Inhibition of the Long non-coding RNA ZFAS1 attenuates pathogenic ferroptosis by sponging miR-150-5p to activate CCND2 against diabetic cardiomyopathy

preprint OA: closed
Full text JSON View at publisher
AI-generated summary by claude@2026-07+body, 2026-07-05

Inhibition of lncRNA ZFAS1 reduced ferroptosis and attenuated diabetic cardiomyopathy by sponging miR-150-5p to activate CCND2.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-05 · read from full text

This preprint investigates whether inhibition of the long non-coding RNA ZFAS1 modulates ferroptosis in diabetic cardiomyopathy (DCM). The authors analyzed microarray datasets reporting higher ZFAS1 and lower miR-150-5p and CCND2, then used high-glucose-treated cardiomyocytes and db/db mice models with adenoviral ZFAS1/CCND2 manipulation and miR-150-5p mimic or control, assessing ferroptosis and apoptosis via multiple staining and protein/RNA assays; key experiments included dual luciferase reporter and RNA pull-down to support the ZFAS1–miR-150-5p–CCND2 regulatory axis. They report that ZFAS1 inhibition reduced collagen deposition, cardiomyocyte apoptosis, and ferroptosis and attenuated DCM progression in vitro and in vivo, with effects reversible by ZFAS1 re-expression. The main caveat stated is that the work is a preprint and not peer reviewed. The paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Background: Diabetic cardiomyopathy (DCM) needs to be responsible for the increasing morbidity and mortality in diabetic patients with heart failure. Unfortunately, the pathogenesis of DCM has yet to be elaborate. Here we investigate the important role of lncRNA-ZFAS1 in the pathological process of DCM associated with ferroptosis. Methods Microarray data analysis of DCM in the patients or mice model from GEO was presented that ZFAS1 was significantly upregulated, miR-150-5p and CCND2 were significantly downregulated. High glucose (HG)-treated cardiomyocytes and db/db mice were simulated DCM in vitro and in vivo . Ad-ZFAS1, Ad-sh-ZFAS1, mimic miR-150-5p, Ad-CCND2, Ad-sh-CCND2 were injected into mice model or transfected into HG-treated Cardiomyocytes to clarify whether ZFAS1 can regulate miR-150-5p and CCND2 on ferroptosis. Effect of ZFAS1 on the left ventricular myocardial tissues in db/db mice and HG-treated cardiomyocytes, ferroptosis and apoptosis was determined by Masson staining, immunohistochemical staining, western blot, MBB staining, immunofluorescence staining and JC-1staining. The relationship among ZFAS1, miR-150-5p, CCND2 was identified by dual luciferase reporter assay and RNA Pull-down assay. Results Inhibition of ZFAS1 led to the reduced collagen deposition, decreased cardiomyocytes apoptosis, ferroptosis and attenuated the DCM progress. ZFAS1 can sponge miR-150-5p to regulate CCND2 expression. Ad-sh-ZFAS1, miR-150-5p mimic and Ad-CCND2 transfection contributed to attenuate ferroptosis and DCM both in vitro and in vivo , while transfection Ad-ZFAS1could reverse the positive effect of miR-150-5p mimic and Ad-CCND2 both in vitro and in vivo. Conclusion lncRNA-ZFAS1 acted as a ceRNA to sponge miR-150-5p can regulate CCND2 to promote cardiomyocytes ferroptosis and developed DCM, and inhibition of ZFAS1 could be a promising therapeutic target for the treatment and prevention of DCM.
Full text 120,674 characters · extracted from preprint-html · click to expand
Inhibition of the Long non-coding RNA ZFAS1 attenuates pathogenic ferroptosis by sponging miR-150-5p to activate CCND2 against diabetic cardiomyopathy | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Original investigation Inhibition of the Long non-coding RNA ZFAS1 attenuates pathogenic ferroptosis by sponging miR-150-5p to activate CCND2 against diabetic cardiomyopathy Tingjuan Ni, Xiaorong Chen, Xingxiao Huang, Sunlei Pan, Zhongqiu Lu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-144450/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Diabetic cardiomyopathy (DCM) needs to be responsible for the increasing morbidity and mortality in diabetic patients with heart failure. Unfortunately, the pathogenesis of DCM has yet to be elaborate. Here we investigate the important role of lncRNA-ZFAS1 in the pathological process of DCM associated with ferroptosis. Methods Microarray data analysis of DCM in the patients or mice model from GEO was presented that ZFAS1 was significantly upregulated, miR-150-5p and CCND2 were significantly downregulated. High glucose (HG)-treated cardiomyocytes and db/db mice were simulated DCM in vitro and in vivo . Ad-ZFAS1, Ad-sh-ZFAS1, mimic miR-150-5p, Ad-CCND2, Ad-sh-CCND2 were injected into mice model or transfected into HG-treated Cardiomyocytes to clarify whether ZFAS1 can regulate miR-150-5p and CCND2 on ferroptosis. Effect of ZFAS1 on the left ventricular myocardial tissues in db/db mice and HG-treated cardiomyocytes, ferroptosis and apoptosis was determined by Masson staining, immunohistochemical staining, western blot, MBB staining, immunofluorescence staining and JC-1staining. The relationship among ZFAS1, miR-150-5p, CCND2 was identified by dual luciferase reporter assay and RNA Pull-down assay. Results Inhibition of ZFAS1 led to the reduced collagen deposition, decreased cardiomyocytes apoptosis, ferroptosis and attenuated the DCM progress. ZFAS1 can sponge miR-150-5p to regulate CCND2 expression. Ad-sh-ZFAS1, miR-150-5p mimic and Ad-CCND2 transfection contributed to attenuate ferroptosis and DCM both in vitro and in vivo , while transfection Ad-ZFAS1could reverse the positive effect of miR-150-5p mimic and Ad-CCND2 both in vitro and in vivo. Conclusion lncRNA-ZFAS1 acted as a ceRNA to sponge miR-150-5p can regulate CCND2 to promote cardiomyocytes ferroptosis and developed DCM, and inhibition of ZFAS1 could be a promising therapeutic target for the treatment and prevention of DCM. Cardiac & Cardiovascular Systems Critical Care & Emergency Medicine Endocrinology & Metabolism Diabetic cardiomyopathy lncRNA-ZFAS1 Ferroptosis miR-150-5p CCND2 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Diabetes makes patients vulnerable to a series of cardiovascular complications, one of the most serious progress is associated with the heart failure [ 1 , 2 ]. With the increasing of the incidence of diabetes (expected to reach 693 million by 2045 [ 3 ]), heart failure caused by diabetes has become a worldwide epidemic [ 4 , 5 ]. Indeed, diabetes accounts for 1/3 of patients with heart failure in clinical, and diabetes has always been an independent predictor of adverse outcomes [ 6 ]. Instead, DCM is currently recognized as a proximate cause of heart failure with a 4-5fold increase in the risk of heart failure among diabetic patients which firstly descripted by the Framingham Heart Study 5 decades ago [ 2 , 7 , 8 ]. Despite the extensive research attention in diabetic cardiomyopathy recently [ 9 ], however, the full spectrum of possible pathogenesis and their relative contribution to the heart failure phenotype in diabetes are still incompletely understood. The long noncoding ribonucleic acids (lncRNAs), non-coding RNA longer than 200 nucleotides in length, which participate in multiple biological processes, including cell metabolism, cell proliferation, cell fate determination, cell apoptosis and cell death, result in a variety of pathological conditions, such as cancer, Alzheimer’s disease, emerge evidence has shown that lncRNAs regulated cardiac diseases [ 10 – 13 ]. Cardiac-related lncRNA-ZFAS1 (zinc finger antisense 1) was proved to associate with acute myocardial infarction [ 14 – 17 ]. Nevertheless, the mechanism between lncRNA-ZFAS1 with diabetic cardiomyopathy is still lacking. One of lncRNAs’ significant function was action as competing endogenous RNAs (ceRNAs) to sponge macromolecules, such as micro-RNAs (miRNAs) and proteins [ 18 ], which associated with a range of physiological, biological and pathological processes, including cardiac diseases [ 19 , 20 ]. A clinical research demonstrated that miR-150-5p was significantly reduced in patients with heart failure, and represented an independent predictor of heart failure [ 21 ]. Furthermore, miR-150-5p could mitigate apoptosis in sepsis-induced myocardial depression [ 22 ], alleviate the progression of myocardial fibrosis [ 23 ], rescue cardiomyocytes from hypoxia-induced injury under the command of lncRNAs FOXD3-AS1 [ 24 ]. However, the role of miR-150-5p in diabetic cardiomyopathy and the relation with lncRNA-ZFAS1 have not been studied. Cyclin D2 (CCND2) could regulate the proliferation of cardiac myocytes [ 25 ], and is beneficial to the cardiac dysfunction [ 26 ], activates cell-cycle progression to enhance myocardial repair [ 27 ]. However, the role of CCND2 in diabetic cardiomyopathy have not been studied. Ferroptosis, an iron-dependent regulated necrosis associated with a new form of regulatory cell death firstly described in 2012 [ 28 ], which could induce the pathological process of cancer, stroke, cardiovascular disease, and kidney failure [ 29 , 30 ]. Glutathione peroxidase 4 (GPX4) could terminated the process of ferroptosis which involved in caspase and necrosomal complex [ 31 ]. Recent report has demonstrated that inhibiting ferroptosis could decrease mitochondrial iron to alleviate DOX-induced cardiac injury [ 32 ], but its role in diabetic cardiomyopathy remains to be explored. In this study, we used HG-treated cardiomyocytes and db/db mice to simulate DCM in vitro and in vivo and investigated the identification of lncRNA-ZFAS1, which is upregulated during DCM, and show that inhibition of ZFAS1 alleviate the development of DCM by reducing ferroptosis via stabilizing miR-150-5p to activate CCND2. Research Design And Methods Ethics and Animal Experiments The Institutes of the First Affiliated Hospital of Wenzhou Medical University Health Guidelines on the Use of Laboratory Animals to guide for the humanitarian care of animals. Male db/+ mice and db/db mice (7 weeks old, weight 24 g) were fed a normal diet for four weeks under a 14-hour light / 8-hour dark cycle at 24 °C which purchased from the Model Animal Research Center of Nanjing University (Nanjing, China). The equal volume adenovirus (Ad-ZFAS1, Ad-sh-ZFAS1, Ad-CCND2, Ad-sh-CCND2) were injected into the left ventricle free wall of mice (40µL respectively, 10µL for each of four sites). MiR-150-5p mimics and mimic control (NC) were injected into the tail vein of mice (50 µg/kg) for every 15 days for 12 weeks. Each group contains 8 mice. Primary Culture of Neonatal Cardiomyocytes and Cell Transfection Primary cardiomyocytes were isolated from the newborn (1- to 2-day-old) mice according to the professional article [ 33 ]. Cardiomyocytes were transfected with the adenovirus including Ad-ZFAS1, Ad-sh-ZFAS1, Ad-CCND2, Ad-sh-CCND2 (10µL/mL, MOI: 100:1, the titer of the adenoviruses was approximately 1.2 × 1010 PFU/mL, Hanbio Technology Ltd. Shanghai, China) in serum-free Dulbecco's Modified Eagle Medium (DMEM) for 6–8 h, the miR-150-5p mimics and mimic control (NC) (Sigma, St. Louis, MO, USA) were transfected into cardiomyocytes using Lipofectamine® 3000 (Invitrogen; Carlsbad, CA, USA), and then cultured in absence or presence of high glucose (HG, 25 mmol/L glucose). Microarray-Based Gene Expression Data Analysis The microarray data of diabetic and non-diabetic patients affected by heart failure (HF) based on the GSE26887, the micro-RNAs in pathophysiology of diabetic cardiomyopathy based on the GSE44179, the expression data from Rat ventricles 3 days, 28 days, and 42 days after STZ injection base on GSE4745, were acquired from the Gene Expression Omnibus (GEO) database ( https://www.ncbi.nlm.nih.gov/geo/ ), differentially DCM-related genes were screened by Excel (Microsoft) with the threshold of |log2FC| >2.0 and adj.P.Val (P value after correction) < 0.05. Dual luciferase reporter assay The online database StarBase v2.0 predicted the binding site of miR-150-5p with lncRNA-ZFAS1 ( http://starbase.sysu.edu.cn/agoClipRNA.php?source=lncRNA ). MiR-150-5p was predicted to binding with CCND2 by online database TargetScan software ( http://www.targetscan.org/mamm_31/ ). Wide sequences (wt-ZFAS1 and wt-CCND2) and mutant sequences (mut-ZFAS1 and mut-CCND2) were designed and synthesized according to the predicted binding sites. The human embryonic kidney cell line (HEK293T cells, ATCC, Manassas, VA) were cultured in 24-well plates reached to 80% confluence, the miR-150-5p mimic (30 n M) or miR-138-5p mimic negative controls (30 n M, Gene-Pharma, Shanghai, China) using Lipofectamine 3000 regent (Thermo Fisher Scientific, USA) to co-transfected into HEK293T cells. After 48 hours, the luciferase activity was explored by the Dual-Luciferase Reporter Assay Kit (Promega, USA). Quantitative real time PCR (qRT-PCR) The expression of ZFAS1, CCND2 and miR-150-5p were measured by qRT-PCR. Total RNA in left ventricle tissue and cardiomyocytes was extracted using the TRIzol reagent (Invitrogen) and RNA extraction kit (TaKaRa), miRNA was extracted using the miRNeasy Mini Kit (Qiagen, Germany) from the total RNA. RT-qPCR was performed according to the manufacturer's protocal on a QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific, USA). The primer sequences were listed as below: ZFAS1 (forward: 5ʹ-ACGTGCAGACATCTACAAC CT-3ʹ and reverse: 5ʹ-TACTTCCAACACCCGCAT-3ʹ), miR-150-5p, forward: 5′-TCGG CGTC TCCC AACC CTTG TAC-3′, reverse: 5′-GTCG TATC CAGT GCAG GGTC CGAG GT-3′, CCND2 (forward: 5′AGAGCCACCGGTATGGAGCTGCTGTGCCACGAGGT 3′, reverse: 5′CTGCAGGCGCGCCGAATTTTTTTTTTAAGTTTCACCCT 3′). RNA pull-down assay Biotinylated wild-type miR-150-5p (Bio-wt-150-5p) or biotinylated mutant miR-150-5p (Bio-mut-150-5p) or biotinylated miRNA which not complementary to ZFAS1 (Bio-NC) were transfected into primary cardiomyocytes. Forty-eight hours after transfection, cardiomyocytes were obtained for biotin-based pull-down assay (Thermo Fisher Scientific, USA) according to the protocol. ZFAS1 expression levels were measured by real-time