Vinblastine Activates the AMPK–TFEB–ATG5 Autophagy Axis to Restrict Intracellular Salmonella Infection

Vinblastine Activates the AMPK–TFEB–ATG5 Autophagy Axis to Restrict Intracellular Salmonella Infection | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Vinblastine Activates the AMPK–TFEB–ATG5 Autophagy Axis to Restrict Intracellular Salmonella Infection Xinyue He, Heng Wang, Lifeng Zhou, Yao Tong, Zihang Gao, Yuming Liu, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9538087/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 8 You are reading this latest preprint version Abstract Background: The rise of multidrug-resistant intracellular pathogens, such as Salmonella , poses a significant global health threat due to their ability to evade conventional antibiotics within host cells. Host-directed therapeutic (HDT) strategies that leverage the autophagy–lysosome pathway to clear these pathogens offer a promising alternative, yet remain largely underexplored. This study aimed to identify potent HDT agents and elucidate their underlying molecular mechanisms. Results: Through a phenotypic screen using integrated lysosomal probes and gentamicin protection assays, we identified the FDA-approved drug vinblastine (VBL) as a potent HDT agent against Salmonella infection. Mechanistically, VBL triggers the phosphorylation of AMPK at Thr172, which relieves the mTOR-independent suppression of TFEB, thereby driving its nuclear translocation. Once in the nucleus, TFEB orchestrates a transcriptional program that upregulates autophagy–lysosome genes, specifically promoting ATG5-dependent autophagosome formation and enhancing lysosomal acidification. This coordinated response establishes a degradative environment that effectively eliminates intracellular bacteria. Genetic ablation of ATG5 or pharmacological inhibition of AMPK completely abolished the antibacterial efficacy of VBL, confirming the necessity of the AMPK–TFEB–ATG5 axis. In a murine model of Salmonella infection, VBL treatment dose-dependently reduced bacterial burden, restored cytokine homeostasis, and mitigated tissue pathology, correlating with autophagy activation in vivo. Conclusion: Our findings identify the activation of the AMPK–TFEB–ATG5 signaling axis as a critical host defense strategy. Furthermore, we nominate VBL as a promising host-directed therapeutic candidate for the treatment of drug-resistant intracellular infections through the repurposing of an existing clinical agent. Host-directed therapies Autophagy AMPK-TFEB-ATG5 axis Vinblastine Salmonella infection Figures Figure 1 Figure 2 Figure 4 Figure 5 Background Antimicrobial resistance (AMR) severely threatens global public health and the livestock/poultry industry, with the rapid evolution of multidrug-resistant (MDR) pathogens pushing humanity and agriculture toward a "post-antibiotic era" and creating an urgent need for novel therapeutics [1, 2]. This crisis is particularly acute for intracellular zoonotic pathogens like Salmonella enterica , which uses the SPI-2-encoded type III secretion system (T3SS-2) to remodel phagosomes into salmonella -containing vacuoles (SCVs), surviving and proliferating in macrophages/intestinal epithelial cells to evade immunity and antibiotics [3, 4]. Notably, Salmonella -induced host metabolic/signaling reprogramming, though increasing treatment difficulty, offers potential novel targets for host-directed therapy (HDT)—a strategy that clears intracellular pathogens by regulating innate immunity, avoids resistance, and fits livestock/poultry disease control needs [5, 6]. The autophagy-lysosome pathway, a core innate immune defense against intracellular pathogens, encapsulates and degrades pathogens via autophagosome-lysosome fusion, mediated by key regulators such as AMPK and TFEB, among others [7, 8]. However, prior human-centric studies have predominantly focused on the discrete functions of individual molecules—for instance, AMPK-driven autophagic activation in human primary macrophages and THP-1-derived macrophages, as well as TFEB-mediated modulation of lysosomal function in human intestinal epithelial cells [9, 10]. There remains a paucity of systematic insights into how these molecules synergize to orchestrate pathway activation for intracellular Salmonella clearance, a critical knowledge gap that hampers the rational development of precise host-directed therapy (HDT) targets [11, 12]. Natural small-molecule compounds are promising for HDT due to good biocompatibility, diverse targets, and low resistance induction. Different from the direct bactericidal mode of traditional antibiotics, natural small molecules mostly exert antibacterial effects by regulating host immune or metabolic pathways, among which autophagy regulation is one of the most core pathways—for example, phillyrin clears intracellular Brucella by activating autophagy, and allicin inhibits the proliferation of intracellular Escherichia coli by regulating lysosomal function [13, 14]. Although existing studies have confirmed the autophagy-regulating potential of natural small molecules, most studies only stay at the "phenomenon description" level, lacking analysis of the full-chain molecular mechanism of "autophagy initiation-regulation-execution". Moreover, specific natural small-molecule HDT candidates targeting livestock/poultry-derived intracellular Salmonella are still very scarce. Based on the aforementioned research background and knowledge gaps, this study hypothesizes that screening natural small molecules with autophagy-regulating activity may achieve efficient clearance of intracellular Salmonella by activating the synergistic effect of core molecules in the autophagy-lysosome pathway. To this end, the present study first identified vinblastine (VBL) as a potential candidate molecule through lysosomal probe screening and gentamicin protection assays, and further aims to evaluate the inhibitory effect and biosafety of VBL on Salmonella in different host cells, attempt to explore its key molecular targets and preliminary mechanisms in regulating the autophagy-lysosome pathway, and verify its in vivo therapeutic potential in a murine Salmonella infection model, ultimately providing new molecular targets and experimental basis for the development of novel host-directed therapeutic (HDT) drugs against salmonellosis in livestock and poultry. RESULT Vinblastine drives host-directed clearance of broad-spectrum intracellular bacteria Based on the critical role of lysosomal activation in anti-bacterial defense, we established an integrated phenotypic screening strategy employing lysosomal probes and gentamicin protection assays. Our screening approach established vinblastine (VBL), which simultaneously induces lysosomal acidification and suppresses the intracellular proliferation of Salmonella (Fig. 1A). To determine whether VBL acts prophylactically, we assessed its effect on bacterial invasion. We found that VBL did not suppress bacterial entry in a concentration-dependent manner, ruling out a prophylactic mechanism (Fig. 1B). We therefore focused on its therapeutic potential. As shown in Figure 1C-1E, VBL treatment dose-dependently reduced intracellular Salmonella loads in RAW 264.7, HeLa, and THP-1 cells (Fig. 1C–E), a finding corroborated by confocal microscopy (Fig. 1F). This antibacterial effect was sustained over 12 hours across all cell types (Fig. 1G–I). Prompted by its potency against Salmonella , we expanded our evaluation and found that VBL also exhibits broad-spectrum activity, significantly restricting the intracellular growth of Escherichia coli , Klebsiella pneumoniae , and Listeria monocytogenes (Fig. 1J–L). Together, these data establish VBL as a broad-spectrum, host-directed agent that activate cell-autonomous clearance of diverse intracellular pathogens. Vinblastine as a well-tolerated host-acting antibacterial drug To evaluate the translational potential of vinblastine (VBL), we systematically characterized its host cell biocompatibility. As shown in Figure 2A-2C, the potential toxicity of VBL was assessed in RAW 264.7 macrophages, HeLa epithelial cells, and THP-1 monocytes using the CCK-8 assay. Within the concentration range of 2-8 μg/mL, which is effective for intracellular antibacterial activity, VBL did not induce significant loss of viability in host cell lines, including macrophages and epithelial cells. The half-maximal cytotoxic concentration (CC₅₀) exceeded 120 μg/mL for all cell types (Fig. 2A-C), indicating a wide therapeutic window. Consistent with this, live/dead cell staining of RAW 264.7 macrophages treated with VBL revealed preserved membrane integrity and minimal cell death across the aforementioned concentration range (Fig. 2D), confirming its favorable biocompatibility. Subsequently, we further investigated the mechanism underlying its antibacterial activity. Growth curve analysis demonstrated that VBL at concentrations of 2-8 μg/mL did not inhibit the in vitro proliferation of Salmonella , Escherichia coli , Klebsiella pneumoniae or Listeria (Fig. 2E-H), ruling out a direct bactericidal mechanism. In striking contrast, in the RAW 264.7 macrophage infection model, treatment with varying concentrations of VBL significantly attenuated cell damage induced by infection with the four pathogenic bacteria, with the cytoprotective effect progressively enhancing as the VBL concentration increased (Fig. 2I-L). Collectively, the present study demonstrates that VBL is a host-directed antimicrobial agent with broad-spectrum intracellular antibacterial activity and excellent biocompatibility within its effective concentration range, while exerting a significant dose-dependent cytoprotective effect on RAW 264.7 macrophages. Vinblastine mediates Salmonella clearance through acidification-driven lysosomal trafficking. To elucidate how vinblastine (VBL) counteracts intracellular Salmonella , we first asked whether it modulates lysosomal function. As shown in Figure 3A-3C, VBL concentration‑dependently increased the fluorescence of both the acidification probe LysoSensor and the proteolytic activity reporter DQ‑BSA in RAW 264.7 macrophages, indicating concurrent elevation of lysosomal acidification and degradative capacity. Flow‑cytometric quantification of LysoTracker and LysoSensor staining further confirmed the increase in lysosomal activity (Fig. 3D and 3E). We next examined whether this enhanced lysosomal function directs bacteria into degradative compartments. Live‑cell confocal imaging of GFP‑tagged Salmonella and LysoTracker‑labeled lysosomes revealed that VBL treatment significantly increased bacteria–lysosome colocalization in a dose‑dependent manner (Fig. 3F and 3G), demonstrating that VBL overcomes bacterial evasion and promotes lysosomal trafficking. To establish a causal link between acidification and bacterial killing, we inhibited lysosomal acidification using bafilomycin A1 (BafA1) or ammonium chloride (NH 4 Cl). Both agents largely abolished VBL’s antibacterial activity in intracellular replication assays (Fig. 3H and 3I). confirming that the antibacterial activity mediated by VBL was critically dependent on an acidic lysosomal pH environment. Consistent with this, confocal imaging revealed a significant reduction in the fluorescence intensity of Sensor and DQ-BSA in inhibitor-treated cells (Figures 3J-M), indicating that BafA1 or NH₄Cl treatment can effectively block lysosomal acidification and proteolysis. In summary, these results indicate that vinblastine rewires the autophagy‑lysosome pathway by activating lysosomal acidification, which in turn drives targeted delivery of Salmonella to degradative organelles and restricts bacterial survival. Vinblastine activates the AMPK–TFEB axis to drive autophagy-lysosome–mediated clearance of salmonella Based on the impaired bacterial clearance upon autophagy inhibition, we systematically evaluated whether vinblastine stimulates autophagic flux. Immunoblot analysis of RAW264.7 cells revealed that vinblastine treatment significantly increased the LC3-II/LC3-I ratio and concurrently decreased SQSTM1 protein levels, indicative of enhanced autophagosome formation and cargo degradation (Fig. 4A). To clarify whether this effect stems from increased autophagic activity rather than late-stage autophagic flux blockade, we further performed BafA1-mediated autophagic flux blockade assays. The results showed that co-treatment with BafA1 completely abrogated the vinblastine-induced LC3-II accumulation and p62 degradation, confirming that VBL promotes complete autophagic flux rather than blocking lysosomal degradation. Next, we analyzed the transcriptional dynamics of the autophagy-lysosome pathway. Real-time qPCR results following BafA1 treatment revealed a multiphasic expression pattern: an early compensatory upregulation of Ampk, Mtor, Tfeb , and Sqstm1 at 1 h; a significant downregulation of Ampk, Tfeb , and Ctsb at 3 h; and a late resurgence of Ampk, Tfeb, Mtor, Ctsb, and Ctsd at 5 h (Figure 4B). These expression characteristics—particularly the sustained activation of TFEB alongside the fluctuating expression of AMPK—implied a potential coordination of autophagic and lysosomal gene expression through the AMPK-TFEB axis. Consistent with the above assumption, immunoblotting showed that vinblastine enhanced AMPK phosphorylation in a dose-dependent manner, while the p-mTOR/mTOR ratio remained unchanged (Figures 4C-G), indicating that vinblastine selectively activates the AMPK signaling pathway independent of mTOR regulation. To functionally validate the contribution of AMPK, we used the pharmacological inhibitor Compound C. Dose-response experiments identified 10 μM as a non-cytotoxic concentration that effectively reversed vinblastine’s antibacterial activity (Figures 4H-I). Notably, 10 μM Compound C significantly blocked the inhibition of intracellular Salmonella proliferation by vinblastine across all tested doses (Figure 4J), establishing AMPK activation as essential for the anti- Salmonella effect of vinblastine. Confocal microscopy further showed that Compound C co-treatment markedly reduced both Sensor and DQ-BSA fluorescence intensities (Figures 4K-N), indicating that AMPK activity is a necessary prerequisite for vinblastine-induced lysosomal acidification and proteolytic activation. In summary, these data revealed a signaling pathway which vinblastine triggers AMPK-dependent autophagic flux and lysosomal acidification, ultimately leading to the targeted clearance of intracellular Salmonella . Vinblastine eliminates intracellular salmonella via an