miRNA and mRNA studies reveal pollination activates hormonal signaling and increases fruit set in the apomictic tree Zanthoxylum bungeanum Maxim

preprint OA: closed
Full text JSON View at publisher
AI-generated deep summary by qwen3.7-flash, 2026-09-08 · read from full text

This study investigates the molecular mechanisms underlying apomixis in Zanthoxylum bungeanum by comparing pollinated and unpollinated fruits through miRNA and mRNA sequencing. Although pollen tubes degenerate before fertilization, confirming obligate apomixis, pollination significantly increases fruit set rates from 74% to 89%. The research identifies that pollination activates hormonal signaling pathways, leading to elevated levels of ABA, IAA, GA3, and JA, which are regulated by negatively correlated miRNA-mRNA interactions. The paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Background: Apomixis is a form of reproduction that does not involve fertilization of female by male gametes but instead produces offspring from the female parent directly. The progeny of apomixis is genotypically identical to the female parent and so maintains any elite traits of the female parent. Apomixis has considerable potential in genetic plant breeding. However, the mechanism of apomictic reproduction remains unclear. Zanthoxylum bungeanum is an apomictic plant. Studies on miRNAs, mRNAs, hormone changes and fertilization process of the pollinated and non-pollinated materials of Zanthoxylum bungeanum allows screening of the important regulatory factors of the apomictic process at both physiological and molecular levels. This information should be of considerable help in understanding the mechanism of apomixis in this species.Results Our results show that Zanthoxylum bungeanum pollen can germinate on the stigma, and that the pollen tube can extend to the ovary wall after two days but that it then degenerates about the fifth day and before reaching the egg cell. So fertilization does not occur. Nevertheless, pollination did increase fruit set from 74.12% (unpollinated) to 89.31% (pollinated). The reproductive mode of the Zanthoxylum bungeanum cultivar ‘Hancheng Dahongpao’ was identified as obligate apomixis. Enrichment analysis of differential genes indicates that pollination activates genes involved in the synthesis of ABA, IAA, GA3 and JA, and that genes related to asexual development, genes involved in flower development, and transcription factors are also activated. RT-qPCR verification shows that the relative expression levels of mRNAs and miRNAs related to hormone signaling pathways and flower development were negatively correlated. Also, that miRNA is an important factor influencing hormone regulation after pollination of this apomictic species. The contents of ABA, IAA, GA3 and JA were all significantly increased following pollination.Conclusions In general, although pollination does not result in fertilization in this species, it does activate mRNAs and miRNAs which serve as signals to activate the anabolic pathways for ABA, IAA, GA3 and JA. Increased levels of these hormones result in increased fruit set.
Full text 173,989 characters · extracted from preprint-html · click to expand
miRNA and mRNA studies reveal pollination activates hormonal signaling and increases fruit set in the apomictic tree Zanthoxylum bungeanum Maxim | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research article miRNA and mRNA studies reveal pollination activates hormonal signaling and increases fruit set in the apomictic tree Zanthoxylum bungeanum Maxim Xitong Fei, Yao Ma, Tuxi Yang, Anzhi Wei This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.2.14447/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Apomixis is a form of reproduction that does not involve fertilization of female by male gametes but instead produces offspring from the female parent directly. The progeny of apomixis is genotypically identical to the female parent and so maintains any elite traits of the female parent. Apomixis has considerable potential in genetic plant breeding. However, the mechanism of apomictic reproduction remains unclear. Zanthoxylum bungeanum is an apomictic plant. Studies on miRNAs, mRNAs, hormone changes and fertilization process of the pollinated and non-pollinated materials of Zanthoxylum bungeanum allows screening of the important regulatory factors of the apomictic process at both physiological and molecular levels. This information should be of considerable help in understanding the mechanism of apomixis in this species. Results Our results show that Zanthoxylum bungeanum pollen can germinate on the stigma, and that the pollen tube can extend to the ovary wall after two days but that it then degenerates about the fifth day and before reaching the egg cell. So fertilization does not occur. Nevertheless, pollination did increase fruit set from 74.12% (unpollinated) to 89.31% (pollinated). The reproductive mode of the Zanthoxylum bungeanum cultivar ‘Hancheng Dahongpao’ was identified as obligate apomixis. Enrichment analysis of differential genes indicates that pollination activates genes involved in the synthesis of ABA, IAA, GA3 and JA, and that genes related to asexual development, genes involved in flower development, and transcription factors are also activated. RT-qPCR verification shows that the relative expression levels of mRNAs and miRNAs related to hormone signaling pathways and flower development were negatively correlated. Also, that miRNA is an important factor influencing hormone regulation after pollination of this apomictic species. The contents of ABA, IAA, GA3 and JA were all significantly increased following pollination. Conclusions In general, although pollination does not result in fertilization in this species, it does activate mRNAs and miRNAs which serve as signals to activate the anabolic pathways for ABA, IAA, GA3 and JA. Increased levels of these hormones result in increased fruit set. Plant Physiology and Morphology Zanthoxylum bungeanum Maxim. Apomixis Hormones miRNA-mRNA fruit set apomictic tree Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 background Zanthoxylum bungeanum Maxim. ( ZB ), common name Chinese prickly ash, is a shrub or dungarunga belonging to the rutaceae. There are about 250 species of the genus Zanthoxylum , which is widely distributed round the world, though most species of this genus originate in Asia [1] . Based on the color of the fruit at maturity, it is divided into two types: red Chinese prickly ash and green Chinese prickly ash. The young leaves of ZB can be eaten as a vegetable and the fruits, stems and roots can be used as medicines [2] . The fruit skin is one of China's eight most important condiments. Having a unique numbing taste. This product is in wide use in Asian cuisine and is an important seasoning for the traditional Chinese hot pot [3, 4] . The fruit skin of ZB is a traditional herbal medicine in China and has been in use for more than 2,000 years [5] . Over 140 chemical compounds have been identified in ZB, including alkaloids, anthraquinones, flavonoids and free fatty acids [6-9] . Used as a medicine, the skin has anti-inflammatory, antibacterial and insecticidal effects [10-13] . For these reasons, ZB is an important species, that also has significant potential for commercial development. Interestingly, the normal reproductive mode of ZB is apomictic [14] - a mode that produces viable seed without pollination. Hence, the genotype of the offspring is identical to that of the female parent [15, 16] . In a commercial species, apomixis can be both a disadvantage and an advantage. The apomictic mechanism maintains the superior traits of the female for breeding, and can also provide a useful model for the genetic breeding of plant traits. However, the performance of apomictic plants following pollination has rarely been reported. Therefore, a study of differences between plants resulting from pollination and from non-pollination should help reveal the mechanisms of apomixis and thus provide a useful reference for plant genetic breeding research. Results Pollen germination Pollen germination tests were carried out on pollen on the in vitro germination medium, and pollen germination rate was counted and expressed as a percentage. The results showed the pollen germination rate of ZB pollen increased from 4.30% after 3 h to 10.70% after 12 h (Figure 1 and Table 1). In general, the germination rate of ZB pollen is low, which presents a huge obstacle to sexual reproduction in this species. Figure 1. In vitro germination and pollen morphology of Zanthoxylum bungeanum pollen. (a) Pollen germination In vitro for 3 h, (b) Pollen germination In vitro for 6 h, (c) Pollen germination In vitro for 12 h, (d) anther, (e) Pollen grain, (f) Pollen grain. Table 1. Germination rate of Zanthoxylum pollen in vitro . Time (h) 3 6 12 Germination rate (%) 4.30±0.30 6.20±0.50 10.70±1.40 Figure 2 . Germination of pollen on the stigma of Zanthoxylum bungeanum. ca: callosum, ce:cellulose, ow: ovary wall,po:pollen, pt:pollen tube, sdp: stigma drop position. Fluorescence microscopy shows pollen germinates on the stigma of ZB . Pollen tube growth commenced by 6 h (Figure 2). After 12 h pollen tube began to extend. After 2 d, the pollen tube penetrated the ovary wall. By 3 d after pollination the stigma begins to wither. Stigma fluorescence gradually dims during the withering process. After 4 d, the stigma falls off but the pollen tube in the ovary wall can still extend further downwards. After 5 d, the pollen tube is broken down into callosum so the fertilization process cannot be completed. We observed 300 samples and found no successful fertilization in any of them. It is thus preliminarily concluded that the reproductive mode of ZB cv. ‘Hancheng Dahongpao’ is obligate apomixis. Path enrichment analysis The pathway enrichment analysis of differential genes reveals changes before and after pollination. It can be seen from Figure 3 that pollination has a significant effect on the various pathways of ZB than unpollinated. After pollination, hormone signal transduction is most active, as are metabolic pathways including starch and sucrose metabolism, glycolysis/gluconeogenesis and phenylpropanoid synthesis. Figure 3b shows the pathway of increased expression after pollination, and Figure 3c shows the pathway of decreased expression after pollination. More than 100 genes were enriched and show elevated expression levels after pollination in the hormone signal transduction pathway. Meanwhile, starch and sucrose metabolism, glycolysis/gluconeogenesis, amino sugar and nucleotide metabolism all showed significant downward trends. Figure 3. Path enrichment analysis. (a) Total pathway enrichment analysis. (b) Active pathway after pollination. (c) Inactive pathway after pollination. Figure 4. Differential gene Venn diagram and volcano map. Transcriptome sequencing of pollinated and unpollinated fruits showed that a total of 69,131 reads were detected. Of these 4,431 were unique to unpollinated material and 4,078 were unique to pollination material (Figure 4). As indicated in the volcano map 7,102 genes were up-regulated and 6491 genes were down-regulated. From this it can be inferred that pollination has a strong influence on transcriptome level in ZB fruits. miRNAs and target genes expression patterns By analyzing interactions between miRNAs and mRNA in pollinated and non-pollinated fruit, it was found that pollinated fruits were more active in a range of hormone signaling pathways. Pollination can activate ABA, IAA, GA3, jasmonic acid synthesis genes and genes associated with asexual development, such as somatic embryogenesis receptor kinase 2 ( SERK2 ), agamous-like MADS-box protein ( AGL9 ), also activating a large number of flower development genes and transcription factors. To further determine the relationship of miRNAs to target genes, RT-qPCR was used to detect relative expression levels of miRNAs and their target genes. According to the results of the RT-qPCR, the reliability of transcriptome and miRNA sequencing results can be determined and the relative expression levels of some miRNAs and their target genes after pollination were confirmed (Figure 5). The results show the expression levels of the ABA, IAA, GA3 and JA synthesis genes and some transcription factors and their corresponding miRNAs were negatively correlated after pollination. This indicates miRNAs and mRNAs are widely involved in the regulation of hormones after pollination of this apomictic Chinese prickly ash cultivar. Figure 5 . Relative expression levels of miRNAs and their target genes. Hormone content analysis The transcriptome and miRNA sequencing shows many hormone pathways became active after pollination. We recorded the levels