Rare earth transfer films enhance the photosynthetic efficiency of strawberry plants, thereby improving fruit quality and yield

Rare earth transfer films enhance the photosynthetic efficiency of strawberry plants, thereby improving fruit quality and yield | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Rare earth transfer films enhance the photosynthetic efficiency of strawberry plants, thereby improving fruit quality and yield Liyuan Zhao, Ru Li, Mengyao Shi, Bing-Bing Cai, Guihong Zhou, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6877648/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 06 Nov, 2025 Read the published version in BMC Plant Biology → Version 1 posted 13 You are reading this latest preprint version Abstract Light plays a particularly important role in the growth and development of plants, affecting almost all growth stages. Light conversion film can provide the red‒orange light and blue‒violet light necessary for plant photosynthesis, promoting the growth and development of crops and nutrient absorption. Strawberry ( Fragaria×ananassa Duch.) is a major economic crop worldwide, and its related industrial chain drives the economic development of various countries. Therefore, this study investigated the effects of rare earth light conversion films (RPOs) on strawberry cultivation. The temperature, light intensity, light transmittance and proportion of spectra beneficial to the crop production of RPO greenhouses were all greater than those of the control. Compared with those of the control, spongy tissues were sparser in RPO1 and RPO2 leaves. The cross-sectional lengths of the main vascular bundles of strawberry petioles in RPO1 and RPO2 increased by 10.85% and 29.56%, respectively, and the cross-sectional widths decreased by 9.11% and 9.60%, respectively. Compared with those of the control, the total leaf area, photosynthetic rate, stomatal conductance, activity of Rubisco and gene expression levels of Rub-af1 , RubLα , RubLβ , and Rib-cs of RPO1 and RPO2 increased by 29.98%, 10.88%, 49.55%, 42.87%, 10.09%, 9.23%, 10.45%, and 7.27% and 31.51%, 23.61%, 157.67%, 44.94%, 9.95%, 8.71%, 9.46%, and 6.13%, respectively, and the intercellular CO 2 concentration decreased by 32.76% and 37.20%, respectively. Compared with those of the control, the single fruit weight, yield, soluble solids, soluble sugar content, Vc content, and flavonoid contents of RPO1 and RPO2 increased by 30.21%, 13.25%, 32.58%, 24.04%, 8.32%, and 27.94% and 33.37%, 23.83%, 33.48%, 33.48%, and 54.87%, respectively. In conclusion, RPO promotes photosynthesis in strawberry plants by optimizing light intensity and temperature in greenhouses; adjusting the spectrum to change the total leaf area, pigment content, spongy tissue structure, petiole vascular bundles, and Rubisco activity; and regulating the expression of the Rubisco gene, thereby increasing the quality and yield of strawberry plants. Compared with RPO1, RPO2 could be a more suitable film for strawberry production. Light conversion film (europium-based) strawberry photosynthesis fruit yield and quality Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Photosynthesis can affect the growth and yield of crops. Photosynthesis is the ultimate energy source of plants and consists of two key stages: the light and dark reactions [ 1 ]. The light reaction mainly occurs during the photosynthesis of chloroplasts in green plants, where light energy is absorbed and converted to generate NADPH and ATP [ 2 ]. Subsequently, the dark reaction utilizes the generated energy to fix CO 2 and convert it into six types of carbon sugars in the carbon assimilation process [ 3 ]. Photosynthetic carbon assimilation can store energy in the biological world and generate most of the biomass in the biosphere. Rubisco (ribulose 1,5-bisphosphate ribulose carboxylase) is the most abundant protein on Earth and is responsible for the vast majority of global carbon fixation [ 4 ], and it is highly sensitive to temperature. With the assistance of different assembly factors, Rubisco can be composed of 8 large subunits (RbcL) and 8 small subunits (RbcS) to form a hexadecamer [ 5 , 6 ]. These assembly factors, large subunits and small subunits affect the activity of Rubisco, thereby influencing photosynthesis. Light is the source of energy for photosynthesis, germination, flowering and fruiting in plants [ 7 ]. Notably, plants exhibit a high absorption efficiency of 90% for blue and red light wavelengths [ 8 ]. Research has demonstrated that light conversion films can modulate spectral transmittance by transforming short wavelengths, such as ultraviolet and violet light, into longer wavelengths, such as red‒orange, blue, and far-red light. This spectral optimization enhances light conditions for improved growth and yield in facility-grown crops [ 9 , 10 ]. Therefore, functional agricultural light transfer films are gradually replacing traditional EVA polyethylene, PVC polyvinyl chloride agricultural films and coated films to improve problems such as low winter and spring yields of facility vegetables, long crop growth cycles and unstable fruit quality. The energy difference in the process of spectral conversion is released in the form of heat energy. Combined with the good thermal insulation performance of the light conversion film, the temperature of the shed covered by the light conversion film is improved [ 11 ]. In autumn cultivation, the increase in air temperature is as high as 0.50°C. The temperature regulation function of the light conversion film reduces the stress caused by higher and lower temperatures to a certain extent. The effects of the light transfer film on the temperature and humidity of the shed differ between sunny days and weak light days (such as cloudy and haze). On sunny days, the average temperature in the light conversion film shed increases by 0.20–6.80°C; on low-light days, it increases by 0.20–1.90°C; under sunny or hazy conditions, the air humidity in the greenhouse with the light-transfer film is 1.73–9.30% higher than that of the control; and on cloudy days, it decreases by 0.71% [ 12 ]. Throughout the entire growth period, light conversion film can also accelerate the growth rate of crops, increase their yield and quality, and reduce the incidence of pests and diseases. Light conversion film can significantly increase the photosynthetic rate of Chinese cabbage and significantly increase its dry leaf weight and leaf area by 33.0% and 33.3%, respectively [ 13 ]. Additionally, light-transferring film has been shown increase the yield of tomatoes by 32.90%, the average yield per unit area of Bebe pumpkins by 5.90%, and the yield of pre-Mingming tea by 51.20–56.20%. The contents of β-carotene, soluble protein, Vc, soluble sugar, aldehydes, furans and ketones can increase, which can advance the spring tea harvest period by 6–27 days and inhibit the reproduction of false-eyed little green leafhoppers ( Empoasca vitis ) and tea aphids ( Toxoptera aurantii ) [ 14 , 15 ]. Rare earth ions have rich spectral energy levels; rare earth luminescence almost covers the entire range of solid-state luminescence. Research on the preparation of agricultural light conversion films doped with rare earth elements has gradually attracted the attention of researchers [ 16 ]. Research has shown that adding a new europium-containing complex as a transfer agent to light-transmitting film can cause the accumulated temperature inside the greenhouse to reach 2072.50°C, and the average daily temperature increased by 3.62% [ 17 ]. A semitransparent film with Eu(III) added as could increase the size of tomato plants by 30–40%, increase the tolerance of tomatoes to high and low temperatures, inhibit the growth of the tomato pathogen Mycobacterium difficile, and promote the growth of tomatoes throughout their lifetime [ 18 ]. Previous studies have also shown that adding elements such as europium and yttrium to light conversion films can increase the yield of cucumbers by 30.01%. Compared with those of the control (traditional membrane), the growth indicators of the plants, the net photosynthetic rate and fruit quality improved to varying degrees [ 19 , 20 ]. Strawberry ( Fragaria×ananassa Duch.) is the world's main cash crop; in addition to its cultivation area and output, it is firmly at the forefront of the world, and its related industrial chain drives the economic development of countries. However, few studies have investigated the influence of rare earth light-transmitting films on strawberries. In recent years, global environmental changes and the frequent occurrence of weak light due to weather conditions such as smog have had a nonnegligible impact on the yield and quality of strawberries. Light conversion film, as one of the means to increase yield and improve the quality of facility crops, is currently more widely used in leafy vegetable crops but less widely studied in strawberry. Therefore, based on results from traditional PO film, in this study, a traditional PO film was used as the control, and rare earth phototransfer films with different amounts of europium and yttrium were used for the treatments. Through the analysis of strawberry leaves and samples at the fruit stage, the effects of rare earth light transfer films on the photosynthesis, yield and fruit quality of facility strawberry plants were investigated in detail, and the effects of the two types of light transfer films were comprehensively evaluated. 2. Materials and Methods 2.1 Experimental design and plant materials The 'Hongyan' variety of strawberry was used as the experimental material in this study. This is the main cultivated variety in the local area. This material is provided by Hebei Zengxian Agricultural Planting. It was cultivated in three solar greenhouses managed by Hebei Zengxian Agricultural Planting Co., Ltd. (Zheng Village, Zhengcun County, Baoding City, Hebei Province, China, 39°0’41’ N, 115°30’13’ E) from September 2023 to May 2024. Each of these greenhouses was 70 m in length, 10.6 m in width, 4.6 m in mid-ridge height, and 10 m in inner span, with a 0.37 m brick wall. The greenhouse, which runs east‒west, is insulated with a quilt made of three layers of flower felt and one layer of pearl cotton covering the black felt. The row spacing for strawberry plants is 90 cm, with a spacing of 10 cm within each row. Each greenhouse was planted with 9,000–10,000 strawberry plants. The strawberry plants were grown in soil beds 0.5 m below ground level, covered with black plastic film and drip-irrigated beneath the film. Each greenhouse contained 72 rows covering 770 m². Within each greenhouse, a sample plot consisting of 11 adjacent rows was randomly selected, with the area of each plot being approximately 90 m 2 . For comparison, three types of covering materials were tested. The first greenhouse was covered with a layer of standard polyolefin film (PO, thickness of 0.1 mm) from Hebei Kangcheng Modern Agricultural Products Development Co., Ltd., as the control (CK). The second greenhouse was covered with a rare earth light-transmitting film (RPO, thickness of 0.1 mm) specifically designed for strawberries from Shandong Shunming Company as a treatment (RPO1). The third greenhouse was covered with a special rare earth light conversion film (RPO, thickness of 0.1 mm) for strawberries from Shandong Xintianhe Company Co., Ltd., as another treatment (RPO2). Each plot included three quarters as repeats. Planting occurred on September 25, 2023, flowering began on October 23, 2023, harvesting began on January 20, 2024, and the crop cycle ended on May 6, 2024. 2.2 Determination of the inner environment of the greenhouses From September 2023 to May 2024, we conducted continuous monitoring of the spectrum, light intensity and air temperature within the greenhouse. The spectral ratios and light transmittance were calculated every 30 days starting from October 28, 2023. Each month between 9:00 and 11:00 a.m., spectral measurements were conducted every half hour using a QE65000 spectrometer (Ocean Optics, Shanghai, China) positioned at a height of 1.5 m from the ground and 5 m away from the film of the greenhouse, and the average of the five measurements was computed as a replicate value. Light intensity was measured using a #3415F Quantum light meter illuminometer (Spectrum Technologies, Inc., United States) mounted in the centre of the greenhouse at 1.5 m above the ground, in conjunction with spectral measurements. Air temperature and air humidity readings of CK, RPO1 and RPO2 samples were taken with i500 temperature sensors (Hangzhou Drucker Co., Ltd., China), which were placed in the middle of the greenhouse at a distance of 1.5 m from the floor. 2.3 Measurement of strawberry leaf growth traits at the flowering stage The third functional leaf was selected from the crown of the strawberry plant. The leaf area and chlorophyll content of the plants were measured. Each functional leaf consists of three leaflets (left, middle, and right). Eight leaves were selected as replicates for each plot. The leaf area of the functional leaves was measured with a leaf area meter (AM-200), and the parietal leaf photosynthetic parameters, including the photosynthetic rate, transpiration rate, intercellular carbon dioxide concentration and stomatal conductance, were measured with a YZQ-100A portable dynamic photosynthesis system (Ji Zhuqi Technology (Beijing) Co., Ltd.), with the optical quantum flux density (PFD) set at 500 µmol·m − 2 ·s − 1 . The fluorescence parameters, including PSII primary light conversion efficiency (Fv/Fm), unit reaction centre absorption (ABS/RC), unit of light energy captured by the reaction centre (TRo/RC) and the energy transferred by an electron (ETo/RC) in the same leaf, were measured using a Handy PEA Plant efficiency analyser (Hansatech, UK). The photosynthetic pigment content was determined using the mixed sample described above, and the pigment was extracted using the 80% acetone method. The absorption value was subsequently determined with an ultraviolet spectrophotometer (U-5100 UV/VIS) at wavelengths of 470, 645 and 663 nm, and the contents of chlorophyll a, chlorophyll b and carotenoids were subsequently calculated. 2.4 Strawberry leaf and petiole sampling and processing for microscopy Permanent sections of the samples were prepared, and the size and number of cells were recorded through photographs and observations under an OLYMPUS BX51M compound microscope (BX51M Olympus Optical Co., Ltd., Tokyo, Japan) [ 21 ]. 2.5 Measurement of strawberry fruit yield and quality Commercial strawberry fruits were collected during the mature period (January 20, 2024). At this stage, 20 fruits were selected from each plot as samples; this process was repeated three times. The weight of commercial strawberry fruits was measured with an electronic balance with an accuracy of 0.01 g, and the fruit length, width and fruit shape index were scanned with an i800plus ScanMaker (MICROTEK, MRS-9600TFU2L, Shanghai Zhongjing Technology Co., Ltd.). The quality of commercial strawberry fruits was assessed during the mature period (December 14, 2023). At this stage, 20 fruits were selected from each plot, mixed finely, and then frozen quickly with liquid detergent to create a mixed sample; this process was repeated five times. The soluble solid content was measured using an ATAGO handheld digital sugar meter (ATAGO, Japan). Chemical experimental methods were employed to determine the contents of other substances. The Coomassie Brilliant Blue G-250 staining method was used to measure the fixed soluble protein content [ 22 ]. The content of vitamin C was determined using the 2,6-dichlorophenol indophenol titration method, whereas the titratable acid content was measured using the sodium hydroxide titration method [ 23 ]. Free amino acid levels were measured through ninhydrin colorimetry [ 24 ], and the soluble sugar content was determined using the anthrone colorimetric method [ 25 ]. Additionally, the number of fruits per plant and the overall plot yield were recorded throughout the harvesting period. Single fruit weights were also measured during the mature period. 2.6 Fluorescent quantitative PCR (qRT‒PCR) NCBI was used to design qRT‒PCR-specific primers for candidate genes (Table 1 ), which were synthesized by Beijing Qingke Biotechnology Co., Ltd. Strawberry leaf RNA (a plant RNA extraction kit) was extracted and reverse-transcribed (Kangwei reverse transcription kit) to obtain cDNA, and then, qRT‒PCR was performed with a Kangwei MagicSYBR mixture kit and a StepTwo real‒time fluorescence quantitative PCR system (Roche, CA, USA). The PCR amplification procedure was as follows: the amplification program included 1 cycle of 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. The 20 µL reaction system was as follows: 2× MagicSYBR mixture, 10 µL; upstream and downstream primers, 4 µL; cDNA, 2 µL; and sterilized ddH 2 Oto 20 µL. Three biological replicates and three technical replicates were used for each gene. The final value of relative quantitation was compared with that of the control internal reference gene StRefActin 1 (LOC101300025) [ 26 ], and multiple changes in gene expression in the samples were tested. The relative expression levels of the candidate genes were analysed by the 2 −ΔΔCT method [ 27 ]. Table 1 qRT‒PCR primers for strawberry Gene ID Primer sequence StRefActin 1-F TTCACGAGACCACCTATAACTC StRefActin 1-R GCTCATCCTATCAGCGATT Rub-af1-F CAACCGACTCGGCTTATGGT Rub-af1-R AGCCATGATTTCAGGGTCGG Rib-cs1-F GGTTTCGTCTACCGTGAGCA Rib-cs1-R GATCCTGATGAAGGCCTCGG RubLα-F ATGGGAGGTTGGCTACAACG RubLα-R CAGCAGGTGACTTGGGCTTA RubLβ-F AGCTTCTACTCCGTTTCGGC RubLβ-R ATGAAGCAATGGAAGCCCGA Rib-cs-F TGTTTCATCATCCGCCCACA Rib-cs-R TGCACAGGCAGCCTAATTGA 2.7 Data analysis All the experiments described here were repeated three times in a randomized complete block design. One-way ANOVA was performed using Duncan’s test in Statistical Product and Service Solutions, version 26.0 (IBM, New York, United States), and the data are presented as the means ± SEs. The weight coefficients were determined using the structural equation model on the SPSSPro website, and then the structural equation model was drawn using Microsoft PowerPoint 2022. The spectral transmission (ST), luminousness (L), handle length ratio (HLR) and plot yield were determined using the following formulas: ST (%) = Wi/W0 × 100% L (%) = Ri/R0 × 100% Cx (mg·g − 1 ) = Ci × Ev ×Dr × W Plot yield (kg·ha − 1 ) = N × W × F × 125 where Wi and W0 are the light intensities of different wavelengths inside and outside the greenhouse, respectively; Ri and R0 are the light intensities parallel to the film inside and outside the greenhouse, respectively; Ci are the contents of chlorophyll a, chlorophyll b and carotenoids; Ev is the extraction volume; Dr denotes the dilution ratio; W is the sample fresh weight; N denotes the number of strawberry plants; W is the single-fruit weight; and F is the number of fruits per strawberry plant. The data were analysed using the fuzzy membership function. The positive correlation index was calculated using the Formula X(u)=(X-X min )/(X max -X min ), and the negative correlation index was calculated using the Formula X(u) = 1-(X-X min )/(X max -X min ). The average membership function values of the growth, leaf and fruit quality of all the plants were calculated to obtain their average membership function values. 