PCR. Magnetic bead coated by a ZFAS1 probe or a random probe were added into cardiomyocytes lysate. MiR-150-5p was eluted from the streptavidin beads after washing and enrichment of beads/RNA complex. MiR-150-5p expression level was measured by Northern Blot (Thermo Fisher Scientific, USA) according to the protocol. Cell immunofluorescence staining After fixed with 4% paraformaldehyde for 15 minutes, permeabilized with 0.5%Triton X-100 for 20 minutes, and blocked with 4% goat serum for 30 minutes at 37 °C, the adherent experimental cardiomyocytes were cultured with the primary antibody against Ferritin Heavy Chain (ab65080) at 4 °C overnight. Next day, after incubated with DyLight 488 and 594 AffiniPure Goat IgG (H + L) for 1 h at 37 °C and counterstained with 0.1 µg/mL DAPI (P36941; Invitrogen) for 3 minutes, images were measured by a Nikon Eclipse Ti-U fluorescence microscope. Histology and immunohistochemistry After dewaxed in 60 ℃ incubator, hydrated with xylene and anhydrous ethanol, antigen repaired with Citrate Antigen Retrieval Solution Sections (Beyotime, China) Sections (5-mm thickness) of the left ventricular myocardial tissues were incubated with primary antibodies against Ferritin Heavy Chain (FTH1, ab65080), 4-Hydroxynonenal (4-HNE, ab46545) at 4 °C overnight. Next day, sections were incubated with secondary antibodies at 37 °C for 30 minutes and then stained with 3,3'-Diaminobenzidine (Gene Tech, China) at 37 °C for 5 minutes, photographed immediately in the dark using Nikon Eclipse Ti-U fluorescence microscope (Tokyo, Japan). Masson staining Masson staining was used to measure cardiac collagen content. After dewaxed in 60 ℃ incubator, hydrated with xylene and anhydrous ethanol, dyed with hematoxylin and Lichun red acid, Sections (5-mm thickness) of the left ventricular myocardial tissues were finally dyed with 1% phosphomolybdic acid, photographed immediately in the dark using Nikon Eclipse Ti-U fluorescence microscope (Tokyo, Japan). Collagen fibers were blue (aniline blue) or green (bright green), muscle fibers and cellulose were red. Monobromobimane (MBB) staining MBB staining was used to determine the glutathione (GSH) in cardiomyocytes. Cardiomyocytes were stained by MBB (20 µM; Sigma-Aldrich, USA) in PBS for 15 minutes at 37 °C, photographed immediately in the dark using Nikon Eclipse Ti-U fluorescence microscope (Tokyo, Japan). JC-1 staining JC-1 staining was used to determine the mitochondrial membrane potential. Cardiomyocytes were stained with JC-1 (MCE, NJ, USA) in PBS for 30 min at 37 °C, photographed immediately in the dark using Nikon Eclipse Ti-U fluorescence microscope (Tokyo, Japan). Western blotting Left ventricle tissue and cardiomyocytes were lysed to extract protein which separated by SDS-PAGE and then transferred onto 0.45 µm polyvinylidene difluoride transfer membranes (PVDF, Millipore, USA). After blocked and incubated with the primary antibodies, including GPX4 (ab125066), CCND2 (ab207604), cleaved caspase 3 (ab13847), Bcl-2 (ab32124), Bax (ab53154), and β-actin (ab8226) overnight at 4 ℃, PVDF membranes were incubated with a peroxidase-conjugated secondary antibody, including anti-mouse and anti-rabbit (Abbkine, Redlands, CA), finally visualized using an ECL Plus Detection Reagent (Sigma, United States). Statistical analysis SPSS version 26.0 software (SPSS Inc, USA, IL) was used to analysis data which shown as mean ± standard deviation (SD) and perform Student’s t test and ANOVA to show differences between two groups or multiple groups. All experiments were repeated at least three times and p values less than 0.05 were considered significant. Results Upregulated ZFAS1 expression and increased ferroptosis involved in diabetic cardiomyopathy and HG-treated cardiomyocytes. The differentially HF-related genes profiles in diabetic patients and non-diabetic patients were screened out from the GSE26887 in the GEO database, lncRNA-ZFAS1 was significantly upregulated in the diabetic patients with HF (Fig. 1 A). To determine whether ZFAS1 was really involved in diabetic cardiomyopathy, the expression of ZFAS1 in the left ventricular myocardial tissues of db/db mice and HG-treated cardiomyocytes was determined by RT-qPCR. The result revealed that ZFAS1 was significantly upregulated at the same way (Fig. 1 B-C). As shown in Fig. 1 D, FTH1, a key iron storage protein involved in iron metabolism and act as ferritinophagy biomarkers, was decreased in the left ventricular myocardial tissues of db/db mice evaluated by immunohistochemical staining (Fig. 1 D). 4-hydroxynonenal (4-HNE), the final product of lipid hydroperoxidation, was increased in the left ventricular myocardial tissues of db/db mice evaluated by immunohistochemical staining (Fig. 1 D). Glutathione peroxidase 4 (GPX4), which could terminate the process of ferroptosis, was decreased in the left ventricular myocardial tissues of db/db mice measured by western blot (Fig. 1 E-F). In keeping with in vivo results, FTH1 was seen colocalized rarely in the cytoplasm in HG-treated cardiomyocytes (Fig. 1 G). We also observed a reduction in the expression of GPX4 in HG-treated cardiomyocytes measured by western blot (Fig. 1 H-I). Taking together, we found that the expression of ZFAS1 was upregulated and ferroptosis was increased in diabetic cardiomyopathy and HG-treated cardiomyocytes. Inhibition of ZFAS1 repressed ferroptosis in diabetic cardiomyopathy and HG-Treated Cardiomyocytes. To further identify the function of ZFAS1 in the process of DCM, we injected Ad-ZFAS1, Ad-sh-ZFAS1 into the left ventricle free wall of mice. Masson staining showed a significant decrease of collagen deposition in the left ventricular myocardial tissues of db/db + Ad-ZFAS1 group (Fig. 2 A). Inhibition of ZFAS1 could restore the expression of FTH1, reduce the expression of 4-HNE evaluated by immunohistochemical staining (Fig. 2 B), rescue the expression of GPX4 and inhibit the expression of apoptosis-related genes including Cleaved caspase 3, Bax, and Bcl-2 measured by western blot (Fig. 2 C-D). Inhibition of ZFAS1 in HG-treated cardiomyocytes could increase intracellular GSH levels assessed by MBB staining to a certain extent (Fig. 2 E), restore the distribution of FTH1 in the cytoplasm (Fig. 2 F), alleviate the mitochondrial membrane potential as revealed by the transition from red fluorescence to green fluorescence measured by JC-1 staining (Fig. 2 G), rescue the expression of GPX4 and inhibit the expression of apoptosis-related genes including Cleaved caspase 3, Bax, and Bcl-2 measured by western blot (Fig. 2 H-I). Altogether, these results suggested that inhibition of ZFAS1 could prevent ferroptosis from diabetic cardiomyopathy and HG-treated cardiomyocytes. lncRNA-ZFAS1 can bind with miR-150-5p to regulate expression of CCND2. The differentially role of micro-RNAs profiles pathophysiology of diabetic cardiomyopathy were screened out from the GSE44179 in the GEO database, we found that miR-150-5p was substantial reduced (Fig. 3 A). To determine whether miR-150-5p was really involved in diabetic cardiomyopathy, the expression of miR-150-5p in the left ventricular myocardial tissues of db/db mice and HG-treated cardiomyocytes was determined by RT-qPCR. The result revealed that miR-150-5p was significantly downregulated at the same way (Fig. 3 B-C). To elucidate the potential molecular mechanism by which ZFAS1 and miR-150-5p regulated DM, we attempted to explore the underlying target bind site between ZFAS1 and miR-150-5p. The predicted bind site of miR-150-5p and ZFAS1 was displayed in the Fig. 3 D analyzed by bioinformatic program TargetScan. Dual luciferase reporter assay demonstrated that transfection with miR-150-5p mimics significantly reduced the relative firefly luciferase activity of wt-ZFAS1 whereas the mut-ZFAS1 luciferase activity was not affected (Fig. 3 E). Further, we compared the sequences of ZFAS1 with that of miR-150-5p analyzed by the bioinformatics program RNAhybrid and investigated that ZFAS1 contains a binding site of miR-150-5p (Fig. 3 F). What’s more, we performed a biotin-avidin pull-down assay to explore whether miR-150-5p could directly bind to ZFAS1. ZFAS1 was pulled down by biotinylated wild-type miR-150-5p, the inability of miR-150-5p to pull down ZFAS1 when introduction of miR-150-5p mutations that destroy base paring between ZFAS1 and miR-150-5p, indicating that the identification of miR-150-5p to ZFAS1 is sequence specific (Fig. 3 G). We also performed inverse pull-down assay to test if ZFAS1 could pull-down miR-150-5p, the results showed that miR-150-5p could be co-precipitated by ZFAS1using a biotin-labeled-specific ZFAS1 probe (Fig. 3 H). The GSE44179 from GEO database presented us that CCND2 was significantly decreased in rat ventricles after STZ injection (Fig. 3 I). To determine whether CCND2 was really involved in diabetic cardiomyopathy, the expression of CCND2 in the left ventricular myocardial tissues of db/db mice and HG-treated cardiomyocytes was determined by western blot. The result revealed that CCND2 was significantly downregulated in the same way (Fig. 3 J-M). The bioinformatic program TargetScan provided information for the predicted binding site of miR-150-5p and CCND2 (Fig. 3 N). Additionally, the dual-luciferase reporter assay demonstrated that transfection with miR-150-5p mimics significantly reduced the relative firefly luciferase activity of wt-CCND2 whereas the mut-CCND2 luciferase activity was not affected (Fig. 3 O). These results supported that ZFAS1 can bind with miR-150-5p to regulate the expression of CCND2. ZFAS1 promoted ferroptosis in diabetic cardiomyopathy and HG-treated Cardiomyocytes through modulating miR-150-5p. Because of the interaction between ZFAS1 and miR-150-5p, we further explored whether ZFAS1 was able to regulate ferroptosis through miR-150-5p. As shown in Fig. 4 A, stimulation of miR-150-5p significantly decreased collagen deposition in the left ventricular myocardial tissues of db/db mice which was similar to the function of ZFAS1 inhibition. However, stimulation of ZFAS1 definitely abolished the positive effect of miR-150-5p detected by Masson staining. Overexpression of miR-150-5p could restore the expression of FTH1, reduce the expression of 4-HNE evaluated by immunohistochemical staining as the function of inhibition of ZFAS1, whereas overexpression of ZFAS1 offset the positive effect of miR-150-5p (Fig. 4 B). Overexpression of miR-150-5p could rescue the expression of GPX4 and CCND2 and inhibit the expression of apoptosis-related genes including Cleaved caspase 3, Bax, and Bcl-2 measured by western blot which were similar to the function of ZFAS1, whereas overexpression of ZFAS1 counteracted the positive effect of miR-150-5p (Fig. 4 C-D). Subsequently, we explored whether ZFAS1 regulate ferroptosis through miR-150-5p in HG-treated cardiomyocytes. As shown in Fig. 4 E, HG-treated cardiomyocytes transfected with Ad-sh-ZFAS1 or mimic miR-150-5p all made sense in the increase of intracellular GSH levels assessed by MBB staining (Fig. 4 E), whereas overexpression of ZFAS1 counteracted the positive effect of miR-150-5p. Moreover, Ad-ZFAS1 administration significantly reversed the effect of miR-150-5p, as demonstrated by a reduction in the expression of FTH1 as detected via immunofluorescence (Fig. 4 F), the decrease in mitochondrial membrane potential as detected via JC-1 staining (Fig. 4 G), a reduction in the expression of GPX4 and CCND2 and a reduction in the expression of apoptosis-related genes including Cleaved caspase 3, Bax, and Bcl-2 measured by western blot (Fig. 4 H-I). Taking together, these results indicated that inhibition of ZFAS1 could suppress ferroptosis in diabetic cardiomyopathy and HG-treated Cardiomyocytes through targeting miR-150-5p. lncRNA-ZFAS1 acted as a ceRNA to sponge miR-150-5p. ZFAS1 promoted ferroptosis in diabetic cardiomyopathy and HG-treated Cardiomyocytes through modulating CCND2. To further elucidate the role of CCND2 in the positive function of ZFAS1 inhibition against ferroptosis in diabetic cardiomyopathy and HG-treated Cardiomyocytes, the left ventricular myocardial tissues of db/db mice were injected with Ad-sh-ZFAS1, Ad-ZFAS1, Ad-CCND2, or Ad-sh-CCND2. Interestingly, overexpression of CCND2 exerted a marked effect in inhibition of ferroptosis likewise the function as the inhibition of ZFAS1, however, these effects were eliminated when stimulation of ZFAS1 corroborated by the increased collagen deposition measured by Masson staining (Fig. 5 A), the decreased expression of FTH1 and increased the expression of 4-HNE measured by immunohistochemical staining (Fig. 5 B), the decreased expression of GPX4 and the increased expression of apoptosis-related genes including Cleaved caspase 3, Bax, and Bcl-2 measured by western blot (Fig. 5 C-D) in the left ventricular myocardial tissues of db/db mice, the decreased of intracellular GSH levels assessed by MBB staining(Fig. 5 E), the reduction expression of FTH1 as detected via immunofluorescence (Fig. 5 F), the decreased mitochondrial membrane potential as detected via JC-1 staining (Fig. 5 G), the reduction in the expression of GPX4 and the reduction in the expression of apoptosis-related genes including Cleaved caspase 3, Bax, and Bcl-2 measured by western blot (Fig. 5 H-I). Cumulatively, these results demonstrated that ZFAS1 inhibition suppressed ferroptosis in diabetic cardiomyopathy and HG-treated Cardiomyocytes through modulating CCND2. lncRNA-ZFAS1 acted as a ceRNA to sponge miR-150-5p can regulate CCND2. Discussion Diabetes mellitus is an independent risk of heart failure (HF), while HF could accelerate diabetes mellitus cardiovascular complication [ 5 ], according to a report, 15%-35% of HF patients should blamed to diabetic patients [ 34 ]. What’s more, diabetic cardiomyopathy is considered an indispensable pathophysiological state among diabetic patients which could result in the dysfunctional cardiomyocytes, abnormal myocardial and the final cardiac