong\u003eFigure \u003cspan class=\"InternalRef\"\u003eS2\u003c/span\u003eA\u003c/strong\u003e, high salt apparently promoted \u003cem\u003eSgk1\u003c/em\u003e mRNA expression in HS-Treg cells compared to HS-Treg cells, which was consistent with previous reports. Beyond our thought, the \u003cem\u003eSgk1\u003c/em\u003e mRNA was not only decreased but increased to some extent after the addition of atRA (\u003cstrong\u003eFig. \u003cspan class=\"InternalRef\"\u003eS2\u003c/span\u003e A\u003c/strong\u003e). In rapid sequence, the levels of total and phosphorylated SGK1 proteins were quantified by Western Blot. In line with the mRNA expression, the obviously increased SGK1 and pSGK1 expression were found in HS group compared to NS group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). However, neither atRA-added NS nor HS group showed the decreased expression of the two molecules. Conversely, atRA increased the expression of total SGK1 in some degrees (\u003cstrong\u003eFig. \u003cspan class=\"InternalRef\"\u003eS2\u003c/span\u003e B, C\u003c/strong\u003e). Furthermore, atRA significantly increased the level pSGK1 both from the NS-cultured or HS-cultured medium in relation to that control respectively (\u003cstrong\u003eFig. \u003cspan class=\"InternalRef\"\u003eS2\u003c/span\u003e B, D\u003c/strong\u003e). These data promoted us to evaluate IL-23R expression, one of the downstream targets of SGK1. Interestingly, HS-Treg cells displayed much elevated \u003cem\u003eil-23r\u003c/em\u003e expression in relation to NS-Treg cells. However, atRA addition significantly downregulated \u003cem\u003eil23r\u003c/em\u003e mRNA expression in either high-salt or normal-salt environment (\u003cstrong\u003eFig.\u0026nbsp;5A\u003c/strong\u003e). Consistent with the quantitative PCR data, WB also corroborates the protein of IL-23R expression was markedly upregulated in HS-Treg cells in comparision to the NS-controls. Identically, atRA strongly inhibited IL-23R protein expression under normal salt condition (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Even under the high salt milieu, atRA also exhibited profound inhibition to IL-23R expression (\u003cstrong\u003eFig.\u0026nbsp;5B, C\u003c/strong\u003e). At last, whether atRA administration can inhibit IL-23R expression in Treg cells \u003cem\u003ein vivo\u003c/em\u003e. CAL-Treg cells were polled from the model or treated mice on day 28 as indicated in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e. Proportions of IL-23R-positive CAL-Treg cells were assessed by FACS.\u003c/p\u003e\n\u003cp\u003eThe results showed that HSD significantly increase IL-23R\u003csup\u003e+\u003c/sup\u003e CAL-Treg cell development compared to NSD. Treatment with atRA decreased the frequency of these cells in CALs from NSD-fed groups. Meanwhile, there was a pronounced decline of IL-23R\u003csup\u003e+\u003c/sup\u003e CAL-Treg cells in atRA-treated HSD-fed EAE mice compared to that HSD-fed controls (\u003cstrong\u003eFig.\u0026nbsp;5D, E\u003c/strong\u003e). Together, these data strongly suggest that atRA significantly attenuated the effect of high salt on the instability of Treg cells, of which the underlying mechanism was possibly IL-23R but not SGK1 dependent.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnti-IL-23R antibody ameliorates high salt-driven EAE progress\u003c/strong\u003e \u003cstrong\u003ein vivo\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eTo further examine whether IL-23 receptor blockade has the therapeutic impact on high salt-provoked EAE pathogenesis. Anti-IL-23R mAb or the control vehicle was administered intraperitoneally into mice, and the whole disease process was monitored.\u003c/p\u003e\n\u003cp\u003eAs shown in \u003cstrong\u003eFig. S3A\u003c/strong\u003e, under normal salt diet we only observed the significant clinical remission by anti-IL-23R mAb administration on day 22 and 25. Next, The CNS-infiltrating Th1 and Th17 cell proportion were examined on day 28. There were no significant differences of Th1 or Th17 cells in the brains from the anti-IL-23R mAb administration group in relation to that model or vehicle-treated group (data not shown). However, we still determined that the SC-infiltrating Th17 cell frequency was significantly reduced in the administrated group compared to model and vehicle- administrated control (\u003cstrong\u003eFig. S4B, C\u003c/strong\u003e). Synchronously, the treatment effect of anti-IL-23R mAb was evaluated under high salt diet. As shown in \u003cstrong\u003eFig.\u0026nbsp;6A\u003c/strong\u003e, the anti-IL-23R mAb-treated groups showed the significant alleviation in the EAE remission period on day 22, 25, 28 compared to model or vehicle-treated groups. Furthermore, there was a significant reduction of brain-Th17 cells from the mAb-treated mice in comparison to other two groups (\u003cstrong\u003eFig.