Cofilin-1 is a Redox-Sensitive Guard of the NLRP3 Inflammasome | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Cofilin-1 is a Redox-Sensitive Guard of the NLRP3 Inflammasome Jae Jin Chae, Yong Hwan Park, Ye Ji Kim, Yeliz Akkaya-Ulum, Daniel Kastner, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6648864/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 18 Mar, 2026 Read the published version in Nature Immunology → Version 1 posted You are reading this latest preprint version Abstract Mutations in NLRP3 cause a spectrum of autoinflammatory disease, cryopyrin-associated periodic syndromes (CAPS). Reactive oxygen species (ROS) play a key role in NLRP3 inflammasome activation. We identified cofilin-1, an actin-severing protein, as a negative regulator of the NLRP3 inflammasome. In resting cells, cofilin-1 directly bound NLRP3, but upon stimulation with NLRP3 inflammasome activators, it was oxidized by ROS and dissociated from NLRP3. CAPS-associated mutant NLRP3 exhibited reduced binding to cofilin-1 compared to wild-type. Residues 101–104 of cofilin-1 were critical for NLRP3 interaction. Oxidation-resistant peptides containing this NLRP3-binding motif suppressed inflammasome activation induced by endogenous CAPS-associated mutations and ex vivo NLRP3 activators such as ATP and nigericin, but not flagellin. Bioinformatic structural analyses corroborate a model in which cofilin-1 plays a pivotal role in NLRP3 activation by ROS and support the potential use of cofilin-1-derived peptides in patients who are unresponsive to or intolerant of other forms of NLRP3 blockade. Biological sciences/Immunology/Inflammation/Inflammasome Biological sciences/Immunology/Immunological disorders/Inflammatory diseases/Autoinflammatory syndrome Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 INTRODUCTION The inflammasome is an intracellular multiprotein complex that plays a crucial role in the inflammatory response by promoting the maturation and release of the proinflammatory cytokines interleukin (IL)-1β and IL-18 1 . The NLRP3 inflammasome is the most extensively studied inflammasome and has been demonstrated to be activated by a diverse array of pathogen-associated or danger-associated molecular patterns (PAMPs, DAMPs). NLRP3 is composed of an N-terminal pyrin domain (PYD), a central NACHT domain (that in turn comprises a fish-specific NACHT-associated [FISNA] domain, a nucleotide-binding domain [NBD] that mediates ATP hydrolysis, two helical domains [HD1 and HD2], and a winged helix domain [WHD]), and a C-terminal leucine rich repeat (LRR) domain 2, 3 . Missense mutations in the gene encoding NLRP3 cause a spectrum of dominantly inherited or de novo autoinflammatory diseases known as the cryopyrin-associated periodic syndromes (CAPS) characterized by recurrent episodes of fevers, urticarial skin rash, varying degrees of arthralgia/arthritis, neutrophil-mediated inflammation, an intense acute-phase response, and, at the severe end of the spectrum, central nervous system (CNS) inflammation 4, 5 . The activation of the NLRP3 inflammasome also has been implicated in various inflammatory and autoimmune diseases, such as gout 6 , atherosclerosis 7 , type 2 diabetes 8 , Alzheimer's disease 9, 10 , and pericarditis 11, 12 . Understanding the regulation and signaling pathways of NLRP3 inflammasome activation is crucial for developing therapeutic strategies to target inflammatory diseases. In the canonical pathway, the activation of the NLRP3 inflammasome involves two distinct signals. The initial signal, also known as the priming signal, induces the expression of components of the NLRP3 inflammasome, including NLRP3 itself and pro-IL-1β, in response to inflammatory cytokines or PAMPs, such as lipopolysaccharide (LPS), from bacteria. Under normal conditions, NLRP3 is thought to be maintained in a closed or inactive conformation, resembling a “cage”, preventing spontaneous activation and inappropriate inflammation 13 . However, upon exposure to certain danger signals, such as microbial components, environmental irritants, or endogenous danger signals from damaged cells, the inactive NLRP3 undergoes conformational changes, leading to its activation. These danger signals are believed to disrupt the stability of the inactive conformation and promote the assembly of the NLRP3 inflammasome complex. In addition to the activation signal, interaction of NLRP3 with NEK7 and hydrolysis of ATP by an ATPase activity on the NBD of NLRP3 are required prior to activation of the NLRP3 inflammasome 14, 15 . In response to the activation signals, three not necessarily mutually exclusive intracellular signaling pathways have been proposed for NLRP3 inflammasome activation: potassium efflux 16 , generation of reactive oxygen species (ROS) from mitochondria 17 , and cathepsin B released from ruptured lysosomes 18 . Recent data strongly suggest that multiple activation signals, in addition to the priming signal, are required for NLRP3 activation, and that this redundancy serves as a safeguard 19 . Despite the diversity of activating signals, ROS has been suggested as a major factor in NLRP3 inflammasome activation since many extracellular NLRP3 activators induce ROS generation. Moreover, monocytes from CAPS patients exhibit elevated ROS levels even in the absence of external stimulation 20, 21 . However, the molecular mechanism by which a change in cellular redox state leads to NLRP3 inflammasome activation, as well as the molecular pathogenesis of CAPS, has not been elucidated. ROS production from macrophages is an important component of the innate immune response against bacterial infections or their components (PAMPs), highlighting the dynamic interplay between host immune cells and pathogens during the infectious process. There is no evidence for post-translational modification of NLRP3 by ROS, nor for direct interaction of activators with NLRP3. This suggests that ROS might modulate NLRP3 inflammasome activation indirectly through an ROS-sensing molecule that binds NLRP3, as seen in the activation mechanism of the pyrin inflammasome, in which there is liberation of inhibitory 14-3-3 proteins from pyrin in response to upstream RhoA GTPase inactivation by certain bacterial toxins 22 . To study the mechanism of NLRP3 inflammasome activation by ROS and the molecular pathogenesis of CAPS, we screened for NLRP3-interacting proteins that inhibit inflammasome activation, and identified an actin-binding protein, cofilin-1. Cofilin-1 is one of the major regulators of actin dynamics by mediating filament severing and polymerization and its activity is regulated by phosphorylation and oxidation. We found that cofilin-1 regulates NLRP3 inflammasome activation by sensing alterations in the redox milieu independently of its actin-regulating activity. Moreover, we identified oxidation-resistant cofilin-1 peptides that are potent inhibitors of the NLRP3 inflammasome, thereby raising the possibility of a new class of NLRP3-blocking agents. RESULTS NLRP3 interacts with cofilin-1, and the interaction is substantially diminished by ATP. To identify negative regulators of the NLRP3 inflammasome, we screened proteins that interact with NLRP3 and dissociate after NLRP3 inflammasome activation. NLRP3 protein complexes were pulled down with an NLRP3-specific antibody from lysates of bone-marrow-derived macrophages (BMDMs) treated with LPS alone or with ATP after LPS priming. Immunoprecipitated complexes were separated on PAGE, and we found a band around 20 kDa that was present only in lysates of LPS-primed WT BMDMs but not in ATP-treated WT BMDMs nor NLRP3-deficient BMDMs (Fig. 1a). Mass spectrometry analysis identified five proteins in the ~20 kDa band, of which three proteins, including myosin regulatory light chain 12B (MYL12b), actin-related protein 2/3 complex subunit 4 (ARPC4), and cofilin-1 disappeared when the inflammasome was activated by ATP (Fig. 1b). Subsequent immunoblot analysis revealed that cofilin-1 is an interacting partner of NLRP3 in LPS-primed BMDMs while MYL12b and ARPC4 did not associate with NLRP3 (Fig. 1c). The interaction of cofilin-1 with NLRP3 was confirmed in a reciprocal co-immunoprecipitation assay with a cofilin-1 specific antibody (Fig. 1d). Cofilin-1 is a 19 kDa actin-severing enzyme that binds to actin, and NLRP3 is also known to bind to actin 23 . Thus, to examine whether the interaction of cofilin-1 and NLRP3 is due to direct binding or indirect binding mediated by actin, an in vitro pull-down assay was performed using purified recombinant cofilin-1 and NLRP3. Indeed, we observed that recombinant cofilin-1 was co-immunoprecipitated with recombinant NLRP3, and vice versa, which indicates a direct interaction of cofilin-1 with NLRP3 (Fig. 1e). Cofilin-1 is a negative regulator of the NLRP3 inflammasome. The NLRP3 inflammasome is activated by a wide range of pathogen-associated or danger-associated molecular patterns (PAMPs, DAMPs), including several microbial molecules, particulates, ion fluxes, as well as ATP. Thus, we examined the effect of various NLRP3 inflammasome activators on the NLRP3-cofilin-1 interaction. As seen in cells treated with ATP, the NLRP3-cofilin-1 interaction was also substantially decreased by nigericin, monosodium urate (MSU) crystals, KH7 (an adenylate cyclase inhibitor), or extracellular calcium 24 (Fig. 2a). Given that cofilin-1 is dissociated from NLRP3 upon its activation signals, we hypothesized that cofilin-1 may suppress the NLRP3 inflammasome. To examine the role of cofilin-1 in NLRP3 inflammasome activation further, the cofilin-1 gene ( Cfl1 ) was knocked down in mouse BMDMs by short interfering RNA (siRNA). Knockdown of Cfl1 in LPS-primed WT BMDMs induced spontaneous IL-1β release, which was dependent on the NLRP3 inflammasome, but independent on the NLRC4 (IPAF, ICE protease-activating factor), pyrin, or AIM2 (absent in melanoma 2) inflammasomes (Fig. 2b and Extended Data Fig. 1a). Moreover, we observed that IL-1β release from the BMDMs with Cfl1 knockdown was substantially increased in response to NLRP3 inflammasome activators, ATP or nigericin, but not by NLRC4 or AIM2 inflammasome activators, flagellin or double-stranded DNA (dsDNA), respectively (Fig 2c). Taken together, these results indicate that cofilin-1 specifically suppresses NLRP3 inflammasome activation. To investigate the structural basis of the NLRP3–cofilin-1 interaction, we modeled the full-length complex using AlphaFold3 25 . The predicted structure revealed a well-defined binding interface between cofilin-1 and both the NBD and LRR domain of NLRP3, comprising 46 atomic contacts within 5 Å (Fig. 2d and Extended Data Movie1). To dissect domain-specific interactions, additional models were generated with cofilin-1 bound to individual NLRP3 domains. The highest predicted binding affinity was observed with the combined NBD–LRR region, yielding a binding free energy (ΔG) of –20.6 kcal/mol and a dissociation constant (Kd) of 3.0 × 10⁻ 15 M (Extended Data Table 1). Consistent with this prediction, pull-down assays using NLRP3 constructs lacking individual domains demonstrated that the interaction with cofilin-1 is mediated through the NBD and LRR domains of NLRP3 (Fig. 2e). Because the NBD of NLRP3 is the most frequent site of CAPS-associated mutations, we next examined how disease-associated variants affect its interaction with cofilin-1. The interaction between cofilin-1 and eight NLRP3 missense mutations—validated as pathogenic in the international INFEVERS registry (https://infevers.umai-montpellier.fr/web/search.php?n=4) and distributed across the NBD and