Detection of carbapenemases activity in MDR isolates of Klebsiella pneumoniae by mCIM method and carbapenem resistance genes blaVIM, blaIMP, blaNDM, blaKPC-2 and blaOXA-48 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Detection of carbapenemases activity in MDR isolates of Klebsiella pneumoniae by mCIM method and carbapenem resistance genes blaVIM, blaIMP, blaNDM, blaKPC-2 and blaOXA-48 Darya Mohammadpour, Mohammad Yousef Memar, Hossein Samadi Kafil, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3998636/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Klebsiella pneumoniae ( K. pneumoniae ) is a Gram-negative, opportunistic bacterium that can cause a variety of infections. Antibiotics such as cephalosporins are usually used to treat K. pneumoniae infections. However, resistance of this bacterium to cephalosporins has been reported. For this reason, alternative antibiotics such as carbapenems are used as the last line of treatment for K. pneumoniae . This bacterium becomes resistant to carbapenems by various mechanisms, including enzymatic hydrolysis of carbapenems by producing carbapenemase enzymes ( bla VIM , bla IMP , bla NDM , bla KPC−2 and bla OXA−48 genes produce the hydrolysis enzyme). The present study aims to investigate the prevalence rate of MDR K. pneumoniae and the evaluation of resistant isolates to carbapenem was done using phenotypic and genotypic methods. In the present study, 205 K. pneumoniae isolates were collected from patients admitted to the Hospitals of Tabriz University of Medical Sciences from November 2022 to April 2023. Antibiotic susceptibility patterns were determined by disc diffusion method and resistance genes of bla VIM , bla IMP , bla NDM , bla KPC−2 and bla OXA−48 were detected by PCR method. Out of 205 samples collected from K. pneumoniae isolates, 100 samples were multidrug resistant (MDR). Of the 100 MDR K. pneumoniae isolates, 80 samples (%80) were resistant to carbapenems by mCIM method. The frequencies of the bla OXA , bla NDM , bla IMP , bla VIM and bla KPC−2 genes were 52 (65%), 23(28.7%), 12 (15%), 8 (10%) and 5 (6.25%), respectively. Antimicrobial resistance was common and worrying, and rapid and accurate detection of MDR K. pneumoniae isolates can help in the management of patients with K. pneumoniae infections and reduce mortality. Rapid detection of MDR K. pneumoniae can also prevent the spread of resistant isolates. K. pneumonia MDR carbapenemase phenotypic method genotypic method Figures Figure 1 Figure 2 Figure 3 1. Introduction Klebsiella pneumoniae (K. pneumoniae) is a Gram-negative, non-motile, encapsulated, lactose-fermenting, facultative anaerobic, rod-shaped bacterium and is a member of Enterobacteriaceae ( 1 ). K. pneumoniae is an opportunistic bacterium that can cause various infections and can increase the mortality in immunocompromised patients ( 2 ). Infections caused by K. pneumoniae include pneumonia, liver abscess, urinary tract infections (UTI), skin, and systemic infections ( 3 , 4 ). Antibiotics such as cephalosporins are usually used to treat K. pneumoniae infections. However, the resistance of this bacterium to cephalosporins has been reported. For this reason, alternative antibiotics such as carbapenem are used as the last line of K. pneumoniae treatment ( 5 , 6 ). Carbapenems are a group of broad-spectrum beta-lactams and they are usually used to treat infections caused by pathogens that show high antibiotic resistance ( 5 , 7 ). Although, in recent years, K. pneumoniae strains have become resistant to carbapenems. This bacterium becomes resistant to carbapenems through various mechanisms, including a) enzymatic hydrolysis of carbapenem by producing carbapenemase enzymes ( bla VIM , bla IMP , bla NDM , bla KPC−2 , and bla OXA−48 genes are included in this category), b) expression of efflux pumps, c) reduction of outer membrane permeability through mutation in ompK35 and ompK36 porins ( 8 , 9 ). The resistance of this bacterium to carbapenems can cause multidrug-resistant (MDR) isolates. MDR bacteria are microorganisms that show resistance to three different classes of antibiotics, and the observation of such strains, especially K. pneumoniae , can be considered a therapeutic warning ( 10 – 12 ). Rapid and accurate detection of MDR K. pneumoniae strains can help in the treatment of patients with K. pneumoniae infections and reduce mortality. Also, rapid detection of MDR K. pneumoniae can prevent the spread of resistant strains ( 13 – 15 ). The present study aims to investigate the rate of MDR K. pneumoniae and the evaluation of K. pneumoniae isolates resistant to carbapenem in northwest Iran (Tabriz). 2. Materials and Methods 2.1. Specimens In this cross-sectional study, performed from November 2022 to April 2023, 205 K. pneumoniae isolates were collected from Imam Reza and Sina hospitals in Tabriz. To identify the K. pneumonia , Gram staining and biochemical tests including triple sugar iron (TSI), sulfur, indole, motility (SIM), Simmons citrate, acid production from glucose, maltose, and saccharose, and urease tests were used. 2.2. Antimicrobial Susceptibility Testing To determine antibiotic susceptibility, the disk diffusion method was performed according to the Clinical & Laboratory Standards Institute (CLSI). For this purpose, a bacterial suspension with a turbidity of 0.5 McFarland was prepared and then inoculated on the Mueller-Hinton agar (MHA) ( 16 , 17 ). The disks of antibiotics including Meropenem (10 µg), Ciprofloxcacin (5 µg), Gentamicin (10 µg), Pipracillin-Tazobactam (110µg), Aztreonam (30 µg), Ceftazidime (30 µg), Amikacin (30 µg), Trimethoprim sulfamethoxazole (25 µg), Cefotaxim (30 µg) were used ( 18 ). All antibiotic disks were provided by Mast Ltd, England. The plates were incubated at 37°C for 24h. The results were interpreted using the CLSI breakpoints. The results of antibiotic susceptibility testing were validated using the control strain of K. pneumoniae ATCC13883 ( 18 ) ( Fig. 1 ). 2.3. Modified Carbapenem Inactivation Method (mCIM( To perform mCIM, 2 mL of Tryptic soy broth (TSB) medium was added into a tube, and then a full loop of K. pneumoniae isolates grown on the MHA medium was added to the TSB and then a disk of meropenem 10µg antibiotic inside the medium (the tube were incubated at 37°C for 4 h) ( 19 , 20 ). Then, the disk is removed from the suspension and placed onto MHA plate seeded with a suspension of a carbapenem-susceptible indicator organism ( E. coli ATCC 25922); following overnight incubation, the zone of inhibition is measured to determine whether the MEM had been hydrolyzed (growth of the indicator organism close to the disk), or is still active (a large zone of inhibition around the disk) ( 13 , 19 ) .Growth of the indicator organism close to the disk 6 to 15 mm is a positive result of the mCIM (the ability of the bacteria to produce carbapenemase, which inactivates the meropenem disk, and as a result, the bacteria can grow around the meropenem disk), growth of the indicator organism at a distance of 16 to 18 mm as an intermediate result of the mCIM (need for further testing to determine the presence or absence of carbapenemase production) and growth of the indicator organism within ≥ 19 mm of the disk as a negative result of the mCIM (inability to produce carbapenemase by bacteria) will be considered ( 13 , 21 , 22 ) (Fig. 2 ). 2.4. Polymerase Chain Reaction (PCR) DNA was extracted from bacterial colonies growing on the MHA by using the lysis buffer method. The specific amplification primers used for PCR and the temperature of denaturation, annealing, and extension of each gene are listed in Table 1 . PCR was performed in the reactions with a final volume of 20 µL including 10 µL of master mix 1X containing Taq DNA polymerase, MgCl2, and dNTPs ( 23 ). Amplification reactions were conducted in a Bio-Rad thermocycler. Isolates of K. pneumoniae that were previously confirmed for the presence of various resistance genes were used as positive controls and isolates that were negative for the presence of genes were used as negative controls in PCR reactions ( 23 ). The PCR products were resolved using the gel electrophoresis on 1% agarose gels in 0.5× TBE buffer. The gels were stained with DNA-safe stain and were visualized under ultraviolet light. The sizes of the PCR products were determined by comparison with a molecular size marker (50 bp DNA ladder) ( 23 ) ( Table 1 ). Table 1 Primer sequences and amplification reaction details for each gene Gene name Amplification reactions Amplification reactions cycles PCR product size (bp) Primers sequences [5'-3'] bla Oxa−48 Denaturation: 95 ⸰ C, 30 s Annealing: 52 ⸰ C, 30 s Extension: 72 ⸰ C, 1 min 30 438 F: GCGTGGTTAAGGATGAACAC R: CATCAAGTTCAACCCAACCG bla NDM Denaturation: 95 ⸰ C, 30s Annealing: 53 ⸰ C, 30 s Extension: 72 ⸰ C, 1 min 30 621 F: GGTTTGGCGATCTGGTTTTC R: CGGAATGGCTCATCACGATC bla IMP Denaturation: 95 ⸰ C, 30 s Annealing: 54 ⸰ C, 45 s Extension: 72 ⸰ C, 1 min 30 233 F: GGAATAGAGTGGCTTAAYTCTC R: GGTTTAAYAAAACAACCACC bla VIM Denaturation: 95 ⸰ C, 30 s Annealing: 60 ⸰ C, 30 s Extension: 72 ⸰ C, 1 min 30 390 F: GATGGTGTTTGGTCGCATA R: CGAATGCGCAGCACCAG bla KPC−2 Denaturation: 95 ⸰ C, 30 s Annealing: 55 ⸰ C, 45 s Extension: 72 ⸰ C, 1 min 30 798 F: CGTCTAGTTCTGCTGTCTTG R: CTTGTCATCCTTGTTAGGCG s: seconds; min: minutes. 