dysfunction characterized by left ventricular longitudinal dysfunction [ 8 , 35 , 36 ]. However, the therapy or specific treatment of DCM in clinical is a considerable challenge. To date, there is still no identified molecular mechanism of DCM to guide the treatment of DCM. In the present study, we aimed to elucidate the role of lncRNA-ZFAS1, miR-150-5p, CCND2 in ferroptosis of cardiomyocytes in DCM. Specifically, inhibition of ZFAS1 could potentially alleviate myocardial fibrosis in DCM by inhibiting cardiomyocyte ferroptosis via sponging miR-150-5p to activate CCND2. These decade, the roles of lncRNAs were paid attention to various cardiovascular diseases, especially myocardial infarction (MI) [ 20 , 37 – 39 ], but little is known about the role of lncRNAs in the pathogenesis of DCM. The GSE26887 from GEO database show that lncRNA-ZFAS1 was significantly upregulated in diabetic patients with HF, compared with non-diabetic patients (Fig. 1 A). As we expected, ZFAS1 was also upregulated in diabetic cardiomyopathy and HG-treated cardiomyocytes (Fig. 1 B-C). ZFAS1 is one of cardiac-related lncRNAs, previously, knockdown of lncRNA-ZFAS1 prevents cardiomyocytes from MI [ 14 ]. Reports emphasized that ZFAS1 was upregulated to promote cardiac disease [ 40 ] and induce mitochondria-mediated cardiomyocytes apoptosis [ 16 ]. Ferroptosis, a unique cell death, characterized by the stimulation of reactive oxygen species (ROS) result in the mitochondria dysfunction induced by iron catalytic activity and lipid peroxidation [ 41 ]. Growing studies has shown that ferroptosis was also a critical form of cardiomyocytes death [ 42 , 43 ]. In this study, we found that ferroptosis was accumulated in the left ventricular myocardial tissues of DCM and HG-treated cardiomyocytes, as demonstrated by the downregulation expression of iron storage protein FTH1 as determined by immunohistochemical staining (Fig. 1 D) and immunofluorescence staining (Fig. 1 G), the upregulation expression of the final product of lipid hydroperoxidation protein 4-HNE as determined by immunohistochemical staining (Fig. 1 D), the downregulation expression of the ferroptosis termination protein GPX4 determined by western blot analysis (Fig. 1 E-F, 1 H-I). Moreover, we found that the inhibition of ZFAS1 in db/db mice could attenuate ferroptosis in the left ventricular myocardial tissues of DCM and HG-treated cardiomyocytes based on the upregulation expression of FTH1 as determined by immunohistochemical staining (Fig. 2 B) and immunofluorescence staining (Fig. 2 F), the upregulation expression of the ferroptosis termination protein GPX4 as determined by western blot analysis (Fig. 2 C-D, 2 -H-I), the increased intracellular GSH levels assessed by MBB staining (Fig. 2 E), the restoration of mitochondrial membrane potential measured by JC-1 staining, all the change related with ferroptosis resulted in the reduction of the collagen deposition to attenuate cardiac fibrosis in myocardial tissue as determined by Masson staining (Fig. 2 A) and the decreased expression of apoptosis-related genes including Cleaved caspase 3, Bax, and Bcl-2 measured by western blot (Fig. 2 C-D, 2 -H-I). Emerging evidence has shown that miR-150-5p involved in heart disease and HF [ 44 , 45 ]. The GSE44179 from GEO database and the RT-qPCR of left ventricular myocardial tissues of db/db mice and HG-treated cardiomyocytes all show that miR-150-5p was significantly downregulated (Fig. 3 A-C). Type D cyclins regulate the transition of cell cycle from G1 to S, while overexpression of CCND2 (cyclin D2) can activate the cell cycle of cardiomyocytes [ 25 , 46 ]. The GSE4745 from GEO database and the RT-qPCR of left ventricular myocardial tissues of db/db mice and HG-treated cardiomyocytes all show that CCND2 was significantly downregulated (Fig. 3 I-M). Further, we identified that ZFAS1 can bind with miR-150-5p to regulate expression of CCND2 as determined by RNA Pull-down assay (Fig. 3 G-H), dual luciferase reporter assay (Fig. 3 E, O), RNAhybrid program (Fig. 3 F) and TargetScan program (Fig. 3 D, N). More importantly, overexpression of miR-150-5p and CCND2 significantly alleviated ferroptosis which was similar to the function of ZFAS1 inhibition in db/db mice and HG-treated Cardiomyocytes, however, these positive effects were eliminated when stimulation of ZFAS1 based on the downregulation expression of FTH1 as determined by immunohistochemical staining (Fig. 4 B, Fig. 5 B) and immunofluorescence staining (Fig. 4 F, Fig. 5 F), the downregulation expression of the ferroptosis termination protein GPX4 as determined by western blot analysis (Fig. 4 C-D and 4 H-I, Fig. 5 C-D and 5 H-I), the decreased intracellular GSH levels assessed by MBB staining (Fig. 4 E, Fig. 5 E), the reduction of mitochondrial membrane potential measured by JC-1 staining (Fig. 4 G, Fig. 5 G), all the change related with ferroptosis resulted in the accumulation of the collagen deposition which induce cardiac fibrosis in myocardial tissue as determined by Masson staining (Fig. 4 A, Fig. 5 A) and the increased expression of apoptosis-related genes including Cleaved caspase 3, Bax, and Bcl-2 measured by western blot (Fig. 4 C-D and 4 H-I, Fig. 5 C-D and 5 H-I). Such findings strongly supported that inhibition of ZFAS1 could inhibit cardiomyocytes ferroptosis by sponging miR-150-5p to activate CCND2 against diabetic cardiomyopathy (Fig. 6 ). Conclusion Together, all these results strongly suggested that simulation of ZFAS1 indeed promote ferroptosis in DCM, lncRNA-ZFAS1 acted as a ceRNA to sponge miR-150-5p can regulate CCND2. Most important of all, inhibition of ZFAS1 could suppress cardiomyocytes ferroptosis and attenuated DCM progress. The ability to target lncRNA-ZFAS1 will pave the way for the novel treatment of DCM. Abbreviations DCM: Diabetic cardiomyopathy; HG: High glucose; lncRNAs: The long noncoding ribonucleic acids; ZFAS1: zinc finger antisense 1; ceRNAs: competing endogenous RNAs; miRNAs: micro-RNAs; GPX4: Glutathione peroxidase 4; GEO: Gene Expression Omnibus; FTH1: Ferritin Heavy Chain; 4-HNE: 4-Hydroxynonenal; GSH: glutathione; MBB: Monobromobimane. Declarations Ethics approval and consent to participate The animal experiments were approved by the Institutes of the First Affiliated Hospital of Wenzhou Medical University Health Guidelines on the Use of Laboratory Animals. Consent for publication All authors have declared their Consent for this publication. Availability of data and materials All data and materials are available upon request. Acknowledgements None. Authors’ contributions Tingjuan Ni and Zhiongqiu Lu designed the study. Tingjuan Ni, Xiaorong Chen, Xingxiao Huang, and Sunlei Pan carried out the in vitro and in vivo experiment. Tingjuan Ni and Xingxiao Huang analyzed the data. Tingjuan Ni and Xiaorong Chen designed the study and drafted the paper. All authors reviewed and approved the final manuscript. Authors' information 1 Department of Emergency Intensive Care Unit, the First Affiliated Hospital, Wenzhou Medical University, Wenzhou, Zhejiang, China. 2 Department of Cardiology, Zhejiang University, Hangzhou, Zhejiang, China. 3 Department of Coronary Care Unit, the First Affiliated Hospital, Wenzhou Medical University, Wenzhou, Zhejiang, China. Competing interests The authors declare that they have no competing interests. Funding This study was supported by the National Natural Science Foundation of China (No. 81772112). References Ritchie RH, Abel ED: Basic Mechanisms of Diabetic Heart Disease . CIRC RES 2020, 126 (11):1501-1525. Kannel WB, Hjortland M, Castelli WP: Role of diabetes in congestive heart failure: The Framingham study . The American Journal of Cardiology 1974, 34 (1):29-34. Cho NH, Shaw JE, Karuranga S, Huang Y, Da Rocha Fernandes JD, Ohlrogge AW, Malanda B: IDF Diabetes Atlas: Global estimates of diabetes prevalence for 2017 and projections for 2045 . DIABETES RES CLIN PR 2018, 138 :271-281. Ni T, Lin N, Huang X, Lu W, Sun Z, Zhang J, Lin H, Chi J, Guo H: Icariin Ameliorates Diabetic Cardiomyopathy Through Apelin/Sirt3 Signalling to Improve Mitochondrial Dysfunction . FRONT PHARMACOL 2020, 11 . Varinder Kaur Randhawa SD: How Diabetes and Heart Failure Modulate Each Other and Condition Management . CAN J CARDIOL 2020, 20 (S0828-282X):31115-31116. Ohkuma T, Komorita Y, Peters SAE, Woodward M: Diabetes as a risk factor for heart failure in women and men: a systematic review and meta-analysis of 47 cohorts including 12 million individuals . DIABETOLOGIA 2019, 62 (9):1550-1560. Leon BM: Diabetes and cardiovascular disease: Epidemiology, biological mechanisms, treatment recommendations and future research . World Journal of Diabetes 2015, 6 (13):1246. Zamora M, Villena JA: Contribution of Impaired Insulin Signaling to the Pathogenesis of Diabetic Cardiomyopathy . INT J MOL SCI 2019, 20 (11). Peterson LR, Gropler RJ: Metabolic and Molecular Imaging of the Diabetic Cardiomyopathy . CIRC RES 2020, 126 (11):1628-1645. Kumarswamy R, Bauters C, Volkmann I, Maury F, Fetisch J, Holzmann A, Lemesle G, de Groote P, Pinet F, Thum T: Circulating Long Noncoding RNA, LIPCAR, Predicts Survival in Patients With Heart Failure . CIRC RES 2014, 114 (10):1569-1575. Uchida S, Dimmeler S: Long Noncoding RNAs in Cardiovascular Diseases . CIRC RES 2015, 116 (4):737-750. Shah RV, Rong J, Larson MG, Yeri A, Ziegler O, Tanriverdi K, Murthy V, Liu X, Xiao C, Pico AR et al : Associations of Circulating Extracellular RNAs With Myocardial Remodeling and Heart Failure . JAMA CARDIOL 2018, 3 (9):871. Zhang Y, Du W, Yang B: Long non-coding RNAs as new regulators of cardiac electrophysiology and arrhythmias: Molecular mechanisms, therapeutic implications and challenges . PHARMACOL THERAPEUT 2019, 203 :107389. Wu T, Wu D, Wu Q, Zou B, Huang X, Cheng X, Wu Y, Hong K, Li P, Yang R et al : Knockdown of Long Non-Coding RNA-ZFAS1 Protects Cardiomyocytes Against Acute Myocardial Infarction Via Anti-Apoptosis by Regulating miR-150/CRP . J CELL BIOCHEM 2017, 118 (10):3281-3289. Zhang Y, Jiao L, Sun L, Li Y, Gao Y, Xu C, Shao Y, Li M, Li C, Lu Y et al : LncRNA ZFAS1 as a SERCA2a Inhibitor to Cause Intracellular Ca2+ Overload and Contractile Dysfunction in a Mouse Model of Myocardial Infarction . CIRC RES 2018. Jiao L, Li M, Shao Y, Zhang Y, Gong M, Yang X, Wang Y, Tan Z, Sun L, Xuan L et al : lncRNA-ZFAS1 induces mitochondria-mediated apoptosis by causing cytosolic Ca2+ overload in myocardial infarction mice model . CELL DEATH DIS 2019, 10 (12). Wang J, Ruan J, Zhu M, Yang J, Du S, Xu P, Zhang Z, Wang P, Yang W, Yu M: Predictive value of long noncoding RNA ZFAS1 in patients with ischemic stroke . CLIN EXP HYPERTENS 2019, 41 (7):615-621. Salmena L, Poliseno L, Tay Y, Kats L, Pandolfi PP: A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? CELL 2011, 146 (3):353-358. Ong S, Katwadi K, Kwek X, Ismail NI, Chinda K, Ong S, Hausenloy DJ: Non-coding RNAs as therapeutic targets for preventing myocardial ischemia-reperfusion injury . EXPERT OPIN THER TAR 2018, 22 (3):247-261. Niu X, Pu S, Ling C, Xu J, Wang J, Sun S, Yao Y, Zhang Z: lncRNA Oip5 ‐ as1 attenuates myocardial ischaemia/reperfusion injury by sponging miR ‐ 29a to activate the SIRT1/AMPK/PGC1 α pathway . CELL PROLIFERAT 2020, 53 (6). Abu-Halima M, Meese E, Saleh MA, Keller A, Abdul-Khaliq H, Raedle-Hurst T: Micro-RNA 150-5p predicts overt heart failure in patients with univentricular hearts . PLOS ONE 2019, 14 (10):e223606. Zhu XG, Zhang TN, Wen R, Liu CF: Overexpression of miR-150-5p Alleviates Apoptosis in Sepsis-Induced Myocardial Depression . BIOMED RES INT 2020, 2020 :1-10. Shen J, Xing W, Gong F, Wang W, Yan Y, Zhang Y, Xie C, Fu S: MiR-150-5p retards the progression of myocardial fibrosis by targeting EGR1 . CELL CYCLE 2019, 18 (12):1335-1348. Zheng J, Peng B, Zhang Y, Ai F, Hu X: FOXD3-AS1 Knockdown Suppresses Hypoxia-Induced Cardiomyocyte Injury by Increasing Cell Survival and Inhibiting Apoptosis via Upregulating Cardioprotective Molecule miR-150-5p In Vitro . FRONT PHARMACOL 2020, 11 :1284. BUSK P, HINRICHSEN R, BARTKOVA J, HANSEN A, CHRISTOFFERSEN T, BARTEK J, HAUNSO S: Cyclin D2 induces proliferation of cardiac myocytes and represses hypertrophy . EXP CELL RES 2005, 304 (1):149-161. Yamak A, Temsah R, Maharsy W, Caron S, Paradis P, Aries A, Nemer M: Cyclin D2 rescues size and function of GATA4 haplo-insufficient hearts . AM J PHYSIOL-HEART C 2012, 303 (8):H1057-H1066. Zhu W, Zhao M, Mattapally S, Chen S, Zhang J: CCND2 Overexpression Enhances the Regenerative Potency of Human Induced Pluripotent Stem Cell – Derived Cardiomyocytes . CIRC RES 2018, 122 (1):88-96. Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, Patel DN, Bauer AJ, Cantley AM, Yang WS et al : Ferroptosis: an iron-dependent form of nonapoptotic cell death . CELL 2012, 149 (5):1060-1072. Paras K. Mishra AAJA: Guidelines for evaluating myocardial cell death . AM J PHYSIOL-HEART C 2019, 317 (5). Hao Zhang PZSW: Role of Iron metabolism in heart failure: From Iron deficiency to Iron overload . BIOCHIMICA ET BIOPHYSICA ACTA-MOLECULAR BASIS OF DISEASE 2018, 1865 (7):1925-1937. Stockwell BR, Friedmann AJ, Bayir H, Bush AI, Conrad M, Dixon SJ, Fulda S, Gascon S, Hatzios SK, Kagan VE et al : Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease . CELL 2017, 171 (2):273-285. Fang X, Wang H, Han D, Xie E, Yang X, Wei J, Gu S, Gao F, Zhu N, Yin X et al : Ferroptosis as a target for protection against cardiomyopathy . P NATL ACAD SCI USA 2019, 116 (7):2672-2680. Leone M, Engel FB: Isolation, Culture, and Live-Cell Imaging of Primary Rat Cardiomyocytes . Methods Mol Biol 2021, 2158 :109-124. Cohen-Solal A, Beauvais F, Logeart D: Heart Failure and Diabetes Mellitus: Epidemiology and Management of an Alarming Association . J CARD FAIL 2008, 14 (7):615-625. Dillmann WH: Diabetic Cardiomyopathy . CIRC RES 2019, 124 (8):1160-1162. Tanaka H, Tatsumi K, Matsuzoe H, Matsumoto K, Hirata K: Impact of diabetes mellitus on left ventricular longitudinal function of patients with non-ischemic dilated cardiomyopathy . CARDIOVASC DIABETOL 2020, 19 (1). Mao Q, Liang X, Zhang C, Pang Y, Lu Y: LncRNA KLF3-AS1 in human mesenchymal stem cell-derived exosomes ameliorates pyroptosis of cardiomyocytes and myocardial infarction through miR-138-5p/Sirt1 axis . STEM CELL RES THER 2019, 10 (1). Sun L, Zhu W, Zhao P, Wang Q, Fan B, Zhu Y, Lu Y, Chen Q, Zhang J, Zhang F: Long noncoding RNA UCA1 from hypoxia-conditioned hMSC-derived exosomes: a novel molecular target for cardioprotection through miR-873-5p/XIAP axis . CELL DEATH DIS 2020, 11 (8):696. Song Y, Wang B, Zhu X, Hu J, Sun J, Xuan J, Ge Z: Human umbilical cord blood – derived MSCs exosome attenuate myocardial injury by inhibiting ferroptosis in acute myocardial infarction mice . CELL BIOL TOXICOL 2020. Tim Vervliet ELRH: Lnc ’ ing Ca 2+ , SERCA and cardiac disease . CELL CALCIUM 2018(72):132-134. Wang Z, Chen X, Liu N, Shi Y, Liu Y, Ouyang L, Tam S, Xiao D, Liu S, Wen F et al : A Nuclear Long Non-Coding RNA LINC00618 Accelerates Ferroptosis in a Manner Dependent upon Apoptosis . MOL THER 2020. Conrad M, Proneth B: Broken hearts: Iron overload, ferroptosis and cardiomyopathy . CELL RES 2019, 29 (4):263-264. Baba Y, Higa JK, Shimada BK, Horiuchi KM, Suhara T, Kobayashi M, Woo JD, Aoyagi H, Marh KS, Kitaoka H et al : Protective effects of the mechanistic target of rapamycin against excess iron and ferroptosis in cardiomyocytes . AM J PHYSIOL-HEART C 2018, 314 (3):H659-H668. Tianxiao Huan JRKT: Dissecting the Roles of MicroRNAs in Coronary Heart Disease via Integrative Genomic Dissecting the Roles of MicroRNAs in Coronary Heart Disease via Integrative Genomic Analyses . Arterioscler Thromb Vasc Biol 2015, 4 (35):1011-1021. Domenico Scrutinio FCAP: Circulating microRNA-150-5p as a novel biomarker for advanced heart failure. A genome-wide prospective studymiR-150-5p in advanced heart failure . J Heart Lung Transplant 2017, 6 (36):616-624. Chengming Fan VGFY: Cardiomyocytes from CCND2-overexpressing human induced- pluripotent stem cells repopulate the myocardial scar in mice: A 6-month study . 2019(137):25-33. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-144450","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Original investigation","associatedPublications":[],"authors":[{"id":7893477,"identity":"5fc779ae-f442-4a09-8ee3-a3c2f8d66f42","order_by":0,"name":"Tingjuan Ni","email":"","orcid":"","institution":"Wenzhou Medical College First Affiliated Hospital: The First Affiliated Hospital of Wenzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Tingjuan","middleName":"","lastName":"Ni","suffix":""},{"id":7893478,"identity":"ff5cfa06-8ee4-4551-8c54-0d59e8ad6a03","order_by":1,"name":"Xiaorong Chen","email":"","orcid":"","institution":"Wenzhou Medical University First Affiliated Hospital: The First Affiliated Hospital of Wenzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xiaorong","middleName":"","lastName":"Chen","suffix":""},{"id":7893479,"identity":"5a9594dd-3e64-4b00-b4db-d29ac5644822","order_by":2,"name":"Xingxiao Huang","email":"","orcid":"","institution":"Zhejiang University - Zijingang Campus: Zhejiang University","correspondingAuthor":false,"prefix":"","firstName":"Xingxiao","middleName":"","lastName":"Huang","suffix":""},{"id":7893480,"identity":"20c56823-4424-481a-8e4b-233e0bc2c8ab","order_by":3,"name":"Sunlei Pan","email":"","orcid":"","institution":"Wenzhou Medical College First Affiliated Hospital: The First Affiliated Hospital of Wenzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Sunlei","middleName":"","lastName":"Pan","suffix":""},{"id":7893481,"identity":"f70df9ef-f9f6-431a-ae79-72b95cb5d560","order_by":4,"name":"Zhongqiu Lu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2ElEQVRIie2RMQrCQBBFJywMKcakkwUlucJKCi1yGNNYRcgdhNjkAAmCZ8gRIgNWegIbwQtsmUpcrex2S8F9MFPNY5g/AB7PDxK9myaZYMrDoEcHBU0F7TzPIonFqWscFRHmm+IoKeMQXZSYewElZzhrNANBGk8H25ZzJaoLJzi/9lytYNEd1hYlaJToGrMFtj23BGt1symClJg8uaihvDOhi4JGIdoUtSzBUSGsgpbyDOmsTMjSfktsEvu8Mt3vHlqPeRrPLIph+f1yaR1/o5ymPB6P5495AZuKPe19538YAAAAAElFTkSuQmCC","orcid":"","institution":"the First Affiliated Hospital, Wenzhou Medical University","correspondingAuthor":true,"prefix":"","firstName":"Zhongqiu","middleName":"","lastName":"Lu","suffix":""}],"badges":[],"createdAt":"2021-01-10 12:04:32","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-144450/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-144450/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":4995767,"identity":"df991f20-77ba-4f2e-87ba-f2e7eeab98b2","added_by":"auto","created_at":"2021-01-15 16:07:12","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":101694,"visible":true,"origin":"","legend":"ZFAS1 is involved in the response to diabetic cardiomyopathy- and high glucose-induced ferroptosis. (A) ZFAS1 expression levels in heart failure of diabetic patients and non-diabetic patients from RNA-sequencing data (GSE26887). (B) RT-qPCR analysis of ZFAS1 expression in the left ventricular myocardial tissues of db/+ and db/db mice. (C) RT-qPCR analysis of ZFAS1 expression in control cardiomyocytes and HG-treated cardiomyocytes. (D) Relative expression of FTH1 and 4-HNE were determined by immunohistochemical staining in the left ventricular myocardial tissues of db/+ and db/db mice. (E-F) Relative protein expression of GPX4 was assessed by western blot analysis in the left ventricular myocardial tissues of db/+ and db/db mice. (G) Immunofluorescence against FTH1 (green) in control cardiomyocytes and HG-treated cardiomyocytes. (H-I) Relative protein expression of GPX4 was assessed by western blot analysis in control cardiomyocytes and HG-treated cardiomyocytes. #P \u003c 0.05 vs CON group or db/+ group, data are measured as mean ± SD (n=3).","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-144450/v1/2dd2e9f182bac60f13845d74.png"},{"id":4995769,"identity":"c8814c58-6d06-4943-977f-86de5a4755bf","added_by":"auto","created_at":"2021-01-15 16:07:12","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":159965,"visible":true,"origin":"","legend":"Inhibition of ZFAS1 alleviated ferroptosis induced in diabetic cardiomyopathy and HG-treated cardiomyocytes. Db/+mice (n = 8) and db/db mice (n=8) were injected with Ad-NC, Ad-ZFAS1, Ad-sh-ZFAS1, respectively. Cardiomyocytes were transfected with Ad-NC, Ad-ZFAS1, Ad-sh-ZFAS1 with or without under HG stimulation. (A) Masson staining was used to assess Collagen deposition in the left ventricular myocardial tissues in experimental mice (blue indicates collagen deposition). (B) Relative expression of FTH1 and 4-HNE were determined by immunohistochemical staining in the left ventricular myocardial tissues of experimental mice. (C-D) Relative protein expression of GPX4, Cleaved caspase 3, Bax, and Bcl-2 were assessed by western blot analysis in the left ventricular myocardial tissues of experimental mice. (E) MBB staining was used to assess GSH levels in experimental cardiomyocytes. (F) Immunofluorescence against FTH1 (green) in experimental cardiomyocytes. (G) JC-1 staining was used to assess mitochondrial membrane potential in experimental cardiomyocytes. (H-I) Relative protein expression of GPX4, Cleaved caspase 3, Bax, and Bcl-2 were assessed by western blot analysis in experimental cardiomyocytes. #P \u003c 0.05 vs CON group or db/+ group, *P \u003c 0.05 vs HG + Ad-NC or db/db + Ad-NC; data are measured as mean ± SD (n=3).","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-144450/v1/6f1b0488d984b4fc97d83342.png"},{"id":4995768,"identity":"483852c2-20a0-4744-9232-6eb579d900f8","added_by":"auto","created_at":"2021-01-15 16:07:12","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":63353,"visible":true,"origin":"","legend":"ZFAS1 can bind with miR-150-5p to regulate expression of CCND2. (A) MiR-150-5p expression levels in control group (CON) and diabetic cardiomyopathy (DCM) from RNA-sequencing data (GSE44179). (B) RT-qPCR analysis of miR-150-5p expression in the left ventricular myocardial tissues of db/+ and db/db mice. (C) RT-qPCR analysis of ZFAS1 expression in control cardiomyocytes and HG-treated cardiomyocytes. (D) The predicted bind site of miR-150-5p with ZFAS1 was analyzed by TargetScan program. (E) Dual luciferase reporter assay was used to confirm the binding of miR-150-5p with ZFAS1. (F) ZFAS1 contains a site complementary to miR-150-5p analyzed by RNAhybrid program. (G) miR-150-5p can bind directly to ZFAS1 in vivo performed by RNA Pull-down assay. (H) ZFAS1 can bind to miR-150-5p in vivo performed by RNA Pull-down assay. (I) CCND2 expression levels in the control rat ventricles and in the rat ventricles after STZ injection from RNA-sequencing data (GSE4745). (J-K) Relative protein expression of CCND2 by western blot analysis in the left ventricular myocardial tissues of db/+ and db/db mice. (L-M) Relative protein expression of CCND2 was assessed by western blot analysis in control cardiomyocytes and HG-treated cardiomyocytes. (N) The predicted bind site of CCND2 with ZFAS1 was analyzed by TargetScan program. (O) Dual luciferase reporter assay was used to confirm the binding of CCND2 with ZFAS1. #P \u003c 0.05 vs CON group or db/+ group, data are measured as mean ± SD (n=3).","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-144450/v1/a888ed010b30117f6865f5e3.png"},{"id":4995653,"identity":"f8862c0f-869b-4ed7-a858-80b6a05ddf4b","added_by":"auto","created_at":"2021-01-15 16:04:12","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":201636,"visible":true,"origin":"","legend":"Inhibition of ZFAS1 repressed ferroptosis by up-regulating miR-150-5p in diabetic cardiomyopathy and HG-treated Cardiomyocytes. Db/+mice (n = 8) and db/db mice (n = 8) were injected with Ad-NC, Ad-ZFAS1, Ad-sh-ZFAS1, mimic NC, mimic miR-150-5p, respectively. Cardiomyocytes were transfected with Ad-NC, Ad-ZFAS1, Ad-sh-ZFAS1, mimic NC or mimic miR-150-5p with or without under HG stimulation. (A) Masson staining was used to assess collagen deposition in the left ventricular myocardial tissues in experimental mice (blue indicates collagen deposition). (B) Relative expression of FTH1 and 4-HNE were determined by immunohistochemical staining in the left ventricular myocardial tissues of experimental mice. (C-D) Relative protein expression of GPX4, Cleaved caspase 3, Bax, and Bcl-2 were assessed by western blot analysis in the left ventricular myocardial tissues of experimental mice. (E) MBB staining was used to assess GSH levels in experimental cardiomyocytes. (F) Immunofluorescence against FTH1 (green) in experimental cardiomyocytes. (G) JC-1 staining was used to assess mitochondrial membrane potential in experimental cardiomyocytes. (H-I) Relative protein expression of GPX4, Cleaved caspase 3, Bax, and Bcl-2 were assessed by western blot analysis in experimental cardiomyocytes. #P \u003c 0.05 vs CON group +Ad-NC+mimic NC or db/+ +Ad-NC+mimic NC group, *P \u003c 0.05 vs HG +Ad-NC+mimic NC or db/db + Ad-NC+mimic NC; data are measured as mean ± SD (n=3).","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-144450/v1/c30240fea43a378b6cbdab16.png"},{"id":4995597,"identity":"838afbe5-fd3d-4fad-bc7a-2329546ee7bf","added_by":"auto","created_at":"2021-01-15 16:01:12","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":200013,"visible":true,"origin":"","legend":"Inhibition of ZFAS1 alleviated ferroptosis by up-regulating CCND2 in diabetic cardiomyopathy and HG-treated Cardiomyocytes. Db/+mice (n = 8) and db/db mice (n = 8) were injected with Ad-NC, Ad-ZFAS1, Ad-sh-ZFAS1, Ad-CCND2, Ad-sh- CCND2, respectively. Cardiomyocytes were transfected with Ad-NC, Ad-ZFAS1, Ad-sh-ZFAS1, Ad-CCND2 or Ad-sh-CCND2 with or without under HG stimulation. (A) Masson staining was used to assess Collagen deposition in the left ventricular myocardial tissues in experimental mice (blue indicates collagen deposition). (B) Relative expression of FTH1 and 4-HNE were determined by immunohistochemical staining in the left ventricular myocardial tissues of experimental mice. (C-D) Relative protein expression of GPX4, Cleaved caspase 3, Bax, and Bcl-2 were assessed by western blot analysis in the left ventricular myocardial tissues of experimental mice. (E) MBB staining was used to assess GSH levels in experimental cardiomyocytes. (F) Immunofluorescence against FTH1 (green) in experimental cardiomyocytes. (G) JC-1 staining was used to assess mitochondrial membrane potential in experimental cardiomyocytes. (H-I) Relative protein expression of GPX4, Cleaved caspase 3, Bax, and Bcl-2 were assessed by western blot analysis in experimental cardiomyocytes. #P \u003c 0.05 vs CON group +Ad-NC or db/+ +Ad-NC group, *P \u003c 0.05 vs HG +Ad-NC or db/db + Ad-NC; data are measured as mean ± SD (n=3).","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-144450/v1/c29fb045543696774cc272a4.png"},{"id":4995656,"identity":"256ce917-9e37-43b5-abb3-1dc6145bacd2","added_by":"auto","created_at":"2021-01-15 16:04:12","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":67962,"visible":true,"origin":"","legend":"Schematic representing that ZFAS1 was highly expressed in DCM, ZFAS1 act as ceRNA to sponge miR-150-5p to regulate CCND2 expression, thereby indeed promote ferroptosis to accelerate diabetic cardiomyopathy.","description":"","filename":"OnlineFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-144450/v1/66144204fe39cb49ead8a35b.png"},{"id":13646849,"identity":"b3155467-974b-4bb5-8e98-e8a1071f35ce","added_by":"auto","created_at":"2021-09-17 09:25:35","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4633413,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-144450/v1/9417a88d-5de3-428c-be02-f1ba9f2f97cb.pdf"}],"financialInterests":"","formattedTitle":"Inhibition of the Long non-coding RNA ZFAS1 attenuates pathogenic ferroptosis by sponging miR-150-5p to activate CCND2 against diabetic cardiomyopathy","fulltext":[{"header":"Introduction","content":" \u003cp\u003eDiabetes makes patients vulnerable to a series of cardiovascular complications, one of the most serious progress is associated with the heart failure [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. With the increasing of the incidence of diabetes (expected to reach 693\u0026nbsp;million by 2045 [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]), heart failure caused by diabetes has become a worldwide epidemic [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Indeed, diabetes accounts for 1/3 of patients with heart failure in clinical, and diabetes has always been an independent predictor of adverse outcomes [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Instead, DCM is currently recognized as a proximate cause of heart failure with a 4-5fold increase in the risk of heart failure among diabetic patients which firstly descripted by the Framingham Heart Study 5 decades ago [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Despite the extensive research attention in diabetic cardiomyopathy recently [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], however, the full spectrum of possible pathogenesis and their relative contribution to the heart failure phenotype in diabetes are still incompletely understood.