AMPK–TFEB–ATG5 autophagic pathway The aforementioned findings demonstrated a coordinated upregulation of AMPK and TFEB, two master regulators of cellular autophagy pathways. To systematically dissect the functional crosstalk between these molecules and their downstream regulatory cascades, we employed the specific AMPK inhibitor Compound C in a series of experiments, initiating with qRT-PCR analysis to profile the expression dynamics of lysosomal and autophagic genes (encompassing key players such as ctsd, ctsb, sqstm1, tfeb, atp6v1e1, and tmem9 ). Notably, Compound C treatment led to a marked upregulation in the expression of Lamp1 , a well-characterized lysosomal membrane marker (Fig. 5A). Concomitantly, immunoblotting assays further validated that pharmacological abrogation of AMPK significantly attenuated vinblastine-induced TFEB expression (Fig. 5B), a result that firmly establishes AMPK activation as a pivotal upstream trigger for TFEB induction. We next examined TFEB subcellular localization. Confocal imaging revealed that vinblastine promoted TFEB nuclear accumulation in a concentration‑dependent manner (Fig. 5C). This translocation was abolished by Compound C co‑treatment (Fig. 5D), demonstrating that AMPK activity is required for TFEB nuclear entry and subsequent transcriptional activation. Since TFEB is well established as a central transcriptional regulator of lysosomal biogenesis and autophagic pathways, we hypothesized that vinblastine exerts its antibacterial effects by targeting core autophagic machinery to mediate intracellular Salmonella clearance. To test this hypothesis, we focused on ATG5, a critical effector molecule indispensable for autophagosome biogenesis. Genetic ablation of Atg5 profoundly impaired the ability of vinblastine to restrict intracellular Salmonella proliferation (Figure 5F), confirming that a functional autophagic pathway is obligatory for vinblastine’s anti- Salmonella efficacy. Importantly, confocal microscopy analyses demonstrated that Atg5 deficiency did not compromise vinblastine-induced enhancements in Sensor and DQ-BSA fluorescence intensities (Figures 5I-J), indicating that lysosomal acidification and proteolytic capacity remained intact. Collectively, our data delineate a comprehensive molecular circuitry wherein vinblastine-induced AMPK activation drives TFEB nuclear translocation, thereby potentiating lysosomal function and biogenesis. The AMPK-TFEB axis subsequently engages ATG5-dependent autophagosome formation, orchestrating an integrated cellular defense program that executes the precise clearance of intracellular Salmonella . Vinblastine ameliorates colitis damage in Salmonella -infected mice Using an established murine model of Salmonella Typhimurium infection (Figure 6A), we comprehensively evaluated the therapeutic efficacy of vinblastine (VBL). Administration of VBL at low, medium, and high doses resulted in dose-dependent restoration of body weight and normalization of feeding and drinking behaviors compared to infected controls (Figures 6B-C). Quantitative analysis of bacterial loads in harvested tissues demonstrated a progressive reduction in Salmonella burden in the liver (Figure 6D), spleen (Figure 6E), cecum (Figure 6G), colon (Figure 6F), and fecal samples (Figure 6H) with increasing VBL concentrations. Concomitantly, cytokine profiling revealed potent immunomodulatory properties of VBL which it marked suppression of pro-inflammatory mediators IL-6 (Figure 6I) and TNF-α (Figure 6K), coupled with a concentration-dependent increase in anti-inflammatory IL-10 (Figure 6J), indicating reestablishment of inflammatory homeostasis. Histopathological examination of H&E-stained sections demonstrated that VBL treatment significantly attenuated infection-induced tissue damage, with the liver (Figure 6L) exhibiting reduced inflammatory infiltration and the spleen (Figure 6M) maintaining architectural integrity. To elucidate the mechanistic basis underlying these effects, we analyzed autophagy markers in hepatic and splenic tissues from healthy controls and VBL-treated (3 mg/kg) mice. Immunofluorescence analysis revealed coordinated activation of the autophagic pathway, characterized by enhanced LC3B puncta formation accompanied by reduced SQSTM1/p62 accumulation in both liver (Figure 6N) and spleen (Figure 6O) tissues. Collectively, these findings elucidate a multimodal mechanism through which vinblastine orchestrates concomitant bacterial clearance, inflammation resolution, and autophagy activation, ultimately restoring tissue homeostasis during Salmonella infection. DISCUSSION The global burden of Salmonella enterica causes severe economic losses in livestock and poultry production and represents a leading cause of foodborne illness in humans through contaminated animal products [15, 16]. A cornerstone of its pathogenicity is its ability to parasitize host cells, evading immune clearance by inhibiting phagosome-lysosome fusion and subverting host signaling pathways. This intracellular niche also shelters the bacterium from many conventional antibiotics, contributing to persistent infections and the accelerating spread of multidrug-resistant (MDR) strains [17]. This is also the key reason why traditional antibiotics are difficult to penetrate intracellular barriers, leading to recurrent infections and exacerbated antimicrobial resistance [18]. In this context, host-directed therapy (HDT)—which aims to bolster the host's intrinsic defence mechanisms—has emerged as a promising strategy to circumvent pathogen resistance. The autophagy-lysosome pathway is a central effector of cell-autonomous immunity against intracellular bacteria like Salmonella [19]. As the "terminal effector" of this pathway, lysosomes achieve pathogen degradation through an acidic microenvironment and contained cathepsins (e.g., CTSB, CTSD). Transcription Factor EB (TFEB), a master regulator of lysosomal biogenesis and autophagy-related gene expression, can initiate the transcription of key genes such as LAMP1 and V-ATPase subunits through nuclear translocation, significantly enhancing lysosomal function [20, 21]. While previous studies utilizing human cell models have independently established that AMPK activation in human primary macrophages and THP-1 monocytes contributes to host defense against Salmonella infection [22-24]. TFEB nuclear translocation in human colonic epithelial cells and HeLa cells [25, 26]. ATG5-dependent autophagy in human HepG2 hepatocellular carcinoma cells and Caco-2 intestinal epithelial cells all contribute to host defense against Salmonella infection [19, 27]. The mechanistic crosstalk integrating these components into a functional, cohesive host defense circuitry remains incompletely defined [23, 24]. Our data establish that VBL-induced clearance operates via a signaling cascade with distinct functional tiers. Phosphorylation and activation of AMPK—occurring independently of mTOR—serves as the initiating trigger. Activated AMPK drives TFEB nuclear translocation, which in turn transcriptionally potentiates lysosomal acidification and proteolytic capacity. Notably, this lysosomal enhancement remains intact in ATG5-deficient cells, indicating that TFEB-mediated lysosomal remodeling and ATG5-dependent autophagosome formation are parallel, complementary arms of the pathway. Both are, however, essential for bacterial clearance, as genetic ablation of ATG5 abolishes VBL’s antibacterial effect without impairing lysosomal function. This architecture reveals a “two-track” mechanism that AMPK-TFEB licenses the lysosomal degradative capacity, while the ATG5 ensures targeted delivery of bacteria to these activated organelles. This model significantly advances the prevailing view of autophagy–lysosome coordination and provides a mechanistic basis for the synergistic efficacy observed. The translational relevance of this pathway is underscored by our in vivo findings. In a murine salmonellosis model, VBL treatment not only reduced bacterial burden in systemic organs but also rebalanced inflammatory cytokines and mitigated tissue damage—effects correlated with activation of autophagy markers in affected tissues. This multi-faceted protection highlights the therapeutic potential of engaging an upstream host regulator like AMPK, which can simultaneously amplify intrinsic clearance pathways and modulate detrimental inflammation. In conclusion, we have identified and validated the AMPK–TFEB–ATG5 axis as a druggable host defence pathway that coordinates lysosomal activation with autophagic capture to eliminate intracellular Salmonella . The study not just preliminarily revealed the cascade transduction characteristics of this pathway in the current model, supplementing experimental evidence for the mechanism of autophagy-related molecules synergistically resisting Salmonella infection, provided basic theoretical reference and experimental support for the subsequent research on vinblastine as a potential HDT for salmonellosis. MATERIALS AND METHODS Mammalian Cell Culture RAW264.7 macrophages and HeLa cells were maintained in high-glucose Dulbecco's Modified Eagle Medium (DMEM; Cytiva), while THP-1 monocytes were cultured in Roswell Park Memorial Institute 1640 medium (RPMI-1640; Cytiva). All media were supplemented with 10% fetal bovine serum (CellBox) and 1% penicillin-streptomycin solution (Cytiva), and cells were incubated under standard conditions (37°C, 5% CO₂). Twenty-four hours prior to infection, cells were seeded at optimized densities: 2×10⁴ cells/well in 96-well plates, 2×10⁵ cells/well in 24-well plates, and 8×10⁵ cells/well in 6-well plates. Bacterial Strains The strains used in this study included S. Typhimurium strain SL1344, Listeria monocytogenes ATCC 19115, Klebsiella pneumoniae ATCC 43816 and Escherichia coli O157, all of which were routinely preserved at low temperature in our laboratory. All strains were cultured using Lysogeny Broth (LB) medium as the base. Specifically, SL1344 was cultured in LB medium supplemented with 100 μg/mL streptomycin to maintain strain characteristics as required for the experiment, while Listeria monocytogenes , Escherichia coli and Klebsiella pneumoniae were routinely cultured in LB medium without antibiotics. Cytotoxicity assay Cell viability was analyzed using the Cell Counting Kit-8 (C0038, Beyotime, China) according to the manufacturer's protocol. Briefly, RAW264.7, THP-1, and HeLa cells were plated in 96-well plates at a density of 1×10⁴ cells per well in 200 μL complete medium and cultured for 24 h under standard conditions (37°C, 5% CO₂). Cells were then treated with serially diluted vinblastine (0 – 512 μg/mL) in DMEM or RPMI-1640 medium for 8 h under light-protected conditions. After adding 20 μL CCK-8 reagent to each well and incubating for 30 min, absorbance was measured at 450 nm using a Bio-Rad microplate reader, with cell-free wells serving as blanks. Cell viability was expressed as absorbance values [28]. Bacterial Growth Kinetics Assay S. Typhimurium, Escherichia coli, Klebsiella pneumoniae and Listeria monocytogenes were inoculated in Lysogeny Broth and cultured overnight at 37°C with shaking at 200 rpm. When the bacterial suspensions reached mid-logarithmic phase (OD₆₀₀ = 0.5), they were supplemented with vinblastine at final concentrations of 0, 2, 4, and 8 μg/mL. The cultures were maintained under continuous shaking incubation at 37°C, and bacterial growth kinetics were monitored in real-time using a microplate reader. Live/Dead Cell Staining Assay RAW264.7 cells were seeded in 24-well plates at a density of 2×10⁵ cells per well and allowed to adhere overnight under standard culture conditions. The cells were then treated with a gradient concentration of vinblastine (0–8 μg/mL) for 6 hours at 37°C. Following treatment, live/dead staining was performed using a commercial double-staining kit (CA1630, Solarbio) strictly following the manufacturer's protocol. Fluorescence images were acquired using an Olympus fluorescence microscope (Germany) [29]. Lactate Dehydrogenase Release Assay RAW264.7 cells were seeded in 96-well plates and cultured until reaching 80–90% confluence. Cells were then infected separately with Salmonella, Escherichia coli, Klebsiella pneumoniae or Listeria monocytogenes at an MOI of 25 for 1 h [30]. Following infection, the medium was replaced with fresh medium containing graded concentrations of vinblastine (0–8 μg/mL) for an additional 4 h. The plates were centrifuged at 400 × g for 5 min, and 120 μL of supernatant from each well was carefully transferred to a new 96-well plate. Subsequent processing and measurement were performed in strict accordance with the manufacturer's instructions of the LDH Cytotoxicity Assay Kit (C0016, Beyotime). Bacterial Invasion Assay RAW264.7, Hela and THP-1 cells were infected with SL1344 at an MOI 25 for 1 h, followed by gentamicin protection (100 μg/mL, 30 min). The medium was then replaced with DMEM containing 10 μg/mL gentamicin and 8 μg/mL vinblastine. After 4 h incubation (37°C, 5% CO2), cells were lysed with 0.2% Triton X-100 for viable bacterial enumeration. Intracellular Bacterial Proliferation Kinetics Curve RAW 264.7, HeLa, and THP-1 cells were prepared and infected with SL1344 (MOI = 25) following the standardized invasion assay protocol [31]. After 1 h of bacterial invasion and gentamicin protection treatment (100 μg/mL, 30 min), the medium was replaced with maintenance medium containing graded concentrations of vinblastine (0–8 μg/mL) and 10 μg/mL gentamicin. Cells were continuously cultured under physiological conditions (37°C, 5% CO₂) for 24 h. At the indicated time points (0, 2, 4, 6, 8, 12, 16, 20, and 24 h), the culture medium was aspirated and cells were gently washed once with PBS, followed by lysis in 0.2% Triton X-100. The resulting lysates were serially diluted, plated on LB agar, and incubated at 37°C for 16 h for colony-forming unit (CFU) enumeration. Quantitative real-time PCR RAW264.7 cells were seeded in 6-well plates at a density of 8×10⁵ cells/well. After 12 hours of incubation, cells were pretreated with vinblastine and bafilomycin A1 for 1h, 3h, and 5h prior to RNA extraction. Total RNA was isolated using TRIzol reagent (Tiangen, Beijing), followed by DNase I treatment. cDNA was synthesized from 1μg RNA using HiScript® II Reverse Transcriptase (Vazyme, Nanjing). Quantitative real-time PCR was performed on an ABI 7900 HT Real-Time PCR System with qPCR SYBR Green Premix (Vazyme, Nanjing) under the following thermal cycling conditions: initial denaturation at 