Intraspecies genetic diversity of Endolimax nana in Sumba Island, Indonesia

Intraspecies genetic diversity of Endolimax nana in Sumba Island, Indonesia | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Intraspecies genetic diversity of Endolimax nana in Sumba Island, Indonesia Aulia Afriani Mustamir, Siti Arifah Lacante, Tetsushi Mizuno, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9530286/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Background Endolimax nana is a common intestinal archamoebid within Evosea (Amoebozoa), alongside genera such as Entamoeba , Iodamoeba , and Mastigamoeba . Despite its frequent colonization of humans, it has received limited attention as a presumed non-pathogenic commensal, and its genetic diversity and host-associated distribution remain poorly resolved. Here, we define the molecular diversity, subtype structure, and host-associated distribution of E. nana . Methods A series of cross-sectional surveys was conducted in Wainyapu Village, Sumba Island, Indonesia. A total of 315 stool samples were collected from humans (n = 144) and animals (n = 171), including rats, pigs, dogs, ducks, chickens, horses, buffaloes, and goats between 2015 and 2016. Samples were screened by PCR targeting the 18S rRNA gene, followed by direct sequencing and subcloning. Phylogenetic relationships were inferred using Bayesian inference, Neighbor-Joining, and Maximum Parsimony methods. In the human subset, the association between E. nana colonization and diarrheal stool form was evaluated using logistic regression analysis. Results E. nana was detected in humans (42.4%, 61/144), rats (12.0%, 6/50), pigs (11.1%, 5/45), dogs (7.7%, 2/26), ducks (20.0%, 1/5), and chickens (3.6%, 1/28). Sequencing yielded 127 sequences (1252–1283 bp) comprising 118 unique 18S rRNA haplotypes. Phylogenetic analyses resolved two major subtypes (ST1 and ST2), each forming well-supported monophyletic clusters and further subdivided into distinct subclusters. Subtype distribution revealed clear host-associated structure: ST1-1 and ST2-2 were predominantly human-associated, ST1-2 was shared between humans and pigs, and ST2-1 was distributed across humans, pigs, and rats. Notably, no subtype was restricted to animal hosts, indicating that all subtype lineages include human-associated populations. No association was observed between E. nana colonization and diarrheal stool form. Conclusions We provide the first molecular characterization of human-derived E. nana , defining its subtype structure and host-associated distribution, and establish a framework for future molecular epidemiological and evolutionary studies. The absence of animal-restricted subtypes suggests that E. nana circulates primarily within human-associated transmission networks. In addition, the lack of association with diarrheal stool form supports its interpretation as a predominantly commensal intestinal protozoan in this setting. Endolimax nana 18S rRNA subtype host-associated distribution intestinal protozoa Figures Figure 1 Figure 2 Background Under the current eukaryotic classification framework, Endolimax nana belongs to Amoebozoa (Evosea) and is placed within the class Archamoebae (Archamoebids) [ 1 , 2 ]. It is one of the most frequently detected intestinal protists in humans, with a global prevalence ranging from 10–30% [ 3 ]. Originally Endolimax nana was described as Entamoeba nana by Wenyon and O’Connor (1917) [ 4 ]. Subsequently, the species was reassigned to Endolimax by Brug (1918) and Dobell (1919, 1943) provided detailed morphological descriptions, including its small trophozoites, eccentric karyosome, and quadri-nucleated cysts [ 5 ]. Despite its frequent detection, E. nana has generally been regarded as a harmless commensal and has therefore received less attention than related genera such as Entamoeba , some members of which are well-established pathogens. Much of the current understanding of the distribution of E. nana is derived from microscopy-based surveys. However, light microscopy does not always allow reliable species-level identification. In contrast, molecular approaches, particularly analyses based on the small subunit ribosomal RNA gene (18S rRNA), provide more robust taxonomic resolution and have revealed unexpected diversity across a wide range of protist groups [ 6 – 9 ]. In fact, the combination of conserved and hypervariable regions within the 18S rRNA gene enables taxonomic resolution down to the subtype/genotype or ribosomal lineage level, as demonstrated in protists such as Blastocystis and archamoebids (e.g., Endolimax , Iodamoeba ) [ 7 , 10 ]. Nevertheless, the reliability of molecular identification is highly dependent on the availability of reference sequences. For amebic organisms, sequence data in public databases such as GenBank remain limited, and insufficient reference datasets can hinder accurate assignment. The first complete 18S rRNA gene sequence of E. nana (isolate NIH:0591:1 from a grey-cheeked mangabey) showed substantial divergence and supported a phylogenetic placement distinct from Entamoeba and Iodamoeba [ 7 , 8 ]. These findings raised the possibility that morphologically similar isolates may represent genetically distinct lineages. Subsequent molecular studies have supported this hypothesis, provided evidence of cryptic diversity and suggested the existence of multiple subtypes within E. nana [ 3 , 11 ]. However, compared with other intestinal amebic organisms, available molecular data for E. nana remain limited, and its true genetic diversity, host distribution, and evolutionary relationships are still incompletely resolved. Although E. nana is considered cosmopolitan, regional molecular data remain unevenly distributed. In particular, Southeast Asia, including Indonesia, appears underrepresented in currently available sequence datasets. Historically, early investigations of "Limax-type intestinal amoebae" from the Dutch East Indies (e.g., Sumatra) contributed to establishing these organisms as true intestinal inhabitants [ 12 ]. Clarifying subtype diversity is important not only for taxonomic refinement but also for improving our understanding of host distribution patterns and broader ecological relationships. In this study, we analyzed 18S rRNA sequences obtained from human and animal hosts in Wainyapu Village, Sumba Island, Indonesia, to investigate subtype diversity and host associations of E. nana . Methods Sample collection, stool form assessment, and DNA extraction A total of 315 stool samples were collected in Wainyapu Village, Sumba Island, Indonesia. These comprised 144 human samples collected in 2016 from healthy schoolchildren aged 7–14 years and 171 animal samples collected between 2015 and 2016 from domestic or peridomestic animals, including rats (n = 50), pigs (n = 45), dogs (n = 26), ducks (n = 5), chickens (n = 28), a horse (n = 1), buffaloes (n = 3), and goats (n = 12). Human samples were obtained from children attending Kera-Panba Primary and Junior High School (9°38′36″S, 119°00′58″E). Animal samples were collected either immediately after defecation (buffaloes, goats, horses), by enema (pigs and dogs), or from intestinal contents obtained by dissection (rats, chickens, and ducks). For the human subset, stool form was assessed using the Bristol stool chart, which classifies stool consistency on a seven-point scale [ 13 ]. Approximately 0.2 g of each stool sample was placed into a 1.5 mL tube pre-filled with DNAzol® reagent (Molecular Research Center, Cincinnati, OH, USA). Samples were stored at approximately 25°C in the field for up to one week and subsequently kept at 4°C until further processing. DNA extraction was performed using the DNAzol® protocol with modifications, including two freeze–thaw cycles (− 80°C and 25°C), overnight digestion with proteinase K (0.4 mg/mL; Wako Pure Chemical Industries, Osaka, Japan) at 55°C, and ethanol precipitation. The resulting DNA pellets were dissolved in 30 µL of 10 mM Tris-HCl (pH 8.0) containing 1 mM EDTA and stored at − 20°C. PCR amplification and sequencing Primers targeting the 18S rRNA gene of E. nana were designed based on multiple sequence alignments of publicly available sequences retrieved from the GenBank/DDBJ/EMBL databases (Table 1 ). Primer specificity was evaluated using the NCBI BLASTn algorithm against the nucleotide database. The outer primer pair, IO_LIMAXF (5′-CTGCCAGTAGTCATATGCTTGTG-3′) and TN14′R (5′-ACCTTGTTACGACTCTTCCTT-3′), targeting an approximately 2,693 bp region of the 18S rRNA gene, was adopted from previous studies [ 11 , 14 ]. The inner primer pair, AU15F (5′-GACAAGGGAGAGTGTGC-3′) and AU8R (5′-GCATCGTTTATGGTTGAGACTAC-3′), was newly designed in this study based on conserved regions identified from multiple sequence alignments, including reference sequence AF149916, to amplify an internal region of approximately 1,311 bp specific to E. nana [ 7 , 11 , 15 ] (Table 2 ). Nested PCR was performed in two rounds. The first round used IO_LIMAXF/TN14′R with Takara Ex Premier™ DNA Polymerase in 10 µL reaction volumes under the following conditions: initial denaturation at 94°C for 1 min; 30 cycles of 98°C for 10 s, 58°C for 15 s, and 68°C for 90 s; followed by a final extension at 68°C for 1 min. The second round used AU15F/AU8R primers to amplify an approximately 1.3 kb product using Ex Premier™ under the following conditions: 94°C for 1 min; 30 cycles of 98°C for 10 s, 55°C for 15 s, and 68°C for 46 s; and a final extension at 68°C for 1 min. For samples showing weak amplification in the first round, LA Taq® with GC buffer and an additional 0.1 µL DMSO was used in the second round with modified cycling conditions (94°C for 1 min; 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 80 s; final extension at 72°C for 5 min). PCR products were electrophoresed on 1% agarose gels stained with ethidium bromide and visualized using a Gel Doc™ EZ system (Bio-Rad, Hercules, CA, USA). Amplicons of the expected size were purified using the FastGene® Gel/PCR Extraction Kit (Nippon Genetics, Tokyo, Japan). Purified PCR products were directly sequenced using the SupreDye™ Cycle Sequencing Kit v3.1 (AdvancedSeq, CA, USA) according to the manufacturer’s instructions. Samples yielding ambiguous chromatograms, suggestive of mixed haplotypes, were sub-cloned into the pMD20-T vector (TA-Mighty Kit, Takara Bio) and transformed into Escherichia coli DH5-α. Colonies were screened on LB agar plates containing ampicillin (100 mg/L). For each sample, 5–10 colonies were selected and cultured overnight at 36°C in 2 mL LB broth with ampicillin. Plasmids were extracted using the NucleoSpin® Plasmid QuickPure Kit (Macherey–Nagel, Düren, Germany), and inserts were sequenced as described above to obtain individual haplotype sequences. Molecular data analysis Phylogenetic analyses were performed as follows. Newly obtained sequences were aligned with nine E. nana reference sequences and one outgroup ( E. piscium ) (Table 1 ) using Multiple Alignment with Fast Fourier Transform (MAFFT), as implemented in Geneious Prime (version 2023.1.1; Biomatters Ltd., New Zealand). Phylogenetic trees were reconstructed using three methods: Bayesian inference (BI) using MrBayes v3.2.6[ 16 ] in Geneious Prime under the HKY85 model, Neighbor-Joining (NJ) in Geneious Prime under the HKY substitution model, and Maximum Parsimony (MP) in MEGA11 [ 17 ]. Clade support was assessed using posterior probabilities (PP > 0.5) for BI and bootstrap values (BV > 50%) for NJ and MP. The final alignment comprised 1,176 nucleotide positions. Pairwise genetic distances were calculated using MEGA11. To evaluate the phylogenetic placement of E. nana among archamoebids, additional analyses were conducted following the same procedures described above. However, due to the inclusion of more distantly related taxa, gap-filtering was required to ensure alignment quality, resulting in a reduced dataset of 739 nucleotide positions. The reference sequences used in this analysis are shown in Fig. 2 . Statistical analysis In the human subset, binary logistic regression analyses were performed to evaluate the associations between explanatory variables (age, sex, and the presence of E. nana ) and