LRR domains—was markedly diminished compared to wild-type NLRP3 or a variant of uncertain significance (Fig. 2f and Extended Data Fig. 1b). Structural modeling of these eight mutations in complex with wild-type cofilin-1 predicted reduced binding affinity for all substitutions (ΔΔG_binding < 0) (Extended Data Fig. 1c,d, and Extended Data Table 2). Taken together, these results suggest that the spontaneous inflammasome activation observed in myeloid cells from CAPS patients may result from diminished inhibition of NLRP3 activation by cofilin-1. The interaction of cofilin-1 with NLRP3 depends on redox states of cofilin-1. Despite the diverse range of activators for the NLRP3 inflammasome, mitochondrial ROS generation is a common cellular response that plays a critical role in inflammasome activation 17 . Thiol groups of cysteines are among the most prominent targets for ROS-mediated oxidation in proteins 26 . The human or mouse cofilin-1 molecules contain four cysteine residues - Cys39, Cys80, Cys139, and Cys147 - that are potential targets for ROS. It has been reported that oxidation of these cysteines leads to the formation of intramolecular disulfide bridges, which cause conformational changes of cofilin-1 and prevent its phosphorylation at Ser3 27, 28, 29 . Taken together, these observations suggest that NLRP3 inflammasome activators may induce cofilin-1 oxidation, leading to the formation of intramolecular disulfide bonds (Fig 3a). To determine the redox status of cofilin-1 in response to NLRP3 inflammasome activators, we analyzed BMDMs by immunoblot using a monoclonal antibody that recognizes an epitope between Cys39 and Cys80 of cofilin-1 when cofilin-1 is in its reduced state (Extended Data Fig. 2a-c). We found that cofilin-1 in ATP- or nigericin-treated BMDMs was not readily detectable using the monoclonal antibody under non-reducing conditions, whereas it was detectable under reducing conditions (Fig. 3b). We also observed a loss of Ser3 phosphorylation of cofilin-1 upon treatment of BMDMs with ATP or nigericin (Fig. 3b), which is also evidence for cofilin-1 oxidation by NLRP3 activators 27 . To further investigate the role of ROS on cofilin-1 oxidation and NLRP3 inflammasome activation, we blocked ROS in ATP-treated BMDMs with an antioxidant, luteolin. In LPS-primed BMDMs, ATP-induced caspase-1 activation and IL-1β release were substantially diminished at the doses of luteolin that decreased oxidized cofilin-1 (Fig. 3c). It is noteworthy that LPS-induced priming, the expression of NLRP3 and pro-IL-1β were not attenuated by luteolin (Fig. 3c). Furthermore, in the luteolin-treated BMDMs, cofilin-1 was not dissociated from NLRP3 by ATP (Fig. 3d). These data suggest that the reduced form of cofilin-1 binds to NLRP3 to suppress its activation, and that cofilin-1 is dissociated from NLRP3 when cofilin-1 is oxidized by ROS generated by NLRP3 activators. Indeed, in an in vitro pull-down assay with recombinant cofilin-1 and NLRP3, the NLRP3-cofilin-1 interaction was decreased in a dose-dependent manner by H 2 O 2 that is known to oxidize cofilin-1 in vitro 27 (Fig. 3e). Extracellular potassium and MCC950 inhibit dissociation of cofilin-1 from NLRP3. Next, we investigated how the interaction of cofilin-1 with NLRP3 is affected by the NLRP3 inflammasome inhibitors, MCC950 (also named CRID3) 30 and high concentrations of extracellular potassium 16 . Consistent with previous studies, in LPS-primed BMDMs, ATP-driven IL-1β release was significantly inhibited by 100 nM of MCC950 or 25 mM of KCl. Interestingly, with both inhibitors, cofilin-1 remained bound to NLRP3 without being dissociated in ATP-treated BMDMs (Fig. 4a). Moreover, in the inhibitor-treated cells, cofilin-1 remained in the reduced form without being oxidized by ATP-induced ROS (Fig. 4a). MCC950 stabilizes the inactive state of NLRP3 by binding to a cleft spanned by the NBD, HD1, WHD, HD2, and transition LRR subdomains, precluding the conformational changes required for ATP-binding 2 , and possibly inhibiting the formation of the C39-C80 disulfide bond in the bound cofilin-1. In an in vitro pull-down assay, we observed that MCC950 had no appreciable effect on the binding of recombinant NLRP3 to recombinant cofilin-1 (Fig. 4b). The in vitro pull-down assay also demonstrated that potassium is not necessary for the NLRP3-cofilin-1 direct interaction, as the assay was conducted in a potassium-free buffer (Fig. 4b). However, extracellular potassium significantly suppressed ATP-induced ROS production in LPS-primed BMDMs (Fig. 4c,d), suggesting an indirect mechanism by which high concentrations of extracellular potassium may prevent the dissociation of cofilin-1 from NLRP3. To gain further insight into the role of potassium and ROS in NLRP3 inflammasome activation, we examined the effects of high concentrations of extracellular potassium or antioxidant on inflammasome activation in mutation-positive CAPS patients’ PBMCs, in which NLRP3 is constitutively activated 24 . Contrary to a previous study with BMDMs from KI-mice harboring CAPS-associated mutations 31 , extracellular potassium substantially blocked IL-1β release from LPS-primed CAPS PBMCs in a dose-dependent manner (Fig. 4e). Moreover, we also observed dose-dependent inhibition of IL-1β release by luteolin in the LPS-primed CAPS PBMCs (Fig. 4f). Taken together, these results are consistent with the hypothesis that cofilin-1 regulates the NLRP3 inflammasome by sensing ROS. Oxidation-resistant C39A/C80A mutant cofilin-1 suppresses NLRP3 inflammasome activation. To investigate cysteine residues of cofilin-1 that regulate the interaction with NLRP3 in response to ROS in vivo , we have generated cofilin-1 knockout (KO) and four knockin (KI) mice bearing oxidation-resistant cysteine to alanine mutations (C39A, C80A, C139A, and C147A) for each of the four cysteine residues. Homozygotes for cofilin-1 KO ( Cof1 -/- ) and C80A KI ( Cof1 C80A/C80A ) mice were embryonic lethal while Cof1 C39A/C39A , Cof1 C139A/C139A , and Cof1 C147A/C147A mice were produced and developed normally (Extended Data Fig. 3a-e). Considering that oxidation of cysteines of cofilin-1 results in the formation of an intramolecular disulfide bond between the two cysteines, we hypothesized that alanine substitution of a cysteine involved in disulfide bond formation may inhibit the dissociation of cofilin-1 from NLRP3 by ROS and subsequently suppress inflammasome activation. However, no suppression of NLRP3 inflammasome activation by ATP was observed in LPS-primed BMDMs of all mutant KI mice, Cof1 C39A/C39A , Cof1 C139A/C139A , Cof1 C147A/C147A , and Cof1 WT/C80A (Extended Data Fig. 3b-e). These results suggest that when cofilin-1 is oxidized by NLRP3 activators, more than one disulfide bond may form, leading to the dissociation of cofilin-1 from NLRP3. In addition to the Cys39-Cys80 intramolecular bonds, cofilin-1 has been shown to form dimers in vitro through intermolecular disulfide bonding when oxidized 32 . To examine whether cofilin-1 can be dimerized by intermolecular disulfide bonds in vivo , we expressed two kinds of cofilin-1 proteins each labeled with two different tags, myc or V5, in BMDMs. No intermolecular interaction was observed between WT cofilin-1 proteins, whereas cofilin-1 mutants with alanine substitutions at Cys39 (C39A) or Cys80 (C80A) interacted each other and the interaction was increased when the cells were treated with ATP (Extended Data Fig. 4a and Fig 5a). However, cofilin-1 failed to interact with itself when both Cys39 and Cys80 were substituted with alanine (Fig 5a). These data indicate that Cys39 and Cys80 of WT cofilin-1 preferentially form an intramolecular disulfide bond, but when one of the cysteine residues is mutated, the remaining cysteine forms a disulfide bond with that of another cofilin-1 (Extended Data Fig. 4b). Based on these data, we generated a structural model of oxidized cofilin-1 with Rosetta 33 , a bioinformatic tool, and manually introduced a disulfide bond between Cys39 and Cys80 using ChimeraX (version 1.9) 34 (Fig 5b). Structural alignment of the reduced and oxidized cofilin-1 revealed conformational differences (Fig. 5b and Extended Data Movie 2). Quantitative analysis showed a 558 Ų reduction in total solvent-accessible surface area in the oxidized form (Extended Data Table 3), indicative of a more compact tertiary structure following disulfide bond formation between Cys39 and Cys80. To assess the impact of cofilin-1 oxidation on its interaction with NLRP3, we conducted docking simulations using the HADDOCK2.4 web server 35 and selected the top-ranked cluster based on scoring parameters (Extended Data Table 4). The oxidized cofilin-1–NLRP3 complex displayed a significantly higher HADDOCK score (–52.5 ± 2.5) compared to the reduced form (–89.3 ± 1.9), along with increased van der Waals energy and a reduced buried surface area (Extended Data Table 5), indicating a weakened interaction following oxidation. These structural and computational analyses support a regulatory role for the Cys39–Cys80 disulfide bond in modulating cofilin-1–NLRP3 binding. Therefore, we next generated mouse macrophage J774A.1 cells ectopically expressing all combinations of mutant cofilin-1 proteins in which each of the two cysteines was substituted with alanine by retroviral transduction. Consistent with the BMDMs of the KI-mice, no inhibition of ATP-induced IL-1β release was observed in retroviral-transduced J774A.1 cells expressing mutant cofilin-1 with a single cysteine to alanine substitution (Fig. 5c). However, the level of IL-1β released by ATP was significantly reduced in the cells expressing cofilin-1 with C39A/C80A double mutations among the J774A.1 cells expressing cofilin-1 with two cysteine-to-alanine mutations (Fig. 5c). In contrast, AIM2 inflammasome activation induced by dsDNA and NLRC4 inflammasome activation induced by flagellin were not suppressed by C39A/C80A mutant cofilin-1 (Fig. 5c). These data indicate that oxidation of both Cys39 and Cys80 in cofilin-1 is required for NLRP3 inflammasome activation and C39A/C80A mutant cofilin-1 suppresses NLRP3. Consistent with this hypothesis, in a pull-down assay with BMDMs ectopically expressing WT and mutant cofilin-1 proteins, we observed that the C39A/C80A mutant cofilin-1 was not dissociated from NLRP3 by ATP, while cofilin-1 with a single mutation, C39A or C80A, was dissociated from NLRP3 by ATP, as was WT cofilin-1 (Fig. 5d). Four amino acid residues from 101 to 104 of cofilin-1 are essential for interaction with NLRP3. Cofilin-1 is a 19 kDa protein consisting of 166 amino acids, most of which comprise an actin‐depolymerizing factor homology (ADF‐H) domain containing a nuclear localization signal and a phosphatidylinositol 4,5-bisphosphate [PI(4,5)P 2 ] binding site (Fig. 6a). To determine the motif through which cofilin-1 binds to NLRP3, we pulled down recombinant GST fusion proteins containing the N-terminal (aa 2-84), middle (aa 41-127), or C-terminal (aa 85-166) half, or the full length cofilin-1, from lysates of LPS-primed differentiated U937 cells expressing endogenous NLRP3. Immunoblot analysis for NLRP3 revealed that the middle and C-terminal halves of cofilin-1 bound to NLRP3 (Fig. 6a, left panel). Since there is an overlapping region between the middle and C-terminal halves, we hypothesized that residues 85-127 harbor an NLRP3-binding motif. Indeed, no binding defect with NLRP3 was observed when the C-terminal end of cofilin-1 was deleted up to aa 135 (Fig. 6a, left panel), but in contrast, a binding defect with NLRP3 was observed when the C-terminal half was deleted