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec, 60°C for 30 sec, and 72°C for 30 sec. Gene expression levels were calculated using the 2-ΔΔCT method with 16S RNA as the endogenous control. The quantification cycle (Cq) cutoff was set at 35 cycles. All procedures were strictly performed according to the manufacturer's protocols. Primer name Oligonucleotide primer sequence (5’–3’) Gapdh F: GGCCTTCCGTGTTCCTACC R: CGGCATCGAAGGTGGAAGAG Ampk F: GCTGCTGAAGAAGCTGAAGG R: GGTGATGGTGTCGATGATGG Mtor F: CAGACAGTGCTGGACATCCT R: TCCTTGGTGATGTCCTTGGT Tfeb F: AGCAGCACCTACACCTACGG R: GCTGCTGTTGTTGCTGTTGT Ctsb F: ATGGCCTACCTGCTGTTCTT R: TTGCTGTTGCTGTTGCTGTT Ctsd F: GAGACAGTGCTGGACATCCT R: TCCTTGGTGATGTCCTTGGT Atp6v0c F: GCTGCTGAAGAAGCTGAAGG R: GGTGATGGTGTCGATGATGG Bcl2 F: CAGACAGTGCTGGACATCCT R: TCCTTGGTGATGTCCTTGGT Calcoco2 F: AGCAGCACCTACACCTACGG R: GCTGCTGTTGTTGCTGTTGT Lc3 F: ATGGCCTACCTGCTGTTCTT R: TTGCTGTTGCTGTTGCTGTT Atp6v0d2 F: GAGACAGTGCTGGACATCCT R: TCCTTGGTGATGTCCTTGGT Sqstm1 F: GCTGCTGAAGAAGCTGAAGG R: GGTGATGGTGTCGATGATGG Lamp1 F: CAGACAGTGCTGGACATCCT R: TCCTTGGTGATGTCCTTGGT Mcoln1 F: AGCAGCACCTACACCTACGG R: GCTGCTGTTGTTGCTGTTGT Atp6v1e1 F: ATGGCCTACCTGCTGTTCTT R: TTGCTGTTGCTGTTGCTGTT Atp6v0da4 F: GAGACAGTGCTGGACATCCT R: TCCTTGGTGATGTCCTTGGT Tmem9 F: GCTGCTGAAGAAGCTGAAGG R: GGTGATGGTGTCGATGATGG Atp6v1h F: CAGACAGTGCTGGACATCCT R: TCCTTGGTGATGTCCTTGGT Assessment of Lysosomal Function Pre-seeded cells were co-cultured with graded concentrations of vinblastine (0-8 μg/mL) for 4 hours, followed by simultaneous staining with the lysosomal probe LysoSensor™ Sensor and DQ™ Red BSA at 37°C for 30 minutes. After PBS washing, Hoechst staining was performed for 15 minutes followed by image acquisition [32]. Flow cytometry analysis RAW264.7 macrophages cultured overnight were incubated with 1 mL serum-free DMEM containing 2-8 μg/mL vinblastine or serum-free DMEM alone for 4 h at 37℃ with 5% CO₂. After treatment, the drug-containing medium was discarded, and cells were gently rinsed twice with pre-warmed (37℃) PBS. LysoTracker and LysoSensor were diluted to 50 nM and 2 μM, respectively, in serum-free DMEM. Then, 300 μL of the mixture was added per well and incubated for 30 min at 37 °C with 5% CO₂ in the dark. Unbound probes were removed by thorough washing with pre-warmed PBS three times. Cells were resuspended in PBS, transferred to 1.5 mL tubes, and centrifuged at 1000 × g for 5 min. The pellet was resuspended in 300 μL PBS, and fluorescence was detected by flow cytometry (CytExpert, Beckman Coulter, USA) using the PE channel and FITC channel, with 100,000 ungated events collected per sample. Data were quantitatively analyzed using Flow jo software [31, 33]. Analysis of GFP-Labeled Bacterial Internalization RAW264.7 cells seeded for 24 hours were infected with GFP-tagged SL1344 strains using a standard procedure. After 1 hour of infection, the medium was replaced with medium containing graded concentrations of vinblastine and cultured for an additional 4 hours. Nuclear staining and image acquisition were then performed according to the general method. All fluorescence imaging experiments were completed using a laser scanning confocal microscope (Olympus F1000, Tokyo, Japan). At least 6 fields of view were randomly selected for each experimental group, and fluorescence intensity was quantified using ImageJ software. Data were further analyzed statistically using GraphPad Prism 9. Bacteria–Lysosome Colocalization Analysis Following GFP-SL1344 infection as described above, cells were treated with graded concentrations of vinblastine for 4 hours, followed by staining with LysoTracker Red for 30 minutes. After nuclear staining as described above, colocalization between LysoTracker Red and GFP-1344 was observed under a confocal microscope, and quantitative colocalization analysis was performed using the Coloc 2 module (Pearson correlation coefficient). Western Blot Analysis Total proteins were extracted from treated cells using RIPA buffer (Beyotime, Shanghai, China) supplemented with 1 mmol/L PMSF, and quantified with a BCA protein assay kit (Beyotime, Shanghai, China). Protein samples were separated by SDS-PAGE and transferred onto methanol-activated PVDF membranes via semi-dry transfer. After blocking with 5% skim milk in TBST for 2 hours, the membranes were incubated with primary antibodies at 4°C overnight. Following three 10-minute washes with TBST, the membranes were incubated with corresponding secondary antibodies at room temperature for 2 hours. Protein bands were visualized using an enhanced chemiluminescence (ECL) kit (Advansta) according to the manufacturer's protocol. Band intensities were quantified using ImageJ software (Version 1.46; National Institutes of Health (NIH), Bethesda, USA). Antibodies Source Catalog Number LC3B Abmart T55992S SQSTM1 Zenbio Q13501 mTOR Proteintech 66888-1-Ig Phospho-mTOR (Ser2448) Proteintech 67778-1-Ig AMPK Proteintech 10929-2-AP Phospho-AMPK (Thr172) Proteintech 80209-6-RR TFEB Zenbio R27339 GADPH Proteintech 60004-1-Ig HRP-conjugated Goat Anti-Rabbit IgG Proteintech SA00001-2 Goat Anti-Rabbit lgG AF 594 Abmart M21014 HRP-conjugated Goat Anti-Mouse IgG Proteintech SA00001-1 Isolation of Peritoneal Macrophages from Atg5 Knockout Mice Six-to-eight-week-old C57 mice were genotype-identified by tail-tip genomic DNA PCR to confirm Atg5 knockout. Mice were then intraperitoneally injected with 3 mL of 3% Tryptose Phosphate Broth (TPB) to recruit peritoneal macrophages, and euthanized by cervical dislocation 3 days post-injection. Immediately after euthanasia, mice were immersed in 75% ethanol for 30 s for surface disinfection, blotted dry with sterile filter paper, and transferred to a biosafety cabinet. Peritoneal lavage fluid was collected by flushing the abdominal cavity three times with 10% fetal bovine serum (FBS)-supplemented RPMI 1640 medium using a sterile 5 mL syringe. The collected lavage fluid was centrifuged at 1600 r/min for 5 min at room temperature. After discarding the supernatant, eBioscience red blood cell lysis buffer (Thermo Fisher Scientific) was added and incubated at room temperature for 5 min to eliminate red blood cells [34, 35]. The lysis reaction was terminated by adding an equal volume of complete medium, followed by a second centrifugation. The cell pellet was resuspended in complete RPMI 1640 medium containing 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin for subsequent plating. Animal experiment This study utilized 6-8-week-old specific pathogen-free (SPF) Balb/c mice purchased from Changsheng Biotechnology Co, Ltd. All experimental procedures were approved by the Institutional Animal Care and Use Committee of Jilin University (SY202510007) and strictly adhered to animal ethics guidelines. Mice were randomly divided into five groups (n=6): healthy control (PBS), infection control (WT), low-dose vinblastine (1 mg/kg), medium-dose vinblastine (2 mg/kg), and high-dose vinblastine (3 mg/kg). After a 3-day pretreatment with 5 g/L streptomycin in drinking water, all groups except the healthy control were orally inoculated with 5×10⁷ CFU SL1344 to establish the infection model. Treatment commenced at 4 hours post-infection, with respective groups receiving vinblastine suspensions (in 0.5% carboxymethyl cellulose) via oral gavage, while healthy and infection control groups received equal volumes of vehicle, administered once daily for 5 consecutive days (100 μL per mouse). Body weight, food intake, and water consumption were monitored throughout the experimental period. Terminal samples included the collection of liver, spleen, and intestinal tissues for organ indices calculation, bacterial load analysis, inflammatory cytokine quantification (IL-6, IL-10, TNF-α), and histopathological examination by hematoxylin and eosin staining [36]. Data analysis All the experiments were performed in triplicate with the data expressed as the mean ± SD. Data analysis was conducted with GraphPad Prism (version 8.3.0). The log-rank test was used for the statistical significance analysis of survival rates and two-tailed Student’s-test was used for other assays. *, P < 0.05; **, P < 0.01. Declarations Acknowledgments This work was supported by the National Natural Science Foundation of China (grant 32560874，U23A20242), and the Natural Science Foundation of Ningxia Hui Autonomous Region Project (2025AAC050040). Author contributions Designed the research: YLZ and HW; Performed the experiments: YLZ, HRL, JFW, XYH, XMD; Date analyzed and Date curation: HW, XYH and LFZ; Visualization: XYH, YT, YML, ZHG; YLZ and XYH wrote the manuscript with input from all the authors. Conflict of interest The authors declare that they have no conflict of interest. Data availability All data are available from the corresponding author on reasonable request. Ethical approval All experimental procedures were approved by the Institutional Animal Care and Use Committee of Jilin University (SY202510007) and strictly adhered to animal ethics guidelines. References Macesic, N., A.C. Uhlemann, and A.Y. Peleg, Multidrug-resistant Gram-negative bacterial infections. Lancet, 2025. 405 (10474): p. 257-272. Makabenta, J.M.V., et al., Antimicrobial-loaded biodegradable nanoemulsions for efficient clearance of intracellular pathogens in bacterial peritonitis. Biomaterials, 2023. 302 : p. 122344. Jennings, E., T.L.M. Thurston, and D.W. Holden, Salmonella SPI-2 Type III Secretion System Effectors: Molecular Mechanisms And Physiological Consequences. Cell Host Microbe, 2017. 22 (2): p. 217-231. Valenzuela, C., et al., SopB- and SifA-dependent shaping of the Salmonella-containing vacuole proteome in the social amoeba Dictyostelium discoideum. Cell Microbiol, 2021. 23 (1): p. e13263. Settembre, C., et al., TFEB links autophagy to lysosomal biogenesis. Science, 2011. 332 (6036): p. 1429-33. Aggarwal, R., et al., Antibiotic resistance: a global crisis, problems and solutions. Crit Rev Microbiol, 2024. 50 (5): p. 896-921. Wileman, T., Autophagy as a defence against intracellular pathogens. Essays Biochem, 2013. 55 : p. 153-63. Wu, S., et al., Salmonella Interacts With Autophagy to Offense or Defense. Front Microbiol, 2020. 11 : p. 721. Wu, Y., et al., Lactobacillus plantarum postbiotics trigger AMPK-dependent autophagy to suppress Salmonella intracellular infection and NLRP3 inflammasome activation. J Cell Physiol, 2023. 238 (6): p. 1336-1353. Nader, W.O., et al., TFEB overexpression alleviates autophagy-lysosomal deficits caused by progranulin insufficiency. Sci Rep, 2025. 15 (1): p. 26217. Ba, L., et al., Allicin attenuates pathological cardiac hypertrophy by inhibiting autophagy via activation of PI3K/Akt/mTOR and MAPK/ERK/mTOR signaling pathways. Phytomedicine, 2019. 58 : p. 152765. Sadhu, S., et al., Gefitinib Results in Robust Host-Directed Immunity Against Salmonella Infection Through Proteo-Metabolomic Reprogramming. Front Immunol, 2021. 12 : p. 648710. Chang, Z., et al., Allicin suppressed Escherichia coli-induced urinary tract infections by a novel MALT1/NF-κB pathway. Food Funct, 2022. 13 (6): p. 3495-3511. Qin, Y., et al., Brucella mediates autophagy, inflammation, and apoptosis to escape host killing. Front Cell Infect Microbiol, 2024. 14 : p. 1408407. Van, T.T., et al., The antibiotic resistance characteristics of non-typhoidal Salmonella enterica isolated from food-producing animals, retail meat and humans in South East Asia. Int J Food Microbiol, 2012. 154 (3): p. 98-106. Tang, B., et al., Genome-based risk assessment for foodborne Salmonella enterica from food animals in China: A One Health perspective. Int J Food Microbiol, 2023. 390 : p. 110120. Ajulo, S. and B. Awosile, Global antimicrobial resistance and use surveillance system (GLASS 2022): Investigating the relationship between antimicrobial resistance and antimicrobial consumption data across the participating countries. PLoS One, 2024. 19 (2): p. e0297921. Borah, P., et al., Prevalence, antimicrobial resistance and virulence genes of Salmonella serovars isolated from humans and animals. Vet Res Commun, 2022. 46 (3): p. 799-810. Nagy, T.A., et al., Autophagy Induction by a Small Molecule Inhibits Salmonella Survival in Macrophages and Mice. Antimicrob Agents Chemother, 2019. 63 (12). Wang, B., et al., TFEB-vacuolar ATPase signaling regulates lysosomal function and microglial activation in tauopathy. Nat Neurosci, 2024. 27 (1): p. 48-62. Nakashima, A., et al., Evidence for lysosomal biogenesis proteome defect and impaired autophagy in preeclampsia. Autophagy, 2020. 16 (10): p. 1771-1785. Zhao, X., et al., Biochanin a Enhances the Defense Against Salmonella enterica Infection Through AMPK/ULK1/mTOR-Mediated Autophagy and Extracellular Traps and Reversing SPI-1-Dependent Macrophage (MΦ) M2 Polarization. Front Cell Infect Microbiol, 2018. 8 : p. 318. Losier, T.T. and R.C. Russell, Bacterial outer membrane vesicles trigger pre-activation of a xenophagic response via AMPK. Autophagy, 2019. 15 (8): p. 1489-1491. Losier, T.T., et al., AMPK Promotes Xenophagy through Priming of Autophagic Kinases upon Detection of Bacterial Outer Membrane Vesicles. Cell Rep, 2019. 26 (8): p. 2150-2165.e5. Gray, M.A., et al., Phagocytosis Enhances Lysosomal and Bactericidal Properties by Activating the Transcription Factor TFEB. Curr Biol, 2016. 26 (15): p. 1955-1964. Rao, S., et al., Colonic epithelial cell-specific TFEB activation: a key mechanism promoting anti-bacterial defense in response to Salmonella infection. Front Microbiol, 2024. 15 : p. 1369471. Cabral-Fernandes, L., et al., Invading Bacterial Pathogens Activate Transcription Factor EB in Epithelial Cells through the Amino Acid Starvation Pathway of mTORC1 Inhibition. Mol Cell Biol, 2022. 42 (9): p. e0024122. Zhuang, X.D., et al., Exogenous hydrogen sulfide alleviates high glucose-induced cardiotoxicity via inhibition of leptin signaling in H9c2 cells. Mol Cell Biochem, 2014. 391 (1-2): p. 147-55. Zhou, Y., et al., Application of Oleanolic Acid and Its Analogues in Combating Pathogenic Bacteria In Vitro/Vivo by a Two-Pronged Strategy of β-Lactamases and Hemolysins. ACS Omega, 2020. 5 (20): p. 11424-11438. Jiang, C., et al., Sesamol hinders the proliferation of intracellular bacteria by promoting fatty acid metabolism and decreasing excessive inflammation. Int Immunopharmacol, 2025. 146 : p. 113966. Wang, T., et al., Synergistic Lysosomal Impairment and ER Stress Activation for Boosted Autophagy Dysfunction Based on Te Double-Headed Nano-Bullets. Small, 2022. 18 (27): p. e2201585. Lu, D., et al., Imidazole-Bearing Polymeric Micelles for Enhanced Cellular Uptake, Rapid Endosomal Escape, and On-demand Cargo Release. AAPS PharmSciTech, 2018. 