\u0026nbsp;6B, C\u003c/strong\u003e). The brian-Th1 cells from the mAb-treated mice showed a certain downward trend (\u003cstrong\u003eFig.\u0026nbsp;6B, C\u003c/strong\u003e). Cells from spinal cord were next analyzed. Both Th17 and Th1 cells had a significant decrease in mAb-treated groups compared to other two groups (\u003cstrong\u003eFig.\u0026nbsp;6D, E\u003c/strong\u003e). Taken together, these data suggest that IL-23R blockade does have the therapeutic potential in treating EAE, which the effect seemed to be evident in HSD-exacerbated EAE model. In other words, IL-23R blockade may be a means of specific resistance to high salt.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eatRA ameliorates high salt-driven intestinal immune responses in EAE mice\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eIt has been well-established that vitamin A and its endogenous metabolites, such as atRA are crucial for normal metabolism, resistance to infection, and enhanced immunity\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Endogenous atRA is most produced by different cell types in the intestine, especially the CD103\u003csup\u003e+\u003c/sup\u003eCD11c\u003csup\u003e+\u003c/sup\u003e dendritic cells (CD103\u003csup\u003e+\u003c/sup\u003eDCs)\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. High salt diet has been shown to exacerbate experimental colitis, which is associated with reduction in \u003cem\u003eLactobacillus\u003c/em\u003e, one of the gut microbiota that produces atRA\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. Collectively, we hypothesized that high salt diet can impact the intestinal CD103\u003csup\u003e+\u003c/sup\u003e DCs and/or the genes associated with retinoic acid metabolic pathway. Therefore, we analyzed the frequency of CD103\u003csup\u003e+\u003c/sup\u003e DCs and Treg cells in the lamina propria (LP) on day 28. Using the gating strategy outlined in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eA, we confirmed that HSD-fed EAE mice show an increased frequency of CD103\u003csup\u003e+\u003c/sup\u003e DCs compared to the NSD-fed mice, but the difference was not significant. However, atRA intraperitoneal injection increased the ratio of these DCs both in HSD- and NSD-fed mice compared to that respective model controls, from which the more significant difference was showed in the HSD groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eB). Given that intestinal CD103\u003csup\u003e+\u003c/sup\u003e DCs are probably tolerogenic and with decreased antigen presenting function, the expression of CD80, CD86 and CD40 were examined by FACS. The similar result was observed that atRA treatment apparently decreased CD86 expression in CD103\u003csup\u003e+\u003c/sup\u003e DCs compared to the indicated controls, from which the difference was more pronounced in HSD-fed two groups than in NSD-fed groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eC). LP-Treg cells were also analyzed simultaneously. There was no significant difference between HSD-fed and NSD-fed model mice. However, atRA administration not only increased the CD4\u003csup\u003e+\u003c/sup\u003eGFP\u003csup\u003e+\u003c/sup\u003e cells in NSD-fed but also in these HSD-fed mice (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eD). Furthermore, IL-23R expression in the LP-Treg cells was also examined. In contrast to the CD103\u003csup\u003e+\u003c/sup\u003e DCs, HSD induced much more IL-23R\u003csup\u003e+\u003c/sup\u003e Treg cells than NSD. There was a significant increase of these cell proportion from the atRA-treated NSD-fed mice in relation to NSD-fed controls (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\n\u003cp\u003eAdditionally, this phenomenon was of great significance between HSD-fed two groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eE). We also confirmed that IL-23R\u003csup\u003e+\u003c/sup\u003e LP-Treg cells was positively correlated to IL-23R\u003csup\u003e+\u003c/sup\u003e CAL-Treg cells (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eF). At last, the mRNA expression levels of the key genes of atRA metabolism-related pathways, such as \u003cem\u003eAldh1a1, Rdh10, Cyp26a1, Cyp26b1\u003c/em\u003e in the small intestines were evaluated. The data showed that high salt significantly downregulated \u003cem\u003eAldh1a1\u003c/em\u003e and \u003cem\u003eRdh10\u003c/em\u003e expression compared to NSD (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eG). However, atRA treatment obviously upregulated the expression of the two genes in both NSD and HSD group. We