from its N-terminus up to aa 105 (Fig. 6a, right panel). Taken together with the observation that the C-terminal portion of cofilin-1 with aa 100-166 still binds to NLRP3 (Fig. 6a, right panel), the binding motif of cofilin-1 for NLRP3 could be localized between aa 100 and aa 105. We also found that a cofilin-1 fragment (aa 95-127) consisting of 33 amino acid residues from 95 to 127, which includes the putative binding motif, strongly binds to NLRP3 (Fig. 6a). To determine the amino acid sequence of the binding motif, each amino acid residue from 99 to 106 of the aa 95-127 fragment was substituted with alanine or threonine. The cofilin-1 fragment spanning amino acids 95–127 failed to interact with NLRP3 when individual residues at positions 101 to 104 were substituted, indicating that the core binding motif comprises Phe101-Ile102-Phe103-Trp104 (Fig. 6b). To evaluate the structural and energetic contributions of this motif to NLRP3 binding, in silico modeling of full-length cofilin-1 variants containing alanine substitutions at each position was performed. All four alanine substitutions resulted in marked reductions in both the intrinsic stability of cofilin-1 and the thermodynamic stability of the cofilin-1–NLRP3 complex. Additionally, binding affinity, as estimated by ΔΔG binding values, was consistently decreased across all variants, supporting the critical role of this aromatic and hydrophobic motif in mediating high-affinity interactions with NLRP3 (Fig. 6c,d and Extended Data Table 6). In contrast, substitution of Phe103 with tyrosine (F103Y) preserved the hydrophobic character and resulted in minimal changes in complex stability (ΔΔG binding = –0.09 kcal/mol) (Fig. 6c,d and Extended Data Table 6). Further, F103Y was predicted to have milder impact by AlphaMissense 36 , CADD 37 , and REVEL 38 , suggesting that an aromatic amino acid at this site is tolerated (Extended Data Table 7). This prediction was experimentally validated by a pull-down assay, which showed that the F103Y mutation within the 95–127 fragment did not compromise NLRP3 binding (Fig. 6e). Cofilin-1 blocks ATPase activity of NLRP3 We next investigated how the NLRP3 inflammasome is inhibited by the cofilin-1 binding. Given that cofilin-1 binds to the NBD, which has ATPase activity, and that ATP hydrolysis is essential for NLRP3 inflammasome assembly 39, 40 and activation, we hypothesized that cofilin-1 may inhibit NLRP3 inflammasome activation by suppressing the ATPase activity of the NLRP3 NBD. In an assay measuring ATP hydrolysis, we observed that full-length cofilin-1 significantly suppressed the ATPase activity of NLRP3 (Fig. 7a). Moreover, the ATPase activity of NLRP3 was significantly suppressed by the WT aa 95-127 fragment, but not by a mutant fragment with a substitution of Phe103 to alanine (aa 95-127 F103A), which did not bind to NLRP3 (Fig. 6b and Fig. 7a). These results demonstrate that cofilin-1 binds to the NBD of NLRP3 and thereby blocks the ATPase activity of NLRP3. Peptides from cofilin-1 inhibit NLRP3 inflammasome activation. The cofilin-1 fragment comprising aa 95-127 contains the NLRP3-binding motif but lacks the cysteines responsible for regulating cofilin-1 dissociation from NLRP3 through oxidation-mediated disulfide bond formation. As expected, we observed that the binding of this fragment to NLRP3 remained unaffected by H 2 O 2 , while the binding of full length cofilin-1 was decreased by H 2 O 2 (Fig. 7b), suggesting that fragment aa 95-127 could be utilized as an inhibitor for the NLRP3 inflammasome. To investigate the impact of the aa 95-127 fragment on the NLRP3 inflammasome, we initially synthesized this fragment in peptide form along with another peptide corresponding to aa 134-166 of cofilin-1, excluding the NLRP3-binding motif. To avoid unintended activation of the AIM2 inflammasome during transfection, we delivered these peptides into BMDMs from AIM2 deficient mice. ATP- or nigericin-induced IL-1β release and caspase-1 activation were markedly inhibited by aa 95-127 but not by aa 134-166, whereas NLRC4 inflammasome activation induced by flagellin was not suppressed by aa 95-127 (Fig. 7c). As demonstrated previously, substitution of phenylalanine with alanine at position 103 (F103A) within the cofilin-1 fragment (aa 95–127) abrogated binding to NLRP3, whereas replacement with tyrosine (F103Y) preserved the interaction (Fig. 6b,e). Consistent with these binding data, the F103A-containing peptide (aa 95–127) failed to inhibit NLRP3 inflammasome activation. In contrast, the F103Y variant, which maintained NLRP3 binding, effectively suppressed NLRP3 inflammasome activity while exhibiting no inhibitory effect on the NLRC4 inflammasome (Fig. 7d). Additionally, we observed that the constitutive inflammasome activation of CAPS PBMCs was also substantially suppressed by peptides aa 95-127 or aa 95-127 F103Y, but not by peptide aa 95-127 F103A (Fig. 7e). Taken together, these data strongly support the proposal of a role for cofilin-1 in suppressing the NLRP3 inflammasome and suggest that fragment aa 95-127 of cofilin-1 potentially serves as an inhibitor for the NLRP3 inflammasome. Moreover, this finding holds significant promise for the development of therapeutic interventions targeting NLRP3-mediated inflammatory diseases, offering a novel approach to managing several acquired inflammatory diseases in which the NLRP3 inflammasome has been implicated. DISCUSSION Through an unbiased proteomic approach complemented with structural modeling, this paper presents, to our knowledge for the first time, strong evidence that cofilin-1 binds to NLRP3 and blocks the activation of the NLRP3 inflammasome, that cofilin-1 oxidation provides a mechanism for sensing intracellular ROS and releasing tonic NLRP3 inhibition, and that specific oxidation-resistant cofilin-1-derived peptides inhibit NLRP3 inflammasome activation. Our data add substantially to the emerging concept of homeostatic regulation of innate immunity 41 , and may also extend our abilities to functionally validate NLRP3 variants in a systematic fashion 3, 42 . The NLRP3 inflammasome is remarkable in its ability to respond to a broad spectrum of stimuli, including pathogens, cellular damage, metabolic stress, and environmental stressors. Rather than directly binding to these activators, NLRP3 detects intracellular physiological changes, such as potassium efflux and ROS generation, that regulate its activation. Our biochemical and modeling data demonstrate that cofilin-1 directly binds to both the NBD and LRR domains of NLRP3 in resting macrophages, perhaps accounting for the distribution of disease-associated NLRP3 variants, and prevents inflammasome activation. However, upon ROS-induced oxidative stress, cofilin-1 undergoes oxidation, leading to its dissociation from NLRP3 and subsequent inflammasome activation. Blocking cofilin-1 oxidation through cysteine mutations or antioxidant treatment resulted in sustained binding to NLRP3 and suppression of inflammasome activation, highlighting the critical role of redox reactions in this regulatory process. Our study also provides new mechanistic insights into CAPS-associated mutant NLRP3 activation. The actin-severing activity of cofilin-1 appears to be dispensable for NLRP3 inflammasome activation as the actin-severing activity is inhibited when the cysteines of colfilin-1 are oxidized 27, 29 . Moreover, our data demonstrate that peptides containing the NLRP3-binding motif, but lacking actin-severing activity, effectively suppress inflammasome activation, indicating that cofilin-1 modulates NLRP3 independently of cytoskeletal remodeling. We observed that mutant NLRP3 proteins causing CAPS exhibit significantly reduced binding to cofilin-1 compared to wild-type NLRP3, suggesting that impaired cofilin-1-mediated regulation contributes to the constitutive activation of these mutants. This finding further strengthens the concept that loss of negative regulatory mechanisms, rather than merely increased sensitivity to activators, plays a key role in the pathogenesis of CAPS. Our previous study of the pyrin inflammasome in familial Mediterranean fever (FMF) revealed a similar regulatory mechanism, in which the binding of inhibitory 14-3-3 proteins to mutant pyrin was substantially reduced compared to their binding to wild-type pyrin 22 . These findings suggest that, like the pyrin inflammasome, NLRP3 inflammasome activation follows a guard-type mechanism conserved in plant defense, in which host sensors detect common physiological disturbances rather than directly recognizing pathogen-associated molecular patterns, allowing the immune system to respond broadly to a wide range of infections and cellular stressors 43 . Thioredoxin-interacting protein (TXNIP) has been proposed to be required for NLRP3 activation in response to ROS through direct interaction in islet cells 44 . However, the role of TXNIP as a positive regulator mediating ROS-induced NLRP3 activation remains controversial. TXNIP activation primarily enhances IL-1β mRNA and intracellular pro-IL-1β levels rather than directly promoting IL-1β secretion 45 , and in BMDMs from TXNIP KO mice, no significant difference in IL-1β release was observed in response to inflammasome activators 46 . In contrast, our BMDM data demonstrate that cofilin-1 knockdown induces NLRP3 inflammasome activation without exogenous stimulation and enhanced ATP- or nigericin-induced NLRP3 inflammasome activation. Cofilin-1 oxidation may also create an autocrine positive feedback loop because oxidized cofilin-1 translocates to mitochondria, leading to mitochondrial dysfunction and increased ROS generation 47, 48 . Importantly, we identified a conserved motif (Phe-Ile-Phe-Trp, residues 101-104) in cofilin-1 that is essential for NLRP3 binding. An oxidation-resistant synthetic peptide containing this NLRP3-binding motif but not the cysteine residues that are oxidized by ROS effectively suppressed IL-1β release induced by both CAPS-associated NLRP3 mutations and canonical inflammasome activators. This finding opens new avenues for therapeutic development, as peptides mimicking this binding interface could serve as potential inhibitors of excessive NLRP3 activation, with a potentially broader impact than biologics that target IL-1b, IL-18, or Gasdermin D individually. Challenges of targeted-delivery remain, but RNA-based systems appear potentially feasible 49, 50 . Although MCC950 and related congeners represent another attractive approach, it is likely there will be a need for alternatives in patients who are unresponsive to 3 or intolerant of 51, 52 these agents. Given the broad involvement of NLRP3 in various inflammatory diseases, including gout 6 , type 2 diabetes 8 , atherosclerosis 7 , Alzheimer’s disease 9, 10 , and pericarditis 11, 12 , targeting the NLRP3-cofilin-1 interaction may represent an important opportunity for treating a spectrum of autoinflammatory and acquired inflammatory conditions. Declarations ACKNOWLEDGMENTS This work was supported by the Intramural Research Programs of the National Human Genome Research Institute. This research was also supported by the Korean Health Technology R&D Project, Ministry of Health and Welfare, South Korea (HR22C173405) and the National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIT) (RS-2023-00217595). References Fu, J., Schroder, K. & Wu, H. Mechanistic insights from inflammasome structures. Nat. Rev. Immunol. 24 ,518-535 (2024). Hochheiser, I.V. et al. Structure of the NLRP3 decamer bound to the cytokine release inhibitor CRID3. Nature 604 ,184-189 (2022). Feng, S. et al. Mechanisms of NLRP3 activation and inhibition elucidated by functional analysis of disease-associated variants. Nat. Immunol. 