\u003c/p\u003e \u003cp\u003eThe long noncoding ribonucleic acids (lncRNAs), non-coding RNA longer than 200 nucleotides in length, which participate in multiple biological processes, including cell metabolism, cell proliferation, cell fate determination, cell apoptosis and cell death, result in a variety of pathological conditions, such as cancer, Alzheimer\u0026rsquo;s disease, emerge evidence has shown that lncRNAs regulated cardiac diseases [\u003cspan additionalcitationids=\"CR11 CR12\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Cardiac-related lncRNA-ZFAS1 (zinc finger antisense 1) was proved to associate with acute myocardial infarction [\u003cspan additionalcitationids=\"CR15 CR16\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Nevertheless, the mechanism between lncRNA-ZFAS1 with diabetic cardiomyopathy is still lacking.\u003c/p\u003e \u003cp\u003eOne of lncRNAs\u0026rsquo; significant function was action as competing endogenous RNAs (ceRNAs) to sponge macromolecules, such as micro-RNAs (miRNAs) and proteins [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], which associated with a range of physiological, biological and pathological processes, including cardiac diseases [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. A clinical research demonstrated that miR-150-5p was significantly reduced in patients with heart failure, and represented an independent predictor of heart failure [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Furthermore, miR-150-5p could mitigate apoptosis in sepsis-induced myocardial depression [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], alleviate the progression of myocardial fibrosis [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], rescue cardiomyocytes from hypoxia-induced injury under the command of lncRNAs FOXD3-AS1 [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. However, the role of miR-150-5p in diabetic cardiomyopathy and the relation with lncRNA-ZFAS1 have not been studied. Cyclin D2 (CCND2) could regulate the proliferation of cardiac myocytes [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], and is beneficial to the cardiac dysfunction [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], activates cell-cycle progression to enhance myocardial repair [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. However, the role of CCND2 in diabetic cardiomyopathy have not been studied.\u003c/p\u003e \u003cp\u003eFerroptosis, an iron-dependent regulated necrosis associated with a new form of regulatory cell death firstly described in 2012 [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], which could induce the pathological process of cancer, stroke, cardiovascular disease, and kidney failure [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Glutathione peroxidase 4 (GPX4) could terminated the process of ferroptosis which involved in caspase and necrosomal complex [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Recent report has demonstrated that inhibiting ferroptosis could decrease mitochondrial iron to alleviate DOX-induced cardiac injury [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], but its role in diabetic cardiomyopathy remains to be explored.\u003c/p\u003e \u003cp\u003eIn this study, we used HG-treated cardiomyocytes and db/db mice to simulate DCM \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e and investigated the identification of lncRNA-ZFAS1, which is upregulated during DCM, and show that inhibition of ZFAS1 alleviate the development of DCM by reducing ferroptosis via stabilizing miR-150-5p to activate CCND2.\u003c/p\u003e "},{"header":"Research Design And Methods","content":" \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eEthics and Animal Experiments\u003c/h2\u003e \u003cp\u003eThe Institutes of the First Affiliated Hospital of Wenzhou Medical University Health Guidelines on the Use of Laboratory Animals to guide for the humanitarian care of animals.\u003c/p\u003e \u003cp\u003eMale db/+ mice and db/db mice (7 weeks old, weight 24\u0026nbsp;g) were fed a normal diet for four weeks under a 14-hour light / 8-hour dark cycle at 24\u0026nbsp;\u0026deg;C which purchased from the Model Animal Research Center of Nanjing University (Nanjing, China). The equal volume adenovirus (Ad-ZFAS1, Ad-sh-ZFAS1, Ad-CCND2, Ad-sh-CCND2) were injected into the left ventricle free wall of mice (40\u0026micro;L respectively, 10\u0026micro;L for each of four sites). MiR-150-5p mimics and mimic control (NC) were injected into the tail vein of mice (50\u0026nbsp;\u0026micro;g/kg) for every 15 days for 12 weeks. Each group contains 8 mice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003ePrimary Culture of Neonatal Cardiomyocytes and Cell Transfection\u003c/h2\u003e \u003cp\u003ePrimary cardiomyocytes were isolated from the newborn (1- to 2-day-old) mice according to the professional article [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Cardiomyocytes were transfected with the adenovirus including Ad-ZFAS1, Ad-sh-ZFAS1, Ad-CCND2, Ad-sh-CCND2 (10\u0026micro;L/mL, MOI: 100:1, the titer of the adenoviruses was approximately 1.2\u0026thinsp;\u0026times;\u0026thinsp;1010 PFU/mL, Hanbio Technology Ltd. Shanghai, China) in serum-free Dulbecco's Modified Eagle Medium (DMEM) for 6\u0026ndash;8\u0026nbsp;h, the miR-150-5p mimics and mimic control (NC) (Sigma, St. Louis, MO, USA) were transfected into cardiomyocytes using Lipofectamine\u0026reg; 3000 (Invitrogen; Carlsbad, CA, USA), and then cultured in absence or presence of high glucose (HG, 25\u0026nbsp;mmol/L glucose).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eMicroarray-Based Gene Expression Data Analysis\u003c/h2\u003e \u003cp\u003eThe microarray data of diabetic and non-diabetic patients affected by heart failure (HF) based on the GSE26887, the micro-RNAs in pathophysiology of diabetic cardiomyopathy based on the GSE44179, the expression data from Rat ventricles 3 days, 28 days, and 42 days after STZ injection base on GSE4745, were acquired from the Gene Expression Omnibus (GEO) database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/geo/\u003c/span\u003e\u003c/span\u003e), differentially DCM-related genes were screened by Excel (Microsoft) with the threshold of |log2FC| \u0026gt;2.0 and adj.P.Val (P value after correction)\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eDual luciferase reporter assay\u003c/h2\u003e \u003cp\u003eThe online database StarBase v2.0 predicted the binding site of miR-150-5p with lncRNA-ZFAS1 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://starbase.sysu.edu.cn/agoClipRNA.php?source=lncRNA\u003c/span\u003e\u003c/span\u003e). MiR-150-5p was predicted to binding with CCND2 by online database TargetScan software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.targetscan.org/mamm_31/\u003c/span\u003e\u003c/span\u003e). Wide sequences (wt-ZFAS1 and wt-CCND2) and mutant sequences (mut-ZFAS1 and mut-CCND2) were designed and synthesized according to the predicted binding sites. The human embryonic kidney cell line (HEK293T cells, ATCC, Manassas, VA) were cultured in 24-well plates reached to 80% confluence, the miR-150-5p mimic (30 n M) or miR-138-5p mimic negative controls (30 n M, Gene-Pharma, Shanghai, China) using Lipofectamine 3000 regent (Thermo Fisher Scientific, USA) to co-transfected into HEK293T cells. After 48 hours, the luciferase activity was explored by the Dual-Luciferase Reporter Assay Kit (Promega, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real time PCR (qRT-PCR)\u003c/h2\u003e \u003cp\u003eThe expression of ZFAS1, CCND2 and miR-150-5p were measured by qRT-PCR. Total RNA in left ventricle tissue and cardiomyocytes was extracted using the TRIzol reagent (Invitrogen) and RNA extraction kit (TaKaRa), miRNA was extracted using the miRNeasy Mini Kit (Qiagen, Germany) from the total RNA. RT-qPCR was performed according to the manufacturer's protocal on a QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific, USA). The primer sequences were listed as below: ZFAS1 (forward: 5ʹ-ACGTGCAGACATCTACAAC CT-3ʹ and reverse: 5ʹ-TACTTCCAACACCCGCAT-3ʹ), miR-150-5p, forward: 5\u0026prime;-TCGG CGTC TCCC AACC CTTG TAC-3\u0026prime;, reverse: 5\u0026prime;-GTCG TATC CAGT GCAG GGTC CGAG GT-3\u0026prime;, CCND2 (forward: 5\u0026prime;AGAGCCACCGGTATGGAGCTGCTGTGCCACGAGGT 3\u0026prime;, reverse: 5\u0026prime;CTGCAGGCGCGCCGAATTTTTTTTTTAAGTTTCACCCT 3\u0026prime;).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eRNA pull-down assay\u003c/h2\u003e \u003cp\u003eBiotinylated wild-type miR-150-5p (Bio-wt-150-5p) or biotinylated mutant miR-150-5p (Bio-mut-150-5p) or biotinylated miRNA which not complementary to ZFAS1 (Bio-NC) were transfected into primary cardiomyocytes. Forty-eight hours after transfection, cardiomyocytes were obtained for biotin-based pull-down assay (Thermo Fisher Scientific, USA) according to the protocol. ZFAS1 expression levels were measured by real-time PCR.\u003c/p\u003e \u003cp\u003eMagnetic bead coated by a ZFAS1 probe or a random probe were added into cardiomyocytes lysate. MiR-150-5p was eluted from the streptavidin beads after washing and enrichment of beads/RNA complex. MiR-150-5p expression level was measured by Northern Blot (Thermo Fisher Scientific, USA) according to the protocol.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eCell immunofluorescence staining\u003c/h2\u003e \u003cp\u003eAfter fixed with 4% paraformaldehyde for 15 minutes, permeabilized with 0.5%Triton X-100 for 20 minutes, and blocked with 4% goat serum for 30 minutes at 37\u0026nbsp;\u0026deg;C, the adherent experimental cardiomyocytes were cultured with the primary antibody against Ferritin Heavy Chain (ab65080) at 4\u0026nbsp;\u0026deg;C overnight. Next day, after incubated with DyLight 488 and 594 AffiniPure Goat IgG (H\u0026thinsp;+\u0026thinsp;L) for 1\u0026nbsp;h at 37\u0026nbsp;\u0026deg;C and counterstained with 0.1\u0026nbsp;\u0026micro;g/mL DAPI (P36941; Invitrogen) for 3 minutes, images were measured by a Nikon Eclipse Ti-U fluorescence microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eHistology and immunohistochemistry\u003c/h2\u003e \u003cp\u003eAfter dewaxed in 60 ℃ incubator, hydrated with xylene and anhydrous ethanol, antigen repaired with Citrate Antigen Retrieval Solution Sections (Beyotime, China) Sections (5-mm thickness) of the left ventricular myocardial tissues were incubated with primary antibodies against Ferritin Heavy Chain (FTH1, ab65080), 4-Hydroxynonenal (4-HNE, ab46545) at 4\u0026nbsp;\u0026deg;C overnight. Next day, sections were incubated with secondary antibodies at 37\u0026nbsp;\u0026deg;C for 30 minutes and then stained with 3,3'-Diaminobenzidine (Gene Tech, China) at 37\u0026nbsp;\u0026deg;C for 5 minutes, photographed immediately in the dark using Nikon Eclipse Ti-U fluorescence microscope (Tokyo, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eMasson staining\u003c/h2\u003e \u003cp\u003eMasson staining was used to measure cardiac collagen content. After dewaxed in 60 ℃ incubator, hydrated with xylene and anhydrous ethanol, dyed with hematoxylin and Lichun red acid, Sections (5-mm thickness) of the left ventricular myocardial tissues were finally dyed with 1% phosphomolybdic acid, photographed immediately in the dark using Nikon Eclipse Ti-U fluorescence microscope (Tokyo, Japan). Collagen fibers were blue (aniline blue) or green (bright green), muscle fibers and cellulose were red.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eMonobromobimane (MBB) staining\u003c/h2\u003e \u003cp\u003eMBB staining was used to determine the glutathione (GSH) in cardiomyocytes. Cardiomyocytes were stained by MBB (20\u0026nbsp;\u0026micro;M; Sigma-Aldrich, USA) in PBS for 15 minutes at 37\u0026nbsp;\u0026deg;C, photographed immediately in the dark using Nikon Eclipse Ti-U fluorescence microscope (Tokyo, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eJC-1 staining\u003c/h2\u003e \u003cp\u003eJC-1 staining was used to determine the mitochondrial membrane potential. Cardiomyocytes were stained with JC-1 (MCE, NJ, USA) in PBS for 30\u0026nbsp;min at 37\u0026nbsp;\u0026deg;C, photographed immediately in the dark using Nikon Eclipse Ti-U fluorescence microscope (Tokyo, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eLeft ventricle tissue and cardiomyocytes were lysed to extract protein which separated by SDS-PAGE and then transferred onto 0.45\u0026nbsp;\u0026micro;m polyvinylidene difluoride transfer membranes (PVDF, Millipore, USA). After blocked and incubated with the primary antibodies, including GPX4 (ab125066), CCND2 (ab207604), cleaved caspase 3 (ab13847), Bcl-2 (ab32124), Bax (ab53154), and β-actin (ab8226) overnight at 4 ℃, PVDF membranes were incubated with a peroxidase-conjugated secondary antibody, including anti-mouse and anti-rabbit (Abbkine, Redlands, CA), finally visualized using an ECL Plus Detection Reagent (Sigma, United States).