Valproic Acid inhibits proliferation and promotes apoptosis of peripheral T cell lymphoma cells via the miRNA-3196/KCNK3 signaling axis

Valproic Acid inhibits proliferation and promotes apoptosis of peripheral T cell lymphoma cells via the miRNA-3196/KCNK3 signaling axis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Valproic Acid inhibits proliferation and promotes apoptosis of peripheral T cell lymphoma cells via the miRNA-3196/KCNK3 signaling axis Zhiqiang Peng, Hanzhi Dong, Jianping Xiong This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4552320/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 3 You are reading this latest preprint version Abstract Objective The aim of this study was to clarify the treatment effect and potential mechanism of Alproic acid (VPA) on peripheral T cell lymphomas (PTCLs). Methods CCK-8 and EdU were used to detect cell proliferation. The mRNA expression of miR-3196 and KCNK3 was detected by qRT-PCR. Biochemical experiments were used to detect changes in the content of ATP, lactate level, and glucose content. Flow cytometry was applied to determine the apoptotic rate and ROS levels. Western blot was used to detect the protein expression of apoptotic proteins, PI3K/AKT pathway and KCNK3. GEO database and miRTarBase and starbase2.0 software were used to identify the target genes of miR-3196. Results VPA greatly inhibited PTCLs cells proliferation and promoted the expression of miR-3196 in a dose-dependent manner. Compared with the control group, VPA and miR-3196 mimics significantly increased the apoptosis rate, Bax and cleaved-caspase-3 expression, lactate level, ROS expression, and glucose content ( P < 0.01), and significantly decreased the cell proliferation, ATP production, and the expression of Bcl-2, p-PI3K and p-AKT ( P < 0.01) in the PTCLs cells. However, the miR-3196 inhibitor had the opposite effect to VPA and mimics. Moreover, the combination of VPA and miR-3196 mimics has the most obvious effect. Moreover, KCNK3 was found to be a potential target gene of miR-3196. VPA and miR-3196 mimics significantly inhibited the expression of KCNK3( P < 0.01), and miR-3196 inhibitor the expression of KCNK3( P < 0.01). Furthermore, si-KCNK3 promoted apoptosis and inhibited proliferation and activation of PI3K/Akt signaling pathways of PTCLs cells( P < 0.01). VPA could significantly enhance the effect of si-KCNK3 in PTCLs cells( P < 0.01). Conclusion VPA could inhibit the expression of KCNK3 by promoting the expression of miR-3196, and then inhibit the activation of PI3K/Akt pathway, ultimately promoting apoptosis and inhibiting proliferation of PTCLs cells. Alproic acid (VPA) peripheral T cell lymphomas (PTCLs) PI3K/Akt pathway apoptosis cell proliferation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1 Introduction Peripheral T cell lymphomas (PTCLs) are a group of heterogeneous lymphoproliferative diseases caused by mature T cells or natural killer cells, accounting for about 10–15% of the total malignant lymphoma[ 1 , 2 ]. The incidence of PTCL has distinct geographical and ethnic characteristics, accounting for 25–30% of non-Hodgkin lymphoma (NHL) incidence in the oriental population[ 3 , 4 ], which is significantly higher than 10–15% reported in European and American countries[ 5 , 6 ]. As PTCL has diverse clinical symptoms, PTCL could affect upper digestive tract to induce esophageal stricture and dysphagia[ 7 ]. The symptoms of digestive lymphoma are similar to that of Crohn’s disease[ 8 ]. It is prone to missed diagnosis and misdiagnosis. The main frontline therapies include brentuximab vedotin [ 9 ], histone deacetylase inhibitors [ 10 ], pralatrexate [ 11 ], mogamulizumab [ 12 ], alemtuzumab [ 13 ], lenalidomide [ 14 ], PI3Ki [ 15 ], and consolidative stem cell transplantation [ 16 ]. However, its overall treatment efficacy is still poor, with a 5-year survival of only 10–30% [ 17 ]. Further studies are needed to investigate the pathogenesis of PTCLs, which are of great significance for the prevention and treatment of PTCLs. Alproic acid (VPA) is a commonly used antiepileptic drug in clinics. Due to its histone deacetyltransferase inhibitor function, its potential antitumor effect has been widely valued. Many studies demonstrated that VPA has a certain antitumor effect [ 18 – 20 ]. In the combined treatment research of VPA and other chemotherapeutics, it is found that VPA itself has the effect of inhibiting tumor cells, and it can also increase the sensitivity of tumor cells to certain chemotherapeutic drugs and reduce the drug resistance of tumor cells[ 21 , 22 ]. Many studies revealed that VPA could regulate the expression of miRNAs in tumor cells to play an antitumor role [ 23 – 25 ]. miR-3196 is closely related to cancer grade, and its expression was significantly lower in low-grade cancer than in high-grade cancer[ 26 ]. Many studies demonstrated that inhibition of miR-3196 can promote the progression of lung adenocarcinoma[ 27 ], liver cancer[ 28 ], gastric cancer[ 29 ] and pancreatic cancer[ 30 ]. miR-3196 maybe act as a tumor suppressor and predicts survival outcomes in cancer patients[ 29 ]. However, the effects of VPA on miRNA-3196 in PTCLs and their specific regulatory mechanisms are currently poorly studied and still need further study. In this study, we used VPA to intervene A3 cells and then observed the effects of VPA on the proliferation, apoptosis, mitochondrial function of A3 cells and further explore the antitumor mechanism of VPA. 2 Materials and Methods 2.1 Cell Culture To detect the role of VPA to PTCL cells, A3 cells (Wuhan Lingjisi Biotechnology Co., LTD) were cultured, and in vitro analysis was conducted. Cells were kept in DMEM with the addition of 10% FBS (FBS, 10270-106; Gibco) at 37°C with 5% CO2. 2.2 Cell treatment The sequence of miR-3196 (GI: 301171776) was checked at the NCBI database. si-KCNK3 is synthesized and supplied by Shanghai Jikai Biotechnology Co., LTD. miR-3196 mimics (5′-CGGGGCGGCAGGGCCUC-3′) or inhibitor (5′-CGGGGCGGCAGGGCCUC-3′) was transported into the cell with Lipofectamine 2000. The transfection was conducted according to the manufacturer’s instructions. 24 hours before transfection, inoculate 1×10 5 cells in 500 µL medium and adjust the cell number to 6×10 5 /well during transfection. siRNA (1 µl, 10 µM) was diluted with Opti-MEM (50 µL). Then, 5 µl Lipofectamine® RNAiMAX was added into 50 µL Opti-MEM. These reagents were mixed and maintained in the fridge (4°C, 5 minutes). Finally, the cells were kept in an incubator at 37°C and 5% CO2 for 24 hours. 2.3 Cell Counting Kit-8 (CCK-8) To detect the cell viability, CCK-8 assay was used. The suspending cells were cultured in 96-well plates at a density of 1×10 4 cells/ml with IMDM, adding 20% FBS for 48 h. Then, 10 µl CCK-8 reagent was added to each well of the plates. The cells with CCK-8 were incubated at 37°C for 4 h. The optical density (450 nm) was determined with a microplate reader (Multiskan FC, Thermo, USA). 2.4 Flow Cytometry After culturing for 48 h, the cell samples from different groups were harvested, added in 1 ml precooled PBS, and centrifuged at 1000g for 5 min. The supernatant was discarded. The cells were resuspended with cold PBS, and Annexin V-FITC and PI were added. The cell apoptotic rate and ROS level of cells were analyzed using flow cytometry according to the manufacturer’s instructions, and the data were analyzed by flow cytometry (Beckman Coulter, USA). 2.5 The Detection of Glucose, A095-1, and A019-2 To detect the level of lactic acid (A019-2), ATP (A095-1), and glucose (F006), the assay kits were brought from Nanjing Jiancheng Bioengineering Institute. The experiments were conducted according to the manufacturer’s instruction. 2.6 Transmission Electron Microscopy (TEM) After rinsing the cells with cold PBS for three times, 2.5% glutaraldehyde was applied to prefix the cells (4°C, 30 min). Then, 1% osmic acid was used to fix the cells for 1 h. Then, after dehydrating, the samples were incubated in acetone and epoxy mixture (1 : 1) at 40°C for 6 h. After further fixing with pure epoxy resin (40°C, 4 h), the samples were embedded and sliced. The slices were double stained and stained with lead citrate for 15 min. The slices were rinsed with double-distilled water. Finally, the mitochondria ultrastructure was recorded with TEM (HT7700, Hitachi). 2.7 Western Blot Analysis The total proteins from cells were extracted, and the concentration was measured by the BCA protein assay kit (Beyotime, China). Total protein was separated in SDS-PAGE (12%). The proteins were then transferred to the PVDF membrane. The membranes were blocked with a blocking buffer (5% nonfat milk, 0.05% Tween-20) which was used to block the membranes. Then, the membranes were labeled with primary antibody including anti-Bad antibody (1:1000, MAB37156, Bioswamp), anti-Bcl-2 antibody (1:1000, PAB33482, Bioswamp), anti-cleaved-caspase-3 antibody (1:1000, MAB37300, Bioswamp), anti-PI3K antibody (1:1000, AF6241, Affinity), anti-p-PI3K antibody (1:1000, AF3242, Affinity), anti-Akt antibody (1:1000, AF0836, Affinity), anti-p-Akt antibody (1:1000, AF0016, Affinity), anti-KCNK3 antibody (1:1000, DF8620, Affinity) and anti-GAPDH antibody (1:1000, PAB36264, Bioswamp). The membranes were rinsed with PBS/Tween-20 three times. Then, the membranes were further labeled with horseradish peroxidase-conjugated secondary goat anti-rabbit IgG (1:10000, SAB43711, Bioswamp) for 2 h at room temperature. The blots were visualized by enhanced chemiluminescence color detection (Tanon-5200, TANON, China). 2.8 Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) The total RNAs of the cultured cell were extracted with TRIzol (Beyotime, China) kit. The cDNAs were synthesized with the reverse transcriptase kit (TAKARA, USA). RT-qPCR was conducted with the SYBR Green PCR Kit (KM4101, KAPA Biosystems) on the real-time system (Bio-Rad). The 2 −△△Ct method was used to analyze the expression of the RNAs. The primers sequences are given in Table 1 . Table 1 Primer sequences Primers Sequence (5′-3′) miR-3196-F GGGCGGGGCGGCAGGG miR-3196-R AACTGGTGTCGTGGAGTCGGC U6-F CTCGCTTCGGCAGCACA U6-R AACGCTTCACGAATTTGCGT KCNK3-F GCTCCTGCTACTTCGTCATCA KCNK3-R TCACTAGTGTGAGCTTGATG GAPDH-F AGACAGTTGCATCTTCTTGT GAPDH-R CTTGCCGTGCCTAGAGTCAT 2.9 EdU detection Dilute EdU (10mM) in cell culture media at a ratio of 1:500 to obtain a 2X EdU working solution (20µM). Add an equal volume of preheated EdU working solution at 37°C to a 24-well plate to achieve a final concentration of 1X EdU in each well. Incubate the cells in a 37°C cell culture incubator for 2 hours. After completion of EdU labeling, remove the culture media and fix the cells with 0.5mL of 4% paraformaldehyde at room temperature for 15 minutes. After cleaning with PBS to remove the fixative, 0.5mL of PBS containing 0.3% Triton X-100 was added and incubated at room temperature for 10-15min. Finally, the cells were cleaned with PBS. Add 0.5mL of Click reaction cocktail, and incubate at room temperature in the dark for 30 minutes. Aspirate the Click reaction cocktail and wash the cells three times with wash buffer, each time for 3–5 minutes. Add 300µL of DAPI solution to each well and incubate at room temperature in the dark for 10 minutes. Wash the cells three times with PBS, each time for 3–5 minutes. Capture fluorescence images using a fluorescence microscope. 