stool consistency. Stool outcomes were defined by the Bristol stool chart as mild diarrheal stool (types 5–7 vs. 1–4 ) and severe diarrheal stool (types 6–7 vs. 1–5) [ 13 ]. Age was treated as a continuous variable and sex as a binary variable. All statistical analyses were performed using R (version 4.2.3; R Foundation for Statistical Computing, Vienna, Austria), and a p-value < 0.05 was considered statistically significant. Limitations of this study Several limitations should be considered. First, archived samples collected across multiple time points may introduce temporal heterogeneity in the dataset. Second, the study was conducted within a single geographically restricted population, which may limit broader applicability. Third, the analysis was based on a partial fragment of the 18S rRNA gene, potentially constraining phylogenetic resolution. Fourth, only a single genetic marker was used, which limits the ability to resolve recombination, population structure, and the biological distinctness of ribosomal lineages. Finally, the cross-sectional study design limits temporal interpretation of the observed patterns. Table 1 Primers used for the nested PCR screening of 18S rRNA gene locus in this study Primer Name Sequence Reference IO_LimaxF 5′–CTGCCAGTAGTCATATGCTTGTG Hocke et al., 2023 [ 11 ] TN14′R 5′–ACCTTGTTACGACTTCTCCTT Lacante et al., 2024 [ 14 ] AU15F 5′–GACAAGGGAGAGTGTGC Present study AU8R 5′–GCATCGTTTATGGTTGAGACTAC Present study Table 2 List of reference 18S rRNA sequences used in this study Species Host/ Isolation source GenBank Accession number Origin Sequence Length (bp) Endolimax nana SW01[ 11 ] NA / Sewage OK483220.1 Sweden 1605 Endolimax nana SW02[ 11 ] NA / Sewage OK483221.1 Sweden 1571 Endolimax nana SW03[ 11 ] NA / Sewage OK483222.1 Sweden 1593 Endolimax sp. TDP-2[ 16 ] Sus scrofa domesticus / Stool of Pig LC230011.1 Japan 2582 Endolimax sp. TDP-2 [ 16 ] Sus scrofa domesticus / Stool of Pig LC230012.1 Japan 2580 Endolimax sp. TDP-2 [ 16 ] Sus scrofa domesticus / Stool of Pig LC230013.1 Japan 2584 Endolimax sp. TDP-2 [ 16 ] Sus scrofa domesticus / Stool of Pig LC230014.1 Japan 2580 Endolimax sp. TDP-2 [ 16 ] Sus scrofa domesticus / Stool of Pig LC230015.1 Japan 2580 Endolimax nana NIH:0591:1 [ 7 ] Cercocebus albigena / Stool of Gray-cheeked mangabey AF149916.1 NA * 2589 Endolimax piscium clone MALEN3 [ 19 ] Solea senegalensis / fish muscle JX101953.1 Spain 2971 * NA, not available. Results Summary of molecular screening results Of the 315 samples examined, 76 were positive for Endolimax nana (24.1%, 76/315) (Table 3 ). Prevalence was higher in humans (42.4%, 61/144) than in animals (8.8%, 15/171) (Table 3 ). Positive animal samples included rats (12.0%, 6/50), pigs (11.1%, 5/45), dogs (7.7%, 2/26), one duck (20.0%, 1/5), and one chicken (3.6%, 1/28), whereas no positives were detected in horses, buffalo, or goats. Several chromatograms of DNA sequencing exhibited double peaks, necessitating sub-cloning to resolve individual haplotypes. Similar observations have been reported for other intestinal amoebae and may reflect intragenomic variation of multicopy rRNA genes, mixed infections, or non-specific amplification [ 3 , 7 , 9 , 11 ]. Further sub-cloning of the 76 E. nana -positive samples yielded 127 DNA reads, comprising 118 unique 18S rRNA haplotypes (i.e., distinct DNA sequence variants). Most of this increase originated from human samples (61 to 98 DNA reads), although animal-derived reads also increased (15 to 29). Multiple haplotypes were occasionally recovered from individual hosts, particularly in pigs and rats. For example, five pig samples yielded 17 distinct haplotypes, while six rat samples yielded eight haplotypes (Fig. 1 ). Table 3 Summary of molecular screening results of E. nana . Host Total E. nana positives (%) Registered DDBJ accession numbers * Sequence length (bp)* Human ( Homo sapiens ) 144 61 (42.4%) LC882021 1271 bp Animal 171 15 (8.8%) Rat ( Rattus exulans ) 50 6 (12.0%) LC882127 1256 bp Pig ( Sus scrofa domesticus ) 45 5 (11.1%) LC882080 1252 bp Dog ( Canis lupus familiaris ) 26 2 (7.7%) LC882052 1279 bp Duck ( Anas superciliosa ) 5 1 (20.0%) LC882079 1256 bp Chicken ( Gallus gallus ) 28 1 (3.6%) LC882077 1255 bp Horse ( Equus ferus caballus ) 1 0 (0%) - - Buffalo ( Bubalus bubalis ) 3 0 (0%) - - Goat ( Capra aegagrus hircus ) 12 0 (0%) - - Total 315 76 (24%) * Representative accession numbers and sequence lengths are shown, while all data, including non-representative sequences, are provided in Supplementary Table S1 . Results of phylogenetic reconstruction Phylogenetic reconstruction based on 1,176 bp of the 18S rRNA locus was performed using a dataset comprising 118 unique haplotypes obtained in this study (Supplementary Table S1 ), nine E. nana references, and E. piscium as a designated outgroup (Table 1 ). BI, NJ, and MP analyses consistently resolved two major clades corresponding to Subtype 1 (ST1) and Subtype 2 (ST2) (Fig. 1 ). Within these clades, a consistent substructure was observed, forming four subclades: ST1-1, ST1-2, ST2-1, and ST2-2. Support values (posterior probabilities and bootstrap values) for key nodes are indicated in Fig. 1 . ST1-1 was dominated by human isolates but included a single pig-derived sequence and a single non-human primate (NHP). ST1-2 also consisted primarily of human isolates, alongside pig-derived reference sequences. Within ST2-1, rat-derived haplotypes exhibited a loose clustering pattern, albeit without robust monophyletic support, suggesting a potential host-associated lineage structure. Notably, no GenBank reference sequences corresponding to ST2-1 were available for the present analysis. ST2-2 was represented exclusively by human isolates in this dataset and clustered with sewage-derived reference sequences (Fig. 1 ). To clarify the molecular taxonomic position of E. nana within archamoebid lineages, an additional 18S rRNA phylogeny was evaluated based on 739 bp of nucleotide positions, including representative lineages of Entamoeba , Mastigamoeba , Iodamoeba , and Endolimax (Fig. 2 ). Phylogenetic analysis robustly placed E. nana within class Archamoebae (Amoebozoa: Evosea), specifically within the Mastigamoeba -related lineage. E. nana and E. piscium formed a strongly supported monophyletic clade, which was recovered as a sister group to Iodamoeba . Together, these taxa constituted a coherent Endolimax – Iodamoeba clade, which was further resolved as a sister group to the Mastigamoeba lineage. This broader assemblage was, in turn, positioned as a sister group to Entamoeba , supporting a hierarchical structure within class Archamoebae (archamoebid lineage). Pairwise genetic distance analyses Pairwise genetic distances based on the 18S rRNA alignment (1,176 bp) supported the subtype framework. Genetic distances within subtypes were low (generally < 0.03), whereas inter-subtype distances were substantially higher (approximately 0.10–0.19), with the greatest divergence (0.19) observed between ST1-2 and ST2-1 (Supplementary Table S2 ). Distances between E. nana and E. piscium were markedly higher (mean approx. 0.54), consistent with deep divergence among congeners. Association of E. nana colonization and subtype with stool consistency Binary logistic regression analysis of 144 human stool samples with complete Bristol stool form data showed no significant association between E. nana colonization and stool consistency after adjustment for age and sex (p = 0.998). In contrast, increasing age was significantly associated with lower odds of diarrheal stool categories (OR = 0.76, p < 0.001). Male sex showed an inverse association with severe diarrheal stool; however, this association did not reach statistical significance. Furthermore, no significant associations were detected between any E. nana subtype and stool consistency after adjustment for age and sex. Discussion In this study, we analyzed 18S rRNA gene sequences obtained from fecal samples of human and animal hosts in Wainyapu Village, Sumba Island, Indonesia, to characterize the haplotype diversity, subtype structure, and host-associated distribution of E. nana in a parasite-endemic setting. Our results provide refined insights into the phylogenetic placement of Endolimax within Amoebozoa and demonstrate pronounced sequence-level diversity among E. nana 18S rRNA haplotypes (Fig. 1 , Fig. 2 ). Phylogenetic analyses (Fig. 2 ) robustly placed E. nana within the clade Evosea of Amoebozoa. In this framework, Endolimax spp. ( E. nana , E. piscium , and E. carassius ) formed a well-supported monophyletic group, hereafter referred to as the main Endolimax clade. This clade was consistently recovered as sister to Iodamoeba , forming an Endolimax–Iodamoeba assemblage, which was in turn recovered as sister to Mastigamoeba , together constituting a Mastigamoeba-related lineage within the class Archamoebae. This topology is congruent with previous phylogenetic frameworks that recognize archamoebids as deeply branching lineages [ 1 ], while providing improved resolution among Endolimax , Iodamoeba , and Mastigamoeba . Notably, Iodamoeba was recovered as sister to the main Endolimax clade, rather than specifically associated with E. piscium , as previously proposed [ 11 ]. Furthermore, sequences previously designated as Endolimax sp. (LC230011, LC230012) were nested within the E. nana clade, supporting their reassignment to E. nana [ 15 ]. It should be noted that inclusion of distantly related taxa required extensive gap filtering, and the limited availability of reference sequences likely contributed to the reduction of the alignment to 739 nucleotide positions and to decreased statistical support for deeper nodes. Accordingly, relationships among major archamoebid lineages should be interpreted with caution. Substantial intra-species sequence diversity was observed among E. nana 18S rRNA haplotypes (Fig. 1 ). Phylogenetic analyses consistently resolved two major subtype groups (ST1 and ST2), each further subdivided into well-defined subclusters (ST1-1, ST1-2, ST2-1, and ST2-2). This structure refines previously proposed ribosomal lineage frameworks, with ST1 broadly corresponding to RL1 and ST2 to RL2 [ 11 ]. Pairwise distance analyses further aligned with this structure (Supplementary Table S2 ), revealing low sequence divergence within subtypes and markedly higher divergence between subtypes. These findings indicate that E. nana comprises deeply structured 18S rRNA haplotype lineages. Accordingly, the subtype-based nomenclature proposed here represents a practical and scalable framework for molecular epidemiological investigations, although confirmation using multilocus or genome-scale data will be necessary to assess whether these ribosomal lineages correspond to biologically distinct entities. Host-associated patterns were suggested by the distribution of E. nana haplotypes; however, clear host specificity could not be established. ST1-1 was detected almost exclusively in human-derived samples, with a single detection in a pig, whereas ST1-2 was primarily identified in humans and pigs, with one detection in a dog. Given the coprophagic behavior of pigs and dogs, these sporadic detections in non-human hosts likely reflect incidental ingestion of human fecal material and subsequent mechanical passage through the gastrointestinal tract rather than true colonization. When interpreted in the context of the overall subtype distribution, ST1-1 and ST2-2 were predominantly human-associated, ST1-2 was shared mainly between humans and pigs, and ST2-1 showed a broader distribution across humans, pigs, and rats. Importantly, no animal-restricted subtype group was identified. Thus, although some host groups were represented by limited sample sizes and the analysis was based on a single genetic marker, the overall pattern suggests that E. nana haplotypes are structured around human-associated lineages rather than independent animal-associated lineages. This finding suggests that E. nana primarily circulates within human-associated transmission networks, with detections in animals likely reflecting secondary exposure or host overlap. Taken together, these observations provide an ecologically meaningful framework