3. Results 3.1 Effects of RPO films on the environment in greenhouses 3.1.1 Effects of RPO films on air temperature and humidity in a greenhouse From November to March of the following year, the average temperatures of the CK, RPO1 and RPO2 treatments all tended to first decrease but then increase (Table 2 ). Compared with those of the control, the minimum temperature, accumulated temperature, and number of hours with temperatures ≥ 10°C and ≥ 20°C treated with RPO1 increased by 25.00–33.87%, 7.02–36.08%, 2.95–13.52% and 7.14–17.48%, respectively, and there was no difference in the maximum temperature; the maximum temperature, minimum temperature, accumulated temperature, and number of hours with temperatures ≥ 10°C and ≥ 20°C of RPO2 increased by 26.92%, 12.96–43.33%, 7.64–37.05%, 13.17–24.91% and 14.94–21.35%, respectively. The average temperatures of RPO1 and RPO2 were not different from that of the control. Table 2 Effects of rare earth light conversion films on the variations in the maximum and minimum temperatures, the average air temperature and accumulated temperature and the hours when the temperature was above 10°C and 20°C. Inner environment Treatment November December January February Marth Maximum Temperature CK 35 ± 1.8a 36 ± 2.3a 26 ± 1.2b 25 ± 2.2a 40 ± 2.2a RPO1 40 ± 3.5a 41 ± 2.7a 31 ± 2.2ab 30 ± 2.6a 44 ± 2.7a RPO2 43 ± 2.3a 42 ± 2.2a 33 ± 1.5a 34 ± 2.7a 46 ± 1.8a Minimum temperature CK 6.0 ± 0.2b 6.0 ± 0.3b 5.6 ± 0.2b 5.4 ± 0.1b 6.2 ± 0.2b RPO1 8.3 ± 0.4a 7.5 ± 0.2a 6.2 ± 0.3ab 5.7 ± 0.2ab 8.3 ± 0.3a RPO2 8.6 ± 0.3a 8.1 ± 0.2a 6.8 ± 0.2a 6.1 ± 0.2a 8.7 ± 0.2a Average temperature CK 16 ± 0.9a 15 ± 1.7a 14 ± 1.5a 13 ± 1.8a 17 ± 1.5a RPO1 18 ± 1.7a 17 ± 0.9a 16 ± 2.1a 15 ± 1.5a 17 ± 2.1a RPO2 18 ± 1.9a 17 ± 1.7a 17 ± 2.3a 15 ± 2.1a 18 ± 2.1a Accumulated temperature CK 291 ± 1.5c 357 ± 1.5c 299 ± 2.2c 299 ± 1.8c 386 ± 1.0c RPO1 396 ± 2.2b 402 ± 1.8b 323 ± 1.7b 320 ± 2.1b 402 ± 1.9b RPO2 412 ± 2.2a 420 ± 2.3a 387 ± 1.7a 400 ± 1.5a 529 ± 1.3a Hours (≥ 10°C) CK 281 ± 1.7b 281 ± 1.2c 281 ± 1.7c 382 ± 1.5c 508 ± 2.2c RPO1 286 ± 1.2b 293 ± 1.5 b 319 ± 1.5b 406 ± 1.2b 523 ± 2.3b RPO2 324 ± 2.2a 318 ± 1.2a 351 ± 2.2a 468 ± 1.7a 627 ± 1.5a Hours (≥ 20°C) CK 103 ± 1.5b 102 ± 2.1b 98 ± 1.5c 87 ± 1.5b 214 ± 1.5c RPO1 121 ± 0.9a 116 ± 1.5a 105 ± 1.5b 100 ± 1.2a 243 ± 1.5b RPO2 125 ± 1.5a 118 ± 1.2a 115 ± 1.5a 100 ± 0.6a 257 ± 1.3a Note: Lowercase letters represent significant differences among the three treatments in the horizontal direction ( p < 0.05). Same as below. 3.1.2 Effects of RPO film on light intensity From November to March of the following year, the average light intensity, maximum light intensity and minimum light intensity of the CK, RPO1 and RPO2 treatments all tended to first decrease but then increase (Table 3 ). Compared with that in the CK treatment, the average light intensity increase in RPO2 was greatest, increasing by 26.82–44.77%, the maximum light intensity increased by 13.02–35.97%, the average light intensity in RPO1 increased by 23.41–40.43%, and the maximum light intensity increased by 7.93–33.34%. Table 3 Effects of rare earth light conversion films on the average, maximum and minimum light intensities. Traits Month Treatment CK RPO1 RPO2 Average light intensity (µmol·m − 2 ·s − 1 ) November 344 ± 5.0b 465 ± 4.4a 477 ± 2.6a December 277 ± 4.3b 389 ± 7.6a 401 ± 3.6a January 229 ± 3.3c 309 ± 2.5b 322 ± 3.2a February 205 ± 4.7b 253 ± 3.5a 260 ± 4.2a March 210 ± 2.1c 280 ± 3.2b 298 ± 2.3a Total 1265 ± 8.5c 1696 ± 13b 1758 ± 13a Maximum light intensity (µmol·m − 2 ·s − 1 ) November 983 ± 2.1c 1061 ± 2.2b 1111 ± 2.9a December 871 ± 2.6c 1047 ± 2.7b 1078 ± 1.8a January 758 ± 2.3b 1011 ± 2.3a 1015 ± 1.9a February 670 ± 1.5c 889 ± 2.2b 911 ± 2.3a March 695 ± 3.5c 842 ± 3.5b 868 ± 3.8a Total 3977 ± 11c 4850 ± 11b 4983 ± 12a Minimum light intensity (µmol·m − 2 ·s − 1 ) November 28 ± 1.9a 32 ± 2.2a 36 ± 2.9a December 23 ± 2.8a 31 ± 2.2a 31 ± 2.6a January 16 ± 2.2a 20 ± 2.9a 22 ± 3.1a February 16 ± 2.0a 18 ± 3.2a 19 ± 3.3a March 29 ± 2.8a 30 ± 2.2a 32 ± 2.7a Total 112 ± 9.6a 131 ± 13a 140 ± 10.4a 3.1.3 Effects of the RPO film on different spectral proportions and transmittances Rare earth semitransparent films can reduce the proportions of ultraviolet, purple and green light; increase the proportions of far-red, red‒orange and blue light; and increase the light transmittance of greenhouse films (Table 4 ). On sunny days, compared with those in the CK treatment, ultraviolet light, violet light and green light in the RPO2 treatment decreased by 7.65%, 6.11% and 8.12%, whereas blue light, red‒orange light and far-red light increased by 6.35%, 11.59% and 22.10%, respectively; in the RPO1 treatment, ultraviolet light, violet light and green light decreased by 3.89%, 5.67% and 8.98%, respectively, whereas blue light, red‒orange light and far-red light increased by 7.00%, 9.75% and 19.98%, respectively. Compared with that of the control, the light transmittances of the lattice films treated with RPO1 and RPO2 significantly increased by 8.27% and 9.84%, respectively. Table 4 Spectral ratios and transmittances of different treatments on clear days and cloudy days Weather Treatment Ultraviolet 300–399 nm Purple 400–439 nm Blue 440–509 nm Green 510–609 nm Red orange 610–709 nm Far-red 710–760 nm Transmittance (%) Clear days CK 19.62 ± 0.26a 9.00 ± 0.02a 15.28 ± 0.06b 22.16 ± 0.07b 21.75 ± 0.06c 11.31 ± 0.05c 84.67 ± 1.20b RPO1 18.81 ± 0.22b 8.49 ± 0.07b 16.35 ± 0.05a 20.17 ± 0.06b 23.87 ± 0.19b 13.57 ± 0.13b 91.67 ± 0.88a RPO2 18.12 ± 0.57b 8.45 ± 0.07b 16.25 ± 0.07a 20.36 ± 0.14a 24.27 ± 0.32a 13.81 ± 0.20a 93.00 ± 0.58a Cloudy days CK 20.15 ± 0.19a 8.51 ± 0.02a 16.19 ± 0.05a 23.08 ± 0.07b 20.69 ± 0.06c 10.27 ± 0.03c 82.33 ± 2.39b RPO1 18.62 ± 0.12a 7.73 ± 0.04b 17.28 ± 0.03b 19.07 ± 0.04b 23.99 ± 0.06b 12.57 ± 0.05b 90.31 ± 3.46a RPO2 17.81 ± 0.07b 7.11 ± 0.07b 17.79 ± 0.11b 18.36 ± 0.11a 24.46 ± 0.14a 12.81 ± 0.18a 92.66 ± 2.47a On cloudy days, compared with those in the CK treatment, ultraviolet light, violet light and green light in the RPO2 treatment decreased by 19.15%, 16.45% and 20.45%, respectively, whereas blue light, red‒orange light and far-red light increased by 9.88%, 18.65% and 24.73%, respectively; in the RPO1 treatment, ultraviolet light, violet light and green light decreased by 7.59%, 9.17% and 17.37%, respectively, whereas blue light, red‒orange light and far-red light increased by 6.73%, 15.95% and 18.92%, respectively. Compared with that of the control, the light transmittances of the lattice films treated with RPO1 and RPO2 increased by 9.69% and 12.55%, respectively. 3.2 Effects of RPO film on the growth and development of strawberry plants in a solar greenhouse 3.2.1 Effects of RPO film on strawberry plant growth in a solar greenhouse Compared with the control, RPO1 and RPO2 increased the total leaf area of strawberry plants by 29.98% and 31.51%, respectively, and decreased the petiole length by 35.05% and 69.79%, respectively. The number of flowers in RPO1 increased slightly but not significantly compared with that in the control, whereas the number of flowers in RPO2 increased by 14.06% compared with that in the control (Table 5 ). Table 5 Effects of rare earth light conversion films on the growth traits of strawberry plants in a solar greenhouse. Treatment Petiole length (cm) Number of blooms Total leaf area (cm 2 ) CK 16.30 ± 0.10a 87.67 ± 3.76b 79.41 ± 4.67b RPO1 12.07 ± 0.12b 94.33 ± 1.20ab 103.22 ± 1.67a RPO2 9.60 ± 0.20c 100.00 ± 1.53a 104.43 ± 1.08a Note: Lowercase letters represent significant differences among the three treatments in the horizontal direction ( p < 0.05). Same as below. 3.2.2 Effects of RPO film on the anatomical structure of strawberry leaves and petioles in solar greenhouses In the same field of view, the spongy tissues of strawberry leaves treated with RPO1 and RPO2 were sparser than that of strawberry leaves treated with CK (Fig. 1 ). At the same magnification, the vascular bundles of strawberry petioles treated with RPO1 and RPO2 were both larger than those in the CK group (Fig. 2 ). Compared with those under the CK treatment, the cross-sectional lengths of the main vascular bundles of strawberry petioles under the RPO1 and RPO2 treatments increased by 10.85% and 29.56%, respectively, and the cross-sectional widths decreased by 9.11% and 9.60%, respectively. 3.2.3 Effects of RPO film on the photosynthetic parameters, fluorescence parameters and chlorophyll content of strawberry leaves in solar greenhouses The photosynthetic rate, transpiration rate, stomatal conductance and intercellular CO 2 concentration of strawberry leaves treated with RPO1 and RPO2 were significantly different from those of the control group (Table 6 ). Compared with those under the CK treatment, the photosynthetic rate, transpiration rate and stomatal conductance of the leaves under the RPO2 treatment increased by 54.44%, 20.27% and 157.67%, respectively; the photosynthetic rate and stomatal conductance of the leaves under the RPO1 treatment increased by 15.66% and 49.55%, respectively. Compared with those under RPO1, the photosynthetic rate, transpiration rate and stomatal conductance of the leaves under RPO2 increased by 31.64%, 11.48% and 72.30%, respectively. The changing trend of the intercellular CO 2 concentration was opposite to those of the above four photosynthetic parameters. Compared with those of the control, the intercellular CO 2 concentrations of RPO1 and RPO2 decreased by 32.76% and 37.20%, respectively. Notably, the intercellular CO 2 concentration of RPO2 decreased by 3.34% compared with that of RPO1. Table 6 Effects of rare earth light conversion films on the photosynthetic parameters, fluorescence parameters and chlorophyll contents of strawberry leaves in solar greenhouses Traits CK RPO1 RPO2 Photosynthetic rate (µmol·m − 2 ·s − 1 ) 19.80 ± 0.74c 22.90 ± 1.32b 30.58 ± 1.05a Transpiration rate (mmol·m − 2 ·s − 1 ) 4.44 ± 0.14b 4.41 ± 0.16b 5.34 ± 0.04a Intercellular carbon dioxide concentration (µmol·mol − 1 ) 597.60 ± 10.03a 450.13 ± 2.77b 442.23 ± 8.52b Stomatal conductance (mmol·m − 2 ·s − 1 ) 770.23 ± 15.88c 1151.87 ± 36.70b 1984.63 ± 13.43a Fv/Fm 0.80 ± 0.002b 0.82 ± 0.004a 0.81 ± 0.002b ABS/RC 1.73 ± 0.05b 2.01 ± 0.07a 2.11 ± 0.02a TRo/RC 1.41 ± 0.04b 1.64 ± 0.06a 1.70 ± 0.01a ETo/RC 0.82 ± 0.02b 0.92 ± 0.02a 0.94 ± 0.01a Content of chlorophyll a (mg·g − 1 ) 1.18 ± 0.07b 1.31 ± 0.04b 1.54 ± 0.03a Content of chlorophyll b (mg·g − 1 ) 0.34 ± 0.01b 0.35 ± 0.02b 0.43 ± 0.01a Content of carotenoid (mg·g − 1 ) 0.23 ± 0.01b 0.25 ± 0.01b 0.29 ± 0.01a The ABS/RC, TRo/RC and ETo/RC of RPO1 and RPO2 were significantly greater than those of CK; RPO1 increased by 16.18%, 16.31% and 12.20%, respectively, and RPO2 increased by 21.97%, 20.57% and 14.63%, respectively (Table 6 ). The Fv/Fm of RPO2 did not significantly differ from that of CK, whereas the Fv/Fm of the RPO1 treatment was 2.5% greater than that of the control. Compared with those in CK leaves, the contents of chlorophyll a, chlorophyll b and carotenoids in strawberry leaves treated with RPO2 significantly increased by 30.51%, 26.47% and 26.09%, respectively, whereas the contents of chlorophyll a, chlorophyll b and carotenoids in RPO1 were not significantly different from those in the control group (Table 6 ). 3.2.4 Effects of RPO film on the activity of the Rubisco enzyme and related genes in strawberry leaves in solar greenhouses The Rubisco activities in strawberry leaves treated with RPO2 and RPO1 were significantly greater than that in the control, increasing by 42.87% and 44.94%, respectively (Fig. 3 A). Compared with those in the control, the expression levels of rubisco accumulation factor 1 ( Rub-af1 ) in the plants treated with RPO1 and RPO2 were upregulated by 10.09% and 9.95%, respectively (Fig. 3 B). The expression levels of the large subunit of Rubisco that binds to subunit α of the protein ( RubLα ) were upregulated by 9.23% and 8.71%, respectively (Fig. 3 D). The expression levels of the large subunit of Rubisco that binds to subunit β of the protein ( RubLβ ) were upregulated by 10.45% and 9.46%, respectively (Fig. 3 E). The expression levels of chloroplast nucleosaccharide diphosphate carboxylase small chain ( Rib-cs ) were upregulated by 7.27% and 6.13%, respectively. Interestingly, the expression level of Rib-cs in RPO1 was upregulated by 1.08% compared with that in RPO2 (Fig. 3 F). There was no significant difference in the expression level of ribulose diphosphate carboxylase small chain 1 ( Rib-cs1 ) (Fig. 3 C). 3.3 Effects of rare earth light conversion film on the yield and quality of strawberry fruits The transverse and longitudinal stems, single fruit weight, and yield of strawberry fruits treated with RPO1 and RPO2 were significantly greater than those of the control (Table 7 ). Compared with those of the control, the longitudinal stems of the fruits treated with RPO1 and RPO2 increased by 5.44% and 6.01%, the transverse diameters of the fruits increased by 7.71% and 10.63%, the single fruit weights increased by 30.21% and 33.37%, and the yield increased by 13.25% and 23.83%, respectively. Table 7 Effects of rare earth light conversion films on the fruit yield of strawberry plants in a solar greenhouse. Treatment Length (cm) Width (cm) Average fruit weight (g) Plot yield (kg·90 m − 2 ) Yield (kg·ha − 1 ) CK 58.50 ± 0.10b 42.51 ± 0.51b 46.43 ± 0.41b 340.96 ± 5.89b 37996 ± 599b RPO1 61.68 ± 0.22b 45.78 ± 0.46b 60.46 ± 0.75b 387.26 ± 6.38a 43028 ± 709a RPO2 62.02 ± 0.77a 47.02 ± 1.93a 61.93 ± 1.00a 423.46 ± 16.80a 47051 ± 1867a Compared with those in the control treatment, the soluble solids in the RPO1 and RPO2 treatments increased by 32.58% and 33.48%, respectively (Fig. 4 A); the soluble sugar content increased by 24.04% and 33.48%, respectively (Fig. 4 B); the Vc content increased by 8.32% and 13.56%, respectively (Fig. 4 E); the flavonoid content increased by 27.94% and 54.87%; the flavonoid content in the RPO2 treatment increased by 62.73%, respectively, compared with that in RPO1 (Fig. 4 F); and the soluble protein content decreased by 24.51% and 22.09%, respectively (Fig. 4 C). The organic acid content of RPO2 was 6.28% lower than that of CK, whereas the organic acid content of RPO1 was not different from that of the control (Fig. 4 D). There was no significant difference in the total phenol content among RPO1, RPO2 and the control (Fig. 4 G). 3.4 Pearson correlation analysis In addition to Fv/Fm and Cb, the photosynthetic indicators of strawberry leaves are closely related to the average light intensity and accumulated temperature. Interestingly, the photosynthetic rate and intercellular CO 2 concentration were negatively correlated with the average light intensity and accumulated temperature (Fig. 5 ). The yield of strawberry plants was significantly positively correlated with the average light intensity, accumulated temperature, and number of hours at temperatures ≥ 10°C and ≥ 20°C (Fig. 6 ). The contents of soluble solids and soluble sugars were extremely significantly positively correlated with the average light intensity. The content of soluble protein was extremely significantly negatively correlated with the average light intensity and the number of hours with temperatures ≥ 20°C. The contents of Vc and flavonoids were significantly positively correlated with the accumulated temperature and the number of hours with temperatures ≥ 10°C and ≥ 20°C. Photosynthesis indicators are closely related to yield (Fig. 7 ). Interestingly, the total leaf area, photosynthetic rate and yield were extremely significantly positively correlated. Notably, in the greenhouse environment, which affects the quality and yield of strawberry fruits (Fig. 6 ) and plant photosynthesis (Fig. 5 ), the average light intensity, accumulated temperature, and number of hours with temperatures ≥ 20°C had the strongest correlations with the above indicators, whereas the correlation with the average temperature was relatively weak. 3.5 Fuzzy mathematics membership function analysis and structural equation model analysis To conduct a comprehensive evaluation of the growth and development of strawberry plants, the membership functions of plant growth, fruit quality and fruit yield in each treatment were obtained according to the fuzzy mathematics membership function method. The mean values of the membership functions of the total components were then obtained and ranked. A comprehensive analysis of the membership functions of strawberry growth and development revealed that the ranking was RPO2 > RPO1 > CK (Table 8 ). The effects of temperature and light intensity on photosynthesis, fruit quality and fruit yield were further clarified through SEM analysis. Light intensity directly affected photosynthetic indicators and fruit quality and thereby influences fruit yield (Fig. 8 ). Table 8 Analysis of the fuzzy mathematical membership functions for component content. Treatment Mean of membership function Ranking Plant growth Fruit quality Fruit yield Total components CK 0.15 0.20 0.00 0.11 3 RPO1 0.43 0.68 0.54 0.55 2 RPO2 0.86 0.80 1.00 0.88 1 Note: Plant growth indicators include petiole length, number of flowers, total leaf area, photosynthetic rate, transpiration rate, intercellular carbon dioxide concentration, stomatal conductance, Fv/Fm, ABS/RC, TRo/RC, ETo/RC, chlorophyll a content, chlorophyll b content, and carotenoid content. Fruit quality indicators include the transverse and longitudinal diameters of the fruit, soluble solid, soluble sugar content, soluble protein content, organic acid content, vitamin C content, flavonoid content and total phenol content. 4. Discussion 4.1 RPO film improves the internal environmental conditions of greenhouses Temperature and light are indispensable environmental conditions for plant growth. Light conversion films can be used to increase the air temperature, CO 2 concentration, photosynthetically active radiation (PAR) and soil temperature [ 12 ]. The temperature, light intensity and spectral ratio of light-transmitting films can be adjusted to change the growth of plants. Li et al. (2024) [ 28 ] reported that the accumulated temperature, maximum temperature, minimum temperature and average temperature of treatments with rare earth photoconversion membranes were higher than those of treatments with traditional membranes. Compared with those of the control, the accumulated temperature and minimum temperature of RPO1 and the accumulated temperature, maximum temperature and minimum temperature of RPO2 all increased. The average temperature of RPO1 and the maximum temperature and average temperature of RPO2 were not different from those of the control (Table 2 ). The increase in the accumulated temperature of RPO1 and the accumulated temperature minimum temperature and the maximum temperature of RPO2 were greater than those reported in the study of Li et al. (2024) [ 28 ]. The increases in the minimum temperature, maximum temperature and average temperature of RPO1 and the average temperature of RPO2 were lower than those reported in the study of Li et al. (2024) [ 28 ]. This may be related to the different temperature measurement years and greenhouse structures. In addition, the temperature variation during RPO2 treatment may also be related to the differences in rare earth light conversion films. Rare earth light-transmitting films also have a certain improvement in light intensity (Table 3 ), which is consistent with a previous study [ 12 ]. The rare earth light conversion film reduced the transmittance ratios of ultraviolet light, violet light and green light and increased the transmittance ratios of blue light, red light and far-red light (Table 4 ). These differences might be related to the added light conversion agent and the dosage of the light conversion agent. 