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eSPSS version 26.0 software (SPSS Inc, USA, IL) was used to analysis data which shown as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) and perform Student\u0026rsquo;s t test and ANOVA to show differences between two groups or multiple groups. All experiments were repeated at least three times and p values less than 0.05 were considered significant.\u003c/p\u003e \u003c/div\u003e "},{"header":"Results","content":" \u003cp\u003e \u003cb\u003eUpregulated ZFAS1 expression and increased ferroptosis involved in diabetic cardiomyopathy and HG-treated cardiomyocytes.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe differentially HF-related genes profiles in diabetic patients and non-diabetic patients were screened out from the GSE26887 in the GEO database, lncRNA-ZFAS1 was significantly upregulated in the diabetic patients with HF (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). To determine whether ZFAS1 was really involved in diabetic cardiomyopathy, the expression of ZFAS1 in the left ventricular myocardial tissues of db/db mice and HG-treated cardiomyocytes was determined by RT-qPCR. The result revealed that ZFAS1 was significantly upregulated at the same way (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-C).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD, FTH1, a key iron storage protein involved in iron metabolism and act as ferritinophagy biomarkers, was decreased in the left ventricular myocardial tissues of db/db mice evaluated by immunohistochemical staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). 4-hydroxynonenal (4-HNE), the final product of lipid hydroperoxidation, was increased in the left ventricular myocardial tissues of db/db mice evaluated by immunohistochemical staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Glutathione peroxidase 4 (GPX4), which could terminate the process of ferroptosis, was decreased in the left ventricular myocardial tissues of db/db mice measured by western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE-F). In keeping with \u003cem\u003ein vivo\u003c/em\u003e results, FTH1 was seen colocalized rarely in the cytoplasm in HG-treated cardiomyocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). We also observed a reduction in the expression of GPX4 in HG-treated cardiomyocytes measured by western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH-I). Taking together, we found that the expression of ZFAS1 was upregulated and ferroptosis was increased in diabetic cardiomyopathy and HG-treated cardiomyocytes.\u003c/p\u003e \u003cp\u003e \u003cb\u003eInhibition of ZFAS1 repressed ferroptosis in diabetic cardiomyopathy and HG-Treated Cardiomyocytes.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo further identify the function of ZFAS1 in the process of DCM, we injected Ad-ZFAS1, Ad-sh-ZFAS1 into the left ventricle free wall of mice. Masson staining showed a significant decrease of collagen deposition in the left ventricular myocardial tissues of db/db\u0026thinsp;+\u0026thinsp;Ad-ZFAS1 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Inhibition of ZFAS1 could restore the expression of FTH1, reduce the expression of 4-HNE evaluated by immunohistochemical staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), rescue the expression of GPX4 and inhibit the expression of apoptosis-related genes including Cleaved caspase 3, Bax, and Bcl-2 measured by western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-D). Inhibition of ZFAS1 in HG-treated cardiomyocytes could increase intracellular GSH levels assessed by MBB staining to a certain extent (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE), restore the distribution of FTH1 in the cytoplasm (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF), alleviate the mitochondrial membrane potential as revealed by the transition from red fluorescence to green fluorescence measured by JC-1 staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG), rescue the expression of GPX4 and inhibit the expression of apoptosis-related genes including Cleaved caspase 3, Bax, and Bcl-2 measured by western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH-I). Altogether, these results suggested that inhibition of ZFAS1 could prevent ferroptosis from diabetic cardiomyopathy and HG-treated cardiomyocytes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003elncRNA-ZFAS1 can bind with miR-150-5p to regulate expression of CCND2.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe differentially role of micro-RNAs profiles pathophysiology of diabetic cardiomyopathy were screened out from the GSE44179 in the GEO database, we found that miR-150-5p was substantial reduced (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). To determine whether miR-150-5p was really involved in diabetic cardiomyopathy, the expression of miR-150-5p in the left ventricular myocardial tissues of db/db mice and HG-treated cardiomyocytes was determined by RT-qPCR. The result revealed that miR-150-5p was significantly downregulated at the same way (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB-C).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo elucidate the potential molecular mechanism by which ZFAS1 and miR-150-5p regulated DM, we attempted to explore the underlying target bind site between ZFAS1 and miR-150-5p. The predicted bind site of miR-150-5p and ZFAS1 was displayed in the Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD analyzed by bioinformatic program TargetScan. Dual luciferase reporter assay demonstrated that transfection with miR-150-5p mimics significantly reduced the relative firefly luciferase activity of wt-ZFAS1 whereas the mut-ZFAS1 luciferase activity was not affected (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Further, we compared the sequences of ZFAS1 with that of miR-150-5p analyzed by the bioinformatics program RNAhybrid and investigated that ZFAS1 contains a binding site of miR-150-5p (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). What\u0026rsquo;s more, we performed a biotin-avidin pull-down assay to explore whether miR-150-5p could directly bind to ZFAS1. ZFAS1 was pulled down by biotinylated wild-type miR-150-5p, the inability of miR-150-5p to pull down ZFAS1 when introduction of miR-150-5p mutations that destroy base paring between ZFAS1 and miR-150-5p, indicating that the identification of miR-150-5p to ZFAS1 is sequence specific (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). We also performed inverse pull-down assay to test if ZFAS1 could pull-down miR-150-5p, the results showed that miR-150-5p could be co-precipitated by ZFAS1using a biotin-labeled-specific ZFAS1 probe (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH).\u003c/p\u003e \u003cp\u003eThe GSE44179 from GEO database presented us that CCND2 was significantly decreased in rat ventricles after STZ injection (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI). To determine whether CCND2 was really involved in diabetic cardiomyopathy, the expression of CCND2 in the left ventricular myocardial tissues of db/db mice and HG-treated cardiomyocytes was determined by western blot. The result revealed that CCND2 was significantly downregulated in the same way (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eJ-M). The bioinformatic program TargetScan provided information for the predicted binding site of miR-150-5p and CCND2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eN). Additionally, the dual-luciferase reporter assay demonstrated that transfection with miR-150-5p mimics significantly reduced the relative firefly luciferase activity of wt-CCND2 whereas the mut-CCND2 luciferase activity was not affected (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eO). These results supported that ZFAS1 can bind with miR-150-5p to regulate the expression of CCND2.\u003c/p\u003e \u003cp\u003e \u003cb\u003eZFAS1 promoted ferroptosis in diabetic cardiomyopathy and HG-treated Cardiomyocytes through modulating miR-150-5p.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eBecause of the interaction between ZFAS1 and miR-150-5p, we further explored whether ZFAS1 was able to regulate ferroptosis through miR-150-5p. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, stimulation of miR-150-5p significantly decreased collagen deposition in the left ventricular myocardial tissues of db/db mice which was similar to the function of ZFAS1 inhibition. However, stimulation of ZFAS1 definitely abolished the positive effect of miR-150-5p detected by Masson staining. Overexpression of miR-150-5p could restore the expression of FTH1, reduce the expression of 4-HNE evaluated by immunohistochemical staining as the function of inhibition of ZFAS1, whereas overexpression of ZFAS1 offset the positive effect of miR-150-5p (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Overexpression of miR-150-5p could rescue the expression of GPX4 and CCND2 and inhibit the expression of apoptosis-related genes including Cleaved caspase 3, Bax, and Bcl-2 measured by western blot which were similar to the function of ZFAS1, whereas overexpression of ZFAS1 counteracted the positive effect of miR-150-5p (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC-D).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSubsequently, we explored whether ZFAS1 regulate ferroptosis through miR-150-5p in HG-treated cardiomyocytes. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE, HG-treated cardiomyocytes transfected with Ad-sh-ZFAS1 or mimic miR-150-5p all made sense in the increase of intracellular GSH levels assessed by MBB staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE), whereas overexpression of ZFAS1 counteracted the positive effect of miR-150-5p. Moreover, Ad-ZFAS1 administration significantly reversed the effect of miR-150-5p, as demonstrated by a reduction in the expression of FTH1 as detected via immunofluorescence (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF), the decrease in mitochondrial membrane potential as detected via JC-1 staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG), a reduction in the expression of GPX4 and CCND2 and a reduction in the expression of apoptosis-related genes including Cleaved caspase 3, Bax, and Bcl-2 measured by western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH-I).\u003c/p\u003e \u003cp\u003eTaking together, these results indicated that inhibition of ZFAS1 could suppress ferroptosis in diabetic cardiomyopathy and HG-treated Cardiomyocytes through targeting miR-150-5p. lncRNA-ZFAS1 acted as a ceRNA to sponge miR-150-5p.\u003c/p\u003e \u003cp\u003e \u003cb\u003eZFAS1 promoted ferroptosis in diabetic cardiomyopathy and HG-treated Cardiomyocytes through modulating CCND2.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo further elucidate the role of CCND2 in the positive function of ZFAS1 inhibition against ferroptosis in diabetic cardiomyopathy and HG-treated Cardiomyocytes, the left ventricular myocardial tissues of db/db mice were injected with Ad-sh-ZFAS1, Ad-ZFAS1, Ad-CCND2, or Ad-sh-CCND2. Interestingly, overexpression of CCND2 exerted a marked effect in inhibition of ferroptosis likewise the function as the inhibition of ZFAS1, however, these effects were eliminated when stimulation of ZFAS1 corroborated by the increased collagen deposition measured by Masson staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), the decreased expression of FTH1 and increased the expression of 4-HNE measured by immunohistochemical staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB), the decreased expression of GPX4 and the increased expression of apoptosis-related genes including Cleaved caspase 3, Bax, and Bcl-2 measured by western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-D) in the left ventricular myocardial tissues of db/db mice, the decreased of intracellular GSH levels assessed by MBB staining(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE), the reduction expression of FTH1 as detected via immunofluorescence (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF), the decreased mitochondrial membrane potential as detected via JC-1 staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG), the reduction in the expression of GPX4 and the reduction in the expression of apoptosis-related genes including Cleaved caspase 3, Bax, and Bcl-2 measured by western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH-I). Cumulatively, these results demonstrated that ZFAS1 inhibition suppressed ferroptosis in diabetic cardiomyopathy and HG-treated Cardiomyocytes through modulating CCND2. lncRNA-ZFAS1 acted as a ceRNA to sponge miR-150-5p can regulate CCND2.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e "},{"header":"Discussion","content":" \u003cp\u003eDiabetes mellitus is an independent risk of heart failure (HF), while HF could accelerate diabetes mellitus cardiovascular complication [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], according to a report, 15%-35% of HF patients should blamed to diabetic patients [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. What\u0026rsquo;s more, diabetic cardiomyopathy is considered an indispensable pathophysiological state among diabetic patients which could result in the dysfunctional cardiomyocytes, abnormal myocardial and the final cardiac dysfunction characterized by left ventricular longitudinal dysfunction [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. However, the therapy or specific treatment of DCM in clinical is a considerable challenge. To date, there is still no identified molecular mechanism of DCM to guide the treatment of DCM. In the present study, we aimed to elucidate the role of lncRNA-ZFAS1, miR-150-5p, CCND2 in ferroptosis of cardiomyocytes in DCM. Specifically, inhibition of ZFAS1 could potentially alleviate myocardial fibrosis in DCM by inhibiting cardiomyocyte ferroptosis via sponging miR-150-5p to activate CCND2.