did not find significant differences of \u003cem\u003eCyp26a1\u003c/em\u003e and \u003cem\u003eCyp26b1\u003c/em\u003e mRNA expression from the groups (data not shown). Taken together, these data suggest that high salt might impair the intestinal retinoic acid metabolism process in the EAE mice. This abnormality may link to the increased IL-23R expression in Treg cells from the LPs and CALs, resulting in significant aggravation of their pathogenic function \u003cem\u003ein vivo\u003c/em\u003e. Thus, exogenous atRA supplementation may directly or indirectly repair the retinoic acid metabolic signaling pathway, contributing to impeding the HSD-enhanced IL-23R expression in Treg cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnti-IL-23R inhibits high salt-increased IL-23R expression in Treg cells and enhances retinoic acid metabolism-related genes\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eAs the impact of Anti-IL-23R mAb may seem particularly striking on HSD-induced Th17 cell development and EAE severity, we next examined more closely the effect of Anti-IL-23R on the IL-23R\u003csup\u003e+\u003c/sup\u003e Treg cells and the restoration of retinoic acid signaling in the intestine from the EAE mice under high salt diet. The frequency of Treg cells and CD11c\u003csup\u003e+\u003c/sup\u003eCD103\u003csup\u003e+\u003c/sup\u003e DCs in the intestine was firstly analyzed. Comparison of anti-IL-23R treated recipients and model controls demonstrated a significant increase in GFP\u003csup\u003e+\u003c/sup\u003e LP-Treg cells (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eA, B). Meanwhile, there were distinct lower IL-23R-positive Treg populations in the LPs from anti-IL-23R treatment mice than vehicle or model controls (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eC, D). Similarly, IL-23R-positive Treg cells were also found in CALs, which had a significant increase from the anti-IL-23R-treated group compared to the cells from model or vehicle-treated group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eE). Moreover, CAL-Treg cells from the anti-IL-23R but not vehicle treated recipients significantly reduced IL-17A production (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eF), whereas IFN-\u0026gamma; expression was not significantly altered (data not shown). Consistent with the result from the atRA-treated HSD-fed mice showed in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eF, significant positive correlation was also discovered between the IL-23R\u003csup\u003e+\u003c/sup\u003e LP-Treg cells and IL-23R\u003csup\u003e+\u003c/sup\u003e CAL-Treg cells (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eG). Moreover, the number of CD11c\u003csup\u003e+\u003c/sup\u003eCD103\u003csup\u003e+\u003c/sup\u003e DCs was significantly increased in the LPs from anti-IL-23R-treated recipients when compared with those of vehicle-treated or model mice (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eH). The antigen presenting molecules, such as CD80, CD86, CD40 were also examined. As we expected, CD86 expression was much decreased in CD11c\u003csup\u003e+\u003c/sup\u003e DCs from anti-IL-23R-treated mice (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eI). No significant differences were observed from the CD80 and CD40 expression (data not shown). In the end, whether anti-IL-23R treatment has the effect on the genes-related to retinoic acid metabolic pathway, we measured \u003cem\u003eAldh1a1, Rdh10\u003c/em\u003e expression from the small intestinal tissue by qPCR. The results revealed the significant lower expression of the two genes in HSD-fed EAE mice than NSD-fed controls. However, anti-IL-23R treatment strikingly enhanced \u003cem\u003eAldh1a1\u003c/em\u003e level compared with model group under high salt diet (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eJ). \u003cem\u003eRdh10\u003c/em\u003e expression was slightly increased (data not shown). Thus, systematically down-regulation of the IL-23R may assist in repairing retinoic acid metabolic pathway, suppressing Th17-like Treg cells development, and ultimately reducing HSD-accelerated EAE severity overall.