2.5. Statistical Method The sample size was determined based on an expected frequency (a priori estimate of frequency according to a pilot study result), an accepted error of 4% (required precision of the estimate), and a 95% level of confidence. The results were analyzed by SPSS.ver 26 software. Fisher’s exact test or Chi-square was applied to evaluate the association between the presence of various genes with resistance to antibiotics. P values ≤ 0.05 were considered statistically significant. 3. Results The samples isolated from various wards including Internal (38%), ICU (34%), Infectious (11%), Surgery (9%), and Emergency (8%). Among the 205 K. pneumoniae isolates, 100 isolates were MDR (48.8%) and these MDR isolates showed resistance to different families of antibiotics. The rate of resistance to antibiotics was shown in the Fig. 1 . The highest frequency of resistance was due to ciprofloxacin at 97% and the lowest frequency of resistance was due to amikacin at 72%. The mCIM test results showed that among the 100 MDR K. pneumoniae isolates, 80 samples (%80) were resistant to carbapenem with carbapenemase production (mCIM positive). Among 80 carbapenem-resistant isolates (mCIM positive), bla OXA , bla NDM , bla IMP , bla VIM , and bla KPC−2 genes were observed in 52 (65%), 23 (28.7%), 12 (15%), 8 (10%), and 5 (6.25%) of isolates, respectively (Fig. 3 ). There was a significant relationship between antibiotic resistance to carbapenem and the presence of the bla OXA , bla NDM , bla IMP , bla VIM , and bla KPC−2 genes (P < 0.05). 4. Discussion K. pneumoniae is a widespread and opportunistic human pathogen that has become a major cause of hospital-acquired infections in recent decades. The management of antimicrobial resistance in multidrug-resistant K. pneumoniae is a major challenge for clinicians. The optimal treatment option for infections is not yet well established. Combined treatments with imipenem, colistin, fosfomycin, and tigecycline and high-dose aminoglycosides are widely used and usually lead to suboptimal results. Resistance to carbapenems, as a last-resort to treat infections caused by CRE is a major health concern. The increase in CRE is a serious issue due to the high mortality rate (> 30%). Research on the mechanisms of CRE is an essential step in planning a national public health strategy for this emerging pathogen ( 8 , 24 ). In the present study, the carbapenem-resistant K. pneumoniae (CRKP0 rate was 48.8% Most of the CRKP colonization is from the Asian continent, mainly in China and India, with a frequency of 1.4%. The frequency of CRKP in Europe was 1.2%, 0.3% in the Americas, and 0.07% in Africa. Only two studies have reported colonization with CRKP in Africa, from Egypt and Morocco ( 25 ). This picture may not represent the practical scenario as most countries, especially Africa and America have no data on colonization with CRKP. Though higher prevalence is reported in China and India, there is still variation within those countries’ reports. In China, the prevalence report ranges from 1 to 21%, and also in India, it ranges from 1 to 22%. The pooled prevalence of CRKP for the Asian continent is 4.56%. Similarly, reports from Italy show variation in the prevalence rate from 2 to 9%, with a 6.16% pooled estimate of prevalence for Europe. This finding indicates that there is no uniform distribution of colonization in different localities even within a country ( 25 ). In addition, due to its high prevalence, CRKP has the ability to cause a wide range of clinical infections and the simultaneous resistance to more than three antibiotics (MDR) poses the greatest risk to public health. Understanding the antibiotic susceptibility patterns of MDR and CRKP is important for the antibiotic treatment of infections caused by this bacterium. K. pneumoniae poses an urgent public health threat because it has been detected to develop resistance to antimicrobials more than most bacteria and emergence of MDR strains associated with hospital outbreaks. MDR strains are being increasingly reported from different countries ( 26 ). It has added attention worldwide, especially in developed countries, due to its high drug resistance. Antimicrobial resistance rates in K. pneumoniae have steadily increased over the years, and K. pneumoniae is becoming resistant to almost all aminoglycosides, quinolones, and β-lactams ( 26 ). In the current study, we found MDR in 48.8%. According to a systematic review and meta-analysis published in 2021, the global prevalence of nosocomial MDR K. pneumoniae was estimated at 32.8%. However, the prevalence of MDR K. pneumoniae varies geographically and has become a significant concern around the world. In Southeastern Asia, the pooled prevalence for MDR K. pneumoniae was estimated at 55% and 27%, respectively. In a study conducted in a hospital setting in Saudi Arabia, the prevalence of MDR K. pneumoniae pattern was found to be at 66.8%. In a Brazilian ICU wards, most of K. pneumoniae isolates (84%) were classified as MDR ( 27 ). For instance, at the European level, more than one-third (36.6%) of K. pneumoniae isolates reported to the European antimicrobial resistance surveillance network for 2019 were resistant to at least one of the antimicrobial groups under regular surveillance, fluoroquinolones, third-generation cephalosporins, aminoglycosides, and carbapenems. The Ethiopian annual antimicrobial surveillance report showed that 95.8% of K. pneumoniae isolates were resistance to ceftriaxone, 86.7% to ceftazidime, 95.6% to trimethoprim-sulfamethoxazole, 83.3% to cefepime, 62.7% to gentamicin, 48.1% to ciprofloxacin, 30.6% to meropenem, and 7.2% to amikacin ( 26 ). These findings can be attributed to the difference in the characteristics of different types of carbapenemase, geographical area and the use of antibiotics. Investigating on the carbapenem resistance mechanisms in bacteria is very important, but current studies of the resistance mechanism focus often on the carbapenemase enzyme production. In the present study, carbapenem resistance by producing carbapenemase enzyme was investigated. In this research, among the 205 K. pneumoniae samples collected, 100 samples were MDR and resistant to carbapenems. Also, among 100 MDR isolates, 80 isolates were mCIM positive, meaning the ability to produce carbapenemase. Furthermore, other isolates (%20) were resistant to carbapenem while their mCIM test was negative, which means these bacteria are resistant to carbapenems using the efflux pump mechanism or porin modification of the outer membrane. The mCIM assay can detect carbapenemase production in CRKP as a rapid phenotypic method with high sensitivity and specificity, which is consistent with studies ( 22 , 28 ). In this study, mCIM was used as a sensitive and rapid phenotypic method to identify carbapenemase in CRKP isolates. This study agrees with previous findings that mCIM as a rapid and cost-effective phenotypic method with high sensitivity and specificity ( 29 , 30 ). The presence of five carbapenemase genes was investigated in 80 isolates. Also 52 isolates for bla OXA-48 ,23 isolates for bla NDM , 12 isolates for bla IMP , 8 isolates for bla VIM and 5 isolates for bla KPC-2 were positive, bla OXA -48 like was the most common gene in K. pneumoniae. This is consistent with previous studies that reported that the common genes in carbapenemase production were bla oxa-48 , bla NDM , bla IMP , bla VIM , and bla KPC-2 . These findings are also consistent with other results obtained by previous studies ( 8 , 31 ). In our study, bla VIM and bla KPC-2 were the least abundant, which is consistent with other reported results ( 8 ). The reason for the difference in frequency genes in carbapenem-resistant K. pneumoniae isolates in each region can be caused by geographical differences, national care policies, the antibiotic patterns used, sample size, compliance with laboratory standards, identification methods, and the population. The weakness of this study may be the inability to distinguish metallobetalactamase types of serine carbapenemase by mCIM method. We showed mCIM as a simple and chip phenotypic method with high appropriate sensitivity and specificity in identifying carbapenem-resistant K. pneumoniae . Considering the effect of regional characteristics on the susceptibility patterns, the results of this study can be used in the control, detection and treatment of these isolates. 