Attenuated CaV1.2-BK channel protein interaction in bipolar disorder

preprint OA: closed
📄 Open PDF Full text JSON View at publisher
Full text 42,319 characters · extracted from preprint-html · click to expand
Attenuated CaV1.2-BK channel protein interaction in bipolar disorder | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Attenuated CaV1.2-BK channel protein interaction in bipolar disorder Rupali Srivastava , Nathaniel Genduso , Koko Ishizuka , Akira Sawa doi: https://doi.org/10.1101/2025.08.08.669447 Rupali Srivastava 1 Department of Psychiatry, Johns Hopkins University School of Medicine Find this author on Google Scholar Find this author on PubMed Search for this author on this site Nathaniel Genduso 1 Department of Psychiatry, Johns Hopkins University School of Medicine Find this author on Google Scholar Find this author on PubMed Search for this author on this site Koko Ishizuka 1 Department of Psychiatry, Johns Hopkins University School of Medicine Find this author on Google Scholar Find this author on PubMed Search for this author on this site Akira Sawa 1 Department of Psychiatry, Johns Hopkins University School of Medicine 2 Departments of Neuroscience, Pharmacology, Genetic Medicine, Biomedical Engineering, Johns Hopkins University School of Medicine 3 Department of Mental Health, Johns Hopkins University Bloomberg School of Public Health Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: asawa1{at}jhmi.edu Abstract Full Text Info/History Metrics Preview PDF ABSTRACT Bipolar disorder (BP) is a severe mental illness featured with potential cycling of depressive and manic episodes. The recurrent cycling is known to be associated with poor prognosis. Thus, it is important to decipher the pathophysiological mechanism that may possibly underlie the cycling. In our study, by using BP patient-derived neurons, we discovered the delay of time-to-peak in depolarization-associated intracellular calcium dynamics. This cellular deficit is selectively associated with the number of manic episodes in BP patients, suggesting that this deficit may participate in the mechanism of clinical cycling. We also observed an attenuated protein interaction between the calcium and voltage-activated potassium (BK) channel and the CaV1.2 L-type VGCC in BP patients. Pharmacological and molecular interventions that target CaV1.2-BK protein interaction, directly to BK channel for the amelioration of this attenuated protein interaction rescues the disease-associated intracellular calcium deficit. To test the involvement of BK channel in cycling-associated behaviors, we generated a novel animal model. INTRODUCTION Bipolar disorder (BP) is a severe mental illness featured with potential cycling of depressive and manic episodes 1 , 2 . Epidemiological data show that BP has a lifetime prevalence of 4-5% in the United States. At least 6 to 7% of BP patients finally die through suicide; there is evidence that suicide rates in BP patients are 20 to 30 times as high as the rates in the general population. The onset of the disease is frequently in young adulthood, leading to chronic disabilities. In particular, the recurrent cycling is known to be associated with poor prognosis. Thus, it is important to decipher the pathophysiological mechanism that may possibly underlie the cycling. The deficits in intracellular calcium [Ca 2+ ] i homeostasis have been classically suggested in BP. Recent genome wide association studies have also supported the idea by highlighting the genes coding for L-type voltage gated calcium channels (VGCC) 3 , 4 . Additional discoveries utilizing BP patient-derived neuronal models have supported this pathophysiological hypothesis 5 . Nevertheless, this hypothesis has not be fully developed for drug discovery and translation. In our study, by using BP patient-derived neurons, we discovered the delay of time-to-peak in depolarization-associated [Ca 2+ ] i dynamics. This cellular deficit is selectively associated with the number of manic episodes in BP patients, suggesting that this deficit may participate in the mechanism of clinical cycling. We also observed an attenuated protein interaction between the calcium and voltage-activated potassium (BK) channel and the CaV1.2 L-type VGCC in BP patients. Pharmacological amelioration of this attenuated protein interaction rescues the disease-associated [Ca 2+ ] i deficit. To test the involvement of BK channel in cycling-associated behaviors, we generated a novel animal model. RESULTS AND DISCUSSION Deficit in the intracellular Ca 2+ homeostasis in BP neurons Based on our hypothesis that neuronal cells from BP patients may have alternations in the intracellular Ca 2+ ([Ca 2+ ] i ) homeostasis, we examined induced neuronal cells (iN cells) from 25 sporadic BP patients in comparison with those