4.2 Influence of RPO films on photosynthesis Photosynthesis produces the materials and energy needed for the growth and development of plants. When crops are exposed to specific light conditions for a long period of time, the anatomical structure of the plant body and the characteristics of chloroplasts change, which indirectly affects photosynthesis [ 29 ]. The content of photosynthetic pigments can reflect the physiological photosynthetic capacity of plants and is an indicator of photosynthetic intensity. The combination of red light and blue light can increase the absorption of photosynthetic pigments [ 29 ]. The concentrations of photosynthetic pigments and chlorophyll biosynthesis precursors in nonspike Chinese cabbage were relatively high under red and blue light treatments [ 30 ]. Red and blue light are conducive to pigment accumulation. The contents of chlorophyll a, chlorophyll b and carotenoids in the RPO group were greater than those in the control group (Table 6 ), which was consistent with the findings of previous studies. The supply and utilization of CO 2 , the supply and utilization of light, and the transport capacity of carbohydrates are the key factors of photosynthesis [ 31 ]. High concentrations of CO 2 can inhibit photosynthesis [ 32 ]. The vascular bundles transport soluble mineral nutrients and water as well as photocompounds. In this study, the intercellular CO 2 concentration under RPO treatment decreased, the photosynthetic rate increased, and the vascular bundle slightly changed (Table 6 , Fig. 2 ). This might be related to the RPO film changing the spectral ratio and increasing the light transmittance (Table 4 ). Rubisco is a key enzyme in photosynthetic carbon assimilation during the dark reaction process of photosynthesis [ 33 ]. It can catalyse carbon reduction in photosynthesis and carbon oxidation in photorespiration, promote the utilization of light energy, accelerate the Calvin cycle, and ultimately increase photosynthetic efficiency [ 34 ]. These findings indicate that the performance of photosynthesis largely depends on the Rubisco kinetics at low temperatures and the Rubisco activation state at high temperatures [ 35 ]. Many plants, including rice and Arabidopsis, contain two closely related subunit types of Rubisco-activating enzyme-encoding genes [ 36 , 37 ]. This study revealed that all four genes that activate the Rubisco enzyme were upregulated to varying degrees (Fig. 3 ), which might be related to the increase in greenhouse temperature caused by RPO (Table 2 ). 4.3 Influence of RPO on fruit quality and yield The light quality of plants affects their photosynthetic capacity, which determines crop yield [ 38 ]. Studies have shown that blue‒violet light promotes the growth of crop stems and leaves and red‒orange light promotes the growth and reproduction of crop fruits, whereas yellow‒green light and near‒violet light have no effect on crop growth. Rare earth light conversion films can convert yellow‒green light and near-ultraviolet light into red‒orange light and blue‒violet light through the combination and interaction of rare earth ions, promoting the growth and development of crops [ 39 – 42 ]. The accumulation of soluble sugars, as primary metabolites of plants, is affected by photosynthesis [ 43 ]. In this study, the photosynthetic rate of the RPO treatment was greater than that of the control (Table 6 ), which might be the reason for the increases in soluble sugars and soluble solids (Fig. 4 A and 4 B). Light stimulates the D-man/L-gal biosynthesis pathway in plants, causing the amount of Vc in plant tissues to increase with increasing irradiance [ 44 ]. Flavonoids are important secondary metabolites in plants that are regulated by the environment. A light mass with a relatively high ratio of FR to NIR increased the activity of flavonoid methyltransferase but inhibited the activity of flavonoid glycosyltransferase. A high proportion of UV-A and a high R/FR ratio can increase the activity of flavonoid glycosyltransferases [ 45 ]. This might explain why the Vc (Fig. 4 E) and flavonoid (Fig. 4 F) contents after RPO treatment were greater than those of the control. RPO treatment increased the yield of cucumbers by 30% and the yield of sweet peppers by 20.34% [ 9 , 28 ]. Compared with ordinary film, light-transferring film can promote strawberry maturation 10 d earlier and increase the yield by 3180 kg·hm − 2 [ 17 ]. Compared with blank film cultivation, light conversion film cultivation increased the aboveground biomasses of different varieties of three vegetables, namely, mustard, Chinese cabbage and Chinese heart, by 20.53–23.40%, 20.13–32.62% and 16.43–20.30%, respectively [ 46 ]. Similarly, the yield of strawberry fruits increased in this experiment (Table 7 ), which might be related to RPO altering the greenhouse environment and enhancing photosynthesis. 5. Conclusions The results of this study revealed that the use of a rare earth semitransparent film increased the spectral ratios of red‒orange light, blue light and far-red light in the greenhouse; reduced the spectral ratios of ultraviolet light, ultraviolet light and green light; and improved the average light intensity, light transmittance and accumulated temperature of the greenhouse. Upregulating the gene expression levels of Rubisco and its different morphological subunits enhanced the activity of the Rubisco enzyme in leaves, increased the leaf area, altered the structure of strawberry petioles, and improved the photosynthetic efficiency and material transport efficiency of strawberry plants, thereby promoting their growth and development and increasing yield. Moreover, the rare earth light conversion film treated with RPO2 was more suitable for the growth of strawberries. Rare earth light conversion films can be used as a strategy to improve photosynthetic traits and increase crop yields. Abbreviations ABS/RC, Real absorption flux per reaction centre; ATP, Adenosine triphosphate; cDNA, Complementary DNA; CK, Polyolefin film; ETo/RC, Real election transport flux per reaction centre; Fv/Fm, Optimal/maximal photochemical efficiency of PSⅡ in the dark; mRNA, Messenger RNA; NADPH, Nicotinamide Adenine Dinucleotide Phosphate Hydrogen; qRT‒PCR, Real-time quantitative PCR; RNA, Ribonucleic acid; RPO, Rare earth conversion film; TRo/RC, Real trapped energy flux per reaction centre. Declarations Acknowledgements We would like to acknowledge the reviewers and editors for their time and constructive feedback, which will undoubtedly enhance the quality of this manuscript. Authors’ contributions Liyuan Zhao: Writing - original draft, Formal analysis, Data curation. Ru Li: Writing - original draft, Investigation. Data curation. Mengyao Shi: Data curation, Visualization. Bing-Bing Cai: Methodology, Conceptualization. Guihong Zhou: Writing - review & editing, Supervision. Xin-Xin Wang: Writing - review & editing. Qingyun Li: Writing - review, Funding, Project administration. Funding This work was supported by the earmarked fund for CARS-Specialty Vegetable (grant number CARS-24-G-03). Declaration of competing interest The authors declare that the research was conducted in the absence of any commercial or financial relationships. Data availability The data presented in this study are available in the article or supplementary information; find some help on our Data availability statements page. Ethics approval and consent to participate In this study, All the strawberry materials required for the experiment were approved by Zengxian Agricultural Corporation of Baoding. The collection materials of the plants complies the relevant institutional, national, and international guidelines and legislation. Consent for publication Not applicable. Competing interests The authors declare no competing interests. References Dong H, Li F, Xuan X, Ahiakpa JK, Tao J, Zhang X, Ge P, Wang Y, Gai W, Zhang Y. The genetic basis and improvement of photosynthesis in tomato. Hortic Plant J. 2025;11(1):69–84. Pfannschmidt T, Nilsson A, Tullberg A, Link G, Allen JF. Direct transcriptional control of the chloroplast genes psbA and psaAB adjusts photosynthesis to light energy distribution in plants. IUBMB Life. 1999;48(3):271–6. Berry JO, Yerramsetty P, Zielinski AM, Mure CM. Photosynthetic gene expression in higher plants. Photosynth Res. 2013;117(1–3):91–120. Bar-On YM, Milo R. The global mass and average rate of rubisco. Proc Natl Acad Sci USA. 2019;116(10):4738–43. Xia L, Jiang Y, Kong W, Sun H, Li W, Chen Y, Zhou C. Molecular basis for the assembly of Rubisco assisted by the chaperone Raf1. Nat Plants. 2020;6(6):708. Eshenour K, Hotto A, Michel EJS, Oh ZG, Stern DB. Transgenic expression of Rubisco accumulation factor2 and Rubisco subunits increases photosynthesis and growth in maize. J Exp Bot. 2024;75(13):4024–37. Zhang Y, Mao Z, Wang D, Zhao J. Synchronous red and blue emitting Ca 3 (PO 4 ) 2 :Eu 2+ , Mn 2+ phosphors applicable for plant-lighting. Mater Res Bull. 2015;67:1–4. Olle M, Virsile A. The effects of light-emitting diode lighting on greenhouse plant growth and quality. Agricultural Food Sci. 2013;22(2):223–34. Gao Y, Li G, Cai B, Zhang Z, Li N, Liu Y, Li Q. Effects of rare-earth light conversion film on the growth and fruit quality of sweet pepper in a solar greenhouse. Front Plant Sci. 2022;13:989271. Simakin AV, Ivanyuk VV, Dorokhov AS, Gudkov SV. Photoconversion fluoropolymer films for the cultivation of agricultural plants under conditions of insufficient insolation. Appl Sciences-Basel. 2020;10(22):8025. Zhou R, Lu X, Yang Q, Wu P. Nanocrystals for large Stokes shift-based optosensing. Chin Chem Lett. 2019;30(10):1843–8. (in Chinese with English). Li J, Zhangzhong L, Zhang X, Wei X, Zhang S, Wang L, Zheng W. Effects of light conversion film on the growth of leafy vegetables in facilities under haze weather. Agronomy-Basel 2022; 12(10). Kang JH, Kim D, Yoon HI, Son JE. Growth, morphology, and photosynthetic activity of Chinese cabbage and lettuce grown under polyethylene and spectrum conversion films. Hortic Environ Biotechnol. 2023;64(4):593–603. Tang H, Liu X, Chen Z, Tang J, Li J. Combined effect of covering translucent film in greenhouse tea gardens during winter and spring low temperature period. Guangdong Agricultural Sci. 2014;41(10):18–22. (in Chinese with English). Xing W, Peng G, Xie X, Yang Y, Cheng F. Study on the effect of translucent film on volatile flavor and metabolomics of bebe pumpkin. J Food Saf Qual Test. 2023;14(10):31–9. (in Chinese with English). Wang J, Qiao X, Li B, Liu B, Zhang J, Yan Z, Hao P, Wang X, Liu Y, Shen L, Wang Z. The research progress of rare earth agricultural light conversion film. Heliyon. 2024;10(17):e36967. Liu Y, Liu Q, Wei H, Dai J, He W. Effects of light conversion film on growth and quality of strawberry. China Vegetables. 2019(9):62–8. (in Chinese with English). Paskhin MO, Yanykin DV, Popov AV, Pobedonostsev RV, Kazantseva DV, Dorokhov AS, Izmailov AY, Vyatchinov AA, Orlovskaya EO, Shaidulin AT, Orlovskii YV, Vodeneev VA, Gudkov SV. Two types of europium-based photoconversion covers for greenhouse farming with different effects on plants. Horticulturae. 2023;9(7):846. Gao Y, Liu Y, Li G, Li N, Li Q. Effect of new rare earth light-transmitting film on the growth of early spring cucumbers in plastic greenhouses. Mod Agricultural Sci Technol. 2023(10):38–42. (in Chinese with English). Gao Y, Li G, Ma W, Zhang Z, Wang X, Mu Y, Li Q. Effects of new rare earth light conversion film on growth,development and yield of cucumber in solar greenhouse. J Hebei Agricultural Univ. 2022;45(3):56–62. (in Chinese with English). Yang Y, Qin N, Huang J, Guo A, Kang X, Li S, Xing G. Dynamic changes of pectin epitopes and daylily tepals during flower opening and senescence of Hemerocallis citrina . Sci Hort. 2021;288:110367. Gasparov VS, Degtiar VG. Protein determination by binding with the dye Coomassie brilliant blue G-250. Biokhimiia. 1994;59(6):763–77. Ahmad B. Observations on the chemical method for the estimation of vitamin C. Biochem J. 1935;29(2):275–81. Abraham E, Hourton-Cabassa C, Erdei L, Szabados L. Methods for determination of proline in plants. Methods in Molecular Biology (Clifton, NJ). 2010; 639:317–331. Leng F, Sun S, Jing Y, Wang F, Wei Q, Wang X, Zhu X. A rapid and sensitive method for determination of trace amounts of glucose by anthrone-sulfuric acid method. Bul Chem Commun. 2016;48(1):109–13. Topcu H. Reference gene selection for RT-qPCR normalization of strawberry at various organs, different growing stages of fruits, and salt-stress treatment. Turkish J Agric Forestry. 2022;46(4):509–24. Wan H, Yuan W, Ruan M, Ye Q, Wang R, Li Z, Zhou G, Yao Z, Zhao J, Liu S, Yang Y. Identification of reference genes for reverse transcription quantitative real-time PCR normalization in pepper ( Capsicum annuum L). Biochem Biophys Res Commun. 2011;416(1–2):24–30. Li R, Gao Y, Cai B, Li G, Xue Z, Wang X-X, Li Q. RPO film effectively promotes fruit quality and yield of cucumber through adjusting greenhouse environment and hormone contents. BMC Plant Biol. 2024;24(1):1250. Zheng L, He H, Song W. Application of light-emitting diodes and the effect of light auality on horticultural crops: a review. HortScience. 2019(10):1656–61. Fan X, Zang J, Xu Z, Guo S, Jiao X, Liu X, Gao Y. Effects of different light quality on growth, chlorophyll concentration and chlorophyll biosynthesis precursors of non-heading Chinese cabbage ( Brassica campestris L). Acta Physiol Plant. 2013;35(9):2721–6. Sharkey TD. Photosynthesis in intact leaves of C 3 plants: physics, physiology and rate limitations. Bot Rev. 1985;51(1):53–105. Krapp A, Stitt M. An evaluation of direct and indirect mechanisms for the sink-regulation of photosynthesis in spinach - changes in gas-exchange, carbohydrates, metabolites, enzyme-activities and steady-state transcript levels after cold-girdling source leaves. Planta. 1995;195(3):313–23. Miziorko HM, Lorimer GH. Ribulose-1,5-bisphosphate carboxylase-oxygenase. Annu Rev Biochem. 1983;52:507–35. Lin X, Liu F, Liao H, Du J, Peng J, Zhou K. Effect of enhanced ultraviolet-b radiation on fruit maturity and quality and leaf photosynthesis in 'Guifei' mango. HortScience. 2022;57(9):1167–72. Yamori W, Suzuki K, Noguchi K, Nakai M, Terashima I. Effects of Rubisco kinetics and Rubisco activation state on the temperature dependence of the photosynthetic rate in spinach leaves from contrasting growth temperatures. Plant Cell Environ. 2006;29(8):1659–70. Tan T, Li S, Fan Y, Wang Z, Raza MA, Shafiq I, Wang B, Wu X, Yong T, Wang X, Wu Y, Yang F, Yang W. Far-red light: A regulator of plant morphology and photosynthetic capacity. Crop J. 2022;10(2):300–9. Fukayama H, Ueguchi C, Nishikawa K, Katoh N, Ishikawa C, Masumoto C, Hatanaka T, Misoo S. Overexpression of Rubisco activase decreases the photosynthetic CO 2 assimilation rate by reducing Rubisco content in rice leaves. Plant Cell Physiol. 2012;53(6):976–86. Cai J. Preparation of Cr 3+ activated agricultural film light-converting agent materials and their luminescent properties. Master Thesis. Guangzhou: Jinan University; 2014. Li Y, Xin G, Wei M, Shi Q, Yang F, Wang X. Carbohydrate accumulation and sucrose metabolism responses in tomato seedling leaves when subjected to different light qualities. Sci Hort. 2017;225:490–7. Hu Z, Li L, Shao C, Cai Q. The light conversion film materials and research status. Mater Rep. 2008;22(Z2):290–3. Zhou M, Liu W, Yang C, Zhao X, Yang Z. Preparation and application of multinuclear rare earth ion doped organic complex light conversion agents. Acta Materiae Compositae Sinica. 2023;40(4):2131–9. (in Chinese with English). Zhang R, Wang X, Wang T, Zhu Y, Wang H. The Research progress of artificial light sources and luminescent materials for promoting plant growth. Mater Rep. 2007;21(10):17–9. (in Chinese with English). Ntagkas N, Woltering EJ, Marcelis LFM. Light regulates ascorbate in plants: An integrated view on physiology and biochemistry. Environ Exp Bot. 2018;147:271–80. Fu B, Ji X, Zhao M, He F, Wang X, Wang Y, Liu P, Niu L. The influence of light quality on the accumulation of flavonoids in tobacco ( Nicotiana tabacum L.) leaves. J Photochem Photobiology B-Biology. 2016;162:544–9. Wu W, Zhang Z, Dong R, Xie G, Zhou J, Wu K, Zhang H, Cai Q, Lei B. Characterization and properties of a Sr 2 Si 5 N 8 :Eu 2+ -based light-conversion agricultural film. J Rare Earths. 2020;38(5):539–45. Li Q, Zhang B, Liang P, Feng W, Li X, Liang B. Effects of light-conversion film on leaf vegetables yield. Guangdong Agricultural Sci. 2015;42(21):30–4. (in Chinese with English). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 06 Nov, 2025 Read the published version in BMC Plant Biology → Version 1 posted Editorial decision: Revision requested 14 Aug, 2025 Reviews received at journal 14 Aug, 2025 Reviews received at journal 11 Aug, 2025 Reviews received at journal 30 Jul, 2025 Reviewers agreed at journal 28 Jul, 2025 Reviewers agreed at journal 27 Jul, 2025 Reviewers agreed at journal 24 Jul, 2025 Reviewers agreed at journal 03 Jul, 2025 Reviewers agreed at journal 26 Jun, 2025 Reviewers invited by journal 24 Jun, 2025 Editor assigned by journal 23 Jun, 2025 Submission checks completed at journal 21 Jun, 2025 First submitted to journal 21 Jun, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6877648","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":475951241,"identity":"38429de9-65c2-44fa-bf34-26f4e1238ddd","order_by":0,"name":"Liyuan Zhao","email":"","orcid":"","institution":"Hebei Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Liyuan","middleName":"","lastName":"Zhao","suffix":""},{"id":475951242,"identity":"3a56f9c2-8dd7-4cfa-a646-271b05e8e08d","order_by":1,"name":"Ru Li","email":"","orcid":"","institution":"Hebei Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Ru","middleName":"","lastName":"Li","suffix":""},{"id":475951244,"identity":"a2497c84-fc6f-4a3d-aead-01d1ebc617f2","order_by":2,"name":"Mengyao Shi","email":"","orcid":"","institution":"Hebei Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Mengyao","middleName":"","lastName":"Shi","suffix":""},{"id":475951245,"identity":"5b2450bd-8877-4ba2-8181-47d8cd07f68e","order_by":3,"name":"Bing-Bing Cai","email":"","orcid":"","institution":"Hebei Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Bing-Bing","middleName":"","lastName":"Cai","suffix":""},{"id":475951246,"identity":"4ea7489f-e173-4be4-8c06-204b20f9212b","order_by":4,"name":"Guihong Zhou","email":"","orcid":"","institution":"Hebei Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Guihong","middleName":"","lastName":"Zhou","suffix":""},{"id":475951249,"identity":"33ec264f-ec54-4402-be84-212a54b71b77","order_by":5,"name":"Xin-Xin Wang","email":"","orcid":"","institution":"Hebei Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xin-Xin","middleName":"","lastName":"Wang","suffix":""},{"id":475951251,"identity":"42eda5ef-035b-4905-a081-c1675037f4f5","order_by":6,"name":"Qingyun Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA10lEQVRIiWNgGAWjYBACPmYGhgNgFnvzwQcJFTWEtbDBtfAcSzZ4cOYYEVrgLAkfM8mHLcxEaGFn3ni44NfhxO0SPGYViQ1sDPzt3QkEHMZWcHhm3+HEnbPbym4k7pBhkDhzdgMBLTwGh3l7DiduuHN4243EM2wMBhK5xGq5kWBWkNjGTKQWnh8gLSlmDERqAfqFtyHdeMOZY8kSCWeO8RD0Cz//4c2fef5Yy2443nzw44+KGjn+9l78WoDAgIGxrRnO4yGkHKKF4U8dMQpHwSgYBaNgpAIAun9NwhVA5cAAAAAASUVORK5CYII=","orcid":"","institution":"Hebei Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Qingyun","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2025-06-12 07:38:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6877648/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6877648/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12870-025-07351-7","type":"published","date":"2025-11-06T15:57:08+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":85518631,"identity":"77abb41c-5638-4914-a704-100988a09cd3","added_by":"auto","created_at":"2025-06-26 18:59:58","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":610476,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of rare earth light conversion films on longitudinal sections of leaves. Sections of the anatomical structures of longitudinal sections of strawberry leaves from three treatments at different magnifications at the same stage (A1), (A4), (A7): 4× micrographs of CK, RPO1 and RPO2; (A2), (A5), (A8): 10× micrographs of CK, RPO1 and RPO2; (A3), (A6), (A9): 20× micrographs of CK, RPO1 and RPO2. The spongy tissue in the yellow circle is that of the strawberry leaves.