\u003c/p\u003e \u003cp\u003eThese decade, the roles of lncRNAs were paid attention to various cardiovascular diseases, especially myocardial infarction (MI) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan additionalcitationids=\"CR38\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], but little is known about the role of lncRNAs in the pathogenesis of DCM. The GSE26887 from GEO database show that lncRNA-ZFAS1 was significantly upregulated in diabetic patients with HF, compared with non-diabetic patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). As we expected, ZFAS1 was also upregulated in diabetic cardiomyopathy and HG-treated cardiomyocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-C). ZFAS1 is one of cardiac-related lncRNAs, previously, knockdown of lncRNA-ZFAS1 prevents cardiomyocytes from MI [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Reports emphasized that ZFAS1 was upregulated to promote cardiac disease [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e] and induce mitochondria-mediated cardiomyocytes apoptosis [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFerroptosis, a unique cell death, characterized by the stimulation of reactive oxygen species (ROS) result in the mitochondria dysfunction induced by iron catalytic activity and lipid peroxidation [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Growing studies has shown that ferroptosis was also a critical form of cardiomyocytes death [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. In this study, we found that ferroptosis was accumulated in the left ventricular myocardial tissues of DCM and HG-treated cardiomyocytes, as demonstrated by the downregulation expression of iron storage protein FTH1 as determined by immunohistochemical staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD) and immunofluorescence staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG), the upregulation expression of the final product of lipid hydroperoxidation protein 4-HNE as determined by immunohistochemical staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD), the downregulation expression of the ferroptosis termination protein GPX4 determined by western blot analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE-F, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH-I).\u003c/p\u003e \u003cp\u003eMoreover, we found that the inhibition of ZFAS1 in db/db mice could attenuate ferroptosis in the left ventricular myocardial tissues of DCM and HG-treated cardiomyocytes based on the upregulation expression of FTH1 as determined by immunohistochemical staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB) and immunofluorescence staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF), the upregulation expression of the ferroptosis termination protein GPX4 as determined by western blot analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-D, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e-H-I), the increased intracellular GSH levels assessed by MBB staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE), the restoration of mitochondrial membrane potential measured by JC-1 staining, all the change related with ferroptosis resulted in the reduction of the collagen deposition to attenuate cardiac fibrosis in myocardial tissue as determined by Masson staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA) and the decreased expression of apoptosis-related genes including Cleaved caspase 3, Bax, and Bcl-2 measured by western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-D, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e-H-I).\u003c/p\u003e \u003cp\u003eEmerging evidence has shown that miR-150-5p involved in heart disease and HF [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. The GSE44179 from GEO database and the RT-qPCR of left ventricular myocardial tissues of db/db mice and HG-treated cardiomyocytes all show that miR-150-5p was significantly downregulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-C). Type D cyclins regulate the transition of cell cycle from G1 to S, while overexpression of CCND2 (cyclin D2) can activate the cell cycle of cardiomyocytes [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. The GSE4745 from GEO database and the RT-qPCR of left ventricular myocardial tissues of db/db mice and HG-treated cardiomyocytes all show that CCND2 was significantly downregulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI-M). Further, we identified that ZFAS1 can bind with miR-150-5p to regulate expression of CCND2 as determined by RNA Pull-down assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG-H), dual luciferase reporter assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, O), RNAhybrid program (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF) and TargetScan program (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD, N).\u003c/p\u003e \u003cp\u003eMore importantly, overexpression of miR-150-5p and CCND2 significantly alleviated ferroptosis which was similar to the function of ZFAS1 inhibition in db/db mice and HG-treated Cardiomyocytes, however, these positive effects were eliminated when stimulation of ZFAS1 based on the downregulation expression of FTH1 as determined by immunohistochemical staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB) and immunofluorescence staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF), the downregulation expression of the ferroptosis termination protein GPX4 as determined by western blot analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC-D and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH-I, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-D and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH-I), the decreased intracellular GSH levels assessed by MBB staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE), the reduction of mitochondrial membrane potential measured by JC-1 staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG), all the change related with ferroptosis resulted in the accumulation of the collagen deposition which induce cardiac fibrosis in myocardial tissue as determined by Masson staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA) and the increased expression of apoptosis-related genes including Cleaved caspase 3, Bax, and Bcl-2 measured by western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC-D and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH-I, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-D and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH-I). Such findings strongly supported that inhibition of ZFAS1 could inhibit cardiomyocytes ferroptosis by sponging miR-150-5p to activate CCND2 against diabetic cardiomyopathy (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e "},{"header":"Conclusion","content":" \u003cp\u003eTogether, all these results strongly suggested that simulation of ZFAS1 indeed promote ferroptosis in DCM, lncRNA-ZFAS1 acted as a ceRNA to sponge miR-150-5p can regulate CCND2. Most important of all, inhibition of ZFAS1 could suppress cardiomyocytes ferroptosis and attenuated DCM progress. The ability to target lncRNA-ZFAS1 will pave the way for the novel treatment of DCM.\u003c/p\u003e "},{"header":"Abbreviations","content":"\u003cp\u003eDCM: Diabetic cardiomyopathy; HG: High glucose; lncRNAs: The long noncoding ribonucleic acids; ZFAS1: zinc finger antisense 1; ceRNAs: competing endogenous RNAs; miRNAs: micro-RNAs; GPX4: Glutathione peroxidase 4; GEO: Gene Expression Omnibus; FTH1: Ferritin Heavy Chain; 4-HNE: 4-Hydroxynonenal; GSH: glutathione; MBB: Monobromobimane.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal experiments were approved by the Institutes of the First Affiliated Hospital of Wenzhou Medical University Health Guidelines on the Use of Laboratory Animals.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors have declared their Consent for this publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data and materials are available upon request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNone.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTingjuan Ni and Zhiongqiu Lu designed the study. Tingjuan Ni, Xiaorong Chen, Xingxiao Huang, and Sunlei Pan carried out the in vitro and in vivo experiment. Tingjuan Ni and Xingxiao Huang analyzed the data. Tingjuan Ni and Xiaorong Chen designed the study and drafted the paper. All authors reviewed and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003e Department of Emergency Intensive Care Unit, the First Affiliated Hospital, Wenzhou Medical University, Wenzhou, Zhejiang, China. \u003csup\u003e2\u003c/sup\u003e Department of Cardiology, Zhejiang University, Hangzhou, Zhejiang, China. \u003csup\u003e3\u003c/sup\u003e Department of Coronary Care Unit, the First Affiliated Hospital, Wenzhou Medical University, Wenzhou, Zhejiang, China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the National Natural Science Foundation of China (No. 81772112).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eRitchie RH, Abel ED: \u003cstrong\u003eBasic Mechanisms of Diabetic Heart Disease\u003c/strong\u003e. \u003cem\u003eCIRC RES\u003c/em\u003e 2020, \u003cstrong\u003e126\u003c/strong\u003e(11):1501-1525.\u003c/li\u003e\n\u003cli\u003eKannel WB, Hjortland M, Castelli WP: \u003cstrong\u003eRole of diabetes in congestive heart failure: The Framingham study\u003c/strong\u003e. \u003cem\u003eThe American Journal of Cardiology\u003c/em\u003e 1974, \u003cstrong\u003e34\u003c/strong\u003e(1):29-34.\u003c/li\u003e\n\u003cli\u003eCho NH, Shaw JE, Karuranga S, Huang Y, Da Rocha Fernandes JD, Ohlrogge AW, Malanda B: \u003cstrong\u003eIDF Diabetes Atlas: Global estimates of diabetes prevalence for 2017 and projections for 2045\u003c/strong\u003e. \u003cem\u003eDIABETES RES CLIN PR\u003c/em\u003e 2018, \u003cstrong\u003e138\u003c/strong\u003e:271-281.\u003c/li\u003e\n\u003cli\u003eNi T, Lin N, Huang X, Lu W, Sun Z, Zhang J, Lin H, Chi J, Guo H: \u003cstrong\u003eIcariin Ameliorates Diabetic Cardiomyopathy Through Apelin/Sirt3 Signalling to Improve Mitochondrial Dysfunction\u003c/strong\u003e. \u003cem\u003eFRONT PHARMACOL\u003c/em\u003e 2020, \u003cstrong\u003e11\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eVarinder Kaur Randhawa SD: \u003cstrong\u003eHow Diabetes and Heart Failure Modulate Each Other and Condition Management\u003c/strong\u003e. \u003cem\u003eCAN J CARDIOL\u003c/em\u003e 2020, \u003cstrong\u003e20\u003c/strong\u003e(S0828-282X):31115-31116.\u003c/li\u003e\n\u003cli\u003eOhkuma T, Komorita Y, Peters SAE, Woodward M: \u003cstrong\u003eDiabetes as a risk factor for heart failure in women and men: a systematic review and meta-analysis of 47 cohorts including 12 million individuals\u003c/strong\u003e. \u003cem\u003eDIABETOLOGIA\u003c/em\u003e 2019, \u003cstrong\u003e62\u003c/strong\u003e(9):1550-1560.\u003c/li\u003e\n\u003cli\u003eLeon BM: \u003cstrong\u003eDiabetes and cardiovascular disease: Epidemiology, biological mechanisms, treatment recommendations and future research\u003c/strong\u003e. \u003cem\u003eWorld Journal of Diabetes\u003c/em\u003e 2015, \u003cstrong\u003e6\u003c/strong\u003e(13):1246.\u003c/li\u003e\n\u003cli\u003eZamora M, Villena JA: \u003cstrong\u003eContribution of Impaired Insulin Signaling to the Pathogenesis of Diabetic Cardiomyopathy\u003c/strong\u003e. \u003cem\u003eINT J MOL SCI\u003c/em\u003e 2019, \u003cstrong\u003e20\u003c/strong\u003e(11).\u003c/li\u003e\n\u003cli\u003ePeterson LR, Gropler RJ: \u003cstrong\u003eMetabolic and Molecular Imaging of the Diabetic Cardiomyopathy\u003c/strong\u003e. \u003cem\u003eCIRC RES\u003c/em\u003e 2020, \u003cstrong\u003e126\u003c/strong\u003e(11):1628-1645.\u003c/li\u003e\n\u003cli\u003eKumarswamy R, Bauters C, Volkmann I, Maury F, Fetisch J, Holzmann A, Lemesle G, de Groote P, Pinet F, Thum T: \u003cstrong\u003eCirculating Long Noncoding RNA, LIPCAR, Predicts Survival in Patients With Heart Failure\u003c/strong\u003e. \u003cem\u003eCIRC RES\u003c/em\u003e 2014, \u003cstrong\u003e114\u003c/strong\u003e(10):1569-1575.\u003c/li\u003e\n\u003cli\u003eUchida S, Dimmeler S: \u003cstrong\u003eLong Noncoding RNAs in Cardiovascular Diseases\u003c/strong\u003e. \u003cem\u003eCIRC RES\u003c/em\u003e 2015, \u003cstrong\u003e116\u003c/strong\u003e(4):737-750.\u003c/li\u003e\n\u003cli\u003eShah RV, Rong J, Larson MG, Yeri A, Ziegler O, Tanriverdi K, Murthy V, Liu X, Xiao C, Pico AR\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eAssociations of Circulating Extracellular RNAs With Myocardial Remodeling and Heart Failure\u003c/strong\u003e. \u003cem\u003eJAMA CARDIOL\u003c/em\u003e 2018, \u003cstrong\u003e3\u003c/strong\u003e(9):871.\u003c/li\u003e\n\u003cli\u003eZhang Y, Du W, Yang B: \u003cstrong\u003eLong non-coding RNAs as new regulators of cardiac electrophysiology and arrhythmias: Molecular mechanisms, therapeutic implications and challenges\u003c/strong\u003e. \u003cem\u003ePHARMACOL THERAPEUT\u003c/em\u003e 2019, \u003cstrong\u003e203\u003c/strong\u003e:107389.\u003c/li\u003e\n\u003cli\u003eWu T, Wu D, Wu Q, Zou B, Huang X, Cheng X, Wu Y, Hong K, Li P, Yang R\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eKnockdown of Long Non-Coding RNA-ZFAS1 Protects Cardiomyocytes Against Acute Myocardial Infarction Via Anti-Apoptosis by Regulating miR-150/CRP\u003c/strong\u003e. \u003cem\u003eJ CELL BIOCHEM\u003c/em\u003e 2017, \u003cstrong\u003e118\u003c/strong\u003e(10):3281-3289.\u003c/li\u003e\n\u003cli\u003eZhang Y, Jiao L, Sun L, Li Y, Gao Y, Xu C, Shao Y, Li M, Li C, Lu Y\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eLncRNA ZFAS1 as a SERCA2a Inhibitor to Cause Intracellular Ca2+ Overload and Contractile Dysfunction in a Mouse Model of Myocardial Infarction\u003c/strong\u003e. \u003cem\u003eCIRC RES\u003c/em\u003e 2018.