26 ,511-523 (2025). Hoffman, H.M., Mueller, J.L., Broide, D.H., Wanderer, A.A. & Kolodner, R.D. Mutation of a new gene encoding a putative pyrin-like protein causes familial cold autoinflammatory syndrome and Muckle-Wells syndrome. Nat. Genet. 29 ,301-305 (2001). Aksentijevich, I. et al. De novo CIAS1 mutations, cytokine activation, and evidence for genetic heterogeneity in patients with neonatal-onset multisystem inflammatory disease (NOMID): a new member of the expanding family of pyrin-associated autoinflammatory diseases. Arthritis Rheum. 46 ,3340-3348 (2002). Martinon, F., Petrilli, V., Mayor, A., Tardivel, A. & Tschopp, J. Gout-associated uric acid crystals activate the NALP3 inflammasome. Nature 440 ,237-241 (2006). Duewell, P. et al. NLRP3 inflammasomes are required for atherogenesis and activated by cholesterol crystals. Nature 464 ,1357-1361 (2010). Vandanmagsar, B. et al. The NLRP3 inflammasome instigates obesity-induced inflammation and insulin resistance. Nature medicine 17 ,179-188 (2011). Halle, A. et al. The NALP3 inflammasome is involved in the innate immune response to amyloid-beta. Nat. Immunol. 9 ,857-865 (2008). Heneka, M.T. et al. NLRP3 is activated in Alzheimer's disease and contributes to pathology in APP/PS1 mice. Nature 493 ,674-678 (2013). Mauro, A.G. et al. The Role of NLRP3 Inflammasome in Pericarditis: Potential for Therapeutic Approaches. JACC Basic Transl Sci 6 ,137-150 (2021). Vecchie, A. et al. Interleukin-1 and the NLRP3 Inflammasome in Pericardial Disease. Curr Cardiol Rep 23 ,157 (2021). Andreeva, L. et al. NLRP3 cages revealed by full-length mouse NLRP3 structure control pathway activation. Cell 184 ,6299-6312 e6222 (2021). He, Y., Zeng, M.Y., Yang, D., Motro, B. & Nunez, G. NEK7 is an essential mediator of NLRP3 activation downstream of potassium efflux. Nature 530 ,354-357 (2016). Shi, H. et al. NLRP3 activation and mitosis are mutually exclusive events coordinated by NEK7, a new inflammasome component. Nat. Immunol. 17 ,250-258 (2016). Petrilli, V. et al. Activation of the NALP3 inflammasome is triggered by low intracellular potassium concentration. Cell Death Differ. 14 ,1583-1589 (2007). Zhou, R., Yazdi, A.S., Menu, P. & Tschopp, J. A role for mitochondria in NLRP3 inflammasome activation. Nature 469 ,221-225 (2011). Bruchard, M. et al. Chemotherapy-triggered cathepsin B release in myeloid-derived suppressor cells activates the Nlrp3 inflammasome and promotes tumor growth. Nature medicine 19 ,57-64 (2013). Saller, B.S. et al. Acute suppression of mitochondrial ATP production prevents apoptosis and provides an essential signal for NLRP3 inflammasome activation. Immunity 58 ,90-107 e111 (2025). Tassi, S. et al. Altered redox state of monocytes from cryopyrin-associated periodic syndromes causes accelerated IL-1beta secretion. Proc. Natl. Acad. Sci. USA. 107 ,9789-9794 (2010). Balow, J.E., Jr. et al. Microarray-based gene expression profiling in patients with cryopyrin-associated periodic syndromes defines a disease-related signature and IL-1-responsive transcripts. Annals of the rheumatic diseases 72 ,1064-1070 (2013). Park, Y.H., Wood, G., Kastner, D.L. & Chae, J.J. Pyrin inflammasome activation and RhoA signaling in the autoinflammatory diseases FMF and HIDS. Nat. Immunol. 17 ,914-921 (2016). Burger, D., Fickentscher, C., de Moerloose, P. & Brandt, K.J. F-actin dampens NLRP3 inflammasome activity via Flightless-I and LRRFIP2. Sci Rep 6 ,29834 (2016). Lee, G.S. et al. The calcium-sensing receptor regulates the NLRP3 inflammasome through Ca2+ and cAMP. Nature 492 ,123-127 (2012). Abramson, J. et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature 630 ,493-500 (2024). Finkel, T. Signal transduction by reactive oxygen species. J. Cell Biol. 194 ,7-15 (2011). Klemke, M. et al. Oxidation of cofilin mediates T cell hyporesponsiveness under oxidative stress conditions. Immunity 29 ,404-413 (2008). Klejnot, M. et al. Analysis of the human cofilin 1 structure reveals conformational changes required for actin binding. Acta Crystallogr D Biol Crystallogr 69 ,1780-1788 (2013). Cameron, J.M. et al. Polarized cell motility induces hydrogen peroxide to inhibit cofilin via cysteine oxidation. Curr. Biol. 25 ,1520-1525 (2015). Coll, R.C. et al. A small-molecule inhibitor of the NLRP3 inflammasome for the treatment of inflammatory diseases. Nature medicine 21 ,248-255 (2015). Munoz-Planillo, R. et al. K(+) efflux is the common trigger of NLRP3 inflammasome activation by bacterial toxins and particulate matter. Immunity 38 ,1142-1153 (2013). Pfannstiel, J. et al. Human cofilin forms oligomers exhibiting actin bundling activity. J. Biol. Chem. 276 ,49476-49484 (2001). Leaver-Fay, A. et al. ROSETTA3: an object-oriented software suite for the simulation and design of macromolecules. Methods Enzymol 487 ,545-574 (2011). Goddard, T.D. et al. UCSF ChimeraX: Meeting modern challenges in visualization and analysis. Protein Sci 27 ,14-25 (2018). Honorato, R.V. et al. The HADDOCK2.4 web server for integrative modeling of biomolecular complexes. Nature protocols 19 ,3219-3241 (2024). Cheng, J. et al. Accurate proteome-wide missense variant effect prediction with AlphaMissense. Science 381 ,eadg7492 (2023). Schubach, M., Maass, T., Nazaretyan, L., Roner, S. & Kircher, M. CADD v1.7: using protein language models, regulatory CNNs and other nucleotide-level scores to improve genome-wide variant predictions. Nucleic acids research 52 ,D1143-D1154 (2024). Ioannidis, N.M. et al. REVEL: An Ensemble Method for Predicting the Pathogenicity of Rare Missense Variants. American journal of human genetics 99 ,877-885 (2016). Duncan, J.A. et al. Cryopyrin/NALP3 binds ATP/dATP, is an ATPase, and requires ATP binding to mediate inflammatory signaling. Proc. Natl. Acad. Sci. USA. 104 ,8041-8046 (2007). Brinkschulte, R. et al. ATP-binding and hydrolysis of human NLRP3. Commun Biol 5 ,1176 (2022). Liston, A. & Masters, S.L. Homeostasis-altering molecular processes as mechanisms of inflammasome activation. Nat. Rev. Immunol. 17 ,208-214 (2017). Cosson, C. et al. Functional diversity of NLRP3 gain-of-function mutants associated with CAPS autoinflammation. J. Exp. Med. 221 (2024). Jones, J.D. & Dangl, J.L. The plant immune system. Nature 444 ,323-329 (2006). Zhou, R., Tardivel, A., Thorens, B., Choi, I. & Tschopp, J. Thioredoxin-interacting protein links oxidative stress to inflammasome activation. Nat. Immunol. 11 ,136-140 (2010). Koenen, T.B. et al. Hyperglycemia activates caspase-1 and TXNIP-mediated IL-1beta transcription in human adipose tissue. Diabetes 60 ,517-524 (2011). Masters, S.L. et al. Activation of the NLRP3 inflammasome by islet amyloid polypeptide provides a mechanism for enhanced IL-1beta in type 2 diabetes. Nat. Immunol. 11 ,897-904 (2010). Klamt, F. et al. Oxidant-induced apoptosis is mediated by oxidation of the actin-regulatory protein cofilin. Nat Cell Biol 11 ,1241-1246 (2009). Hoffmann, L. et al. Cofilin1 oxidation links oxidative distress to mitochondrial demise and neuronal cell death. Cell Death Dis 12 ,953 (2021). Paunovska, K., Loughrey, D. & Dahlman, J.E. Drug delivery systems for RNA therapeutics. Nat Rev Genet 23 ,265-280 (2022). Taya, T., Kami, D., Teruyama, F., Matoba, S. & Gojo, S. Peptide-encoding gene transfer to modulate intracellular protein-protein interactions. Mol Ther Methods Clin Dev 32 ,101226 (2024). Li, H. et al. Therapeutic potential of MCC950, a specific inhibitor of NLRP3 inflammasome. Eur J Pharmacol 928 ,175091 (2022). Tang, F. et al. First-in-human phase 1 trial evaluating safety, pharmacokinetics, and pharmacodynamics of NLRP3 inflammasome inhibitor, GDC-2394, in healthy volunteers. Clin Transl Sci 16 ,1653-1666 (2023). METHODS Reagents Ultra-pure flagellin (tlrl-pstfla), ATP (tlrl-atpl), poly (dA:dT) (tlrl-patn), nigericin (tlrl-nig), MSU (tlrl-msu), and ultra-pure LPS (tlrl-3pelps) were obtained from InvivoGen. Luteolin (2874), MCC950 (5479), and KH7 (3834) were from Tocris Bioscience. Recombinant human NLRP3 protein (TP320952) was from Origene and recombinant human Cofilin-1 protein (CF01) was from Cytoskeleton. Mice We used 8- to 16-week-old male and female mice ( Mus musculus ) on a C57BL/6J background in our experiments. Wild-type (WT) C57BL/6J mice were obtained from the Jackson Laboratory. Pyrin-KO ( Mefv −/− ) mice have been described previously 16 . ASC-, NLRP3-, and NLRC4-knockout (KO) mice were gifts from V.M. Dixit (Genentech Inc.). Caspase-1 KO mice were from R. Flavell (Yale University). AIM2 KO mice were from E. Alnemri (Thomas Jefferson University). In each experiment, experimental and control mice were age and sex matched, with both male and female mice used depending on availability. All animal studies were performed in accordance with US National Institutes of Health guidelines and were approved by the Institutional Animal Care and Use Committee of the National Human Genome Research Institute. Cofilin-1-Deficient Mice were generated using a targeting construct by inserting a 4.3 kb genomic fragment encompassing upstream and exon 1 (5’ arm), 3.0-kb genomic fragment encompassing exon 2-4 flanking two loxP with neomycin resistant cassette, and 4.0-kb genomic fragment of downstream of cof1 . (3’ arm) into pPNT-double loxP. Linearized constructs were introduced into embryonic stem (ES) cells of C57BL/6 background. G418-resistant clones were screened for homologous recombination by PCR. Heterozygotes generated from founders were crossed with EIIa-Cre transgenic mice (Jackson Laboratory) to remove exon 2-4 with the neo cassette. Four knockin (KI) mice bearing oxidation-resistant cysteine to alanine mutations (C39A, C80A, C139A, and C147A) for each of the four cysteine residues in cofilin-1 were generated by homology-directed repair (HDR) using CRISPR-Cas9 genome editing. Single guide RNAs (sgRNAs) were 5’-GGTGCTCTTTTGCCTGAGTG-3’ for C39A, 5’-TTGCATCATAGAGTGCATAG-3’ for C80A, 5’-ATTACAAGCTAACTGCTACG-3’ for C139A, and 5’-GGTCAAGGACCGCTGCACCC-3’ for C147A. HDR donor oligonucleotides were 5’-CAAAAGTGGTGTAGGGGTCGTCCACAGTCTGCCCCACATCTCCTACCAGGATCTCCTTGCCCTCCTCCAGGATGATGTTCTTCTTGTCTTCACTCAGTGCAAAGAGCACCGCCTTCTTGCGTTTCTTCACTTCTTC-3’ for C39A, 5’-CATCCTGGAGGAGGGCAAGGAGATCCTGGTAGGAGATGTGGGGCAGACTGTGGACGACCCCTACACCACTTTTGTCAAGATGCTGCCAGACAAGGACGCGCGCTATGCACTCTATGATGCAACCTATGAGACCAAG-3’ for C80A, 5’-GAGGTGGCTCACAAAGGCTTGCCCTCCAGGGAAATGACGGCGCTGCCACCTAGTTTCTCTGCCAGGGTGCAGCGGTCCTTGACCTCTTCGTACGCGTTAGCTTGTAATTCATGCTTGATTCCTACAGGGTG-3’ for C139A, and 5’-AAATGACGGCGCTGCCACCTAGTTTCTCTGCAAGGGTGGCGCGGTCCTTGACCTCCTCGTAGCAGTTAGCTTGTAATTCATGCTTGATTCCTACAGGGTGAAAAGAGAGCAGTGAGCAGGAAGCACTGGGG-3’ for C147A. Cas9, sgRNA, and HDR donor oligonucleotides were transfected to mouse embryos at 0.5 day post coitum by electroporation. Electroporated zygotes were transferred to the oviducts of pseudopregnant females on the day of the vaginal plug. Patients Blood specimens from 5 CAPS patients were drawn after obtaining informed consent under a protocol approved by the National Institute of Arthritis and Musculoskeletal and Skin Diseases/National Institute of Diabetes and Digestive and Kidney Diseases Institutional Review Board. Cell preparation , inflammasome activation and immunoblot Bone marrow progenitors were isolated from the tibia and femur of 8–16-week-old male or female mice. The isolated progenitors were differentiated into macrophages (BMDMs) by culturing in Iscove's Modified Dulbecco's Media (IMDM; Gibco) supplemented with 20 ng/ml M-CSF (PeproTech), 10% heat-inactivated