from 26 healthy subjects ( Fig. 1a ). Although Fura2a did not detect a difference of baseline [Ca 2+ ] i between these two groups (data not shown), we observed a delay of [Ca 2+ ] i time-to-peak in a high potassium-evoked depolarization ( Fig. 1b, c ). Next, we investigated whether this [Ca 2+ ] i deficit is associated with clinical manifestations in BP patients. Notably, the number of manic episodes was the only variable among many clinical factors with a significant correlation with the cellular characteristic, time-to-peak, after correction of multiple comparisons ( Fig. 1d ). This cellular deficit was also reproducibly seen in iPS cell-derived excitatory neurons ( Fig. 1e ). By using multiple pharmacological agents, we underscored that L-type voltage-gated calcium channel (VGCC) plays a key role in this [Ca 2+ ] i deficit (data not shown). Download figure Open in new tab Fig. 1: Deficit in the intracellular Ca 2+ homeostasis in BP neurons ( a ) Demographic distribution of the subjects included for the induced neuronal cells (iN cells) initial screening experiments; ( b ) Schematic depicting high potassium-evoked depolarization [Ca 2+ ] i homeostasis. Time to peak is measured for the first peak evoked; ( c ) BP derive excitatory iN cells showed delayed depolarization-induced time to peak. Each dot represents average for each subject. HC: Healthy Control; BP: Bipolar disorder-1; ( d ) correlation analysis between cellular phenotype and clinical phenotype showed significance between number of mania and time to peak after adjustment of several factors; ( e ) iPSC lines were generated for selected BP with best fit for correlation (d), and matched HC. Excitatory iPSC-neurons from BP again showed delayed depolarization-evoked [Ca 2+ ] i homeostasis. Attenuated CaV1.2-BK protein interactions in BP neurons We hypothesized that this [Ca 2+ ] i deficit may be elicited by aberrant protein interactions involving CaV1.2. To address this question, we conducted a bioinformatics search using STRING database and found that CaV1.2 protein interacted with no more than 20 proteins with the highest confidence score of 0.9. Among these, we discovered one protein that has been known to regulate [Ca 2+ ] i , which is the calcium and voltage activated potassium (BK) channel subunit KCNMA1 6 , 7 ( Fig. 2a ). Download figure Open in new tab Fig. 2: Attenuated CaV1.2-BK protein interactions in BP neurons ( a ) STRING database hits for the CACNA1C (CaV1.2) interactors highlighted KCNMA1 (coding for the pore-forming subunit of the big potassium (BK) channel; ( b ) Immunofluorescence comparison for the CaV1.2 and BK channel for HC versus BP excitatory iPSC-neurons shows no significant difference in average image intensity normalized to CaMKII α . Similar results were obtained by western blotting (data not shown); ( c ) In situ proximity ligation assay (PLA) marking the interaction between CaV1.2 and BK channel as the red puncta dots shows significant decrease in interaction for the BP condition. Each dot here represents one image average; ( d ) Whole cell patch clamp electrophysiology showed a more depolarized state for the BP neurons and also decreased outward currents. Each dot represents neuron. Accordingly, we tested whether CaV1.2-BK protein interaction may be altered in BP by using in situ proximity ligation assay (PLA). In iPS cell-derived excitatory neurons, we did not observe difference in the expression levels of these two proteins, respectively ( Fig. 2b ). However, the PLA signals indicated that the protein interaction was attenuated ( Fig. 2c ). The levels of the protein interaction were correlated with the number of manic episodes in BP patients (data not shown). Basic physiology has shown that BK channel outward potassium current is reduced when this protein is attenuated 7 . To test whether this reduction may also occur in BP neurons in which the pathological attenuation of CaV1.2-BK protein interaction is observed, we conducted whole cell patch clamp electrophysiology in BP patient neurons. We found that BP neurons were indeed more depolarized and had lesser outward potassium currents than the HC neurons ( Fig. 2d ), which are consistent with the theory established in basic physiology. Altogether, we demonstrate that CaV1.2-BK protein interaction is attenuated at both molecular and functional levels in BP patients. Attenuated CaV1.2-BK protein interactions as a driver for BP-associated intracellular Ca 2+ homeostasis deficit: amelioration by BK-associated pharmacological interventions We next wished to test whether the attenuated protein interaction is an upstream driver of delay of [Ca 2+ ] i time-to-peak in a high potassium-evoked depolarization, which is seen in BP patients in association with the number of manic episodes. To address this