of four hormones ABA, IAA, GA3 and JA were for pollinated and unpollinated materials. The results show the four hormones were significantly higher in the pollination material than in the unpollinated (Figure 6). This indicates pollination can activate the synthetic pathway of these four hormones, it also suggests these four hormones participate in the development of embryos and fruits of ZB and, ultimately, in fruit set. Figure 6 . Hormone content of unpollinated and pollinated material of Zanthoxylum bungeanum . Comparing the pollinated with the unpollinated ZB material (Table 2), it is clear that pollination significantly increased fruit set rate but had little effect on fruit size. Table 2 . Pollination and non-pollination fruit set rate and fruit size. Samples Non-pollination Pollination Fruit set rate 74.12% b 89.31% a Fruit length (axial) 5.83±0.72 a 5.85±0.56 a Fruit diameter (transverse) 5.59±0.81 a 5.60±0.88 a Conclusion Pollen of ZB was cultured in vitro on a solid culture medium for 12 h. At this stage germination percentage was only 10.77%. Fluorescence microscopy showed that the pollen does germinate on the ZB stigma and that the pollen tube extended to the ovary after 2 d but then degenerated to callosum after 5 d without fertilization. The reproductive mode of ZB (Hancheng Dahongpao) is identified as obligate apomixis. Enrichment analysis of differentially expressed genes in the pollination and non-pollination materials indicate plant hormone signaling pathways were activated by fertilization. The relative expressions of ABA, IAA, GA3 and JA were up-regulated. At the same time, genes related to asexual development were also activated, including somatic embryogenesis receptor kinase 2 (SERK2) and agamous-like MADS-box protein (AGL9). A large number of other genes and transcription factors related to flower development were also activated. RT-qPCR showed the relative expression levels of mRNAs and miRNAs related to the hormone signaling pathway and to flower development were negatively correlated, suggesting miRNA is an important factor influencing hormone regulation after pollination of apomictic ZB . Comparison of pollination and non-pollination materials showed increases in the contents of ABA, IAA, GA3 and JA. Nevertheless, although pollination did not result in fertilization, it did increase fruit set significantly. Discussion Double fertilization is one of the most common reproductive modes in plants, egg cells combine with the polar nuclei of pollen [23] . The fertilized egg cells then develop into embryos. The latter develops into endosperm, which provides energy for seed germination. Nevertheless, some plants can form viable seeds without fertilization having taken place. This indicates fertilization is not essential for seed formation [24] . Analysis of hormones in unpollinated and pollinated ovaries of various species reveals that fertilized eggs and developing seeds release hormones that are important determinants of fruit set [25, 26] . There are many obstacles to the success of sexual reproduction in plants. In this study, the in vitro germination rate of pollen was very low, with a germination rate after 12 h of only about 11%. In addition, pollen research in the Zanthoxylum piperitum showed that the pollen germination rate was only 10%, which was mutually verified with the results of this study. This is far lower than for other species [27-30] . Our results for pollen germination in vivo indicate the pollen tube has difficulty extending into the ovary to reach the egg cells with eventual degeneration of the pollen tube prior to reaching the egg cells, so preventing fertilization. Nevertheless, pollination did increase the levels of ABA, IAA, GA3 and JA and fruit set. Figure 7 . Hormone signal regulation model after pollination of Zanthoxylum bungeanum . In most plants, pollination is followed by fertilization, the formation of a zygote and this the development of a fruit containing viable seed(s). In an obligate apomictic plant, fertilization fails but the fruit nevertheless develops and is contains viable seeds. By analyzing the pollination process in ZB , we show that pollination fails to combine the male and female gametes but it does increase the production of ABA, IAA, GA3 and JA and so the fruit sets. We speculate that in ZB , pollination fails to achieve fertilization but nevertheless delivers a signal which activates a series of hormone synthesis pathways, which produce hormones that promote both fruit set and fruit development (Figure 7). This view is supported in tomato where it has been found that low levels of ABA lead to poor fruit development [31] . In cherry, ABA and its signal transduction related gene PaSnRK2.1/2.2/2.4 are highly expressed in the ovary and young fruit. This indicates ABA plays an important role in fruit development [32] . In Arabidopsis , ABA has also been shown to act as a switch for flower development. It has been shown that ABA activates photoperiod response genes and flowering genes to promote flowering, but ABA can also inhibit flowering, independent of the flowering gene [33] . The interaction between hormones is an important element of floral organ development. In the citrus ovule, it has been shown that IAA activates the expression of the GA3 biosynthetic gene, while also reducing the breakdown of GA3. Applications of exogenous IAA or GA3 to unpollinated citrus flowers restores fruit set and fruit development to the same levels as pollination [34] . ABI5 is a transcription factor that binds specifically to the auxin response element 5'-TGTCTC-3', thereby functioning as a transcriptional activator. It can form a dimer with Aux/IAA protein to participate in the expression of auxin while promoting the synthesis of JA [35-37] . ARF7 is also an auxin response factor with high expression levels in tomato ovaries and these regulate fruit development [38] . In many plants, successful pollination and fertilization can induce increases in auxin and gibberellin levels in the ovary [39-41] . Moreover, after pollination, auxin and gibberellin response genes were up-regulated, indicating auxin and gibberellin signals can be induced by pollination [42] . We selected 300 samples to identify the reproductive mode in ZB Hancheng Dahongpao. We found no evidence of successful fertilization. We conclude its reproductive mode is obligate apomictic. However, due to the complex genetic background of ZB genotypes and the wide phenotypic variability among its cultivars [43, 44] , we cannot exclude the possibility that some ZB genotypes may well be able to reproduce through normal sexual processes. We recorded fruit set and fruit size of pollinated and unpollinated flowers. These indicate that pollination had no significant effect on the development of fruit size in ZB but can significantly increase fruit set. Commercial cultivars of ZB are generally considered dioecious, and yet there are usually no male plants in a plantation. Therefore, we suggest a small proportion of male plants should be co-established in a commercial ZB plantation to increase fruit set, and thus fruit yield. methods Fruit of the ZB cultivar ‘Hancheng Dahongpao’ was collected from the Fengxian Experimental Station of the Northwest A&F University (N33°59′6.55′′ E106°39′29.38′′). Prof. Liu Yonghong identified the materials. The experimental materials are currently stored in the specimen room of the College of Forestry, Northwest A&F University (WUK 0028639). A healthy five-year-old tree with uniform growth was selected and the unopened flowers were continuously sampled at 1 d intervals. A portion of the sample was stored in liquid nitrogen in a -80 ℃ refrigerator, and another portion placed in FAA fixative. Each analysis was repeated three times. Pollen germination The collected ZB anthers were surface sterilized with 1% sodium hypochlorite for 8 minutes, washed three times with sterile water, and then the pollen in the anthers was transferred to a solid medium. The medium components were agarose (5.8 g/L), sucrose (50 g/L) and boric acid (0.01 g/L) [17-19] . It was then incubated at 25 ± 2℃ with a light intensity of 2000 lx. Pollen tube growth greater than one cell diameter. Pollen germination was assessed after 3, 6 and 12 h. Total RNA extraction and reverse transcription RNA samples were extracted using the TaKaRa MiniBEST Plant RNA Extraction Kit (TaKaRa, Beijing, China). The Mir-X miRNA First-Strand Synthesis Kit (TaKaRa, Beijing, China) was used for reverse transcription of mRNAs and the Mir-X TM miRNA First Strand Synthesis Kit (TaKaRa, Beijing, China) was used for reverse transcription of miRNAs. RT-qPCR The RT-qPCR reaction was carried out using the cDNA of the collected material as a template. The primers for RT-qPCR were designed by Primer Premier 5.0 (Palo Alto, CA, USA). These primers are listed in Table 3. The RT-qPCR reaction was carried out in a CFX96 Real-Time PCR Detection System with a reaction system (Bio-Rad, Hercules, CA, USA) of 10 μL containing 5 μL of 2× SYBR Premix Ex Taq II (TaKaRa), 0.5 μL of upstream and downstream primers, 3 μL of ddH 2 O, and 1 μL of cDNA as template. The reaction procedure was at 95℃ for 30 s, then 35 cycles at 94℃ for 5 s, at 54℃ for 30 s and at 72℃ for 45 s. ZBUBQ and ZBUBA were used as reference genes to correct the relative expression levels of mRNAs [20] and U6 was used as a reference gene for miRNAs [21] . Table 3 . RT-qPCR primers. Gene Name Description upstream Primer Sequence (5`-3`) downstream Primer Sequence (5`-3`) miRNAs Primer Sequence (5 `-3`) AGL9 Agamous-like MADS-box protein AGL9 homolog CTGATGAGCGAAGCAAATAAG GTCCAAGGGTTGAAAAAAGGT ath-miR156b-3p TGCTCACCTCTCTTTCTGTCAGT IAA8 Auxin-responsive protein IAA8 GGAAAACACACTGGCCACTAAT TCCATGCTGACCTTGACAAACA ath-miR165a-3p TCGGACCAGGCTTCATCCCCC M3KE1 MAP3K epsilon protein kinase 1 CTTAGAGAATCTTCAGCGGGCA CCATATCACACAGTAGAGGCAA ath-miR166a-3p TCGGACCAGGCTTCATTCCCC ABF4 ABSCISIC ACID-INSENSITIVE 5-like protein 7 AGGATCTTTAACTTTGCCACG CACTCACATCTTCAGCACCAG ath-miR167d TGAAGCTGCCAGCATGATCTGG MYB44 Transcription factor MYB44 ACAACAACTCAATCCACTCGGT TCCTTATCATCTCTTGCATCAC ath-miR396a-3p GTTCAATAAAGCTGTGGGAAG G2OX8 Gibberellin 2-beta-dioxygenase 8 TTGATAAGAAGAGCCAAGAAGAC TTAGTGAAACCAGCAACAGAAGT ath-miR5658 ATGATGATGATGATGATGAAA ARF6 Auxin response factor 6 TTCTATTTCATTGCCCCCTTTT TTGTGGAATCACTATTGCTCCC novel_10 AGATCATGTTGCAGTTTCACC ASY3 Meiosis-specific protein ASY3 CAGAAAATAAAGGTGAGGGTGC AATGGGTGCTGTTTGGTAAAAG novel_27 AACGAGTCTGATGGTTCAAGAATC ARF2 Auxin response factor 2 ATGGTTGGTGTGAGTGGAGAAGGGG CCCCTTCTCCACTCACACCAACCAT novel_29 AGCTCTCTGAACTCCAAGTC FLK Flowering locus K homology domain TCAAATACCCAGTCGGCACCAT CTGTCATCTCCCCAGGAACACC novel_38 TGCTTACTTCTCTTTCTGTCAG WRKY40 Probable WRKY transcription factor 40 ATCCTTCTCCTCGAGCCTACTT TTGGTCCTCAACACTTCTTTGT novel_48 CAACAGAATCGGCCTTCTTT ARF2 Auxin response factor 2 AGCAGAGGTTTACTGGGACC ACATCGGAAGTGGATTGAGA novel_56 TCGGACTTTCGCTATCTTTTAGGGT SERK2 Somatic embryogenesis receptor kinase 2 GAAGATAAAGGTTTGGGCTT GTACAGGGATTGACGAGGGT novel_64 ATCGTCCGCATATGCAATAAAGC PIE1 Protein PHOTOPERIOD-INDEPENDENT EARLY FLOWERING 1 ACTCGGGATTTGATAATGGACCT TCTTCCTCAATAGTGTGCTCGTC novel_66 TTTGGACTGAAGGGAGCTCCT PSF2 DNA replication complex GINS protein PSF2 CAAGAAGTAACTAGACAGCGGCA GAAAAGAGAGAGGAAAGAAACGG novel_76 TTCTCTTTTACAAGATTGTAGA FBP1 Floral homeotic protein FBP1 AATTCTTCAGTTTGCTTCCTTG AGATGTGACATCATTTCCCTTG novel_77 AAAGGCCGAACCTCACCTGACA U6 Reference gene of miRNAs TTGGACCATTTCTCGATTTGTGC CCTTAGGGGACATCCGATAAAATTG - - ZBUBQ ubiquitin extension protein TCGAAGATGGCCGTACATTG TCCTCTAAGCCTCAGCACCA - - ZBUBA ubiquitin-60S ribosomal protein L40 GACTTAGGGGAGGGATTATTGAG TTCTTCTTCCGACAGTTTACAGC - - Hormone content determination Based on the endogenous hormone extraction and determination methods of Niu Huiling et al. [22] we took a 0.5 g tissue sample, extracted it with 80% methanol, purified it, dry it under a stream of nitrogen, diluted it to 1.0 mL. We then determined the auxin (IAA) , gibberellin (GA 3 ) , JA (jasmonic acid) and abscisic acid (ABA) contents of ZB fruits at different times by LC–MS/MS. ). There were two samples (pollinated and non-pollinated fruit) and each was repeated three times. Details of the LC–MS/MS were liquid chromatograph (Shimadzu; Wondasil C18 column (150 mm × 4.6 mm, 5 μm); column temperature 35°C; injection volume 2 μL; flow rate 0.5 mL • min-1; mobile phase A: ultrapure water; Phase B: methanol; gradient elution procedure: 0 ~ 6.5 min, 40% B; 6.5 ~ 11.0 min, 100% B; 11.0 ~ 15.0 min, 40% B) and mass spectrometer (API 2000; mass spectrometry. Conditions: API; ion source temperature: 450°C; scanning method: multiple reaction monitoring MRM). miRNA target gene prediction The psRNATarget online site (http://plantgrn.noble.org/psRNATarget/) was used for interaction analysis between miRNA and target mRNA. The miRNAs and mRNA sequences were uploaded to the website and the conditions were set to the default values. The interaction relationship between miRNAs and mRNA was analyzed, and the most reliable results were obtained by screening. Abbreviations ABA: Abscisic acid; AGL9: agamous-like MADS-box protein; GA: Gibberellin acid; IAA: Indole-3-acetic acid; JA: jasmonic acid; SERK2: somatic embryogenesis receptor kinase 2. Declarations Acknowledgements Thanks to the experimental technical support provided by Dr. Huang Dong. Authors’ contributions A.W. conceived the project. X.F. designed the experiments and performed the experiment. X.F. wrote the paper. All authors (X.F., Y.M., T.Y. and A.W.) discussed the results and commented on the manuscript. Funding The funders had no role in the experiment design, data analysis, decision to publish or preparation of the manuscript. This study was financially supported by the National Key Research and Development Program Project Funding (2018YFD1000605). Availability of data and materials Not applicable. Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Declarations The authors declare there are no commercial financial conflicts of interest. References Xiao-Qin, Y.U., et al., Evaluation of Specific Quality of Zanthoxylum bungeanum Maxim and Zanthoxylum schinifolium Sieb. et Zucc. Food Science, 2009. 30 (15): p. 45-48. Bhatt, V., et al., Simultaneous quantification and identification of flavonoids, lignans, coumarin and amides in leaves of Zanthoxylum armatum using UPLC-DAD-ESI-QTOF–MS/MS ☆ . Journal of Pharmaceutical & Biomedical Analysis, 2017. 132 : p. 46-55. Li, J.H., S.H. Zhang, and L.H. Kong, Research development of Chinese prickly ash. China Condiment, 2009. Fei, X., et al., Patterns of Drought Response of 38 WRKY Transcription Factors of Zanthoxylum bungeanum Maxim. Int J Mol Sci, 2018. 20 (1). Li, X., et al., The Chemical and Genetic Characteristics of Szechuan Pepper (Zanthoxylum bungeanumandZ. armatum) Cultivars and Their Suitable Habitat. Frontiers in Plant Science, 2016. 7 . Xiong, Q., et al., Alkylamides from pericarps of Zanthoxylum bungeanum. Phytochemistry, 1997. 46 (46): p. 1123-1126. Xiaogen, Y., Aroma constituents and alkylamides of red and green huajiao (Zanthoxylum bungeanum and Zanthoxylum schinifolium). Journal of Agricultural & Food Chemistry, 2008. 56 (5): p. 1689-96. Yang, L.C., et al., Polyphenolics Composition of the Leaves of Zanthoxylum bungeanum Maxim. Grown in Hebei, China, and Their Radical Scavenging Activities. J Agric Food Chem, 2013. 61 (8): p. 1772-1778. Xia, L., et al., Compositional and Antioxidant Activity Analysis of Zanthoxylum bungeanum Seed Oil Obtained by Supercritical CO2 Fluid Extraction. Journal of the American Oil Chemists' Society, 2010. 88 (1): p. 23-32. Mi, X., et al., Study on the extraction, separation and antimicrobial effect of volatile oil from Zanthoxylum bungeanum maxim. Journal of Nanjing Normal University, 2004. 27 (4): p. 63-66. Zhang, Z., et al., Zanthoxylum bungeanum pericarp extract prevents dextran sulfate sodium-induced experimental colitis in mice via the regulation of TLR4 and TLR4-related signaling pathways. International Immunopharmacology, 2016. 41 : p. 127-135. Bowers, W.S., et al., Insect Repellents from the Chinese Prickly Ash Zanthoxylum bungeanum. Journal of Natural Products, 1993. 56 (6): p. 935-938. Singh, G., et al., Anthelmintic efficacy of aqueous extract of Zanthoxylum armatum DC. seeds against Haemonchus contortus of small ruminants. Journal of Parasitic Diseases, 2016. 40 (2): p. 528-532. Liu, Y., Apomixis in Zanthoxylum bungeanum and Z. simulans. Journal of Genetics & Genomics, 1987. 14 (2): p. 107-113. Bicknell, R.A. and A.M. Koltunow, Understanding apomixis: recent advances and remaining conundrums. Plant Cell, 2004. 16 Suppl : p. S228-45. Matzk., F., et al., Reconstruction of reproductive diversity in Hypericum perforatum L. opens novel strategies to manage apomixis. Plant Journal, 2001. 26 (3): p. 275-282. Ji-wen., H., et al., Research on Pollen Germination and Vigor of Toona sinensis. Forest R esearch, 2019. 32 (2): p. 160-165. Shivanna, K.R., H.F. Linskens, and M. Cresti, Pollen viability and pollen vigor. Theoretical & Applied Genetics, 1991. 81 (1): p. 38-42. Hong-Zao, H.E., Study on the Pollen Viability of Zanthoxylum planispinum var.dingtanensis and its Response to Zinc. Journal of Anhui Agricultural Sciences, 2007. Fei, X., et al., Expression Stabilities of Ten Candidate Reference Genes for RT-qPCR in Zanthoxylum bungeanum Maxim. Molecules, 2018. 23 (4). Zhang, X., et al., miRNA and mRNA expression profiles reveal insight into the chitosan-mediated regulation of plant growth. J Agric Food Chem, 2018. 66 (15): p. 3810-3822. Hui-ling., N., et al., Flower Formation and Endogenous Hormones Dynamic in Chinese Jujube. Acta Horticulturae Sinica, 2015. 42 (4): p. 655–664. Berger, F., et al., Double fertilization - caught in the act. Trends in Plant Science, 2008. 13 (8): p. 437-443. Gillaspy, G., H. Bendavid, and W. Gruissem, Fruits: A Developmental Perspective. Plant Cell, 1993. 5 (10): p. 1439-1451. Koltunow, A.M., Special Review Issue on Plant Reproduction || Apomixis: Embryo Sacs and Embryos Formed without Meiosis or Fertilization in Ovules. Plant Cell, 1993. 5 (10): p. 1425-1437. Koltunow, A.M., R.A. Bicknell, and A.M. Chaudhury, Apomixis: Molecular Strategies for the Generation of Genetically Identical Seeds without Fertilization. Plant Physiology, 1995. 108 (4): p. 1345-1352. Sato, S., et al., Establishment of reliable methods of in vitro pollen germination and pollen preservation of Brassica rapa (syn. B. campestris). Euphytica, 1998. 103 (1): p. 29-33. Fan, L.M., et al., In vitro Arabidopsis pollen germination and characterization of the inward potassium currents in Arabidopsis pollen grain protoplasts. Journal of Experimental Botany, 2001. 52 (361): p. 1603-1614. ROSELL, HERRERO, and G. V., Pollen germination of cherimoya (Annona cherimola Mill.). In vivo characterization and optimization of in vitro germination. Scientia Horticulturae, 1999. 81 (3): p. 251-265. Ylstra, B., et al., Steroid Hormones Stimulate Germination and Tube Growth of in Vitro Matured Tobacco Pollen. Plant Physiology, 1995. 107 (2): p. 639-643. Nitsch, L., et al., ABA-deficiency results in reduced plant and fruit size in tomato. Journal of Plant Physiology, 2012. 169 (9): p. 878-883. Leng, P., et al., Expression pattern of ABA metabolic and signalling genes during floral development and fruit set in sweet cherry. Plant Growth Regulation, 2017. 84 (4): p. 1-10. Riboni, M., et al., ABA-dependent control of GIGANTEA signalling enables drought escape via up-regulation of FLOWERING LOCUS T in Arabidopsis thaliana. Journal of Experimental Botany, 2016. 67 (22): p. 6309-6322. Bermejo, A., et al., Auxin and Gibberellin Interact in Citrus Fruit Set. Journal of Plant Growth Regulation, 2017. 37 (2): p. 491-501. Wu, J., et al., Gladiolus hybridus ABSCISIC ACID INSENSITIVE 5 (GhABI5) is an important transcription factor in ABA signaling that can enhance Gladiolus corm dormancy and Arabidopsis seed dormancy. Front Plant Sci, 2015. 6 : p. 960. Dekkers, B.J.W., et al., The Arabidopsis DELAY OF GERMINATION 1 gene affects ABSCISIC ACID INSENSITIVE 5 (ABI5) expression and genetically interacts with ABI3 during Arabidopsis seed development. Plant Journal, 2016. 85 (4): p. 451-465. Tabata, R., et al., Arabidopsis auxin response factor6 and 8 regulate jasmonic acid biosynthesis and floral organ development via repression of class 1 KNOX genes. Plant Cell Physiol, 2010. 51 (1): p. 164-75. de Jong, M., et al., TheSolanum lycopersicumauxin response factor 7 (SlARF7) regulates auxin signaling during tomato fruit set and development. The Plant Journal, 2009. 57 (1): p. 160-170. Koshioka, M., et al., Analysis of gibberellins in growing fruits of Lycopersicon esculentum after pollination or treatment with 4-chlorophenoxyacetic acid. Journal of Pomology & Horticultural Science, 1994. 69 (1): p. 171-179. Mapelli, S., et al., Relationship between set, development and activities of growth regulators in tomato fruits. Plant & Cell Physiology, 1978. 19 (7): p. 1281-1288. Sjut, V. and F. Bangerth, Induced parthenocarpy—a way of changing the levels of endogenous hormones in tomato fruits ( Lycopersicon esculentum Mill.) 1. Extractable hormones. Plant Growth Regulation, 1982. 1 (4): p. 243-251. Vriezen, W.H., et al., Changes in tomato ovary transcriptome demonstrate complex hormonal regulation of fruit set. New Phytologist, 2010. 177 (1): p. 60-76. Chen, X., et al., Quality evaluation and chemometric discrimination of Zanthoxylum bungeanum Maxim leaves based on flavonoids profiles, bioactivity and HPLC-fingerprint in a common garden experiment. Industrial Crops and Products, 2019. 134 : p. 225-233. Ke, J., et al., Application of HPLC fingerprint based on acid amide components in Chinese prickly ash (Zanthoxylum). Industrial Crops and Products, 2018. 119 : p. 267-276. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5125","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research article","associatedPublications":[],"authors":[{"id":154972,"identity":"591b18c3-4ae6-46be-b0b8-2b2d76c087fa","order_by":1,"name":"Xitong Fei","email":"","orcid":"","institution":"Northwest Agriculture and Forestry University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xitong","middleName":"","lastName":"Fei","suffix":""},{"id":154973,"identity":"9b9b4e4f-e8a9-4264-b690-6f205cf49fdd","order_by":2,"name":"Yao Ma","email":"","orcid":"","institution":"Northwest Agriculture and Forestry University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yao","middleName":"","lastName":"Ma","suffix":""},{"id":154974,"identity":"79e56e72-b91b-47f2-8611-37c0e2dfda97","order_by":3,"name":"Tuxi Yang","email":"","orcid":"","institution":"Northwest Agriculture and Forestry University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tuxi","middleName":"","lastName":"Yang","suffix":""},{"id":154975,"identity":"182f89d2-cc06-481b-b4b7-90d911b7efdc","order_by":4,"name":"Anzhi Wei","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4klEQVRIie3PMQrCMBSA4VeE1OGha6WigxfIJIJFr9IidCriESoBXTyAx/AIqQ/r4gEKCiKCm1BwEexgcFVi3RzyD5nel8cDMJn+MitWj0RmCylz7g3KkxqmQbKchKOyqyS0nKhDmK9fP2jjWzG9TYpDkzkRkMdlBWzarLRklwh3iRdkeJUU8UMNMAwzHelmQeyiQ+r8sa/IpQIOdvXkeBIP5IpAxKnHyYq/ksyauegrUlUEypDhLpj1USqCqZ8seDhi325pzLfnPRY0bM8F5ffCG9RtSrXkPfbbuMlkMpk+9QRpNE9Z7sGjDAAAAABJRU5ErkJggg==","orcid":"","institution":"Northwest Agriculture and Forestry University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Anzhi","middleName":"","lastName":"Wei","suffix":""}],"badges":[],"createdAt":"2019-09-12 13:09:35","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.2.14447/v1","doiUrl":"https://doi.org/10.21203/rs.2.14447/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":86560,"identity":"13ee9260-2c10-4064-9084-70628764dd0a","added_by":"auto","created_at":"2019-09-16 00:37:05","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":115614,"visible":true,"origin":"","legend":"In vitro germination and pollen morphology of Zanthoxylum bungeanum pollen. (a) Pollen germination In vitro for 3 h, (b) Pollen germination In vitro for 6 h, (c) Pollen germination In vitro for 12 h, (d) anther, (e) Pollen grain, (f) Pollen grain.","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/0eb3f9a3-33a9-4b2f-813e-d10128b012b4/v1/1.jpg"},{"id":86562,"identity":"2077fa66-e165-4034-8f1f-f237201428ca","added_by":"auto","created_at":"2019-09-16 00:37:05","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":128614,"visible":true,"origin":"","legend":"Germination of pollen on the stigma of Zanthoxylum bungeanum. ca: callosum, ce:cellulose, ow: ovary wall,po:pollen, pt:pollen tube, sdp: stigma drop position.","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/0eb3f9a3-33a9-4b2f-813e-d10128b012b4/v1/2.jpg"},{"id":86563,"identity":"af7f8675-d46b-40a2-9078-f64238da615d","added_by":"auto","created_at":"2019-09-16 00:37:05","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":109145,"visible":true,"origin":"","legend":"Path enrichment analysis. (a) Total pathway enrichment analysis. (b) Active pathway after pollination. (c) Inactive pathway after pollination.","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/0eb3f9a3-33a9-4b2f-813e-d10128b012b4/v1/3.jpg"},{"id":86564,"identity":"a5fb1af0-46b0-460a-8b7b-e6353e812646","added_by":"auto","created_at":"2019-09-16 00:37:05","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":50374,"visible":true,"origin":"","legend":"Differential gene Venn diagram and volcano map.","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/0eb3f9a3-33a9-4b2f-813e-d10128b012b4/v1/4.jpg"},{"id":86565,"identity":"9db9876f-e3fd-40c5-8cc2-eaed462a8b22","added_by":"auto","created_at":"2019-09-16 00:37:05","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":139279,"visible":true,"origin":"","legend":"Relative expression levels of miRNAs and their target genes","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/0eb3f9a3-33a9-4b2f-813e-d10128b012b4/v1/5.jpg"},{"id":86566,"identity":"1a680a58-3259-4827-bc5e-a9d17ace1bbf","added_by":"auto","created_at":"2019-09-16 00:37:05","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":43850,"visible":true,"origin":"","legend":"Hormone content of unpollinated and pollinated material of Zanthoxylum bungeanum.","description":"","filename":"6.jpg","url":"https://assets-eu.researchsquare.com/files/0eb3f9a3-33a9-4b2f-813e-d10128b012b4/v1/6.jpg"},{"id":86567,"identity":"932c1b2e-d35f-40eb-998d-c455c6a1246f","added_by":"auto","created_at":"2019-09-16 00:37:05","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":141805,"visible":true,"origin":"","legend":"Hormone signal regulation model after pollination of Zanthoxylum bungeanum.","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/0eb3f9a3-33a9-4b2f-813e-d10128b012b4/v1/Figure 7.jpg"},{"id":13473426,"identity":"12e3bb38-5c75-4eac-9480-833af62095ea","added_by":"auto","created_at":"2021-09-16 21:19:30","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":884792,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5125/v1/5bb533e0-70f2-46bf-bb79-893ae575438a.