fetal bovine serum (FBS; Invitrogen), 1 mM sodium pyruvate (Invitrogen), 100 U/ml penicillin (Invitrogen), and 100 μg/ml streptomycin (Invitrogen). The differentiation process was carried out for 7 days in a humidified incubator at 37°C with 5% CO₂. BMDMs were replated in 12-well plates (1.0 × 10 6 cells per well) in DMEM (Invitrogen) containing 10% FBS and antibiotics.1 day prior to experiments. Human peripheral blood mononuclear cells (PBMCs) were isolated by LSM-Lymphocyte Separation Medium (50494, MP Biomedicals) from freshly drawn peripheral venous blood from patients, and plated in 12-well plates(2.0 × 10 6 cells per well) in RPMI 1640 (Invitrogen) containing 10% FBS and antibiotics. cDNAs encoding WT or various mutant cofilin-1 was cloned into pLNCX2 vector (631503,Takara) and then transfected into RetroPack PT67 cells (631510, Takara). The cell culture medium of the transfected PT67 cells, which contain viral particles, was collected by filtration with a low protein-binding0.22-μm syringe filter. The viral particle-containing medium was transferred to J774 cells for viral infection in the presence of polybrene (8 μg ml−1). Cells were centrifuged at 1,200 g for 90 min at 32 °C and incubated for 8 h. Transduced J774 cells were selected with G418 (800 μg ml −1 ) for 3 weeks and replated in 12-well plates (1.0 × 10 6 cells per well) in DMEM containing 10% FBS and antibiotics.1 day prior to experiments. BMDMs, PBMCs, or J774 cells were primed with 1 μg ml -1 LPS for 3 h. For AIM2 or NLRC4 inflammasome activation, 1 μg ml -1 of dsDNA with 2.5 μl ml -1 of Lipofectamine 2000 (Invitrogen) or 0.5 μg ml -1 flagellin with 25 μl ml -1 DOTAP (Sigma), respectively, were mixed in Opti-MEM and incubated for 10 min before treating the cells. For NLRP3 inflammasome activation, cells were treated with ATP (5 mM), nigericin (10 µM), MSU (200 µg ml -1 ), KH7 (50 µM), and CaCl 2 (1 mM). None of the reagents in these experiments induced cytotoxicity as confirmed by LDH assay (K311-400, BioVision). Cell culture supernatants were collected, and cells were lysed with M-PER mammalian protein extraction reagent (78501, Thermo Fisher Scientific). Lysates and supernatants were analyzed by immunoblot with antibodies to human IL-1β (AF-201-NA, R&D Systems); mouse IL-1β (AF-401-NA, R&D Systems); cofilin-1 (sc-33779, rabbit polyclonal; sc-53934, mouse monoclonal, specific for reduced cofilin-1; sc-376476, mouse monoclonal, Santa Cruz Biotechnology); MYL12B (sc-130331 Santa Cruz Biotechnology); ARPC4 (ab217056, abcam); human Caspase-1 (p20) (AG-20B-0048, Adipogen Life Sciences); mouse Caspase-1 (p20) (AG-20B-0042, Adipogen Life Sciences); actin (sc-1615HRP; Santa Cruz Biotechnology); myc (sc-40HRP, Santa Cruz Biotechnology); NLRP3 (AG-20B-0014-C100, Adipogen; 15101, Cell Signaling); or V5 (R961-25, Thermo Fisher scientific). Released IL-1β was also measured in supernatants by ELISA (MLB00C, R&D Systems). Mass-Compatible Silver Staining and Mass Spectrometry Immunoprecipitated protein samples with NLRP3 specific antibody were separated on a 4-20 % SDS-polyacrylamide gel. The gel was fixed in 50% methanol and 12% acetic acid for 30 min, followed by washing with 50% ethanol for 20 min and then with 10% ethanol for 10 min. The gel was sensitized with 0.02% sodium thiosulfate for 1 min and washed with distilled water (D.W) three times. Staining was performed with 0.1% silver nitrate for 30 min in the dark, followed by three quick washes with D.W. Development was carried out in a solution containing 2% sodium carbonate and 0.04% formaldehyde until protein bands became visible. The reaction was halted by incubating the gel in 5% acetic acid for 10 minutes, followed by thorough rinsing with distilled water. The stained bands were then excised from the gel using a clean scalpel, digested in-gel with sequencing grade modified trypsin, and analyzed on a NanoLC-ESI-MS/MS system, a service provided by ProtTech, Phoenixville, PA. The mass spectrometric data was used to search against the most recent non-redundant protein database (NR database) from NCBI with ProtTech’s ProtQuest software suite. Site-directed mutagenesis and gene knockdown assay Mutated human cofilin constructs were generated by site-directed mutagenesis using QuickChange Lightning Kit (210519-5, Agilent Technologies) according to the manufacturer's instructions. siRNAs targeting mouse cofilin-1 and negative control siRNA (4390847) were purchased from Invitrogen. The siRNAs for mouse Cof1 knockdown was 5′-AGGAGAUCCUGGUAGGAGATT -3′ (s121365). For siRNA gene knockdown experiments, 50 - 250 pmol siRNA was transfected into BMDMs (1x10 6 cells per well) by electroporation and replated in 12-well plates. After 18 h, the siRNA-transfected cells were primed with LPS for 7 h and the culture medium was replaced with serum free medium. Cell culture supernatants and lysates were collected after 2 h and analyzed by immunoblot or ELISA. Immunoprecipitation and Pull-down assay LPS-primed BMDMs treated with activators or inhibitors or 293T cells transiently transfected with expression constructs for the WT, CAPS-associated mutant, or various deleted forms of NLRP3 or WT or mutant cofilin-1 were lysed in an IP lysis buffer (30 mM Tris-Cl pH 7.4, 120 mM NaCl, 2 mM KCl, 2 mM EDTA, 10% Glycerol, 0.2% NP-40). The cell lysates were incubated overnight with antibodies to cofilin-1 (sc-376476, Santa Cruz Biotechnology); NLRP3 (AG-20B-0014-C100, Adipogen); V5 (R961-25, Thermo Fisher scientific); or myc (2278, Cell Signaling Technology) followed by incubation with protein A/G beads for 1 h at 4°C. After washing with the IP lysis buffer or PBS, bound proteins were eluted by 2× SDS sample buffer from the beads and analyzed by immunoblot with antibodies to cofilin-1 (sc-53934, Santa Cruz Biotechnology); NLRP3 (15101, Cell Signaling or AG-20B-0014-C100, Adipogen); V5 (R961-25, Thermo Fisher Scientific); or myc (sc-40HRP, Santa Cruz Biotechnology). For in vitro GST pull-down assay, purified GST-tagged full-length and various deleted cofilin-1 were bound to glutathione magnetic agarose beads (78602, Thermo Fisher Scientific) and incubated with phorbol 12-myristate 13-acetate (PMA) treated U937 cell lysates in a GST lysis buffer (20 mM Tris-Cl pH 8.0, 300 mM NaCl, 1 mM EDTA, 0.5% NP-40) for 30 min and washed with the GST lysis buffer and PBS. Bound proteins were eluted by 2× SDS sample buffer from the beads and analyzed by immunoblot with antibodies to NLRP3 or GST (sc-138 HRP, Santa Cruz Biotechnology). Recombinant cofilin-1 and NLRP3 proteins were incubated in the presence or absence of H₂O₂ for 30 min at 37°C, immunoprecipitated with antibodies to NLRP3, cofilin-1, or normal mouse IgG, and analyzed by immunoblot. Measurements of Intracellular ROS and potassium BMDMs were plated 6.25 × 10 3 cells/well in 96 well cell culture plate or 0.3 × 10 6 cells/well in 4 chamber cell culture slide one day before treatment. The cells were primed with LPS (100 ng ml -1 ) for 3 h, then treated with 5 or 10 μM MitoSox TM Green or Red mitochondrial superoxide indicators (M36009, Thermo Fisher Scientific) or Asante potassium green-2 AM y(ab142806, abcam) for 10 min. Following washing with PBS, cells were treated with 5 mM ATP for 5 min co-treatment with luteolin, KCl, or MCC950. Fluorescent signals were measured by a plate reader (Victor3 TM , Perkin Elmer) or captured by confocal microscopy using Confocal Laser Scanning microscope (LSM 710; Carl Zeiss) and analyzed to assess the levels of intracellular ROS. Measurement of the ATPase activity of NLRP3 Human recombinant 0.15 ug NLRP3 protein (100190; BPS Bioscience) was incubated with purified GST, GST-tagged full-length cofilin-1, or GST-tagged WT or F103A mutant aa 95-127 cofilin-1 fragment in a reaction buffer (100 mM Tris pH 7.8, 2.8 mM EDTA, 100 mM MgCl 2 , 15 mM KCl, 665 mM NaCl) at RT for 1 h followed by the addition of ATP (1 mM) for 40 min at 37 ◦C. The hydrolysis of ATP by NLRP3 was measured using ADP-Glo max assay (V7001, Promega, Madison, USA) according to the manufacturer’s instruction. Transfection of Peptides Peptides were chemically synthesized with >95% purity by custom peptide synthesis service from Biomatik Corporation, Ontario, Canada. BMDMs from AIM2-deficient mice were plated 0.5 × 10 6 cells/well in 12 well cell culture plate one day before transfection and PBMCs from CAPS patients were plated 2 × 10 6 cells/well in 12 well cell culture plate on the day of transfection. Cells were primed with LPS (1 μg ml -1 for BMDMs, 0.1 μg ml -1 for PBMCs) for 3 h and changed the culture media with 350 ul of FBS-free DMEM (BMDMs) or RPMI (PBMCs). Peptides (20 uM, final concentration) were transfected into BMDMs using the Xfect TM protein transfection reagent (631324, Takara Bio Inc.), according to the manufacturer’s instruction. After 15 min, BMDMs were treated with ATP (5 mM), nigericin (1.25 uM), or flagellin (0.5 μg ml -1 with 25 μl ml -1 DOTAP) for 30 min, and PBMCs were incubated for 1 h. In-silico analysis Protein structure acquisition and complex prediction. Initial monomeric structures for human cofilin-1 and NLRP3 were obtained from the AlphaFold Protein Structure Database (AF-P23528-F1 and AF-Q96P20-F1). Canonical protein sequences retrieved from UniProt (CFL1: sp|P23528|COF1_HUMAN; NLRP3: sp|Q96P20|NALP3_HUMAN) were submitted to the AlphaFold3 server using the complex prediction mode to generate de novo models of protein–protein interaction 21 . Two configurations were modeled: full-length cofilin-1 with full-length NLRP3 (FL–FL), and a C-terminal peptide of cofilin-1 (residues 95–127) with full-length NLRP3 (P–FL). Chain A was designated as cofilin-1 (or peptide-cofilin-1) and chain B as NLRP3 in all models. A spin movie of the cofilin-1–NLRP3 complex was created using UCSF ChimeraX (version 1.9) 31 . Mutagenesis and structural analysis. Point mutations were introduced into each model manually using PyMOL v3.0 44 , and mutant structures were evaluated without further energy minimization. PyMOL was also used to visualize side-chain level residue contacts and evaluate structural interaction types, including van der Waals forces, hydrophobic packing, hydrogen bonding, aromatic stacking, and ionic contacts. Both the FL–FL and P–FL complexes were analyzed independently. In addition, interatomic contacts within 5 Å were calculated for all wild-type and mutant models to quantify the number of angstrom-level interactions at the protein–protein interface. Stability, flexibility, and binding prediction. The effect of each mutation on protein stability, conformational flexibility, and protein–protein binding affinity was assessed using multiple complementary in silico prediction tools. Free energy changes (ΔΔG) were calculated as the difference between wild-type and mutant states (ΔΔG = ΔG_WT − ΔG_Mutant), where negative values reflect destabilization or reduced binding affinity [4-10]. Mutational effects on ΔΔG were predicted using mCSM 45 , DUET 46 , DynaMut 47 , DynaMut2 48 , DDMut 49 , SDM 50 , and ENCoM 51 . ENCoM was further used to compute changes in vibrational entropy (ΔΔS_vib). These predictors estimate how missense variants affect either monomeric protein stability or complex integrity using graph-based approaches and statistical models trained on experimental ΔΔG measurements. Changes in protein–protein binding affinity (ΔΔG_binding) were estimated using DDMut-PPI 52 and mCSM-PPI2 53 . All predictions were calculated using both full-length and peptide-bound models of the Cofilin-1–NLRP3 complex. A consensus approach between tools was used to evaluate overall mutation effect. Variant impact