question, we aimed to enhance CaV1.2-BK protein interaction by introducing a linker protein between these two. The linker includes BK channel interactor (peptide from the auxiliary protein beta1) 8 , 9 and CaV1.2 channel interacting nanobody 10 . Indeed, the introduction of this linker has enhanced CaV1.2-BK protein interaction evident by the enhanced PLA signals ( Fig. 3a ). Most importantly, this molecular intervention could ameliorate the delayed time-to-peak in BP patients, fixing this characteristic to the level seen in heathy subjects ( Fig. 3a ). These results clearly indicate that the attenuated CaV1.2-BK protein interaction is a key driver for the BP-associated intracellular Ca 2+ homeostasis deficit. Download figure Open in new tab Fig. 3: Attenuated CaV1.2-BK protein interactions as a driver for BP-associated intracellular Ca 2+ homeostasis deficit: amelioration by BK-associated pharmacological interventions ( a ) Pharmacological intervention with estramustine (Es), our bioinformatics-based hit that may affect the interaction, showed increased interaction and a resulting rescue of time to peak delay in two BP subject neurons. Dotted line represents HC average; ( b ) Molecular re-instatement of CaV1.2-BK channel interaction in BP iPSC-neurons by using a hybrid protein beta1-nanobody (P1). This also resulted in a rescue of time to peak phenotype as depicted for one BP subject. Scale bar is 20 μm; ( c ) Pharmacological interventions directly enhancing BK channel activity, viz. Unoprostone (Uno) and NS1619, also showed a rescue effect on time to peak in BP subjects. Each dot represents here average of one BP subject. Encouraged by this data that the enhancement of the attenuated CaV1.2-BK protein interaction is a way of normalizing the key cellular deficit that may be associated with clinical cycling features in BP, we looked for compounds that may have a similar action. To address this, we looked for compounds that interest with BK channel. We conducted a bioinformatic assessment using BioGRID4.4 database and underscored estramustine and fluticasone propionate. In particular, as a cytoskeletal anchor that interacts with the BK channel subunit KCNMA1, we hypothesize that estramustine may affect CaV1.2-BK protein interaction. At the experimental level, we observed that the BP-associated attenuation of the protein interaction was ameliorated ( Fig. 3b ). Importantly, once the protein interaction is normalized by estramustine, we also observed amelioration of the disease-associated [Ca 2+ ] i deficit ( Fig. 3b ). We also tested whether other interventions targeting to BK channel may also be effective to ameliorate the disease-associated [Ca 2+ ] i deficit. To address this question, we used two types of BK channel activators unoprostone isopropyl ester (Uno) or NS1619. First, the addition of BK channel activators ameliorated the aberrant BK-associated potassium current characteristics that exist in associated with the attenuated CaV1.2-BK protein interaction (data not shown). Importantly, we also observed that both Uno and NS1619 were effective to ameliorate the [Ca 2+ ] i deficit in BP neurons ( Fig. 3c ). Stress-induced behavior phase shift in mice: amelioration by BK-associated pharmacological interventions Thus far, we have demonstrated the [Ca 2+ ] i homeostasis-related cellular deficit that is clinically associated with manic episode numbers. For this cellular deficit, we underscore disease-associated attenuation of CaV1.2-BK protein interactions as a key upstream driver. This [Ca 2+ ] i deficit can be ameliorated by targeting to CaV1.2-BK protein interaction or more directly to the BK channel. Altogether, our cellular observations linking to the clinical phenotypes highlight BK channel potentially as a key molecule for mood cycling. Thus, we aimed to model this cycling in mice by using BK channel as a lead molecule. Clinically, mood cycling frequently occurs in association with stressors. Altogether, we combined KCNMA1(BK) knockout mice with a mild stressor of a short sleep deprivation (SD) possibly to model cycling ( Fig. 4a ). Download figure Open in new tab Fig. 4: Stress-induced behavior phase shift in mice: amelioration by BK-associated pharmacological interventions ( a ) Behavior phase switch study paradigm schema. The mice are first tested at baseline behavior in week 0, followed by acute sleep deprivation and re-testing in week 4. This is followed by a long rest and re-testing in week 8; ( b ) CaMKII α -driven KCNMA1 knockout heterozygous (BK) mice were tested for the behavior phase switch with forced swim test and showed a ‘phase switch’ with sleep deprivation of 4 hours. Unoprostone (Uno) was able to rescue this switch in knockout mice. Notably, no significant difference in behavior was observed for the wild type (WT) mice; ( c ) Behavior phase switch was also observed when the BK mice performed sucrose splash test. Each dot represents one mouse. We observed that heterozygous knockout of BK mice (BK Het) showed significantly higher immobility compared with control mice in forced swim test at the baseline ( Fig. 4b ). Four weeks after we examined the baseline behaviors, we applied acute SD for four h to both BK Het and WT, respectively. This mild stressor did not change the behavior in WT when we monitored this immediately after SD. In contrast, we observed a significant change in FST behaviors in BK Het: although more immobile compared with WT at the baseline as described above, BK Het became less immobile compared with WT immediately after SD ( Fig. 4b ). This change looks like a “phase switch” in BK Het compared with WT. This switch is unlikely a mere acute response, as the less immobile status stayed at least for one week as far as we tested (data not sown). Interestingly, this stress-induced status in BK Het disappeared and went back to the default status (baseline level) eight weeks after the SD-elicited switch. Indeed, without any further intervention after the SD, BK Het displayed significantly higher immobility compared with WT again ( Fig. 4b ). Similar behavioral phase switch was also observed in sucrose splash test ( Fig. 4c ). Finally, we tested whether the pharmacological intervention with BK channel may ameliorate this “phase switch”. Thus, we intraperitoneally (I.P.) injected Uno (0.06 mg/kg) or saline 20 min before behavior testing at each stage (baseline, SD, and default). Interestingly, we found not only the drug was able to rescue the higher immobility phenotype at baseline and default stage (0 and 12 w, respectively: see Fig. 4b ), but was also able to rescue the switch due to SD (4 w: see Fig. 4b ). WT mice had no statistically significant effect with these injections ( Fig. 4b ). Novel mechanism for BP with an association with mood cycling: a possible amelioration by BK-associated pharmacological interventions The recurrent cycling is known to be associated with poor prognosis. Thus, it is important to decipher the pathophysiological mechanism that may possibly underlie the cycling for a future treatment of BP. Here we report intracellular Ca 2+ homeostasis deficit in BP patients, which is primarily driven by the attenuated CaV1.2-BK protein interaction. Intervention with the protein interaction or directly with BK channel can ameliorate the intracellular Ca 2+ homeostasis. Given that the cellular deficit is associated with the number of manic episodes, suggesting the implication in mood cycling, we developed a novel mouse model of phase switch. Interestingly, this mouse behavior was also ameliorated by targeting to BK channel. Thus, further investigation of this molecular and cellular cascade may be a promising means for translational research for BP. METHODS Subject recruitment and assessment Johns Hopkins Schizophrenia Center recruited control and BP patients for this study and all the protocols were approved by the Johns Hopkins Medicine Institutional Review Board (IRB). Prior written informed consent in each case was obtained from the participants after discussing the purpose, sample extraction procedures and all other details of the recruitment procedure. Trained dermatologists performed the skin biopsy as per approved protocol. A total of 26 control and 25 BP-type 1 patient samples were utilized in the study. All clinical scales were administered by board-certified psychiatrists. The diagnosis of BP was assessed by the Diagnostic Interview for Genetic Studies (DIGS) 4.0 interview; the presence and severity of depressive and manic symptoms was measured respectively by the Montgomery Asberg Depression Rating Scale (MADRS) and the Young Mania Rating Scale (YMRS). Finally, the Retrospective Criteria of Long-Term Treatment Response in Research Subjects with Bipolar Disorder (Alda scale) was used to evaluate treatment response to lithium. Antibody The primary antibodies used for human neuronal cultured cells included: CaMKII α (R&D systems, MAB5584), MAP2 (Sigma, M2320), GFAP (Dako, Z0334), GAD67 (Millipore, MAB5406), vGLUT1 (Abcam, ab72311), synapsin-1 (Millipore, AB1543), PSD-95 (ABcam, ab2723), BRN2 (Cell Signaling tech. 12137S), SATB2 (ABcam, ab51502), CTIP2 (ABcam, ab18465), Anti-CaV1.2 (Alomone labs, ACC-003-GP), and anti KCNMA1 (Alomone labs, APC-107) were used for the immunofluorescence, proximity ligation assay, co-IP studies. Plasmids, and virus Plasmids for the study have been prepared with the PureYield TM plasmid midiprep system (A2492) (Promega). Lentiviral particles harboring human ASCL1, POU3F2 and MYT1L and were generated as previously described 11 and were used at 1:4 multiplicity of infection (MOI). pLenti-CaMKIIa-GCaMP5g