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6877648/v1/81bf7f1e16e0f57e685b2309.jpeg"},{"id":85519372,"identity":"3c3fb1a6-b464-45a0-97fa-25797371839c","added_by":"auto","created_at":"2025-06-26 19:15:58","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":342407,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of the rare earth light conversion films on longitudinal sections of petioles. Anatomical sections of cross sections of strawberry petioles from three treatments at different magnifications at the same stage (A1), (A4), (A7): 2× micrographs of CK, RPO1 and RPO2; (A2), (A5), (A8): 4× micrographs of CK, RPO1 and RPO2; (A3), (A6), (A9): 10× micrographs of CK, RPO1 and RPO2.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6877648/v1/fc82fa4b2fd59c9ff5c93fe7.jpeg"},{"id":85518629,"identity":"b8656d2e-ee8c-478d-ada6-8730a0b71d49","added_by":"auto","created_at":"2025-06-26 18:59:58","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":437943,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of rare earth light conversion films on the enzyme activity of Rubisco and the related coding genes of Rubisco genetic analysis of strawberry leaves in solar greenhouses (A): Activity of the Rubisco enzyme in leaves. (B): Expression level of rubisco accumulation factor 1 (\u003cem\u003eRub-af1\u003c/em\u003e). (C): Expression level of ribulose diphosphate carboxylase small chain 1 (\u003cem\u003eRib-cs1\u003c/em\u003e) in the capsule. (D): Expression level of the large subunit binding protein subunit α (\u003cem\u003eRubLα\u003c/em\u003e) of vascular Rubisco. (E): Expression level of the Rubisco large subunit binding protein subunit β (\u003cem\u003eRubLβ\u003c/em\u003e). (F): Expression level of ribose-bisphosphate carboxylase small chains (\u003cem\u003eRib-cs\u003c/em\u003e) in chloroplast ribose-thylakoid sacs. Lowercase letters represent significant differences among the three treatments in the horizontal direction (\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05). Same as below.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6877648/v1/3f00e4dcb71b75fe68fe7ed8.jpeg"},{"id":85518636,"identity":"a5538fa0-e35c-46d3-b38c-bb365c3d1de1","added_by":"auto","created_at":"2025-06-26 18:59:58","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":508599,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of rare earth light conversion films on the fruit quality of strawberry plants in a solar greenhouse. (A): Soluble solid. (B): Soluble sugar content. (C): Soluble protein content. (D): Organic acid content. (E): Vc content. (F): Flavonoid content. (G): Total phenol content.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6877648/v1/d834935f7365360863d4104b.jpeg"},{"id":85518635,"identity":"d5662d57-5a96-4be0-8014-af74a71ce2fd","added_by":"auto","created_at":"2025-06-26 18:59:58","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":292389,"visible":true,"origin":"","legend":"\u003cp\u003eCorrelation analysis of internal environment indicators and leaf photosynthesis indicators. PL represents the length of the petiole; TLA represents the total leaf area; PR represents the photosynthetic rate; TR represents the transpiration rate; ICDC represents the intercellular CO\u003csub\u003e2\u003c/sub\u003e concentration; SC represents the stomatal conductance; Ca represents the content of chlorophyll a; Cb represents the content of chlorophyll b; Cc represents the content of carotenoids; and RuBP represents the activity of ribulose-1,5-bisphosphate carboxylase. ***, ** and * indicate significance at \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 and \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, respectively. Same below.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6877648/v1/658ac94b8625a5df9dfb8688.jpeg"},{"id":85518634,"identity":"7212ccf6-fe7a-4ea8-8e8e-a1403bc07f01","added_by":"auto","created_at":"2025-06-26 18:59:58","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":205405,"visible":true,"origin":"","legend":"\u003cp\u003eCorrelation analysis of internal environmental indicators, strawberry fruit quality, yield and fruit weight. LT stands for transmittance; AT represents the average air temperature in the shed. ALI represents the average light intensity in the shed. ATT stands for the accumulated temperature in the shed; H1 represents the number of hours above 10 °C; H2 represents the number of hours above 20 °C. W stands for strawberry fruit weight; Y stands for shed yield. SS stands for soluble solid; SP stands for soluble protein content; Ss stands for soluble sugar content; OA stands for organic acid content; Vc stands for vitamin C; F represents the flavonoid content; and TP represents the total phenol content.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6877648/v1/0bc004cc46624d3363da4679.jpeg"},{"id":85518638,"identity":"07e0f0c2-9e10-4449-b5bb-bd036c3b2893","added_by":"auto","created_at":"2025-06-26 18:59:58","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":531171,"visible":true,"origin":"","legend":"\u003cp\u003eCorrelation analysis of leaf photosynthesis indicators, strawberry fruit weight and fruit yield. W represents strawberry fruit weight; Y represents shed output; PL represents the length of the petiole; TLA represents the total leaf area; PR represents the photosynthetic rate; TR represents the transpiration rate; ICDC represents the intercellular CO\u003csub\u003e2\u003c/sub\u003e concentration; SC represents stomatal conductance; Ca represents the content of chlorophyll a; Cb represents the content of chlorophyll b; Cc represents the content of carotenoids; and RuBP represents the activity of ribulose-1,5-bisphosphate carboxylase.\u003c/p\u003e","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6877648/v1/5a82752270de625f16d2e52c.jpeg"},{"id":85518913,"identity":"c28c5d44-7905-435f-b743-7ef6e22c414e","added_by":"auto","created_at":"2025-06-26 19:07:58","extension":"jpeg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":168591,"visible":true,"origin":"","legend":"\u003cp\u003eStructural equation model. Red indicates a negative correlation, and blue indicates a positive correlation. The dotted line represents a significant influence at the 0.05 level. The solid lines represent no significant influence at the 0.05 level. * and ** indicate significance at \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05 and \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, respectively.\u003c/p\u003e","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6877648/v1/6318f80abbe9d3c0b146bd0b.jpeg"},{"id":95563936,"identity":"531cac4a-c81e-4af3-b172-94ab4fdc4353","added_by":"auto","created_at":"2025-11-10 16:04:39","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4847549,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6877648/v1/c57428cb-3618-4823-8a26-112ca92d483d.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Rare earth transfer films enhance the photosynthetic efficiency of strawberry plants, thereby improving fruit quality and yield","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003ePhotosynthesis can affect the growth and yield of crops. Photosynthesis is the ultimate energy source of plants and consists of two key stages: the light and dark reactions [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The light reaction mainly occurs during the photosynthesis of chloroplasts in green plants, where light energy is absorbed and converted to generate NADPH and ATP [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Subsequently, the dark reaction utilizes the generated energy to fix CO\u003csub\u003e2\u003c/sub\u003e and convert it into six types of carbon sugars in the carbon assimilation process [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Photosynthetic carbon assimilation can store energy in the biological world and generate most of the biomass in the biosphere. Rubisco (ribulose 1,5-bisphosphate ribulose carboxylase) is the most abundant protein on Earth and is responsible for the vast majority of global carbon fixation [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], and it is highly sensitive to temperature. With the assistance of different assembly factors, Rubisco can be composed of 8 large subunits (RbcL) and 8 small subunits (RbcS) to form a hexadecamer [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. These assembly factors, large subunits and small subunits affect the activity of Rubisco, thereby influencing photosynthesis.\u003c/p\u003e \u003cp\u003eLight is the source of energy for photosynthesis, germination, flowering and fruiting in plants [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Notably, plants exhibit a high absorption efficiency of 90% for blue and red light wavelengths [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Research has demonstrated that light conversion films can modulate spectral transmittance by transforming short wavelengths, such as ultraviolet and violet light, into longer wavelengths, such as red‒orange, blue, and far-red light. This spectral optimization enhances light conditions for improved growth and yield in facility-grown crops [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Therefore, functional agricultural light transfer films are gradually replacing traditional EVA polyethylene, PVC polyvinyl chloride agricultural films and coated films to improve problems such as low winter and spring yields of facility vegetables, long crop growth cycles and unstable fruit quality.\u003c/p\u003e \u003cp\u003eThe energy difference in the process of spectral conversion is released in the form of heat energy. Combined with the good thermal insulation performance of the light conversion film, the temperature of the shed covered by the light conversion film is improved [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In autumn cultivation, the increase in air temperature is as high as 0.50\u0026deg;C. The temperature regulation function of the light conversion film reduces the stress caused by higher and lower temperatures to a certain extent. The effects of the light transfer film on the temperature and humidity of the shed differ between sunny days and weak light days (such as cloudy and haze). On sunny days, the average temperature in the light conversion film shed increases by 0.20\u0026ndash;6.80\u0026deg;C; on low-light days, it increases by 0.20\u0026ndash;1.90\u0026deg;C; under sunny or hazy conditions, the air humidity in the greenhouse with the light-transfer film is 1.73\u0026ndash;9.30% higher than that of the control; and on cloudy days, it decreases by 0.71% [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThroughout the entire growth period, light conversion film can also accelerate the growth rate of crops, increase their yield and quality, and reduce the incidence of pests and diseases. Light conversion film can significantly increase the photosynthetic rate of Chinese cabbage and significantly increase its dry leaf weight and leaf area by 33.0% and 33.3%, respectively [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Additionally, light-transferring film has been shown increase the yield of tomatoes by 32.90%, the average yield per unit area of Bebe pumpkins by 5.90%, and the yield of pre-Mingming tea by 51.20\u0026ndash;56.20%. The contents of β-carotene, soluble protein, Vc, soluble sugar, aldehydes, furans and ketones can increase, which can advance the spring tea harvest period by 6\u0026ndash;27 days and inhibit the reproduction of false-eyed little green leafhoppers (\u003cem\u003eEmpoasca vitis\u003c/em\u003e) and tea aphids (\u003cem\u003eToxoptera aurantii\u003c/em\u003e) [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eRare earth ions have rich spectral energy levels; rare earth luminescence almost covers the entire range of solid-state luminescence. Research on the preparation of agricultural light conversion films doped with rare earth elements has gradually attracted the attention of researchers [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Research has shown that adding a new europium-containing complex as a transfer agent to light-transmitting film can cause the accumulated temperature inside the greenhouse to reach 2072.50\u0026deg;C, and the average daily temperature increased by 3.62% [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. A semitransparent film with Eu(III) added as could increase the size of tomato plants by 30\u0026ndash;40%, increase the tolerance of tomatoes to high and low temperatures, inhibit the growth of the tomato pathogen Mycobacterium difficile, and promote the growth of tomatoes throughout their lifetime [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Previous studies have also shown that adding elements such as europium and yttrium to light conversion films can increase the yield of cucumbers by 30.01%. Compared with those of the control (traditional membrane), the growth indicators of the plants, the net photosynthetic rate and fruit quality improved to varying degrees [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eStrawberry (\u003cem\u003eFragaria\u0026times;ananassa\u003c/em\u003e Duch.) is the world's main cash crop; in addition to its cultivation area and output, it is firmly at the forefront of the world, and its related industrial chain drives the economic development of countries. However, few studies have investigated the influence of rare earth light-transmitting films on strawberries. In recent years, global environmental changes and the frequent occurrence of weak light due to weather conditions such as smog have had a nonnegligible impact on the yield and quality of strawberries. Light conversion film, as one of the means to increase yield and improve the quality of facility crops, is currently more widely used in leafy vegetable crops but less widely studied in strawberry. Therefore, based on results from traditional PO film, in this study, a traditional PO film was used as the control, and rare earth phototransfer films with different amounts of europium and yttrium were used for the treatments. Through the analysis of strawberry leaves and samples at the fruit stage, the effects of rare earth light transfer films on the photosynthesis, yield and fruit quality of facility strawberry plants were investigated in detail, and the effects of the two types of light transfer films were comprehensively evaluated.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Experimental design and plant materials\u003c/h2\u003e \u003cp\u003eThe 'Hongyan' variety of strawberry was used as the experimental material in this study. This is the main cultivated variety in the local area. This material is provided by Hebei Zengxian Agricultural Planting. It was cultivated in three solar greenhouses managed by Hebei Zengxian Agricultural Planting Co., Ltd. (Zheng Village, Zhengcun County, Baoding City, Hebei Province, China, 39\u0026deg;0\u0026rsquo;41\u0026rsquo; N, 115\u0026deg;30\u0026rsquo;13\u0026rsquo; E) from September 2023 to May 2024. Each of these greenhouses was 70 m in length, 10.6 m in width, 4.6 m in mid-ridge height, and 10 m in inner span, with a 0.37 m brick wall. The greenhouse, which runs east‒west, is insulated with a quilt made of three layers of flower felt and one layer of pearl cotton covering the black felt. The row spacing for strawberry plants is 90 cm, with a spacing of 10 cm within each row. Each greenhouse was planted with 9,000\u0026ndash;10,000 strawberry plants. The strawberry plants were grown in soil beds 0.5 m below ground level, covered with black plastic film and drip-irrigated beneath the film. Each greenhouse contained 72 rows covering 770 m\u0026sup2;. Within each greenhouse, a sample plot consisting of 11 adjacent rows was randomly selected, with the area of each plot being approximately 90 m\u003csup\u003e2\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eFor comparison, three types of covering materials were tested. The first greenhouse was covered with a layer of standard polyolefin film (PO, thickness of 0.1 mm) from Hebei Kangcheng Modern Agricultural Products Development Co., Ltd., as the control (CK). The second greenhouse was covered with a rare earth light-transmitting film (RPO, thickness of 0.1 mm) specifically designed for strawberries from Shandong Shunming Company as a treatment (RPO1). The third greenhouse was covered with a special rare earth light conversion film (RPO, thickness of 0.1 mm) for strawberries from Shandong Xintianhe Company Co., Ltd., as another treatment (RPO2). Each plot included three quarters as repeats. Planting occurred on September 25, 2023, flowering began on October 23, 2023, harvesting began on January 20, 2024, and the crop cycle ended on May 6, 2024.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Determination of the inner environment of the greenhouses\u003c/h2\u003e \u003cp\u003eFrom September 2023 to May 2024, we conducted continuous monitoring of the spectrum, light intensity and air temperature within the greenhouse. The spectral ratios and light transmittance were calculated every 30 days starting from October 28, 2023. Each month between 9:00 and 11:00 a.m., spectral measurements were conducted every half hour using a QE65000 spectrometer (Ocean Optics, Shanghai, China) positioned at a height of 1.5 m from the ground and 5 m away from the film of the greenhouse, and the average of the five measurements was computed as a replicate value. Light intensity was measured using a #3415F Quantum light meter illuminometer (Spectrum Technologies, Inc., United States) mounted in the centre of the greenhouse at 1.5 m above the ground, in conjunction with spectral measurements. Air temperature and air humidity readings of CK, RPO1 and RPO2 samples were taken with i500 temperature sensors (Hangzhou Drucker Co., Ltd., China), which were placed in the middle of the greenhouse at a distance of 1.5 m from the floor.