5. Conclusion According to the present study, the resistance rate of K. pneumoniae to carbapenem is high. To manage CRKP infections and reduce mortality, a rapid and accurate assay is suggested. We recommend the mCIM method in developing countries to identify carbapenemase production. Declarations Acknowledgments We are grateful to our dear expert colleagues in the laboratory: Mrs. Yazdan Parast, Mrs. Yagoubi, Mrs. Abdullahi, and Mr. Lelahzadeh. Funding The financial resources of this study were provided by Tabriz University of Medical Sciences, Iran. Conflict interest We (all of authors) have no conflict interest. Ethical Approval This study was approved by the research ethics committee ) IR.TBZMED.REC.1402.027 ( at Tabriz University of Medical Sciences, Tabriz, Iran. Availability of data and content (transparency of data): All data and content in this article are transparent and accessible. Code availability (Software program or custom code): 'Not applicable'. Consent for publication (including appropriate statements): This article and all the contents and data of this study can be published with the consent of all authors. Author Contributions All authors made substantial contributions to conception and design, acquisition of data, or analysis and interpretation of data. Participated in drafting the article or revising it critically for important intellectual content. issued final approval of the published version and agree to be accountable for all aspects of the work. Concept and design of the study: Darya Mohammadpour, Mohammad Youssef Memar, Reza Ghotaslou. Data collection and sampling: Darya Mohammadpour, Reza Ghotaslou, Hossein Samadi Kefil, Alka Hosni, Mohammad Ahangarzadeh Rezaei, Hivakdkhoda. Data analysis and interpretation: Darya Mohammadpour, Mohammad Yusuf Memar, Idris Nabizadeh. Preparation of the main draft: Darya Mohammadpour, Mohammad Youssef Memar, Reza Ghotaslou, Hamed Ebrahimzadeh. Review and editing: Mohammad Youssef Memar, Reza Ghotaslou. Study supervision: Reza Ghotaslou. References Hansen GT. Continuous evolution: perspective on the epidemiology of carbapenemase resistance among Enterobacterales and other Gram-negative bacteria. Infect Dis therapy. 2021;10:75–92. AlTamimi M, AlSalamah A, AlKhulaifi M, AlAjlan H. Comparison of phenotypic and PCR methods for detection of carbapenemases production by Enterobacteriaceae. Saudi J Biol Sci. 2017;24(1):155–61. Cao X, Xu X, Zhang Z, Shen H, Chen J, Zhang K. Molecular characterization of clinical multidrug-resistant Klebsiella pneumoniae isolates. Ann Clin Microbiol Antimicrob. 2014;13(1):1–5. Palmeiro JK, De Souza RF, Schörner MA, Passarelli-Araujo H, Grazziotin AL, Vidal NM, et al. Molecular epidemiology of multidrug-resistant Klebsiella pneumoniae isolates in a Brazilian tertiary hospital. Front Microbiol. 2019;10:1669. Codjoe FS, Donkor ES. Carbapenem resistance: a review. Med Sci. 2017;6(1):1. Ling W, Furuya-Kanamori L, Ezure Y, Harris PN, Paterson DL. Adverse clinical outcomes associated with infections by Enterobacterales producing ESBL (ESBL-E): a systematic review and meta-analysis. JAC-antimicrobial Resist. 2021;3(2):dlab068. Logan LK, Weinstein RA. The epidemiology of carbapenem-resistant Enterobacteriaceae: the impact and evolution of a global menace. J Infect Dis. 2017;215(suppl1):S28–36. Alizadeh N, Ahangarzadeh Rezaee M, Samadi Kafil H, Hasani A, Soroush Barhaghi MH, Milani M et al. Evaluation of resistance mechanisms in carbapenem-resistant Enterobacteriaceae. Infect Drug Resist. 2020:1377–85. Aurilio C, Sansone P, Barbarisi M, Pota V, Giaccari LG, Coppolino F, et al. Mechanisms of action of carbapenem resistance. Antibiotics. 2022;11(3):421. Yekani M, Rezaee MA, Beheshtirouy S, Baghi HB, Bazmani A, Farzinazar A, et al. Carbapenem resistance in Bacteroides fragilis: A review of molecular mechanisms. Anaerobe. 2022;76:102606. Suay-García B, Pérez-Gracia MT. Present and future of carbapenem-resistant Enterobacteriaceae infections. Advances in clinical immunology, medical microbiology, COVID-19, and big data. 2021:435 – 56. Wyres KL, Holt KE. Klebsiella pneumoniae as a key trafficker of drug resistance genes from environmental to clinically important bacteria. Curr Opin Microbiol. 2018;45:131–9. Gandor NHM, Amr GE-S, Eldin Algammal SMS, Ahmed AA. Characterization of carbapenem-resistant k. pneumoniae isolated from intensive care units of zagazig university hospitals. Antibiotics. 2022;11(8):1108. Effah CY, Sun T, Liu S, Wu Y. Klebsiella pneumoniae: an increasing threat to public health. Ann Clin Microbiol Antimicrob. 2020;19(1):1–9. van Duin D, Doi Y. The global epidemiology of carbapenemase-producing Enterobacteriaceae. Virulence. 2017;8(4):460–9. Bonnin RA, Emeraud C, Jousset AB, Naas T, Dortet L. Comparison of disk diffusion, MIC test strip and broth microdilution methods for cefiderocol susceptibility testing on carbapenem-resistant Enterobacterales. Clin Microbiol Infect. 2022;28(8):1156. e1-. e5. Nakamura-Silva R, Cerdeira L, Oliveira-Silva M, da Costa KRC, Sano E, Fuga B, et al. Multidrug-resistant Klebsiella pneumoniae: a retrospective study in Manaus, Brazil. Arch Microbiol. 2022;204(4):202. Moradigaravand D, Martin V, Peacock SJ, Parkhill J. Evolution and epidemiology of multidrug-resistant Klebsiella pneumoniae in the United Kingdom and Ireland. MBio. 2017;8(1):01976–16. 10.1128/mbio . Ding L, Shi Q, Han R, Yin D, Wu S, Yang Y, et al. Comparison of four carbapenemase detection methods for bla KPC-2 variants. Microbiol Spectr. 2021;9(3):e00954–21. Li J, Li C, Cai X, Shi J, Feng L, Tang K et al. Performance of modified carbapenem inactivation method and inhibitor-based combined disk test in the detection and distinguishing of carbapenemase producing Enterobacteriaceae. Annals Translational Med. 2019;7(20). Pierce VM, Simner PJ, Lonsway DR, Roe-Carpenter DE, Johnson JK, Brasso WB, et al. Modified carbapenem inactivation method for phenotypic detection of carbapenemase production among Enterobacteriaceae. J Clin Microbiol. 2017;55(8):2321–33. Tamma PD, Simner PJ. Phenotypic detection of carbapenemase-producing organisms from clinical isolates. J Clin Microbiol. 2018;56(11):01140–18. 10.1128/jcm . Tsai Y-M, Wang S, Chiu H-C, Kao C-Y, Wen L-L. Combination of modified carbapenem inactivation method (mCIM) and EDTA-CIM (eCIM) for phenotypic detection of carbapenemase-producing Enterobacteriaceae. BMC Microbiol. 2020;20(1):1–7. Lou T, Du X, Zhang P, Shi Q, Han X, Lan P, et al. Risk factors for infection and mortality caused by carbapenem-resistant Klebsiella pneumoniae: A large multicentre case–control and cohort study. J Infect. 2022;84(5):637–47. Tesfa T, Mitiku H, Edae M, Assefa N. Prevalence and incidence of carbapenem-resistant K. pneumoniae colonization: systematic review and meta-analysis. Syst reviews. 2022;11(1):1–15. Awoke T, Teka B, Seman A, Sebre S, Yeshitela B, Aseffa A, et al. High prevalence of multidrug-resistant klebsiella pneumoniae in a tertiary care hospital in Ethiopia. Antibiotics. 2021;10(8):1007. Mohd Asri NA, Ahmad S, Mohamud R, Mohd Hanafi N, Mohd Zaidi NF, Irekeola AA, et al. Global prevalence of nosocomial multidrug-resistant Klebsiella pneumoniae: a systematic review and meta-analysis. Antibiotics. 2021;10(12):1508. Sun K, Xu X, Yan J, Zhang L. Evaluation of six phenotypic methods for the detection of carbapenemases in Gram-negative bacteria with characterized resistance mechanisms. Annals Lab Med. 2017;37(4):305–12. Simner PJ, Johnson JK, Brasso WB, Anderson K, Lonsway DR, Pierce VM, et al. Multicenter evaluation of the modified carbapenem inactivation method and the Carba NP for detection of carbapenemase-producing Pseudomonas aeruginosa and Acinetobacter baumannii. J Clin Microbiol. 2018;56(1):01369–17. 10.1128/jcm . Zhou M, Wang D, Kudinha T, Yang Q, Yu S, Xu Y-C. Comparative evaluation of four phenotypic methods for detection of class A and B carbapenemase-producing Enterobacteriaceae in China. J Clin Microbiol. 2018;56(8). 10.1128/jcm . 