2.10 Double luciferase assay Remove the cell culture media and add 100µl of cell lysis buffer to each well to thoroughly lyse the cells. After cell lysis, transfer the lysed cells from each well to individual Eppendorf tubes. Allow the firefly luciferase assay reagent and the Renilla luciferase assay detection buffer to equilibrate to room temperature. Keep the Renilla luciferase assay substrate (100×) on ice for later use. Prepare the Renilla luciferase detection working solution by adding the Renilla luciferase assay substrate (100×) to the Renilla luciferase assay detection buffer at a ratio of 1:100. Turn on the GLO-MAX 20/20 fluorescence detector, set the detection parameters with a detection interval of 2 seconds and a detection time of 10 seconds. For the measurement of Firefly Luciferase (F) activity, add 100µl of firefly luciferase assay reagent to each cell sample, mix well, and immediately place the Eppendorf tubes into the GLO-MAX 20/20 fluorescence detector to calculate the F value. Add 100µl of Renilla luciferase detection working solution to each sample, mix well, and immediately place the tubes into the GLO-MAX 20/20 fluorescence detector to calculate the Renilla Luciferase (R) activity. After completing measurements for all samples, the GLO-MAX 20/20 fluorescence detector will calculate the relative luciferase activity (ΔCT) based on the previously measured F and R values. 2.11 Gene Expression Omnibus (GEO) analysis The data set (GSE132550) in GEO was selected, which included 80 PTCL patients and 16 control samples. The screening criteria for PTCL differentially expressed genes were obtained by edgeR R analysis :|logFC|< and P < 0.05). 2.12 Prediction analysis of miR-3196 target genes Using miRTarBase ( https://mirtarbase.cuhk.edu.cn/ ) and starbase2.0 starbase.sysu.edu.cn/index.php ( https:// ) online analytical tools, the potential target genes of miR-3196 were analyzed. 2.13 Statistical Analysis All data are presented as the mean ± standard deviation (SD; n ≥ 3). GraphPad Prism software, version 8.1 (Graph Pad Software), was used for statistical analysis and comparing differences in the mental data. A non-parametric t -test was used to compare the two groups, and one-way analysis of variance and Tukey’s test were used to identify statistical differences between the two groups. P 0.5 mM VPA significantly inhibited the proliferation of A3 cells after 24h intervention ( P < 0.01) (Fig. 1 A). When the VPA intervention concentration was greater than 8mM, the effect on cell proliferation was not significant change. qRT-PCR analysis showed that the expression of miR-3196 was significantly increased after different concentrations of VPA intervention (8, 16 and 32 mM) in A3 cells compared with the control group ( P < 0.01) (Fig. 1 B). So, 8 mM was selected as the VPA intervention concentration in the follow-up experiment. Furthermore, miR-3196 mimics significantly promoted the expression of miR-3196, and miR-3196 inhibitor significantly inhibited the expression of miR-3196 in cells ( P < 0.01) (Fig. 1 C). CCK8 and flow cytometry results shown, compared with control group, VPA and miR-3196 mimics significantly inhibited proliferation ( P < 0.01), and promoted apoptosis ( P < 0.01); while miR-3196 inhibitor significantly promoted cell proliferation ( P < 0.05), and inhibited cells apoptosis ( P < 0.05), and combined with miR-3196 mimics, VPA could further promote apoptosis ( P < 0.01), and inhibited cell proliferation ( P < 0.01) (Fig. 1 D-F). Moreover, the results of apoptosis-related protein expression revealed that compared with control group, VPA and miR-3196 mimics significantly promoted the expression of Bad and Cleaved caspase-3 proteins ( P < 0.01), and inhibited the expression of Bcl-2 protein ( P < 0.01); while miR-3196 inhibitor significantly inhibited the expression of Bad and Cleaved caspase-3 protein ( P < 0.01), and promoted the expression of Bcl-2 protein ( P < 0.01); In combination with miR-3196 mimics, VPA further promoted the expression of Bad and Cleaved caspase-3 proteins ( P < 0.01), and inhibited the expression of Bcl-2 protein ( P < 0.01) (Fig. 1 G-J). 3.2 VPA regulated mitochondrial function and inhibited PI3K/Akt pathway activation in PTCL cell through miR-3196 Compared with control group, VPA and miR-3196 mimics significantly increased ROS, glucose and lactate content ( P < 0.01), and decreased ATP production ( P < 0.01), while miR-3196 inhibitor could significantly decrease ROS, glucose and lactate content in cells ( P < 0.01), and increase ATP production ( P < 0.01); In combination with miR-3196 mimics, VPA further increased ROS, glucose and lactate content in cells ( P < 0.01), and decreased ATP production ( P < 0.01) (Fig. 2 A-E). To investigate whether VPA inhibits PI3K/Akt pathway through miR-3196, we detected the expression of PI3K/Akt pathway proteins in A3 cells by Western blot. The results showed that VPA and miR-3196 mimics significantly inhibited the expression of p-PI3K and p-AKT ( P < 0.01). However, miR-3196 inhibitor significantly promoted the expression of p-PI3K and p-AKT ( P < 0.01). In combination with miR-3196 mimics, VPA further inhibited the expression of p-PI3K and p-AKT ( P < 0.01) (Fig. 2 F-H). 3.3 Screening and validation of miR-3196 target genes The potential target genes of miR-3196 were analyzed by GEO data set (GSE132550), miRTarBase and starbase2.0 online software. Analysis results showed that the intersection of miR-3196 target genes obtained by the three analysis methods was 13 target genes. Among them, KCNK3 is ranked first in the GSE132550 data set, logFC = 7.197 and P < 0.001 (Fig. 3 A). qRT-PCR and Western blot results demonstrated that VPA intervention and miR-3196 mimics could significantly inhibit the expression of KCNK3 ( P < 0.01); miR-3196 inhibitor significantly promoted the expression of KCNK3 in A3 cells ( P < 0.05) (Fig. 3 B-D). Luciferase assay showed that co-transfection of KCNK3 3 '-UTR luciferase reporter gene vector with miR-3196 mimics significantly inhibited the relative luciferase activity ( P 0.05) (Fig. 3 E and F). 3.4 VPA inhibited proliferation and promoted apoptosis in PTCL cell through miR-3196/KCNK3 pathway EdU results showed that VPA intervention could significantly inhibit cell proliferation ( P < 0.01), but inhibition of miR-3196 (inhibitor) could significantly promote cell proliferation ( P < 0.01). Compared with inhibitor group, VPA significantly reversed cell proliferation induced by miR-3196 inhibitor ( P < 0.01). Interestingly, comparing with inhibitor group, si-KCNK3 also significantly reversed cell proliferation induced by miR-3196 inhibitor ( P < 0.01) (Fig. 4 A and B). Similarly, flow cytometry analysis supported that VPA intervention and si-KCNK3 significantly promoted apoptosis ( P < 0.01), and inhibition of miR-3196 (inhibitor) significantly inhibited cells apoptosis ( P < 0.01) (Fig. 4 C and D). Western blot analysis also demonstrated that compared with control, VPA significantly promoted the expression of Bad and Cleaved caspase-3 protein ( P < 0.01), and inhibited the expression of Bcl-2 protein ( P < 0.01), while miR-3196 inhibitor significantly inhibited the expression of Bad and Cleaved caspase-3 protein ( P < 0.01), promoted the expression of Bcl-2 protein ( P < 0.01). Compared with inhibitor group, VPA and si-KCNK3 significantly increased the expression of Bad and Cleaved caspase-3 protein ( P < 0.01), and inhibited the expression of Bcl-2 protein ( P < 0.01) (Fig. 4 E-H). Moreover, our results confirmed a significant synergistic effect of VPA and si-KCNK3 in A3 cell. 3.5 VPA inhibited the activity of PI3K/Akt pathway through miR-3196/KCNK3 pathway To investigate the effect of miR-3196/KCNK3 on PI3K/Akt signaling pathway, we examined the expression of related pathway proteins using Western blot (WB). WB results showed that VPA significantly inhibit the expression of p-PI3K and p-Akt ( P < 0.01), while miR-3196 inhibitor significantly promoted the expression of p-PI3K and p-Akt protein ( P < 0.01); Compared with inhibitor group, VPA and si-KCNK3 could significantly inhibit the expression of p-PI3K and p-Akt protein ( P < 0.01); Compared with si-KCNK3 + inhibitor group, VPA + si-KCNK3 + inhibitor group shown a lower expression of p-PI3K and p-Akt protein ( P < 0.01) (Fig. 5 ). 4 Discussion Despite significant improvements in the clinical treatment of PTCL, the 5-year survival rate for peripheral T-cell lymphoma remains low. In the context of the development of cancer therapy, epigenetics has received more and more attention. Abnormal epigenetic disorders, including DNA methylation, histone modification, and chromatin remodeling, play a key role in tumorigenesis[ 31 – 33 ]. Histone deacetylases (HDAC) and histone acetyltransferases (HATS) participate in epigenetic regulation of genes by controlling the acetylation status of lysine residues in the histone tail[ 34 ]. Histone acetyltransferases acetylate histone tails to form "open" chromatin structures that promote gene transcription execution; In contrast, histone deacetylases control the deacetylation of histone tails, keeping chromatin in a "closed" state and causing silencing of expression of related genes[ 35 ]. Under normal circumstances, there is a dynamic balance between HDAC and HATs, and the disruption of the balance is closely related to the occurrence and development of tumors. Histone deacetylases regulate the deacetylation of histones and certain non-histone proteins, including activation of tumor-priming related transcription factors and post-translational modification of key proteins including tumor suppressor genes [ 36 , 37 ], and have become potential anti-cancer targets due to their close correlation with tumor cell proliferation, apoptosis, differentiation, migration and metastasis[ 38 ]. Currently, several molecules have been developed as HDAC inhibitors (HDACi) for the treatment of diseases such as cancer. In 2001, VPA was recognized as an HDACi and is currently considered a PAN inhibitor. Studies have found that VPA can exert its anticancer effects by changing the level of histone acetylation in tumor cells. Meanwhile, the expression level of anti-apoptotic protein survivin is down-regulated to cancel its anti-apoptotic effect and play a role in inducing apoptosis of tumor cells[ 39 , 40 ]. Moreover, VPA can significantly down-regulate the expression of epithelial markers E-cadherin (E-cadherin) and zone-1 (ZO-1), and up-regulate the expression of mesenchymal markers Vimentin and N-cadherin in colorectal cancer cells[ 41 ]. It is suggested that VPA can trigger Epithelial-Mesenchymal Transition (EMT) in colorectal cancer cells. Therefore, in this experiment, we first examined the effects of VPA on the proliferation and apoptosis of PTCL cells. Our results demonstrated that VPA could significantly inhibit the proliferation and promote the apoptosis of A3 cells compared with the control group. Meantime, VPA could promote the expression of miR-3196 in a dose-dependent manner. Similarly, our results revealed that overexpression of miR-3196 inhibited proliferation and promoted apoptosis in A3 cells. Similar to previous studies, VPA and miR-3196 may have significant anticancer effects. Mitochondria are important energy sources in the cell, and their morphology is a dynamic change process in the cellular process. Mitochondria are extremely vulnerable to the attack of reactive oxygen species, resulting in