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003emiRNA and mRNA studies reveal pollination activates hormonal signaling and increases fruit set in the apomictic tree Zanthoxylum bungeanum Maxim\u003c/p\u003e","fulltext":[{"header":"background","content":"\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eZanthoxylum bungeanum\u003c/span\u003e\u003c/em\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e Maxim. (\u003cem\u003eZB\u003c/em\u003e), common name Chinese prickly ash, is a shrub or dungarunga belonging to the rutaceae. There are about 250 species of the genus \u003cem\u003eZanthoxylum\u003c/em\u003e, which is widely distributed round the world, though most species of this genus originate in Asia \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[1]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. Based on the color of the fruit at maturity, it is divided into two types: red Chinese prickly ash and green Chinese prickly ash. The young leaves of\u003cem\u003e ZB\u003c/em\u003e can be eaten as a vegetable and the fruits, stems and roots can be used as medicines \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[2]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. The fruit skin is one of China's eight most important condiments. Having a unique numbing taste. This product is in wide use in Asian cuisine and is an important seasoning for the traditional Chinese hot pot \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[3, 4]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. The fruit skin of \u003cem\u003eZB\u003c/em\u003e is a traditional herbal medicine in China and has been in use for more than 2,000 years \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[5]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. Over 140 chemical compounds have been identified in \u003cem\u003eZB,\u003c/em\u003e including alkaloids, anthraquinones, flavonoids and free fatty acids \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[6-9]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. Used as a medicine, the skin has anti-inflammatory, antibacterial and insecticidal effects \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[10-13]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e.\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e For these reasons, \u003cem\u003eZB\u003c/em\u003e is an important species, that also has significant potential for commercial development.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eInterestingly, the normal reproductive mode of \u003cem\u003eZB\u003c/em\u003e is apomictic \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[14]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e - a mode that produces viable seed without pollination. Hence, the genotype of the offspring is identical to that of the female parent \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[15, 16]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. In a commercial species, apomixis can be both a disadvantage and an advantage. The apomictic mechanism maintains the superior traits of the female for breeding, and can also provide a useful model for the genetic breeding of plant traits. However, the performance of apomictic plants following pollination has rarely been reported. Therefore, a study of differences between plants resulting from pollination and from non-pollination should help reveal the mechanisms of apomixis and thus provide a useful reference for plant genetic breeding research.\u003c/span\u003e\u003c/p\u003e"},{"header":"Results","content":"\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003ePollen germination \u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003ePollen germination tests were carried out on pollen on the \u003cem\u003ein vitro\u003c/em\u003e germination medium, and pollen germination rate was counted and expressed as a percentage. The results showed the pollen germination rate of \u003cem\u003eZB\u003c/em\u003e pollen increased from 4.30% after 3 h to 10.70% after 12 h (Figure 1 and Table 1). In general, the germination rate of \u003cem\u003eZB\u003c/em\u003e pollen is low, which presents a huge obstacle to sexual reproduction in this species.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eFigure 1.\u003c/span\u003e\u003c/strong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e \u003cem\u003eIn vitro\u003c/em\u003e germination and pollen morphology of \u003cem\u003eZanthoxylum bungeanum\u003c/em\u003e pollen. (a) Pollen germination\u003cem\u003e In vitro\u003c/em\u003e for 3 h, (b) Pollen germination\u003cem\u003e In vitro\u003c/em\u003e for 6 h, (c) Pollen germination\u003cem\u003e In vitro\u003c/em\u003e for 12 h, (d) anther, (e) Pollen grain, (f)\u003c/span\u003e \u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003ePollen grain.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTable 1. \u003c/span\u003e\u003c/strong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eGermination rate of \u003cem\u003eZanthoxylum pollen in vitro\u003c/em\u003e.\u003c/span\u003e\u003c/p\u003e\n\u003ctable style=\"border-collapse: collapse; border: none;\"\u003e\n\u003ctbody\u003e\n\u003ctr style=\"height: 12.1pt;\"\u003e\n\u003ctd style=\"width: 117.45pt; border: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 12.1pt;\" width=\"157\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTime (h)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 117.45pt; border: solid windowtext 1.0pt; border-left: none; padding: 0in 5.4pt 0in 5.4pt; height: 12.1pt;\" width=\"157\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e3 \u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 117.5pt; border: solid windowtext 1.0pt; border-left: none; padding: 0in 5.4pt 0in 5.4pt; height: 12.1pt;\" width=\"157\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e6 \u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 117.5pt; border: solid windowtext 1.0pt; border-left: none; padding: 0in 5.4pt 0in 5.4pt; height: 12.1pt;\" width=\"157\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e12 \u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 24.65pt;\"\u003e\n\u003ctd style=\"width: 117.45pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 24.65pt;\" width=\"157\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eGermination rate (%)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 117.45pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 24.65pt;\" width=\"157\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e4.30\u0026plusmn;0.30\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 117.5pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 24.65pt;\" width=\"157\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e6.20\u0026plusmn;0.50\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 117.5pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 24.65pt;\" width=\"157\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e10.70\u0026plusmn;1.40\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eFigure 2\u003c/span\u003e\u003c/strong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. Germination of pollen on the stigma of \u003cem\u003eZanthoxylum bungeanum.\u003c/em\u003e ca: callosum, ce:cellulose, ow:\u003c/span\u003e \u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eovary wall,po:pollen, pt:pollen tube, sdp:\u003c/span\u003e \u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003estigma drop position.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"text-indent: 24.0pt; line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eFluorescence microscopy shows pollen germinates on the stigma of \u003cem\u003eZB\u003c/em\u003e. Pollen tube growth commenced by 6 h (Figure 2). After 12 h pollen tube began to extend. After 2 d, the pollen tube penetrated the ovary wall. By 3 d after pollination the stigma begins to wither. Stigma fluorescence gradually dims during the withering process. After 4 d, the stigma falls off but the pollen tube in the ovary wall can still extend further downwards. After 5 d, the pollen tube is broken down into callosum so the fertilization process cannot be completed.\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e We observed 300 samples and found no successful fertilization in any of them. It is thus preliminarily concluded that the reproductive mode of \u003cem\u003eZB \u003c/em\u003ecv. \u0026lsquo;Hancheng Dahongpao\u0026rsquo; is obligate apomixis.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003ePath enrichment analysis\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eThe pathway enrichment analysis of differential genes reveals changes before and after pollination. It can be seen from Figure 3 that pollination has a significant effect on the various pathways of \u003cem\u003eZB\u003c/em\u003e than unpollinated. After pollination, hormone signal transduction is most active, as are metabolic pathways including starch and sucrose metabolism, glycolysis/gluconeogenesis and phenylpropanoid synthesis. Figure 3b shows the pathway of increased expression after pollination, and Figure 3c shows the pathway of decreased expression after pollination. More than 100 genes were enriched and show elevated expression levels after pollination in the hormone signal transduction pathway. Meanwhile, starch and sucrose metabolism, glycolysis/gluconeogenesis, amino sugar and nucleotide metabolism all showed significant downward trends.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eFigure 3.\u003c/span\u003e\u003c/strong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e Path enrichment analysis. (a)\u003c/span\u003e \u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTotal pathway enrichment analysis. (b)\u003c/span\u003e \u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eActive pathway after pollination. (c) Inactive pathway after pollination.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eFigure 4.\u003c/span\u003e\u003c/strong\u003e \u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eDifferential gene Venn diagram and volcano map.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"text-indent: 24.0pt; line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTranscriptome sequencing of pollinated and unpollinated fruits showed that a total of 69,131 reads were detected. Of these 4,431 were unique to unpollinated material and 4,078 were unique to pollination material (Figure 4). As indicated in the volcano map 7,102 genes were up-regulated and 6491 genes were down-regulated. From this it can be inferred that pollination has a strong influence on transcriptome level in \u003cem\u003eZB\u003c/em\u003e fruits.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003emiRNAs and target genes\u003c/span\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e expression patterns\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eBy analyzing interactions between miRNAs and mRNA in pollinated and non-pollinated fruit, it was found that pollinated fruits were more active in a range of hormone signaling pathways. Pollination can activate ABA, IAA, GA3, jasmonic acid synthesis genes and genes associated with asexual development, such as somatic embryogenesis receptor kinase 2 (\u003cem\u003eSERK2\u003c/em\u003e), agamous-like MADS-box protein (\u003cem\u003eAGL9\u003c/em\u003e), also activating a large number of flower development genes and transcription factors. To further determine the relationship of miRNAs to target genes, RT-qPCR was used to detect relative expression levels of miRNAs and their target genes.