00395 – 18. Ramadan Mohamed E, Ali MY, Waly NG, Halby HM, Abd El-Baky RM. The Inc FII plasmid and its contribution in the transmission of blaNDM-1 and blaKPC-2 in Klebsiella pneumoniae in Egypt. Antibiotics. 2019;8(4):266. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3998636","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":282684156,"identity":"01b805c7-14ef-4ee7-932f-3240ae65d729","order_by":0,"name":"Darya Mohammadpour","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Darya","middleName":"","lastName":"Mohammadpour","suffix":""},{"id":282684157,"identity":"7f4ed9ef-34f1-4a6a-8e3e-5ddd396897fb","order_by":1,"name":"Mohammad Yousef Memar","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"Yousef","lastName":"Memar","suffix":""},{"id":282684158,"identity":"8bc64dd9-f788-401d-9fa6-d83d362dcd3c","order_by":2,"name":"Hossein Samadi Kafil","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Hossein","middleName":"Samadi","lastName":"Kafil","suffix":""},{"id":282684159,"identity":"064b2ae5-8283-484c-9802-d5527d75c6f3","order_by":3,"name":"Alka Hasani","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Alka","middleName":"","lastName":"Hasani","suffix":""},{"id":282684160,"identity":"bc2f58db-54ff-45db-94fc-4af3af46bd9f","order_by":4,"name":"Mohammad Ahangarzadeh Rezaee","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"Ahangarzadeh","lastName":"Rezaee","suffix":""},{"id":282684161,"identity":"01a8ab3c-d8ed-46de-acd6-bdc87451f819","order_by":5,"name":"Anahita Ghotaslou","email":"","orcid":"","institution":"Medipol University","correspondingAuthor":false,"prefix":"","firstName":"Anahita","middleName":"","lastName":"Ghotaslou","suffix":""},{"id":282684162,"identity":"1ea9a07d-8bc1-40f0-9ab0-27fbadeba39f","order_by":6,"name":"Hamed Ebrahimzadeh Leylabadlo","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Hamed","middleName":"Ebrahimzadeh","lastName":"Leylabadlo","suffix":""},{"id":282684163,"identity":"8afe25fb-acb2-486c-a10c-dc0137493ec7","order_by":7,"name":"Edris Nabizadeh","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Edris","middleName":"","lastName":"Nabizadeh","suffix":""},{"id":282684164,"identity":"41feb60a-c857-429e-9f80-a13929d024ab","order_by":8,"name":"Hiva Kadkhoda","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Hiva","middleName":"","lastName":"Kadkhoda","suffix":""},{"id":282684165,"identity":"16aba3c3-18b0-4cf7-a842-6b66ca9fc600","order_by":9,"name":"Reza Ghotaslou","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3UlEQVRIiWNgGAWjYDADPgbmAwyMDcQqP5DAwMDGwJZAshYeA+K0mPcfv/j44w87ezb2nm8SP3fYyDGwHz66AZ8WmQNnig0OJCQntvGc3SbZeybNmIEnLe0GPi0SjD1pEgcSmBPYJHK3SfC2HU5skOAxw6+FmQekpd6eTSLnmeRforSwsR8DajnM2CaRwyZNnC08PMwGZ9KOA/1yzNhati3NmI2gX/iPP3xQYVNtz8/e/PDm2zYbOX72w8fwamEARQcUsEiASDb8ykGA/QGMxfyBsOpRMApGwSgYiQAAdYdGg4u3hh8AAAAASUVORK5CYII=","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Reza","middleName":"","lastName":"Ghotaslou","suffix":""}],"badges":[],"createdAt":"2024-02-29 05:32:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3998636/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3998636/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":53493000,"identity":"cc02fb73-0b04-46d3-8b8b-99ae36048c0f","added_by":"auto","created_at":"2024-03-26 16:02:13","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":314801,"visible":true,"origin":"","legend":"\u003cp\u003eThe rate of resistance to tested antibiotics among \u003cem\u003eK. pneumoniae\u003c/em\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3998636/v1/a312b3bd367e32ed6cdcb266.png"},{"id":53492463,"identity":"6d715592-3950-4e13-becd-3f424494e91a","added_by":"auto","created_at":"2024-03-26 15:53:23","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":22959,"visible":true,"origin":"","legend":"\u003cp\u003eThe isolates 1, 2, 3 and 4 that produce the carbapenemase enzyme by mCIM method\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3998636/v1/0ea44fa719a17127bb1fecf5.jpg"},{"id":53492464,"identity":"bfdf1ba0-0d2e-40c0-9c16-6ae54a9cd8d2","added_by":"auto","created_at":"2024-03-26 15:53:23","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":108475,"visible":true,"origin":"","legend":"\u003cp\u003eGel electrophoresis of the PCR products, A,\u003csub\u003e \u003c/sub\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eOxa-48\u003c/em\u003e\u003c/sub\u003e, B, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eNDM\u003c/em\u003e\u003c/sub\u003e, C, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eIMP\u003c/em\u003e\u003c/sub\u003e, D, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eVIM\u003c/em\u003e\u003c/sub\u003e, and E, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eKPC-2\u003c/em\u003e\u003c/sub\u003e. Positive and negative controls for each gene are indicated by + and - symbols.\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3998636/v1/20b86f4e9551741b70737923.jpg"},{"id":56845396,"identity":"69026256-4aab-4775-be03-4cfda39fe7b4","added_by":"auto","created_at":"2024-05-21 07:55:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":869735,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3998636/v1/01dea825-ac42-4e1a-91bf-bc589569ae70.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Detection of carbapenemases activity in MDR isolates of Klebsiella pneumoniae by mCIM method and carbapenem resistance genes blaVIM, blaIMP, blaNDM, blaKPC-2 and blaOXA-48","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003e \u003cem\u003eKlebsiella pneumoniae (K. pneumoniae)\u003c/em\u003e is a Gram-negative, non-motile, encapsulated, lactose-fermenting, facultative anaerobic, rod-shaped bacterium and is a member of \u003cem\u003eEnterobacteriaceae\u003c/em\u003e (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). \u003cem\u003eK. pneumoniae\u003c/em\u003e is an opportunistic bacterium that can cause various infections and can increase the mortality in immunocompromised patients (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Infections caused by \u003cem\u003eK. pneumoniae\u003c/em\u003e include pneumonia, liver abscess, urinary tract infections (UTI), skin, and systemic infections (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). Antibiotics such as cephalosporins are usually used to treat \u003cem\u003eK. pneumoniae\u003c/em\u003e infections. However, the resistance of this bacterium to cephalosporins has been reported. For this reason, alternative antibiotics such as carbapenem are used as the last line of \u003cem\u003eK. pneumoniae\u003c/em\u003e treatment (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Carbapenems are a group of broad-spectrum beta-lactams and they are usually used to treat infections caused by pathogens that show high antibiotic resistance (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Although, in recent years, \u003cem\u003eK. pneumoniae\u003c/em\u003e strains have become resistant to carbapenems. This bacterium becomes resistant to carbapenems through various mechanisms, including a) enzymatic hydrolysis of carbapenem by producing carbapenemase enzymes (\u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eVIM\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eIMP\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eNDM\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eKPC\u0026minus;2\u003c/em\u003e\u003c/sub\u003e, and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eOXA\u0026minus;48\u003c/em\u003e\u003c/sub\u003e genes are included in this category), b) expression of efflux pumps, c) reduction of outer membrane permeability through mutation in ompK35 and ompK36 porins (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). The resistance of this bacterium to carbapenems can cause multidrug-resistant (MDR) isolates. MDR bacteria are microorganisms that show resistance to three different classes of antibiotics, and the observation of such strains, especially \u003cem\u003eK. pneumoniae\u003c/em\u003e, can be considered a therapeutic warning (\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Rapid and accurate detection of MDR \u003cem\u003eK. pneumoniae\u003c/em\u003e strains can help in the treatment of patients with \u003cem\u003eK. pneumoniae\u003c/em\u003e infections and reduce mortality. Also, rapid detection of MDR \u003cem\u003eK. pneumoniae\u003c/em\u003e can prevent the spread of resistant strains (\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). The present study aims to investigate the rate of MDR \u003cem\u003eK. pneumoniae\u003c/em\u003e and the evaluation of \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates resistant to carbapenem in northwest Iran (Tabriz).