the destruction of the homeostasis of mitochondrial division and polymerization, and ultimately apoptosis[ 42 , 43 ]. Studies have shown that histone deacetylase inhibitors can inhibit the formation of reactive oxygen species in tumor cells, promote the activation of caspase-8, caspase-9, caspase-3 and PARP, and ultimately lead to cell apoptosis[ 44 ]. We found that VPA and miR-3196 mimics significantly increased ROS, glucose and lactate content, and decreased ATP content in cells. Our results may reveal that VPA promotes apoptosis through the mitochondrial pathway. The PI3K/AKT axis is the most frequently activated signaling pathway in human cancer and is often implicated in resistance to anticancer therapies[ 45 ]. Dysfunction of components of this pathway such as hyperactivity of PI3K, loss of function of PTEN, and gain-of-function of AKT, are notorious drivers of treatment resistance and disease progression in cancer[ 46 ]. A previous study demonstrated that PIK3 pathway has been shown to be highly activated in PTCL samples, high PIK3α expression was significantly associated with poor survival, even after adjustment for age, International Prognostic Index (IPI) score and anthracycline-based chemotherapy in first line[ 47 ]. Moreover, PTCL patients with high p-AKT expression showed aggressive clinical courses with significantly worse OS and PFS and a poor chemotherapy response rate[ 48 ]. Our results showed that VPA and miRNA-3196 significantly inhibited the activity of PI3K/AKT pathway in A3 cells. Moreover, VPA and miRNA-3196 had a significant synergistic effect to inhibit the activation of PI3K/Akt signaling pathway. In a word, VPA may inhibit the proliferation, and promote apoptosis, and regulate mitochondrial function, which may be achieved by regulating the miR-3196/PI3K/AKT pathway. To further investigate the mechanism of miR-3196 promoting apoptosis of PTCL cells, we used bioinformatics methods to predict and verify the target genes of miR-3196. In this study, through GEO database and biological online software analysis such as miRTarBase and starbase2.0, and then luciferase, qRT-PCR and Western blot analysis, TWIK associated acid-sensitive Potassium channel subfamily K member 3 (TASK-1, also known as KCNK3) was confirmed to be a potential target gene of miR-3196. KCNK3 is a subtype of two-pore potassium channel. KCNK3 is extremely sensitive to various extracellular signal stimuli, resulting in changes in its expression and activity, such as PH, hypoxia, and intracellular signaling pathways[ 49 ]. Study found that the expression of KCNK3 in lung cancer is significantly increased, and overexpression of KCNK3 can promote the differentiation of A549 cells into tumor stem cells and promote the resistance of cells to gefitinib; meanwhile, overexpression of KCNK3 can promote the expression of CD133, OCT-4 and Nanog proteins, and promote EMT[ 50 ]. Down-regulation of KCNK3 inhibited EMT and reversed gefitinib sensitivity in lung cancer. Similarly, after siRNA interfered with the expression of KCNK3, apoptosis of A549 cells increased and cell proliferation decreased[ 51 ]. Inhibition of TASK-1 can significantly inhibit the proliferation of MCF-7 cells, and TASK-1 is required in MCF-7 cancer cell lines[ 52 ]. In this study, inhibition of KCNK3 expression significantly inhibited the proliferation and promoted their apoptosis of A3 cells. In combination with VPA, it further promoted the apoptosis and inhibited the proliferation of A3 cells. Interestingly, our results revealed that si-KCNK3 significantly inhibited the activity of PI3K/Akt pathway. A previous study demonstrated that the change of KCNK3 expression is closely related to the activation of PI3K/Akt pathway[ 53 ]. Moreover, an inhibitor of PI3-kinase could occlude the channel regulation function of TASK, revealing a correlation of TASK with PI3K[ 54 ]. At the same time, KCNK3 acted as the target gene of miR-3196, and VPA significantly promoted the expression of miR-3196. It is suggested that VPA regulates the proliferation and apoptosis of A3 cells is closely related to miR-3196/KCNK3/PI3K/Akt signaling axis. In conclusion, our results showed that VPA could inhibit the proliferation and promote the apoptosis of A3 cells, and further studies showed that VPA might inhibit the expression and activation of PI3K/Akt signaling pathway by promoting the expression of miR-3196, and finally inhibit the proliferation and promote the apoptosis of PTCL cell. Through GEO database and biological online software analysis miRTarBase and starbase2.0, and then luciferase, qRT-PCR and Western blot analysis, KCNK3 was found to be a potential target gene of miR-3196. Furthermore, we speculated that by promoting the expression of miR-3196, VPA inhibits the expression of KCNK3, thus inhibiting the activation of PI3K/Akt pathway, and finally promoting the apoptosis and inhibiting the proliferation of PTCL cell. Our findings will facilitate the application of VPA in PTCL. Declarations Author Contribution Zhiqiang Peng contributed to experiment and drafted the manuscript.Hanzhi Dong contributed to data analysis. Jianping Xiong contributed to the study design and the revision of the manuscript. References Armitage JO. The aggressive peripheral T-cell lymphomas: 2015. Am J Hematol. 2015;90(7):665–73. Broccoli A, Zinzani PL. Peripheral T-cell lymphomas. Hematol Oncol. 2023;41(Suppl 1):82–7. Yang QP, et al. Subtype distribution of lymphomas in Southwest China: analysis of 6,382 cases using WHO classification in a single institution. Diagn Pathol. 2011;6:77. Sun J, et al. Distribution of lymphoid neoplasms in China: analysis of 4,638 cases according to the World Health Organization classification. Am J Clin Pathol. 2012;138(3):429–34. Hennessy BT, Hanrahan EO, Daly PA. Non-Hodgkin lymphoma: an update. Lancet Oncol. 2004;5(6):341–53. Vose J, et al. International peripheral T-cell and natural killer/T-cell lymphoma study: pathology findings and clinical outcomes. J Clin Oncol. 2008;26(25):4124–30. Zhang Q, et al. Esophageal peripheral T-cell lymphoma treated with radiotherapy: A case report. Med (Baltim). 2021;100(4):e24455. Coppo P, et al. Mature CD8(+) T-cell clonal expansion in the oral cavity and digestive tract: a severe lymphoid malignancy that mimics Crohn's disease. Clin Case Rep. 2016;4(12):1088–90. Fanale MA, et al. Five-year outcomes for frontline brentuximab vedotin with CHP for CD30-expressing peripheral T-cell lymphomas. Blood. 2018;131(19):2120–4. Chen IC, Sethy B, Liou JP. Recent Update of HDAC Inhibitors in Lymphoma. Front Cell Dev Biol. 2020;8:576391. O'Connor OA, et al. Pralatrexate in patients with relapsed or refractory peripheral T-cell lymphoma: results from the pivotal PROPEL study. J Clin Oncol. 2011;29(9):1182–9. Kim YH, et al. Mogamulizumab versus vorinostat in previously treated cutaneous T-cell lymphoma (MAVORIC): an international, open-label, randomised, controlled phase 3 trial. Lancet Oncol. 2018;19(9):1192–204. Gallamini A, et al. Alemtuzumab (Campath-1H) and CHOP chemotherapy as first-line treatment of peripheral T-cell lymphoma: results of a GITIL (Gruppo Italiano Terapie Innovative nei Linfomi) prospective multicenter trial. Blood. 2007;110(7):2316–23. Toumishey E, et al. Final report of a phase 2 clinical trial of lenalidomide monotherapy for patients with T-cell lymphoma. Cancer. 2015;121(5):716–23. Horwitz SM, et al. Activity of the PI3K-delta,gamma inhibitor duvelisib in a phase 1 trial and preclinical models of T-cell lymphoma. Blood. 2018;131(8):888–98. Al-Mansour Z, et al. Autologous transplantation as consolidation for high risk aggressive T-cell non-Hodgkin lymphoma: a SWOG 9704 intergroup trial subgroup analysis. Leuk Lymphoma. 2019;60(8):1934–41. Zhang Y, et al. Therapeutic options in peripheral T cell lymphoma. J Hematol Oncol. 2016;9:37. Tofilon PJ, Camphausen K. HDAC inhibitors in cancer care. Oncol (Williston Park). 2010;24(2):180–5. Kim SH, et al. Synergistic cytotoxicity of BIIB021 with triptolide through suppression of PI3K/Akt/mTOR and NF-kappaB signal pathways in thyroid carcinoma cells. Biomed Pharmacother. 2016;83:22–32. Shi YK, et al. The histone deacetylase inhibitor suberoylanilide hydroxamic acid induces growth inhibition and enhances taxol-induced cell death in breast cancer. Cancer Chemother Pharmacol. 2010;66(6):1131–40. Ueda T, et al. Apicidin, a novel histone deacetylase inhibitor, has profound anti-growth activity in human endometrial and ovarian cancer cells. Int J Mol Med. 2007;19(2):301–8. Bazzaro M, et al. Ubiquitin proteasome system stress underlies synergistic killing of ovarian cancer cells by bortezomib and a novel HDAC6 inhibitor. Clin Cancer Res. 2008;14(22):7340–7. Lin T, et al. Valproic acid exhibits anti-tumor activity selectively against EGFR/ErbB2/ErbB3-coexpressing pancreatic cancer via induction of ErbB family members-targeting microRNAs. J Exp Clin Cancer Res. 2019;38(1):150. Gunel NS, et al. Effect of valproic acid on miRNAs affecting histone deacetylase in a model of anaplastic thyroid cancer. Mol Biol Rep. 2021;48(8):6085–91. Injinari N, et al. Apoptotic effects of valproic acid on miR-34a, miR-520h and HDAC1 gene in breast cancer. Life Sci. 2021;269:119027. Winters AN, et al. MicroRNA expression associated with low-grade cervical intraepithelial neoplasia outcomes. J Cancer Res Clin Oncol. 2023;149(13):11969–78. Wu Q, Jiang J. LncRNA MAFG-AS1 Promotes Lung Adenocarcinoma Cell Migration and Invasion by Targeting miR-3196 and Regulating SOX12 Expression. Mol Biotechnol. 2022;64(9):970–83. Chen T, Huang B, Pan Y. Long Non-coding RNA MAFG-AS1 Promotes Cell Proliferation, Migration, and EMT by miR-3196/STRN4 in Drug-Resistant Cells of Liver Cancer. Front Cell Dev Biol. 2021;9:688603. Chen G, et al. miR-3196 acts as a Tumor Suppressor and Predicts Survival Outcomes in Patients With Gastric Cancer. Technol Cancer Res Treat. 2020;19:1533033820923427. Ye L, et al. MAFG-AS1 aggravates the progression of pancreatic cancer by sponging miR-3196 to boost NFIX. Cancer Cell Int. 2020;20(1):591. Sun L, Zhang H, Gao P. Metabolic reprogramming and epigenetic modifications on the path to cancer. Protein Cell. 2022;13(12):877–919. Garcia-Martinez L, et al. Epigenetic mechanisms in breast cancer therapy and resistance. Nat Commun. 2021;12(1):1786. Ge R, et al. Epigenetic modulations and lineage plasticity in advanced prostate cancer. Ann Oncol. 2020;31(4):470–9. Glozak MA, et al. Acetylation and deacetylation of non-histone proteins. Gene. 2005;363:15–23. Parbin S, et al. Histone deacetylases: a saga of perturbed acetylation homeostasis in cancer. J Histochem Cytochem. 2014;62(1):11–33. Eckschlager T et al. Histone Deacetylase Inhibitors as Anticancer Drugs. Int J Mol Sci, 2017. 18(7). Frey RR, et al. Trifluoromethyl ketones as inhibitors of histone deacetylase. Bioorg Med Chem Lett. 2002;12(23):3443–7. Lobera M, et al. Selective class IIa histone deacetylase inhibition via a nonchelating zinc-binding group. Nat Chem Biol. 2013;9(5):319–25. Cosenza M, et al. The histone deacetylase inhibitor romidepsin synergizes with lenalidomide and enhances tumor cell death in T-cell lymphoma cell lines. Cancer Biol Ther. 2016;17(10):1094–106. Bolden JE, Peart MJ, Johnstone RW. Anticancer activities of histone deacetylase inhibitors. Nat Rev Drug Discov. 