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Measurement of strawberry leaf growth traits at the flowering stage\u003c/h2\u003e \u003cp\u003eThe third functional leaf was selected from the crown of the strawberry plant. The leaf area and chlorophyll content of the plants were measured. Each functional leaf consists of three leaflets (left, middle, and right). Eight leaves were selected as replicates for each plot. The leaf area of the functional leaves was measured with a leaf area meter (AM-200), and the parietal leaf photosynthetic parameters, including the photosynthetic rate, transpiration rate, intercellular carbon dioxide concentration and stomatal conductance, were measured with a YZQ-100A portable dynamic photosynthesis system (Ji Zhuqi Technology (Beijing) Co., Ltd.), with the optical quantum flux density (PFD) set at 500 \u0026micro;mol\u0026middot;m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e\u0026middot;s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. The fluorescence parameters, including PSII primary light conversion efficiency (Fv/Fm), unit reaction centre absorption (ABS/RC), unit of light energy captured by the reaction centre (TRo/RC) and the energy transferred by an electron (ETo/RC) in the same leaf, were measured using a Handy PEA Plant efficiency analyser (Hansatech, UK). The photosynthetic pigment content was determined using the mixed sample described above, and the pigment was extracted using the 80% acetone method. The absorption value was subsequently determined with an ultraviolet spectrophotometer (U-5100 UV/VIS) at wavelengths of 470, 645 and 663 nm, and the contents of chlorophyll a, chlorophyll b and carotenoids were subsequently calculated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Strawberry leaf and petiole sampling and processing for microscopy\u003c/h2\u003e \u003cp\u003ePermanent sections of the samples were prepared, and the size and number of cells were recorded through photographs and observations under an OLYMPUS BX51M compound microscope (BX51M Olympus Optical Co., Ltd., Tokyo, Japan) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Measurement of strawberry fruit yield and quality\u003c/h2\u003e \u003cp\u003eCommercial strawberry fruits were collected during the mature period (January 20, 2024). At this stage, 20 fruits were selected from each plot as samples; this process was repeated three times. The weight of commercial strawberry fruits was measured with an electronic balance with an accuracy of 0.01 g, and the fruit length, width and fruit shape index were scanned with an i800plus ScanMaker (MICROTEK, MRS-9600TFU2L, Shanghai Zhongjing Technology Co., Ltd.). The quality of commercial strawberry fruits was assessed during the mature period (December 14, 2023). At this stage, 20 fruits were selected from each plot, mixed finely, and then frozen quickly with liquid detergent to create a mixed sample; this process was repeated five times. The soluble solid content was measured using an ATAGO handheld digital sugar meter (ATAGO, Japan). Chemical experimental methods were employed to determine the contents of other substances. The Coomassie Brilliant Blue G-250 staining method was used to measure the fixed soluble protein content [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The content of vitamin C was determined using the 2,6-dichlorophenol indophenol titration method, whereas the titratable acid content was measured using the sodium hydroxide titration method [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Free amino acid levels were measured through ninhydrin colorimetry [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], and the soluble sugar content was determined using the anthrone colorimetric method [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Additionally, the number of fruits per plant and the overall plot yield were recorded throughout the harvesting period. Single fruit weights were also measured during the mature period.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Fluorescent quantitative PCR (qRT‒PCR)\u003c/h2\u003e \u003cp\u003eNCBI was used to design qRT‒PCR-specific primers for candidate genes (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), which were synthesized by Beijing Qingke Biotechnology Co., Ltd. Strawberry leaf RNA (a plant RNA extraction kit) was extracted and reverse-transcribed (Kangwei reverse transcription kit) to obtain cDNA, and then, qRT‒PCR was performed with a Kangwei MagicSYBR mixture kit and a StepTwo real‒time fluorescence quantitative PCR system (Roche, CA, USA). The PCR amplification procedure was as follows: the amplification program included 1 cycle of 95\u0026deg;C for 30 s, followed by 40 cycles of 95\u0026deg;C for 5 s and 60\u0026deg;C for 30 s. The 20 \u0026micro;L reaction system was as follows: 2\u0026times; MagicSYBR mixture, 10 \u0026micro;L; upstream and downstream primers, 4 \u0026micro;L; cDNA, 2 \u0026micro;L; and sterilized ddH\u003csub\u003e2\u003c/sub\u003eOto 20 \u0026micro;L. Three biological replicates and three technical replicates were used for each gene. The final value of relative quantitation was compared with that of the control internal reference gene StRefActin 1 (LOC101300025) [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], and multiple changes in gene expression in the samples were tested. The relative expression levels of the candidate genes were analysed by the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eqRT‒PCR primers for strawberry\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStRefActin 1-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCACGAGACCACCTATAACTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStRefActin 1-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTCATCCTATCAGCGATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRub-af1-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAACCGACTCGGCTTATGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRub-af1-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCCATGATTTCAGGGTCGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRib-cs1-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTTTCGTCTACCGTGAGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRib-cs1-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATCCTGATGAAGGCCTCGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRubLα-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGGAGGTTGGCTACAACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRubLα-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGCAGGTGACTTGGGCTTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRubLβ-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCTTCTACTCCGTTTCGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRubLβ-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGAAGCAATGGAAGCCCGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRib-cs-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTTTCATCATCCGCCCACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRib-cs-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCACAGGCAGCCTAATTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Data analysis\u003c/h2\u003e \u003cp\u003eAll the experiments described here were repeated three times in a randomized complete block design. One-way ANOVA was performed using Duncan\u0026rsquo;s test in Statistical Product and Service Solutions, version 26.0 (IBM, New York, United States), and the data are presented as the means\u0026thinsp;\u0026plusmn;\u0026thinsp;SEs. The weight coefficients were determined using the structural equation model on the SPSSPro website, and then the structural equation model was drawn using Microsoft PowerPoint 2022. The spectral transmission (ST), luminousness (L), handle length ratio (HLR) and plot yield were determined using the following formulas:\u003c/p\u003e \u003cp\u003eST (%)\u0026thinsp;=\u0026thinsp;Wi/W0 \u0026times; 100%\u003c/p\u003e \u003cp\u003eL (%)\u0026thinsp;=\u0026thinsp;Ri/R0 \u0026times; 100%\u003c/p\u003e \u003cp\u003eCx (mg\u0026middot;g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u0026thinsp;=\u0026thinsp;Ci \u0026times; Ev \u0026times;Dr \u0026times; W\u003c/p\u003e \u003cp\u003ePlot yield (kg\u0026middot;ha\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u0026thinsp;=\u0026thinsp;N \u0026times; W \u0026times; F \u0026times; 125\u003c/p\u003e \u003cp\u003ewhere Wi and W0 are the light intensities of different wavelengths inside and outside the greenhouse, respectively; Ri and R0 are the light intensities parallel to the film inside and outside the greenhouse, respectively; Ci are the contents of chlorophyll a, chlorophyll b and carotenoids; Ev is the extraction volume; Dr denotes the dilution ratio; W is the sample fresh weight; N denotes the number of strawberry plants; W is the single-fruit weight; and F is the number of fruits per strawberry plant.\u003c/p\u003e \u003cp\u003eThe data were analysed using the fuzzy membership function. The positive correlation index was calculated using the Formula X(u)=(X-X\u003csub\u003emin\u003c/sub\u003e)/(X\u003csub\u003emax\u003c/sub\u003e-X\u003csub\u003emin\u003c/sub\u003e), and the negative correlation index was calculated using the Formula X(u)\u0026thinsp;=\u0026thinsp;1-(X-X\u003csub\u003emin\u003c/sub\u003e)/(X\u003csub\u003emax\u003c/sub\u003e-X\u003csub\u003emin\u003c/sub\u003e). The average membership function values of the growth, leaf and fruit quality of all the plants were calculated to obtain their average membership function values.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Effects of RPO films on the environment in greenhouses\u003c/h2\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e3.1.1 Effects of RPO films on air temperature and humidity in a greenhouse\u003c/h2\u003e \u003cp\u003eFrom November to March of the following year, the average temperatures of the CK, RPO1 and RPO2 treatments all tended to first decrease but then increase (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Compared with those of the control, the minimum temperature, accumulated temperature, and number of hours with temperatures\u0026thinsp;\u0026ge;\u0026thinsp;10\u0026deg;C and \u0026ge;\u0026thinsp;20\u0026deg;C treated with RPO1 increased by 25.00\u0026ndash;33.87%, 7.02\u0026ndash;36.08%, 2.95\u0026ndash;13.52% and 7.14\u0026ndash;17.48%, respectively, and there was no difference in the maximum temperature; the maximum temperature, minimum temperature, accumulated temperature, and number of hours with temperatures\u0026thinsp;\u0026ge;\u0026thinsp;10\u0026deg;C and \u0026ge;\u0026thinsp;20\u0026deg;C of RPO2 increased by 26.92%, 12.96\u0026ndash;43.33%, 7.64\u0026ndash;37.05%, 13.17\u0026ndash;24.91% and 14.94\u0026ndash;21.35%, respectively. The average temperatures of RPO1 and RPO2 were not different from that of the control.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of rare earth light conversion films on the variations in the maximum and minimum temperatures, the average air temperature and accumulated temperature and the hours when the temperature was above 10\u0026deg;C and 20\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eInner environment\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNovember\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDecember\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eJanuary\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFebruary\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eMarth\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eMaximum Temperature\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e35\u0026thinsp;\u0026plusmn;\u0026thinsp;1.8a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e36\u0026thinsp;\u0026plusmn;\u0026thinsp;2.3a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e26\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e25\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e40\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eRPO1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e40\u0026thinsp;\u0026plusmn;\u0026thinsp;3.5a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e41\u0026thinsp;\u0026plusmn;\u0026thinsp;2.7a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e31\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e30\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e44\u0026thinsp;\u0026plusmn;\u0026thinsp;2.7a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eRPO2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e43\u0026thinsp;\u0026plusmn;\u0026thinsp;2.3a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e42\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e33\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e34\u0026thinsp;\u0026plusmn;\u0026thinsp;2.7a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e46\u0026thinsp;\u0026plusmn;\u0026thinsp;1.8a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eMinimum temperature\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.0\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.0\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e5.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e6.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eRPO1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e5.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e8.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eRPO2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e6.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e8.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eAverage temperature\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15\u0026thinsp;\u0026plusmn;\u0026thinsp;1.7a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e14\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e13\u0026thinsp;\u0026plusmn;\u0026thinsp;1.8a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e17\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eRPO1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e18\u0026thinsp;\u0026plusmn;\u0026thinsp;1.7a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e16\u0026thinsp;\u0026plusmn;\u0026thinsp;2.1a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e15\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e17\u0026thinsp;\u0026plusmn;\u0026thinsp;2.1a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eRPO2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e18\u0026thinsp;\u0026plusmn;\u0026thinsp;1.9a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e17\u0026thinsp;\u0026plusmn;\u0026thinsp;1.7a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e17\u0026thinsp;\u0026plusmn;\u0026thinsp;2.3a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e15\u0026thinsp;\u0026plusmn;\u0026thinsp;2.1a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e18\u0026thinsp;\u0026plusmn;\u0026thinsp;2.1a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eAccumulated temperature\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e291\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e357\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e299\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e299\u0026thinsp;\u0026plusmn;\u0026thinsp;1.8c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e386\u0026thinsp;\u0026plusmn;\u0026thinsp;1.0c\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eRPO1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e396\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e402\u0026thinsp;\u0026plusmn;\u0026thinsp;1.8b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e323\u0026thinsp;\u0026plusmn;\u0026thinsp;1.7b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e320\u0026thinsp;\u0026plusmn;\u0026thinsp;2.1b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e402\u0026thinsp;\u0026plusmn;\u0026thinsp;1.9b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eRPO2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e412\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e420\u0026thinsp;\u0026plusmn;\u0026thinsp;2.3a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e387\u0026thinsp;\u0026plusmn;\u0026thinsp;1.7a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e400\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e529\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eHours (\u0026ge;\u0026thinsp;10\u0026deg;C)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e281\u0026thinsp;\u0026plusmn;\u0026thinsp;1.7b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e281\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e281\u0026thinsp;\u0026plusmn;\u0026thinsp;1.7c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e382\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e508\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2c\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eRPO1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e286\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e293\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5 b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e319\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e406\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e523\u0026thinsp;\u0026plusmn;\u0026thinsp;2.3b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eRPO2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e324\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e318\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e351\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e468\u0026thinsp;\u0026plusmn;\u0026thinsp;1.7a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e627\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eHours (\u0026ge;\u0026thinsp;20\u0026deg;C)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e103\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e102\u0026thinsp;\u0026plusmn;\u0026thinsp;2.1b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e98\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e87\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e214\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5c\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eRPO1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e121\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e116\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e105\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e100\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e243\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eRPO2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e125\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e118\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e115\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e100\u0026thinsp;\u0026plusmn;\u0026thinsp;0.6a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e257\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"8\"\u003eNote: Lowercase letters represent significant differences among the three treatments in the horizontal direction (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Same as below.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003e3.1.2 Effects of RPO film on light intensity\u003c/h2\u003e \u003cp\u003eFrom November to March of the following year, the average light intensity, maximum light intensity and minimum light intensity of the CK, RPO1 and RPO2 treatments all tended to first decrease but then increase (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Compared with that in the CK treatment, the average light intensity increase in RPO2 was greatest, increasing by 26.82\u0026ndash;44.77%, the maximum light intensity increased by 13.02\u0026ndash;35.97%, the average light intensity in RPO1 increased by 23.41\u0026ndash;40.43%, and the maximum light intensity increased by 7.93\u0026ndash;33.34%.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of rare earth light conversion films on the average, maximum and minimum light intensities.