for interpreting the host distribution and transmission dynamics of E. nana in parasite-endemic settings. These findings add to accumulating molecular epidemiological evidence that intestinal protozoa are frequently detected as components of complex gut microbial communities in endemic settings. Our previous investigations in the same population have reported the co-detection of diverse protozoa, including Giardia intestinalis [ 19 ], Entamoeba spp. [ 20 ], Enteromonas spp. [ 14 ], Chilomastix spp. [ 21 ], and Retortamonas spp. [ 22 ], highlighting the complexity of protozoan assemblages in the human gastrointestinal tract. In the present study, the detection of genetically diverse E. nana 18S rRNA haplotypes, together with the absence of an association between intestinal detection of E. nana and diarrheal stool form in this dataset, is consistent with the interpretation that this organism represents a commonly detected member of the gut protozoan community rather than an incidental finding in this endemic population. More broadly, the repeated detection of diverse, largely commensal intestinal protozoa in endemic populations may indicate a gut ecosystem that retains features of the ancestral human intestinal environment. The subtype framework established in this study therefore provides a standardized basis for molecular detection, comparative epidemiological analyses, and future investigations into the ecological and functional significance of under-characterized intestinal protozoa. Conclusion This study refines the phylogenetic placement of E. nana within archamoebids and reveals extensive 18S rRNA haplotype diversity in a parasite-endemic setting. The identified haplotypes were organized into two major subtypes (ST1 and ST2) with distinct subclusters, providing a practical framework for molecular epidemiological studies. Subtype distribution indicated clear host-associated structure: ST1-1 and ST2-2 were predominantly human-associated, ST1-2 was shared between humans and pigs, and ST2-1 was detected across humans, pigs, and rats. The absence of animal-restricted subtypes suggests that E. nana primarily circulates within human-associated transmission networks. No association was observed between E. nana colonization and stool consistency, supporting its predominantly commensal nature in this context. Collectively, this framework provides a basis for standardized comparative analyses and supports future multilocus and longitudinal studies to better understand the ecology and transmission dynamics of intestinal protozoa. Abbreviations 18S rRNA 18S small subunit ribosomal RNA BI Bayesian inference BLASTn Basic Local Alignment Search Tool for nucleotide sequences BV Bootstrap value / bootstrap values DDBJ DNA Data Bank of Japan DMSO Dimethyl sulfoxide EMBL European Molecular Biology Laboratory GenBank GenBank HKY Hasegawa–Kishino–Yano substitution model HKY85 Hasegawa–Kishino–Yano 1985 model LB Luria–Bertani medium MAFFT Multiple Alignment using Fast Fourier Transform MEGA11 Molecular Evolutionary Genetics Analysis version 11 MP Maximum Parsimony NA Not available NCBI National Center for Biotechnology Information NHP Non-human primate NJ Neighbor-Joining PCR Polymerase Chain Reaction PP Posterior probability RL Ribosomal lineage ST Subtype Declarations Acknowledgments The initial observations for this study were validated by numerous students from Kanazawa University who participated in our fieldwork in Indonesia between 2006 and 2016. We would like to thank Anggi PN Hidayati and Ismail E Rozi (Eijkman Institute of Molecular Biology, Jakarta) for their contributions to our fieldwork. The authors acknowledge the language editing support provided by Paperpal (https:// paper pal. com/), which helped improve the English descriptions in this manuscript. Author details 1 Department of Global Infectious Diseases, Graduate School of Advanced Preventive Medical Sciences, Kanazawa University, Kanazawa, Japan 2 Graduate School of Hasanuddin University, Makassar, Indonesia 3 Eijkman Research Center for Molecular Biology, National Research and Innovation Agency, Republic of Indonesia 4 Environmental Stress Research Center, Kanazawa University, Kanazawa, Japan 5 Department of Global Infectious Diseases, Graduate School of Medical Sciences, Kanazawa University, Kanazawa, Japan 6 Department of Parasitology, Faculty of Medicine, Hasanuddin University, Makassar, Indonesia Authors’ contributions This study was designed by AAM, TM and MT. Its protocol written by AAM, SAL, TM, MT, with the validation by AAM, TM, MT. Data collection was performed by AAM, PBA, SAL, SD. AAM performed molecular analyses. Data analyses were done by NRN, SY, HA, AAM. AAM, SAL, BX and TM was responsible for resources. AAM wrote the manuscript. AAM, SAL, TM, BX and MT performed the visualization of the data, wrote the review and edited the manuscript. Supervision and project administration was performed by TM and MT. Funding acquisition provided by MT. Funding This study was supported in part by research funding for MT from the Japan Society for the Promotion of Science (JSPS) KAKENHI Grant-in-Aid for Scientific Research B (Grant Nos. 26305008 and 16H05803), Scientific Research C (Grant No. 25460514), and Grant-in-Aid for Scientific Research under the Fund for the Promotion of Joint International Research (International Collaborative Research Enhancement B) (Grant No. 19KK0200), provided by the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan, as well as by the Research Program on Emerging and Re-emerging Infectious Diseases from the Japan Agency for Medical Research and Development (AMED) (Grant No. JP25fk0108908). Availability of data and materials DNA sequences of the 18S rRNA gene locus have been deposited into the DNA Database (DDBJ-EMBL-Genbank) data library with accession number LC882021–LC882147. Ethics approval and consent to participate This study was approved by the scientific and ethics review unit at the Faculty of Medicine, Hasanuddin University, Makassar, Indonesia, and Kanazawa University, Japan. Informed consent and assent were obtained from the study participants (children) and their guardians. Consent for publication Not applicable. Competing interests The authors declare that they have no conflict of interests. References Adl SM, Bass D, Lane CE, Lukeš J, Schoch CL, Smirnov A, Agatha S, Berney C, Brown MW, Burki F, Cárdenas P, Čepička I, Chistyakova L, Campo J del, Dunthorn M, Edvardsen B, Eglit Y, Guillou L, Hampl V, Heiss AA, Hoppenrath M, James TY, Karnkowska A, Karpov S, Kim E, Kolisko M, Kudryavtsev A, Lahr DJG, Lara E, Gall LL, Lynn DH, Mann DG, Massana R, Mitchell EAD, Morrow C, Park JS, Pawlowski JW, Powell MJ, Richter DJ, Rueckert S, Shadwick L, Shimano S, Spiegel FW, Torruella G, Youssef N, Zlatogursky V, Zhang Q. Revisions to the Classification, Nomenclature, and Diversity of Eukaryotes. J Eukaryot Microbiol 2019;66:4–119. https://doi.org/10.1111/jeu.12691. Ptáčková E, Kostygov AYu, Chistyakova LV, Falteisek L, Frolov AO, Patterson DJ, Walker G, Cepicka I. Evolution of Archamoebae: Morphological and Molecular Evidence for Pelobionts Including Rhizomastix , Entamoeba , Iodamoeba , and Endolimax . Protist 2013;164:380–410. https://doi.org/10.1016/j.protis.2012.11.005. Poulsen CS, Stensvold CR. Systematic review on Endolimax nana : A less well studied intestinal ameba. Trop Parasitol 2016;6:8–29. https://doi.org/10.4103/2229-5070.175077. Dobell C. The amoebae living in man; a zoological monograph . Medical Research Committee; 1919. Dobell C. Researches on the intestinal protozoa of monkeys and man. Parasitology 1943;35:134–58. https://doi.org/10.1017/s003118200002151x. Stensvold CR, Lebbad M, Verweij JJ. The impact of genetic diversity in protozoa on molecular diagnostics. Trends Parasitol 2011;27:53–8. https://doi.org/10.1016/j.pt.2010.11.005. Silberman JD, Clark CG, Diamond LS, Sogin ML. Phylogeny of the genera Entamoeba and Endolimax as deduced from small-subunit ribosomal RNA sequences. Mol Biol Evol 1999;16:1740–51. https://doi.org/10.1093/oxfordjournals.molbev.a026086. Clark CG, Diamond LS. Intraspecific variation and phylogenetic relationships in the genus Entamoeba as revealed by riboprinting. J Eukaryot Microbiol 1997;44:142–54. https://doi.org/10.1111/j.1550-7408.1997.tb05951.x. Chihi A, Andersen LO, Aoun K, Bouratbine A, Stensvold CR. Amplicon-based next-generation sequencing for detection of single-celled parasites in human faecal samples. Parasite Epidemiol Control 2022;17:e00242. https://doi.org/10.1016/j.parepi.2022.e00242. Stensvold CR, Lebbad M, Hansen A, Beser J, Belkessa S, Andersen LO, Clark CG. Differentiation of Blastocystis and parasitic archamoebids by amplicon-based NGS. Parasite Epidemiol Control 2020;9:e00131. https://doi.org/10.1016/j.parepi.2019.e00131. Hocke EF, Jamy M, Burki F, Clark CG, Stensvold CR. Intrageneric diversity of Endolimax . Protist 2022;173:125908. https://doi.org/10.1016/j.protis.2022.125908. Swellengrebel NH, Winoto RMM. The life history of amoebae of the Limax type in the human intestine. Parasitology 1917;9:266–73. https://doi.org/10.1017/s0031182000006089. O’Donnell LJ, Virjee J, Heaton KW. Detection of pseudodiarrhoea. Br Med J 1990;300:439. https://doi.org/10.1136/bmj.300.6722.439. Lacante SA, Jiang C, Mustamir AA, Mizuno T, Bi X, Syafruddin D, Tokoro M. Molecular detection of Enteromonas species. MethodsX 2024;13:102875. https://doi.org/10.1016/j.mex.2024.102875. Yoshida N et al. Growth effects on Entamoeba and Endolimax species isolates. Biosci Trends 2019;13:402–10. https://doi.org/10.5582/bst.2019.01233. Huelsenbeck JP, Ronquist F. MRBAYES. Bioinformatics 2001;17:754–5. https://doi.org/10.1093/bioinformatics/17.8.754. Tamura K, Stecher G, Kumar S. MEGA11. Mol Biol Evol 2021;38:3022–7. https://doi.org/10.1093/molbev/msab120. Constenla M, Padrós F, Palenzuela O. Endolimax piscium sp. nov. J Fish Dis 2014;37:229–40. https://doi.org/10.1111/jfd.12097. Mizuno T et al. Diversity of Giardia intestinalis . Parasitol Int 2020;75:102038. https://doi.org/10.1016/j.parint.2019.102038. Matsumura T, Hendarto J, Mizuno T, Syafruddin D, Yoshikawa H, Matsubayashi M, Nishimura T, Tokoro M. Possible pathogenicity of commensal Entamoeba hartmanni . Trop Med Health 2019;47:7. https://doi.org/10.1186/s41182-018-0132-7. Jiang C et al. Genetic diversity of Chilomastix . Trop Med Health 2025;53:40. https://doi.org/10.1186/s41182-025-00725-5. Hendarto J et al. Clusters in Retortamonas species. Parasitol Int 2019;69:93–8. https://doi.org/10.1016/j.parint.2018.12.004. Additional Declarations No competing interests reported. Supplementary Files Supplementary1.GenBankaccessionnumbersforE.nanasequencesusedinthisstudy.docx Supplementary2.SummaryofpairwisegeneticdistanceswithinandbetweenEndolimaxnanasubtypes.docx supplementary3.Binarylogisticregressionanalyses.docx Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 17 May, 2026 Reviewers agreed at journal 16 May, 2026 Reviewers agreed at journal 06 May, 2026 Reviewers invited by journal 30 Apr, 2026 Editor assigned by journal 29 Apr, 2026 Submission checks completed at journal 29 Apr, 2026 First submitted to journal 26 Apr, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9530286","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":635204976,"identity":"b207e602-8b16-44ea-9232-9c9f1ac7846b","order_by":0,"name":"Aulia Afriani Mustamir","email":"","orcid":"","institution":"Kanazawa University","correspondingAuthor":false,"prefix":"","firstName":"Aulia","middleName":"Afriani","lastName":"Mustamir","suffix":""},{"id":635204977,"identity":"776cf2c3-615f-46b6-9a9a-3c2a6f270a52","order_by":1,"name":"Siti Arifah Lacante","email":"","orcid":"","institution":"National Research and Innovation Agency","correspondingAuthor":false,"prefix":"","firstName":"Siti","middleName":"Arifah","lastName":"Lacante","suffix":""},{"id":635204981,"identity":"dc4826ef-ba04-473f-9087-8b1d350320d9","order_by":2,"name":"Tetsushi Mizuno","email":"","orcid":"","institution":"Kanazawa University","correspondingAuthor":false,"prefix":"","firstName":"Tetsushi","middleName":"","lastName":"Mizuno","suffix":""},{"id":635204983,"identity":"432203e8-beee-444a-a40a-89af27c28ed4","order_by":3,"name":"Xiuqio