2006;5(9):769–84. Terranova-Barberio M, et al. Synergistic antitumor interaction between valproic acid, capecitabine and radiotherapy in colorectal cancer: critical role of p53. J Exp Clin Cancer Res. 2017;36(1):177. Ouaissi M, et al. Rationale for possible targeting of histone deacetylase signaling in cancer diseases with a special reference to pancreatic cancer. J Biomed Biotechnol. 2011;2011:315939. Pistritto G, et al. Apoptosis as anticancer mechanism: function and dysfunction of its modulators and targeted therapeutic strategies. Aging. 2016;8(4):603–19. Kaminskyy VO, et al. Combined inhibition of DNA methyltransferase and histone deacetylase restores caspase-8 expression and sensitizes SCLC cells to TRAIL. Carcinogenesis. 2011;32(10):1450–8. Lu Y, et al. Cystatin SA attenuates gastric cancer cells growth and increases sensitivity to oxaliplatin via PI3K/AKT signaling pathway. J Cancer Res Clin Oncol. 2024;150(5):244. Glaviano A, et al. PI3K/AKT/mTOR signaling transduction pathway and targeted therapies in cancer. Mol Cancer. 2023;22(1):138. Huang D, et al. Evaluation of the PIK3 pathway in peripheral T-cell lymphoma and NK/T-cell lymphoma. Br J Haematol. 2020;189(4):731–44. Hong JY, et al. The clinical significance of activated p-AKT expression in peripheral T-cell lymphoma. Anticancer Res. 2015;35(4):2465–74. Olschewski A et al. TASK-1 (KCNK3) channels in the lung: from cell biology to clinical implications. Eur Respir J, 2017. 50(5). Wang XG, et al. TASK-1 induces gefitinib resistance by promoting cancer initiating cell formation and epithelial-mesenchymal transition in lung cancer. Exp Ther Med. 2018;15(1):365–70. Leithner K, et al. TASK-1 Regulates Apoptosis and Proliferation in a Subset of Non-Small Cell Lung Cancers. PLoS ONE. 2016;11(6):e0157453. Arevalo B, et al. Selective TASK-1 Inhibitor with a Defined Structure-Activity Relationship Reduces Cancer Cell Proliferation and Viability. J Med Chem. 2022;65(22):15014–27. Le Ribeuz H et al. Proteomic Analysis of KCNK3 Loss of Expression Identified Dysregulated Pathways in Pulmonary Vascular Cells. Int J Mol Sci, 2020. 21(19). Konakov MV, et al. Anti-hypoxic effect of interleukin-10 in hippocampal neurons is mediated by modulation of TASK-1 and TASK-3 channels activity. Biochem Biophys Res Commun. 2022;615:17–23. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editor assigned by journal 25 Jun, 2024 Submission checks completed at journal 25 Jun, 2024 First submitted to journal 08 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4552320","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":318592675,"identity":"396da31b-9e4a-42d3-96bb-c4f078ae670b","order_by":0,"name":"Zhiqiang Peng","email":"","orcid":"","institution":"Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Zhiqiang","middleName":"","lastName":"Peng","suffix":""},{"id":318592676,"identity":"7019e037-7f2d-4235-973e-cb52c3b10829","order_by":1,"name":"Hanzhi Dong","email":"","orcid":"","institution":"Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Hanzhi","middleName":"","lastName":"Dong","suffix":""},{"id":318592677,"identity":"717cc79c-24dc-463c-9788-a6e836c13e24","order_by":2,"name":"Jianping Xiong","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7ElEQVRIie3PMWvCQBTA8VcOzuUZ1xzxQzw5sBSk/SpKQJdDcLN06CBcl3wAS79HZkOGLtf9Sh2MNwu6uWl0liRuHe4/vYP3g3cAPt9/zMKDO9IAO63k+sagAWES5uOuSAzAqiS8AeERmHxAS3UlUEuCvw8nZ5ohiV3mDuq5y4EVW1tBxHo1cp+a42M0jSlL4/IwLqWqIGSHObU14tOX6odZykqCPKomIx22dYj0ay7kvQmJeYSGkCxeSF5PhB2z3nI+RJEoST/pN3JW85fATorNnk4vnZbpbV7Tt3JYFK6K3Ijdt+7z+Xy+G50B0lFI3B0t130AAAAASUVORK5CYII=","orcid":"","institution":"Nanchang University","correspondingAuthor":true,"prefix":"","firstName":"Jianping","middleName":"","lastName":"Xiong","suffix":""}],"badges":[],"createdAt":"2024-06-09 03:38:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4552320/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4552320/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":60406783,"identity":"65e21e74-917d-4f2f-bf65-be7117dd7b7c","added_by":"auto","created_at":"2024-07-16 12:12:11","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1879350,"visible":true,"origin":"","legend":"\u003cp\u003eVPA inhibited proliferation and promotes miR-3196 expression in A3 cells. (A) Effect of VPA on cell proliferation; (B) Effect of VPA on the relative expression miR-3196; (C) Effect of miR-3196 mimics and miR-3196 inhibitor on the relative expression miR-3196; (D) CCK8 detected the effects of VPV, miR-3196 mimics and miR-3196 inhibitor on cell proliferation; (E) Flow cytometry detected the effects of VPV, miR-3196 mimics and miR-3196 inhibitor on cell apoptosis; (F) Flow cytometry data statistics; (G) Western blot detection image; (H) Relative protein leave of Bad; (I) Relative protein leave of Bcl-2; (J) Relative protein leave of Cleaved caspase-3. All values are presented as the mean ± SD (n ≥ 3). Compared with control group, \u003csup\u003ens\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026gt;0.05, *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01; Compared with mimics group, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4552320/v1/b0cfec5a75090c4d87f96f39.png"},{"id":60407423,"identity":"3cb353ad-605c-4612-be7b-87336b0e2644","added_by":"auto","created_at":"2024-07-16 12:20:11","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1264839,"visible":true,"origin":"","legend":"\u003cp\u003eVPA regulated mitochondrial function and inhibited PI3K/Akt pathway in A3 cell. (A) Flow cytometry detected ROS content; (B) Flow cytometry data statistics; (C) Determination of ATP content; (D) Determination of glucose content; (F) Determination of lactic acid content; (F) Western blot detection image; (G) Relative protein level of p-PI3K; (H) Relative protein level of p-Akt. All values are presented as the mean ± SD (n ≥ 3). Compared with control group, \u003csup\u003ens\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026gt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01; Compared with mimics group, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4552320/v1/a9f7ed3423331c3fffa6ddd7.png"},{"id":60407422,"identity":"1feb4faa-8de7-4ba3-801d-7c3efda3991b","added_by":"auto","created_at":"2024-07-16 12:20:11","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":841622,"visible":true,"origin":"","legend":"\u003cp\u003eScreening and validation of miR-3196 target genes. (A) miR-3196 target gene prediction; (B) Western blot detection image; (C) Relative protein level of KCNK3; (D) Relative mRNA level of KCNK3; (E) Luciferase assay verified the relationship between miR-3196 and KCNK3 target genes; (F) Relative luciferase activity. All values are presented as the mean ± SD (n ≥ 3). Compared with control group, \u003csup\u003ens\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026gt;0.05, *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01; Compared with inhibitor group, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4552320/v1/83dbacb89422f9b99a0c840c.png"},{"id":60406785,"identity":"aa554977-efdb-40ec-87fc-f345fa639055","added_by":"auto","created_at":"2024-07-16 12:12:11","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":5672922,"visible":true,"origin":"","legend":"\u003cp\u003eVPA inhibited the proliferation and promoted apoptosis of A3 cell. (A) EdU detection image; (B EdU data statistics; (C) Flow cytometry detected cell apoptosis; (D) Flow cytometry data statistics; (E) Western blot detection image; (F) Relative protein level of Bad; (G) Relative protein level of Bcl-2; (H) Relative protein level of Cleaved caspasre-3. All values are presented as the mean ± SD (n ≥ 3). Compared with control group, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01; Compared with inhibitor group, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01; Compared with inhibitor + si-KCNK3 group, \u003csup\u003e$$\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4552320/v1/78b6e9ca7947d9d7eafc79fe.png"},{"id":60406786,"identity":"6fe27ff1-860c-475f-9902-39f209afd226","added_by":"auto","created_at":"2024-07-16 12:12:11","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":652505,"visible":true,"origin":"","legend":"\u003cp\u003eVPA inhibited the activity of PI3K/Akt pathway. (A) Western blot detection image; (B) Relative protein level of p-PI3K; (C) Relative protein level of p-Akt. All values are presented as the mean ± SD (n ≥ 3). Compared with control group, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01; Compared with inhibitor group, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01; Compared with inhibitor + si-KCNK3 group, \u003csup\u003e$$\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4552320/v1/d64841980a0ca2128cfc696e.png"},{"id":60407431,"identity":"69420436-5f8f-4361-992a-7062da98d669","added_by":"auto","created_at":"2024-07-16 12:20:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":12298435,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4552320/v1/409c3cbc-2cf3-4f28-a284-b3cd5472d20c.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Valproic Acid inhibits proliferation and promotes apoptosis of peripheral T cell lymphoma cells via the miRNA-3196/KCNK3 signaling axis","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003ePeripheral T cell lymphomas (PTCLs) are a group of heterogeneous lymphoproliferative diseases caused by mature T cells or natural killer cells, accounting for about 10\u0026ndash;15% of the total malignant lymphoma[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The incidence of PTCL has distinct geographical and ethnic characteristics, accounting for 25\u0026ndash;30% of non-Hodgkin lymphoma (NHL) incidence in the oriental population[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], which is significantly higher than 10\u0026ndash;15% reported in European and American countries[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. As PTCL has diverse clinical symptoms, PTCL could affect upper digestive tract to induce esophageal stricture and dysphagia[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The symptoms of digestive lymphoma are similar to that of Crohn\u0026rsquo;s disease[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. It is prone to missed diagnosis and misdiagnosis. The main frontline therapies include brentuximab vedotin [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], histone deacetylase inhibitors [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], pralatrexate [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], mogamulizumab [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], alemtuzumab [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], lenalidomide [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], PI3Ki [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], and consolidative stem cell transplantation [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. However, its overall treatment efficacy is still poor, with a 5-year survival of only 10\u0026ndash;30% [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Further studies are needed to investigate the pathogenesis of PTCLs, which are of great significance for the prevention and treatment of PTCLs.