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTraits\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMonth\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c5\" namest=\"c3\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRPO1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eRPO2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"5\" rowspan=\"6\"\u003e \u003cp\u003eAverage light intensity\u003c/p\u003e \u003cp\u003e(\u0026micro;mol\u0026middot;m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e\u0026middot;s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNovember\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e344\u0026thinsp;\u0026plusmn;\u0026thinsp;5.0b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e465\u0026thinsp;\u0026plusmn;\u0026thinsp;4.4a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e477\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDecember\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e277\u0026thinsp;\u0026plusmn;\u0026thinsp;4.3b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e389\u0026thinsp;\u0026plusmn;\u0026thinsp;7.6a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e401\u0026thinsp;\u0026plusmn;\u0026thinsp;3.6a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eJanuary\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e229\u0026thinsp;\u0026plusmn;\u0026thinsp;3.3c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e309\u0026thinsp;\u0026plusmn;\u0026thinsp;2.5b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e322\u0026thinsp;\u0026plusmn;\u0026thinsp;3.2a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFebruary\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e205\u0026thinsp;\u0026plusmn;\u0026thinsp;4.7b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e253\u0026thinsp;\u0026plusmn;\u0026thinsp;3.5a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e260\u0026thinsp;\u0026plusmn;\u0026thinsp;4.2a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMarch\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e210\u0026thinsp;\u0026plusmn;\u0026thinsp;2.1c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e280\u0026thinsp;\u0026plusmn;\u0026thinsp;3.2b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e298\u0026thinsp;\u0026plusmn;\u0026thinsp;2.3a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1265\u0026thinsp;\u0026plusmn;\u0026thinsp;8.5c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1696\u0026thinsp;\u0026plusmn;\u0026thinsp;13b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1758\u0026thinsp;\u0026plusmn;\u0026thinsp;13a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"5\" rowspan=\"6\"\u003e \u003cp\u003eMaximum light intensity\u003c/p\u003e \u003cp\u003e(\u0026micro;mol\u0026middot;m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e\u0026middot;s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNovember\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e983\u0026thinsp;\u0026plusmn;\u0026thinsp;2.1c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1061\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1111\u0026thinsp;\u0026plusmn;\u0026thinsp;2.9a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDecember\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e871\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1047\u0026thinsp;\u0026plusmn;\u0026thinsp;2.7b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1078\u0026thinsp;\u0026plusmn;\u0026thinsp;1.8a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eJanuary\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e758\u0026thinsp;\u0026plusmn;\u0026thinsp;2.3b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1011\u0026thinsp;\u0026plusmn;\u0026thinsp;2.3a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1015\u0026thinsp;\u0026plusmn;\u0026thinsp;1.9a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFebruary\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e670\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e889\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e911\u0026thinsp;\u0026plusmn;\u0026thinsp;2.3a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMarch\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e695\u0026thinsp;\u0026plusmn;\u0026thinsp;3.5c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e842\u0026thinsp;\u0026plusmn;\u0026thinsp;3.5b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e868\u0026thinsp;\u0026plusmn;\u0026thinsp;3.8a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3977\u0026thinsp;\u0026plusmn;\u0026thinsp;11c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4850\u0026thinsp;\u0026plusmn;\u0026thinsp;11b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4983\u0026thinsp;\u0026plusmn;\u0026thinsp;12a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"5\" rowspan=\"6\"\u003e \u003cp\u003eMinimum light intensity\u003c/p\u003e \u003cp\u003e(\u0026micro;mol\u0026middot;m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e\u0026middot;s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNovember\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28\u0026thinsp;\u0026plusmn;\u0026thinsp;1.9a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e32\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e36\u0026thinsp;\u0026plusmn;\u0026thinsp;2.9a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDecember\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e23\u0026thinsp;\u0026plusmn;\u0026thinsp;2.8a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e31\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e31\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eJanuary\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e20\u0026thinsp;\u0026plusmn;\u0026thinsp;2.9a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e22\u0026thinsp;\u0026plusmn;\u0026thinsp;3.1a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFebruary\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16\u0026thinsp;\u0026plusmn;\u0026thinsp;2.0a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e18\u0026thinsp;\u0026plusmn;\u0026thinsp;3.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e19\u0026thinsp;\u0026plusmn;\u0026thinsp;3.3a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMarch\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e29\u0026thinsp;\u0026plusmn;\u0026thinsp;2.8a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e32\u0026thinsp;\u0026plusmn;\u0026thinsp;2.7a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e112\u0026thinsp;\u0026plusmn;\u0026thinsp;9.6a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e131\u0026thinsp;\u0026plusmn;\u0026thinsp;13a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e140\u0026thinsp;\u0026plusmn;\u0026thinsp;10.4a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e \u003ch2\u003e3.1.3 Effects of the RPO film on different spectral proportions and transmittances\u003c/h2\u003e \u003cp\u003eRare earth semitransparent films can reduce the proportions of ultraviolet, purple and green light; increase the proportions of far-red, red‒orange and blue light; and increase the light transmittance of greenhouse films (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). On sunny days, compared with those in the CK treatment, ultraviolet light, violet light and green light in the RPO2 treatment decreased by 7.65%, 6.11% and 8.12%, whereas blue light, red‒orange light and far-red light increased by 6.35%, 11.59% and 22.10%, respectively; in the RPO1 treatment, ultraviolet light, violet light and green light decreased by 3.89%, 5.67% and 8.98%, respectively, whereas blue light, red‒orange light and far-red light increased by 7.00%, 9.75% and 19.98%, respectively. Compared with that of the control, the light transmittances of the lattice films treated with RPO1 and RPO2 significantly increased by 8.27% and 9.84%, respectively.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSpectral ratios and transmittances of different treatments on clear days and cloudy days\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWeather\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eUltraviolet\u003c/p\u003e \u003cp\u003e300\u0026ndash;399\u003c/p\u003e \u003cp\u003enm\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePurple\u003c/p\u003e \u003cp\u003e400\u0026ndash;439\u003c/p\u003e \u003cp\u003enm\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBlue\u003c/p\u003e \u003cp\u003e440\u0026ndash;509\u003c/p\u003e \u003cp\u003enm\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGreen\u003c/p\u003e \u003cp\u003e510\u0026ndash;609\u003c/p\u003e \u003cp\u003enm\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eRed orange\u003c/p\u003e \u003cp\u003e610\u0026ndash;709 nm\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eFar-red\u003c/p\u003e \u003cp\u003e710\u0026ndash;760 nm\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eTransmittance\u003c/p\u003e \u003cp\u003e(%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eClear\u003c/p\u003e \u003cp\u003edays\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e19.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e22.16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e21.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e11.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e84.67\u0026thinsp;\u0026plusmn;\u0026thinsp;1.20b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRPO1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e16.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e20.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e23.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e13.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e91.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.88a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRPO2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e16.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e20.36\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e24.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.32a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e13.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e93.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eCloudy days\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20.15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.51\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e16.19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e23.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e20.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e10.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e82.33\u0026thinsp;\u0026plusmn;\u0026thinsp;2.39b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRPO1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.73\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e17.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e19.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e23.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e12.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e90.31\u0026thinsp;\u0026plusmn;\u0026thinsp;3.46a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRPO2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e17.79\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e18.36\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e24.46\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e12.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e92.66\u0026thinsp;\u0026plusmn;\u0026thinsp;2.47a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eOn cloudy days, compared with those in the CK treatment, ultraviolet light, violet light and green light in the RPO2 treatment decreased by 19.15%, 16.45% and 20.45%, respectively, whereas blue light, red‒orange light and far-red light increased by 9.88%, 18.65% and 24.73%, respectively; in the RPO1 treatment, ultraviolet light, violet light and green light decreased by 7.59%, 9.17% and 17.37%, respectively, whereas blue light, red‒orange light and far-red light increased by 6.73%, 15.95% and 18.92%, respectively. Compared with that of the control, the light transmittances of the lattice films treated with RPO1 and RPO2 increased by 9.69% and 12.55%, respectively.\u003c/p\u003e \u003cp\u003e \u003cb\u003e3.2 Effects of RPO film on the growth and development of strawberry plants in a solar greenhouse\u003c/b\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e \u003ch2\u003e3.2.1 Effects of RPO film on strawberry plant growth in a solar greenhouse\u003c/h2\u003e \u003cp\u003eCompared with the control, RPO1 and RPO2 increased the total leaf area of strawberry plants by 29.98% and 31.51%, respectively, and decreased the petiole length by 35.05% and 69.79%, respectively. The number of flowers in RPO1 increased slightly but not significantly compared with that in the control, whereas the number of flowers in RPO2 increased by 14.06% compared with that in the control (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of rare earth light conversion films on the growth traits of strawberry plants in a solar greenhouse.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePetiole length (cm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNumber of blooms\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTotal leaf area (cm\u003csup\u003e2\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e16.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e87.67\u0026thinsp;\u0026plusmn;\u0026thinsp;3.76b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e79.41\u0026thinsp;\u0026plusmn;\u0026thinsp;4.67b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRPO1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e94.33\u0026thinsp;\u0026plusmn;\u0026thinsp;1.20ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e103.22\u0026thinsp;\u0026plusmn;\u0026thinsp;1.67a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRPO2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100.00\u0026thinsp;\u0026plusmn;\u0026thinsp;1.53a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e104.43\u0026thinsp;\u0026plusmn;\u0026thinsp;1.08a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003eNote: Lowercase letters represent significant differences among the three treatments in the horizontal direction (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Same as below.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.2.2 Effects of RPO film on the anatomical structure of strawberry leaves and petioles in solar greenhouses\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIn the same field of view, the spongy tissues of strawberry leaves treated with RPO1 and RPO2 were sparser than that of strawberry leaves treated with CK (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). At the same magnification, the vascular bundles of strawberry petioles treated with RPO1 and RPO2 were both larger than those in the CK group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Compared with those under the CK treatment, the cross-sectional lengths of the main vascular bundles of strawberry petioles under the RPO1 and RPO2 treatments increased by 10.85% and 29.56%, respectively, and the cross-sectional widths decreased by 9.11% and 9.60%, respectively.\u003c/p\u003e \u003cp\u003e \u003cb\u003e3.2.3 Effects of RPO film on the photosynthetic parameters, fluorescence parameters and chlorophyll content of strawberry leaves in solar greenhouses\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe photosynthetic rate, transpiration rate, stomatal conductance and intercellular CO\u003csub\u003e2\u003c/sub\u003e concentration of strawberry leaves treated with RPO1 and RPO2 were significantly different from those of the control group (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Compared with those under the CK treatment, the photosynthetic rate, transpiration rate and stomatal conductance of the leaves under the RPO2 treatment increased by 54.44%, 20.27% and 157.67%, respectively; the photosynthetic rate and stomatal conductance of the leaves under the RPO1 treatment increased by 15.66% and 49.55%, respectively. Compared with those under RPO1, the photosynthetic rate, transpiration rate and stomatal conductance of the leaves under RPO2 increased by 31.64%, 11.48% and 72.30%, respectively. The changing trend of the intercellular CO\u003csub\u003e2\u003c/sub\u003e concentration was opposite to those of the above four photosynthetic parameters. Compared with those of the control, the intercellular CO\u003csub\u003e2\u003c/sub\u003e concentrations of RPO1 and RPO2 decreased by 32.76% and 37.20%, respectively. Notably, the intercellular CO\u003csub\u003e2\u003c/sub\u003e concentration of RPO2 decreased by 3.34% compared with that of RPO1.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of rare earth light conversion films on the photosynthetic parameters, fluorescence parameters and chlorophyll contents of strawberry leaves in solar greenhouses\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTraits\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCK\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRPO1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRPO2\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhotosynthetic rate (\u0026micro;mol\u0026middot;m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e\u0026middot;s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e19.80\u0026thinsp;\u0026plusmn;\u0026thinsp;0.74c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22.90\u0026thinsp;\u0026plusmn;\u0026thinsp;1.32b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30.58\u0026thinsp;\u0026plusmn;\u0026thinsp;1.05a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTranspiration rate (mmol\u0026middot;m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e\u0026middot;s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.41\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIntercellular carbon dioxide concentration (\u0026micro;mol\u0026middot;mol\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e597.60\u0026thinsp;\u0026plusmn;\u0026thinsp;10.03a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e450.13\u0026thinsp;\u0026plusmn;\u0026thinsp;2.77b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e442.23\u0026thinsp;\u0026plusmn;\u0026thinsp;8.52b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStomatal conductance (mmol\u0026middot;m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e\u0026middot;s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e770.23\u0026thinsp;\u0026plusmn;\u0026thinsp;15.88c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1151.87\u0026thinsp;\u0026plusmn;\u0026thinsp;36.70b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1984.63\u0026thinsp;\u0026plusmn;\u0026thinsp;13.43a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFv/Fm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.80\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.82\u0026thinsp;\u0026plusmn;\u0026thinsp;0.004a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eABS/RC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.73\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRo/RC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.41\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.64\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.70\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eETo/RC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.82\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.94\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eContent of chlorophyll a (mg\u0026middot;g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.54\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eContent of chlorophyll b (mg\u0026middot;g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eContent of carotenoid (mg\u0026middot;g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe ABS/RC, TRo/RC and ETo/RC of RPO1 and RPO2 were significantly greater than those of CK; RPO1 increased by 16.18%, 16.31% and 12.20%, respectively, and RPO2 increased by 21.97%, 20.57% and 14.63%, respectively (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). The Fv/Fm of RPO2 did not significantly differ from that of CK, whereas the Fv/Fm of the RPO1 treatment was 2.5% greater than that of the control. Compared with those in CK leaves, the contents of chlorophyll a, chlorophyll b and carotenoids in strawberry leaves treated with RPO2 significantly increased by 30.51%, 26.47% and 26.09%, respectively, whereas the contents of chlorophyll a, chlorophyll b and carotenoids in RPO1 were not significantly different from those in the control group (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003e3.2.4 Effects of RPO film on the activity of the Rubisco enzyme and related genes in strawberry leaves in solar greenhouses\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe Rubisco activities in strawberry leaves treated with RPO2 and RPO1 were significantly greater than that in the control, increasing by 42.87% and 44.94%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Compared with those in the control, the expression levels of rubisco accumulation factor 1 (\u003cem\u003eRub-af1\u003c/em\u003e) in the plants treated with RPO1 and RPO2 were upregulated by 10.09% and 9.95%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). The expression levels of the large subunit of Rubisco that binds to subunit α of the protein (\u003cem\u003eRubLα\u003c/em\u003e) were upregulated by 9.23% and 8.71%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). The expression levels of the large subunit of Rubisco that binds to subunit β of the protein (\u003cem\u003eRubLβ\u003c/em\u003e) were upregulated by 10.45% and 9.46%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). The expression levels of chloroplast nucleosaccharide diphosphate carboxylase small chain (\u003cem\u003eRib-cs\u003c/em\u003e) were upregulated by 7.27% and 6.13%, respectively. Interestingly, the expression level of \u003cem\u003eRib-cs\u003c/em\u003e in RPO1 was upregulated by 1.08% compared with that in RPO2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). There was no significant difference in the expression level of ribulose diphosphate carboxylase small chain 1 (\u003cem\u003eRib-cs1\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Effects of rare earth light conversion film on the yield and quality of strawberry fruits\u003c/h2\u003e \u003cp\u003eThe transverse and longitudinal stems, single fruit weight, and yield of strawberry fruits treated with RPO1 and RPO2 were significantly greater than those of the control (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). Compared with those of the control, the longitudinal stems of the fruits treated with RPO1 and RPO2 increased by 5.44% and 6.01%, the transverse diameters of the fruits increased by 7.71% and 10.63%, the single fruit weights increased by 30.21% and 33.37%, and the yield increased by 13.25% and 23.83%, respectively.