\u003c/p\u003e"},{"header":"2. Materials and Methods ","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Specimens\u003c/h2\u003e \u003cp\u003eIn this cross-sectional study, performed from November 2022 to April 2023, 205 \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates were collected from Imam Reza and Sina hospitals in Tabriz. To identify the \u003cem\u003eK. pneumonia\u003c/em\u003e, Gram staining and biochemical tests including triple sugar iron (TSI), sulfur, indole, motility (SIM), Simmons citrate, acid production from glucose, maltose, and saccharose, and urease tests were used.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Antimicrobial Susceptibility Testing\u003c/h2\u003e \u003cp\u003eTo determine antibiotic susceptibility, the disk diffusion method was performed according to the Clinical \u0026amp; Laboratory Standards Institute (CLSI). For this purpose, a bacterial suspension with a turbidity of 0.5 McFarland was prepared and then inoculated on the Mueller-Hinton agar (MHA) (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). The disks of antibiotics including Meropenem (10 \u0026micro;g), Ciprofloxcacin (5 \u0026micro;g), Gentamicin (10 \u0026micro;g), Pipracillin-Tazobactam (110\u0026micro;g), Aztreonam (30 \u0026micro;g), Ceftazidime (30 \u0026micro;g), Amikacin (30 \u0026micro;g), Trimethoprim sulfamethoxazole (25 \u0026micro;g), Cefotaxim (30 \u0026micro;g) were used (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). All antibiotic disks were provided by Mast Ltd, England. The plates were incubated at 37\u0026deg;C for 24h. The results were interpreted using the CLSI breakpoints. The results of antibiotic susceptibility testing were validated using the control strain of \u003cem\u003eK. pneumoniae\u003c/em\u003e ATCC13883 (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e) ( Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Modified Carbapenem Inactivation Method (mCIM(\u003c/h2\u003e \u003cp\u003eTo perform mCIM, 2 mL of Tryptic soy broth (TSB) medium was added into a tube, and then a full loop of \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates grown on the MHA medium was added to the TSB and then a disk of meropenem 10\u0026micro;g antibiotic inside the medium (the tube were incubated at 37\u0026deg;C for 4 h) (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Then, the disk is removed from the suspension and placed onto MHA plate seeded with a suspension of a carbapenem-susceptible indicator organism (\u003cem\u003eE. coli\u003c/em\u003e ATCC 25922); following overnight incubation, the zone of inhibition is measured to determine whether the MEM had been hydrolyzed (growth of the indicator organism close to the disk), or is still active (a large zone of inhibition around the disk) (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e) .Growth of the indicator organism close to the disk 6 to 15 mm is a positive result of the mCIM (the ability of the bacteria to produce carbapenemase, which inactivates the meropenem disk, and as a result, the bacteria can grow around the meropenem disk), growth of the indicator organism at a distance of 16 to 18 mm as an intermediate result of the mCIM (need for further testing to determine the presence or absence of carbapenemase production) and growth of the indicator organism within \u0026ge;\u0026thinsp;19 mm of the disk as a negative result of the mCIM (inability to produce carbapenemase by bacteria) will be considered (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Polymerase Chain Reaction (PCR)\u003c/h2\u003e \u003cp\u003eDNA was extracted from bacterial colonies growing on the MHA by using the lysis buffer method. The specific amplification primers used for PCR and the temperature of denaturation, annealing, and extension of each gene are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. PCR was performed in the reactions with a final volume of 20 \u0026micro;L including 10 \u0026micro;L of master mix 1X containing Taq DNA polymerase, MgCl2, and dNTPs (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Amplification reactions were conducted in a Bio-Rad thermocycler. Isolates of \u003cem\u003eK. pneumoniae\u003c/em\u003e that were previously confirmed for the presence of various resistance genes were used as positive controls and isolates that were negative for the presence of genes were used as negative controls in PCR reactions (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). The PCR products were resolved using the gel electrophoresis on 1% agarose gels in 0.5\u0026times; TBE buffer. The gels were stained with DNA-safe stain and were visualized under ultraviolet light. The sizes of the PCR products were determined by comparison with a molecular size marker (50 bp DNA ladder) (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e) ( Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences and amplification reaction details for each gene\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAmplification reactions\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAmplification reactions cycles\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePCR product size (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePrimers sequences [5'-3']\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eOxa\u0026minus;48\u003c/em\u003e\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDenaturation: 95\u003csup\u003e⸰\u003c/sup\u003e C, 30 s\u003c/p\u003e \u003cp\u003eAnnealing: 52\u003csup\u003e⸰\u003c/sup\u003e C, 30 s\u003c/p\u003e \u003cp\u003eExtension: 72\u003csup\u003e⸰\u003c/sup\u003e C, 1 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e438\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF: GCGTGGTTAAGGATGAACAC\u003c/p\u003e \u003cp\u003eR: CATCAAGTTCAACCCAACCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eNDM\u003c/em\u003e\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDenaturation: 95\u003csup\u003e⸰\u003c/sup\u003e C, 30s\u003c/p\u003e \u003cp\u003eAnnealing: 53\u003csup\u003e⸰\u003c/sup\u003e C, 30 s\u003c/p\u003e \u003cp\u003eExtension: 72\u003csup\u003e⸰\u003c/sup\u003e C, 1 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e621\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF: GGTTTGGCGATCTGGTTTTC\u003c/p\u003e \u003cp\u003eR: CGGAATGGCTCATCACGATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eIMP\u003c/em\u003e\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDenaturation: 95\u003csup\u003e⸰\u003c/sup\u003e C, 30 s\u003c/p\u003e \u003cp\u003eAnnealing: 54\u003csup\u003e⸰\u003c/sup\u003e C, 45 s\u003c/p\u003e \u003cp\u003eExtension: 72\u003csup\u003e⸰\u003c/sup\u003e C, 1 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e233\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF: GGAATAGAGTGGCTTAAYTCTC\u003c/p\u003e \u003cp\u003eR: GGTTTAAYAAAACAACCACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eVIM\u003c/em\u003e\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDenaturation: 95\u003csup\u003e⸰\u003c/sup\u003e C, 30 s\u003c/p\u003e \u003cp\u003eAnnealing: 60\u003csup\u003e⸰\u003c/sup\u003e C, 30 s\u003c/p\u003e \u003cp\u003eExtension: 72\u003csup\u003e⸰\u003c/sup\u003e C, 1 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e390\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF: GATGGTGTTTGGTCGCATA\u003c/p\u003e \u003cp\u003eR: CGAATGCGCAGCACCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eKPC\u0026minus;2\u003c/em\u003e\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDenaturation: 95\u003csup\u003e⸰\u003c/sup\u003e C, 30 s\u003c/p\u003e \u003cp\u003eAnnealing: 55\u003csup\u003e⸰\u003c/sup\u003e C, 45 s\u003c/p\u003e \u003cp\u003eExtension: 72\u003csup\u003e⸰\u003c/sup\u003e C, 1 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e798\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF: CGTCTAGTTCTGCTGTCTTG\u003c/p\u003e \u003cp\u003eR: CTTGTCATCCTTGTTAGGCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003es: seconds; min: minutes.