Bi","email":"","orcid":"","institution":"Kanazawa University","correspondingAuthor":false,"prefix":"","firstName":"Xiuqio","middleName":"","lastName":"Bi","suffix":""},{"id":635204986,"identity":"928bf72f-3532-4115-802d-b951d65fb919","order_by":4,"name":"Din Syafruddin","email":"","orcid":"","institution":"Hasanuddin University","correspondingAuthor":false,"prefix":"","firstName":"Din","middleName":"","lastName":"Syafruddin","suffix":""},{"id":635204987,"identity":"cedfca7f-642c-44ee-89ae-b61a9a0634b4","order_by":5,"name":"Puji Budi Setia Asih","email":"","orcid":"","institution":"National Research and Innovation Agency","correspondingAuthor":false,"prefix":"","firstName":"Puji","middleName":"Budi Setia","lastName":"Asih","suffix":""},{"id":635204988,"identity":"dda2a133-00ff-48ec-ab0c-f63e22e0a696","order_by":6,"name":"Afzan Hairul","email":"","orcid":"","institution":"Kanazawa University","correspondingAuthor":false,"prefix":"","firstName":"Afzan","middleName":"","lastName":"Hairul","suffix":""},{"id":635204989,"identity":"d111dfe7-89ac-44d9-a922-2bd764175d79","order_by":7,"name":"Nirina Rafarahanta Norton","email":"","orcid":"","institution":"Kanazawa University","correspondingAuthor":false,"prefix":"","firstName":"Nirina","middleName":"Rafarahanta","lastName":"Norton","suffix":""},{"id":635204990,"identity":"d3e34856-a517-42c8-b5d4-9663178c31a8","order_by":8,"name":"Yujia Sun","email":"","orcid":"","institution":"Kanazawa University","correspondingAuthor":false,"prefix":"","firstName":"Yujia","middleName":"","lastName":"Sun","suffix":""},{"id":635204991,"identity":"d88dd845-f968-4c15-a942-6c8eaf2f51be","order_by":9,"name":"Masaharu Tokoro","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABEUlEQVRIiWNgGAWjYFACNhBhA8QJzOhSB7Bq4IFoSSNdy2GsWrADe/a2xMcVFeej+dkTmA1+7rCz55+R/ICZh8FOnoHxLFZreHiOHTY8c+Z27syeB8yJvWeSmSVupBkAtSQbNjCcS8CqRSK9TbKx7XbuhhsJzAd425jZGG4nmP/mYWAGKj9jgEfLudz9QC0H/7bV88jfTv8AtKUej5a0Y0AtB3I3SCQwJ/O2HZYwuJ0Dcthh3FrOHAO6+kxy7owzD5uNZduOGxjef1PAOMfguGEbDr+wt7cZPmyosMvtb08+LPm2rdpe7szxDQxvKqrl+SWwhxgSYGxA4gCdxCZxhoAOTMDfQ7KWUTAKRsEoGJYAALTzXKFt6LEaAAAAAElFTkSuQmCC","orcid":"","institution":"Kanazawa University","correspondingAuthor":true,"prefix":"","firstName":"Masaharu","middleName":"","lastName":"Tokoro","suffix":""}],"badges":[],"createdAt":"2026-04-26 08:08:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9530286/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9530286/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":108799524,"identity":"d618723c-24d1-4a81-936b-01ffaa80bf64","added_by":"auto","created_at":"2026-05-08 13:59:02","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":983531,"visible":true,"origin":"","legend":"\u003cp\u003eGenetic diversity of the 18S rRNA in \u003cem\u003eEndolimax nana\u003c/em\u003e. A phylogenetic tree was constructed based on 1,176 bp of the 18S rRNA gene using BI. Node support values are shown as PP/BV/BV (BI/MP/NJ) for major clusters, whereas only PP are shown for lower-level clades when significant. \u003cem\u003eEndolimax piscium\u003c/em\u003e clone MALEN3 was used as the outgroup. The scale bar represents substitutions per site.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-9530286/v1/b334dc0e62cd49f709c5360b.png"},{"id":108799522,"identity":"9b1c57b9-b635-4b10-8622-fca3e94082d8","added_by":"auto","created_at":"2026-05-08 13:59:02","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":268656,"visible":true,"origin":"","legend":"\u003cp\u003eBayesian phylogeny of the class Archamoebae based on 18S rRNA sequences, including \u003cem\u003eE. nana\u003c/em\u003e. The tree was inferred based on 739 bp of the 18S rRNA sequences, including representative taxa of \u003cem\u003eEntamoeba\u003c/em\u003e, \u003cem\u003eMastigamoeba\u003c/em\u003e, \u003cem\u003eIodamoeba\u003c/em\u003e, and \u003cem\u003eEndolimax\u003c/em\u003e (including \u003cem\u003eE. nana\u003c/em\u003e, \u003cem\u003eE. piscium\u003c/em\u003e, \u003cem\u003eE. carassius\u003c/em\u003e, and \u003cem\u003eEndolimax\u003c/em\u003e sp.). The phylogeny was rooted with \u003cem\u003eAcanthamoeba\u003c/em\u003e sp. (AY176047) as an outgroup within Amoebozoa. Numbers at nodes indicate PP of BI. The scale bar represents substitutions per site.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-9530286/v1/a3ccb1b8b494298692bbd8a3.png"},{"id":108799732,"identity":"f3836a52-c6a0-4f89-9f07-63e95f4380f0","added_by":"auto","created_at":"2026-05-08 14:00:08","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1604683,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9530286/v1/3281e847-f78e-48c2-8c85-87b6e0ceb896.pdf"},{"id":108799598,"identity":"3264f100-b18c-4d85-a754-06da5c2d077e","added_by":"auto","created_at":"2026-05-08 13:59:32","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":37758,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementary1.GenBankaccessionnumbersforE.nanasequencesusedinthisstudy.docx","url":"https://assets-eu.researchsquare.com/files/rs-9530286/v1/0bb6e8995c8c5a8e3d6d29a9.docx"},{"id":108799606,"identity":"e7a98012-78d6-463b-bc78-7c2ed47a650a","added_by":"auto","created_at":"2026-05-08 13:59:37","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":18724,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementary2.SummaryofpairwisegeneticdistanceswithinandbetweenEndolimaxnanasubtypes.docx","url":"https://assets-eu.researchsquare.com/files/rs-9530286/v1/cae25e1119016c08375b746f.docx"},{"id":108799564,"identity":"78b24984-26b1-4c1c-b931-12dcfab8ec25","added_by":"auto","created_at":"2026-05-08 13:59:14","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":21743,"visible":true,"origin":"","legend":"","description":"","filename":"supplementary3.Binarylogisticregressionanalyses.docx","url":"https://assets-eu.researchsquare.com/files/rs-9530286/v1/58f7515195a19ee1d81bcbec.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Intraspecies genetic diversity of Endolimax nana in Sumba Island, Indonesia","fulltext":[{"header":"Background","content":"\u003cp\u003eUnder the current eukaryotic classification framework, \u003cem\u003eEndolimax nana\u003c/em\u003e belongs to Amoebozoa (Evosea) and is placed within the class Archamoebae (Archamoebids) [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. It is one of the most frequently detected intestinal protists in humans, with a global prevalence ranging from 10\u0026ndash;30% [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Originally \u003cem\u003eEndolimax nana\u003c/em\u003e was described as \u003cem\u003eEntamoeba nana\u003c/em\u003e by Wenyon and O\u0026rsquo;Connor (1917) [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Subsequently, the species was reassigned to \u003cem\u003eEndolimax\u003c/em\u003e by Brug (1918) and Dobell (1919, 1943) provided detailed morphological descriptions, including its small trophozoites, eccentric karyosome, and quadri-nucleated cysts [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Despite its frequent detection, \u003cem\u003eE. nana\u003c/em\u003e has generally been regarded as a harmless commensal and has therefore received less attention than related genera such as \u003cem\u003eEntamoeba\u003c/em\u003e, some members of which are well-established pathogens.\u003c/p\u003e \u003cp\u003eMuch of the current understanding of the distribution of \u003cem\u003eE. nana\u003c/em\u003e is derived from microscopy-based surveys. However, light microscopy does not always allow reliable species-level identification. In contrast, molecular approaches, particularly analyses based on the small subunit ribosomal RNA gene (18S rRNA), provide more robust taxonomic resolution and have revealed unexpected diversity across a wide range of protist groups [\u003cspan additionalcitationids=\"CR7 CR8\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In fact, the combination of conserved and hypervariable regions within the 18S rRNA gene enables taxonomic resolution down to the subtype/genotype or ribosomal lineage level, as demonstrated in protists such as \u003cem\u003eBlastocystis\u003c/em\u003e and archamoebids (e.g., \u003cem\u003eEndolimax\u003c/em\u003e, \u003cem\u003eIodamoeba\u003c/em\u003e) [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Nevertheless, the reliability of molecular identification is highly dependent on the availability of reference sequences. For amebic organisms, sequence data in public databases such as GenBank remain limited, and insufficient reference datasets can hinder accurate assignment.\u003c/p\u003e \u003cp\u003eThe first complete 18S rRNA gene sequence of \u003cem\u003eE. nana\u003c/em\u003e (isolate NIH:0591:1 from a grey-cheeked mangabey) showed substantial divergence and supported a phylogenetic placement distinct from \u003cem\u003eEntamoeba\u003c/em\u003e and \u003cem\u003eIodamoeba\u003c/em\u003e [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. These findings raised the possibility that morphologically similar isolates may represent genetically distinct lineages. Subsequent molecular studies have supported this hypothesis, provided evidence of cryptic diversity and suggested the existence of multiple subtypes within \u003cem\u003eE. nana\u003c/em\u003e [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. However, compared with other intestinal amebic organisms, available molecular data for \u003cem\u003eE. nana\u003c/em\u003e remain limited, and its true genetic diversity, host distribution, and evolutionary relationships are still incompletely resolved.\u003c/p\u003e \u003cp\u003eAlthough \u003cem\u003eE. nana\u003c/em\u003e is considered cosmopolitan, regional molecular data remain unevenly distributed. In particular, Southeast Asia, including Indonesia, appears underrepresented in currently available sequence datasets. Historically, early investigations of \"Limax-type intestinal amoebae\" from the Dutch East Indies (e.g., Sumatra) contributed to establishing these organisms as true intestinal inhabitants [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Clarifying subtype diversity is important not only for taxonomic refinement but also for improving our understanding of host distribution patterns and broader ecological relationships.\u003c/p\u003e \u003cp\u003eIn this study, we analyzed 18S rRNA sequences obtained from human and animal hosts in Wainyapu Village, Sumba Island, Indonesia, to investigate subtype diversity and host associations of \u003cem\u003eE. nana\u003c/em\u003e.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSample collection, stool form assessment, and DNA extraction\u003c/h2\u003e \u003cp\u003eA total of 315 stool samples were collected in Wainyapu Village, Sumba Island, Indonesia. These comprised 144 human samples collected in 2016 from healthy schoolchildren aged 7\u0026ndash;14 years and 171 animal samples collected between 2015 and 2016 from domestic or peridomestic animals, including rats (n\u0026thinsp;=\u0026thinsp;50), pigs (n\u0026thinsp;=\u0026thinsp;45), dogs (n\u0026thinsp;=\u0026thinsp;26), ducks (n\u0026thinsp;=\u0026thinsp;5), chickens (n\u0026thinsp;=\u0026thinsp;28), a horse (n\u0026thinsp;=\u0026thinsp;1), buffaloes (n\u0026thinsp;=\u0026thinsp;3), and goats (n\u0026thinsp;=\u0026thinsp;12).\u003c/p\u003e \u003cp\u003eHuman samples were obtained from children attending Kera-Panba Primary and Junior High School (9\u0026deg;38\u0026prime;36\u0026Prime;S, 119\u0026deg;00\u0026prime;58\u0026Prime;E). Animal samples were collected either immediately after defecation (buffaloes, goats, horses), by enema (pigs and dogs), or from intestinal contents obtained by dissection (rats, chickens, and ducks).\u003c/p\u003e \u003cp\u003eFor the human subset, stool form was assessed using the Bristol stool chart, which classifies stool consistency on a seven-point scale [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eApproximately 0.2 g of each stool sample was placed into a 1.5 mL tube pre-filled with DNAzol\u0026reg; reagent (Molecular Research Center, Cincinnati, OH, USA). Samples were stored at approximately 25\u0026deg;C in the field for up to one week and subsequently kept at 4\u0026deg;C until further processing.