19 (6): p. 2610-2619. Martin, J.K., 2nd, et al., A Dual-Mechanism Antibiotic Kills Gram-Negative Bacteria and Avoids Drug Resistance. Cell, 2020. 181 (7): p. 1518-1532.e14. Layoun, A., M. Samba, and M.M. Santos, Isolation of murine peritoneal macrophages to carry out gene expression analysis upon Toll-like receptors stimulation. J Vis Exp, 2015(98): p. e52749. Liu, Y., et al., The immunoenhancement effects of starfish Asterias rollestoni polysaccharides in macrophages and cyclophosphamide-induced immunosuppression mouse models. Food Funct, 2020. 11 (12): p. 10700-10708. Böhme, J., et al., Metformin enhances anti-mycobacterial responses by educating CD8+ T-cell immunometabolic circuits. Nat Commun, 2020. 11 (1): p. 5225. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 15 May, 2026 Reviewers agreed at journal 13 May, 2026 Reviewers agreed at journal 11 May, 2026 Reviewers agreed at journal 08 May, 2026 Reviewers invited by journal 06 May, 2026 Editor assigned by journal 27 Apr, 2026 Submission checks completed at journal 27 Apr, 2026 First submitted to journal 27 Apr, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9538087","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":639864659,"identity":"2379ffb0-f9eb-4628-bd4a-e1a5e7ee101d","order_by":0,"name":"Xinyue He","email":"","orcid":"","institution":"Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Xinyue","middleName":"","lastName":"He","suffix":""},{"id":639864660,"identity":"e8398847-d21a-46ba-8f0e-7cc9de48a428","order_by":1,"name":"Heng Wang","email":"","orcid":"","institution":"Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Heng","middleName":"","lastName":"Wang","suffix":""},{"id":639864661,"identity":"391c6ab2-d0fb-45d8-a2bb-92e545cac555","order_by":2,"name":"Lifeng Zhou","email":"","orcid":"","institution":"Ningxia University","correspondingAuthor":false,"prefix":"","firstName":"Lifeng","middleName":"","lastName":"Zhou","suffix":""},{"id":639864662,"identity":"99b7f509-997a-46f6-86ec-bd46e90a5989","order_by":3,"name":"Yao Tong","email":"","orcid":"","institution":"Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Yao","middleName":"","lastName":"Tong","suffix":""},{"id":639864663,"identity":"87eb2c0e-ef6d-4046-8bb3-cce815425efe","order_by":4,"name":"Zihang Gao","email":"","orcid":"","institution":"Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Zihang","middleName":"","lastName":"Gao","suffix":""},{"id":639864664,"identity":"02c86b77-c4fb-4898-b14f-66eb869408bd","order_by":5,"name":"Yuming Liu","email":"","orcid":"","institution":"Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Yuming","middleName":"","lastName":"Liu","suffix":""},{"id":639864665,"identity":"9a62baf2-91fe-4ec8-9755-94dbbe3ff283","order_by":6,"name":"Jianfeng Wang","email":"","orcid":"","institution":"Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Jianfeng","middleName":"","lastName":"Wang","suffix":""},{"id":639864666,"identity":"c719b853-57ee-4117-b8ce-dbb33c72f85a","order_by":7,"name":"Xuming Deng","email":"","orcid":"","institution":"Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Xuming","middleName":"","lastName":"Deng","suffix":""},{"id":639864667,"identity":"b36a5335-72ae-4b6c-a045-42deec8e988b","order_by":8,"name":"Houru Liu","email":"","orcid":"","institution":"Linyi University","correspondingAuthor":false,"prefix":"","firstName":"Houru","middleName":"","lastName":"Liu","suffix":""},{"id":639864668,"identity":"83639d00-f730-4336-b31a-a9cae123548e","order_by":9,"name":"Yonglin Zhou","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBUlEQVRIiWNgGAWjYDACCSjNx8zA/PDDDxsIj4cYLWzMDGzGkj1ppGgBsXnYDhPWIj+7+Zg0T8UduzZ23gMGEjzn8wxuJDA+eNvGIG+OQwvjnGNp0jxnniW3MfMlPCiwuF0sOSOB2XBuG4PhzgbsWpglcsykedsOJ7Mx8xgAbbmd2C+RwAYUYUgwOIBdCxuyFqBfziW2SSSw/8anhQeqxQ6q5QDYFmZ8WiQk0pIt55w5DFTGYwYM5OTEmT0PmyXnnJMw3IBDi/yM5IM33lQctufnP2MMjEq7xA3Hkw9+eFNmI4/LFhBgAsZCYgOCzwhiS+BQDFXyg4HBHq+KUTAKRsEoGNkAAMDTUKAn9e4qAAAAAElFTkSuQmCC","orcid":"","institution":"Ningxia University","correspondingAuthor":true,"prefix":"","firstName":"Yonglin","middleName":"","lastName":"Zhou","suffix":""}],"badges":[],"createdAt":"2026-04-27 07:59:54","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9538087/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9538087/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":109319663,"identity":"ede4479c-75bd-401f-9d05-cc90ee226569","added_by":"auto","created_at":"2026-05-15 13:18:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":416049,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eVinblastine restricts intracellular \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eSalmonella\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e proliferation. \u003c/strong\u003e(A) Schematic diagram of the phenotypic screening strategy for vinblastine identification. (B) Bacterial invasion efficiency following prophylactic treatment with vinblastine at different concentrations (2–8 μg/mL). (C-E) Intracellular \u003cem\u003eSalmonella\u003c/em\u003eloads in (C) RAW 264.7 macrophages, (D) HeLa cells, and (E) THP-1 monocytes after vinblastine treatment. (F) Representative confocal microscopy image of GFP-expressing \u003cem\u003eSalmonella\u003c/em\u003e in RAW 264.7 macrophages treated with vinblastine. (G-I) Time-course replication kinetics of \u003cem\u003eSalmonella\u003c/em\u003e in (G) RAW 264.7 macrophages, (H) HeLa cells, and (I) THP-1 monocytes within 24 hours post-infection. (J-L) Results of intracellular replication assays of (J) \u003cem\u003eEscherichia coli\u003c/em\u003e, (K) \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e, and (L) \u003cem\u003eListeria monocytogenes\u003c/em\u003efollowing vinblastine treatment. Data are presented as the mean ± standard deviation (SD) from three independent experiments. ns, not significant; **P ≤ 0.01.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-9538087/v1/fdbee26a8d5a8c66dea5636c.png"},{"id":109319664,"identity":"cc6a7ca9-e68f-47ff-af7d-56e24f2d19ee","added_by":"auto","created_at":"2026-05-15 13:18:57","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":205773,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eVinblastine demonstrates favorable biocompatibility. \u003c/strong\u003e(A-C) Cytotoxicity evaluation and CC₅₀ calculation of vinblastine in RAW 264.7 macrophages (A), HeLa cells (B), and THP-1 monocytes (C). (D) Representative live/dead cell staining images of RAW 264.7 cells treated with vinblastine at different concentrations (2, 4, and 8 μg/mL). (E-H) Effects of vinblastine at varying concentrations (2, 4, and 8 μg/mL) on the growth curves of \u003cem\u003eSalmonella\u003c/em\u003e (E), \u003cem\u003eEscherichia coli\u003c/em\u003e (F), \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e (G), and \u003cem\u003eListeria\u003c/em\u003e (H). (I-L) Lactate dehydrogenase (LDH) is a hallmark indicator of cell injury. LDH release was quantified in cells with infection-induced injury by \u003cem\u003eSalmonella\u003c/em\u003e (I), \u003cem\u003eEscherichia coli\u003c/em\u003e(J), \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e (K), and \u003cem\u003eListeria\u003c/em\u003e (L), followed by treatment with vinblastine at the aforementioned concentrations. Data are presented as mean ± standard deviation (mean ± SD) (n=3); *P \u0026lt; 0.05, **P \u0026lt; 0.01; ns, not significant.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-9538087/v1/8bfc2fbc4a0c8389acc9bb12.png"},{"id":109319668,"identity":"2a58eabf-eb51-41d5-b53b-f1a6bf11e31f","added_by":"auto","created_at":"2026-05-15 13:18:57","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":602270,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAMPK activation induced by vinblastine to clear intracellular \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003esalmonella\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003e(A) Immunoblot analysis of LC3B‑I/II and SQSTM1 in RAW264.7 cells treated with vinblastine (VBL) at indicated concentrations. GAPDH served as loading control. (B) Real-time qPCR of autophagy‑lysosome genes in VBL‑treated RAW264.7 cells after bafilomycin A1‑mediated lysosomal inhibition. (C) Immunoblot results of mTOR, phosphorylated mTOR, AMPK, and phosphorylated AMPK in RAW264.7 cells exposed to graded concentrations of vinblastine. (D-G) Quantification of LC3B-II/LC3B-I ratio (D), SQSTM1 (E), p-AMPK/AMPK ratio (F) and p-mTOR/mTOR ratio (G) by ImageJ. (H) Cytotoxicity assay of the AMPK inhibitor Compound C in RAW264.7 cells. (I) Intracellular \u003cem\u003eSalmonella\u003c/em\u003e replication upon co‑treatment with Compound C and VBL. (J) Antibacterial activity assay of vinblastine in the presence of a fixed concentration of Compound C (10 μM). (K-L) Confocal micrographs of the LysoSensor (green) and DQ-BSA (red) in RAW264.7 cells co-treated with Compound C and vinblastine. (M-N) Quantitative analysis of LysoSensor and DQ-BSA fluorescence intensities. Data are presented as mean ± SD (n=3); *P \u0026lt; 0.05, **P \u0026lt; 0.01; ns, not significant.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-9538087/v1/f1afe93bd1f7b1ba08cd4aea.png"},{"id":109319666,"identity":"dd0c9105-52ec-4d8a-9499-df8a20262e69","added_by":"auto","created_at":"2026-05-15 13:18:57","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":577482,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe clearance of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003esalmonella\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e controlled by vinblastine-induced AMPK–TFEB–ATG5 axis. \u003c/strong\u003e(A) QRT-PCR analysis profiling the expression dynamics of lysosomal and autophagy-related genes upon treatment with the AMPK inhibitor Compound C. (B) Immunoblot analysis of TFEB protein expression in RAW264.7 cells treated with vinblastine alone or in combination with the AMPK inhibitor Compound C. (C) Representative confocal micrographs showing vinblastine-induced TFEB nuclear accumulation. (D) Effect of combined vinblastine and Compound C treatment on TFEB subcellular localization. (E) Quantitative analysis of TFEB nuclear fluorescence intensity in panel C, D. (F) Intracellular \u003cem\u003eSalmonella\u003c/em\u003ereplication in \u003cem\u003eAtg5\u003c/em\u003e‑knockout cells treated with VBL. (G-H) Quantitative results of fluorescence intensities of the LysoSensor and DQ-BSA in \u003cem\u003eAtg5\u003c/em\u003e-knockout cells following vinblastine treatment. (I-J) Confocal images of \u003cem\u003eAtg5\u003c/em\u003e-knockout cells stained with LysoSensor and DQ-BSA after vinblastine exposure. Data are presented as mean ± SD (n=3); **P \u0026lt; 0.01; ns, not significant.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-9538087/v1/81efa810e64211511fcbf94d.png"},{"id":109405756,"identity":"10fe3d33-1ea8-482b-91be-8453ce83b222","added_by":"auto","created_at":"2026-05-17 13:20:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1813003,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9538087/v1/92268179-a1d4-48a7-9534-514bda2d82d8.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Vinblastine Activates the AMPK–TFEB–ATG5 Autophagy Axis to Restrict Intracellular Salmonella Infection","fulltext":[{"header":"Background","content":"\u003cp\u003eAntimicrobial resistance (AMR) severely threatens global public health and the livestock/poultry industry, with the rapid evolution of multidrug-resistant (MDR) pathogens pushing humanity and agriculture toward a \u0026quot;post-antibiotic era\u0026quot; and creating an urgent need for novel therapeutics\u0026nbsp;[1, 2]. This crisis is particularly acute for intracellular zoonotic pathogens like \u003cem\u003eSalmonella enterica\u003c/em\u003e, which uses the SPI-2-encoded type III secretion system (T3SS-2) to remodel phagosomes into \u003cem\u003esalmonella\u003c/em\u003e-containing vacuoles (SCVs), surviving and proliferating in macrophages/intestinal epithelial cells to evade immunity and antibiotics [3, 4]. Notably, \u003cem\u003eSalmonella\u003c/em\u003e-induced host metabolic/signaling reprogramming, though increasing treatment difficulty, offers potential novel targets for host-directed therapy (HDT)\u0026mdash;a strategy that clears intracellular pathogens by regulating innate immunity, avoids resistance, and fits livestock/poultry disease control needs [5, 6].\u003c/p\u003e\n\u003cp\u003eThe autophagy-lysosome pathway, a core innate immune defense against intracellular pathogens, encapsulates and degrades pathogens via autophagosome-lysosome fusion, mediated by key regulators such as AMPK and TFEB, among others [7, 8]. However, prior human-centric studies have predominantly focused on the discrete functions of individual molecules\u0026mdash;for instance, AMPK-driven autophagic activation in human primary macrophages and THP-1-derived macrophages, as well as TFEB-mediated modulation of lysosomal function in human intestinal epithelial cells [9, 10]. There remains a paucity of systematic insights into how these molecules synergize to orchestrate pathway activation for intracellular \u003cem\u003eSalmonella\u003c/em\u003e clearance, a critical knowledge gap that hampers the rational development of precise host-directed therapy (HDT) targets [11, 12].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNatural small-molecule compounds are promising for HDT due to good biocompatibility, diverse targets, and low resistance induction. Different from the direct bactericidal mode of traditional antibiotics, natural small molecules mostly exert antibacterial effects by regulating host immune or metabolic pathways, among which autophagy regulation is one of the most core pathways\u0026mdash;for example, phillyrin clears intracellular \u003cem\u003eBrucella\u003c/em\u003e by activating autophagy, and allicin inhibits the proliferation of intracellular \u003cem\u003eEscherichia coli\u003c/em\u003e by regulating lysosomal function [13, 14]. Although existing studies have confirmed the autophagy-regulating potential of natural small molecules, most studies only stay at the \u0026quot;phenomenon description\u0026quot; level, lacking analysis of the full-chain molecular mechanism of \u0026quot;autophagy initiation-regulation-execution\u0026quot;. Moreover, specific natural small-molecule HDT candidates targeting livestock/poultry-derived intracellular \u003cem\u003eSalmonella\u003c/em\u003e are still very scarce.