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Statistical Method\u003c/h2\u003e \u003cp\u003eThe sample size was determined based on an expected frequency (a priori estimate of frequency according to a pilot study result), an accepted error of 4% (required precision of the estimate), and a 95% level of confidence. The results were analyzed by SPSS.ver 26 software. Fisher\u0026rsquo;s exact test or Chi-square was applied to evaluate the association between the presence of various genes with resistance to antibiotics. P values\u0026thinsp;\u0026le;\u0026thinsp;0.05 were considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cp\u003eThe samples isolated from various wards including Internal (38%), ICU (34%), Infectious (11%), Surgery (9%), and Emergency (8%). Among the 205 \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates, 100 isolates were MDR (48.8%) and these MDR isolates showed resistance to different families of antibiotics. The rate of resistance to antibiotics was shown in the Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The highest frequency of resistance was due to ciprofloxacin at 97% and the lowest frequency of resistance was due to amikacin at 72%. The mCIM test results showed that among the 100 MDR \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates, 80 samples (%80) were resistant to carbapenem with carbapenemase production (mCIM positive). Among 80 carbapenem-resistant isolates (mCIM positive), \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eOXA\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eNDM\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eIMP\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eVIM\u003c/em\u003e\u003c/sub\u003e, and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eKPC\u0026minus;2\u003c/em\u003e\u003c/sub\u003e genes were observed in 52 (65%), 23 (28.7%), 12 (15%), 8 (10%), and 5 (6.25%) of isolates, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). There was a significant relationship between antibiotic resistance to carbapenem and the presence of the \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eOXA\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eNDM\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eIMP\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eVIM\u003c/em\u003e\u003c/sub\u003e, and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eKPC\u0026minus;2\u003c/em\u003e\u003c/sub\u003e genes (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003e \u003cem\u003eK. pneumoniae\u003c/em\u003e is a widespread and opportunistic human pathogen that has become a major cause of hospital-acquired infections in recent decades. The management of antimicrobial resistance in multidrug-resistant \u003cem\u003eK. pneumoniae\u003c/em\u003e is a major challenge for clinicians. The optimal treatment option for infections is not yet well established. Combined treatments with imipenem, colistin, fosfomycin, and tigecycline and high-dose aminoglycosides are widely used and usually lead to suboptimal results. Resistance to carbapenems, as a last-resort to treat infections caused by CRE is a major health concern. The increase in CRE is a serious issue due to the high mortality rate (\u0026gt;\u0026thinsp;30%). Research on the mechanisms of CRE is an essential step in planning a national public health strategy for this emerging pathogen (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). In the present study, the carbapenem-resistant \u003cem\u003eK. pneumoniae\u003c/em\u003e (CRKP0 rate was 48.8% Most of the CRKP colonization is from the Asian continent, mainly in China and India, with a frequency of 1.4%. The frequency of CRKP in Europe was 1.2%, 0.3% in the Americas, and 0.07% in Africa. Only two studies have reported colonization with CRKP in Africa, from Egypt and Morocco (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). This picture may not represent the practical scenario as most countries, especially Africa and America have no data on colonization with CRKP. Though higher prevalence is reported in China and India, there is still variation within those countries\u0026rsquo; reports. In China, the prevalence report ranges from 1 to 21%, and also in India, it ranges from 1 to 22%. The pooled prevalence of CRKP for the Asian continent is 4.56%. Similarly, reports from Italy show variation in the prevalence rate from 2 to 9%, with a 6.16% pooled estimate of prevalence for Europe. This finding indicates that there is no uniform distribution of colonization in different localities even within a country (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn addition, due to its high prevalence, CRKP has the ability to cause a wide range of clinical infections and the simultaneous resistance to more than three antibiotics (MDR) poses the greatest risk to public health. Understanding the antibiotic susceptibility patterns of MDR and CRKP is important for the antibiotic treatment of infections caused by this bacterium. \u003cem\u003eK. pneumoniae\u003c/em\u003e poses an urgent public health threat because it has been detected to develop resistance to antimicrobials more than most bacteria and emergence of MDR strains associated with hospital outbreaks. MDR strains are being increasingly reported from different countries (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). It has added attention worldwide, especially in developed countries, due to its high drug resistance. Antimicrobial resistance rates in \u003cem\u003eK. pneumoniae\u003c/em\u003e have steadily increased over the years, and \u003cem\u003eK. pneumoniae\u003c/em\u003e is becoming resistant to almost all aminoglycosides, quinolones, and β-lactams (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). In the current study, we found MDR in 48.8%. According to a systematic review and meta-analysis published in 2021, the global prevalence of nosocomial MDR \u003cem\u003eK. pneumoniae\u003c/em\u003e was estimated at 32.8%. However, the prevalence of MDR \u003cem\u003eK. pneumoniae\u003c/em\u003e varies geographically and has become a significant concern around the world. In Southeastern Asia, the pooled prevalence for MDR \u003cem\u003eK. pneumoniae\u003c/em\u003e was estimated at 55% and 27%, respectively. In a study conducted in a hospital setting in Saudi Arabia, the prevalence of MDR \u003cem\u003eK. pneumoniae\u003c/em\u003e pattern was found to be at 66.8%. In a Brazilian ICU wards, most of \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates (84%) were classified as MDR (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). For instance, at the European level, more than one-third (36.6%) of \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates reported to the European antimicrobial resistance surveillance network for 2019 were resistant to at least one of the antimicrobial groups under regular surveillance, fluoroquinolones, third-generation cephalosporins, aminoglycosides, and carbapenems. The Ethiopian annual antimicrobial surveillance report showed that 95.8% of \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates were resistance to ceftriaxone, 86.7% to ceftazidime, 95.6% to trimethoprim-sulfamethoxazole, 83.3% to cefepime, 62.7% to gentamicin, 48.1% to ciprofloxacin, 30.6% to meropenem, and 7.2% to amikacin (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThese findings can be attributed to the difference in the characteristics of different types of carbapenemase, geographical area and the use of antibiotics.\u003c/p\u003e \u003cp\u003eInvestigating on the carbapenem resistance mechanisms in bacteria is very important, but current studies of the resistance mechanism focus often on the carbapenemase enzyme production. In the present study, carbapenem resistance by producing carbapenemase enzyme was investigated.\u003c/p\u003e \u003cp\u003eIn this research, among the 205 \u003cem\u003eK. pneumoniae\u003c/em\u003e samples collected, 100 samples were MDR and resistant to carbapenems. Also, among 100 MDR isolates, 80 isolates were mCIM positive, meaning the ability to produce carbapenemase. Furthermore, other isolates (%20) were resistant to carbapenem while their mCIM test was negative, which means these bacteria are resistant to carbapenems using the efflux pump mechanism or porin modification of the outer membrane. The mCIM assay can detect carbapenemase production in CRKP as a rapid phenotypic method with high sensitivity and specificity, which is consistent with studies (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). In this study, mCIM was used as a sensitive and rapid phenotypic method to identify carbapenemase in CRKP isolates. This study agrees with previous findings that mCIM as a rapid and cost-effective phenotypic method with high sensitivity and specificity (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe presence of five carbapenemase genes was investigated in 80 isolates. Also 52 isolates for bla\u003csub\u003eOXA-48\u003c/sub\u003e ,23 isolates for \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eNDM\u003c/em\u003e\u003c/sub\u003e, 12 isolates for \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eIMP\u003c/em\u003e\u003c/sub\u003e, 8 isolates for \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eVIM\u003c/em\u003e\u003c/sub\u003e and 5 isolates for \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eKPC-2\u003c/em\u003e\u003c/sub\u003e were positive, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eOXA\u003c/em\u003e-48\u003c/sub\u003e like was the most common gene in \u003cem\u003eK. pneumoniae.