\u003c/p\u003e \u003cp\u003eDNA extraction was performed using the DNAzol\u0026reg; protocol with modifications, including two freeze\u0026ndash;thaw cycles (\u0026minus;\u0026thinsp;80\u0026deg;C and 25\u0026deg;C), overnight digestion with proteinase K (0.4 mg/mL; Wako Pure Chemical Industries, Osaka, Japan) at 55\u0026deg;C, and ethanol precipitation. The resulting DNA pellets were dissolved in 30 \u0026micro;L of 10 mM Tris-HCl (pH 8.0) containing 1 mM EDTA and stored at \u0026minus;\u0026thinsp;20\u0026deg;C.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePCR amplification and sequencing\u003c/h3\u003e\n\u003cp\u003ePrimers targeting the 18S rRNA gene of \u003cem\u003eE. nana\u003c/em\u003e were designed based on multiple sequence alignments of publicly available sequences retrieved from the GenBank/DDBJ/EMBL databases (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Primer specificity was evaluated using the NCBI BLASTn algorithm against the nucleotide database.\u003c/p\u003e \u003cp\u003eThe outer primer pair, IO_LIMAXF (5\u0026prime;-CTGCCAGTAGTCATATGCTTGTG-3\u0026prime;) and TN14\u0026prime;R (5\u0026prime;-ACCTTGTTACGACTCTTCCTT-3\u0026prime;), targeting an approximately 2,693 bp region of the 18S rRNA gene, was adopted from previous studies [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The inner primer pair, AU15F (5\u0026prime;-GACAAGGGAGAGTGTGC-3\u0026prime;) and AU8R (5\u0026prime;-GCATCGTTTATGGTTGAGACTAC-3\u0026prime;), was newly designed in this study based on conserved regions identified from multiple sequence alignments, including reference sequence AF149916, to amplify an internal region of approximately 1,311 bp specific to \u003cem\u003eE. nana\u003c/em\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eNested PCR was performed in two rounds. The first round used IO_LIMAXF/TN14\u0026prime;R with Takara Ex Premier\u0026trade; DNA Polymerase in 10 \u0026micro;L reaction volumes under the following conditions: initial denaturation at 94\u0026deg;C for 1 min; 30 cycles of 98\u0026deg;C for 10 s, 58\u0026deg;C for 15 s, and 68\u0026deg;C for 90 s; followed by a final extension at 68\u0026deg;C for 1 min.\u003c/p\u003e \u003cp\u003eThe second round used AU15F/AU8R primers to amplify an approximately 1.3 kb product using Ex Premier\u0026trade; under the following conditions: 94\u0026deg;C for 1 min; 30 cycles of 98\u0026deg;C for 10 s, 55\u0026deg;C for 15 s, and 68\u0026deg;C for 46 s; and a final extension at 68\u0026deg;C for 1 min. For samples showing weak amplification in the first round, LA Taq\u0026reg; with GC buffer and an additional 0.1 \u0026micro;L DMSO was used in the second round with modified cycling conditions (94\u0026deg;C for 1 min; 30 cycles of 94\u0026deg;C for 30 s, 55\u0026deg;C for 30 s, and 72\u0026deg;C for 80 s; final extension at 72\u0026deg;C for 5 min).\u003c/p\u003e \u003cp\u003ePCR products were electrophoresed on 1% agarose gels stained with ethidium bromide and visualized using a Gel Doc\u0026trade; EZ system (Bio-Rad, Hercules, CA, USA). Amplicons of the expected size were purified using the FastGene\u0026reg; Gel/PCR Extraction Kit (Nippon Genetics, Tokyo, Japan).\u003c/p\u003e \u003cp\u003ePurified PCR products were directly sequenced using the SupreDye\u0026trade; Cycle Sequencing Kit v3.1 (AdvancedSeq, CA, USA) according to the manufacturer\u0026rsquo;s instructions. Samples yielding ambiguous chromatograms, suggestive of mixed haplotypes, were sub-cloned into the pMD20-T vector (TA-Mighty Kit, Takara Bio) and transformed into \u003cem\u003eEscherichia coli\u003c/em\u003e DH5-α. Colonies were screened on LB agar plates containing ampicillin (100 mg/L). For each sample, 5\u0026ndash;10 colonies were selected and cultured overnight at 36\u0026deg;C in 2 mL LB broth with ampicillin. Plasmids were extracted using the NucleoSpin\u0026reg; Plasmid QuickPure Kit (Macherey\u0026ndash;Nagel, D\u0026uuml;ren, Germany), and inserts were sequenced as described above to obtain individual haplotype sequences.\u003c/p\u003e\n\u003ch3\u003eMolecular data analysis\u003c/h3\u003e\n\u003cp\u003ePhylogenetic analyses were performed as follows. Newly obtained sequences were aligned with nine \u003cem\u003eE. nana\u003c/em\u003e reference sequences and one outgroup (\u003cem\u003eE. piscium\u003c/em\u003e) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) using Multiple Alignment with Fast Fourier Transform (MAFFT), as implemented in Geneious Prime (version 2023.1.1; Biomatters Ltd., New Zealand). Phylogenetic trees were reconstructed using three methods: Bayesian inference (BI) using MrBayes v3.2.6[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] in Geneious Prime under the HKY85 model, Neighbor-Joining (NJ) in Geneious Prime under the HKY substitution model, and Maximum Parsimony (MP) in MEGA11 [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Clade support was assessed using posterior probabilities (PP\u0026thinsp;\u0026gt;\u0026thinsp;0.5) for BI and bootstrap values (BV\u0026thinsp;\u0026gt;\u0026thinsp;50%) for NJ and MP. The final alignment comprised 1,176 nucleotide positions. Pairwise genetic distances were calculated using MEGA11.\u003c/p\u003e \u003cp\u003eTo evaluate the phylogenetic placement of \u003cem\u003eE. nana\u003c/em\u003e among archamoebids, additional analyses were conducted following the same procedures described above. However, due to the inclusion of more distantly related taxa, gap-filtering was required to ensure alignment quality, resulting in a reduced dataset of 739 nucleotide positions. The reference sequences used in this analysis are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eIn the human subset, binary logistic regression analyses were performed to evaluate the associations between explanatory variables (age, sex, and the presence of \u003cem\u003eE. nana\u003c/em\u003e) and stool consistency. Stool outcomes were defined by the Bristol stool chart as mild diarrheal stool (types 5\u0026ndash;7 vs. 1\u0026ndash;4 ) and severe diarrheal stool (types 6\u0026ndash;7 vs. 1\u0026ndash;5) [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Age was treated as a continuous variable and sex as a binary variable. All statistical analyses were performed using R (version 4.2.3; R Foundation for Statistical Computing, Vienna, Austria), and a p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eLimitations of this study\u003c/h3\u003e\n\u003cp\u003eSeveral limitations should be considered. First, archived samples collected across multiple time points may introduce temporal heterogeneity in the dataset. Second, the study was conducted within a single geographically restricted population, which may limit broader applicability. Third, the analysis was based on a partial fragment of the 18S rRNA gene, potentially constraining phylogenetic resolution. Fourth, only a single genetic marker was used, which limits the ability to resolve recombination, population structure, and the biological distinctness of ribosomal lineages. Finally, the cross-sectional study design limits temporal interpretation of the observed patterns.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for the nested PCR screening of 18S rRNA gene locus in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIO_LimaxF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026prime;\u0026ndash;CTGCCAGTAGTCATATGCTTGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHocke et al., 2023 [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTN14\u0026prime;R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026prime;\u0026ndash;ACCTTGTTACGACTTCTCCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLacante et al., 2024 [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAU15F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026prime;\u0026ndash;GACAAGGGAGAGTGTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePresent study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAU8R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026prime;\u0026ndash;GCATCGTTTATGGTTGAGACTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePresent study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of reference 18S rRNA sequences used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSpecies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHost/ Isolation source\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGenBank Accession number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOrigin\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSequence Length\u003c/p\u003e \u003cp\u003e(bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEndolimax nana\u003c/em\u003e SW01[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNA / Sewage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOK483220.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSweden\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1605\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEndolimax nana\u003c/em\u003e SW02[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNA / Sewage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOK483221.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSweden\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1571\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEndolimax nana\u003c/em\u003e SW03[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNA / Sewage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOK483222.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSweden\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1593\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEndolimax\u003c/em\u003e sp. TDP-2[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eSus scrofa domesticus\u003c/em\u003e / Stool of Pig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLC230011.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eJapan\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2582\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEndolimax\u003c/em\u003e sp. TDP-2 [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eSus scrofa domesticus\u003c/em\u003e / Stool of Pig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLC230012.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eJapan\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2580\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEndolimax\u003c/em\u003e sp. TDP-2 [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eSus scrofa domesticus\u003c/em\u003e / Stool of Pig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLC230013.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eJapan\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2584\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEndolimax\u003c/em\u003e sp. TDP-2 [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eSus scrofa domesticus\u003c/em\u003e / Stool of Pig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLC230014.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eJapan\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2580\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEndolimax\u003c/em\u003e sp. TDP-2 [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eSus scrofa domesticus\u003c/em\u003e / Stool of Pig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLC230015.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eJapan\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2580\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEndolimax nana\u003c/em\u003e NIH:0591:1 [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCercocebus albigena\u003c/em\u003e / Stool of Gray-cheeked mangabey\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAF149916.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNA\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2589\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEndolimax piscium\u003c/em\u003e clone MALEN3 [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eSolea senegalensis\u003c/em\u003e / fish muscle\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJX101953.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSpain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2971\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003csup\u003e*\u003c/sup\u003e NA, not available.