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"text-indent: 24.0pt; line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAccording to the results of the RT-qPCR, the reliability of transcriptome and miRNA sequencing results can be determined and the relative expression levels of some miRNAs and their target genes after pollination were confirmed (Figure 5). The results show the expression levels of the ABA, IAA, GA3 and JA synthesis genes and some transcription factors and their corresponding miRNAs were negatively correlated after pollination. This indicates miRNAs and mRNAs are widely involved in the regulation of hormones after pollination of this apomictic Chinese prickly ash cultivar.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eFigure 5\u003c/span\u003e\u003c/strong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. Relative expression levels of miRNAs and their target genes.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eHormone content analysis\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eThe transcriptome and miRNA sequencing shows many hormone pathways became active after pollination. We recorded the levels of four hormones ABA, IAA, GA3 and JA were for pollinated and unpollinated materials. The results show the four hormones were significantly higher in the pollination material than in the \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eunpollinated\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e (Figure 6). This indicates pollination can activate the synthetic pathway of these four hormones, it also suggests these four hormones participate in the development of embryos and fruits of \u003cem\u003eZB\u003c/em\u003e and, ultimately, in fruit set.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eFigure 6\u003c/span\u003e\u003c/strong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. Hormone content of unpollinated and pollinated material of\u003cem\u003e Zanthoxylum bungeanum\u003c/em\u003e.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"text-indent: 24.0pt; line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eComparing the pollinated with the unpollinated \u003cem\u003eZB\u003c/em\u003e material (Table 2), it is clear that pollination significantly increased fruit set rate but had little effect on fruit size.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTable 2\u003c/span\u003e\u003c/strong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. Pollination and non-pollination fruit set rate and fruit size.\u003c/span\u003e\u003c/p\u003e\n\u003ctable style=\"border-collapse: collapse; border: none;\"\u003e\n\u003ctbody\u003e\n\u003ctr style=\"height: 16.75pt;\"\u003e\n\u003ctd style=\"width: 154.25pt; border: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 16.75pt;\" width=\"206\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eSamples\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 170.1pt; border: solid windowtext 1.0pt; border-left: none; padding: 0in 5.4pt 0in 5.4pt; height: 16.75pt;\" width=\"227\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eNon-pollination\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.05pt; border: solid windowtext 1.0pt; border-left: none; padding: 0in 5.4pt 0in 5.4pt; height: 16.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003ePollination\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 16.75pt;\"\u003e\n\u003ctd style=\"width: 154.25pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 16.75pt;\" width=\"206\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eFruit set rate\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 170.1pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 16.75pt;\" width=\"227\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e74.12% b\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 16.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e89.31% a\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 16.75pt;\"\u003e\n\u003ctd style=\"width: 154.25pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 16.75pt;\" width=\"206\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eFruit length (axial)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 170.1pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 16.75pt;\" width=\"227\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e5.83\u0026plusmn;0.72 a\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 16.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e5.85\u0026plusmn;0.56 a\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 17.4pt;\"\u003e\n\u003ctd style=\"width: 154.25pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 17.4pt;\" width=\"206\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eFruit diameter (transverse)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 170.1pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 17.4pt;\" width=\"227\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e5.59\u0026plusmn;0.81 a\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 17.4pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e5.60\u0026plusmn;0.88 a\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eConclusion\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003ePollen of \u003cem\u003eZB\u003c/em\u003e was cultured \u003cem\u003ein vitro\u003c/em\u003e on a solid culture medium for 12 h. At this stage germination percentage was only 10.77%. Fluorescence microscopy showed that the pollen does germinate on the \u003cem\u003eZB\u003c/em\u003e stigma and that the pollen tube extended to the ovary after 2 d but then degenerated to callosum after 5 d without fertilization. The reproductive mode of \u003cem\u003eZB\u003c/em\u003e (Hancheng Dahongpao) is identified as obligate apomixis. Enrichment analysis of differentially expressed genes in the pollination and non-pollination materials indicate plant hormone signaling pathways were activated by fertilization. The relative expressions of ABA, IAA, GA3 and JA were up-regulated. At the same time, genes related to asexual development were also activated, including somatic embryogenesis receptor kinase 2 (SERK2) and agamous-like MADS-box protein (AGL9). A large number of other genes and transcription factors related to flower development were also activated. RT-qPCR showed the relative expression levels of mRNAs and miRNAs related to the hormone signaling pathway and to flower development were negatively correlated, suggesting miRNA is an important factor influencing hormone regulation after pollination of apomictic \u003cem\u003eZB\u003c/em\u003e. Comparison of pollination and non-pollination materials showed increases in the contents of ABA, IAA, GA3 and JA. Nevertheless, although pollination did not result in fertilization, it did increase fruit set significantly. \u003c/span\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eDouble fertilization is one of the most common reproductive modes in plants, egg cells combine with the polar nuclei of pollen \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[23]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. The fertilized egg cells then develop into embryos. The latter develops into endosperm, which provides energy for seed germination. Nevertheless, some plants can form viable seeds without fertilization having taken place. This indicates fertilization is not essential for seed formation \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[24]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. Analysis of hormones in unpollinated and pollinated ovaries of various species reveals that fertilized eggs and developing seeds release hormones that are important determinants of fruit set \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[25, 26]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"text-indent: 24.0pt; line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eThere are many obstacles to the success of sexual reproduction in plants. In this study, the \u003cem\u003ein vitro\u003c/em\u003e germination rate of pollen was very low, with a germination rate after 12 h of only about 11%. In addition, pollen research in the \u003cem\u003eZanthoxylum piperitum\u003c/em\u003e showed that the pollen germination rate was only 10%, which was mutually verified with the results of this study. This is far lower than for other species \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[27-30]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. Our results for pollen germination \u003cem\u003ein vivo\u003c/em\u003e indicate the pollen tube has difficulty extending into the ovary to reach the egg cells with eventual degeneration of the pollen tube prior to reaching the egg cells, so preventing fertilization. Nevertheless, pollination did increase the levels of ABA, IAA, GA3 and JA and fruit set.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eFigure 7\u003c/span\u003e\u003c/strong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e.\u003c/span\u003e \u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eHormone signal regulation model after pollination of \u003cem\u003eZanthoxylum bungeanum\u003c/em\u003e.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eIn most plants, pollination is followed by fertilization, the formation of a zygote and this the development of a fruit containing viable seed(s). In an obligate apomictic plant, fertilization fails but the fruit nevertheless develops and is contains viable seeds. By analyzing the pollination process in \u003cem\u003eZB\u003c/em\u003e, we show that pollination fails to combine the male and female gametes but it does increase the production of ABA, IAA, GA3 and JA and so the fruit sets. We speculate that in \u003cem\u003eZB\u003c/em\u003e, pollination fails to achieve fertilization but nevertheless delivers a signal which activates a series of hormone synthesis pathways, which produce hormones that promote both fruit set and fruit development (Figure 7).\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"text-indent: 24.0pt; line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eThis view is supported in tomato where it has been found that low levels of ABA lead to poor fruit development \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[31]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e.\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e In cherry, ABA and its signal transduction related gene \u003cem\u003ePaSnRK2.1/2.2/2.4\u003c/em\u003e are highly expressed in the ovary and young fruit. This indicates ABA plays an important role in fruit development \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[32]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. In \u003cem\u003eArabidopsis\u003c/em\u003e, ABA has also been shown to act as a switch for flower development. It has been shown that ABA activates photoperiod response genes and flowering genes to promote flowering, but ABA can also inhibit flowering, independent of the flowering gene \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[33]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. The interaction between hormones is an important element of floral organ development. In the citrus ovule, it has been shown that IAA activates the expression of the GA3 biosynthetic gene, while also reducing the breakdown of GA3. Applications of exogenous IAA or GA3 to unpollinated citrus flowers restores fruit set and fruit development to the same levels as pollination \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[34]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. ABI5 is a transcription factor that binds specifically to the auxin response element 5'-TGTCTC-3', thereby functioning as a transcriptional activator. It can form a dimer with Aux/IAA protein to participate in the expression of auxin while promoting the synthesis of JA \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[35-37]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. ARF7 is also an auxin response factor with high expression levels in tomato ovaries and these regulate fruit development \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[38]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. In many plants, successful pollination and fertilization can induce increases in auxin and gibberellin levels in the ovary \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[39-41]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e.