was generated by sub-cloning GCaMP5g from pCMV-GCaMP5G [(pCMV-GCaMP5G was a gift from Douglas Kim & Loren Looger & GENIE Project (Addgene plasmid # 31788; http://n2t.net/addgene:31788 ; RRID:Addgene_31788)] 12 into pLenti-CaMKIIa-ChETA-EYFP [pLenti-CaMKIIa-ChETA-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 26967; http://n2t.net/addgene:26967 ; RRID:Addgene_26967 (Addgene plasmid # 26967)] 13 . It was used at 1:8 MOI as determined by the functionality in the neuronal cells. pLenti-CaMKIIa-mCherry was generated by sub-cloning mCherry from ChR2-mCherry-rAAV vector 14 into FCK(1.3)GW lentivector 15 . Beta1-SH3 construct generated with Twist Biosciences ( https://www.twistbioscience.com/ ) using pTWIST-CMV-beta globin backbone. Immunoprecipitation and western blotting Cells were lysed in lysis buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.5, 1% Triton X-100, will be modified) containing a protease inhibitor mixture (Roche Applied Sciences). Lysates were sonicated, cell debris was cleared by centrifugation, and the soluble fraction was immunoprecipitated as described previously 16 . Fibroblast generation and cell culture Skin biopsies were done by the trained clinician staff at the Johns Hopkins, and the fibroblast cell lines were generated with the Johns Hopkins core. The fibroblast lines were maintained with MEM backbone media supplemented with 10% FBS, 1X MEM-NEAA, 1X pen-strep and 1X sodium pyruvate. Coverslip preparation iN cell and iPSC-neuron differentiation was performed on 12 mm glass coverslips coated with 100 µg/ml poly-L-ornithine and 5 µg/ml laminin (PO/L) Other cell culture surfaces (like, six-well plate or culture flask etc.), were similarly coated with PO/L when stated. Fibroblast derived iN cells iN cells were generated with some modification to our published protocol 11 . 20,000 fibroblast cells were transduced with ASCL1, POU3F2, MYT1L (1:4 MOI). Small molecule (SMC) media comprised of Neurobasal medium (50% backbone), DMEM-F12 (50% backbone), N2 supplement (1X), B27 supplement (1X) glutaMAX (0.5X), ITS-X (0.5X), db-cAMP (200 µM), CHIR99021 (2 µM), SB431542 (10 µM), Noggin (500 ng/ml) and lamimin (1 µg/ml). SMC was maintained for two weeks. The final (FD) media was then started and maintained for additional four weeks, and comprised of Neurobasal (100% backbone), B27 supplement (1X), GlutaMAX (1X), BDNF (10 ng/ml), GDNF (2 ng/ml), NT3 (10 ng/ml)and laminin (1 µg/ml). iPSC generation and cell culture The skin fibroblasts from BP patients at early passage (p2) were used for the generation of iPSC. The ployclonal iPSC lines were generated by the New York Stem Cell Foundation (NYSCF) according to their published protocol 17 . iPSC derived excitatory neuron-enriched culture generation STEMdiff neural system (StemCell technologies) with minor modifications was used to generate central nervous system-type neural progenitor cells (NPC). Briefly, iPSC lines were seeded on PO/L coated wells of the six-well plate in the presence of STEMdiff neural induction medium + SMADi (twice). The cells were re-passaged and cultured in STEMdiff forebrain neuron differentiation media until confluency. These NPC could be further passaged and cryopreserved with Synth-a-Freeze until further differentiation. Thiazovivin (1µM) was included in media each time while passaging or thawing the cells. The media composition used for FD stage included BrainPhys backbone (100%), glutaMAX (1X), B27 supplement (1X), BDNF (10 ng/ml), GDNF (2 ng/ml), NT3 (10 ng/ml), laminin (1 µg/ml) as adapted from the iN FD media to generate CaMKII α positive neurons, and additionally Ascorbic acid and db-cAMP. Proximity ligation assay (PLA) iPSC-neurons were fixed with 4% paraformaldehyde (PFA) and PLA was performed with Sigma’s Duolink in situ PLA reagents. The signal visible as the distinct fluorescent spot was visualized with LSM700 confocal microscope at 40X magnification and quantified either for average image intensity by using Fiji software (imagej.net) or puncta count done by software Volocity. Calcium imaging Olympus fixed-stage BX61-Wi microscope with infrared-sensitive CCD camera (iXon3, ANDOR technology) set-up on anti-vibration table, and high speed galvo mirror with filters (DG4-1015, Shutter Instruments Company) were used for all the imaging. CaMKII α -driven genetically encoded calcium indicator version 5g (GCaMP5g) has been used as the Ca 2+ change marker in the neuronal cells for high potassium-mediated depolarization-evoked Ca 2+ kinetics. Normal artificial cerebro-spinal-fluid (aCSF) solution composed of NaCl (150 mM), KCl (3 mM), CaCl2.2H 2 O (2mM), MgCl2.6H 2 O (1.3 mM), HEPES (10 mM) and glucose (10 mM). High potassium solution was composed of NaCl (53 mM), KCl (100 mM), CaCl2.2H 2 O (2mM), MgCl2.6H 2 O (1.3 mM), HEPES (10 mM) and glucose (10 mM). Osmolarity was set between 290 to 300 mOsmol/kg for all the solutions (Advanced instruments) and pH set to 7.4 (Fisher) with NaOH. 1 µM tetrodotoxin was maintained in all the solutions for calcium imaging. 