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eSummary of molecular screening results\u003c/h2\u003e \u003cp\u003eOf the 315 samples examined, 76 were positive for \u003cem\u003eEndolimax nana\u003c/em\u003e (24.1%, 76/315) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Prevalence was higher in humans (42.4%, 61/144) than in animals (8.8%, 15/171) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Positive animal samples included rats (12.0%, 6/50), pigs (11.1%, 5/45), dogs (7.7%, 2/26), one duck (20.0%, 1/5), and one chicken (3.6%, 1/28), whereas no positives were detected in horses, buffalo, or goats.\u003c/p\u003e \u003cp\u003eSeveral chromatograms of DNA sequencing exhibited double peaks, necessitating sub-cloning to resolve individual haplotypes. Similar observations have been reported for other intestinal amoebae and may reflect intragenomic variation of multicopy rRNA genes, mixed infections, or non-specific amplification [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Further sub-cloning of the 76 \u003cem\u003eE. nana\u003c/em\u003e-positive samples yielded 127 DNA reads, comprising 118 unique 18S rRNA haplotypes (i.e., distinct DNA sequence variants). Most of this increase originated from human samples (61 to 98 DNA reads), although animal-derived reads also increased (15 to 29). Multiple haplotypes were occasionally recovered from individual hosts, particularly in pigs and rats. For example, five pig samples yielded 17 distinct haplotypes, while six rat samples yielded eight haplotypes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSummary of molecular screening results of \u003cem\u003eE. nana\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHost\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eE. nana\u003c/em\u003e positives (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRegistered DDBJ accession\u003c/p\u003e \u003cp\u003enumbers *\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSequence length (bp)*\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHuman (\u003cem\u003eHomo sapiens\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e144\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e61 (42.4%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLC882021\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003e1271 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnimal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e171\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15 (8.8%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRat (\u003cem\u003eRattus exulans\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6 (12.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLC882127\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003e1256 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePig (\u003cem\u003eSus scrofa domesticus\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5 (11.1%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLC882080\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003e1252 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDog (\u003cem\u003eCanis lupus familiaris\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2 (7.7%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLC882052\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003e1279 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDuck (\u003cem\u003eAnas superciliosa\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 (20.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLC882079\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003e1256 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eChicken (\u003cem\u003eGallus gallus\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 (3.6%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLC882077\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003e1255 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHorse (\u003cem\u003eEquus ferus caballus\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0 (0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBuffalo (\u003cem\u003eBubalus bubalis\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0 (0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGoat (\u003cem\u003eCapra aegagrus hircus\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0 (0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e315\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e76 (24%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e* Representative accession numbers and sequence lengths are shown, while all data, including non-representative sequences, are provided in Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eResults of phylogenetic reconstruction\u003c/h3\u003e\n\u003cp\u003ePhylogenetic reconstruction based on 1,176 bp of the 18S rRNA locus was performed using a dataset comprising 118 unique haplotypes obtained in this study (Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e), nine \u003cem\u003eE. nana\u003c/em\u003e references, and \u003cem\u003eE. piscium\u003c/em\u003e as a designated outgroup (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). BI, NJ, and MP analyses consistently resolved two major clades corresponding to Subtype 1 (ST1) and Subtype 2 (ST2) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Within these clades, a consistent substructure was observed, forming four subclades: ST1-1, ST1-2, ST2-1, and ST2-2. Support values (posterior probabilities and bootstrap values) for key nodes are indicated in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003eST1-1 was dominated by human isolates but included a single pig-derived sequence and a single non-human primate (NHP). ST1-2 also consisted primarily of human isolates, alongside pig-derived reference sequences. Within ST2-1, rat-derived haplotypes exhibited a loose clustering pattern, albeit without robust monophyletic support, suggesting a potential host-associated lineage structure. Notably, no GenBank reference sequences corresponding to ST2-1 were available for the present analysis. ST2-2 was represented exclusively by human isolates in this dataset and clustered with sewage-derived reference sequences (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTo clarify the molecular taxonomic position of \u003cem\u003eE. nana\u003c/em\u003e within archamoebid lineages, an additional 18S rRNA phylogeny was evaluated based on 739 bp of nucleotide positions, including representative lineages of \u003cem\u003eEntamoeba\u003c/em\u003e, \u003cem\u003eMastigamoeba\u003c/em\u003e, \u003cem\u003eIodamoeba\u003c/em\u003e, and \u003cem\u003eEndolimax\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Phylogenetic analysis robustly placed \u003cem\u003eE. nana\u003c/em\u003e within class Archamoebae (Amoebozoa: Evosea), specifically within the \u003cem\u003eMastigamoeba\u003c/em\u003e-related lineage. \u003cem\u003eE. nana\u003c/em\u003e and \u003cem\u003eE. piscium\u003c/em\u003e formed a strongly supported monophyletic clade, which was recovered as a sister group to \u003cem\u003eIodamoeba\u003c/em\u003e. Together, these taxa constituted a coherent \u003cem\u003eEndolimax\u003c/em\u003e\u0026ndash;\u003cem\u003eIodamoeba\u003c/em\u003e clade, which was further resolved as a sister group to the \u003cem\u003eMastigamoeba\u003c/em\u003e lineage. This broader assemblage was, in turn, positioned as a sister group to \u003cem\u003eEntamoeba\u003c/em\u003e, supporting a hierarchical structure within class Archamoebae (archamoebid lineage).\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003ePairwise genetic distance analyses\u003c/h2\u003e \u003cp\u003ePairwise genetic distances based on the 18S rRNA alignment (1,176 bp) supported the subtype framework. Genetic distances within subtypes were low (generally\u0026thinsp;\u0026lt;\u0026thinsp;0.03), whereas inter-subtype distances were substantially higher (approximately 0.10\u0026ndash;0.19), with the greatest divergence (0.19) observed between ST1-2 and ST2-1 (Supplementary Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). Distances between \u003cem\u003eE. nana\u003c/em\u003e and \u003cem\u003eE. piscium\u003c/em\u003e were markedly higher (mean approx. 0.54), consistent with deep divergence among congeners.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eAssociation of E. nana colonization and subtype with stool consistency\u003c/h2\u003e \u003cp\u003eBinary logistic regression analysis of 144 human stool samples with complete Bristol stool form data showed no significant association between \u003cem\u003eE. nana\u003c/em\u003e colonization and stool consistency after adjustment for age and sex (p\u0026thinsp;=\u0026thinsp;0.998). In contrast, increasing age was significantly associated with lower odds of diarrheal stool categories (OR\u0026thinsp;=\u0026thinsp;0.76, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Male sex showed an inverse association with severe diarrheal stool; however, this association did not reach statistical significance. Furthermore, no significant associations were detected between any \u003cem\u003eE. nana\u003c/em\u003e subtype and stool consistency after adjustment for age and sex.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we analyzed 18S rRNA gene sequences obtained from fecal samples of human and animal hosts in Wainyapu Village, Sumba Island, Indonesia, to characterize the haplotype diversity, subtype structure, and host-associated distribution of \u003cem\u003eE. nana\u003c/em\u003e in a parasite-endemic setting. Our results provide refined insights into the phylogenetic placement of \u003cem\u003eEndolimax\u003c/em\u003e within Amoebozoa and demonstrate pronounced sequence-level diversity among \u003cem\u003eE. nana\u003c/em\u003e 18S rRNA haplotypes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePhylogenetic analyses (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) robustly placed \u003cem\u003eE. nana\u003c/em\u003e within the clade Evosea of Amoebozoa. In this framework, \u003cem\u003eEndolimax\u003c/em\u003e spp. (\u003cem\u003eE. nana\u003c/em\u003e, \u003cem\u003eE. piscium\u003c/em\u003e, and \u003cem\u003eE. carassius\u003c/em\u003e) formed a well-supported monophyletic group, hereafter referred to as the main \u003cem\u003eEndolimax\u003c/em\u003e clade. This clade was consistently recovered as sister to \u003cem\u003eIodamoeba\u003c/em\u003e, forming an \u003cem\u003eEndolimax\u0026ndash;Iodamoeba\u003c/em\u003e assemblage, which was in turn recovered as sister to \u003cem\u003eMastigamoeba\u003c/em\u003e, together constituting a Mastigamoeba-related lineage within the class Archamoebae. This topology is congruent with previous phylogenetic frameworks that recognize archamoebids as deeply branching lineages [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], while providing improved resolution among \u003cem\u003eEndolimax\u003c/em\u003e, \u003cem\u003eIodamoeba\u003c/em\u003e, and \u003cem\u003eMastigamoeba\u003c/em\u003e. Notably, \u003cem\u003eIodamoeba\u003c/em\u003e was recovered as sister to the main \u003cem\u003eEndolimax\u003c/em\u003e clade, rather than specifically associated with \u003cem\u003eE. piscium\u003c/em\u003e, as previously proposed [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Furthermore, sequences previously designated as \u003cem\u003eEndolimax\u003c/em\u003e sp. (LC230011, LC230012) were nested within the \u003cem\u003eE. nana\u003c/em\u003e clade, supporting their reassignment to \u003cem\u003eE. nana\u003c/em\u003e [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. It should be noted that inclusion of distantly related taxa required extensive gap filtering, and the limited availability of reference sequences likely contributed to the reduction of the alignment to 739 nucleotide positions and to decreased statistical support for deeper nodes. Accordingly, relationships among major archamoebid lineages should be interpreted with caution.