\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e Moreover, after pollination, auxin and gibberellin response genes were up-regulated, indicating auxin and gibberellin signals can be induced by pollination \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[42]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"text-indent: 24.0pt; line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eWe selected 300 samples to identify the reproductive mode in\u003cem\u003e ZB\u003c/em\u003e Hancheng Dahongpao. We found no evidence of successful fertilization. We conclude its reproductive mode is obligate apomictic. However, due to the complex genetic background of \u003cem\u003eZB\u003c/em\u003e genotypes and the wide phenotypic variability among its cultivars \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[43, 44]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e, we cannot exclude the possibility that some \u003cem\u003eZB\u003c/em\u003e genotypes may well be able to reproduce through normal sexual processes. We recorded fruit set and fruit size of pollinated and unpollinated flowers. These indicate that pollination had no significant effect on the development of fruit size in \u003cem\u003eZB\u003c/em\u003e but can significantly increase fruit set. Commercial cultivars of \u003cem\u003eZB\u003c/em\u003e are generally considered dioecious, and yet there are usually no male plants in a plantation. Therefore, we suggest a small proportion of male plants should be co-established in a commercial \u003cem\u003eZB \u003c/em\u003eplantation to increase fruit set, and thus fruit yield.\u003c/span\u003e\u003c/p\u003e"},{"header":"methods","content":"\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eFruit of the \u003cem\u003eZB\u003c/em\u003e cultivar \u0026lsquo;Hancheng Dahongpao\u0026rsquo; was collected from the Fengxian Experimental Station of the Northwest A\u0026amp;F University (N33\u0026deg;59\u0026prime;6.55\u0026prime;\u0026prime; E106\u0026deg;39\u0026prime;29.38\u0026prime;\u0026prime;). Prof. Liu Yonghong identified the materials. The experimental materials are currently stored in the specimen room of the College of Forestry, Northwest A\u0026amp;F University (WUK 0028639). A healthy five-year-old tree with uniform growth was selected and the unopened flowers were continuously sampled at 1 d intervals. A portion of the sample was stored in liquid nitrogen in a -80\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: SimSun; color: black;\"\u003e℃\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e refrigerator, and another portion placed in FAA fixative. Each analysis was repeated three times. \u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003ePollen germination \u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eThe collected \u003cem\u003eZB\u003c/em\u003e anthers were surface sterilized with 1% sodium hypochlorite for 8 minutes, washed three times with sterile water, and then the pollen in the anthers was transferred to a solid medium. The medium components were agarose (5.8 g/L), sucrose (50 g/L) and boric acid (0.01 g/L) \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[17-19]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. It was then incubated at 25 \u0026plusmn; 2℃ with a light intensity of 2000 lx. Pollen tube growth greater than one cell diameter. Pollen germination was assessed after 3, 6 and 12 h.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTotal RNA extraction and reverse transcription\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eRNA samples were extracted using the TaKaRa MiniBEST Plant RNA Extraction Kit (TaKaRa, Beijing, China). The Mir-X miRNA First-Strand Synthesis Kit (TaKaRa, Beijing, China) was used for reverse transcription of mRNAs and the Mir-X\u003csup\u003eTM\u003c/sup\u003e miRNA First Strand Synthesis Kit (TaKaRa, Beijing, China) was used for reverse transcription of miRNAs.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eRT-qPCR\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eThe RT-qPCR reaction was carried out using the cDNA of the collected material as a template. The primers for RT-qPCR were designed by Primer Premier 5.0 (Palo Alto, CA, USA). These primers are listed in Table 3. The RT-qPCR reaction was carried out in a CFX96 Real-Time PCR Detection System with a reaction system (Bio-Rad, Hercules, CA, USA) of 10 \u0026mu;L containing 5 \u0026mu;L of 2\u0026times; SYBR Premix Ex Taq II (TaKaRa), 0.5 \u0026mu;L of upstream and downstream primers, 3 \u0026mu;L of ddH\u003csub\u003e2\u003c/sub\u003eO, and 1 \u0026mu;L of cDNA as template. The reaction procedure was at 95℃ for 30 s, then 35 cycles at 94℃ for 5 s, at 54℃ for 30 s and at 72℃ for 45 s. \u003cem\u003eZBUBQ\u003c/em\u003e and \u003cem\u003eZBUBA\u003c/em\u003e were used as reference genes to correct the relative expression levels of mRNAs \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[20]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e and U6 was used as a reference gene for miRNAs \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[21]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTable 3\u003c/span\u003e\u003c/strong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e. RT-qPCR primers.\u003c/span\u003e\u003c/p\u003e\n\u003ctable style=\"border-collapse: collapse; border: none;\" width=\"929\"\u003e\n\u003ctbody\u003e\n\u003ctr style=\"height: 26.45pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 26.45pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eGene Name\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border: solid windowtext 1.0pt; border-left: none; padding: 0in 5.4pt 0in 5.4pt; height: 26.45pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eDescription\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border: solid windowtext 1.0pt; border-left: none; padding: 0in 5.4pt 0in 5.4pt; height: 26.45pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eupstream Primer Sequence (5`-3`)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border: solid windowtext 1.0pt; border-left: none; padding: 0in 5.4pt 0in 5.4pt; height: 26.45pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003edownstream Primer Sequence (5`-3`)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border: solid windowtext 1.0pt; border-left: none; padding: 0in 5.4pt 0in 5.4pt; height: 26.45pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003emiRNAs\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border: solid windowtext 1.0pt; border-left: none; padding: 0in 5.4pt 0in 5.4pt; height: 26.45pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003ePrimer Sequence (5\u003c/span\u003e\u003cspan style=\"line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e`-3`)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAGL9\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAgamous-like MADS-box protein AGL9 homolog\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eCTGATGAGCGAAGCAAATAAG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eGTCCAAGGGTTGAAAAAAGGT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eath-miR156b-3p\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTGCTCACCTCTCTTTCTGTCAGT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eIAA8\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAuxin-responsive protein IAA8\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eGGAAAACACACTGGCCACTAAT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTCCATGCTGACCTTGACAAACA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eath-miR165a-3p\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTCGGACCAGGCTTCATCCCCC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eM3KE1\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eMAP3K epsilon protein kinase 1\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eCTTAGAGAATCTTCAGCGGGCA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eCCATATCACACAGTAGAGGCAA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eath-miR166a-3p\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTCGGACCAGGCTTCATTCCCC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eABF4\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eABSCISIC ACID-INSENSITIVE 5-like protein 7\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAGGATCTTTAACTTTGCCACG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eCACTCACATCTTCAGCACCAG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eath-miR167d\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTGAAGCTGCCAGCATGATCTGG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eMYB44\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTranscription factor MYB44\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eACAACAACTCAATCCACTCGGT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTCCTTATCATCTCTTGCATCAC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eath-miR396a-3p\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eGTTCAATAAAGCTGTGGGAAG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eG2OX8\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eGibberellin 2-beta-dioxygenase 8\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTTGATAAGAAGAGCCAAGAAGAC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTTAGTGAAACCAGCAACAGAAGT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eath-miR5658\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eATGATGATGATGATGATGAAA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eARF6\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAuxin response factor 6\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTTCTATTTCATTGCCCCCTTTT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTTGTGGAATCACTATTGCTCCC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003enovel_10\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAGATCATGTTGCAGTTTCACC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eASY3\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eMeiosis-specific protein ASY3\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eCAGAAAATAAAGGTGAGGGTGC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAATGGGTGCTGTTTGGTAAAAG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003enovel_27\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAACGAGTCTGATGGTTCAAGAATC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eARF2\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAuxin response factor 2\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eATGGTTGGTGTGAGTGGAGAAGGGG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eCCCCTTCTCCACTCACACCAACCAT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003enovel_29\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAGCTCTCTGAACTCCAAGTC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eFLK\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eFlowering locus K homology domain\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTCAAATACCCAGTCGGCACCAT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eCTGTCATCTCCCCAGGAACACC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003enovel_38\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTGCTTACTTCTCTTTCTGTCAG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eWRKY40\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eProbable WRKY transcription factor 40\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eATCCTTCTCCTCGAGCCTACTT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTTGGTCCTCAACACTTCTTTGT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003enovel_48\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eCAACAGAATCGGCCTTCTTT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eARF2\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAuxin response factor 2\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAGCAGAGGTTTACTGGGACC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eACATCGGAAGTGGATTGAGA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003enovel_56\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTCGGACTTTCGCTATCTTTTAGGGT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eSERK2\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eSomatic embryogenesis receptor kinase 2\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eGAAGATAAAGGTTTGGGCTT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eGTACAGGGATTGACGAGGGT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003enovel_64\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eATCGTCCGCATATGCAATAAAGC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003ePIE1\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eProtein PHOTOPERIOD-INDEPENDENT EARLY FLOWERING 1\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eACTCGGGATTTGATAATGGACCT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTCTTCCTCAATAGTGTGCTCGTC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003enovel_66\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTTTGGACTGAAGGGAGCTCCT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003ePSF2\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eDNA replication complex GINS protein PSF2\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eCAAGAAGTAACTAGACAGCGGCA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eGAAAAGAGAGAGGAAAGAAACGG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003enovel_76\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTTCTCTTTTACAAGATTGTAGA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eFBP1\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eFloral homeotic protein FBP1\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAATTCTTCAGTTTGCTTCCTTG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAGATGTGACATCATTTCCCTTG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003enovel_77\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAAAGGCCGAACCTCACCTGACA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eU6\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eReference gene of miRNAs\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-size: 10.