\u003c/li\u003e\n\u003cli\u003eJiao L, Li M, Shao Y, Zhang Y, Gong M, Yang X, Wang Y, Tan Z, Sun L, Xuan L\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003elncRNA-ZFAS1 induces mitochondria-mediated apoptosis by causing cytosolic Ca2+ overload in myocardial infarction mice model\u003c/strong\u003e. \u003cem\u003eCELL DEATH DIS\u003c/em\u003e 2019, \u003cstrong\u003e10\u003c/strong\u003e(12).\u003c/li\u003e\n\u003cli\u003eWang J, Ruan J, Zhu M, Yang J, Du S, Xu P, Zhang Z, Wang P, Yang W, Yu M: \u003cstrong\u003ePredictive value of long noncoding RNA ZFAS1 in patients with ischemic stroke\u003c/strong\u003e. \u003cem\u003eCLIN EXP HYPERTENS\u003c/em\u003e 2019, \u003cstrong\u003e41\u003c/strong\u003e(7):615-621.\u003c/li\u003e\n\u003cli\u003eSalmena L, Poliseno L, Tay Y, Kats L, Pandolfi PP: \u003cstrong\u003eA ceRNA hypothesis: the Rosetta Stone of a hidden RNA language?\u003c/strong\u003e\u003cem\u003eCELL\u003c/em\u003e 2011, \u003cstrong\u003e146\u003c/strong\u003e(3):353-358.\u003c/li\u003e\n\u003cli\u003eOng S, Katwadi K, Kwek X, Ismail NI, Chinda K, Ong S, Hausenloy DJ: \u003cstrong\u003eNon-coding RNAs as therapeutic targets for preventing myocardial ischemia-reperfusion injury\u003c/strong\u003e. \u003cem\u003eEXPERT OPIN THER TAR\u003c/em\u003e 2018, \u003cstrong\u003e22\u003c/strong\u003e(3):247-261.\u003c/li\u003e\n\u003cli\u003eNiu X, Pu S, Ling C, Xu J, Wang J, Sun S, Yao Y, Zhang Z: \u003cstrong\u003elncRNA Oip5\u003c/strong\u003e\u003cstrong\u003e‐\u003c/strong\u003e\u003cstrong\u003eas1 attenuates myocardial ischaemia/reperfusion injury by sponging miR\u003c/strong\u003e\u003cstrong\u003e‐\u003c/strong\u003e\u003cstrong\u003e29a to activate the SIRT1/AMPK/PGC1\u003c/strong\u003e\u003cstrong\u003e\u0026alpha;\u003c/strong\u003e\u003cstrong\u003e pathway\u003c/strong\u003e. \u003cem\u003eCELL PROLIFERAT\u003c/em\u003e 2020, \u003cstrong\u003e53\u003c/strong\u003e(6).\u003c/li\u003e\n\u003cli\u003eAbu-Halima M, Meese E, Saleh MA, Keller A, Abdul-Khaliq H, Raedle-Hurst T: \u003cstrong\u003eMicro-RNA 150-5p predicts overt heart failure in patients with univentricular hearts\u003c/strong\u003e. \u003cem\u003ePLOS ONE\u003c/em\u003e 2019, \u003cstrong\u003e14\u003c/strong\u003e(10):e223606.\u003c/li\u003e\n\u003cli\u003eZhu XG, Zhang TN, Wen R, Liu CF: \u003cstrong\u003eOverexpression of miR-150-5p Alleviates Apoptosis in Sepsis-Induced Myocardial Depression\u003c/strong\u003e. \u003cem\u003eBIOMED RES INT\u003c/em\u003e 2020, \u003cstrong\u003e2020\u003c/strong\u003e:1-10.\u003c/li\u003e\n\u003cli\u003eShen J, Xing W, Gong F, Wang W, Yan Y, Zhang Y, Xie C, Fu S: \u003cstrong\u003eMiR-150-5p retards the progression of myocardial fibrosis by targeting EGR1\u003c/strong\u003e. \u003cem\u003eCELL CYCLE\u003c/em\u003e 2019, \u003cstrong\u003e18\u003c/strong\u003e(12):1335-1348.\u003c/li\u003e\n\u003cli\u003eZheng J, Peng B, Zhang Y, Ai F, Hu X: \u003cstrong\u003eFOXD3-AS1 Knockdown Suppresses Hypoxia-Induced Cardiomyocyte Injury by Increasing Cell Survival and Inhibiting Apoptosis via Upregulating Cardioprotective Molecule miR-150-5p In Vitro\u003c/strong\u003e. \u003cem\u003eFRONT PHARMACOL\u003c/em\u003e 2020, \u003cstrong\u003e11\u003c/strong\u003e:1284.\u003c/li\u003e\n\u003cli\u003eBUSK P, HINRICHSEN R, BARTKOVA J, HANSEN A, CHRISTOFFERSEN T, BARTEK J, HAUNSO S: \u003cstrong\u003eCyclin D2 induces proliferation of cardiac myocytes and represses hypertrophy\u003c/strong\u003e. \u003cem\u003eEXP CELL RES\u003c/em\u003e 2005, \u003cstrong\u003e304\u003c/strong\u003e(1):149-161.\u003c/li\u003e\n\u003cli\u003eYamak A, Temsah R, Maharsy W, Caron S, Paradis P, Aries A, Nemer M: \u003cstrong\u003eCyclin D2 rescues size and function of GATA4 haplo-insufficient hearts\u003c/strong\u003e. \u003cem\u003eAM J PHYSIOL-HEART C\u003c/em\u003e 2012, \u003cstrong\u003e303\u003c/strong\u003e(8):H1057-H1066.\u003c/li\u003e\n\u003cli\u003eZhu W, Zhao M, Mattapally S, Chen S, Zhang J: \u003cstrong\u003eCCND2 Overexpression Enhances the Regenerative Potency of Human Induced Pluripotent Stem Cell\u003c/strong\u003e\u003cstrong\u003e\u0026ndash;\u003c/strong\u003e\u003cstrong\u003eDerived Cardiomyocytes\u003c/strong\u003e. \u003cem\u003eCIRC RES\u003c/em\u003e 2018, \u003cstrong\u003e122\u003c/strong\u003e(1):88-96.\u003c/li\u003e\n\u003cli\u003eDixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, Patel DN, Bauer AJ, Cantley AM, Yang WS\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eFerroptosis: an iron-dependent form of nonapoptotic cell death\u003c/strong\u003e. \u003cem\u003eCELL\u003c/em\u003e 2012, \u003cstrong\u003e149\u003c/strong\u003e(5):1060-1072.\u003c/li\u003e\n\u003cli\u003eParas K. Mishra AAJA: \u003cstrong\u003eGuidelines for evaluating myocardial cell death\u003c/strong\u003e. \u003cem\u003eAM J PHYSIOL-HEART C\u003c/em\u003e 2019, \u003cstrong\u003e317\u003c/strong\u003e(5).\u003c/li\u003e\n\u003cli\u003eHao Zhang PZSW: \u003cstrong\u003eRole of Iron metabolism in heart failure: From Iron deficiency to\u003c/strong\u003e\u003cstrong\u003eIron overload\u003c/strong\u003e. \u003cem\u003eBIOCHIMICA ET BIOPHYSICA ACTA-MOLECULAR BASIS OF DISEASE \u003c/em\u003e2018, \u003cstrong\u003e1865\u003c/strong\u003e(7):1925-1937.\u003c/li\u003e\n\u003cli\u003eStockwell BR, Friedmann AJ, Bayir H, Bush AI, Conrad M, Dixon SJ, Fulda S, Gascon S, Hatzios SK, Kagan VE\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eFerroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease\u003c/strong\u003e. \u003cem\u003eCELL\u003c/em\u003e 2017, \u003cstrong\u003e171\u003c/strong\u003e(2):273-285.\u003c/li\u003e\n\u003cli\u003eFang X, Wang H, Han D, Xie E, Yang X, Wei J, Gu S, Gao F, Zhu N, Yin X\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eFerroptosis as a target for protection against cardiomyopathy\u003c/strong\u003e. \u003cem\u003eP NATL ACAD SCI USA\u003c/em\u003e 2019, \u003cstrong\u003e116\u003c/strong\u003e(7):2672-2680.\u003c/li\u003e\n\u003cli\u003eLeone M, Engel FB: \u003cstrong\u003eIsolation, Culture, and Live-Cell Imaging of Primary Rat Cardiomyocytes\u003c/strong\u003e. \u003cem\u003eMethods Mol Biol\u003c/em\u003e 2021, \u003cstrong\u003e2158\u003c/strong\u003e:109-124.\u003c/li\u003e\n\u003cli\u003eCohen-Solal A, Beauvais F, Logeart D: \u003cstrong\u003eHeart Failure and Diabetes Mellitus: Epidemiology and Management of an Alarming Association\u003c/strong\u003e. \u003cem\u003eJ CARD FAIL\u003c/em\u003e 2008, \u003cstrong\u003e14\u003c/strong\u003e(7):615-625.\u003c/li\u003e\n\u003cli\u003eDillmann WH: \u003cstrong\u003eDiabetic Cardiomyopathy\u003c/strong\u003e. \u003cem\u003eCIRC RES\u003c/em\u003e 2019, \u003cstrong\u003e124\u003c/strong\u003e(8):1160-1162.\u003c/li\u003e\n\u003cli\u003eTanaka H, Tatsumi K, Matsuzoe H, Matsumoto K, Hirata K: \u003cstrong\u003eImpact of diabetes mellitus on left ventricular longitudinal function of patients with non-ischemic dilated cardiomyopathy\u003c/strong\u003e. \u003cem\u003eCARDIOVASC DIABETOL\u003c/em\u003e 2020, \u003cstrong\u003e19\u003c/strong\u003e(1).\u003c/li\u003e\n\u003cli\u003eMao Q, Liang X, Zhang C, Pang Y, Lu Y: \u003cstrong\u003eLncRNA KLF3-AS1 in human mesenchymal stem cell-derived exosomes ameliorates pyroptosis of cardiomyocytes and myocardial infarction through miR-138-5p/Sirt1 axis\u003c/strong\u003e. \u003cem\u003eSTEM CELL RES THER\u003c/em\u003e 2019, \u003cstrong\u003e10\u003c/strong\u003e(1).\u003c/li\u003e\n\u003cli\u003eSun L, Zhu W, Zhao P, Wang Q, Fan B, Zhu Y, Lu Y, Chen Q, Zhang J, Zhang F: \u003cstrong\u003eLong noncoding RNA UCA1 from hypoxia-conditioned hMSC-derived exosomes: a novel molecular target for cardioprotection through miR-873-5p/XIAP axis\u003c/strong\u003e. \u003cem\u003eCELL DEATH DIS\u003c/em\u003e 2020, \u003cstrong\u003e11\u003c/strong\u003e(8):696.\u003c/li\u003e\n\u003cli\u003eSong Y, Wang B, Zhu X, Hu J, Sun J, Xuan J, Ge Z: \u003cstrong\u003eHuman umbilical cord blood\u003c/strong\u003e\u003cstrong\u003e\u0026ndash;\u003c/strong\u003e\u003cstrong\u003ederived MSCs exosome attenuate myocardial injury by inhibiting ferroptosis in acute myocardial infarction mice\u003c/strong\u003e. \u003cem\u003eCELL BIOL TOXICOL\u003c/em\u003e 2020.\u003c/li\u003e\n\u003cli\u003eTim Vervliet ELRH: \u003cstrong\u003eLnc\u003c/strong\u003e\u003cstrong\u003e\u0026rsquo;\u003c/strong\u003e\u003cstrong\u003eing Ca 2+ , SERCA and cardiac disease\u003c/strong\u003e. \u003cem\u003eCELL CALCIUM\u003c/em\u003e 2018(72):132-134.\u003c/li\u003e\n\u003cli\u003eWang Z, Chen X, Liu N, Shi Y, Liu Y, Ouyang L, Tam S, Xiao D, Liu S, Wen F\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eA Nuclear Long Non-Coding RNA LINC00618 Accelerates Ferroptosis in a Manner Dependent upon Apoptosis\u003c/strong\u003e. \u003cem\u003eMOL THER\u003c/em\u003e 2020.\u003c/li\u003e\n\u003cli\u003eConrad M, Proneth B: \u003cstrong\u003eBroken hearts: Iron overload, ferroptosis and cardiomyopathy\u003c/strong\u003e. \u003cem\u003eCELL RES\u003c/em\u003e 2019, \u003cstrong\u003e29\u003c/strong\u003e(4):263-264.\u003c/li\u003e\n\u003cli\u003eBaba Y, Higa JK, Shimada BK, Horiuchi KM, Suhara T, Kobayashi M, Woo JD, Aoyagi H, Marh KS, Kitaoka H\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eProtective effects of the mechanistic target of rapamycin against excess iron and ferroptosis in cardiomyocytes\u003c/strong\u003e. \u003cem\u003eAM J PHYSIOL-HEART C\u003c/em\u003e 2018, \u003cstrong\u003e314\u003c/strong\u003e(3):H659-H668.\u003c/li\u003e\n\u003cli\u003eTianxiao Huan JRKT: \u003cstrong\u003eDissecting the Roles of MicroRNAs in Coronary Heart Disease via Integrative Genomic\u003c/strong\u003e\u003cstrong\u003eDissecting the Roles of MicroRNAs in Coronary Heart Disease via Integrative Genomic\u003c/strong\u003e\u003cstrong\u003eAnalyses\u003c/strong\u003e. \u003cem\u003eArterioscler Thromb Vasc Biol\u003c/em\u003e 2015, \u003cstrong\u003e4\u003c/strong\u003e(35):1011-1021.\u003c/li\u003e\n\u003cli\u003eDomenico Scrutinio FCAP: \u003cstrong\u003eCirculating microRNA-150-5p as a novel\u003c/strong\u003e\u003cstrong\u003ebiomarker for advanced heart failure. A genome-wide prospective studymiR-150-5p in advanced\u003c/strong\u003e\u003cstrong\u003eheart failure\u003c/strong\u003e. \u003cem\u003eJ Heart Lung Transplant\u003c/em\u003e 2017, \u003cstrong\u003e6\u003c/strong\u003e(36):616-624.\u003c/li\u003e\n\u003cli\u003eChengming Fan VGFY: \u003cstrong\u003eCardiomyocytes from CCND2-overexpressing human induced-\u003c/strong\u003e\u003cstrong\u003epluripotent stem cells repopulate the myocardial scar in mice: A\u003c/strong\u003e\u003cstrong\u003e6-month study\u003c/strong\u003e. 2019(137):25-33.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Diabetic cardiomyopathy, lncRNA-ZFAS1, Ferroptosis, miR-150-5p, CCND2","lastPublishedDoi":"10.21203/rs.3.rs-144450/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-144450/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eDiabetic cardiomyopathy (DCM) needs to be responsible for the increasing morbidity and mortality in diabetic patients with heart failure. Unfortunately, the pathogenesis of DCM has yet to be elaborate. Here we investigate the important role of lncRNA-ZFAS1 in the pathological process of DCM associated with ferroptosis.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eMicroarray data analysis of DCM in the patients or mice model from GEO was presented that ZFAS1 was significantly upregulated, miR-150-5p and CCND2 were significantly downregulated. High glucose (HG)-treated cardiomyocytes and db/db mice were simulated DCM \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. Ad-ZFAS1, Ad-sh-ZFAS1, mimic miR-150-5p, Ad-CCND2, Ad-sh-CCND2 were injected into mice model or transfected into HG-treated Cardiomyocytes to clarify whether ZFAS1 can regulate miR-150-5p and CCND2 on ferroptosis. Effect of ZFAS1 on the left ventricular myocardial tissues in db/db mice and HG-treated cardiomyocytes, ferroptosis and apoptosis was determined by Masson staining, immunohistochemical staining, western blot, MBB staining, immunofluorescence staining and JC-1staining. The relationship among ZFAS1, miR-150-5p, CCND2 was identified by dual luciferase reporter assay and RNA Pull-down assay.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eInhibition of ZFAS1 led to the reduced collagen deposition, decreased cardiomyocytes apoptosis, ferroptosis and attenuated the DCM progress. ZFAS1 can sponge miR-150-5p to regulate CCND2 expression. Ad-sh-ZFAS1, miR-150-5p mimic and Ad-CCND2 transfection contributed to attenuate ferroptosis and DCM both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e, while transfection Ad-ZFAS1could reverse the positive effect of miR-150-5p mimic and Ad-CCND2 both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo.\u003c/em\u003e\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003elncRNA-ZFAS1 acted as a ceRNA to sponge miR-150-5p can regulate CCND2 to promote cardiomyocytes ferroptosis and developed DCM, and inhibition of ZFAS1 could be a promising therapeutic target for the treatment and prevention of DCM.\u003c/p\u003e","manuscriptTitle":"Inhibition of the Long non-coding RNA ZFAS1 attenuates pathogenic ferroptosis by sponging miR-150-5p to activate CCND2 against diabetic cardiomyopathy","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-01-15 16:01:10","doi":"10.21203/rs.3.rs-144450/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8e1922b5-09c7-4e42-b088-6acf6ae9c6f0","owner":[],"postedDate":"January 15th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":1913069,"name":"Cardiac \u0026 Cardiovascular Systems"},{"id":1913070,"name":"Critical Care \u0026 Emergency Medicine"},{"id":1913071,"name":"Endocrinology \u0026 Metabolism"}],"tags":[],"updatedAt":"2021-01-15T16:01:11+00:00","versionOfRecord":[],"versionCreatedAt":"2021-01-15 16:01:10","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-144450","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-144450","identity":"rs-144450","version":["v1"]},"buildId":"J0_U0BvcaRcwD8yVFaRlm","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00