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eIt is increasingly recognized that aberrant Treg cell responses can develop within CNS and, as a consequence, can cause neuroinflammation, demyelination, and dysfunction\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. Various stimulants can impair the immunosuppressive function of Treg cells, which are known to be several proinflammatory cytokines, traffic-related PM (2.5), glucose intake, and high salt diet, etc\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. High salt diet aggravates neuroinflammation and accelerates the development of experimental autoimmune encephalomyelitis (EAE) via initiating Th17 responses and compromising thymic Treg cell activities\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Treg cells are vulnerable and can be switched to other T effector cell subsets, including Th1, Th2, and Th17 cells, accompanied by the downregulation of Foxp3 and a decrease in their inhibitory function\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. In a previous work, we elucidated that atRA, the active derivative of vitamin A, has a pivotal role in maintaining the stability and functionality of Treg cells in the presence of IL-6 mediated by the inhibition of IL-6R /CD126 expression and its related signaling by Treg cells\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. The current study demonstrates that atRA treatment are able to exert a significant effect on harnessing the high salt-induced inflammatory responses, whereas IL-23R serves as an indispensable link between the efficacy of atRA treatment and the restraint of high salt-provoked inflammatory responses in the context of CNS inflammation.\u003c/p\u003e\n\u003cp\u003eFirstly, we investigated that systemic administration of atRA induced Treg cell differentiation and downregulated the infiltration of inflammatory T helper cells in the CNS from both na\u0026iuml;ve mice and MOG\u003csub\u003e35\u0026thinsp;\u0026minus;\u0026thinsp;55\u003c/sub\u003e-induced EAE. From an immune-functional point of view, atRA in vitro completely repairs high salt diminished functional activities of Treg cells, and significantly maintains the stability of Treg cells which are resistant to the expression of IL-17A and IFN-\u0026gamma;. Our \u003cem\u003ein vivo\u003c/em\u003e data illustrated that atRA administration ameliorates high salt exacerbated EAE development, which is characterized by decreased clinical scores and less lymphocytic infiltrates in the brains and spinal cords by HE staining. The possible mechanisms could be attributed to decreased encephalitogenic Th17 and/or increased Treg cell proportion in CNS. On the other hand, encephalitogenic Treg cells were not studied here in this paper due to the technique difficulties and not enough cells mount. Nonetheless, lymphatic drainage of the CNS is associated with lymph nodes in the neck and axillary (NALs). Next, by examining the T helper cell responses in NALs, we indeed found that in the atRA administration groups more Treg cells were generated in both normal salt diet (NSD)-fed and high salt diet (HSD)-fed mice along with markedly reduction of Th17 cells, whereas Th1 cells only diminished from the HSD-fed mice. Meanwhile, atRA-treated NALs-polled Treg cells showed strikingly decreased GM-CSF and ROR\u0026gamma;t expression, of which the co-expression of the two molecules are identified as pathogenic Th17 cells\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. These results clearly provide cellular mechanisms atRA administration can markedly reverses the destructive effects of HSD on EAE, and this efficacy may be related to the stabilization of Treg cells by atRA. Initial studies have revealed that excessive salt enhances Th17 cell differentiation through the SGK1-IL-23R signaling pathway, and SGK1 is also critical for destabilizing the Treg cell stability\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. Hence, we hypothesize that atRA possibly inhibits SGK1 and/or its downstream target IL-23R. Unexpectedly, our \u003cem\u003ein vitro\u003c/em\u003e data show that both the Treg cells and atRA-pretreated Treg cells has the elevated SGK1 expression transcriptionally and translationally. And this changed are more significant under the high salt condition. Growing evidences have indicated that as a hub of multiple signal transduction pathways, SGK1 plays essential roles in cell proliferation, corticoid metabolism, autoimmune inflammation responses, etc\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. In addition, atRA also plays a variety of powerful roles in cell growth and the cell development cycle. So that may explain why atRA promotes SGK1 expression due to the identical function of the promotion of cell proliferation.