\u003c/p\u003e \u003cp\u003eAlproic acid (VPA) is a commonly used antiepileptic drug in clinics. Due to its histone deacetyltransferase inhibitor function, its potential antitumor effect has been widely valued. Many studies demonstrated that VPA has a certain antitumor effect [\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In the combined treatment research of VPA and other chemotherapeutics, it is found that VPA itself has the effect of inhibiting tumor cells, and it can also increase the sensitivity of tumor cells to certain chemotherapeutic drugs and reduce the drug resistance of tumor cells[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Many studies revealed that VPA could regulate the expression of miRNAs in tumor cells to play an antitumor role [\u003cspan additionalcitationids=\"CR24\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. miR-3196 is closely related to cancer grade, and its expression was significantly lower in low-grade cancer than in high-grade cancer[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Many studies demonstrated that inhibition of miR-3196 can promote the progression of lung adenocarcinoma[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], liver cancer[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], gastric cancer[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] and pancreatic cancer[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. miR-3196 maybe act as a tumor suppressor and predicts survival outcomes in cancer patients[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHowever, the effects of VPA on miRNA-3196 in PTCLs and their specific regulatory mechanisms are currently poorly studied and still need further study. In this study, we used VPA to intervene A3 cells and then observed the effects of VPA on the proliferation, apoptosis, mitochondrial function of A3 cells and further explore the antitumor mechanism of VPA.\u003c/p\u003e"},{"header":"2 Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Cell Culture\u003c/h2\u003e \u003cp\u003eTo detect the role of VPA to PTCL cells, A3 cells (Wuhan Lingjisi Biotechnology Co., LTD) were cultured, and \u003cem\u003ein vitro\u003c/em\u003e analysis was conducted. Cells were kept in DMEM with the addition of 10% FBS (FBS, 10270-106; Gibco) at 37\u0026deg;C with 5% CO2.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Cell treatment\u003c/h2\u003e \u003cp\u003eThe sequence of miR-3196 (GI: 301171776) was checked at the NCBI database. si-KCNK3 is synthesized and supplied by Shanghai Jikai Biotechnology Co., LTD. miR-3196 mimics (5\u0026prime;-CGGGGCGGCAGGGCCUC-3\u0026prime;) or inhibitor (5\u0026prime;-CGGGGCGGCAGGGCCUC-3\u0026prime;) was transported into the cell with Lipofectamine 2000. The transfection was conducted according to the manufacturer\u0026rsquo;s instructions. 24 hours before transfection, inoculate 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells in 500 \u0026micro;L medium and adjust the cell number to 6\u0026times;10\u003csup\u003e5\u003c/sup\u003e/well during transfection. siRNA (1 \u0026micro;l, 10 \u0026micro;M) was diluted with Opti-MEM (50 \u0026micro;L). Then, 5 \u0026micro;l Lipofectamine\u0026reg; RNAiMAX was added into 50 \u0026micro;L Opti-MEM. These reagents were mixed and maintained in the fridge (4\u0026deg;C, 5 minutes). Finally, the cells were kept in an incubator at 37\u0026deg;C and 5% CO2 for 24 hours.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Cell Counting Kit-8 (CCK-8)\u003c/h2\u003e \u003cp\u003eTo detect the cell viability, CCK-8 assay was used. The suspending cells were cultured in 96-well plates at a density of 1\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells/ml with IMDM, adding 20% FBS for 48 h. Then, 10 \u0026micro;l CCK-8 reagent was added to each well of the plates. The cells with CCK-8 were incubated at 37\u0026deg;C for 4 h. The optical density (450 nm) was determined with a microplate reader (Multiskan FC, Thermo, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Flow Cytometry\u003c/h2\u003e \u003cp\u003eAfter culturing for 48 h, the cell samples from different groups were harvested, added in 1 ml precooled PBS, and centrifuged at 1000g for 5 min. The supernatant was discarded. The cells were resuspended with cold PBS, and Annexin V-FITC and PI were added. The cell apoptotic rate and ROS level of cells were analyzed using flow cytometry according to the manufacturer\u0026rsquo;s instructions, and the data were analyzed by flow cytometry (Beckman Coulter, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 The Detection of Glucose, A095-1, and A019-2\u003c/h2\u003e \u003cp\u003eTo detect the level of lactic acid (A019-2), ATP (A095-1), and glucose (F006), the assay kits were brought from Nanjing Jiancheng Bioengineering Institute. The experiments were conducted according to the manufacturer\u0026rsquo;s instruction.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Transmission Electron Microscopy (TEM)\u003c/h2\u003e \u003cp\u003eAfter rinsing the cells with cold PBS for three times, 2.5% glutaraldehyde was applied to prefix the cells (4\u0026deg;C, 30 min). Then, 1% osmic acid was used to fix the cells for 1 h. Then, after dehydrating, the samples were incubated in acetone and epoxy mixture (1 : 1) at 40\u0026deg;C for 6 h. After further fixing with pure epoxy resin (40\u0026deg;C, 4 h), the samples were embedded and sliced. The slices were double stained and stained with lead citrate for 15 min. The slices were rinsed with double-distilled water. Finally, the mitochondria ultrastructure was recorded with TEM (HT7700, Hitachi).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Western Blot Analysis\u003c/h2\u003e \u003cp\u003eThe total proteins from cells were extracted, and the concentration was measured by the BCA protein assay kit (Beyotime, China). Total protein was separated in SDS-PAGE (12%). The proteins were then transferred to the PVDF membrane. The membranes were blocked with a blocking buffer (5% nonfat milk, 0.05% Tween-20) which was used to block the membranes. Then, the membranes were labeled with primary antibody including anti-Bad antibody (1:1000, MAB37156, Bioswamp), anti-Bcl-2 antibody (1:1000, PAB33482, Bioswamp), anti-cleaved-caspase-3 antibody (1:1000, MAB37300, Bioswamp), anti-PI3K antibody (1:1000, AF6241, Affinity), anti-p-PI3K antibody (1:1000, AF3242, Affinity), anti-Akt antibody (1:1000, AF0836, Affinity), anti-p-Akt antibody (1:1000, AF0016, Affinity), anti-KCNK3 antibody (1:1000, DF8620, Affinity) and anti-GAPDH antibody (1:1000, PAB36264, Bioswamp). The membranes were rinsed with PBS/Tween-20 three times. Then, the membranes were further labeled with horseradish peroxidase-conjugated secondary goat anti-rabbit IgG (1:10000, SAB43711, Bioswamp) for 2 h at room temperature. The blots were visualized by enhanced chemiluminescence color detection (Tanon-5200, TANON, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)\u003c/h2\u003e \u003cp\u003eThe total RNAs of the cultured cell were extracted with TRIzol (Beyotime, China) kit. The cDNAs were synthesized with the reverse transcriptase kit (TAKARA, USA). RT-qPCR was conducted with the SYBR Green PCR Kit (KM4101, KAPA Biosystems) on the real-time system (Bio-Rad). The 2\u003csup\u003e\u0026minus;△△Ct\u003c/sup\u003e method was used to analyze the expression of the RNAs. The primers sequences are given in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimers\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiR-3196-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGCGGGGCGGCAGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiR-3196-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACTGGTGTCGTGGAGTCGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eU6-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCGCTTCGGCAGCACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eU6-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACGCTTCACGAATTTGCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKCNK3-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTCCTGCTACTTCGTCATCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKCNK3-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCACTAGTGTGAGCTTGATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGACAGTTGCATCTTCTTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTGCCGTGCCTAGAGTCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 EdU detection\u003c/h2\u003e \u003cp\u003eDilute EdU (10mM) in cell culture media at a ratio of 1:500 to obtain a 2X EdU working solution (20\u0026micro;M). Add an equal volume of preheated EdU working solution at 37\u0026deg;C to a 24-well plate to achieve a final concentration of 1X EdU in each well. Incubate the cells in a 37\u0026deg;C cell culture incubator for 2 hours. After completion of EdU labeling, remove the culture media and fix the cells with 0.5mL of 4% paraformaldehyde at room temperature for 15 minutes. After cleaning with PBS to remove the fixative, 0.5mL of PBS containing 0.3% Triton X-100 was added and incubated at room temperature for 10-15min. Finally, the cells were cleaned with PBS. Add 0.5mL of Click reaction cocktail, and incubate at room temperature in the dark for 30 minutes. Aspirate the Click reaction cocktail and wash the cells three times with wash buffer, each time for 3\u0026ndash;5 minutes. Add 300\u0026micro;L of DAPI solution to each well and incubate at room temperature in the dark for 10 minutes. Wash the cells three times with PBS, each time for 3\u0026ndash;5 minutes. Capture fluorescence images using a fluorescence microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Double luciferase assay\u003c/h2\u003e \u003cp\u003eRemove the cell culture media and add 100\u0026micro;l of cell lysis buffer to each well to thoroughly lyse the cells. After cell lysis, transfer the lysed cells from each well to individual Eppendorf tubes. Allow the firefly luciferase assay reagent and the Renilla luciferase assay detection buffer to equilibrate to room temperature. Keep the Renilla luciferase assay substrate (100\u0026times;) on ice for later use. Prepare the Renilla luciferase detection working solution by adding the Renilla luciferase assay substrate (100\u0026times;) to the Renilla luciferase assay detection buffer at a ratio of 1:100. Turn on the GLO-MAX 20/20 fluorescence detector, set the detection parameters with a detection interval of 2 seconds and a detection time of 10 seconds. For the measurement of Firefly Luciferase (F) activity, add 100\u0026micro;l of firefly luciferase assay reagent to each cell sample, mix well, and immediately place the Eppendorf tubes into the GLO-MAX 20/20 fluorescence detector to calculate the F value. Add 100\u0026micro;l of Renilla luciferase detection working solution to each sample, mix well, and immediately place the tubes into the GLO-MAX 20/20 fluorescence detector to calculate the Renilla Luciferase (R) activity. After completing measurements for all samples, the GLO-MAX 20/20 fluorescence detector will calculate the relative luciferase activity (ΔCT) based on the previously measured F and R values.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Gene Expression Omnibus (GEO) analysis\u003c/h2\u003e \u003cp\u003eThe data set (GSE132550) in GEO was selected, which included 80 PTCL patients and 16 control samples. The screening criteria for PTCL differentially expressed genes were obtained by edgeR R analysis :|logFC|\u0026lt; and P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Prediction analysis of miR-3196 target genes\u003c/h2\u003e \u003cp\u003eUsing miRTarBase (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://mirtarbase.cuhk.edu.cn/\u003c/span\u003e\u003cspan address=\"https://mirtarbase.cuhk.edu.