\u003c/p\u003e \u003cp\u003eSubstantial intra-species sequence diversity was observed among \u003cem\u003eE. nana\u003c/em\u003e 18S rRNA haplotypes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Phylogenetic analyses consistently resolved two major subtype groups (ST1 and ST2), each further subdivided into well-defined subclusters (ST1-1, ST1-2, ST2-1, and ST2-2). This structure refines previously proposed ribosomal lineage frameworks, with ST1 broadly corresponding to RL1 and ST2 to RL2 [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Pairwise distance analyses further aligned with this structure (Supplementary Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e), revealing low sequence divergence within subtypes and markedly higher divergence between subtypes. These findings indicate that \u003cem\u003eE. nana\u003c/em\u003e comprises deeply structured 18S rRNA haplotype lineages. Accordingly, the subtype-based nomenclature proposed here represents a practical and scalable framework for molecular epidemiological investigations, although confirmation using multilocus or genome-scale data will be necessary to assess whether these ribosomal lineages correspond to biologically distinct entities.\u003c/p\u003e \u003cp\u003eHost-associated patterns were suggested by the distribution of \u003cem\u003eE. nana\u003c/em\u003e haplotypes; however, clear host specificity could not be established. ST1-1 was detected almost exclusively in human-derived samples, with a single detection in a pig, whereas ST1-2 was primarily identified in humans and pigs, with one detection in a dog. Given the coprophagic behavior of pigs and dogs, these sporadic detections in non-human hosts likely reflect incidental ingestion of human fecal material and subsequent mechanical passage through the gastrointestinal tract rather than true colonization. When interpreted in the context of the overall subtype distribution, ST1-1 and ST2-2 were predominantly human-associated, ST1-2 was shared mainly between humans and pigs, and ST2-1 showed a broader distribution across humans, pigs, and rats. Importantly, no animal-restricted subtype group was identified. Thus, although some host groups were represented by limited sample sizes and the analysis was based on a single genetic marker, the overall pattern suggests that \u003cem\u003eE. nana\u003c/em\u003e haplotypes are structured around human-associated lineages rather than independent animal-associated lineages. This finding suggests that \u003cem\u003eE. nana\u003c/em\u003e primarily circulates within human-associated transmission networks, with detections in animals likely reflecting secondary exposure or host overlap. Taken together, these observations provide an ecologically meaningful framework for interpreting the host distribution and transmission dynamics of \u003cem\u003eE. nana\u003c/em\u003e in parasite-endemic settings.\u003c/p\u003e \u003cp\u003eThese findings add to accumulating molecular epidemiological evidence that intestinal protozoa are frequently detected as components of complex gut microbial communities in endemic settings. Our previous investigations in the same population have reported the co-detection of diverse protozoa, including \u003cem\u003eGiardia intestinalis\u003c/em\u003e [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], \u003cem\u003eEntamoeba\u003c/em\u003e spp. [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], \u003cem\u003eEnteromonas\u003c/em\u003e spp. [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], \u003cem\u003eChilomastix\u003c/em\u003e spp. [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], and \u003cem\u003eRetortamonas\u003c/em\u003e spp. [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], highlighting the complexity of protozoan assemblages in the human gastrointestinal tract. In the present study, the detection of genetically diverse \u003cem\u003eE. nana\u003c/em\u003e 18S rRNA haplotypes, together with the absence of an association between intestinal detection of \u003cem\u003eE. nana\u003c/em\u003e and diarrheal stool form in this dataset, is consistent with the interpretation that this organism represents a commonly detected member of the gut protozoan community rather than an incidental finding in this endemic population. More broadly, the repeated detection of diverse, largely commensal intestinal protozoa in endemic populations may indicate a gut ecosystem that retains features of the ancestral human intestinal environment. The subtype framework established in this study therefore provides a standardized basis for molecular detection, comparative epidemiological analyses, and future investigations into the ecological and functional significance of under-characterized intestinal protozoa.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study refines the phylogenetic placement of \u003cem\u003eE. nana\u003c/em\u003e within archamoebids and reveals extensive 18S rRNA haplotype diversity in a parasite-endemic setting. The identified haplotypes were organized into two major subtypes (ST1 and ST2) with distinct subclusters, providing a practical framework for molecular epidemiological studies. Subtype distribution indicated clear host-associated structure: ST1-1 and ST2-2 were predominantly human-associated, ST1-2 was shared between humans and pigs, and ST2-1 was detected across humans, pigs, and rats. The absence of animal-restricted subtypes suggests that \u003cem\u003eE. nana\u003c/em\u003e primarily circulates within human-associated transmission networks. No association was observed between \u003cem\u003eE. nana\u003c/em\u003e colonization and stool consistency, supporting its predominantly commensal nature in this context. Collectively, this framework provides a basis for standardized comparative analyses and supports future multilocus and longitudinal studies to better understand the ecology and transmission dynamics of intestinal protozoa.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e18S rRNA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e18S small subunit ribosomal RNA\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBayesian inference\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBLASTn\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBasic Local Alignment Search Tool for nucleotide sequences\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBootstrap value / bootstrap values\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDDBJ\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDNA Data Bank of Japan\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDMSO\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDimethyl sulfoxide\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eEMBL\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eEuropean Molecular Biology Laboratory\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGenBank\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGenBank\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHKY\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHasegawa\u0026ndash;Kishino\u0026ndash;Yano substitution model\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHKY85\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHasegawa\u0026ndash;Kishino\u0026ndash;Yano 1985 model\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLB\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eLuria\u0026ndash;Bertani medium\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMAFFT\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMultiple Alignment using Fast Fourier Transform\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMEGA11\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMolecular Evolutionary Genetics Analysis version 11\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMaximum Parsimony\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNot available\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNCBI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNational Center for Biotechnology Information\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNHP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNon-human primate\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNJ\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNeighbor-Joining\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePCR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePolymerase Chain Reaction\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePosterior probability\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eRL\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eRibosomal lineage\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eST\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSubtype\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe initial observations for this study were validated by numerous students from Kanazawa University who participated in our fieldwork in Indonesia between 2006 and 2016. We would like to\u0026nbsp;thank Anggi PN Hidayati and Ismail E Rozi (Eijkman Institute of Molecular Biology, Jakarta) for their contributions to our fieldwork. The authors acknowledge the language editing support provided by Paperpal (https:// paper pal. com/), which helped improve the English descriptions in this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u0026nbsp;\u003c/sup\u003eDepartment of Global Infectious Diseases, Graduate School of Advanced Preventive Medical Sciences, Kanazawa University, Kanazawa, Japan\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e2\u0026nbsp;\u003c/sup\u003eGraduate School of Hasanuddin University, Makassar, Indonesia\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e3\u0026nbsp;\u003c/sup\u003eEijkman Research Center for Molecular Biology, National Research and Innovation Agency, Republic of Indonesia\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e4\u0026nbsp;\u003c/sup\u003eEnvironmental Stress Research Center, Kanazawa University, Kanazawa, Japan\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e5\u0026nbsp;\u003c/sup\u003eDepartment of Global Infectious Diseases, Graduate School of Medical Sciences, Kanazawa University, Kanazawa, Japan\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e6\u0026nbsp;\u003c/sup\u003eDepartment of Parasitology, Faculty of Medicine, Hasanuddin University, Makassar, Indonesia\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors’ contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was designed by AAM, TM and MT. Its protocol written by AAM, SAL, TM, MT, with the validation by AAM, TM, MT. Data collection was performed by AAM, PBA, SAL, SD. AAM performed molecular analyses. Data analyses were done by NRN, SY, HA, AAM. AAM, SAL, BX and TM was responsible for resources. AAM wrote the manuscript. AAM, SAL, TM, BX and MT performed the visualization of the data, wrote the review and edited the manuscript. Supervision and project administration was performed by TM and MT. Funding acquisition provided by MT.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported in part by research funding for MT from the Japan Society for the Promotion of Science (JSPS) KAKENHI Grant-in-Aid for Scientific Research B (Grant Nos. 26305008 and 16H05803), Scientific Research C (Grant No. 25460514), and Grant-in-Aid for Scientific Research under the Fund for the Promotion of Joint International Research (International Collaborative Research Enhancement B) (Grant No. 19KK0200), provided by the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan, as well as by the Research Program on Emerging and Re-emerging Infectious Diseases from the Japan Agency for Medical Research and Development (AMED) (Grant No. JP25fk0108908).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDNA sequences of the 18S rRNA gene locus have been deposited into the DNA Database (DDBJ-EMBL-Genbank) data library with accession number LC882021–LC882147.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the scientific and ethics review unit at the Faculty of Medicine, Hasanuddin University, Makassar, Indonesia, and Kanazawa University, Japan. Informed consent and assent were obtained from the study participants (children) and their guardians.