predictions. Variants were annotated using the Ensembl Variant Effect Predictor (VEP). Pathogenicity scores were obtained from AlphaMissense 33 , CADD v1.7 34 , and REVEL 35 . Allele frequencies and population-level constraint metrics were derived from the gnomAD database 54 to assess variant rarity and potential functional impact. Domain-level interaction prediction. To assess which domains of NLRP3 contribute most to cofilin-1 binding, we generated models of cofilin-1 with truncated NLRP3 constructs (PYD, PYD+NACHT, LRR, NACHT+LRR). Binding affinities (ΔG) and dissociation constants (Kd) were calculated using the PRODIGY (PROtein binDIng enerGY prediction) web server 55 . Interface contact types and non-interacting surfaces were also extracted for interaction profiling. Structural modeling of oxidized cofilin-1. Using Robetta 56 available at https://robetta.bakerlab.org), which utilizes the Rosetta software suite 30 , we submitted the monomeric structure for human cofilin-1 (AF-P23528-F1) for structural refinement to reduce the distance between Cys39 and Cys80, which were initially 11.6 Å apart. The PDB output of Rosetta was examined using ChimeraX for the appropriate bond geometry, ensuring that the sulfur atoms of the cysteine residues were within a typical bond distance (approximately 2.0-2.5 Å). We verified that the final model of cofilin-1 after Robetta optimization placed Cys39 and Cys80 2.1 Å apart, facilitating the formation of a disulfide bond. We then used ChimeraX to manually introduce a disulfide bond between the Cys39 and Cys80 residues, representing the hypothetical oxidized form of cofilin-1. The input and output cofilin-1 structures were aligned, compared, and a spin movie animation was created to illustrate the dynamic structural differences between the two conformations. Solvent accessible surface area (SASA) values for reduced and oxidized cofilin-1 models were calculated using ChimeraX. The ‘measure sasa’ command was applied to each model using the default probe radius of 1.4 Å and vertex density of 2.0. Total SASA values were recorded and compared to assess conformational changes resulting from disulfide bond formation. We then used the HADDOCK2.4 web server 32 to generate a model for the oxidized cofilin-1–NLRP3 complex. The Rosetta/ChimeraX output oxidized cofilin-1 PDB and NLRP3 PDB obtained from the AlphaFold Protein Structure Database (AF-Q96P20-F1) were used as input files. Data obtained from the Alphafold3 model of cofilin-1 and NLRP3 were used to define the probable interface residues. Among the HADDOCK output data for the oxidized cofilin-1–NLRP3 complex, two clusters displayed top-ranking scores (Clusters 1 and 3; see Extended Data Table 4 for detailed comparison). Although Cluster 3 had a slightly lower average HADDOCK score, we selected Cluster 1 for subsequent analysis, as the most reliable docking solution. This decision was based on its substantially larger cluster size (49 vs. 14), indicating better sampling convergence and increased confidence in the modeled interaction. Additionally, Cluster 1 showed advantages in terms of interface quality, with stronger electrostatic energy and greater buried surface area—both suggestive of a stronger and more stable interface. To enable direct comparison, we also evaluated the AlphaFold3-predicted cofilin-1–NLRP3 complex using the HADDOCK scoring protocol, by submitting the pre-assembled complex structure. Data analysis, statistics and experimental replicates Statistical analysis was carried out using a nonparametric Mann-Whitney t test, and the unpaired two-tailed t test using Prism software (GraphPad). A P value of ≤ 0.05 was considered statistically significant. The number of reproduced experimental repeats is described in the relevant figure legends. The investigators were not blinded to allocation during experiments and outcome assessment, except as noted above. 53. Schrödinger, L. The PyMOL Molecular Graphics System, Version 3.0. (2023). 54. Pires, D.E., Ascher, D.B. & Blundell, T.L. mCSM: predicting the effects of mutations in proteins using graph-based signatures. Bioinformatics 30 ,335-342 (2014). 55. Pires, D.E., Ascher, D.B. & Blundell, T.L. DUET: a server for predicting effects of mutations on protein stability using an integrated computational approach. Nucleic acids research 42 ,W314-319 (2014). 56. Rodrigues, C.H., Pires, D.E. & Ascher, D.B. DynaMut: predicting the impact of mutations on protein conformation, flexibility and stability. Nucleic acids research 46 ,W350-W355 (2018). 57. Rodrigues, C.H.M., Pires, D.E.V. & Ascher, D.B. DynaMut2: Assessing changes in stability and flexibility upon single and multiple point missense mutations. Protein Sci 30 ,60-69 (2021). 58. Zhou, Y., Pan, Q., Pires, D.E.V., Rodrigues, C.H.M. & Ascher, D.B. DDMut: predicting effects of mutations on protein stability using deep learning. Nucleic acids research 51 ,W122-W128 (2023). 59. Worth, C.L., Preissner, R. & Blundell, T.L. SDM--a server for predicting effects of mutations on protein stability and malfunction. Nucleic acids research 39 ,W215-222 (2011). 60. Frappier, V., Chartier, M. & Najmanovich, R.J. ENCoM server: exploring protein conformational space and the effect of mutations on protein function and stability. Nucleic acids research 43 ,W395-400 (2015). 61. Zhou, Y., Myung, Y., Rodrigues, C.H.M. & Ascher, D.B. DDMut-PPI: predicting effects of mutations on protein-protein interactions using graph-based deep learning. Nucleic acids research 52 ,W207-W214 (2024). 62. Rodrigues, C.H.M., Myung, Y., Pires, D.E.V. & Ascher, D.B. mCSM-PPI2: predicting the effects of mutations on protein-protein interactions. Nucleic acids research 47 ,W338-W344 (2019). 63. Chen, S. et al. A genomic mutational constraint map using variation in 76,156 human genomes. Nature 625 ,92-100 (2024). 64. Xue, L.C., Rodrigues, J.P., Kastritis, P.L., Bonvin, A.M. & Vangone, A. PRODIGY: a web server for predicting the binding affinity of protein-protein complexes. Bioinformatics 32 ,3676-3678 (2016). 65. Kim, D.E., Chivian, D. & Baker, D. Protein structure prediction and analysis using the Robetta server. Nucleic acids research 32 ,W526-531 (2004). Additional Declarations There is NO Competing Interest. Supplementary Files ExtendedDataFig1.pdf Extended Data Fig. 1 Cofilin-1 is a negative regulator of the NLRP3 inflammasome. a, IL-1β Measurements of culture supernatants from WT, Nlrc4 -, Mefv -, and Aim2 -deficient BMDMs transiently transfected with negative control siRNA (N.C.) or siRNA targeting Cfl1 , then treated with LPS for 9h. n =3, mean + s.e.m, *** P ≤ 0.001 and **** P ≤ 0.0001 (unpaired two-tailed t -test). b, Immunoblot analysis with antibody to cofilin-1 in proteins IP with antibody to myc from Lys of 293T cells transiently expressing WT, the V198M variant of uncertain significance, or CAPS-associated D303G mutant NLRP3 proteins. Data are representative of three independent experiments with similar results. c, Structural model of the cofilin-1–NLRP3 complex highlighting the positions of eight CAPS-associated NLRP3 mutations. d, Predicted changes in binding affinity (ΔΔG_binding) between cofilin-1 and NLRP3 variants harboring CAPS-associated mutations, relative to wild-type NLRP3. ExtendedDataFig2.pdf Extended Data Fig. 2 Epitope mapping of a Monoclonal Cofilin-1 Antibody. a,b, Immunoblot analysis of recombinant GST-tagged full-length or indicated fragments of cofilin-1 proteins (above lanes) with antibody to GST (a) or with monoclonal antibody to cofilin-1 (b). c, The schematic structure of full-length cofilin-1 with lines corresponding to N-terminal (aa 1-84), middle (aa 41-127), and C-terminal (aa 85-166) halves of cofilin-1. NLS, nuclear localization signal; ADF-H, actin-depolymerizing factor homology domain; PI(4,5)P 2 ; phosphatidylinositol 4,5-bisphosphate binding site. ExtendedDataFig3.pdf Extended Data Fig. 3 IL-1β releases are not suppressed in BMDMs of KI mice harboring single cysteine to alanine mutation. a-e, IL-1β measurements of culture supernatants of LPS-primed BMDMs from WT ( Cof1 WT/WT ), Cof1 WT/- (a), Cof1 C39A/C39A (b), Cof1 WT/C80A (c), Cof1 C139A/C139A (d), and Cof1 C147A/C147A (e) mice treated with 5 mM ATP. n =5. ExtendedDataFig4.pdf Extended Data Fig. 4 Cofilin-1 forms intermolecular disulfide bonds. a, Immunoblot analysis with antibody to V5 or myc for cofilin-1 in proteins IP with anti-V5 antibody from Lys of Aim2 -deficient BMDMs transiently expressing both V5-tagged and myc-tagged WT cofilin-1 or cofilin-1 with various oxidation resistant cysteine to alanine substitutions (above lanes) and treated with or without ATP. b, Proposed model for formation of intramolecular disulfide bond in WT cofilin-1 and intermolecular disulfide bond between two C39A or C80A mutant cofilin-1 molecules when oxidized by ROS. ExtendedDataTable1.xlsx Extended Data Table 1 ExtendedDataTable2.xlsx Extended Data Table 2 ExtendedDataTable3.xlsx Extended Data Table 3 ExtendedDataTable4.xlsx Extended Data Table 4 ExtendedDataTable5.xlsx Extended Data Table 5 ExtendedDataTable6.xlsx Extended Data Table 6 ExtendedDataTable7.xlsx Extended Data Table 7 Extendeddatamovie1.mp4 Extended Data movie 1 Extendeddatamovie2.mp4 Extended Data movie 2 Cite Share Download PDF Status: Published Journal Publication published 18 Mar, 2026 Read the published version in Nature Immunology → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6648864","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":459802191,"identity":"005a5ce0-e24c-44ff-b61a-4e1dbdda4958","order_by":0,"name":"Jae Jin Chae","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0UlEQVRIiWNgGAWjYDACCRCuYGBgYwcyEhuI1nIGqIWZJC2MbUACpIWRGC38s5sfPrCct02ej5mB7cHDHQx2/RIJBCy5c8zYQHLbbcM2ZgZ2g8QzDMkzZxDQYiCRYCYB1MII1MImkdjGkGxw5gAhLenff0jOuW1PipYcMwbJhtuJMC12BscbCPjlRk6xhMSx28ltzIxtQC0SCZLtBLTwz0jf+Fmi5rbt/PbmY5I/22zs+Znx6wADZgkwBY4UCeJik/EDEseeGB2jYBSMglEwsgAAOec8s+xr+eUAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0003-0719-4349","institution":"NHGRI/National Institutes of Health","correspondingAuthor":true,"prefix":"","firstName":"Jae","middleName":"Jin","lastName":"Chae","suffix":""},{"id":459802192,"identity":"f997e7ec-45e5-42fd-b8de-d1c2f0f08a5d","order_by":1,"name":"Yong Hwan Park","email":"","orcid":"","institution":"Ajou University","correspondingAuthor":false,"prefix":"","firstName":"Yong","middleName":"Hwan","lastName":"Park","suffix":""},{"id":459802193,"identity":"989b1e8d-7d12-49e8-865a-ca23ccb0da4f","order_by":2,"name":"Ye Ji Kim","email":"","orcid":"","institution":"Ajou University","correspondingAuthor":false,"prefix":"","firstName":"Ye","middleName":"Ji","lastName":"Kim","suffix":""},{"id":459802194,"identity":"55fd68a6-7613-4052-b283-495cf8d532b6","order_by":3,"name":"Yeliz Akkaya-Ulum","email":"","orcid":"","institution":"NHGRI/National Institutes of Health","correspondingAuthor":false,"prefix":"","firstName":"Yeliz","middleName":"","lastName":"Akkaya-Ulum","suffix":""},{"id":459802195,"identity":"4597f029-2220-4500-91d9-26d4e66c3d8c","order_by":4,"name":"Daniel Kastner","email":"","orcid":"https://orcid.org/0000-0001-7188-4550","institution":"NHGRI/National Institutes of Health","correspondingAuthor":false,"prefix":"","firstName":"Daniel","middleName":"","lastName":"Kastner","suffix":""},{"id":459802196,"identity":"a20e1053-0b6c-472e-9f1c-e6d221ec6b3a","order_by":5,"name":"Ezgi D. Batu","email":"","orcid":"https://orcid.org/0000-0003-1065-2363","institution":"NHGRI/National Institutes of Health","correspondingAuthor":false,"prefix":"","firstName":"Ezgi","middleName":"D.","lastName":"Batu","suffix":""},{"id":459802197,"identity":"2c0e2daf-256b-4fdc-bcad-c667fa7d0760","order_by":6,"name":"Brynja Matthíasardóttir","email":"","orcid":"","institution":"NHGRI/National Institutes of Health","correspondingAuthor":false,"prefix":"","firstName":"Brynja","middleName":"","lastName":"Matthíasardóttir","suffix":""}],"badges":[],"createdAt":"2025-05-12 17:30:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6648864/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6648864/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41590-026-02477-8","type":"published","date":"2026-03-18T04:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":83356556,"identity":"449eb9f8-0179-45fb-ad50-2c93cab7dbe5","added_by":"auto","created_at":"2025-05-23 15:12:48","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2777918,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNLRP3 interacts with cofilin-1.