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and starbase2.0 starbase.sysu.edu.cn/index.php (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://\u003c/span\u003e\u003cspan address=\"https://\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) online analytical tools, the potential target genes of miR-3196 were analyzed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13 Statistical Analysis\u003c/h2\u003e \u003cp\u003eAll data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD; n\u0026thinsp;\u0026ge;\u0026thinsp;3). GraphPad Prism software, version 8.1 (Graph Pad Software), was used for statistical analysis and comparing differences in the mental data. A non-parametric \u003cem\u003et\u003c/em\u003e-test was used to compare the two groups, and one-way analysis of variance and Tukey\u0026rsquo;s test were used to identify statistical differences between the two groups. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3 Results","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.1 VPA inhibited proliferation and promoted apoptosis of PTCL cell through miR-3196\u003c/h2\u003e \u003cp\u003eCCK-8 analysis showed that \u0026gt;\u0026thinsp;0.5 mM VPA significantly inhibited the proliferation of A3 cells after 24h intervention (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). When the VPA intervention concentration was greater than 8mM, the effect on cell proliferation was not significant change. qRT-PCR analysis showed that the expression of miR-3196 was significantly increased after different concentrations of VPA intervention (8, 16 and 32 mM) in A3 cells compared with the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). So, 8 mM was selected as the VPA intervention concentration in the follow-up experiment. Furthermore, miR-3196 mimics significantly promoted the expression of miR-3196, and miR-3196 inhibitor significantly inhibited the expression of miR-3196 in cells (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eCCK8 and flow cytometry results shown, compared with control group, VPA and miR-3196 mimics significantly inhibited proliferation (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and promoted apoptosis (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01); while miR-3196 inhibitor significantly promoted cell proliferation (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and inhibited cells apoptosis (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and combined with miR-3196 mimics, VPA could further promote apoptosis (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and inhibited cell proliferation (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD-F). Moreover, the results of apoptosis-related protein expression revealed that compared with control group, VPA and miR-3196 mimics significantly promoted the expression of Bad and Cleaved caspase-3 proteins (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and inhibited the expression of Bcl-2 protein (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01); while miR-3196 inhibitor significantly inhibited the expression of Bad and Cleaved caspase-3 protein (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and promoted the expression of Bcl-2 protein (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01); In combination with miR-3196 mimics, VPA further promoted the expression of Bad and Cleaved caspase-3 proteins (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and inhibited the expression of Bcl-2 protein (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG-J).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.2 VPA regulated mitochondrial function and inhibited PI3K/Akt pathway activation in PTCL cell through miR-3196\u003c/h2\u003e \u003cp\u003eCompared with control group, VPA and miR-3196 mimics significantly increased ROS, glucose and lactate content (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and decreased ATP production (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), while miR-3196 inhibitor could significantly decrease ROS, glucose and lactate content in cells (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and increase ATP production (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01); In combination with miR-3196 mimics, VPA further increased ROS, glucose and lactate content in cells (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and decreased ATP production (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-E). To investigate whether VPA inhibits PI3K/Akt pathway through miR-3196, we detected the expression of PI3K/Akt pathway proteins in A3 cells by Western blot. The results showed that VPA and miR-3196 mimics significantly inhibited the expression of p-PI3K and p-AKT (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). However, miR-3196 inhibitor significantly promoted the expression of p-PI3K and p-AKT (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). In combination with miR-3196 mimics, VPA further inhibited the expression of p-PI3K and p-AKT (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF-H).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Screening and validation of miR-3196 target genes\u003c/h2\u003e \u003cp\u003eThe potential target genes of miR-3196 were analyzed by GEO data set (GSE132550), miRTarBase and starbase2.0 online software. Analysis results showed that the intersection of miR-3196 target genes obtained by the three analysis methods was 13 target genes. Among them, KCNK3 is ranked first in the GSE132550 data set, logFC\u0026thinsp;=\u0026thinsp;7.197 and \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). qRT-PCR and Western blot results demonstrated that VPA intervention and miR-3196 mimics could significantly inhibit the expression of KCNK3 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01); miR-3196 inhibitor significantly promoted the expression of KCNK3 in A3 cells (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB-D). Luciferase assay showed that co-transfection of KCNK3 3 '-UTR luciferase reporter gene vector with miR-3196 mimics significantly inhibited the relative luciferase activity (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). However, there was no significant effect on the relative luciferase activity after co-transfection of mutant KCNK3 3 '-UTR luciferase reporter gene vector with miR-3196 mimics (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE and F).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.4 VPA inhibited proliferation and promoted apoptosis in PTCL cell through miR-3196/KCNK3 pathway\u003c/h2\u003e \u003cp\u003eEdU results showed that VPA intervention could significantly inhibit cell proliferation (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), but inhibition of miR-3196 (inhibitor) could significantly promote cell proliferation (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Compared with inhibitor group, VPA significantly reversed cell proliferation induced by miR-3196 inhibitor (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Interestingly, comparing with inhibitor group, si-KCNK3 also significantly reversed cell proliferation induced by miR-3196 inhibitor (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and B). Similarly, flow cytometry analysis supported that VPA intervention and si-KCNK3 significantly promoted apoptosis (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and inhibition of miR-3196 (inhibitor) significantly inhibited cells apoptosis (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and D). Western blot analysis also demonstrated that compared with control, VPA significantly promoted the expression of Bad and Cleaved caspase-3 protein (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and inhibited the expression of Bcl-2 protein (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), while miR-3196 inhibitor significantly inhibited the expression of Bad and Cleaved caspase-3 protein (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), promoted the expression of Bcl-2 protein (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Compared with inhibitor group, VPA and si-KCNK3 significantly increased the expression of Bad and Cleaved caspase-3 protein (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and inhibited the expression of Bcl-2 protein (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE-H). Moreover, our results confirmed a significant synergistic effect of VPA and si-KCNK3 in A3 cell.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.5 VPA inhibited the activity of PI3K/Akt pathway through miR-3196/KCNK3 pathway\u003c/h2\u003e \u003cp\u003eTo investigate the effect of miR-3196/KCNK3 on PI3K/Akt signaling pathway, we examined the expression of related pathway proteins using Western blot (WB). WB results showed that VPA significantly inhibit the expression of p-PI3K and p-Akt (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), while miR-3196 inhibitor significantly promoted the expression of p-PI3K and p-Akt protein (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01); Compared with inhibitor group, VPA and si-KCNK3 could significantly inhibit the expression of p-PI3K and p-Akt protein (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01); Compared with si-KCNK3\u0026thinsp;+\u0026thinsp;inhibitor group, VPA\u0026thinsp;+\u0026thinsp;si-KCNK3\u0026thinsp;+\u0026thinsp;inhibitor group shown a lower expression of p-PI3K and p-Akt protein (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eDespite significant improvements in the clinical treatment of PTCL, the 5-year survival rate for peripheral T-cell lymphoma remains low. In the context of the development of cancer therapy, epigenetics has received more and more attention. Abnormal epigenetic disorders, including DNA methylation, histone modification, and chromatin remodeling, play a key role in tumorigenesis[\u003cspan additionalcitationids=\"CR32\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Histone deacetylases (HDAC) and histone acetyltransferases (HATS) participate in epigenetic regulation of genes by controlling the acetylation status of lysine residues in the histone tail[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Histone acetyltransferases acetylate histone tails to form \"open\" chromatin structures that promote gene transcription execution; In contrast, histone deacetylases control the deacetylation of histone tails, keeping chromatin in a \"closed\" state and causing silencing of expression of related genes[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Under normal circumstances, there is a dynamic balance between HDAC and HATs, and the disruption of the balance is closely related to the occurrence and development of tumors. Histone deacetylases regulate the deacetylation of histones and certain non-histone proteins, including activation of tumor-priming related transcription factors and post-translational modification of key proteins including tumor suppressor genes [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], and have become potential anti-cancer targets due to their close correlation with tumor cell proliferation, apoptosis, differentiation, migration and metastasis[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCurrently, several molecules have been developed as HDAC inhibitors (HDACi) for the treatment of diseases such as cancer. In 2001, VPA was recognized as an HDACi and is currently considered a PAN inhibitor. Studies have found that VPA can exert its anticancer effects by changing the level of histone acetylation in tumor cells. Meanwhile, the expression level of anti-apoptotic protein survivin is down-regulated to cancel its anti-apoptotic effect and play a role in inducing apoptosis of tumor cells[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Moreover, VPA can significantly down-regulate the expression of epithelial markers E-cadherin (E-cadherin) and zone-1 (ZO-1), and up-regulate the expression of mesenchymal markers Vimentin and N-cadherin in colorectal cancer cells[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. It is suggested that VPA can trigger Epithelial-Mesenchymal Transition (EMT) in colorectal cancer cells. Therefore, in this experiment, we first examined the effects of VPA on the proliferation and apoptosis of PTCL cells. Our results demonstrated that VPA could significantly inhibit the proliferation and promote the apoptosis of A3 cells compared with the control group. Meantime, VPA could promote the expression of miR-3196 in a dose-dependent manner. Similarly, our results revealed that overexpression of miR-3196 inhibited proliferation and promoted apoptosis in A3 cells. Similar to previous studies, VPA and miR-3196 may have significant anticancer effects.