\u003c/p\u003e\n\u003cp\u003eBased on the aforementioned research background and knowledge gaps, this study hypothesizes that screening natural small molecules with autophagy-regulating activity may achieve efficient clearance of intracellular \u003cem\u003eSalmonella\u003c/em\u003e by activating the synergistic effect of core molecules in the autophagy-lysosome pathway. To this end, the present study first identified vinblastine (VBL) as a potential candidate molecule through lysosomal probe screening and gentamicin protection assays, and further aims to evaluate the inhibitory effect and biosafety of VBL on \u003cem\u003eSalmonella\u003c/em\u003e in different host cells, attempt to explore its key molecular targets and preliminary mechanisms in regulating the autophagy-lysosome pathway, and verify its in vivo therapeutic potential in a murine \u003cem\u003eSalmonella\u003c/em\u003e infection model, ultimately providing new molecular targets and experimental basis for the development of novel host-directed therapeutic (HDT) drugs against salmonellosis in livestock and poultry.\u003c/p\u003e"},{"header":"RESULT","content":"\u003cp\u003e\u003cstrong\u003eVinblastine drives host-directed clearance of broad-spectrum intracellular bacteria\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBased on the critical role of lysosomal activation in anti-bacterial defense, we established an integrated phenotypic screening strategy employing lysosomal probes and gentamicin protection assays. Our screening approach established vinblastine (VBL), which simultaneously induces lysosomal acidification and suppresses the intracellular proliferation of \u003cem\u003eSalmonella\u003c/em\u003e (Fig. 1A). To determine whether VBL acts prophylactically, we assessed its effect on bacterial invasion. We found that VBL did not suppress bacterial entry in a concentration-dependent manner, ruling out a prophylactic mechanism (Fig. 1B). We therefore focused on its therapeutic potential. As shown in Figure 1C-1E, VBL treatment dose-dependently reduced intracellular \u003cem\u003eSalmonella\u003c/em\u003e loads in RAW 264.7, HeLa, and THP-1 cells (Fig. 1C\u0026ndash;E), a finding corroborated by confocal microscopy (Fig. 1F). This antibacterial effect was sustained over 12 hours across all cell types (Fig. 1G\u0026ndash;I). Prompted by its potency against \u003cem\u003eSalmonella\u003c/em\u003e, we expanded our evaluation and found that VBL also exhibits broad-spectrum activity, significantly restricting the intracellular growth of \u003cem\u003eEscherichia coli\u003c/em\u003e, \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e, and\u003cem\u003e\u0026nbsp;Listeria monocytogenes\u003c/em\u003e (Fig. 1J\u0026ndash;L). Together, these data establish VBL as a broad-spectrum, host-directed agent that activate cell-autonomous clearance of diverse intracellular pathogens.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVinblastine as a well-tolerated host-acting antibacterial drug\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate the translational potential of vinblastine (VBL), we systematically characterized its host cell biocompatibility. As shown in Figure 2A-2C, the potential toxicity of VBL was assessed in RAW 264.7 macrophages, HeLa epithelial cells, and THP-1 monocytes using the CCK-8 assay. Within the concentration range of 2-8 \u0026mu;g/mL, which is effective for intracellular antibacterial activity, VBL did not induce significant loss of viability in host cell lines, including macrophages and epithelial cells. The half-maximal cytotoxic concentration (CC₅₀) exceeded 120 \u0026mu;g/mL for all cell types (Fig. 2A-C), indicating a wide therapeutic window. Consistent with this, live/dead cell staining of RAW 264.7 macrophages treated with VBL revealed preserved membrane integrity and minimal cell death across the aforementioned concentration range (Fig. 2D), confirming its favorable biocompatibility.\u003c/p\u003e\n\u003cp\u003eSubsequently, we further investigated the mechanism underlying its antibacterial activity. Growth curve analysis demonstrated that VBL at concentrations of 2-8 \u0026mu;g/mL did not inhibit the in vitro proliferation of \u003cem\u003eSalmonella\u003c/em\u003e, \u003cem\u003eEscherichia coli\u003c/em\u003e, \u003cem\u003eKlebsiella pneumoniae\u0026nbsp;\u003c/em\u003eor \u003cem\u003eListeria\u003c/em\u003e (Fig. 2E-H), ruling out a direct bactericidal mechanism. In striking contrast, in the RAW 264.7 macrophage infection model, treatment with varying concentrations of VBL significantly attenuated cell damage induced by infection with the four pathogenic bacteria, with the cytoprotective effect progressively enhancing as the VBL concentration increased (Fig. 2I-L). Collectively, the present study demonstrates that VBL is a host-directed antimicrobial agent with broad-spectrum intracellular antibacterial activity and excellent biocompatibility within its effective concentration range, while exerting a significant dose-dependent cytoprotective effect on RAW 264.7 macrophages.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVinblastine mediates \u003cem\u003eSalmonella\u003c/em\u003e clearance through acidification-driven lysosomal trafficking.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo elucidate how vinblastine (VBL) counteracts intracellular \u003cem\u003eSalmonella\u003c/em\u003e, we first asked whether it modulates lysosomal function. As shown in Figure 3A-3C, VBL concentration‑dependently increased the fluorescence of both the acidification probe LysoSensor and the proteolytic activity reporter DQ‑BSA in RAW 264.7 macrophages, indicating concurrent elevation of lysosomal acidification and degradative capacity. Flow‑cytometric quantification of LysoTracker and LysoSensor staining further confirmed the increase in lysosomal activity (Fig. 3D and 3E). We next examined whether this enhanced lysosomal function directs bacteria into degradative compartments. Live‑cell confocal imaging of GFP‑tagged \u003cem\u003eSalmonella\u003c/em\u003e and LysoTracker‑labeled lysosomes revealed that VBL treatment significantly increased bacteria\u0026ndash;lysosome colocalization in a dose‑dependent manner (Fig. 3F and 3G), demonstrating that VBL overcomes bacterial evasion and promotes lysosomal trafficking. To establish a causal link between acidification and bacterial killing, we inhibited lysosomal acidification using bafilomycin A1 (BafA1) or ammonium chloride (NH\u003csub\u003e4\u003c/sub\u003eCl). Both agents largely abolished VBL\u0026rsquo;s antibacterial activity in intracellular replication assays (Fig. 3H and 3I). confirming that the antibacterial activity mediated by VBL was critically dependent on an acidic lysosomal pH environment. Consistent with this, confocal imaging revealed a significant reduction in the fluorescence intensity of Sensor and DQ-BSA in inhibitor-treated cells (Figures 3J-M), indicating that BafA1 or NH₄Cl treatment can effectively block lysosomal acidification and proteolysis. In summary, these results indicate that vinblastine rewires the autophagy‑lysosome pathway by activating lysosomal acidification, which in turn drives targeted delivery of \u003cem\u003eSalmonella\u003c/em\u003e to degradative organelles and restricts bacterial survival.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVinblastine activates the AMPK\u0026ndash;TFEB axis to drive autophagy-lysosome\u0026ndash;mediated clearance of \u003cem\u003esalmonella\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBased on the impaired bacterial clearance upon autophagy inhibition, we systematically evaluated whether vinblastine stimulates autophagic flux. Immunoblot analysis of RAW264.7 cells revealed that vinblastine treatment significantly increased the LC3-II/LC3-I ratio and concurrently decreased SQSTM1 protein levels, indicative of enhanced autophagosome formation and cargo degradation (Fig. 4A). To clarify whether this effect stems from increased autophagic activity rather than late-stage autophagic flux blockade, we further performed BafA1-mediated autophagic flux blockade assays. The results showed that co-treatment with BafA1 completely abrogated the vinblastine-induced LC3-II accumulation and p62 degradation, confirming that VBL promotes complete autophagic flux rather than blocking lysosomal degradation. Next, we analyzed the transcriptional dynamics of the autophagy-lysosome pathway. Real-time qPCR results following BafA1 treatment revealed a multiphasic expression pattern: an early compensatory upregulation of \u003cem\u003eAmpk, Mtor, Tfeb\u003c/em\u003e, and \u003cem\u003eSqstm1\u003c/em\u003e at 1 h; a significant downregulation of \u003cem\u003eAmpk, Tfeb\u003c/em\u003e, and \u003cem\u003eCtsb\u003c/em\u003e at 3 h; and a late resurgence of \u003cem\u003eAmpk, Tfeb, Mtor, Ctsb, and Ctsd\u003c/em\u003e at 5 h (Figure 4B). These expression characteristics\u0026mdash;particularly the sustained activation of TFEB alongside the fluctuating expression of AMPK\u0026mdash;implied a potential coordination of autophagic and lysosomal gene expression through the AMPK-TFEB axis.\u003c/p\u003e\n\u003cp\u003eConsistent with the above assumption, immunoblotting showed that vinblastine enhanced AMPK phosphorylation in a dose-dependent manner, while the p-mTOR/mTOR ratio remained unchanged (Figures 4C-G), indicating that vinblastine selectively activates the AMPK signaling pathway independent of mTOR regulation. To functionally validate the contribution of AMPK, we used the pharmacological inhibitor Compound C. Dose-response experiments identified 10 \u0026mu;M as a non-cytotoxic concentration that effectively reversed vinblastine\u0026rsquo;s antibacterial activity (Figures 4H-I). Notably, 10 \u0026mu;M Compound C significantly blocked the inhibition of intracellular \u003cem\u003eSalmonella\u003c/em\u003e proliferation by vinblastine across all tested doses (Figure 4J), establishing AMPK activation as essential for the anti-\u003cem\u003eSalmonella\u003c/em\u003e effect of vinblastine. Confocal microscopy further showed that Compound C co-treatment markedly reduced both Sensor and DQ-BSA fluorescence intensities (Figures 4K-N), indicating that AMPK activity is a necessary prerequisite for vinblastine-induced lysosomal acidification and proteolytic activation. In summary, these data revealed a signaling pathway which vinblastine triggers AMPK-dependent autophagic flux and lysosomal acidification, ultimately leading to the targeted clearance of intracellular \u003cem\u003eSalmonella\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVinblastine eliminates intracellular \u003cem\u003esalmonella\u003c/em\u003e via an AMPK\u0026ndash;TFEB\u0026ndash;ATG5 autophagic pathway\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe aforementioned findings demonstrated a coordinated upregulation of AMPK and TFEB, two master regulators of cellular autophagy pathways. To systematically dissect the functional crosstalk between these molecules and their downstream regulatory cascades, we employed the specific AMPK inhibitor Compound C in a series of experiments, initiating with qRT-PCR analysis to profile the expression dynamics of lysosomal and autophagic genes (encompassing key players such as \u003cem\u003ectsd, ctsb, sqstm1, tfeb, atp6v1e1, and tmem9\u003c/em\u003e). Notably, Compound C treatment led to a marked upregulation in the expression of \u003cem\u003eLamp1\u003c/em\u003e, a well-characterized lysosomal membrane marker (Fig. 5A). Concomitantly, immunoblotting assays further validated that pharmacological abrogation of AMPK significantly attenuated vinblastine-induced TFEB expression (Fig. 5B), a result that firmly establishes AMPK activation as a pivotal upstream trigger for TFEB induction. We next examined TFEB subcellular localization. Confocal imaging revealed that vinblastine promoted TFEB nuclear accumulation in a concentration‑dependent manner (Fig. 5C). This translocation was abolished by Compound C co‑treatment (Fig. 5D), demonstrating that AMPK activity is required for TFEB nuclear entry and subsequent transcriptional activation.\u003c/p\u003e\n\u003cp\u003eSince TFEB is well established as a central transcriptional regulator of lysosomal biogenesis and autophagic pathways, we hypothesized that vinblastine exerts its antibacterial effects by targeting core autophagic machinery to mediate intracellular \u003cem\u003eSalmonella\u003c/em\u003e clearance. To test this hypothesis, we focused on ATG5, a critical effector molecule indispensable for autophagosome biogenesis. Genetic ablation of \u003cem\u003eAtg5\u003c/em\u003e profoundly impaired the ability of vinblastine to restrict intracellular \u003cem\u003eSalmonella\u003c/em\u003e proliferation (Figure 5F), confirming that a functional autophagic pathway is obligatory for vinblastine\u0026rsquo;s anti-\u003cem\u003eSalmonella\u003c/em\u003e efficacy. Importantly, confocal microscopy analyses demonstrated that \u003cem\u003eAtg5\u003c/em\u003e deficiency did not compromise vinblastine-induced enhancements in Sensor and DQ-BSA fluorescence intensities (Figures 5I-J), indicating that lysosomal acidification and proteolytic capacity remained intact. Collectively, our data delineate a comprehensive molecular circuitry wherein vinblastine-induced AMPK activation drives TFEB nuclear translocation, thereby potentiating lysosomal function and biogenesis. The AMPK-TFEB axis subsequently engages ATG5-dependent autophagosome formation, orchestrating an integrated cellular defense program that executes the precise clearance of intracellular \u003cem\u003eSalmonella\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVinblastine ameliorates colitis damage in \u003cem\u003eSalmonella\u003c/em\u003e-infected mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUsing an established murine model of \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium infection (Figure 6A), we comprehensively evaluated the therapeutic efficacy of vinblastine (VBL). Administration of VBL at low, medium, and high doses resulted in dose-dependent restoration of body weight and normalization of feeding and drinking behaviors compared to infected controls (Figures 6B-C). Quantitative analysis of bacterial loads in harvested tissues demonstrated a progressive reduction in \u003cem\u003eSalmonella\u003c/em\u003e burden in the liver (Figure 6D), spleen (Figure 6E), cecum (Figure 6G), colon (Figure 6F), and fecal samples (Figure 6H) with increasing VBL concentrations. Concomitantly, cytokine profiling revealed potent immunomodulatory properties of VBL which it marked suppression of pro-inflammatory mediators IL-6 (Figure 6I) and TNF-\u0026alpha; (Figure 6K), coupled with a concentration-dependent increase in anti-inflammatory IL-10 (Figure 6J), indicating reestablishment of inflammatory homeostasis. Histopathological examination of H\u0026amp;E-stained sections demonstrated that VBL treatment significantly attenuated infection-induced tissue damage, with the liver (Figure 6L) exhibiting reduced inflammatory infiltration and the spleen (Figure 6M) maintaining architectural integrity. To elucidate the mechanistic basis underlying these effects, we analyzed autophagy markers in hepatic and splenic tissues from healthy controls and VBL-treated (3 mg/kg) mice. Immunofluorescence analysis revealed coordinated activation of the autophagic pathway, characterized by enhanced LC3B puncta formation accompanied by reduced SQSTM1/p62 accumulation in both liver (Figure 6N) and spleen (Figure 6O) tissues. Collectively, these findings elucidate a multimodal mechanism through which vinblastine orchestrates concomitant bacterial clearance, inflammation resolution, and autophagy activation, ultimately restoring tissue homeostasis during \u003cem\u003eSalmonella\u003c/em\u003e infection.