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTTGGACCATTTCTCGATTTGTGC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"text-align: left; line-height: 200%;\"\u003e\u003cspan style=\"font-size: 10.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eCCTTAGGGGACATCCGATAAAATTG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e-\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e-\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eZBUBQ\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eubiquitin extension protein\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTCGAAGATGGCCGTACATTG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTCCTCTAAGCCTCAGCACCA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e-\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e-\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 18.75pt;\"\u003e\n\u003ctd style=\"width: 55.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"73\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cem\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eZBUBA\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 106.3pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"142\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eubiquitin-60S ribosomal protein L40\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.85pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eGACTTAGGGGAGGGATTATTGAG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"198\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eTTCTTCTTCCGACAGTTTACAGC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 85.05pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"113\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e-\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 153.0pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\" width=\"204\"\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 11.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e-\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eHormone content determination\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eBased on the endogenous hormone extraction and determination methods of Niu Huiling et al. \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e[22]\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e we took a 0.5 g tissue sample, extracted it with 80% methanol, purified it, dry it under a stream of nitrogen, diluted it to 1.0 mL. We then determined the auxin (IAA)\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e,\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e gibberellin (GA\u003csub\u003e3\u003c/sub\u003e)\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e,\u003c/span\u003e \u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eJA \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e(jasmonic acid) and abscisic acid (ABA)\u003c/span\u003e \u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003econtents of \u003cem\u003eZB\u003c/em\u003e fruits at different times by LC\u0026ndash;MS/MS. ). There were \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003etwo\u003c/span\u003e \u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003esamples (pollinated and non-pollinated fruit)\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e and each was repeated three times.\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e Details of the \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eLC\u0026ndash;MS/MS were liquid chromatograph (Shimadzu; Wondasil C18 column (150 mm \u0026times; 4.6 mm, 5 \u0026mu;m); column temperature 35\u0026deg;C; injection volume 2 \u0026mu;L; flow rate 0.5 mL \u0026bull; min-1; mobile phase A: ultrapure water; Phase B: methanol; gradient elution procedure: 0 ~ 6.5 min, 40% B; 6.5 ~ 11.0 min, 100% B; 11.0 ~ 15.0 min, 40% B) and mass spectrometer (API 2000; mass spectrometry. Conditions: API; ion source temperature: 450\u0026deg;C; scanning method: multiple reaction monitoring MRM).\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003emiRNA target gene prediction\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eThe psRNATarget online site (http://plantgrn.noble.org/psRNATarget/) was used for interaction analysis between miRNA and target mRNA. The miRNAs and mRNA sequences were uploaded to the website and the conditions were set to the default values. The interaction relationship between miRNAs and mRNA was analyzed, and the most reliable results were obtained by screening.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e"},{"header":"Abbreviations ","content":"\u003cp style=\"line-height: 150%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 150%; font-family: 'Times New Roman',serif;\"\u003eABA: Abscisic acid; AGL9: agamous-like MADS-box protein; GA: Gibberellin acid; IAA: Indole-3-acetic acid; JA: jasmonic acid; SERK2: somatic embryogenesis receptor kinase 2.\u003c/span\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAcknowledgements\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eThanks to the experimental technical support provided by Dr. Huang Dong.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAuthors\u0026rsquo; contributions\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 150%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 150%; font-family: 'Times New Roman',serif;\"\u003eA.W. conceived the project. X.F. designed the experiments and performed the experiment. X.F. wrote the paper. All authors (X.F., Y.M., T.Y. and A.W.) discussed the results and commented on the manuscript.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eFunding\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 150%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 150%; font-family: 'Times New Roman',serif;\"\u003eThe funders had no role in the experiment design, data analysis, decision to publish or preparation of the manuscript. This study was financially supported by the \u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 150%; font-family: 'Times New Roman',serif;\"\u003eNational Key Research and Development Program\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 150%; font-family: 'Times New Roman',serif;\"\u003e Project\u003c/span\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 150%; font-family: 'Times New Roman',serif;\"\u003e Funding (2018YFD1000605).\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eAvailability of data and materials\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eNot applicable.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eEthics approval and consent to participate\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: left; text-autospace: none;\"\u003e\u003cspan style=\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\"\u003eNot applicable.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eConsent for publication\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: left; text-autospace: none;\"\u003e\u003cspan style=\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\"\u003eNot applicable.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eCompeting interests\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: left; text-autospace: none;\"\u003e\u003cspan style=\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\"\u003eThe authors declare that they have no competing interests.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003eDeclarations\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: left; text-autospace: none;\"\u003e\u003cspan style=\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\"\u003eThe authors declare there are no commercial financial conflicts of interest.\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif; color: black;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Xiao-Qin, Y.U., et al., \u003cem\u003eEvaluation of Specific Quality of Zanthoxylum bungeanum Maxim and Zanthoxylum schinifolium Sieb. et Zucc.\u003c/em\u003e Food Science, 2009. \u003cstrong\u003e30\u003c/strong\u003e(15): p. 45-48.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Bhatt, V., et al., \u003cem\u003eSimultaneous quantification and identification of flavonoids, lignans, coumarin and amides in leaves of Zanthoxylum armatum using UPLC-DAD-ESI-QTOF\u0026ndash;MS/MS \u003c/em\u003e\u003c/span\u003e\u003cem\u003e☆\u003c/em\u003e\u003cem\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e.\u003c/span\u003e\u003c/em\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Journal of Pharmaceutical \u0026amp; Biomedical Analysis, 2017. \u003cstrong\u003e132\u003c/strong\u003e: p. 46-55.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Li, J.H., S.H. Zhang, and L.H. Kong, \u003cem\u003eResearch development of Chinese prickly ash.\u003c/em\u003e China Condiment, 2009.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Fei, X., et al., \u003cem\u003ePatterns of Drought Response of 38 WRKY Transcription Factors of Zanthoxylum bungeanum Maxim.\u003c/em\u003e Int J Mol Sci, 2018. \u003cstrong\u003e20\u003c/strong\u003e(1).\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Li, X., et al., \u003cem\u003eThe Chemical and Genetic Characteristics of Szechuan Pepper (Zanthoxylum bungeanumandZ. armatum) Cultivars and Their Suitable Habitat.\u003c/em\u003e Frontiers in Plant Science, 2016. \u003cstrong\u003e7\u003c/strong\u003e.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Xiong, Q., et al., \u003cem\u003eAlkylamides from pericarps of Zanthoxylum bungeanum.\u003c/em\u003e Phytochemistry, 1997. \u003cstrong\u003e46\u003c/strong\u003e(46): p. 1123-1126.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Xiaogen, Y., \u003cem\u003eAroma constituents and alkylamides of red and green huajiao (Zanthoxylum bungeanum and Zanthoxylum schinifolium).\u003c/em\u003e Journal of Agricultural \u0026amp; Food Chemistry, 2008. \u003cstrong\u003e56\u003c/strong\u003e(5): p. 1689-96.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Yang, L.C., et al., \u003cem\u003ePolyphenolics Composition of the Leaves of Zanthoxylum bungeanum Maxim. Grown in Hebei, China, and Their Radical Scavenging Activities.\u003c/em\u003e J Agric Food Chem, 2013. \u003cstrong\u003e61\u003c/strong\u003e(8): p. 1772-1778.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Xia, L., et al., \u003cem\u003eCompositional and Antioxidant Activity Analysis of Zanthoxylum bungeanum Seed Oil Obtained by Supercritical CO2 Fluid Extraction.\u003c/em\u003e Journal of the American Oil Chemists' Society, 2010. \u003cstrong\u003e88\u003c/strong\u003e(1): p. 23-32.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Mi, X., et al., \u003cem\u003eStudy on the extraction, separation and antimicrobial effect of volatile oil from Zanthoxylum bungeanum maxim.\u003c/em\u003e Journal of Nanjing Normal University, 2004. \u003cstrong\u003e27\u003c/strong\u003e(4): p. 63-66.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Zhang, Z., et al., \u003cem\u003eZanthoxylum bungeanum pericarp extract prevents dextran sulfate sodium-induced experimental colitis in mice via the regulation of TLR4 and TLR4-related signaling pathways.\u003c/em\u003e International Immunopharmacology, 2016. \u003cstrong\u003e41\u003c/strong\u003e: p. 127-135.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Bowers, W.S., et al., \u003cem\u003eInsect Repellents from the Chinese Prickly Ash Zanthoxylum bungeanum.\u003c/em\u003e Journal of Natural Products, 1993. \u003cstrong\u003e56\u003c/strong\u003e(6): p. 935-938.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Singh, G., et al., \u003cem\u003eAnthelmintic efficacy of aqueous extract of Zanthoxylum armatum DC. seeds against Haemonchus contortus of small ruminants.