\u003c/p\u003e\n\u003cp\u003eSince SGK1 was not an option, we then focused on its downstream regulatory molecule, IL-23R. Although previous study demonstrated that retinoic acid inhibits the expression of IL-6R\u0026alpha;, IL-23R and thus inhibits Th17 differentiation, the molecular and regulatory mechanism by which atRA inhibits high salt-driven Treg cell conversion via IL-23R signaling has not been addressed\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. Our further mechanism study showed that atRA rescues the compromised suppressive function of Treg cells by high salt, which might be via the inhibition of IL-23R expression in Treg cells. Several pieces of experimental evidence support this view. First, atRA did decrease IL-23R mRNA and protein expression in murine Treg cells in vitro. This efficacy is rather apparent, when the culture system is with additional NaCl. Second, the in vivo therapeutic results also confirmed that anti-IL-23R mAb administration attenuates the clinical scores of EAE. Intriguingly, this phenomenon is also obviously presented under high salt diet rather than normal salt diet. Moreover, we further correlated the IL-23R expression in VAL-Treg cells with that in intestinal-Treg cells which showed a significant positive correlation with each other. These elucidations of atRA -repaired the compromised Treg cell capacity through the inhibition of IL-23R in Treg cells provides a previously unrecognized potential therapeutic targets for high salt-mediated exacerbation of autoimmunity.\u003c/p\u003e\n\u003cp\u003eNext, we seek whether high salt disturbs the endogenous vitamin A metabolism pathway in the intestine, leading to the pathogenesis of EAE. Several pieces of previous experimental evidence support this view. First, studies have shown that the level of endogenous vitamin A was reduced in ulcerative colitis, which was negatively associated with the colonic IL-23R expression and was positively correlated with the disease activity\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. Second, high salt intake affects the gut microbiome in mice, particularly by depleting Lactobacillus murinus, leading to the worsening EAE course\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. However, oral administration of L. murinus ameliorates high salt-induced exacerbation of actively-induced EAE\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. Meanwhile, it is known that gut bacteria Lactobacillus intestinalis metabolized vitamin A and specifically restored retinoic acid levels in the mice gut\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. Third, intestinal CD103\u0026thinsp;+\u0026thinsp;dendritic cells are known to drive the differentiation of gut-homing Treg cells by metabolizing vitamin A and producing retinoic acid\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. In line with these findings, we found that high salt increased CD86 and IL-23R expression in CD11c\u003csup\u003e+\u003c/sup\u003e DC and Treg cells in lamina propria. However, atRA decreased CD86 and increased CD103 expression in CD11c\u003csup\u003e+\u003c/sup\u003e DCs, and promoted Treg cell development but inhibits IL-23R expression in the LPs. Importantly, the two key enzymes (\u003cem\u003eAldh1a1\u003c/em\u003e and \u003cem\u003eRdh10\u003c/em\u003e) that regulate the retinoic acid synthesis were decreased in high salt-fed EAE mice\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. However, atRA significantly reversed and even enhanced the levels of the genes. These results suggest that atRA may convert antigen-presenting into tolerogenic function of LP-CD11c\u003csup\u003e+\u003c/sup\u003eDC, and that conversion may link to the decreased IL-23R expression in LP-Treg cells. Additionally, we further demonstrated that IL-23R blockade did inhibit high salt-driven EAE process, which may result from the increased proportions of CD103\u003csup\u003e+\u003c/sup\u003eCD11c\u003csup\u003e+\u003c/sup\u003e DC and Treg cells, and also the diminished IL-23R expression in Treg cells. Whether and, if so, anti-IL-23R blockade can ameliorate the EAE development, especially the high salt-evoked EAE remains unclear. The current study clearly shows that the anti-IL-23R mAb administration partially attenuates EAE progress, but markedly decreased the severity of high salt-driven EAE. Additionally, the increased proportion of Treg cell and CD103\u003csup\u003e+\u003c/sup\u003eCD11c\u003csup\u003e+\u003c/sup\u003e DC in the LPs, and the decreased IL-23R expression in LP-Treg cell possibly contribute to the therapeutic effect of anti-IL-23R mAb. And the key enzymes \u003cem\u003eAldh1a2\u003c/em\u003e, decreased by high salt was also reversed via the anti-IL-23R blockade.