\u003c/em\u003e This is consistent with previous studies that reported that the common genes in carbapenemase production were \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eoxa-48\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eNDM\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eIMP\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eVIM\u003c/em\u003e\u003c/sub\u003e, and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eKPC-2\u003c/em\u003e\u003c/sub\u003e. These findings are also consistent with other results obtained by previous studies (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). In our study, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eVIM\u003c/em\u003e\u003c/sub\u003e and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eKPC-2\u003c/em\u003e\u003c/sub\u003e were the least abundant, which is consistent with other reported results (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). The reason for the difference in frequency genes in carbapenem-resistant \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates in each region can be caused by geographical differences, national care policies, the antibiotic patterns used, sample size, compliance with laboratory standards, identification methods, and the population.\u003c/p\u003e \u003cp\u003eThe weakness of this study may be the inability to distinguish metallobetalactamase types of serine carbapenemase by mCIM method. We showed mCIM as a simple and chip phenotypic method with high appropriate sensitivity and specificity in identifying carbapenem-resistant \u003cem\u003eK. pneumoniae\u003c/em\u003e. Considering the effect of regional characteristics on the susceptibility patterns, the results of this study can be used in the control, detection and treatment of these isolates.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eAccording to the present study, the resistance rate of \u003cem\u003eK. pneumoniae\u003c/em\u003e to carbapenem is high. To manage CRKP infections and reduce mortality, a rapid and accurate assay is suggested. We recommend the mCIM method in developing countries to identify carbapenemase production.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are grateful to our dear expert colleagues in the laboratory: Mrs. Yazdan Parast, Mrs. Yagoubi, Mrs. Abdullahi, and Mr. Lelahzadeh.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe financial resources of this study were provided by Tabriz University of Medical Sciences, Iran.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe (all of authors) have no conflict interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the research ethics committee\u003cspan dir=\"RTL\"\u003e)\u003c/span\u003e IR.TBZMED.REC.1402.027 \u003cspan dir=\"RTL\"\u003e(\u003c/span\u003eat Tabriz University of Medical Sciences, Tabriz, Iran.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and content (transparency of data):\u003c/strong\u003e All data and content in this article are transparent and accessible.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCode availability\u003c/strong\u003e (Software program or custom code):\u0026nbsp;\u0026apos;Not applicable\u0026apos;.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e (including appropriate statements): This article and all the contents and data of this study can be published with the consent of all authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors made substantial contributions to conception and design, acquisition of data, or analysis and interpretation of data. Participated in drafting the article or revising it critically for important intellectual content. issued final approval of the published version and agree to be accountable for all aspects of the work. Concept and design of the study: Darya Mohammadpour, Mohammad Youssef Memar, Reza Ghotaslou. Data collection and sampling: Darya Mohammadpour, Reza Ghotaslou, Hossein Samadi Kefil, Alka Hosni, Mohammad Ahangarzadeh Rezaei, Hivakdkhoda. Data analysis and interpretation: Darya Mohammadpour, Mohammad Yusuf Memar, Idris Nabizadeh. Preparation of the main draft: Darya Mohammadpour, Mohammad Youssef Memar, Reza Ghotaslou, Hamed Ebrahimzadeh. Review and editing: Mohammad Youssef Memar, Reza Ghotaslou. Study supervision: Reza Ghotaslou.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eHansen GT. Continuous evolution: perspective on the epidemiology of carbapenemase resistance among Enterobacterales and other Gram-negative bacteria. Infect Dis therapy. 2021;10:75\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlTamimi M, AlSalamah A, AlKhulaifi M, AlAjlan H. Comparison of phenotypic and PCR methods for detection of carbapenemases production by Enterobacteriaceae. Saudi J Biol Sci. 2017;24(1):155\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao X, Xu X, Zhang Z, Shen H, Chen J, Zhang K. Molecular characterization of clinical multidrug-resistant Klebsiella pneumoniae isolates. Ann Clin Microbiol Antimicrob. 2014;13(1):1\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePalmeiro JK, De Souza RF, Sch\u0026ouml;rner MA, Passarelli-Araujo H, Grazziotin AL, Vidal NM, et al. Molecular epidemiology of multidrug-resistant Klebsiella pneumoniae isolates in a Brazilian tertiary hospital. Front Microbiol. 2019;10:1669.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCodjoe FS, Donkor ES. Carbapenem resistance: a review. Med Sci. 2017;6(1):1.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLing W, Furuya-Kanamori L, Ezure Y, Harris PN, Paterson DL. Adverse clinical outcomes associated with infections by Enterobacterales producing ESBL (ESBL-E): a systematic review and meta-analysis. JAC-antimicrobial Resist. 2021;3(2):dlab068.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLogan LK, Weinstein RA. The epidemiology of carbapenem-resistant Enterobacteriaceae: the impact and evolution of a global menace. J Infect Dis. 2017;215(suppl1):S28\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlizadeh N, Ahangarzadeh Rezaee M, Samadi Kafil H, Hasani A, Soroush Barhaghi MH, Milani M et al. Evaluation of resistance mechanisms in carbapenem-resistant Enterobacteriaceae. Infect Drug Resist. 2020:1377\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAurilio C, Sansone P, Barbarisi M, Pota V, Giaccari LG, Coppolino F, et al. Mechanisms of action of carbapenem resistance. Antibiotics. 2022;11(3):421.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYekani M, Rezaee MA, Beheshtirouy S, Baghi HB, Bazmani A, Farzinazar A, et al. Carbapenem resistance in Bacteroides fragilis: A review of molecular mechanisms. Anaerobe. 2022;76:102606.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuay-Garc\u0026iacute;a B, P\u0026eacute;rez-Gracia MT. Present and future of carbapenem-resistant Enterobacteriaceae infections. Advances in clinical immunology, medical microbiology, COVID-19, and big data. 2021:435\u0026thinsp;\u0026ndash;\u0026thinsp;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWyres KL, Holt KE. Klebsiella pneumoniae as a key trafficker of drug resistance genes from environmental to clinically important bacteria. Curr Opin Microbiol. 2018;45:131\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGandor NHM, Amr GE-S, Eldin Algammal SMS, Ahmed AA. Characterization of carbapenem-resistant k. pneumoniae isolated from intensive care units of zagazig university hospitals. Antibiotics. 2022;11(8):1108.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEffah CY, Sun T, Liu S, Wu Y. Klebsiella pneumoniae: an increasing threat to public health. Ann Clin Microbiol Antimicrob. 2020;19(1):1\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan Duin D, Doi Y. The global epidemiology of carbapenemase-producing Enterobacteriaceae. Virulence. 2017;8(4):460\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBonnin RA, Emeraud C, Jousset AB, Naas T, Dortet L. Comparison of disk diffusion, MIC test strip and broth microdilution methods for cefiderocol susceptibility testing on carbapenem-resistant Enterobacterales. Clin Microbiol Infect. 