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab7\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 7\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of rare earth light conversion films on the fruit yield of strawberry plants in a solar greenhouse.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLength (cm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eWidth (cm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAverage fruit weight (g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePlot yield (kg\u0026middot;90 m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eYield (kg\u0026middot;ha\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e58.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e42.51\u0026thinsp;\u0026plusmn;\u0026thinsp;0.51b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e46.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.41b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e340.96\u0026thinsp;\u0026plusmn;\u0026thinsp;5.89b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e37996\u0026thinsp;\u0026plusmn;\u0026thinsp;599b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRPO1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e61.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e45.78\u0026thinsp;\u0026plusmn;\u0026thinsp;0.46b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60.46\u0026thinsp;\u0026plusmn;\u0026thinsp;0.75b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e387.26\u0026thinsp;\u0026plusmn;\u0026thinsp;6.38a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e43028\u0026thinsp;\u0026plusmn;\u0026thinsp;709a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRPO2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e62.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.77a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e47.02\u0026thinsp;\u0026plusmn;\u0026thinsp;1.93a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e61.93\u0026thinsp;\u0026plusmn;\u0026thinsp;1.00a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e423.46\u0026thinsp;\u0026plusmn;\u0026thinsp;16.80a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e47051\u0026thinsp;\u0026plusmn;\u0026thinsp;1867a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eCompared with those in the control treatment, the soluble solids in the RPO1 and RPO2 treatments increased by 32.58% and 33.48%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA); the soluble sugar content increased by 24.04% and 33.48%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB); the Vc content increased by 8.32% and 13.56%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE); the flavonoid content increased by 27.94% and 54.87%; the flavonoid content in the RPO2 treatment increased by 62.73%, respectively, compared with that in RPO1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF); and the soluble protein content decreased by 24.51% and 22.09%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). The organic acid content of RPO2 was 6.28% lower than that of CK, whereas the organic acid content of RPO1 was not different from that of the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). There was no significant difference in the total phenol content among RPO1, RPO2 and the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Pearson correlation analysis\u003c/h2\u003e \u003cp\u003eIn addition to Fv/Fm and Cb, the photosynthetic indicators of strawberry leaves are closely related to the average light intensity and accumulated temperature. Interestingly, the photosynthetic rate and intercellular CO\u003csub\u003e2\u003c/sub\u003e concentration were negatively correlated with the average light intensity and accumulated temperature (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The yield of strawberry plants was significantly positively correlated with the average light intensity, accumulated temperature, and number of hours at temperatures\u0026thinsp;\u0026ge;\u0026thinsp;10\u0026deg;C and \u0026ge;\u0026thinsp;20\u0026deg;C (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). The contents of soluble solids and soluble sugars were extremely significantly positively correlated with the average light intensity. The content of soluble protein was extremely significantly negatively correlated with the average light intensity and the number of hours with temperatures\u0026thinsp;\u0026ge;\u0026thinsp;20\u0026deg;C. The contents of Vc and flavonoids were significantly positively correlated with the accumulated temperature and the number of hours with temperatures\u0026thinsp;\u0026ge;\u0026thinsp;10\u0026deg;C and \u0026ge;\u0026thinsp;20\u0026deg;C. Photosynthesis indicators are closely related to yield (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). Interestingly, the total leaf area, photosynthetic rate and yield were extremely significantly positively correlated.\u003c/p\u003e \u003cp\u003eNotably, in the greenhouse environment, which affects the quality and yield of strawberry fruits (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e) and plant photosynthesis (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e), the average light intensity, accumulated temperature, and number of hours with temperatures\u0026thinsp;\u0026ge;\u0026thinsp;20\u0026deg;C had the strongest correlations with the above indicators, whereas the correlation with the average temperature was relatively weak.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Fuzzy mathematics membership function analysis and structural equation model analysis\u003c/h2\u003e \u003cp\u003e To conduct a comprehensive evaluation of the growth and development of strawberry plants, the membership functions of plant growth, fruit quality and fruit yield in each treatment were obtained according to the fuzzy mathematics membership function method. The mean values of the membership functions of the total components were then obtained and ranked. A comprehensive analysis of the membership functions of strawberry growth and development revealed that the ranking was RPO2\u0026thinsp;\u0026gt;\u0026thinsp;RPO1\u0026thinsp;\u0026gt;\u0026thinsp;CK (Table\u0026nbsp;\u003cspan refid=\"Tab8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). The effects of temperature and light intensity on photosynthesis, fruit quality and fruit yield were further clarified through SEM analysis. Light intensity directly affected photosynthetic indicators and fruit quality and thereby influences fruit yield (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab8\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 8\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAnalysis of the fuzzy mathematical membership functions for component content.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c5\" namest=\"c2\"\u003e \u003cp\u003eMean of membership function\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eRanking\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePlant growth\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFruit quality\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFruit yield\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTotal components\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRPO1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRPO2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003eNote: Plant growth indicators include petiole length, number of flowers, total leaf area, photosynthetic rate, transpiration rate, intercellular carbon dioxide concentration, stomatal conductance, Fv/Fm, ABS/RC, TRo/RC, ETo/RC, chlorophyll a content, chlorophyll b content, and carotenoid content. Fruit quality indicators include the transverse and longitudinal diameters of the fruit, soluble solid, soluble sugar content, soluble protein content, organic acid content, vitamin C content, flavonoid content and total phenol content.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e4.1 RPO film improves the internal environmental conditions of greenhouses\u003c/h2\u003e \u003cp\u003eTemperature and light are indispensable environmental conditions for plant growth. Light conversion films can be used to increase the air temperature, CO\u003csub\u003e2\u003c/sub\u003e concentration, photosynthetically active radiation (PAR) and soil temperature [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The temperature, light intensity and spectral ratio of light-transmitting films can be adjusted to change the growth of plants. Li et al. (2024) [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] reported that the accumulated temperature, maximum temperature, minimum temperature and average temperature of treatments with rare earth photoconversion membranes were higher than those of treatments with traditional membranes. Compared with those of the control, the accumulated temperature and minimum temperature of RPO1 and the accumulated temperature, maximum temperature and minimum temperature of RPO2 all increased. The average temperature of RPO1 and the maximum temperature and average temperature of RPO2 were not different from those of the control (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The increase in the accumulated temperature of RPO1 and the accumulated temperature minimum temperature and the maximum temperature of RPO2 were greater than those reported in the study of Li et al. (2024) [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. The increases in the minimum temperature, maximum temperature and average temperature of RPO1 and the average temperature of RPO2 were lower than those reported in the study of Li et al. (2024) [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. This may be related to the different temperature measurement years and greenhouse structures. In addition, the temperature variation during RPO2 treatment may also be related to the differences in rare earth light conversion films. Rare earth light-transmitting films also have a certain improvement in light intensity (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), which is consistent with a previous study [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The rare earth light conversion film reduced the transmittance ratios of ultraviolet light, violet light and green light and increased the transmittance ratios of blue light, red light and far-red light (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). These differences might be related to the added light conversion agent and the dosage of the light conversion agent.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e4.2 Influence of RPO films on photosynthesis\u003c/h2\u003e \u003cp\u003ePhotosynthesis produces the materials and energy needed for the growth and development of plants. When crops are exposed to specific light conditions for a long period of time, the anatomical structure of the plant body and the characteristics of chloroplasts change, which indirectly affects photosynthesis [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The content of photosynthetic pigments can reflect the physiological photosynthetic capacity of plants and is an indicator of photosynthetic intensity. The combination of red light and blue light can increase the absorption of photosynthetic pigments [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The concentrations of photosynthetic pigments and chlorophyll biosynthesis precursors in nonspike Chinese cabbage were relatively high under red and blue light treatments [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Red and blue light are conducive to pigment accumulation. The contents of chlorophyll a, chlorophyll b and carotenoids in the RPO group were greater than those in the control group (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e), which was consistent with the findings of previous studies. The supply and utilization of CO\u003csub\u003e2\u003c/sub\u003e, the supply and utilization of light, and the transport capacity of carbohydrates are the key factors of photosynthesis [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. High concentrations of CO\u003csub\u003e2\u003c/sub\u003e can inhibit photosynthesis [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The vascular bundles transport soluble mineral nutrients and water as well as photocompounds. In this study, the intercellular CO\u003csub\u003e2\u003c/sub\u003e concentration under RPO treatment decreased, the photosynthetic rate increased, and the vascular bundle slightly changed (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). This might be related to the RPO film changing the spectral ratio and increasing the light transmittance (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eRubisco is a key enzyme in photosynthetic carbon assimilation during the dark reaction process of photosynthesis [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. It can catalyse carbon reduction in photosynthesis and carbon oxidation in photorespiration, promote the utilization of light energy, accelerate the Calvin cycle, and ultimately increase photosynthetic efficiency [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. These findings indicate that the performance of photosynthesis largely depends on the Rubisco kinetics at low temperatures and the Rubisco activation state at high temperatures [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Many plants, including rice and Arabidopsis, contain two closely related subunit types of Rubisco-activating enzyme-encoding genes [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. This study revealed that all four genes that activate the Rubisco enzyme were upregulated to varying degrees (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), which might be related to the increase in greenhouse temperature caused by RPO (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e4.3 Influence of RPO on fruit quality and yield\u003c/h2\u003e \u003cp\u003eThe light quality of plants affects their photosynthetic capacity, which determines crop yield [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Studies have shown that blue‒violet light promotes the growth of crop stems and leaves and red‒orange light promotes the growth and reproduction of crop fruits, whereas yellow‒green light and near‒violet light have no effect on crop growth. Rare earth light conversion films can convert yellow‒green light and near-ultraviolet light into red‒orange light and blue‒violet light through the combination and interaction of rare earth ions, promoting the growth and development of crops [\u003cspan additionalcitationids=\"CR40 CR41\" citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe accumulation of soluble sugars, as primary metabolites of plants, is affected by photosynthesis [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. In this study, the photosynthetic rate of the RPO treatment was greater than that of the control (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e), which might be the reason for the increases in soluble sugars and soluble solids (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Light stimulates the D-man/L-gal biosynthesis pathway in plants, causing the amount of Vc in plant tissues to increase with increasing irradiance [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Flavonoids are important secondary metabolites in plants that are regulated by the environment. A light mass with a relatively high ratio of FR to NIR increased the activity of flavonoid methyltransferase but inhibited the activity of flavonoid glycosyltransferase. A high proportion of UV-A and a high R/FR ratio can increase the activity of flavonoid glycosyltransferases [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. This might explain why the Vc (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE) and flavonoid (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF) contents after RPO treatment were greater than those of the control. RPO treatment increased the yield of cucumbers by 30% and the yield of sweet peppers by 20.34% [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Compared with ordinary film, light-transferring film can promote strawberry maturation 10 d earlier and increase the yield by 3180 kg\u0026middot;hm\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Compared with blank film cultivation, light conversion film cultivation increased the aboveground biomasses of different varieties of three vegetables, namely, mustard, Chinese cabbage and Chinese heart, by 20.53\u0026ndash;23.40%, 20.13\u0026ndash;32.62% and 16.43\u0026ndash;20.30%, respectively [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Similarly, the yield of strawberry fruits increased in this experiment (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e), which might be related to RPO altering the greenhouse environment and enhancing photosynthesis.\u003c/p\u003e \u003c/div\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eThe results of this study revealed that the use of a rare earth semitransparent film increased the spectral ratios of red‒orange light, blue light and far-red light in the greenhouse; reduced the spectral ratios of ultraviolet light, ultraviolet light and green light; and improved the average light intensity, light transmittance and accumulated temperature of the greenhouse. Upregulating the gene expression levels of Rubisco and its different morphological subunits enhanced the activity of the Rubisco enzyme in leaves, increased the leaf area, altered the structure of strawberry petioles, and improved the photosynthetic efficiency and material transport efficiency of strawberry plants, thereby promoting their growth and development and increasing yield. Moreover, the rare earth light conversion film treated with RPO2 was more suitable for the growth of strawberries. Rare earth light conversion films can be used as a strategy to improve photosynthetic traits and increase crop yields.