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eThe global burden of \u003cem\u003eSalmonella\u003c/em\u003e \u003cem\u003eenterica\u003c/em\u003e causes severe economic losses in livestock and poultry production and represents a leading cause of foodborne illness in humans through contaminated animal products [15, 16]. A cornerstone of its pathogenicity is its ability to parasitize host cells, evading immune clearance by inhibiting phagosome-lysosome fusion and subverting host signaling pathways. This intracellular niche also shelters the bacterium from many conventional antibiotics, contributing to persistent infections and the accelerating spread of multidrug-resistant (MDR) strains [17]. This is also the key reason why traditional antibiotics are difficult to penetrate intracellular barriers, leading to recurrent infections and exacerbated antimicrobial resistance [18]. In this context, host-directed therapy (HDT)\u0026mdash;which aims to bolster the host\u0026apos;s intrinsic defence mechanisms\u0026mdash;has emerged as a promising strategy to circumvent pathogen resistance.\u003c/p\u003e\n\u003cp\u003eThe autophagy-lysosome pathway is a central effector of cell-autonomous immunity against intracellular bacteria like \u003cem\u003eSalmonella\u003c/em\u003e [19]. As the \u0026quot;terminal effector\u0026quot; of this pathway, lysosomes achieve pathogen degradation through an acidic microenvironment and contained cathepsins (e.g., CTSB, CTSD). Transcription Factor EB (TFEB), a master regulator of lysosomal biogenesis and autophagy-related gene expression, can initiate the transcription of key genes such as LAMP1 and V-ATPase subunits through nuclear translocation, significantly enhancing lysosomal function [20, 21]. While previous studies utilizing human cell models have independently established that AMPK activation in human primary macrophages and THP-1 monocytes contributes to host defense against \u003cem\u003eSalmonella\u003c/em\u003e infection [22-24]. TFEB nuclear translocation in human colonic epithelial cells and HeLa cells [25, 26]. ATG5-dependent autophagy in human HepG2 hepatocellular carcinoma cells and Caco-2 intestinal epithelial cells all contribute to host defense against \u003cem\u003eSalmonella\u003c/em\u003e infection [19, 27]. The mechanistic crosstalk integrating these components into a functional, cohesive host defense circuitry remains incompletely defined [23, 24].\u003c/p\u003e\n\u003cp\u003eOur data establish that VBL-induced clearance operates via a signaling cascade with distinct functional tiers. Phosphorylation and activation of AMPK\u0026mdash;occurring independently of mTOR\u0026mdash;serves as the initiating trigger. Activated AMPK drives TFEB nuclear translocation, which in turn transcriptionally potentiates lysosomal acidification and proteolytic capacity. Notably, this lysosomal enhancement remains intact in ATG5-deficient cells, indicating that TFEB-mediated lysosomal remodeling and ATG5-dependent autophagosome formation are parallel, complementary arms of the pathway. Both are, however, essential for bacterial clearance, as genetic ablation of ATG5 abolishes VBL\u0026rsquo;s antibacterial effect without impairing lysosomal function. This architecture reveals a \u0026ldquo;two-track\u0026rdquo; mechanism that AMPK-TFEB licenses the lysosomal degradative capacity, while the ATG5 ensures targeted delivery of bacteria to these activated organelles. This model significantly advances the prevailing view of autophagy\u0026ndash;lysosome coordination and provides a mechanistic basis for the synergistic efficacy observed.\u003c/p\u003e\n\u003cp\u003eThe translational relevance of this pathway is underscored by our in vivo findings. In a murine salmonellosis model, VBL treatment not only reduced bacterial burden in systemic organs but also rebalanced inflammatory cytokines and mitigated tissue damage\u0026mdash;effects correlated with activation of autophagy markers in affected tissues. This multi-faceted protection highlights the therapeutic potential of engaging an upstream host regulator like AMPK, which can simultaneously amplify intrinsic clearance pathways and modulate detrimental inflammation.\u003c/p\u003e\n\u003cp\u003eIn conclusion, we have identified and validated the AMPK\u0026ndash;TFEB\u0026ndash;ATG5 axis as a druggable host defence pathway that coordinates lysosomal activation with autophagic capture to eliminate intracellular \u003cem\u003eSalmonella\u003c/em\u003e. The study not just preliminarily revealed the cascade transduction characteristics of this pathway in the current model, supplementing experimental evidence for the mechanism of autophagy-related molecules synergistically resisting \u003cem\u003eSalmonella\u003c/em\u003e infection, provided basic theoretical reference and experimental support for the subsequent research on vinblastine as a potential HDT for salmonellosis.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003e\u003cstrong\u003eMammalian Cell Culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRAW264.7 macrophages and HeLa cells were maintained in high-glucose Dulbecco\u0026apos;s Modified Eagle Medium (DMEM; Cytiva), while THP-1 monocytes were cultured in Roswell Park Memorial Institute 1640 medium (RPMI-1640; Cytiva). All media were supplemented with 10% fetal bovine serum (CellBox) and 1% penicillin-streptomycin solution (Cytiva), and cells were incubated under standard conditions (37\u0026deg;C, 5% CO₂). Twenty-four hours prior to infection, cells were seeded at optimized densities: 2\u0026times;10⁴ cells/well in 96-well plates, 2\u0026times;10⁵ cells/well in 24-well plates, and 8\u0026times;10⁵ cells/well in 6-well plates.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBacterial Strains\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe strains used in this study included \u003cem\u003eS. Typhimurium\u003c/em\u003e strain SL1344, \u003cem\u003eListeria monocytogenes\u0026nbsp;\u003c/em\u003eATCC 19115,\u003cem\u003e\u0026nbsp;Klebsiella pneumoniae\u003c/em\u003e ATCC 43816 and \u003cem\u003eEscherichia coli\u0026nbsp;\u003c/em\u003eO157, all of which were routinely preserved at low temperature in our laboratory. All strains were cultured using Lysogeny Broth (LB) medium as the base. Specifically, SL1344 was cultured in LB medium supplemented with 100 \u0026mu;g/mL streptomycin to maintain strain characteristics as required for the experiment, while \u003cem\u003eListeria monocytogenes\u003c/em\u003e, \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e were routinely cultured in LB medium without antibiotics.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCytotoxicity assay\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell viability was analyzed using the Cell Counting Kit-8 (C0038, Beyotime, China) according to the manufacturer\u0026apos;s protocol. Briefly, RAW264.7, THP-1, and HeLa cells were plated in 96-well plates at a density of 1\u0026times;10⁴ cells per well in 200 \u0026mu;L complete medium and cultured for 24 h under standard conditions (37\u0026deg;C, 5% CO₂). Cells were then treated with serially diluted vinblastine (0 \u0026ndash; 512 \u0026mu;g/mL) in DMEM or RPMI-1640 medium for 8 h under light-protected conditions. After adding 20 \u0026mu;L CCK-8 reagent to each well and incubating for 30 min, absorbance was measured at 450 nm using a Bio-Rad microplate reader, with cell-free wells serving as blanks. Cell viability was expressed as absorbance values [28].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBacterial Growth Kinetics Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eS. Typhimurium,\u0026nbsp;Escherichia coli, Klebsiella pneumoniae and\u0026nbsp;Listeria monocytogenes\u0026nbsp;were inoculated in Lysogeny Broth and cultured overnight at 37\u0026deg;C with shaking at 200 rpm. When the bacterial suspensions reached mid-logarithmic phase (OD₆₀₀ = 0.5), they were supplemented with vinblastine at final concentrations of 0, 2, 4, and 8 \u0026mu;g/mL. The cultures were maintained under continuous shaking incubation at 37\u0026deg;C, and bacterial growth kinetics were monitored in real-time using a microplate reader.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLive/Dead Cell Staining Assay\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRAW264.7 cells were seeded in 24-well plates at a density of 2\u0026times;10⁵ cells per well and allowed to adhere overnight under standard culture conditions. The cells were then treated with a gradient concentration of vinblastine (0\u0026ndash;8 \u0026mu;g/mL) for 6 hours at 37\u0026deg;C. Following treatment, live/dead staining was performed using a commercial double-staining kit (CA1630, Solarbio) strictly following the manufacturer\u0026apos;s protocol. Fluorescence images were acquired using an Olympus fluorescence microscope (Germany) [29].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLactate Dehydrogenase Release Assay\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRAW264.7 cells were seeded in 96-well plates and cultured until reaching 80\u0026ndash;90% confluence. Cells were then infected separately with\u0026nbsp;Salmonella,\u0026nbsp;Escherichia coli, Klebsiella pneumoniae or\u0026nbsp;Listeria monocytogenes\u0026nbsp;at an MOI of 25 for 1 h [30]. Following infection, the medium was replaced with fresh medium containing graded concentrations of vinblastine (0\u0026ndash;8 \u0026mu;g/mL) for an additional 4 h. The plates were centrifuged at 400 \u0026times; g for 5 min, and 120 \u0026mu;L of supernatant from each well was carefully transferred to a new 96-well plate. Subsequent processing and measurement were performed in strict accordance with the manufacturer\u0026apos;s instructions of the LDH Cytotoxicity Assay Kit (C0016, Beyotime).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBacterial Invasion Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRAW264.7, Hela and THP-1 cells were infected with SL1344 at an MOI 25 for 1 h, followed by gentamicin protection (100 \u0026mu;g/mL, 30 min). The medium was then replaced with DMEM containing 10 \u0026mu;g/mL gentamicin and 8 \u0026mu;g/mL vinblastine. After 4 h incubation (37\u0026deg;C, 5% CO2), cells were lysed with 0.2% Triton X-100 for viable bacterial enumeration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIntracellular Bacterial Proliferation Kinetics Curve\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRAW 264.7, HeLa, and THP-1 cells were prepared and infected with SL1344 (MOI = 25) following the standardized invasion assay protocol [31]. After 1 h of bacterial invasion and gentamicin protection treatment (100 \u0026mu;g/mL, 30 min), the medium was replaced with maintenance medium containing graded concentrations of vinblastine (0\u0026ndash;8 \u0026mu;g/mL) and 10 \u0026mu;g/mL gentamicin. Cells were continuously cultured under physiological conditions (37\u0026deg;C, 5% CO₂) for 24 h. At the indicated time points (0, 2, 4, 6, 8, 12, 16, 20, and 24 h), the culture medium was aspirated and cells were gently washed once with PBS, followed by lysis in 0.2% Triton X-100. The resulting lysates were serially diluted, plated on LB agar, and incubated at 37\u0026deg;C for 16 h for colony-forming unit (CFU) enumeration.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative real-time PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRAW264.7 cells were seeded in 6-well plates at a density of 8\u0026times;10⁵ cells/well. After 12 hours of incubation, cells were pretreated with vinblastine and bafilomycin A1 for 1h, 3h, and 5h prior to RNA extraction. Total RNA was isolated using TRIzol reagent (Tiangen, Beijing), followed by DNase I treatment. cDNA was synthesized from 1\u0026mu;g RNA using HiScript\u0026reg; II Reverse Transcriptase (Vazyme, Nanjing). Quantitative real-time PCR was performed on an ABI 7900 HT Real-Time PCR System with qPCR SYBR Green Premix (Vazyme, Nanjing) under the following thermal cycling conditions: initial denaturation at 95\u0026deg;C for 30 sec, followed by 40 cycles of 95\u0026deg;C for 5 sec, 60\u0026deg;C for 30 sec, and 72\u0026deg;C for 30 sec. Gene expression levels were calculated using the 2-\u0026Delta;\u0026Delta;CT method with 16S RNA as the endogenous control. The quantification cycle (Cq) cutoff was set at 35 cycles. All procedures were strictly performed according to the manufacturer\u0026apos;s protocols.