401 images were taken for calcium kinetics. Images were processed through the Metamorph advanced, Molecular device. For kinetics dF/F base values were calculated for the region of interest selected in the cell body near extension junction. Only the cells having dF/F base values above the threshold cutoff of 5% were used, and only the first peak values were included for the analysis. Cells transduced with lentivirus harboring CaMKII α -mCherry were used for the baseline [Ca 2+ ] i measurements. For loading, Fura2-AM 1 mM stock was made in DMSO anhydrous, and 1 μM working was made in FD media. Imaging was completed within 1 hour of dye loading. All drugs were used acutely 30 min before all the recordings and maintained in all the solutions. Drug doses Uno (2 nM), NS1619 (10 μM), NS309 (5 μM), dantrolene (50 μM), thapsigargin (10 μM), 2-APB (10 or 100 μM as specified), verapamil (10 μM), ω-agatoxin TK (1 μM), huwentoxin XVI (150 nM), SNX-482 (100 nM), FPL64176 (1 μM), lithium (1 mM), carbamazapine (100 μM), phenytoin (100 μM), VPA (500 μM), iberiotoxin (100 nM), estramustine (10 μM). Electrophysiology Coverslips containing iN cells or iPSC-neurons were loaded on an upright microscope (Olympus BX-50-WI) fitted with a Warner RC-27 submerged recording chamber. Solutions and recording conditions were adapted from the published article 18 . Patch pipettes (5-8 M Ω ) were pulled and filled with an internal solution composed of potassium gluconate (126 mM), KCl (8 mM), HEPES (20 mM), EGTA (0.2 mM), NaCl (2 mM), MgATP (3 mM), and Na 3 GTP (0.5 mM) (pH 7.3, 290-300 mOsm). Recordings were made at 23-25°C in aCSF composed of NaCl 137 mM, KCl 5 mM, CaCl 2 2 mM, MgCl 2 1 mM, HEPES 10 mM, and glucose 10 mM (pH 7.4, 290-300 mOsmol/kg). CaMKII α -promoter driven mCherry positive neurons were identified by epifluorescence signal through CCD camera (ANDOR-iXon3). Whole-cell patch-clamp recording were obtained with a Multiclamp 700B amplifier (Molecular Devices) controlled by pClampex 10.3 (Axon Instruments), and acquired at a sampling rate of 10 kHz with Digidata 1440A (Molecular Devices). All recordings were made in the presence of TTX (1 μM) unless otherwise specified. Cells were held at approximately −70 mV, then a series of voltages steps from −100 to +60 mV (in 20 mV increments for 500 ms) were delivered through the patch electrode for current recording. The peak amplitude of the resulting outward currents was quantified with leak subtraction and normalized with cell capacitance. Mice Animals were group housed after weaning and maintained on a 12-hour light/dark cycle with food and water provided ad libitum . All mice were used in accordance with Johns Hopkins University School of Medicine Institutional Animal Care and Use Committee (IACUC) guidelines. Mice testing was performed in batch of 8-15 mice, with the earliest starting age around 12 weeks. Kcnma1(fl/fl)-tdTomato (fBK) mice were provided by their generator, Dr. Andrea Meredith, University of Maryland 19 . Genotyping was performed with N1: 5 ′□ CAAAGGGGGTTTGCTTGTGAGAGG □ 3 ′ and N2: 5 ′□ CATGAGCGTGTGCCTAAACGCA □ 3 ′ , which amplify a 642□bp product from the Kcnma1-tdTomato floxed conditional allele and a 577□bp product from WT controls. Mice for comparing WT, Het (fl/+) and Hom (fl/fl) mice were generated by fl/+ x fl/+ matings for injection of a control virus [pENN.AAV.CamKII0.4.eGFP.WPRE.rBG was a gift from James M. Wilson (Addgene plasmid # 105541; http://n2t.net/addgene:105541 ; RRID:Addgene_105541)] or a CaMKIIa-Cre virus [pENN.AAV.CamKII.HI.GFP- Cre.WPRE.SV40 was a gift from James M. Wilson (Addgene viral prep # 105551-AAV9; http://n2t.net/addgene:105551 ; RRID:Addgene_105551]. For generation of CaMKIIa-Cre x fBK mice we crossed Hom B6.Cg-Tg (CaMKIIa-cre)T29-1Stl/J mice (Jax line 005359) with fl/+ BK mice and compared the resulting WT vs. f/+ mice (all were Cre/+). Ear tagging was performed to achieve individual identification followed by utilization of the minute ear piece extracted during tagging for genotyping. For mouse Genotyping, tissue samples were lysed into crude DNA using a PCR lysis reagent (Viagen: 102-T). Subsequently, crude DNA was diluted ten times and used in PCR protocols with Taq polymerase (Takara: RR001A) as necessary for either Cre or floxed genes. Behavior assays Forced swim test (FST) The FST was used to determine mice mobility as a proxy for anxiety-like behavior. Water was prepared overnight in 5000 ml beakers, animals were gently placed in the water and their activity was recorded with a camcorder for six minutes. Multistopwatch ( http://www.multistopwatch.com/ ) was used for scoring the active struggling time. FST and behavior phase switch paradigm Throughout testing period, mice were provided food pellets and hydrogel ad libitum . For behavior phase switch, animals were exposed to repeated FST with stated interval between each trial. The test was started by measuring the baseline FST behavior in week 0 at ZT 4. In week 4, sleep deprivation paradigm was provided as a mild stressor before FST from ZT 0 (lights on time) to ZT 4, after which they were tested for FST. The phase of baseline-sleep deprivation-reversal testing was repeated after a period of 3 months where mentioned. Mice were given Uno (0.06 mg/kg) by intraperitoneal (IP) injection 20 minutes before behavior testing, where mentioned. Sucrose Splash Test (SST) Mice were first transferred out of their home cage and kept in a surrogate cage for 1 hour of acclimation. Home cages were then set up underneath a camera for behavior recording. Each mouse was sprayed on the back twice with a 10% sucrose solution made in distilled water. They were then placed gently in their home cages and recorded for 5 minutes. The behavior phase switch paradigm was repeated with this behavioral assay like for the FST. Grooming latency was recorded by using spacebarclicker.org. Data analysis Ca 2+ pharmacology and behavior analysis Data analysis for Ca 2+ pharmacology was performed in Graph pad prism with ANCOVA for multiple comparisons; and t-test analysis for in-group comparison and a p value of 0.05 was considered significant. Correlation analysis of time-to-peak with clinical phenotypes Linear regression analysis adjusting for age, gender, race, smoking status, duration of illness, cuprizone, and mood stabilizer usage (Yes/No) were conducted to test the correlations between time to peak and main clinical variables, including number of mania episodes, number of depressive episodes, number of total episodes, global assessment scale (GAS), young mania scale total, ALDA total score. ACKNOWLEDGEMENT We thank Ms. Yukiko Y. Lema for manuscript organization. We also thank Dr. Fernando Goes, Dr. Hanna Jaaro-Peled, Dr. Kun Yang, Dr. Manu Ben-Johny, Dr. Anjali Rajadhyaksha, Dr. Andrea Meredith, Ms. Josephine de Chabot de Tramecourt, Ms. Lauren Guttman, Mr. Imad Isehak, as well as many other Sawa lab members and collaborators for scientific contributions. This observation has been included in the patent application filed as PCT/US2024/053139. REFERENCES 1. ↵ Kato . Current understanding of bipolar disorder: Toward integration of biological basis and treatment strategies . Psychiatry Clin Neurosci . 2019 Sep ; 73 ( 9 ): 526 – 540 . doi: 10.1111/pcn.12852 . PMID: 31021488 . OpenUrl CrossRef PubMed 2. ↵ Carvalho AF , Firth J , and Vieta E. Bipolar disorder . N Engl J Med . 2020 Jul 2; 383 ( 1 ): 58 – 66 . doi: 10.1056/NEJMra1906193 . PMID: 32609982 . OpenUrl CrossRef PubMed 3. ↵ Ferreira et al. Collaborative genome-wide association analysis supports a role for ANK3 and CACNA1C in bipolar disorder . Nat Genetics , 2008 Sept ; 40 ( 9 ): 1056 – 1058 . doi: 10.1038/ng.209 . PMID: 18711365 . OpenUrl CrossRef PubMed Web of Science 4. ↵ Mullins et al. Genome-wide association study of more than 40,000 bipolar disorder cases provides new insights into the underlying biology . Nat Genet . 2021 June ; 53 ( 6 ): 817 – 829 . doi: 10.1038/s41588-021-00857-4 . PMID: 34002096 . OpenUrl CrossRef PubMed 5. ↵ Harrison PJ , Hall N , Mould A , Al-Juffali N , and Tunbridge EM . Cellular calcium in bipolar disorder: systematic review and meta-analysis . Mol Psychiatry . 2021 Aug ; 26 ( 8 ): 4106 – 4116 . doi: 10.1038/s41380-019-0622-y . PMID: 31801967 . OpenUrl CrossRef PubMed 6. ↵ Cox DH . Modeling a Ca(2+) channel/BKCa channel complex at the single-complex level . Biophys J . 2014 Dec 16; 107 ( 12 ): 2797 – 2814 . doi: 10.1016/j.bpj.2014.10.069 . PMID: 25517147 . OpenUrl CrossRef PubMed 7. ↵ Berkefeld H , Sailer CA , Bildl W , Rohde V , Thumfart J-O , Eble S , Klugbauer N , Reisinger E , Bischofberger J , Oliver D , Knaus H-G , Schulte U , and Fakler B. BKCa-Cav channel complexes mediate rapid and localized Ca2+-activated K+ signaling . Science . 2006 Oct 27; 314 ( 5799 ): 615 – 620 . doi: 10.1126/science.1132915 . PMID: 17068255 . OpenUrl Abstract / FREE Full Text 8. ↵ Berkefeld H , Fakler B , and Schulte U. Ca2+-activated K+ channels: from protein complexes to function . Physiol Rev 2010 Oct ; 90 ( 4 ): 1437 – 59 . doi: 10.1152/physrev.00049.2009 . PMID: 20959620 . OpenUrl CrossRef PubMed Web of Science 9. ↵ Gonzales-Perez V , and Lingle CJ . Regulation of BK channels by beta and gamma subunits . Annu Rev Physiol . 