2022;28(8):1156. e1-. e5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakamura-Silva R, Cerdeira L, Oliveira-Silva M, da Costa KRC, Sano E, Fuga B, et al. Multidrug-resistant Klebsiella pneumoniae: a retrospective study in Manaus, Brazil. Arch Microbiol. 2022;204(4):202.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoradigaravand D, Martin V, Peacock SJ, Parkhill J. Evolution and epidemiology of multidrug-resistant Klebsiella pneumoniae in the United Kingdom and Ireland. MBio. 2017;8(1):01976\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/mbio\u003c/span\u003e\u003cspan address=\"10.1128/mbio\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDing L, Shi Q, Han R, Yin D, Wu S, Yang Y, et al. Comparison of four carbapenemase detection methods for bla KPC-2 variants. Microbiol Spectr. 2021;9(3):e00954\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Li C, Cai X, Shi J, Feng L, Tang K et al. Performance of modified carbapenem inactivation method and inhibitor-based combined disk test in the detection and distinguishing of carbapenemase producing Enterobacteriaceae. Annals Translational Med. 2019;7(20).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePierce VM, Simner PJ, Lonsway DR, Roe-Carpenter DE, Johnson JK, Brasso WB, et al. Modified carbapenem inactivation method for phenotypic detection of carbapenemase production among Enterobacteriaceae. J Clin Microbiol. 2017;55(8):2321\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTamma PD, Simner PJ. Phenotypic detection of carbapenemase-producing organisms from clinical isolates. J Clin Microbiol. 2018;56(11):01140\u0026ndash;18. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/jcm\u003c/span\u003e\u003cspan address=\"10.1128/jcm\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsai Y-M, Wang S, Chiu H-C, Kao C-Y, Wen L-L. Combination of modified carbapenem inactivation method (mCIM) and EDTA-CIM (eCIM) for phenotypic detection of carbapenemase-producing Enterobacteriaceae. BMC Microbiol. 2020;20(1):1\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLou T, Du X, Zhang P, Shi Q, Han X, Lan P, et al. Risk factors for infection and mortality caused by carbapenem-resistant Klebsiella pneumoniae: A large multicentre case\u0026ndash;control and cohort study. J Infect. 2022;84(5):637\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTesfa T, Mitiku H, Edae M, Assefa N. Prevalence and incidence of carbapenem-resistant K. pneumoniae colonization: systematic review and meta-analysis. Syst reviews. 2022;11(1):1\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAwoke T, Teka B, Seman A, Sebre S, Yeshitela B, Aseffa A, et al. High prevalence of multidrug-resistant klebsiella pneumoniae in a tertiary care hospital in Ethiopia. Antibiotics. 2021;10(8):1007.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohd Asri NA, Ahmad S, Mohamud R, Mohd Hanafi N, Mohd Zaidi NF, Irekeola AA, et al. Global prevalence of nosocomial multidrug-resistant Klebsiella pneumoniae: a systematic review and meta-analysis. Antibiotics. 2021;10(12):1508.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun K, Xu X, Yan J, Zhang L. Evaluation of six phenotypic methods for the detection of carbapenemases in Gram-negative bacteria with characterized resistance mechanisms. Annals Lab Med. 2017;37(4):305\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSimner PJ, Johnson JK, Brasso WB, Anderson K, Lonsway DR, Pierce VM, et al. Multicenter evaluation of the modified carbapenem inactivation method and the Carba NP for detection of carbapenemase-producing Pseudomonas aeruginosa and Acinetobacter baumannii. J Clin Microbiol. 2018;56(1):01369\u0026ndash;17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/jcm\u003c/span\u003e\u003cspan address=\"10.1128/jcm\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou M, Wang D, Kudinha T, Yang Q, Yu S, Xu Y-C. Comparative evaluation of four phenotypic methods for detection of class A and B carbapenemase-producing Enterobacteriaceae in China. J Clin Microbiol. 2018;56(8). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/jcm\u003c/span\u003e\u003cspan address=\"10.1128/jcm\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. 00395\u0026thinsp;\u0026ndash;\u0026thinsp;18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamadan Mohamed E, Ali MY, Waly NG, Halby HM, Abd El-Baky RM. The Inc FII plasmid and its contribution in the transmission of blaNDM-1 and blaKPC-2 in Klebsiella pneumoniae in Egypt. Antibiotics. 2019;8(4):266.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"K. pneumonia, MDR, carbapenemase, phenotypic method, genotypic method","lastPublishedDoi":"10.21203/rs.3.rs-3998636/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3998636/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e (\u003cem\u003eK. pneumoniae\u003c/em\u003e) is a Gram-negative, opportunistic bacterium that can cause a variety of infections. Antibiotics such as cephalosporins are usually used to treat \u003cem\u003eK. pneumoniae\u003c/em\u003e infections. However, resistance of this bacterium to cephalosporins has been reported. For this reason, alternative antibiotics such as carbapenems are used as the last line of treatment for \u003cem\u003eK. pneumoniae\u003c/em\u003e. This bacterium becomes resistant to carbapenems by various mechanisms, including enzymatic hydrolysis of carbapenems by producing carbapenemase enzymes (\u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eVIM\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eIMP\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eNDM\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eKPC\u0026minus;2\u003c/em\u003e\u003c/sub\u003e and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eOXA\u0026minus;48\u003c/em\u003e\u003c/sub\u003e genes produce the hydrolysis enzyme). The present study aims to investigate the prevalence rate of MDR \u003cem\u003eK. pneumoniae\u003c/em\u003e and the evaluation of resistant isolates to carbapenem was done using phenotypic and genotypic methods. In the present study, 205 \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates were collected from patients admitted to the Hospitals of Tabriz University of Medical Sciences from November 2022 to April 2023. Antibiotic susceptibility patterns were determined by disc diffusion method and resistance genes of \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eVIM\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eIMP\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eNDM\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eKPC\u0026minus;2\u003c/em\u003e\u003c/sub\u003e and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eOXA\u0026minus;48\u003c/em\u003e\u003c/sub\u003e were detected by PCR method. Out of 205 samples collected from \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates, 100 samples were multidrug resistant (MDR). Of the 100 MDR \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates, 80 samples (%80) were resistant to carbapenems by mCIM method. The frequencies of the \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eOXA\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eNDM\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eIMP\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eVIM\u003c/em\u003e\u003c/sub\u003e and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eKPC\u0026minus;2\u003c/em\u003e\u003c/sub\u003e genes were 52 (65%), 23(28.7%), 12 (15%), 8 (10%) and 5 (6.25%), respectively. Antimicrobial resistance was common and worrying, and rapid and accurate detection of MDR \u003cem\u003eK. pneumoniae\u003c/em\u003e isolates can help in the management of patients with \u003cem\u003eK. pneumoniae\u003c/em\u003e infections and reduce mortality. Rapid detection of MDR \u003cem\u003eK. pneumoniae\u003c/em\u003e can also prevent the spread of resistant isolates.\u003c/p\u003e","manuscriptTitle":"Detection of carbapenemases activity in MDR isolates of Klebsiella pneumoniae by mCIM method and carbapenem resistance genes blaVIM, blaIMP, blaNDM, blaKPC-2 and blaOXA-48","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-26 15:53:19","doi":"10.21203/rs.3.rs-3998636/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6ba290d1-9282-4419-b9f8-de168379a5c1","owner":[],"postedDate":"March 26th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-05-21T07:47:29+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-26 15:53:19","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3998636","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3998636","identity":"rs-3998636","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.