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAdl SM, Bass D, Lane CE, Luke\u0026scaron; J, Schoch CL, Smirnov A, Agatha S, Berney C, Brown MW, Burki F, C\u0026aacute;rdenas P, Čepička I, Chistyakova L, Campo J del, Dunthorn M, Edvardsen B, Eglit Y, Guillou L, Hampl V, Heiss AA, Hoppenrath M, James TY, Karnkowska A, Karpov S, Kim E, Kolisko M, Kudryavtsev A, Lahr DJG, Lara E, Gall LL, Lynn DH, Mann DG, Massana R, Mitchell EAD, Morrow C, Park JS, Pawlowski JW, Powell MJ, Richter DJ, Rueckert S, Shadwick L, Shimano S, Spiegel FW, Torruella G, Youssef N, Zlatogursky V, Zhang Q. Revisions to the Classification, Nomenclature, and Diversity of Eukaryotes. \u003cem\u003eJ Eukaryot Microbiol\u003c/em\u003e 2019;66:4\u0026ndash;119. https://doi.org/10.1111/jeu.12691.\u003c/li\u003e\n \u003cli\u003ePt\u0026aacute;čkov\u0026aacute; E, Kostygov AYu, Chistyakova LV, Falteisek L, Frolov AO, Patterson DJ, Walker G, Cepicka I. Evolution of Archamoebae: Morphological and Molecular Evidence for Pelobionts Including \u003cem\u003eRhizomastix\u003c/em\u003e, \u003cem\u003eEntamoeba\u003c/em\u003e, \u003cem\u003eIodamoeba\u003c/em\u003e, and \u003cem\u003eEndolimax\u003c/em\u003e. \u003cem\u003eProtist\u003c/em\u003e 2013;164:380\u0026ndash;410. https://doi.org/10.1016/j.protis.2012.11.005.\u003c/li\u003e\n \u003cli\u003ePoulsen CS, Stensvold CR. Systematic review on \u003cem\u003eEndolimax nana\u003c/em\u003e: A less well studied intestinal ameba. \u003cem\u003eTrop Parasitol\u003c/em\u003e 2016;6:8\u0026ndash;29. https://doi.org/10.4103/2229-5070.175077.\u003c/li\u003e\n \u003cli\u003eDobell C. \u003cem\u003eThe amoebae living in man; a zoological monograph\u003c/em\u003e. Medical Research Committee; 1919.\u003c/li\u003e\n \u003cli\u003eDobell C. Researches on the intestinal protozoa of monkeys and man. \u003cem\u003eParasitology\u003c/em\u003e 1943;35:134\u0026ndash;58. https://doi.org/10.1017/s003118200002151x.\u003c/li\u003e\n \u003cli\u003eStensvold CR, Lebbad M, Verweij JJ. The impact of genetic diversity in protozoa on molecular diagnostics. \u003cem\u003eTrends Parasitol\u003c/em\u003e 2011;27:53\u0026ndash;8. https://doi.org/10.1016/j.pt.2010.11.005.\u003c/li\u003e\n \u003cli\u003eSilberman JD, Clark CG, Diamond LS, Sogin ML. Phylogeny of the genera \u003cem\u003eEntamoeba\u003c/em\u003e and \u003cem\u003eEndolimax\u003c/em\u003e as deduced from small-subunit ribosomal RNA sequences. \u003cem\u003eMol Biol Evol\u003c/em\u003e 1999;16:1740\u0026ndash;51. https://doi.org/10.1093/oxfordjournals.molbev.a026086.\u003c/li\u003e\n \u003cli\u003eClark CG, Diamond LS. Intraspecific variation and phylogenetic relationships in the genus \u003cem\u003eEntamoeba\u003c/em\u003e as revealed by riboprinting. \u003cem\u003eJ Eukaryot Microbiol\u003c/em\u003e 1997;44:142\u0026ndash;54. https://doi.org/10.1111/j.1550-7408.1997.tb05951.x.\u003c/li\u003e\n \u003cli\u003eChihi A, Andersen LO, Aoun K, Bouratbine A, Stensvold CR. Amplicon-based next-generation sequencing for detection of single-celled parasites in human faecal samples. \u003cem\u003eParasite Epidemiol Control\u003c/em\u003e 2022;17:e00242. https://doi.org/10.1016/j.parepi.2022.e00242.\u003c/li\u003e\n \u003cli\u003eStensvold CR, Lebbad M, Hansen A, Beser J, Belkessa S, Andersen LO, Clark CG. Differentiation of \u003cem\u003eBlastocystis\u003c/em\u003e and parasitic archamoebids by amplicon-based NGS. \u003cem\u003eParasite Epidemiol Control\u003c/em\u003e 2020;9:e00131. https://doi.org/10.1016/j.parepi.2019.e00131.\u003c/li\u003e\n \u003cli\u003eHocke EF, Jamy M, Burki F, Clark CG, Stensvold CR. Intrageneric diversity of \u003cem\u003eEndolimax\u003c/em\u003e. \u003cem\u003eProtist\u003c/em\u003e 2022;173:125908. https://doi.org/10.1016/j.protis.2022.125908.\u003c/li\u003e\n \u003cli\u003eSwellengrebel NH, Winoto RMM. The life history of amoebae of the Limax type in the human intestine. \u003cem\u003eParasitology\u003c/em\u003e 1917;9:266\u0026ndash;73. https://doi.org/10.1017/s0031182000006089.\u003c/li\u003e\n \u003cli\u003eO\u0026rsquo;Donnell LJ, Virjee J, Heaton KW. Detection of pseudodiarrhoea. \u003cem\u003eBr Med J\u003c/em\u003e 1990;300:439. https://doi.org/10.1136/bmj.300.6722.439.\u003c/li\u003e\n \u003cli\u003eLacante SA, Jiang C, Mustamir AA, Mizuno T, Bi X, Syafruddin D, Tokoro M. Molecular detection of \u003cem\u003eEnteromonas\u003c/em\u003e species. \u003cem\u003eMethodsX\u003c/em\u003e 2024;13:102875. https://doi.org/10.1016/j.mex.2024.102875.\u003c/li\u003e\n \u003cli\u003eYoshida N et al. Growth effects on \u003cem\u003eEntamoeba\u003c/em\u003e and \u003cem\u003eEndolimax\u003c/em\u003e species isolates. \u003cem\u003eBiosci Trends\u003c/em\u003e 2019;13:402\u0026ndash;10. https://doi.org/10.5582/bst.2019.01233.\u003c/li\u003e\n \u003cli\u003eHuelsenbeck JP, Ronquist F. MRBAYES. \u003cem\u003eBioinformatics\u003c/em\u003e 2001;17:754\u0026ndash;5. https://doi.org/10.1093/bioinformatics/17.8.754.\u003c/li\u003e\n \u003cli\u003eTamura K, Stecher G, Kumar S. MEGA11. \u003cem\u003eMol Biol Evol\u003c/em\u003e 2021;38:3022\u0026ndash;7. https://doi.org/10.1093/molbev/msab120.\u003c/li\u003e\n \u003cli\u003eConstenla M, Padr\u0026oacute;s F, Palenzuela O. \u003cem\u003eEndolimax piscium\u003c/em\u003e sp. nov. \u003cem\u003eJ Fish Dis\u003c/em\u003e 2014;37:229\u0026ndash;40. https://doi.org/10.1111/jfd.12097.\u003c/li\u003e\n \u003cli\u003eMizuno T et al. Diversity of \u003cem\u003eGiardia intestinalis\u003c/em\u003e. \u003cem\u003eParasitol Int\u003c/em\u003e 2020;75:102038. https://doi.org/10.1016/j.parint.2019.102038.\u003c/li\u003e\n \u003cli\u003eMatsumura T, Hendarto J, Mizuno T, Syafruddin D, Yoshikawa H, Matsubayashi M, Nishimura T, Tokoro M. Possible pathogenicity of commensal \u003cem\u003eEntamoeba hartmanni\u003c/em\u003e. \u003cem\u003eTrop Med Health\u003c/em\u003e 2019;47:7. https://doi.org/10.1186/s41182-018-0132-7.\u003c/li\u003e\n \u003cli\u003eJiang C et al. Genetic diversity of \u003cem\u003eChilomastix\u003c/em\u003e. \u003cem\u003eTrop Med Health\u003c/em\u003e 2025;53:40. https://doi.org/10.1186/s41182-025-00725-5.\u003c/li\u003e\n \u003cli\u003eHendarto J et al. Clusters in \u003cem\u003eRetortamonas\u003c/em\u003e species. \u003cem\u003eParasitol Int\u003c/em\u003e 2019;69:93\u0026ndash;8. https://doi.org/10.1016/j.parint.2018.12.004.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"tropical-medicine-and-health","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"tmah","sideBox":"Learn more about [Tropical Medicine and Health](https://tropmedhealth.biomedcentral.com/)","snPcode":"41182","submissionUrl":"https://submission.springernature.com/new-submission/41182/3","title":"Tropical Medicine and Health","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Endolimax nana, 18S rRNA, subtype, host-associated distribution, intestinal protozoa","lastPublishedDoi":"10.21203/rs.3.rs-9530286/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9530286/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003e \u003cem\u003eEndolimax nana is a\u003c/em\u003e common intestinal archamoebid within Evosea (Amoebozoa), alongside genera such as \u003cem\u003eEntamoeba\u003c/em\u003e, \u003cem\u003eIodamoeba\u003c/em\u003e, and \u003cem\u003eMastigamoeba\u003c/em\u003e. Despite its frequent colonization of humans, it has received limited attention as a presumed non-pathogenic commensal, and its genetic diversity and host-associated distribution remain poorly resolved. Here, we define the molecular diversity, subtype structure, and host-associated distribution of \u003cem\u003eE. nana\u003c/em\u003e.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eA series of cross-sectional surveys was conducted in Wainyapu Village, Sumba Island, Indonesia. A total of 315 stool samples were collected from humans (n\u0026thinsp;=\u0026thinsp;144) and animals (n\u0026thinsp;=\u0026thinsp;171), including rats, pigs, dogs, ducks, chickens, horses, buffaloes, and goats between 2015 and 2016. Samples were screened by PCR targeting the 18S rRNA gene, followed by direct sequencing and subcloning. Phylogenetic relationships were inferred using Bayesian inference, Neighbor-Joining, and Maximum Parsimony methods. In the human subset, the association between \u003cem\u003eE. nana\u003c/em\u003e colonization and diarrheal stool form was evaluated using logistic regression analysis.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003e \u003cem\u003eE. nana\u003c/em\u003e was detected in humans (42.4%, 61/144), rats (12.0%, 6/50), pigs (11.1%, 5/45), dogs (7.7%, 2/26), ducks (20.0%, 1/5), and chickens (3.6%, 1/28). Sequencing yielded 127 sequences (1252\u0026ndash;1283 bp) comprising 118 unique 18S rRNA haplotypes. Phylogenetic analyses resolved two major subtypes (ST1 and ST2), each forming well-supported monophyletic clusters and further subdivided into distinct subclusters. Subtype distribution revealed clear host-associated structure: ST1-1 and ST2-2 were predominantly human-associated, ST1-2 was shared between humans and pigs, and ST2-1 was distributed across humans, pigs, and rats. Notably, no subtype was restricted to animal hosts, indicating that all subtype lineages include human-associated populations. No association was observed between \u003cem\u003eE. nana\u003c/em\u003e colonization and diarrheal stool form.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eWe provide the first molecular characterization of human-derived \u003cem\u003eE. nana\u003c/em\u003e, defining its subtype structure and host-associated distribution, and establish a framework for future molecular epidemiological and evolutionary studies. The absence of animal-restricted subtypes suggests that \u003cem\u003eE. nana\u003c/em\u003e circulates primarily within human-associated transmission networks. In addition, the lack of association with diarrheal stool form supports its interpretation as a predominantly commensal intestinal protozoan in this setting.\u003c/p\u003e","manuscriptTitle":"Intraspecies genetic diversity of Endolimax nana in Sumba Island, Indonesia","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-05-08 13:57:50","doi":"10.21203/rs.3.rs-9530286/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"294098113742561896624703060497997680411","date":"2026-05-18T01:07:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"199709200919336299073511404520875637180","date":"2026-05-16T14:09:02+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"63227775700516560564572765185519195905","date":"2026-05-06T05:34:04+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-04-30T06:12:03+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-04-30T02:28:56+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-04-30T02:28:28+00:00","index":"","fulltext":""},{"type":"submitted","content":"Tropical Medicine and Health","date":"2026-04-26T08:02:22+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"tropical-medicine-and-health","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"tmah","sideBox":"Learn more about [Tropical Medicine and Health](https://tropmedhealth.biomedcentral.com/)","snPcode":"41182","submissionUrl":"https://submission.springernature.com/new-submission/41182/3","title":"Tropical Medicine and Health","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6208cad9-6140-49f3-aa96-2e1eb5a84905","owner":[],"postedDate":"May 8th, 2026","published":true,"recentEditorialEvents":[{"type":"reviewerAgreed","content":"294098113742561896624703060497997680411","date":"2026-05-18T01:07:46+00:00","index":26,"fulltext":""},{"type":"reviewerAgreed","content":"199709200919336299073511404520875637180","date":"2026-05-16T14:09:02+00:00","index":25,"fulltext":""},{"type":"reviewerAgreed","content":"63227775700516560564572765185519195905","date":"2026-05-06T05:34:04+00:00","index":15,"fulltext":""},{"type":"reviewersInvited","content":"16","date":"2026-04-30T06:12:03+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-04-30T02:28:56+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-04-30T02:28:28+00:00","index":"","fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-08T13:57:50+00:00","versionOfRecord":[],"versionCreatedAt":"2026-05-08 13:57:50","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9530286","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9530286","identity":"rs-9530286","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}