\u003c/p\u003e \u003cp\u003eMitochondria are important energy sources in the cell, and their morphology is a dynamic change process in the cellular process. Mitochondria are extremely vulnerable to the attack of reactive oxygen species, resulting in the destruction of the homeostasis of mitochondrial division and polymerization, and ultimately apoptosis[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Studies have shown that histone deacetylase inhibitors can inhibit the formation of reactive oxygen species in tumor cells, promote the activation of caspase-8, caspase-9, caspase-3 and PARP, and ultimately lead to cell apoptosis[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. We found that VPA and miR-3196 mimics significantly increased ROS, glucose and lactate content, and decreased ATP content in cells. Our results may reveal that VPA promotes apoptosis through the mitochondrial pathway.\u003c/p\u003e \u003cp\u003eThe PI3K/AKT axis is the most frequently activated signaling pathway in human cancer and is often implicated in resistance to anticancer therapies[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Dysfunction of components of this pathway such as hyperactivity of PI3K, loss of function of PTEN, and gain-of-function of AKT, are notorious drivers of treatment resistance and disease progression in cancer[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. A previous study demonstrated that PIK3 pathway has been shown to be highly activated in PTCL samples, high PIK3α expression was significantly associated with poor survival, even after adjustment for age, International Prognostic Index (IPI) score and anthracycline-based chemotherapy in first line[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Moreover, PTCL patients with high p-AKT expression showed aggressive clinical courses with significantly worse OS and PFS and a poor chemotherapy response rate[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Our results showed that VPA and miRNA-3196 significantly inhibited the activity of PI3K/AKT pathway in A3 cells. Moreover, VPA and miRNA-3196 had a significant synergistic effect to inhibit the activation of PI3K/Akt signaling pathway. In a word, VPA may inhibit the proliferation, and promote apoptosis, and regulate mitochondrial function, which may be achieved by regulating the miR-3196/PI3K/AKT pathway.\u003c/p\u003e \u003cp\u003eTo further investigate the mechanism of miR-3196 promoting apoptosis of PTCL cells, we used bioinformatics methods to predict and verify the target genes of miR-3196. In this study, through GEO database and biological online software analysis such as miRTarBase and starbase2.0, and then luciferase, qRT-PCR and Western blot analysis, TWIK associated acid-sensitive Potassium channel subfamily K member 3 (TASK-1, also known as KCNK3) was confirmed to be a potential target gene of miR-3196. KCNK3 is a subtype of two-pore potassium channel. KCNK3 is extremely sensitive to various extracellular signal stimuli, resulting in changes in its expression and activity, such as PH, hypoxia, and intracellular signaling pathways[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Study found that the expression of KCNK3 in lung cancer is significantly increased, and overexpression of KCNK3 can promote the differentiation of A549 cells into tumor stem cells and promote the resistance of cells to gefitinib; meanwhile, overexpression of KCNK3 can promote the expression of CD133, OCT-4 and Nanog proteins, and promote EMT[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Down-regulation of KCNK3 inhibited EMT and reversed gefitinib sensitivity in lung cancer. Similarly, after siRNA interfered with the expression of KCNK3, apoptosis of A549 cells increased and cell proliferation decreased[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Inhibition of TASK-1 can significantly inhibit the proliferation of MCF-7 cells, and TASK-1 is required in MCF-7 cancer cell lines[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, inhibition of KCNK3 expression significantly inhibited the proliferation and promoted their apoptosis of A3 cells. In combination with VPA, it further promoted the apoptosis and inhibited the proliferation of A3 cells. Interestingly, our results revealed that si-KCNK3 significantly inhibited the activity of PI3K/Akt pathway. A previous study demonstrated that the change of KCNK3 expression is closely related to the activation of PI3K/Akt pathway[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Moreover, an inhibitor of PI3-kinase could occlude the channel regulation function of TASK, revealing a correlation of TASK with PI3K[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. At the same time, KCNK3 acted as the target gene of miR-3196, and VPA significantly promoted the expression of miR-3196. It is suggested that VPA regulates the proliferation and apoptosis of A3 cells is closely related to miR-3196/KCNK3/PI3K/Akt signaling axis.\u003c/p\u003e \u003cp\u003eIn conclusion, our results showed that VPA could inhibit the proliferation and promote the apoptosis of A3 cells, and further studies showed that VPA might inhibit the expression and activation of PI3K/Akt signaling pathway by promoting the expression of miR-3196, and finally inhibit the proliferation and promote the apoptosis of PTCL cell. Through GEO database and biological online software analysis miRTarBase and starbase2.0, and then luciferase, qRT-PCR and Western blot analysis, KCNK3 was found to be a potential target gene of miR-3196. Furthermore, we speculated that by promoting the expression of miR-3196, VPA inhibits the expression of KCNK3, thus inhibiting the activation of PI3K/Akt pathway, and finally promoting the apoptosis and inhibiting the proliferation of PTCL cell. Our findings will facilitate the application of VPA in PTCL.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eZhiqiang Peng contributed to experiment and drafted the manuscript.Hanzhi Dong contributed to data analysis. Jianping Xiong contributed to the study design and the revision of the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eArmitage JO. The aggressive peripheral T-cell lymphomas: 2015. Am J Hematol. 2015;90(7):665\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBroccoli A, Zinzani PL. Peripheral T-cell lymphomas. Hematol Oncol. 2023;41(Suppl 1):82\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang QP, et al. Subtype distribution of lymphomas in Southwest China: analysis of 6,382 cases using WHO classification in a single institution. Diagn Pathol. 2011;6:77.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun J, et al. Distribution of lymphoid neoplasms in China: analysis of 4,638 cases according to the World Health Organization classification. Am J Clin Pathol. 2012;138(3):429\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHennessy BT, Hanrahan EO, Daly PA. Non-Hodgkin lymphoma: an update. Lancet Oncol. 2004;5(6):341\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVose J, et al. International peripheral T-cell and natural killer/T-cell lymphoma study: pathology findings and clinical outcomes. J Clin Oncol. 2008;26(25):4124\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Q, et al. Esophageal peripheral T-cell lymphoma treated with radiotherapy: A case report. Med (Baltim). 2021;100(4):e24455.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCoppo P, et al. Mature CD8(+) T-cell clonal expansion in the oral cavity and digestive tract: a severe lymphoid malignancy that mimics Crohn's disease. Clin Case Rep. 2016;4(12):1088\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFanale MA, et al. Five-year outcomes for frontline brentuximab vedotin with CHP for CD30-expressing peripheral T-cell lymphomas. Blood. 2018;131(19):2120\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen IC, Sethy B, Liou JP. Recent Update of HDAC Inhibitors in Lymphoma. Front Cell Dev Biol. 2020;8:576391.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eO'Connor OA, et al. Pralatrexate in patients with relapsed or refractory peripheral T-cell lymphoma: results from the pivotal PROPEL study. J Clin Oncol. 2011;29(9):1182\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim YH, et al. Mogamulizumab versus vorinostat in previously treated cutaneous T-cell lymphoma (MAVORIC): an international, open-label, randomised, controlled phase 3 trial. Lancet Oncol. 2018;19(9):1192\u0026ndash;204.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGallamini A, et al. Alemtuzumab (Campath-1H) and CHOP chemotherapy as first-line treatment of peripheral T-cell lymphoma: results of a GITIL (Gruppo Italiano Terapie Innovative nei Linfomi) prospective multicenter trial. Blood. 2007;110(7):2316\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eToumishey E, et al. Final report of a phase 2 clinical trial of lenalidomide monotherapy for patients with T-cell lymphoma. Cancer. 2015;121(5):716\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHorwitz SM, et al. Activity of the PI3K-delta,gamma inhibitor duvelisib in a phase 1 trial and preclinical models of T-cell lymphoma. Blood. 2018;131(8):888\u0026ndash;98.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAl-Mansour Z, et al. Autologous transplantation as consolidation for high risk aggressive T-cell non-Hodgkin lymphoma: a SWOG 9704 intergroup trial subgroup analysis. Leuk Lymphoma. 2019;60(8):1934\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, et al. Therapeutic options in peripheral T cell lymphoma. J Hematol Oncol. 2016;9:37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTofilon PJ, Camphausen K. HDAC inhibitors in cancer care. Oncol (Williston Park). 2010;24(2):180\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim SH, et al. Synergistic cytotoxicity of BIIB021 with triptolide through suppression of PI3K/Akt/mTOR and NF-kappaB signal pathways in thyroid carcinoma cells. Biomed Pharmacother. 