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eABS/RC, Real absorption flux per reaction centre;\u003c/p\u003e\n\u003cp\u003eATP, Adenosine triphosphate;\u003c/p\u003e\n\u003cp\u003ecDNA, Complementary DNA;\u003c/p\u003e\n\u003cp\u003eCK, Polyolefin film;\u003c/p\u003e\n\u003cp\u003eETo/RC, Real election transport flux per reaction centre;\u003c/p\u003e\n\u003cp\u003eFv/Fm, Optimal/maximal photochemical efficiency of PSⅡ in the dark;\u003c/p\u003e\n\u003cp\u003emRNA,\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Messenger RNA;\u003c/p\u003e\n\u003cp\u003eNADPH, Nicotinamide Adenine Dinucleotide Phosphate Hydrogen;\u003c/p\u003e\n\u003cp\u003eqRT‒PCR, Real-time quantitative PCR;\u003c/p\u003e\n\u003cp\u003eRNA, Ribonucleic acid;\u003c/p\u003e\n\u003cp\u003eRPO, Rare earth conversion film;\u003c/p\u003e\n\u003cp\u003eTRo/RC, Real trapped energy flux per reaction centre.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to acknowledge the reviewers and editors for their time and constructive feedback, which will undoubtedly enhance the quality of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLiyuan Zhao: Writing - original draft, Formal analysis, Data curation. Ru Li: Writing - original draft, Investigation. Data curation. Mengyao Shi: Data curation, Visualization. Bing-Bing Cai: Methodology, Conceptualization. Guihong Zhou: Writing - review \u0026amp; editing, Supervision. Xin-Xin Wang: Writing - review \u0026amp; editing. Qingyun Li: Writing - review, Funding, Project administration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the earmarked fund for CARS-Specialty Vegetable (grant number CARS-24-G-03).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data presented in this study are available in the article or supplementary information; find some help on our Data availability statements page.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, All the strawberry materials required for the experiment were approved by Zengxian Agricultural Corporation of Baoding. The collection materials of the plants complies the relevant institutional, national, and international guidelines and legislation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eDong H, Li F, Xuan X, Ahiakpa JK, Tao J, Zhang X, Ge P, Wang Y, Gai W, Zhang Y. The genetic basis and improvement of photosynthesis in tomato. Hortic Plant J. 2025;11(1):69\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePfannschmidt T, Nilsson A, Tullberg A, Link G, Allen JF. Direct transcriptional control of the chloroplast genes \u003cem\u003epsbA\u003c/em\u003e and \u003cem\u003epsaAB\u003c/em\u003e adjusts photosynthesis to light energy distribution in plants. IUBMB Life. 1999;48(3):271\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerry JO, Yerramsetty P, Zielinski AM, Mure CM. Photosynthetic gene expression in higher plants. Photosynth Res. 2013;117(1\u0026ndash;3):91\u0026ndash;120.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBar-On YM, Milo R. The global mass and average rate of rubisco. Proc Natl Acad Sci USA. 2019;116(10):4738\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia L, Jiang Y, Kong W, Sun H, Li W, Chen Y, Zhou C. Molecular basis for the assembly of Rubisco assisted by the chaperone Raf1. Nat Plants. 2020;6(6):708.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEshenour K, Hotto A, Michel EJS, Oh ZG, Stern DB. Transgenic expression of Rubisco accumulation factor2 and Rubisco subunits increases photosynthesis and growth in maize. J Exp Bot. 2024;75(13):4024\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Mao Z, Wang D, Zhao J. Synchronous red and blue emitting Ca\u003csub\u003e3\u003c/sub\u003e(PO\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003e:Eu\u003csup\u003e2+\u003c/sup\u003e, Mn\u003csup\u003e2+\u003c/sup\u003e phosphors applicable for plant-lighting. Mater Res Bull. 2015;67:1\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOlle M, Virsile A. The effects of light-emitting diode lighting on greenhouse plant growth and quality. Agricultural Food Sci. 2013;22(2):223\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao Y, Li G, Cai B, Zhang Z, Li N, Liu Y, Li Q. Effects of rare-earth light conversion film on the growth and fruit quality of sweet pepper in a solar greenhouse. Front Plant Sci. 2022;13:989271.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSimakin AV, Ivanyuk VV, Dorokhov AS, Gudkov SV. Photoconversion fluoropolymer films for the cultivation of agricultural plants under conditions of insufficient insolation. Appl Sciences-Basel. 2020;10(22):8025.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou R, Lu X, Yang Q, Wu P. Nanocrystals for large Stokes shift-based optosensing. Chin Chem Lett. 2019;30(10):1843\u0026ndash;8. (in Chinese with English).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Zhangzhong L, Zhang X, Wei X, Zhang S, Wang L, Zheng W. Effects of light conversion film on the growth of leafy vegetables in facilities under haze weather. Agronomy-Basel 2022; 12(10).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang JH, Kim D, Yoon HI, Son JE. Growth, morphology, and photosynthetic activity of Chinese cabbage and lettuce grown under polyethylene and spectrum conversion films. Hortic Environ Biotechnol. 2023;64(4):593\u0026ndash;603.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang H, Liu X, Chen Z, Tang J, Li J. Combined effect of covering translucent film in greenhouse tea gardens during winter and spring low temperature period. Guangdong Agricultural Sci. 2014;41(10):18\u0026ndash;22. (in Chinese with English).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXing W, Peng G, Xie X, Yang Y, Cheng F. Study on the effect of translucent film on volatile flavor and metabolomics of bebe pumpkin. J Food Saf Qual Test. 2023;14(10):31\u0026ndash;9. (in Chinese with English).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang J, Qiao X, Li B, Liu B, Zhang J, Yan Z, Hao P, Wang X, Liu Y, Shen L, Wang Z. The research progress of rare earth agricultural light conversion film. Heliyon. 2024;10(17):e36967.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Liu Q, Wei H, Dai J, He W. Effects of light conversion film on growth and quality of strawberry. China Vegetables. 2019(9):62\u0026ndash;8. (in Chinese with English).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaskhin MO, Yanykin DV, Popov AV, Pobedonostsev RV, Kazantseva DV, Dorokhov AS, Izmailov AY, Vyatchinov AA, Orlovskaya EO, Shaidulin AT, Orlovskii YV, Vodeneev VA, Gudkov SV. Two types of europium-based photoconversion covers for greenhouse farming with different effects on plants. Horticulturae. 2023;9(7):846.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao Y, Liu Y, Li G, Li N, Li Q. Effect of new rare earth light-transmitting film on the growth of early spring cucumbers in plastic greenhouses. Mod Agricultural Sci Technol. 2023(10):38\u0026ndash;42. (in Chinese with English).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao Y, Li G, Ma W, Zhang Z, Wang X, Mu Y, Li Q. Effects of new rare earth light conversion film on growth,development and yield of cucumber in solar greenhouse. J Hebei Agricultural Univ. 2022;45(3):56\u0026ndash;62. (in Chinese with English).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, Qin N, Huang J, Guo A, Kang X, Li S, Xing G. Dynamic changes of pectin epitopes and daylily tepals during flower opening and senescence of \u003cem\u003eHemerocallis citrina\u003c/em\u003e. Sci Hort. 2021;288:110367.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGasparov VS, Degtiar VG. Protein determination by binding with the dye Coomassie brilliant blue G-250. Biokhimiia. 1994;59(6):763\u0026ndash;77.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhmad B. Observations on the chemical method for the estimation of vitamin C. Biochem J. 1935;29(2):275\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbraham E, Hourton-Cabassa C, Erdei L, Szabados L. Methods for determination of proline in plants. Methods in Molecular Biology (Clifton, NJ). 2010; 639:317\u0026ndash;331.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeng F, Sun S, Jing Y, Wang F, Wei Q, Wang X, Zhu X. A rapid and sensitive method for determination of trace amounts of glucose by anthrone-sulfuric acid method. Bul Chem Commun. 2016;48(1):109\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTopcu H. Reference gene selection for RT-qPCR normalization of strawberry at various organs, different growing stages of fruits, and salt-stress treatment. Turkish J Agric Forestry. 2022;46(4):509\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWan H, Yuan W, Ruan M, Ye Q, Wang R, Li Z, Zhou G, Yao Z, Zhao J, Liu S, Yang Y. Identification of reference genes for reverse transcription quantitative real-time PCR normalization in pepper (\u003cem\u003eCapsicum annuum\u003c/em\u003e L). Biochem Biophys Res Commun. 2011;416(1\u0026ndash;2):24\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi R, Gao Y, Cai B, Li G, Xue Z, Wang X-X, Li Q. RPO film effectively promotes fruit quality and yield of cucumber through adjusting greenhouse environment and hormone contents. BMC Plant Biol. 2024;24(1):1250.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng L, He H, Song W. Application of light-emitting diodes and the effect of light auality on horticultural crops: a review. HortScience. 2019(10):1656\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan X, Zang J, Xu Z, Guo S, Jiao X, Liu X, Gao Y. Effects of different light quality on growth, chlorophyll concentration and chlorophyll biosynthesis precursors of non-heading Chinese cabbage (\u003cem\u003eBrassica campestris\u003c/em\u003e L). Acta Physiol Plant. 2013;35(9):2721\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharkey TD. Photosynthesis in intact leaves of C\u003csub\u003e3\u003c/sub\u003e plants: physics, physiology and rate limitations. Bot Rev. 1985;51(1):53\u0026ndash;105.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrapp A, Stitt M. An evaluation of direct and indirect mechanisms for the sink-regulation of photosynthesis in spinach - changes in gas-exchange, carbohydrates, metabolites, enzyme-activities and steady-state transcript levels after cold-girdling source leaves. Planta. 1995;195(3):313\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiziorko HM, Lorimer GH. Ribulose-1,5-bisphosphate carboxylase-oxygenase. Annu Rev Biochem. 1983;52:507\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin X, Liu F, Liao H, Du J, Peng J, Zhou K. Effect of enhanced ultraviolet-b radiation on fruit maturity and quality and leaf photosynthesis in 'Guifei' mango. HortScience. 2022;57(9):1167\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamori W, Suzuki K, Noguchi K, Nakai M, Terashima I. Effects of Rubisco kinetics and Rubisco activation state on the temperature dependence of the photosynthetic rate in spinach leaves from contrasting growth temperatures. Plant Cell Environ. 2006;29(8):1659\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan T, Li S, Fan Y, Wang Z, Raza MA, Shafiq I, Wang B, Wu X, Yong T, Wang X, Wu Y, Yang F, Yang W. Far-red light: A regulator of plant morphology and photosynthetic capacity. Crop J. 2022;10(2):300\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFukayama H, Ueguchi C, Nishikawa K, Katoh N, Ishikawa C, Masumoto C, Hatanaka T, Misoo S. Overexpression of Rubisco activase decreases the photosynthetic CO\u003csub\u003e2\u003c/sub\u003e assimilation rate by reducing Rubisco content in rice leaves. Plant Cell Physiol. 2012;53(6):976\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai J. Preparation of Cr\u003csup\u003e3+\u003c/sup\u003e activated agricultural film light-converting agent materials and their luminescent properties. Master Thesis. Guangzhou: Jinan University; 2014.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Xin G, Wei M, Shi Q, Yang F, Wang X. Carbohydrate accumulation and sucrose metabolism responses in tomato seedling leaves when subjected to different light qualities. Sci Hort. 2017;225:490\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu Z, Li L, Shao C, Cai Q. The light conversion film materials and research status. Mater Rep. 2008;22(Z2):290\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou M, Liu W, Yang C, Zhao X, Yang Z. Preparation and application of multinuclear rare earth ion doped organic complex light conversion agents. Acta Materiae Compositae Sinica. 2023;40(4):2131\u0026ndash;9. (in Chinese with English).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang R, Wang X, Wang T, Zhu Y, Wang H. The Research progress of artificial light sources and luminescent materials for promoting plant growth. Mater Rep. 2007;21(10):17\u0026ndash;9. (in Chinese with English).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNtagkas N, Woltering EJ, Marcelis LFM. Light regulates ascorbate in plants: An integrated view on physiology and biochemistry. Environ Exp Bot. 2018;147:271\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu B, Ji X, Zhao M, He F, Wang X, Wang Y, Liu P, Niu L. The influence of light quality on the accumulation of flavonoids in tobacco (\u003cem\u003eNicotiana tabacum\u003c/em\u003e L.) leaves. J Photochem Photobiology B-Biology. 2016;162:544\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu W, Zhang Z, Dong R, Xie G, Zhou J, Wu K, Zhang H, Cai Q, Lei B. Characterization and properties of a Sr\u003csub\u003e2\u003c/sub\u003eSi\u003csub\u003e5\u003c/sub\u003eN\u003csub\u003e8\u003c/sub\u003e:Eu\u003csup\u003e2+\u003c/sup\u003e-based light-conversion agricultural film. J Rare Earths. 2020;38(5):539\u0026ndash;45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Q, Zhang B, Liang P, Feng W, Li X, Liang B. Effects of light-conversion film on leaf vegetables yield. Guangdong Agricultural Sci. 2015;42(21):30\u0026ndash;4. (in Chinese with English).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-plant-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pbio","sideBox":"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pbio/default.aspx","title":"BMC Plant Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Light conversion film (europium-based), strawberry, photosynthesis, fruit yield and quality","lastPublishedDoi":"10.21203/rs.3.rs-6877648/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6877648/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eLight plays a particularly important role in the growth and development of plants, affecting almost all growth stages. Light conversion film can provide the red‒orange light and blue‒violet light necessary for plant photosynthesis, promoting the growth and development of crops and nutrient absorption. Strawberry (\u003cem\u003eFragaria\u0026times;ananassa\u003c/em\u003e Duch.) is a major economic crop worldwide, and its related industrial chain drives the economic development of various countries. Therefore, this study investigated the effects of rare earth light conversion films (RPOs) on strawberry cultivation. The temperature, light intensity, light transmittance and proportion of spectra beneficial to the crop production of RPO greenhouses were all greater than those of the control. Compared with those of the control, spongy tissues were sparser in RPO1 and RPO2 leaves. The cross-sectional lengths of the main vascular bundles of strawberry petioles in RPO1 and RPO2 increased by 10.85% and 29.56%, respectively, and the cross-sectional widths decreased by 9.11% and 9.60%, respectively. Compared with those of the control, the total leaf area, photosynthetic rate, stomatal conductance, activity of Rubisco and gene expression levels of \u003cem\u003eRub-af1\u003c/em\u003e, \u003cem\u003eRubLα\u003c/em\u003e, \u003cem\u003eRubLβ\u003c/em\u003e, and \u003cem\u003eRib-cs\u003c/em\u003e of RPO1 and RPO2 increased by 29.98%, 10.88%, 49.55%, 42.87%, 10.09%, 9.23%, 10.45%, and 7.27% and 31.51%, 23.61%, 157.67%, 44.94%, 9.95%, 8.71%, 9.46%, and 6.13%, respectively, and the intercellular CO\u003csub\u003e2\u003c/sub\u003e concentration decreased by 32.76% and 37.20%, respectively. Compared with those of the control, the single fruit weight, yield, soluble solids, soluble sugar content, Vc content, and flavonoid contents of RPO1 and RPO2 increased by 30.21%, 13.25%, 32.58%, 24.04%, 8.32%, and 27.94% and 33.37%, 23.83%, 33.48%, 33.48%, and 54.87%, respectively. In conclusion, RPO promotes photosynthesis in strawberry plants by optimizing light intensity and temperature in greenhouses; adjusting the spectrum to change the total leaf area, pigment content, spongy tissue structure, petiole vascular bundles, and Rubisco activity; and regulating the expression of the Rubisco gene, thereby increasing the quality and yield of strawberry plants. Compared with RPO1, RPO2 could be a more suitable film for strawberry production.\u003c/p\u003e","manuscriptTitle":"Rare earth transfer films enhance the photosynthetic efficiency of strawberry plants, thereby improving fruit quality and yield","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-26 18:59:53","doi":"10.21203/rs.3.rs-6877648/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-08-14T09:23:59+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-14T07:30:33+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-12T03:17:43+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-07-31T00:49:18+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"50049637591262378328264208609445569439","date":"2025-07-28T08:22:37+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"147523225870765143801249771586137212642","date":"2025-07-27T23:14:38+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"11494421928656590823824546224624374402","date":"2025-07-24T09:56:24+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"332679471237439197614292136680481220354","date":"2025-07-03T14:36:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"271300691139973192989624021952556904019","date":"2025-06-26T07:35:31+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-06-24T05:50:50+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-06-23T05:18:23+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-06-21T09:09:29+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Plant Biology","date":"2025-06-21T09:05:56+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-plant-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pbio","sideBox":"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pbio/default.aspx","title":"BMC Plant Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cdf1600e-1a2b-46d0-9a56-f81d57ea9946","owner":[],"postedDate":"June 26th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-11-10T15:59:21+00:00","versionOfRecord":{"articleIdentity":"rs-6877648","link":"https://doi.org/10.1186/s12870-025-07351-7","journal":{"identity":"bmc-plant-biology","isVorOnly":false,"title":"BMC Plant Biology"},"publishedOn":"2025-11-06 15:57:08","publishedOnDateReadable":"November 6th, 2025"},"versionCreatedAt":"2025-06-26 18:59:53","video":"","vorDoi":"10.1186/s12870-025-07351-7","vorDoiUrl":"https://doi.org/10.1186/s12870-025-07351-7","workflowStages":[]},"version":"v1","identity":"rs-6877648","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6877648","identity":"rs-6877648","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}