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003ePrimer name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eOligonucleotide primer sequence (5\u0026rsquo;\u0026ndash;3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003eGapdh\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eF: GGCCTTCCGTGTTCCTACC\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eR: CGGCATCGAAGGTGGAAGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003eAmpk\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eF: GCTGCTGAAGAAGCTGAAGG\u003c/p\u003e\n \u003cp\u003eR: GGTGATGGTGTCGATGATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003eMtor\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eF: CAGACAGTGCTGGACATCCT\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eR: TCCTTGGTGATGTCCTTGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003eTfeb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eF: AGCAGCACCTACACCTACGG\u003c/p\u003e\n \u003cp\u003eR: GCTGCTGTTGTTGCTGTTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003eCtsb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eF: ATGGCCTACCTGCTGTTCTT\u003c/p\u003e\n \u003cp\u003eR: TTGCTGTTGCTGTTGCTGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003eCtsd\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eF: GAGACAGTGCTGGACATCCT\u003c/p\u003e\n \u003cp\u003eR: TCCTTGGTGATGTCCTTGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003eAtp6v0c\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eF: GCTGCTGAAGAAGCTGAAGG\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eR: GGTGATGGTGTCGATGATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003eBcl2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eF: CAGACAGTGCTGGACATCCT\u003c/p\u003e\n \u003cp\u003eR: TCCTTGGTGATGTCCTTGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003eCalcoco2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eF: AGCAGCACCTACACCTACGG\u003c/p\u003e\n \u003cp\u003eR: GCTGCTGTTGTTGCTGTTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003eLc3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eF: ATGGCCTACCTGCTGTTCTT\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eR: TTGCTGTTGCTGTTGCTGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003eAtp6v0d2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eF: GAGACAGTGCTGGACATCCT\u003c/p\u003e\n \u003cp\u003eR: TCCTTGGTGATGTCCTTGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003eSqstm1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eF: GCTGCTGAAGAAGCTGAAGG\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eR: GGTGATGGTGTCGATGATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003eLamp1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eF: CAGACAGTGCTGGACATCCT\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eR: TCCTTGGTGATGTCCTTGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003eMcoln1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eF: AGCAGCACCTACACCTACGG\u003c/p\u003e\n \u003cp\u003eR: GCTGCTGTTGTTGCTGTTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003eAtp6v1e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eF: ATGGCCTACCTGCTGTTCTT\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eR: TTGCTGTTGCTGTTGCTGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003eAtp6v0da4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eF: GAGACAGTGCTGGACATCCT\u003c/p\u003e\n \u003cp\u003eR: TCCTTGGTGATGTCCTTGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003eTmem9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eF: GCTGCTGAAGAAGCTGAAGG\u003c/p\u003e\n \u003cp\u003eR: GGTGATGGTGTCGATGATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 36.8%;\"\u003e\n \u003cp\u003eAtp6v1h\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 63.2%;\"\u003e\n \u003cp\u003eF: CAGACAGTGCTGGACATCCT\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eR: TCCTTGGTGATGTCCTTGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eAssessment of Lysosomal Function\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePre-seeded cells were co-cultured with graded concentrations of vinblastine (0-8 \u0026mu;g/mL) for 4 hours, followed by simultaneous staining with the lysosomal probe LysoSensor\u0026trade; Sensor and DQ\u0026trade; Red BSA at 37\u0026deg;C for 30 minutes. After PBS washing, Hoechst staining was performed for 15 minutes followed by image acquisition [32].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow cytometry analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRAW264.7 macrophages cultured overnight were incubated with 1 mL serum-free DMEM containing 2-8 \u0026mu;g/mL vinblastine or serum-free DMEM alone for 4 h at 37℃ with 5% CO₂. After treatment, the drug-containing medium was discarded, and cells were gently rinsed twice with pre-warmed (37℃) PBS. LysoTracker and LysoSensor were diluted to 50 nM and 2 \u0026mu;M, respectively, in serum-free DMEM. Then, 300 \u0026mu;L of the mixture was added per well and incubated for 30 min at 37 \u0026deg;C with 5% CO₂ in the dark. Unbound probes were removed by thorough washing with pre-warmed PBS three times. Cells were resuspended in PBS, transferred to 1.5 mL tubes, and centrifuged at 1000 \u0026times; g for 5 min. The pellet was resuspended in 300 \u0026mu;L PBS, and fluorescence was detected by flow cytometry (CytExpert, Beckman Coulter, USA) using the PE channel and FITC channel, with 100,000 ungated events collected per sample. Data were quantitatively analyzed using Flow jo software [31, 33].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnalysis of GFP-Labeled Bacterial Internalization\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRAW264.7 cells seeded for 24 hours were infected with GFP-tagged SL1344 strains using a standard procedure. After 1 hour of infection, the medium was replaced with medium containing graded concentrations of vinblastine and cultured for an additional 4 hours. Nuclear staining and image acquisition were then performed according to the general method. All fluorescence imaging experiments were completed using a laser scanning confocal microscope (Olympus F1000, Tokyo, Japan). At least 6 fields of view were randomly selected for each experimental group, and fluorescence intensity was quantified using ImageJ software. Data were further analyzed statistically using GraphPad Prism 9.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBacteria\u0026ndash;Lysosome Colocalization Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFollowing GFP-SL1344 infection as described above, cells were treated with graded concentrations of vinblastine for 4 hours, followed by staining with LysoTracker Red for 30 minutes. After nuclear staining as described above, colocalization between LysoTracker Red and GFP-1344 was observed under a confocal microscope, and quantitative colocalization analysis was performed using the Coloc 2 module (Pearson correlation coefficient).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern Blot Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal proteins were extracted from treated cells using RIPA buffer (Beyotime, Shanghai, China) supplemented with 1 mmol/L PMSF, and quantified with a BCA protein assay kit (Beyotime, Shanghai, China). Protein samples were separated by SDS-PAGE and transferred onto methanol-activated PVDF membranes via semi-dry transfer. After blocking with 5% skim milk in TBST for 2 hours, the membranes were incubated with primary antibodies at 4\u0026deg;C overnight. Following three 10-minute washes with TBST, the membranes were incubated with corresponding secondary antibodies at room temperature for 2 hours. Protein bands were visualized using an enhanced chemiluminescence (ECL) kit (Advansta) according to the manufacturer\u0026apos;s protocol. Band intensities were quantified using ImageJ software (Version 1.46; National Institutes of Health (NIH), Bethesda, USA).\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"604\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 43.7086%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAntibodies\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.7815%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSource\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.5099%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCatalog Number\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 43.7086%;\"\u003e\n \u003cp\u003eLC3B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.7815%;\"\u003e\n \u003cp\u003eAbmart\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.5099%;\"\u003e\n \u003cp\u003eT55992S\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 43.7086%;\"\u003e\n \u003cp\u003eSQSTM1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.7815%;\"\u003e\n \u003cp\u003eZenbio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.5099%;\"\u003e\n \u003cp\u003eQ13501\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 43.7086%;\"\u003e\n \u003cp\u003emTOR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.7815%;\"\u003e\n \u003cp\u003eProteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.5099%;\"\u003e\n \u003cp\u003e66888-1-Ig\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 43.7086%;\"\u003e\n \u003cp\u003ePhospho-mTOR (Ser2448)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.7815%;\"\u003e\n \u003cp\u003eProteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.5099%;\"\u003e\n \u003cp\u003e67778-1-Ig\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 43.7086%;\"\u003e\n \u003cp\u003eAMPK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.7815%;\"\u003e\n \u003cp\u003eProteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.5099%;\"\u003e\n \u003cp\u003e10929-2-AP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 43.7086%;\"\u003e\n \u003cp\u003ePhospho-AMPK\u0026nbsp;\u0026nbsp;(Thr172)\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.7815%;\"\u003e\n \u003cp\u003eProteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.5099%;\"\u003e\n \u003cp\u003e80209-6-RR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 43.7086%;\"\u003e\n \u003cp\u003eTFEB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.7815%;\"\u003e\n \u003cp\u003eZenbio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.5099%;\"\u003e\n \u003cp\u003eR27339\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 43.7086%;\"\u003e\n \u003cp\u003eGADPH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.7815%;\"\u003e\n \u003cp\u003eProteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.5099%;\"\u003e\n \u003cp\u003e60004-1-Ig\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 43.7086%;\"\u003e\n \u003cp\u003eHRP-conjugated Goat Anti-Rabbit IgG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.7815%;\"\u003e\n \u003cp\u003eProteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.5099%;\"\u003e\n \u003cp\u003eSA00001-2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 43.7086%;\"\u003e\n \u003cp\u003eGoat Anti-Rabbit lgG AF 594\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.7815%;\"\u003e\n \u003cp\u003eAbmart\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.5099%;\"\u003e\n \u003cp\u003eM21014\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 43.7086%;\"\u003e\n \u003cp\u003eHRP-conjugated Goat Anti-Mouse IgG\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.7815%;\"\u003e\n \u003cp\u003eProteintech\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 23.5099%;\"\u003e\n \u003cp\u003eSA00001-1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation of Peritoneal Macrophages from \u003cem\u003eAtg5\u003c/em\u003e Knockout Mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSix-to-eight-week-old C57 mice were genotype-identified by tail-tip genomic DNA PCR to confirm \u003cem\u003eAtg5\u003c/em\u003e knockout. Mice were then intraperitoneally injected with 3 mL of 3% Tryptose Phosphate Broth (TPB) to recruit peritoneal macrophages, and euthanized by cervical dislocation 3 days post-injection. Immediately after euthanasia, mice were immersed in 75% ethanol for 30 s for surface disinfection, blotted dry with sterile filter paper, and transferred to a biosafety cabinet. Peritoneal lavage fluid was collected by flushing the abdominal cavity three times with 10% fetal bovine serum (FBS)-supplemented RPMI 1640 medium using a sterile 5 mL syringe. The collected lavage fluid was centrifuged at 1600 r/min for 5 min at room temperature. After discarding the supernatant, eBioscience red blood cell lysis buffer (Thermo Fisher Scientific) was added and incubated at room temperature for 5 min to eliminate red blood cells [34, 35]. The lysis reaction was terminated by adding an equal volume of complete medium, followed by a second centrifugation. The cell pellet was resuspended in complete RPMI 1640 medium containing 10% FBS, 100 U/mL penicillin, and 100 \u0026mu;g/mL streptomycin for subsequent plating.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimal experiment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study utilized 6-8-week-old specific pathogen-free (SPF) Balb/c mice purchased from Changsheng Biotechnology Co, Ltd. All experimental procedures were approved by the Institutional Animal Care and Use Committee of Jilin University (SY202510007) and strictly adhered to animal ethics guidelines. Mice were randomly divided into five groups (n=6): healthy control (PBS), infection control (WT), low-dose vinblastine (1 mg/kg), medium-dose vinblastine (2 mg/kg), and high-dose vinblastine (3 mg/kg). After a 3-day pretreatment with 5 g/L streptomycin in drinking water, all groups except the healthy control were orally inoculated with 5\u0026times;10⁷ CFU SL1344 to establish the infection model. Treatment commenced at 4 hours post-infection, with respective groups receiving vinblastine suspensions (in 0.5% carboxymethyl cellulose) via oral gavage, while healthy and infection control groups received equal volumes of vehicle, administered once daily for 5 consecutive days (100 \u0026mu;L per mouse). Body weight, food intake, and water consumption were monitored throughout the experimental period. Terminal samples included the collection of liver, spleen, and intestinal tissues for organ indices calculation, bacterial load analysis, inflammatory cytokine quantification (IL-6, IL-10, TNF-\u0026alpha;), and histopathological examination by hematoxylin and eosin staining [36].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the experiments were performed in triplicate with the data expressed as the mean \u0026plusmn; SD. Data analysis was conducted with GraphPad Prism (version 8.3.0). The log-rank test was used for the statistical significance analysis of survival rates and two-tailed Student\u0026rsquo;s-test was used for other assays. *, P \u0026lt; 0.05; **, P \u0026lt; 0.01.\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (grant 32560874，U23A20242), and the Natural Science Foundation of Ningxia Hui Autonomous Region Project (2025AAC050040).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Designed the research: YLZ and HW; Performed the experiments: YLZ, HRL, JFW, XYH, XMD; Date analyzed and Date curation: HW, XYH and LFZ; Visualization: XYH, YT, YML, ZHG; YLZ and XYH wrote the manuscript with input from all the authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experimental procedures were approved by the Institutional Animal Care and Use Committee of Jilin University (SY202510007) and strictly adhered to animal ethics guidelines.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMacesic, N., A.C. Uhlemann, and A.Y. Peleg, \u003cem\u003eMultidrug-resistant Gram-negative bacterial infections.