2016;83:22\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi YK, et al. The histone deacetylase inhibitor suberoylanilide hydroxamic acid induces growth inhibition and enhances taxol-induced cell death in breast cancer. Cancer Chemother Pharmacol. 2010;66(6):1131\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUeda T, et al. Apicidin, a novel histone deacetylase inhibitor, has profound anti-growth activity in human endometrial and ovarian cancer cells. Int J Mol Med. 2007;19(2):301\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBazzaro M, et al. Ubiquitin proteasome system stress underlies synergistic killing of ovarian cancer cells by bortezomib and a novel HDAC6 inhibitor. Clin Cancer Res. 2008;14(22):7340\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin T, et al. Valproic acid exhibits anti-tumor activity selectively against EGFR/ErbB2/ErbB3-coexpressing pancreatic cancer via induction of ErbB family members-targeting microRNAs. J Exp Clin Cancer Res. 2019;38(1):150.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGunel NS, et al. Effect of valproic acid on miRNAs affecting histone deacetylase in a model of anaplastic thyroid cancer. Mol Biol Rep. 2021;48(8):6085\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eInjinari N, et al. Apoptotic effects of valproic acid on miR-34a, miR-520h and HDAC1 gene in breast cancer. Life Sci. 2021;269:119027.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWinters AN, et al. MicroRNA expression associated with low-grade cervical intraepithelial neoplasia outcomes. J Cancer Res Clin Oncol. 2023;149(13):11969\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu Q, Jiang J. LncRNA MAFG-AS1 Promotes Lung Adenocarcinoma Cell Migration and Invasion by Targeting miR-3196 and Regulating SOX12 Expression. Mol Biotechnol. 2022;64(9):970\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen T, Huang B, Pan Y. Long Non-coding RNA MAFG-AS1 Promotes Cell Proliferation, Migration, and EMT by miR-3196/STRN4 in Drug-Resistant Cells of Liver Cancer. Front Cell Dev Biol. 2021;9:688603.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen G, et al. miR-3196 acts as a Tumor Suppressor and Predicts Survival Outcomes in Patients With Gastric Cancer. Technol Cancer Res Treat. 2020;19:1533033820923427.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe L, et al. MAFG-AS1 aggravates the progression of pancreatic cancer by sponging miR-3196 to boost NFIX. Cancer Cell Int. 2020;20(1):591.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun L, Zhang H, Gao P. Metabolic reprogramming and epigenetic modifications on the path to cancer. Protein Cell. 2022;13(12):877\u0026ndash;919.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarcia-Martinez L, et al. Epigenetic mechanisms in breast cancer therapy and resistance. Nat Commun. 2021;12(1):1786.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGe R, et al. Epigenetic modulations and lineage plasticity in advanced prostate cancer. Ann Oncol. 2020;31(4):470\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGlozak MA, et al. Acetylation and deacetylation of non-histone proteins. Gene. 2005;363:15\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParbin S, et al. Histone deacetylases: a saga of perturbed acetylation homeostasis in cancer. J Histochem Cytochem. 2014;62(1):11\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEckschlager T et al. Histone Deacetylase Inhibitors as Anticancer Drugs. Int J Mol Sci, 2017. 18(7).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrey RR, et al. Trifluoromethyl ketones as inhibitors of histone deacetylase. Bioorg Med Chem Lett. 2002;12(23):3443\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLobera M, et al. Selective class IIa histone deacetylase inhibition via a nonchelating zinc-binding group. Nat Chem Biol. 2013;9(5):319\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCosenza M, et al. The histone deacetylase inhibitor romidepsin synergizes with lenalidomide and enhances tumor cell death in T-cell lymphoma cell lines. Cancer Biol Ther. 2016;17(10):1094\u0026ndash;106.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBolden JE, Peart MJ, Johnstone RW. Anticancer activities of histone deacetylase inhibitors. Nat Rev Drug Discov. 2006;5(9):769\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTerranova-Barberio M, et al. Synergistic antitumor interaction between valproic acid, capecitabine and radiotherapy in colorectal cancer: critical role of p53. J Exp Clin Cancer Res. 2017;36(1):177.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOuaissi M, et al. Rationale for possible targeting of histone deacetylase signaling in cancer diseases with a special reference to pancreatic cancer. J Biomed Biotechnol. 2011;2011:315939.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePistritto G, et al. Apoptosis as anticancer mechanism: function and dysfunction of its modulators and targeted therapeutic strategies. Aging. 2016;8(4):603\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaminskyy VO, et al. Combined inhibition of DNA methyltransferase and histone deacetylase restores caspase-8 expression and sensitizes SCLC cells to TRAIL. Carcinogenesis. 2011;32(10):1450\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu Y, et al. Cystatin SA attenuates gastric cancer cells growth and increases sensitivity to oxaliplatin via PI3K/AKT signaling pathway. J Cancer Res Clin Oncol. 2024;150(5):244.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGlaviano A, et al. PI3K/AKT/mTOR signaling transduction pathway and targeted therapies in cancer. Mol Cancer. 2023;22(1):138.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang D, et al. Evaluation of the PIK3 pathway in peripheral T-cell lymphoma and NK/T-cell lymphoma. Br J Haematol. 2020;189(4):731\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHong JY, et al. The clinical significance of activated p-AKT expression in peripheral T-cell lymphoma. Anticancer Res. 2015;35(4):2465\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOlschewski A et al. TASK-1 (KCNK3) channels in the lung: from cell biology to clinical implications. Eur Respir J, 2017. 50(5).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang XG, et al. TASK-1 induces gefitinib resistance by promoting cancer initiating cell formation and epithelial-mesenchymal transition in lung cancer. Exp Ther Med. 2018;15(1):365\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeithner K, et al. TASK-1 Regulates Apoptosis and Proliferation in a Subset of Non-Small Cell Lung Cancers. PLoS ONE. 2016;11(6):e0157453.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArevalo B, et al. Selective TASK-1 Inhibitor with a Defined Structure-Activity Relationship Reduces Cancer Cell Proliferation and Viability. J Med Chem. 2022;65(22):15014\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLe Ribeuz H et al. Proteomic Analysis of KCNK3 Loss of Expression Identified Dysregulated Pathways in Pulmonary Vascular Cells. Int J Mol Sci, 2020. 21(19).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKonakov MV, et al. Anti-hypoxic effect of interleukin-10 in hippocampal neurons is mediated by modulation of TASK-1 and TASK-3 channels activity. Biochem Biophys Res Commun. 2022;615:17\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"discover-oncology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"dion","sideBox":"Learn more about [Discover Oncology](https://www.springer.com/12672)","snPcode":"","submissionUrl":"","title":"Discover Oncology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Discover Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Alproic acid (VPA), peripheral T cell lymphomas (PTCLs), PI3K/Akt pathway, apoptosis, cell proliferation","lastPublishedDoi":"10.21203/rs.3.rs-4552320/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4552320/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eThe aim of this study was to clarify the treatment effect and potential mechanism of Alproic acid (VPA) on peripheral T cell lymphomas (PTCLs).\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eCCK-8 and EdU were used to detect cell proliferation. The mRNA expression of miR-3196 and KCNK3 was detected by qRT-PCR. Biochemical experiments were used to detect changes in the content of ATP, lactate level, and glucose content. Flow cytometry was applied to determine the apoptotic rate and ROS levels. Western blot was used to detect the protein expression of apoptotic proteins, PI3K/AKT pathway and KCNK3. GEO database and miRTarBase and starbase2.0 software were used to identify the target genes of miR-3196.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eVPA greatly inhibited PTCLs cells proliferation and promoted the expression of miR-3196 in a dose-dependent manner. Compared with the control group, VPA and miR-3196 mimics significantly increased the apoptosis rate, Bax and cleaved-caspase-3 expression, lactate level, ROS expression, and glucose content (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and significantly decreased the cell proliferation, ATP production, and the expression of Bcl-2, p-PI3K and p-AKT (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) in the PTCLs cells. However, the miR-3196 inhibitor had the opposite effect to VPA and mimics. Moreover, the combination of VPA and miR-3196 mimics has the most obvious effect. Moreover, KCNK3 was found to be a potential target gene of miR-3196. VPA and miR-3196 mimics significantly inhibited the expression of KCNK3(\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and miR-3196 inhibitor the expression of KCNK3(\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Furthermore, si-KCNK3 promoted apoptosis and inhibited proliferation and activation of PI3K/Akt signaling pathways of PTCLs cells(\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). VPA could significantly enhance the effect of si-KCNK3 in PTCLs cells(\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eVPA could inhibit the expression of KCNK3 by promoting the expression of miR-3196, and then inhibit the activation of PI3K/Akt pathway, ultimately promoting apoptosis and inhibiting proliferation of PTCLs cells.\u003c/p\u003e","manuscriptTitle":"Valproic Acid inhibits proliferation and promotes apoptosis of peripheral T cell lymphoma cells via the miRNA-3196/KCNK3 signaling axis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-16 12:12:06","doi":"10.21203/rs.3.rs-4552320/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorAssigned","content":"","date":"2024-06-25T04:01:18+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-06-25T04:01:03+00:00","index":"","fulltext":""},{"type":"submitted","content":"Discover Oncology","date":"2024-06-09T03:36:44+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"discover-oncology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"dion","sideBox":"Learn more about [Discover Oncology](https://www.springer.com/12672)","snPcode":"","submissionUrl":"","title":"Discover Oncology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Discover Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0e8a05f6-1651-4776-aa6c-e9ea05f72fa0","owner":[],"postedDate":"July 16th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-07-22T06:44:10+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-16 12:12:06","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4552320","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4552320","identity":"rs-4552320","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}