\u003c/p\u003e\n\u003cp\u003eOur data highlight the compromised retinoic acid signaling in high salt-driven EAE mice leads to the IL-23R expression in Treg cells. In other words, IL-23R as a salt-sensitive target contributes to the therapeutic potential of systematic atRA supplementation. But the experiment is still limited in depth and precision and needs to be validated using the transgenic mouse. Although IL-23R may systematically influence the Treg stability and function \u003cem\u003ein vivo\u003c/em\u003e, not excluding the possibility that other immune cells may be contributors of similar importance. Additionally, we demonstrated that atRA repaired the compromised intestinal retinoic acid signaling, a finding that needs to be addressed in more detail \u003cem\u003ein vivo\u003c/em\u003e. Considering this limitation, it suggests that the interaction between endogenous RA metabolic signaling and IL-23/IL-23R signaling under high salt diet need to be thoroughly investigated. In conclusion, high salt consumption not only leads to hypertension, cardia-cerebrovascular disease but also additionally drive autoimmunity. There is still a long way to go to promote low salt diet in the population. Therefore, the development of discovering ways to combat the proinflammatory effects of a high-salt diet is an intriguing new avenue for many aberrant Treg/Th17 cell-associated autoimmune diseases. Our experimental data suggest that one of the active metabolites of vitamin A, atRA might serve as a potential resistant agent to counteract salt-sensitive conditions. Meanwhile, the identification of IL-23R as a \u0026lsquo;natural inhibitor\u0026rsquo; of high salt-compromised Treg cells in mice could serve as a basis for the development of novel prevention and treatment strategies.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAUTHORS\u0026rsquo; CONTRIBUTIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJT, YW, HL and YL jointly completed the experiment of this study. JT and YL wrote the original draft. XW and YG processed the data. JT and YW collected the data. HW edited the draft. HW and YL designed the study. YG and YL contributed to the project administration. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFUNDING\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (81960293); the Natural Science Foundation of Gansu Province (20JR5RA3); the Joint Research Fund of Gansu Province (23JRRA1495), the China Postdoctoral Foundation project (2023M731460); the Lanzhou Chengguan District talent innovation and entrepreneurship project (2023RCCX0021), the Hui-Chun Chin and Tsung-Dao Lee Chinese Undergraduate Research Endowment (LZU-JZH2634) and the First Hospital of Lanzhou University excellent doctoral research start-up fund (ldyyyn2018-23).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAVAILABILITY OF DATA AND MATERIALS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank all the participants in the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Approval and Consent to Participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments in this study were approved by the Institutional Animal Care and Use Committee and the Laboratory Animal Ethics Committee of Lanzhou University First Hospital (No. LDYYLL-2024-199).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Publish\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no financial or non-financial competing interests related to this work.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eYAN X, JIN J, SU X, et al. Intestinal Flora Modulates Blood Pressure by Regulating the Synthesis of Intestinal-Derived Corticosterone in High Salt-Induced Hypertension [J]. Circ Res, 2020, 126(7): 839-53.\u003c/li\u003e\n\u003cli\u003eGAO P, YOU M, LI L, et al. Salt-Induced Hepatic Inflammatory Memory Contributes to Cardiovascular Damage Through Epigenetic Modulation of SIRT3 [J]. Circulation, 2022, 145(5): 375-91.\u003c/li\u003e\n\u003cli\u003eZHANG W C, ZHENG X J, DU L J, et al. High salt primes a specific activation state of macrophages, M(Na) [J]. Cell Res, 2015, 25(8): 893-910.\u003c/li\u003e\n\u003cli\u003eLUO T, JI W J, YUAN F, et al. Th17/Treg Imbalance Induced by Dietary Salt Variation Indicates Inflammation of Target Organs in Humans [J]. Sci Rep, 2016, 6: 26767.\u003c/li\u003e\n\u003cli\u003eKLEINEWIETFELD M, MANZEL A, TITZE J, et al. Sodium chloride drives autoimmune disease by the induction of pathogenic TH17 cells [J]. Nature, 2013, 496(7446): 518-22.\u003c/li\u003e\n\u003cli\u003eYANG X, YAO G, CHEN W, et al. Exacerbation of lupus nephritis by high sodium chloride related to activation of SGK1 pathway [J]. Int Immunopharmacol, 2015, 29(2): 568-73.\u003c/li\u003e\n\u003cli\u003eWANG D, JIN H, SHENG J, et al. A high salt diet protects interleukin 10-deficient mice against chronic colitis by improving the mucosal barrier function [J]. Mol Immunol, 2022, 150: 39-46.\u003c/li\u003e\n\u003cli\u003eWU C, YOSEF N, THALHAMER T, et al. Induction of pathogenic TH17 cells by inducible salt-sensing kinase SGK1 [J]. Nature, 2013, 496(7446): 513-7.\u003c/li\u003e\n\u003cli\u003eHERNANDEZ A L, KITZ A, WU C, et al. Sodium chloride inhibits the suppressive function of FOXP3+ regulatory T cells [J]. J Clin Invest, 2015, 125(11): 4212-22.