\u003c/em\u003e Journal of Parasitic Diseases, 2016. \u003cstrong\u003e40\u003c/strong\u003e(2): p. 528-532.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Liu, Y., \u003cem\u003eApomixis in Zanthoxylum bungeanum and Z. simulans.\u003c/em\u003e Journal of Genetics \u0026amp; Genomics, 1987. \u003cstrong\u003e14\u003c/strong\u003e(2): p. 107-113.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Bicknell, R.A. and A.M. Koltunow, \u003cem\u003eUnderstanding apomixis: recent advances and remaining conundrums.\u003c/em\u003e Plant Cell, 2004. \u003cstrong\u003e16 Suppl\u003c/strong\u003e: p. S228-45.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Matzk., F., et al., \u003cem\u003eReconstruction of reproductive diversity in Hypericum perforatum L. opens novel strategies to manage apomixis.\u003c/em\u003e Plant Journal, 2001. \u003cstrong\u003e26\u003c/strong\u003e(3): p. 275-282.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Ji-wen., H., et al., \u003cem\u003eResearch on Pollen Germination and Vigor of Toona sinensis.\u003c/em\u003e Forest \u003c/span\u003e\u003cspan style=\"font-family: SimSun;\"\u003eR\u003c/span\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003eesearch, 2019. \u003cstrong\u003e32\u003c/strong\u003e(2): p. 160-165.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Shivanna, K.R., H.F. Linskens, and M. Cresti, \u003cem\u003ePollen viability and pollen vigor.\u003c/em\u003e Theoretical \u0026amp; Applied Genetics, 1991. \u003cstrong\u003e81\u003c/strong\u003e(1): p. 38-42.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Hong-Zao, H.E., \u003cem\u003eStudy on the Pollen Viability of Zanthoxylum planispinum var.dingtanensis and its Response to Zinc.\u003c/em\u003e Journal of Anhui Agricultural Sciences, 2007.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Fei, X., et al., \u003cem\u003eExpression Stabilities of Ten Candidate Reference Genes for RT-qPCR in Zanthoxylum bungeanum Maxim.\u003c/em\u003e Molecules, 2018. \u003cstrong\u003e23\u003c/strong\u003e(4).\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Zhang, X., et al., \u003cem\u003emiRNA and mRNA expression profiles reveal insight into the chitosan-mediated regulation of plant growth.\u003c/em\u003e J Agric Food Chem, 2018. \u003cstrong\u003e66\u003c/strong\u003e(15): p. 3810-3822.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Hui-ling., N., et al., \u003cem\u003eFlower Formation and Endogenous Hormones Dynamic in Chinese Jujube.\u003c/em\u003e Acta Horticulturae Sinica, 2015. \u003cstrong\u003e42\u003c/strong\u003e(4): p. 655\u0026ndash;664.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Berger, F., et al., \u003cem\u003eDouble fertilization - caught in the act.\u003c/em\u003e Trends in Plant Science, 2008. \u003cstrong\u003e13\u003c/strong\u003e(8): p. 437-443.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Gillaspy, G., H. Bendavid, and W. Gruissem, \u003cem\u003eFruits: A Developmental Perspective.\u003c/em\u003e Plant Cell, 1993. \u003cstrong\u003e5\u003c/strong\u003e(10): p. 1439-1451.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Koltunow, A.M., \u003cem\u003eSpecial Review Issue on Plant Reproduction || Apomixis: Embryo Sacs and Embryos Formed without Meiosis or Fertilization in Ovules.\u003c/em\u003e Plant Cell, 1993. \u003cstrong\u003e5\u003c/strong\u003e(10): p. 1425-1437.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Koltunow, A.M., R.A. Bicknell, and A.M. Chaudhury, \u003cem\u003eApomixis: Molecular Strategies for the Generation of Genetically Identical Seeds without Fertilization.\u003c/em\u003e Plant Physiology, 1995. \u003cstrong\u003e108\u003c/strong\u003e(4): p. 1345-1352.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Sato, S., et al., \u003cem\u003eEstablishment of reliable methods of in vitro pollen germination and pollen preservation of Brassica rapa (syn. B. campestris).\u003c/em\u003e Euphytica, 1998. \u003cstrong\u003e103\u003c/strong\u003e(1): p. 29-33.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Fan, L.M., et al., \u003cem\u003eIn vitro Arabidopsis pollen germination and characterization of the inward potassium currents in Arabidopsis pollen grain protoplasts.\u003c/em\u003e Journal of Experimental Botany, 2001. \u003cstrong\u003e52\u003c/strong\u003e(361): p. 1603-1614.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e ROSELL, HERRERO, and G. V., \u003cem\u003ePollen germination of cherimoya (Annona cherimola Mill.). In vivo characterization and optimization of in vitro germination.\u003c/em\u003e Scientia Horticulturae, 1999. \u003cstrong\u003e81\u003c/strong\u003e(3): p. 251-265.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Ylstra, B., et al., \u003cem\u003eSteroid Hormones Stimulate Germination and Tube Growth of in Vitro Matured Tobacco Pollen.\u003c/em\u003e Plant Physiology, 1995. \u003cstrong\u003e107\u003c/strong\u003e(2): p. 639-643.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Nitsch, L., et al., \u003cem\u003eABA-deficiency results in reduced plant and fruit size in tomato.\u003c/em\u003e Journal of Plant Physiology, 2012. \u003cstrong\u003e169\u003c/strong\u003e(9): p. 878-883.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Leng, P., et al., \u003cem\u003eExpression pattern of ABA metabolic and signalling genes during floral development and fruit set in sweet cherry.\u003c/em\u003e Plant Growth Regulation, 2017. \u003cstrong\u003e84\u003c/strong\u003e(4): p. 1-10.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Riboni, M., et al., \u003cem\u003eABA-dependent control of GIGANTEA signalling enables drought escape via up-regulation of FLOWERING LOCUS T in Arabidopsis thaliana.\u003c/em\u003e Journal of Experimental Botany, 2016. \u003cstrong\u003e67\u003c/strong\u003e(22): p. 6309-6322.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Bermejo, A., et al., \u003cem\u003eAuxin and Gibberellin Interact in Citrus Fruit Set.\u003c/em\u003e Journal of Plant Growth Regulation, 2017. \u003cstrong\u003e37\u003c/strong\u003e(2): p. 491-501.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Wu, J., et al., \u003cem\u003eGladiolus hybridus ABSCISIC ACID INSENSITIVE 5 (GhABI5) is an important transcription factor in ABA signaling that can enhance Gladiolus corm dormancy and Arabidopsis seed dormancy.\u003c/em\u003e Front Plant Sci, 2015. \u003cstrong\u003e6\u003c/strong\u003e: p. 960.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Dekkers, B.J.W., et al., \u003cem\u003eThe Arabidopsis DELAY OF GERMINATION 1 gene affects ABSCISIC ACID INSENSITIVE 5 (ABI5) expression and genetically interacts with ABI3 during Arabidopsis seed development.\u003c/em\u003e Plant Journal, 2016. \u003cstrong\u003e85\u003c/strong\u003e(4): p. 451-465.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Tabata, R., et al., \u003cem\u003eArabidopsis auxin response factor6 and 8 regulate jasmonic acid biosynthesis and floral organ development via repression of class 1 KNOX genes.\u003c/em\u003e Plant Cell Physiol, 2010. \u003cstrong\u003e51\u003c/strong\u003e(1): p. 164-75.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e de Jong, M., et al., \u003cem\u003eTheSolanum lycopersicumauxin response factor\u0026emsp;7 (SlARF7) regulates auxin signaling during tomato fruit set and development.\u003c/em\u003e The Plant Journal, 2009. \u003cstrong\u003e57\u003c/strong\u003e(1): p. 160-170.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Koshioka, M., et al., \u003cem\u003eAnalysis of gibberellins in growing fruits of Lycopersicon esculentum after pollination or treatment with 4-chlorophenoxyacetic acid.\u003c/em\u003e Journal of Pomology \u0026amp; Horticultural Science, 1994. \u003cstrong\u003e69\u003c/strong\u003e(1): p. 171-179.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Mapelli, S., et al., \u003cem\u003eRelationship between set, development and activities of growth regulators in tomato fruits.\u003c/em\u003e Plant \u0026amp; Cell Physiology, 1978. \u003cstrong\u003e19\u003c/strong\u003e(7): p. 1281-1288.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Sjut, V. and F. Bangerth, \u003cem\u003eInduced parthenocarpy\u0026mdash;a way of changing the levels of endogenous hormones in tomato fruits ( Lycopersicon esculentum Mill.) 1. Extractable hormones.\u003c/em\u003e Plant Growth Regulation, 1982. \u003cstrong\u003e1\u003c/strong\u003e(4): p. 243-251.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Vriezen, W.H., et al., \u003cem\u003eChanges in tomato ovary transcriptome demonstrate complex hormonal regulation of fruit set.\u003c/em\u003e New Phytologist, 2010. \u003cstrong\u003e177\u003c/strong\u003e(1): p. 60-76.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Chen, X., et al., \u003cem\u003eQuality evaluation and chemometric discrimination of Zanthoxylum bungeanum Maxim leaves based on flavonoids profiles, bioactivity and HPLC-fingerprint in a common garden experiment.\u003c/em\u003e Industrial Crops and Products, 2019. \u003cstrong\u003e134\u003c/strong\u003e: p. 225-233.\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cspan style=\"font-family: 'Times New Roman',serif;\"\u003e Ke, J., et al., \u003cem\u003eApplication of HPLC fingerprint based on acid amide components in Chinese prickly ash (Zanthoxylum).\u003c/em\u003e Industrial Crops and Products, 2018. \u003cstrong\u003e119\u003c/strong\u003e: p. 267-276.\u003c/span\u003e\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Zanthoxylum bungeanum Maxim., Apomixis, Hormones, miRNA-mRNA, fruit set, apomictic tree","lastPublishedDoi":"10.21203/rs.2.14447/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.2.14447/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground Apomixis is a form of reproduction that does not involve fertilization of female by male gametes but instead produces offspring from the female parent directly. The progeny of apomixis is genotypically identical to the female parent and so maintains any elite traits of the female parent. Apomixis has considerable potential in genetic plant breeding. However, the mechanism of apomictic reproduction remains unclear. Zanthoxylum bungeanum is an apomictic plant. Studies on miRNAs, mRNAs, hormone changes and fertilization process of the pollinated and non-pollinated materials of Zanthoxylum bungeanum allows screening of the important regulatory factors of the apomictic process at both physiological and molecular levels. This information should be of considerable help in understanding the mechanism of apomixis in this species.\u003c/p\u003e\u003cp\u003eResults Our results show that Zanthoxylum bungeanum pollen can germinate on the stigma, and that the pollen tube can extend to the ovary wall after two days but that it then degenerates about the fifth day and before reaching the egg cell. So fertilization does not occur. Nevertheless, pollination did increase fruit set from 74.12% (unpollinated) to 89.31% (pollinated). The reproductive mode of the Zanthoxylum bungeanum cultivar ‘Hancheng Dahongpao’ was identified as obligate apomixis. Enrichment analysis of differential genes indicates that pollination activates genes involved in the synthesis of ABA, IAA, GA3 and JA, and that genes related to asexual development, genes involved in flower development, and transcription factors are also activated. RT-qPCR verification shows that the relative expression levels of mRNAs and miRNAs related to hormone signaling pathways and flower development were negatively correlated. Also, that miRNA is an important factor influencing hormone regulation after pollination of this apomictic species. The contents of ABA, IAA, GA3 and JA were all significantly increased following pollination.\u003c/p\u003e\u003cp\u003eConclusions In general, although pollination does not result in fertilization in this species, it does activate mRNAs and miRNAs which serve as signals to activate the anabolic pathways for ABA, IAA, GA3 and JA. Increased levels of these hormones result in increased fruit set.\u003c/p\u003e","manuscriptTitle":"miRNA and mRNA studies reveal pollination activates hormonal signaling and increases fruit set in the apomictic tree Zanthoxylum bungeanum Maxim","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2019-09-16 00:37:04","doi":"10.21203/rs.2.14447/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b9e4b102-f21f-4ff8-98de-9f6ad4b45ca9","owner":[],"postedDate":"September 16th, 2019","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":26155,"name":"Plant Physiology and Morphology"}],"tags":[],"updatedAt":"","versionOfRecord":[],"versionCreatedAt":"2019-09-16 00:37:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5125","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"identity":"rs-5125","version":["v1"]},"buildId":"GqpaHPwrfC8PjnIFayRh5","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00