\u003c/em\u003e Lancet, 2025. \u003cstrong\u003e405\u003c/strong\u003e(10474): p. 257-272.\u003c/li\u003e\n\u003cli\u003eMakabenta, J.M.V., et al., \u003cem\u003eAntimicrobial-loaded biodegradable nanoemulsions for efficient clearance of intracellular pathogens in bacterial peritonitis.\u003c/em\u003e Biomaterials, 2023. \u003cstrong\u003e302\u003c/strong\u003e: p. 122344.\u003c/li\u003e\n\u003cli\u003eJennings, E., T.L.M. Thurston, and D.W. Holden, \u003cem\u003eSalmonella SPI-2 Type III Secretion System Effectors: Molecular Mechanisms And Physiological Consequences.\u003c/em\u003e Cell Host Microbe, 2017. \u003cstrong\u003e22\u003c/strong\u003e(2): p. 217-231.\u003c/li\u003e\n\u003cli\u003eValenzuela, C., et al., \u003cem\u003eSopB- and SifA-dependent shaping of the Salmonella-containing vacuole proteome in the social amoeba Dictyostelium discoideum.\u003c/em\u003e Cell Microbiol, 2021. \u003cstrong\u003e23\u003c/strong\u003e(1): p. e13263.\u003c/li\u003e\n\u003cli\u003eSettembre, C., et al., \u003cem\u003eTFEB links autophagy to lysosomal biogenesis.\u003c/em\u003e Science, 2011. \u003cstrong\u003e332\u003c/strong\u003e(6036): p. 1429-33.\u003c/li\u003e\n\u003cli\u003eAggarwal, R., et al., \u003cem\u003eAntibiotic resistance: a global crisis, problems and solutions.\u003c/em\u003e Crit Rev Microbiol, 2024. \u003cstrong\u003e50\u003c/strong\u003e(5): p. 896-921.\u003c/li\u003e\n\u003cli\u003eWileman, T., \u003cem\u003eAutophagy as a defence against intracellular pathogens.\u003c/em\u003e Essays Biochem, 2013. \u003cstrong\u003e55\u003c/strong\u003e: p. 153-63.\u003c/li\u003e\n\u003cli\u003eWu, S., et al., \u003cem\u003eSalmonella Interacts With Autophagy to Offense or Defense.\u003c/em\u003e Front Microbiol, 2020. \u003cstrong\u003e11\u003c/strong\u003e: p. 721.\u003c/li\u003e\n\u003cli\u003eWu, Y., et al., \u003cem\u003eLactobacillus plantarum postbiotics trigger AMPK-dependent autophagy to suppress Salmonella intracellular infection and NLRP3 inflammasome activation.\u003c/em\u003e J Cell Physiol, 2023. \u003cstrong\u003e238\u003c/strong\u003e(6): p. 1336-1353.\u003c/li\u003e\n\u003cli\u003eNader, W.O., et al., \u003cem\u003eTFEB overexpression alleviates autophagy-lysosomal deficits caused by progranulin insufficiency.\u003c/em\u003e Sci Rep, 2025. \u003cstrong\u003e15\u003c/strong\u003e(1): p. 26217.\u003c/li\u003e\n\u003cli\u003eBa, L., et al., \u003cem\u003eAllicin attenuates pathological cardiac hypertrophy by inhibiting autophagy via activation of PI3K/Akt/mTOR and MAPK/ERK/mTOR signaling pathways.\u003c/em\u003e Phytomedicine, 2019. \u003cstrong\u003e58\u003c/strong\u003e: p. 152765.\u003c/li\u003e\n\u003cli\u003eSadhu, S., et al., \u003cem\u003eGefitinib Results in Robust Host-Directed Immunity Against Salmonella Infection Through Proteo-Metabolomic Reprogramming.\u003c/em\u003e Front Immunol, 2021. \u003cstrong\u003e12\u003c/strong\u003e: p. 648710.\u003c/li\u003e\n\u003cli\u003eChang, Z., et al., \u003cem\u003eAllicin suppressed Escherichia coli-induced urinary tract infections by a novel MALT1/NF-\u0026kappa;B pathway.\u003c/em\u003e Food Funct, 2022. \u003cstrong\u003e13\u003c/strong\u003e(6): p. 3495-3511.\u003c/li\u003e\n\u003cli\u003eQin, Y., et al., \u003cem\u003eBrucella mediates autophagy, inflammation, and apoptosis to escape host killing.\u003c/em\u003e Front Cell Infect Microbiol, 2024. \u003cstrong\u003e14\u003c/strong\u003e: p. 1408407.\u003c/li\u003e\n\u003cli\u003eVan, T.T., et al., \u003cem\u003eThe antibiotic resistance characteristics of non-typhoidal Salmonella enterica isolated from food-producing animals, retail meat and humans in South East Asia.\u003c/em\u003e Int J Food Microbiol, 2012. \u003cstrong\u003e154\u003c/strong\u003e(3): p. 98-106.\u003c/li\u003e\n\u003cli\u003eTang, B., et al., \u003cem\u003eGenome-based risk assessment for foodborne Salmonella enterica from food animals in China: A One Health perspective.\u003c/em\u003e Int J Food Microbiol, 2023. \u003cstrong\u003e390\u003c/strong\u003e: p. 110120.\u003c/li\u003e\n\u003cli\u003eAjulo, S. and B. Awosile, \u003cem\u003eGlobal antimicrobial resistance and use surveillance system (GLASS 2022): Investigating the relationship between antimicrobial resistance and antimicrobial consumption data across the participating countries.\u003c/em\u003e PLoS One, 2024. \u003cstrong\u003e19\u003c/strong\u003e(2): p. e0297921.\u003c/li\u003e\n\u003cli\u003eBorah, P., et al., \u003cem\u003ePrevalence, antimicrobial resistance and virulence genes of Salmonella serovars isolated from humans and animals.\u003c/em\u003e Vet Res Commun, 2022. \u003cstrong\u003e46\u003c/strong\u003e(3): p. 799-810.\u003c/li\u003e\n\u003cli\u003eNagy, T.A., et al., \u003cem\u003eAutophagy Induction by a Small Molecule Inhibits Salmonella Survival in Macrophages and Mice.\u003c/em\u003e Antimicrob Agents Chemother, 2019. \u003cstrong\u003e63\u003c/strong\u003e(12).\u003c/li\u003e\n\u003cli\u003eWang, B., et al., \u003cem\u003eTFEB-vacuolar ATPase signaling regulates lysosomal function and microglial activation in tauopathy.\u003c/em\u003e Nat Neurosci, 2024. \u003cstrong\u003e27\u003c/strong\u003e(1): p. 48-62.\u003c/li\u003e\n\u003cli\u003eNakashima, A., et al., \u003cem\u003eEvidence for lysosomal biogenesis proteome defect and impaired autophagy in preeclampsia.\u003c/em\u003e Autophagy, 2020. \u003cstrong\u003e16\u003c/strong\u003e(10): p. 1771-1785.\u003c/li\u003e\n\u003cli\u003eZhao, X., et al., \u003cem\u003eBiochanin a Enhances the Defense Against Salmonella enterica Infection Through AMPK/ULK1/mTOR-Mediated Autophagy and Extracellular Traps and Reversing SPI-1-Dependent Macrophage (M\u0026Phi;) M2 Polarization.\u003c/em\u003e Front Cell Infect Microbiol, 2018. \u003cstrong\u003e8\u003c/strong\u003e: p. 318.\u003c/li\u003e\n\u003cli\u003eLosier, T.T. and R.C. Russell, \u003cem\u003eBacterial outer membrane vesicles trigger pre-activation of a xenophagic response via AMPK.\u003c/em\u003e Autophagy, 2019. \u003cstrong\u003e15\u003c/strong\u003e(8): p. 1489-1491.\u003c/li\u003e\n\u003cli\u003eLosier, T.T., et al., \u003cem\u003eAMPK Promotes Xenophagy through Priming of Autophagic Kinases upon Detection of Bacterial Outer Membrane Vesicles.\u003c/em\u003e Cell Rep, 2019. \u003cstrong\u003e26\u003c/strong\u003e(8): p. 2150-2165.e5.\u003c/li\u003e\n\u003cli\u003eGray, M.A., et al., \u003cem\u003ePhagocytosis Enhances Lysosomal and Bactericidal Properties by Activating the Transcription Factor TFEB.\u003c/em\u003e Curr Biol, 2016. \u003cstrong\u003e26\u003c/strong\u003e(15): p. 1955-1964.\u003c/li\u003e\n\u003cli\u003eRao, S., et al., \u003cem\u003eColonic epithelial cell-specific TFEB activation: a key mechanism promoting anti-bacterial defense in response to Salmonella infection.\u003c/em\u003e Front Microbiol, 2024. \u003cstrong\u003e15\u003c/strong\u003e: p. 1369471.\u003c/li\u003e\n\u003cli\u003eCabral-Fernandes, L., et al., \u003cem\u003eInvading Bacterial Pathogens Activate Transcription Factor EB in Epithelial Cells through the Amino Acid Starvation Pathway of mTORC1 Inhibition.\u003c/em\u003e Mol Cell Biol, 2022. \u003cstrong\u003e42\u003c/strong\u003e(9): p. e0024122.\u003c/li\u003e\n\u003cli\u003eZhuang, X.D., et al., \u003cem\u003eExogenous hydrogen sulfide alleviates high glucose-induced cardiotoxicity via inhibition of leptin signaling in H9c2 cells.\u003c/em\u003e Mol Cell Biochem, 2014. \u003cstrong\u003e391\u003c/strong\u003e(1-2): p. 147-55.\u003c/li\u003e\n\u003cli\u003eZhou, Y., et al., \u003cem\u003eApplication of Oleanolic Acid and Its Analogues in Combating Pathogenic Bacteria In Vitro/Vivo by a Two-Pronged Strategy of \u0026beta;-Lactamases and Hemolysins.\u003c/em\u003e ACS Omega, 2020. \u003cstrong\u003e5\u003c/strong\u003e(20): p. 11424-11438.\u003c/li\u003e\n\u003cli\u003eJiang, C., et al., \u003cem\u003eSesamol hinders the proliferation of intracellular bacteria by promoting fatty acid metabolism and decreasing excessive inflammation.\u003c/em\u003e Int Immunopharmacol, 2025. \u003cstrong\u003e146\u003c/strong\u003e: p. 113966.\u003c/li\u003e\n\u003cli\u003eWang, T., et al., \u003cem\u003eSynergistic Lysosomal Impairment and ER Stress Activation for Boosted Autophagy Dysfunction Based on Te Double-Headed Nano-Bullets.\u003c/em\u003e Small, 2022. \u003cstrong\u003e18\u003c/strong\u003e(27): p. e2201585.\u003c/li\u003e\n\u003cli\u003eLu, D., et al., \u003cem\u003eImidazole-Bearing Polymeric Micelles for Enhanced Cellular Uptake, Rapid Endosomal Escape, and On-demand Cargo Release.\u003c/em\u003e AAPS PharmSciTech, 2018. \u003cstrong\u003e19\u003c/strong\u003e(6): p. 2610-2619.\u003c/li\u003e\n\u003cli\u003eMartin, J.K., 2nd, et al., \u003cem\u003eA Dual-Mechanism Antibiotic Kills Gram-Negative Bacteria and Avoids Drug Resistance.\u003c/em\u003e Cell, 2020. \u003cstrong\u003e181\u003c/strong\u003e(7): p. 1518-1532.e14.\u003c/li\u003e\n\u003cli\u003eLayoun, A., M. Samba, and M.M. Santos, \u003cem\u003eIsolation of murine peritoneal macrophages to carry out gene expression analysis upon Toll-like receptors stimulation.\u003c/em\u003e J Vis Exp, 2015(98): p. e52749.\u003c/li\u003e\n\u003cli\u003eLiu, Y., et al., \u003cem\u003eThe immunoenhancement effects of starfish Asterias rollestoni polysaccharides in macrophages and cyclophosphamide-induced immunosuppression mouse models.\u003c/em\u003e Food Funct, 2020. \u003cstrong\u003e11\u003c/strong\u003e(12): p. 10700-10708.\u003c/li\u003e\n\u003cli\u003eB\u0026ouml;hme, J., et al., \u003cem\u003eMetformin enhances anti-mycobacterial responses by educating CD8+ T-cell immunometabolic circuits.\u003c/em\u003e Nat Commun, 2020. \u003cstrong\u003e11\u003c/strong\u003e(1): p. 5225.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Biology](https://bmcbiol.biomedcentral.com/)","snPcode":"12915","submissionUrl":"https://submission.springernature.com/new-submission/12915/3","title":"BMC Biology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Host-directed therapies, Autophagy, AMPK-TFEB-ATG5 axis, Vinblastine, Salmonella infection","lastPublishedDoi":"10.21203/rs.3.rs-9538087/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9538087/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e The rise of multidrug-resistant intracellular pathogens, such as \u003cem\u003eSalmonella\u003c/em\u003e, poses a significant global health threat due to their ability to evade conventional antibiotics within host cells. Host-directed therapeutic (HDT) strategies that leverage the autophagy–lysosome pathway to clear these pathogens offer a promising alternative, yet remain largely underexplored. This study aimed to identify potent HDT agents and elucidate their underlying molecular mechanisms.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e Through a phenotypic screen using integrated lysosomal probes and gentamicin protection assays, we identified the FDA-approved drug vinblastine (VBL) as a potent HDT agent against \u003cem\u003eSalmonella\u003c/em\u003e infection. Mechanistically, VBL triggers the phosphorylation of AMPK at Thr172, which relieves the mTOR-independent suppression of TFEB, thereby driving its nuclear translocation. Once in the nucleus, TFEB orchestrates a transcriptional program that upregulates autophagy–lysosome genes, specifically promoting ATG5-dependent autophagosome formation and enhancing lysosomal acidification. This coordinated response establishes a degradative environment that effectively eliminates intracellular bacteria. Genetic ablation of \u003cem\u003eATG5\u003c/em\u003e or pharmacological inhibition of AMPK completely abolished the antibacterial efficacy of VBL, confirming the necessity of the AMPK–TFEB–ATG5 axis. In a murine model of \u003cem\u003eSalmonella\u003c/em\u003einfection, VBL treatment dose-dependently reduced bacterial burden, restored cytokine homeostasis, and mitigated tissue pathology, correlating with autophagy activation in vivo.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e Our findings identify the activation of the AMPK–TFEB–ATG5 signaling axis as a critical host defense strategy. Furthermore, we nominate VBL as a promising host-directed therapeutic candidate for the treatment of drug-resistant intracellular infections through the repurposing of an existing clinical agent.\u003c/p\u003e","manuscriptTitle":"Vinblastine Activates the AMPK–TFEB–ATG5 Autophagy Axis to Restrict Intracellular Salmonella Infection","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-05-15 13:18:48","doi":"10.21203/rs.3.rs-9538087/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2026-05-15T07:53:56+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"265486396333267392271008283671765698331","date":"2026-05-13T13:36:31+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"153525652418890856294063712833785024443","date":"2026-05-11T15:11:31+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"128208110688992518512378552029112228328","date":"2026-05-08T22:07:25+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-05-06T13:27:09+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-04-27T12:25:33+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-04-27T10:57:33+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Biology","date":"2026-04-27T07:27:40+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Biology](https://bmcbiol.biomedcentral.com/)","snPcode":"12915","submissionUrl":"https://submission.springernature.com/new-submission/12915/3","title":"BMC Biology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"53ea42e0-bf4b-4392-a076-ac8824d1127c","owner":[],"postedDate":"May 15th, 2026","published":true,"recentEditorialEvents":[{"type":"editorInvitedReview","content":"","date":"2026-05-15T07:53:56+00:00","index":25,"fulltext":""},{"type":"reviewerAgreed","content":"265486396333267392271008283671765698331","date":"2026-05-13T13:36:31+00:00","index":23,"fulltext":""},{"type":"reviewerAgreed","content":"153525652418890856294063712833785024443","date":"2026-05-11T15:11:31+00:00","index":15,"fulltext":""},{"type":"reviewerAgreed","content":"128208110688992518512378552029112228328","date":"2026-05-08T22:07:25+00:00","index":14,"fulltext":""},{"type":"reviewersInvited","content":"12","date":"2026-05-06T13:27:09+00:00","index":"","fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-15T13:18:48+00:00","versionOfRecord":[],"versionCreatedAt":"2026-05-15 13:18:48","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9538087","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9538087","identity":"rs-9538087","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}