2019 Feb 10; 81 : 113 – 137 . doi: 10.1146/annurev-physiol-022516-034038 . PMID: 30742788 . OpenUrl CrossRef PubMed 10. ↵ Morfin PJDR , Chavez DS , Jayaraman S , Yang L , Geisler SM , Kochiss AL , Tuluc P , Colecraft HM , Marx SO , Liu XS , Rajadhyaksha AM , and Ben-Johny M. A genetically encoded actuator boosts L-type calcium channel function in diverse physiological settings . Sci Adv . 2024 Nov ; 10 ( 44 ): eadq3374 . doi: 10.1126/sciadv.adq3374 . PMID: 39475605 . OpenUrl CrossRef PubMed 11. ↵ Kano S , Cardarelli RA , Maegawa G , Higurashi N , Gaval-Cruz M , Wilson AM , Tristan C , Kondo MA , Chen Y , Koga M , Obie C , Ishizuka K , Seshadri S , Srivastava R , Kato TA , Horiuchi Y , Sedlak TW , Lee Y , Rapoport JL , Hirose S , Okano H , Valle D , O’Donnell P , Sawa A , and Kai M. Clinical utility of neuronal cells directly converted from fibroblasts of patients for neuropsychiatric disorders: studies of lysosomal storage diseases and channelopathy . Curr Mol Med . 2015 ; 15 ( 2 ): 138 – 45 . doi: 10.2174/1566524015666150303110300 . PMID: 25732146 . OpenUrl CrossRef PubMed 12. ↵ Akerboom et al. Optimization of a GCaMP calcium indicator for neural activity imaging . J Neurosci . 2012 Oct ; 32 ( 40 ): 13819 – 40 . doi: 10.1523/JNEUROSCI.2601-12.2012 . PMID: 23035093 . OpenUrl Abstract / FREE Full Text 13. ↵ Gunaydin LA , Yizhar O , Berndt A , Sohal VS , Deisseroth K , and Hegemann P. Ultrafast optogenetic control . Nat Neurosci . 2010 Mar ; 13 ( 3 ): 387 – 92 . doi: 10.1038/nn.2495 . PMID: 20081849 . OpenUrl CrossRef PubMed Web of Science 14. ↵ Knobloch HS , Charlet A , Hoffmann LC , Eliava M , Khrulev S , Cetin AH , Osten P , Schwarz MK , Seeburg PH , Stoop R , and Grinevich V. Evoked axonal oxytocin release in the central amygdala attenuates fear response . Neuron , 2012 , 73 ( 3 ): 553 – 566 . doi: 10.1016/j.neuron.2011.11.030 . PMID: 22325206 . OpenUrl CrossRef PubMed Web of Science 15. ↵ Ditthen T , Nimmerjahn A , Komai S , Licznerski P , Waters J , Margrie TW , Helmchen F , Denk W , Brecht M , and Osten P. Lentivirus-based genetic manipulations of cortical neurons and their optical and electrophysiological monitoring in vivo . PNAS , 2004 , 101 ( 52 ): 18206 – 18211 . doi: 10.1073/pnas.0407976101 . PMID: 15608064 . OpenUrl Abstract / FREE Full Text 16. ↵ Ishizuka K , Kamiya A , Oh EC , Kanki H , Seshadri S , Robinson JF , Murdoch H , Dunlop AJ , Kubo K , Furukori K , Huang B , Zeledon M , Hayashi-Takagi A , Okano H , Nakajima K , Houslay MD , Katsanis N , and Sawa A. DISC1-dependent switch from progenitor proliferation to migration in the developing cortex . Nature . 2011 May 5; 473 ( 7345 ): 92 – 6 . doi: 10.1038/nature09859 . PMID: 21471969 . OpenUrl CrossRef PubMed Web of Science 17. ↵ Paull et al. Automated, high-throughput derivation, characterization and differentiation of induced pluripotent stem cells . Nat Methods . 2015 Sept ; 12 ( 9 ): 885 – 892 . doi: 10.1038/nmeth.3507 . PMID: 26237226 . OpenUrl CrossRef PubMed 18. ↵ Sun et al. Potassium channel dysfunction in human neuronal models of Angelman syndrome . Science . 2019 Dec ; 366 ( 6472 ): 1486 – 1492 . doi: 10.1126/science.aav5386 . PMID: 31857479 . OpenUrl Abstract / FREE Full Text 19. ↵ Zemen BG , Lai MH , Whitt JP , Khan Z , Zhao G , and Meredith AL . Generation of Kcnma1f1-tdTomato, a conditional deletion of the BK channel α subunit in mouse . Physiol Rep . 2015 Nov ; 3 ( 11 ): e12612 . doi: 10.14814/phy2.12612 . PMID: 26537348 . OpenUrl Abstract / FREE Full Text View the discussion thread. Back to top Previous Next Posted August 10, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Attenuated CaV1.2-BK channel protein interaction in bipolar disorder Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Attenuated CaV1.2-BK channel protein interaction in bipolar disorder Rupali Srivastava , Nathaniel Genduso , Koko Ishizuka , Akira Sawa bioRxiv 2025.08.08.669447; doi: https://doi.org/10.1101/2025.08.08.669447 Share This Article: Copy Citation Tools Attenuated CaV1.2-BK channel protein interaction in bipolar disorder Rupali Srivastava , Nathaniel Genduso , Koko Ishizuka , Akira Sawa bioRxiv 2025.08.08.669447; doi: https://doi.org/10.1101/2025.08.08.669447 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Neuroscience Subject Areas All Articles Animal Behavior and Cognition (7629) Biochemistry (17660) Bioengineering (13881) Bioinformatics (41910) Biophysics (21436) Cancer Biology (18576) Cell Biology (25480) Clinical Trials (138) Developmental Biology (13368) Ecology (19887) Epidemiology (2067) Evolutionary Biology (24302) Genetics (15598) Genomics (22482) Immunology (17726) Microbiology (40360) Molecular Biology (17163) Neuroscience (88534) Paleontology (666) Pathology (2830) Pharmacology and Toxicology (4821) Physiology (7637) Plant Biology (15129) Scientific Communication and Education (2045) Synthetic Biology (4290) Systems Biology (9817) Zoology (2269)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00