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e, PAGE-silver staining analysis of immunoprecipitated (IP) NLRP3 binding proteins in lysates (Lys) of wild-type (WT) or \u003cem\u003eNlrp3\u003c/em\u003e-deficient (\u003cem\u003eNlrp3\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e) BMDMs treated without or with ATP. \u003cstrong\u003eb\u003c/strong\u003e, Mass spectrometry analysis of NLRP3 binding proteins in a ~20kDa band, indicated with red arrow in \u003cstrong\u003ea\u003c/strong\u003e, of IP proteins from WT BMDMs treated without or with ATP. \u003cstrong\u003ec\u003c/strong\u003e, Immunoblot analysis of NLRP3, MYL12b, ARPC4, and cofilin-1 in proteins IP with anti-NLRP3 antibody from Lys of WT or \u003cem\u003eNlrp3\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e BMDMs treated with or without ATP. \u003cstrong\u003ed\u003c/strong\u003e, Immunoblot analysis of NLRP3 and cofilin-1 in proteins IP with anti-cofilin-1 antibody from Lys of WT or \u003cem\u003eNlrp3\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e BMDMs treated with or without ATP. \u003cstrong\u003ee\u003c/strong\u003e, Immunoblot analysis of NLRP3 and cofilin-1 in proteins IP with anti-cofilin-1, anti-NLRP3 antibodies, or control IgG from mixtures of purified recombinant cofilin-1 and NLRP3 proteins. Data are representative of three independent experiments with similar results (\u003cstrong\u003ea\u003c/strong\u003e,\u003cstrong\u003ec\u003c/strong\u003e-\u003cstrong\u003ee\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/fe58cfa6a0cf08055f1e5d75.jpg"},{"id":83355472,"identity":"f1017345-39a7-41e2-9d71-a688943be6b3","added_by":"auto","created_at":"2025-05-23 15:04:49","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":8078035,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCofilin-1 is a negative regulator of the NLRP3 inflammasome.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e, Immunoblot analysis of NLRP3 and cofilin-1 in proteins IP with anti-cofilin-1 antibody from Lys of WT BMDMs treated with indicated NLRP3 inflammasome activators (above lanes). \u003cstrong\u003eb\u003c/strong\u003e, Immunoblot analysis of IL-1β in culture supernatants (Sup) and Lys of WT, \u003cem\u003eAsc-\u003c/em\u003e, \u003cem\u003eCasp1-\u003c/em\u003e, or \u003cem\u003eNlrp3\u003c/em\u003e-deficient BMDMs transiently transfected with negative control siRNA with no substantial sequence similarity to mouse or human gene sequences (N.C.) or siRNA targeting \u003cem\u003eCfl1\u003c/em\u003e, then treated with LPS for 9h. \u003cstrong\u003ec\u003c/strong\u003e, Immunoblot analysis of IL-1β in Sup and Lys of LPS-primed WT BMDMs transiently transfected with negative control siRNA or siRNA targeting \u003cem\u003eCfl1\u003c/em\u003e, then treated with ATP, nigericin, flagellin or dsDNA (poly(dA:dT)). \u003cstrong\u003ed\u003c/strong\u003e, Structural model of the predicted cofilin-1-NLRP3 complex, showing full-length cofilin-1 (orange) bound to NLRP3 (grey), with NLRP3 domains highlighted by region: PYD (light blue), NBD (green), and LRR (blue). \u003cstrong\u003ee\u003c/strong\u003e, Immunoblot analysis with antibody to endogenous cofilin-1 in proteins IP with anti-V5 antibody for NLRP3 from Lys of 293T cells transiently expressing full-length NLRP3 or various deletion mutants of NLRP3. Above blots, the schematic structure of full-length NLRP3 and its deletion mutants. PYD, PYRIN domain; NBD, nucleotide-binding domain; LRR, leucine-rich repeats. \u003cstrong\u003ef\u003c/strong\u003e, Immunoblot analysis with antibody to myc for NLRP3 in proteins IP with antibody to endogenous cofilin-1 from Lys of 293T cells transiently expressing WT or CAPS-associated mutant NLRP3. Data are representative of three independent experiments with similar results (\u003cstrong\u003ea\u003c/strong\u003e-\u003cstrong\u003ec\u003c/strong\u003e,\u003cstrong\u003ee,f\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/ed12922684adde32b4e05d4a.jpg"},{"id":83355469,"identity":"232122de-35ca-4954-b357-57b878f3056a","added_by":"auto","created_at":"2025-05-23 15:04:49","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3750218,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe interaction of cofilin-1 with NLRP3 depends on redox states of cofilin-1.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e, Schematic diagram of the intramolecular disulfide bond formation between Cys39 and Cys80 after oxidation by ROS. \u003cstrong\u003eb\u003c/strong\u003e, Immunoblot analysis with monoclonal or polyclonal antibody to cofilin-1 or antibody to phosphorylated cofilin-1 from reduced (with DTT) or non-reduced (without DTT) Lys. of LPS-primed BMDMs treated without or with ATP or nigericin. \u003cstrong\u003ec\u003c/strong\u003e, Immunoblot analyses of Inflammasome activation and oxidation-reduction state of cofilin-1 (top), intracellular ROS measurements (bottom) from LPS-primed BMDMs treated with ATP and various doses of luteolin. \u003cem\u003en\u003c/em\u003e=5, mean + s.e.m, *\u003cem\u003eP \u003c/em\u003e≤ 0.05 and **\u003cem\u003eP \u003c/em\u003e≤ 0.01 (unpaired two-tailed nonparametric \u003cem\u003et\u003c/em\u003e-test). \u003cstrong\u003ed\u003c/strong\u003e, Immunoblot analysis of NLRP3 and cofilin-1 under reducing conditions in proteins IP with anti–cofilin-1 antibody from Lys. of LPS-primed WT BMDMs treated with ATP alone or ATP plus luteolin. \u003cstrong\u003ee\u003c/strong\u003e, Immunoblot analysis of NLRP3 and cofilin-1 under reducing conditions in proteins IP with anti-NLRP3 antibody from mixtures of purified recombinant cofilin-1 and NLRP3 proteins in the presence of various doses of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e. Data are representative of three independent experiments with similar results (\u003cstrong\u003eb\u003c/strong\u003e-\u003cstrong\u003ee\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/87334efdc1efffa9788832c0.jpg"},{"id":83355475,"identity":"96cd483c-fecb-4c0e-be5b-211fd00f1768","added_by":"auto","created_at":"2025-05-23 15:04:49","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":5489093,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExtracellular potassium and MCC950 inhibit dissociation of cofilin-1 from NLRP3.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e, Immunoblot analyses of IL-1β release (top), NLRP3 and cofilin-1 in proteins IP with anti-cofilin-1 antibody (middle), and oxidation-reduction state of cofilin-1 (bottom) from Sup or Lys of LPS-primed WT BMDMs treated with ATP in the presence of 100nM MCC950 or 20mM KCl. \u003cstrong\u003eb\u003c/strong\u003e, Immunoblot analysis of NLRP3 and cofilin-1 in proteins IP with antibody to NLRP3 from mixtures of purified recombinant cofilin-1 and NLRP3 in the presence of various doses of MCC950 (above lanes). \u003cstrong\u003ec\u003c/strong\u003e, ROS production assay from LPS-primed BMDMs treated with ATP and various doses of KCl, then stained with MitoSox Green reagent and DAPI.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ed\u003c/strong\u003e, Immunoblot analysis of IL-1β release (top) and measurements of intracellular ROS (bottom) from LPS-primed BMDMs treated with ATP and various doses of KCl \u003cem\u003en\u003c/em\u003e=5, mean + s.e.m, **\u003cem\u003eP \u003c/em\u003e≤ 0.01 (unpaired two-tailed nonparametric \u003cem\u003et\u003c/em\u003e-test). \u003cstrong\u003ee\u003c/strong\u003e,\u003cstrong\u003ef\u003c/strong\u003e Immunoblot analysis of IL-1β release from LPS-primed PBMCs of CAPS patients (1 and 2) with various mutations (above lanes) in \u003cem\u003eNLRP3\u003c/em\u003e and treated with various doses of KCl (\u003cstrong\u003ee\u003c/strong\u003e) or luteolin (\u003cstrong\u003ef\u003c/strong\u003e). Data are representative of three independent experiments with similar results (\u003cstrong\u003ea\u003c/strong\u003e-\u003cstrong\u003ed\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/f31ca023b333d5ab90b8d61d.jpg"},{"id":83355471,"identity":"46accf4c-6c34-4593-972a-7c6111938bec","added_by":"auto","created_at":"2025-05-23 15:04:49","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":7010263,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOxidation-resistant C39A/C80A mutant cofilin-1 suppresses NLRP3 inflammasome activation.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e, Immunoblot analysis with antibody to V5 or myc for cofilin-1 in proteins IP with antibody to V5 from Lys of \u003cem\u003eAim2\u003c/em\u003e-deficient BMDMs transiently expressing both V5-tagged and myc-tagged WT cofilin-1 or cofilin-1 with various oxidation resistant cysteine to alanine substitutions (above lanes) and treated with ATP. \u003cstrong\u003eb\u003c/strong\u003e, Structural comparison of reduced and oxidized cofilin-1. Distance between Cys39 and Cys80 is indicated with dotted line. \u003cstrong\u003ec\u003c/strong\u003e, Immunoblot analysis of IL-1β release from retroviral-transduced J774A.1 cells, expressing WT or indicated mutant cofilin-1 proteins (above lanes) and treated with ATP, Poly(dA:dT), and flagellin. \u003cstrong\u003ed\u003c/strong\u003e, GST-pulldown assay of Lys of LPS-primed \u003cem\u003eAim2\u003c/em\u003e-deficient BMDMs transiently expressing GST-tagged WT or indicated mutant cofilin-1 and treated with or without ATP. Data are representative of three independent experiments with similar results (\u003cstrong\u003ea,c,d\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/e3bbe0b9c50db7395bc174ea.jpg"},{"id":83355476,"identity":"77f5fa43-4e49-4d2a-a1dd-b6b504e4de23","added_by":"auto","created_at":"2025-05-23 15:04:49","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":6355802,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFour amino acid residues from 101 to 104 of cofilin-1 are essential for interaction with NLRP3.