\u003c/li\u003e\n\u003cli\u003eWU C, CHEN Z, XIAO S, et al. SGK1 Governs the Reciprocal Development of Th17 and Regulatory T Cells [J]. Cell Rep, 2018, 22(3): 653-65.\u003c/li\u003e\n\u003cli\u003eZHANG Y, LUO Y, SHI J, et al. All-trans retinoic acid alleviates collagen-induced arthritis and promotes intestinal homeostasis [J]. Sci Rep, 2024, 14(1): 1811.\u003c/li\u003e\n\u003cli\u003eHONG K, ZHANG Y, GUO Y, et al. All-trans retinoic acid attenuates experimental colitis through inhibition of NF-\u0026kappa;B signaling [J]. Immunol Lett, 2014, 162(1 Pt A): 34-40.\u003c/li\u003e\n\u003cli\u003eCAI W, WANG J, HU M, et al. All trans-retinoic acid protects against acute ischemic stroke by modulating neutrophil functions through STAT1 signaling [J]. J Neuroinflammation, 2019, 16(1): 175.\u003c/li\u003e\n\u003cli\u003eLI Y, SHENG L, JENA P K, et al. Retinoic Acid Signaling Is Compromised in DSS-Induced Dysbiosis [J]. Nutrients, 2022, 14(14).\u003c/li\u003e\n\u003cli\u003eTERATANI T, MIKAMI Y, NAKAMOTO N, et al. The liver-brain-gut neural arc maintains the T(reg) cell niche in the gut [J]. Nature, 2020, 585(7826): 591-6.\u003c/li\u003e\n\u003cli\u003eZHOU X, KONG N, WANG J, et al. Cutting edge: all-trans retinoic acid sustains the stability and function of natural regulatory T cells in an inflammatory milieu [J]. J Immunol, 2010, 185(5): 2675-9.\u003c/li\u003e\n\u003cli\u003eLU L, LAN Q, LI Z, et al. Critical role of all-trans retinoic acid in stabilizing human natural regulatory T cells under inflammatory conditions [J]. Proc Natl Acad Sci U S A, 2014, 111(33): E3432-40.\u003c/li\u003e\n\u003cli\u003eLUO Y, XUE Y, WANG J, et al. Negligible Effect of Sodium Chloride on the Development and Function of TGF-\u0026beta;-Induced CD4(+) Foxp3(+) Regulatory T Cells [J]. Cell Rep, 2019, 26(7): 1869-79.e3.\u003c/li\u003e\n\u003cli\u003eLEE H G, LEE J U, KIM D H, et al. Pathogenic function of bystander-activated memory-like CD4(+) T cells in autoimmune encephalomyelitis [J]. Nat Commun, 2019, 10(1): 709.\u003c/li\u003e\n\u003cli\u003eYAMAZAKI S, MORITA A. Dendritic cells in the periphery control antigen-specific natural and induced regulatory T cells [J]. Front Immunol, 2013, 4: 151.\u003c/li\u003e\n\u003cli\u003eWILCK N, MATUS M G, KEARNEY S M, et al. Salt-responsive gut commensal modulates T(H)17 axis and disease [J]. Nature, 2017, 551(7682): 585-9.\u003c/li\u003e\n\u003cli\u003eCHEN S, REN Z, HUO Y, et al. Targeting the gut microbiota to investigate the mechanism of Lactiplantibacillus plantarum 1201 in negating colitis aggravated by a high-salt diet [J]. Food Res Int, 2022, 162(Pt A): 112010.\u003c/li\u003e\n\u003cli\u003eXIAO Z X, MILLER J S, ZHENG S G. An updated advance of autoantibodies in autoimmune diseases [J]. Autoimmun Rev, 2021, 20(2): 102743.\u003c/li\u003e\n\u003cli\u003eWANG C, WANG J, ZHENG X, et al. Epigenetic regulation is involved in traffic-related PM(2.5) aggravating allergic airway inflammation in rats [J]. Clin Immunol, 2022, 234: 108914.\u003c/li\u003e\n\u003cli\u003eZHANG D, CHIA C, JIAO X, et al. D-mannose induces regulatory T cells and suppresses immunopathology [J]. Nat Med, 2017, 23(9): 1036-45.\u003c/li\u003e\n\u003cli\u003eLU R Q, ZHANG Y Y, ZHAO H Q, et al. SGK1, a Critical Regulator of Immune Modulation and Fibrosis and a Potential Therapeutic Target in Chronic Graft-Versus-Host Disease [J]. Front Immunol, 2022, 13: 822303.\u003c/li\u003e\n\u003cli\u003eXIAO S, JIN H, KORN T, et al. Retinoic acid increases Foxp3+ regulatory T cells and inhibits development of Th17 cells by enhancing TGF-beta-driven Smad3 signaling and inhibiting IL-6 and IL-23 receptor expression [J]. J Immunol, 2008, 181(4): 2277-84.\u003c/li\u003e\n\u003cli\u003eVERMA P, SUBODH S, TIWARI V, et al. Correlation of Serum Vitamin A Levels with Disease Activity Indices and Colonic IL-23R and FOXP3 mRNA Expression in Ulcerative Colitis Patients [J]. Scand J Immunol, 2016, 84(2): 110-7.\u003c/li\u003e\n\u003cli\u003eBONAKDAR M, CZUBA L C, HAN G, et al. Gut commensals expand vitamin A metabolic capacity of the mammalian host [J]. Cell Host Microbe, 2022, 30(8): 1084-92.e5.\u003c/li\u003e\n\u003cli\u003eSCOTT C L, AUMEUNIER A M, MOWAT A M. Intestinal CD103+ dendritic cells: master regulators of tolerance? [J]. Trends Immunol, 2011, 32(9): 412-9.\u003c/li\u003e\n\u003cli\u003eFENG R, FANG L, CHENG Y, et al. Retinoic acid homeostasis through aldh1a2 and cyp26a1 mediates meiotic entry in Nile tilapia (Oreochromis niloticus) [J]. Sci Rep, 2015, 5: 10131.\u003c/li\u003e\n\u003cli\u003eLU K, LIU L, XU X, et al. ADAMTS13 ameliorates inflammatory responses in experimental autoimmune encephalomyelitis [J]. J Neuroinflammation, 2020, 17(1): 67.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"inflammation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ifla","sideBox":"Learn more about [Inflammation](https://www.springer.com/journal/10753)","snPcode":"10753","submissionUrl":"https://submission.nature.com/new-submission/10753/3","title":"Inflammation","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Thymic regulatory T cells (tTreg cells), All-trans retinoid acid (atRA), Experimental autoimmune encephalomyelitis (EAE), Interleukin-23 receptor (IL-23R), Th17 cells, dendritic cells","lastPublishedDoi":"10.21203/rs.3.rs-4186387/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4186387/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHigh salt diet (HSD) is implicated in numerous disorders. HSD boosts Th17 development, compromises the immunosuppressive function of thymic Treg cells leading to the exacerbation of EAE. However, little is known regarding the harness of excessive proinflammatory responses evoked by HSD. Here we show that atRA, a key vitamin A metabolite with multifaceted immunoregulatory properties has the potential to harness the HSD-provoked EAE pathogenesis. Treatment with atRA \u003cem\u003ein vivo\u003c/em\u003e elicited the Treg generation in cervical and axillary lymph nodes (CALs) and in CNS, thus attenuated the HSD-aggravated EAE disease. In-vitro mechanistic studies were also performed by several FACS- and MACS-sorting experiments, followed by cell coculture assays, and the related western blotting or qPCR verification. The final protective mechanism of IL-23R inhibition was studied by administration with anti-IL-23R mAb. atRA reverses the compromised function of high-salt modified tTreg cells contributing to the mitigation of HSD-provoked EAE. atRA protects Treg cell against high-salt modification via the repression of IL-23R but not SGK1 signaling. atRA also repairs the perturbed endogenous retinoic acid metabolic signaling under HSD, whereas systematic inhibition of IL-23R had a moderate therapeutic potential in inhibiting inflammatory effects of high salt. In conclusion, administration of atRA might be a way to combat the proinflammatory effects of HSD. Meanwhile, the identification of IL-23R as a \u0026lsquo;natural inhibitor\u0026rsquo; of high salt-compromised Treg cells in mice could serve as a basis for the identification of novel therapeutic strategies against HSD-driven autoimmune disorders.\u003c/p\u003e","manuscriptTitle":"atRA mitigates high salt-driven EAE by stabilizing Treg cell mediated the inhibition of IL- 23R and the repairment of compromised endogenous RA signaling","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-03 15:49:59","doi":"10.21203/rs.3.rs-4186387/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2024-04-22T17:25:10+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-20T02:34:46+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-18T17:16:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"7d5b6fbc-534b-4868-8a5d-28a32c558d11","date":"2024-04-01T08:55:21+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"9321ac4a-90a5-4eac-a628-899eb3639137","date":"2024-03-31T21:58:33+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"7f644feb-03b6-4669-babd-19712a2898ba","date":"2024-03-30T13:23:31+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-03-29T18:26:25+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-03-29T09:15:44+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-03-29T09:15:44+00:00","index":"","fulltext":""},{"type":"submitted","content":"Inflammation","date":"2024-03-29T07:39:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"inflammation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ifla","sideBox":"Learn more about [Inflammation](https://www.springer.com/journal/10753)","snPcode":"10753","submissionUrl":"https://submission.nature.com/new-submission/10753/3","title":"Inflammation","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"bc96f9cb-d646-4194-9260-5806f1f1a62a","owner":[],"postedDate":"April 3rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-08-26T16:07:00+00:00","versionOfRecord":{"articleIdentity":"rs-4186387","link":"https://doi.org/10.1007/s10753-024-02130-2","journal":{"identity":"inflammation","isVorOnly":false,"title":"Inflammation"},"publishedOn":"2024-08-21 15:57:01","publishedOnDateReadable":"August 21st, 2024"},"versionCreatedAt":"2024-04-03 15:49:59","video":"","vorDoi":"10.1007/s10753-024-02130-2","vorDoiUrl":"https://doi.org/10.1007/s10753-024-02130-2","workflowStages":[]},"version":"v1","identity":"rs-4186387","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4186387","identity":"rs-4186387","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}