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e, GST-pulldown assay of Lys of LPS-primed U937 cells, expressing endogenous NLRP3, with recombinant GST-tagged full-length or indicated fragments of cofilin-1 proteins (above lanes). Above blots, the schematic structure of full-length cofilin-1 with lines corresponding to N-terminal (aa 1-84), middle (aa 41-127), and C-terminal (aa 85-166) halves of cofilin-1. NLS, nuclear localization signal; ADF-H, actin-depolymerizing factor homology domain; PI(4,5)P\u003csub\u003e2\u003c/sub\u003e; phosphatidylinositol 4,5-bisphosphate binding site. \u003cstrong\u003eb\u003c/strong\u003e, GST-pulldown assay of Lys of LPS-primed U937 cells, expressing endogenous NLRP3, with recombinant GST-tagged WT or mutant (above lanes) aa 95-127 cofilin-1 fragments. \u003cstrong\u003ec\u003c/strong\u003e, Predicted changes in binding affinity (ΔΔG_binding) between NLRP3 and cofilin-1 variants with single-residue substitutions at each position of the binding motif (Phe101-Ile102-Phe103-Trp104), relative to wild-type cofilin-1. \u003cstrong\u003ed\u003c/strong\u003e, Magnified views of interaction interfaces between NLRP3 (dark blue) and cofilin-1 (red), with wild-type (F103) or alanine (A103) or tyrosine (Y103) substitution at residue 103 (F103). Putative interactions are indicated by dotted lines, green, hydrophobic interaction; red, hydrogen; and orange, polar bond \u003cstrong\u003ee\u003c/strong\u003e, GST-pulldown assay of Lys of LPS-primed U937 cells, expressing endogenous NLRP3, with recombinant GST-tagged WT or F103A or F103Y mutant aa 95-127 fragments of cofilin-1. Data are representative of three independent experiments with similar results (\u003cstrong\u003ea,b \u003c/strong\u003eand\u003cstrong\u003e e\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/ac80e1233dc7fc56a04f95d1.jpg"},{"id":83356562,"identity":"d37c838b-1f26-4e0d-87ac-d902d6f5fb0d","added_by":"auto","created_at":"2025-05-23 15:12:49","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":4390415,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePeptides containing the NLRP3-binding motif of cofilin-1 suppresses NLRP3 inflammasome activation.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e, Measurements of ATPase activity from purified recombinant human NLRP3 (expressed in a HEK293 cells) with purified GST (control), GST-tagged full-length (FL) cofilin-1, or GST-tagged WT or F103A mutant aa 95-127 cofilin-1 fragment. \u003cem\u003en\u003c/em\u003e=7, mean + s.e.m, ***\u003cem\u003eP \u003c/em\u003e≤ 0.001 (unpaired two-tailed nonparametric \u003cem\u003et\u003c/em\u003e-test). \u003cstrong\u003eb\u003c/strong\u003e, GST-pulldown assay of Lys of LPS-primed U937 cells, expressing endogenous NLRP3, with recombinant GST-tagged full-length cofilin-1 or aa 95-127 cofilin-1 fragment in the presence of various doses of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (above lanes). \u003cstrong\u003ec\u003c/strong\u003e, Immunoblot analysis of IL-1β and caspase-1 (Casp-1) from Sup or Lys of LPS-primed \u003cem\u003eAim2\u003c/em\u003e-deficient BMDMs transiently transfected with synthesized peptides corresponding to aa 95-127 or aa 134-166 of cofilin-1 and treated with 1.25 µM nigericin, 5 mM ATP, or flagellin. \u003cstrong\u003ed\u003c/strong\u003e,\u003cstrong\u003ee\u003c/strong\u003e, Immunoblot analysis of IL-1β and Casp-1 from Sup or Lys of LPS-primed \u003cem\u003eAim2\u003c/em\u003e-deficient BMDMs (\u003cstrong\u003ed\u003c/strong\u003e) or PBMCs of CAPS patients (3, 4 and 5) with various \u003cem\u003eNLRP3 \u003c/em\u003emutations (above blots) (\u003cstrong\u003ee\u003c/strong\u003e), transiently transfected with synthesized WT or F103A or F103Y mutant peptides corresponding to aa 95-127 of cofilin-1 and treated with 1.25 µM nigericin, 5 mM ATP, or flagellin (\u003cstrong\u003ed\u003c/strong\u003e) or LPS-priming alone (\u003cstrong\u003ee\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/fe7767415c639c4eb444454e.jpg"},{"id":104951708,"identity":"735a71b4-9cf6-4fe7-a979-5ff1d3760452","added_by":"auto","created_at":"2026-03-19 07:06:48","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":39287975,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/017f435a-710b-4b67-bbbb-064fc5f74169.pdf"},{"id":83355458,"identity":"371a99c0-f657-430a-a4d7-d2d297fea586","added_by":"auto","created_at":"2025-05-23 15:04:48","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1437963,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExtended Data Fig. 1 Cofilin-1 is a negative regulator of the NLRP3 inflammasome.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e, IL-1β Measurements of culture supernatants from WT, \u003cem\u003eNlrc4\u003c/em\u003e-, \u003cem\u003eMefv\u003c/em\u003e-, and \u003cem\u003eAim2\u003c/em\u003e-deficient BMDMs transiently transfected with negative control siRNA (N.C.) or siRNA targeting \u003cem\u003eCfl1\u003c/em\u003e, then treated with LPS for 9h. \u003cem\u003en\u003c/em\u003e=3, mean + s.e.m, ***\u003cem\u003eP \u003c/em\u003e≤ 0.001 and ****\u003cem\u003eP \u003c/em\u003e≤ 0.0001 (unpaired two-tailed \u003cem\u003et\u003c/em\u003e-test). \u003cstrong\u003eb\u003c/strong\u003e, Immunoblot analysis with antibody to cofilin-1 in proteins IP with antibody to myc from Lys of 293T cells transiently expressing WT, the V198M variant of uncertain significance, or CAPS-associated D303G mutant NLRP3 proteins. Data are representative of three independent experiments with similar results. \u003cstrong\u003ec\u003c/strong\u003e, Structural model of the cofilin-1–NLRP3 complex highlighting the positions of eight CAPS-associated NLRP3 mutations. \u003cstrong\u003ed\u003c/strong\u003e, Predicted changes in binding affinity (ΔΔG_binding) between cofilin-1 and NLRP3 variants harboring CAPS-associated mutations, relative to wild-type NLRP3.\u003c/p\u003e","description":"","filename":"ExtendedDataFig1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/8750d4f25f9622a4751f6475.pdf"},{"id":83355459,"identity":"7c71fe93-18d9-4b82-9ea1-de6948265e60","added_by":"auto","created_at":"2025-05-23 15:04:48","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":625000,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExtended Data Fig. 2\u003c/strong\u003e \u003cstrong\u003eEpitope mapping of a Monoclonal Cofilin-1 Antibody.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e,\u003cstrong\u003eb\u003c/strong\u003e, Immunoblot analysis of recombinant GST-tagged full-length or indicated fragments of cofilin-1 proteins (above lanes) with antibody to GST (\u003cstrong\u003ea\u003c/strong\u003e) or with monoclonal antibody to cofilin-1 (\u003cstrong\u003eb\u003c/strong\u003e). \u003cstrong\u003ec\u003c/strong\u003e, The schematic structure of full-length cofilin-1 with lines corresponding to N-terminal (aa 1-84), middle (aa 41-127), and C-terminal (aa 85-166) halves of cofilin-1. NLS, nuclear localization signal; ADF-H, actin-depolymerizing factor homology domain; PI(4,5)P\u003csub\u003e2\u003c/sub\u003e; phosphatidylinositol 4,5-bisphosphate binding site.\u003c/p\u003e","description":"","filename":"ExtendedDataFig2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/be18c487eea759e0b4c0a190.pdf"},{"id":83356557,"identity":"1257258d-b0bc-4ece-bf5b-edc660d399d2","added_by":"auto","created_at":"2025-05-23 15:12:48","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":163102,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExtended Data Fig. 3 IL-1β releases are not suppressed in BMDMs of KI mice harboring single cysteine to alanine mutation.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e-\u003cstrong\u003ee\u003c/strong\u003e, IL-1β measurements of culture supernatants of LPS-primed BMDMs from WT (\u003cem\u003eCof1\u003c/em\u003e\u003csup\u003eWT/WT\u003c/sup\u003e),\u003cem\u003e Cof1\u003c/em\u003e\u003csup\u003eWT/-\u003c/sup\u003e (\u003cstrong\u003ea\u003c/strong\u003e), \u003cem\u003eCof1\u003c/em\u003e\u003csup\u003eC39A/C39A\u003c/sup\u003e (\u003cstrong\u003eb\u003c/strong\u003e), \u003cem\u003eCof1\u003c/em\u003e\u003csup\u003eWT/C80A\u003c/sup\u003e (\u003cstrong\u003ec\u003c/strong\u003e), \u003cem\u003eCof1\u003c/em\u003e\u003csup\u003eC139A/C139A\u003c/sup\u003e (\u003cstrong\u003ed\u003c/strong\u003e), and \u003cem\u003eCof1\u003c/em\u003e\u003csup\u003eC147A/C147A\u003c/sup\u003e (\u003cstrong\u003ee\u003c/strong\u003e) mice treated with 5 mM ATP. \u003cem\u003en\u003c/em\u003e=5.\u003c/p\u003e","description":"","filename":"ExtendedDataFig3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/70a6593495db6956ac80d688.pdf"},{"id":83355465,"identity":"f4a3b07c-7cb1-4894-b08b-e7b1bfc85fe3","added_by":"auto","created_at":"2025-05-23 15:04:49","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":529260,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExtended Data Fig. 4 Cofilin-1 forms intermolecular disulfide bonds.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea,\u003c/strong\u003e Immunoblot analysis with antibody to V5 or myc for cofilin-1 in proteins IP with anti-V5 antibody from Lys of \u003cem\u003eAim2\u003c/em\u003e-deficient BMDMs transiently expressing both V5-tagged and myc-tagged WT cofilin-1 or cofilin-1 with various oxidation resistant cysteine to alanine substitutions (above lanes) and treated with or without ATP. \u003cstrong\u003eb\u003c/strong\u003e, Proposed model for formation of intramolecular disulfide bond in WT cofilin-1 and intermolecular disulfide bond between two C39A or C80A mutant cofilin-1 molecules when oxidized by ROS.\u003c/p\u003e","description":"","filename":"ExtendedDataFig4.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/6b5ca777a46deffcb0f92ba5.pdf"},{"id":83356894,"identity":"9170252b-012f-4e4c-945e-b99f1cf8f20a","added_by":"auto","created_at":"2025-05-23 15:20:49","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":13072,"visible":true,"origin":"","legend":"Extended Data Table 1","description":"","filename":"ExtendedDataTable1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/13ec06d30f1154ce079a69e0.xlsx"},{"id":83355461,"identity":"143ef9b0-8bd1-44e3-bf38-662eb64e1d5f","added_by":"auto","created_at":"2025-05-23 15:04:48","extension":"xlsx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":14984,"visible":true,"origin":"","legend":"Extended Data Table 2","description":"","filename":"ExtendedDataTable2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/0f009464ab68a4703200977e.xlsx"},{"id":83356893,"identity":"9cc97237-30c3-4696-95e0-351a71667227","added_by":"auto","created_at":"2025-05-23 15:20:48","extension":"xlsx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":11502,"visible":true,"origin":"","legend":"Extended Data Table 3","description":"","filename":"ExtendedDataTable3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/b879d1e10c78ef25f20b1326.xlsx"},{"id":83356895,"identity":"fd4f4071-746b-4167-a44a-8634d7c26b75","added_by":"auto","created_at":"2025-05-23 15:20:49","extension":"xlsx","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":12114,"visible":true,"origin":"","legend":"Extended Data Table 4","description":"","filename":"ExtendedDataTable4.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/ec9e77bc4ff7e418a1ed6696.xlsx"},{"id":83355466,"identity":"87891fd6-c977-45b6-b32b-1362ca4b237a","added_by":"auto","created_at":"2025-05-23 15:04:49","extension":"xlsx","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":12135,"visible":true,"origin":"","legend":"Extended Data Table 5","description":"","filename":"ExtendedDataTable5.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/75b8682271295af6b9848f52.xlsx"},{"id":83355468,"identity":"dabd56f7-1b54-4a11-b682-c4eda7123c61","added_by":"auto","created_at":"2025-05-23 15:04:49","extension":"xlsx","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":14809,"visible":true,"origin":"","legend":"Extended Data Table 6","description":"","filename":"ExtendedDataTable6.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/426f95872dc3b5f11e4db1c3.xlsx"},{"id":83356560,"identity":"a3d62577-d933-496c-ad23-47acadb4ceaf","added_by":"auto","created_at":"2025-05-23 15:12:49","extension":"xlsx","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":12209,"visible":true,"origin":"","legend":"Extended Data Table 7","description":"","filename":"ExtendedDataTable7.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/147e5a171445c78285cca004.xlsx"},{"id":83355477,"identity":"b44e7959-9b50-4b04-8f72-396d75cfc7b9","added_by":"auto","created_at":"2025-05-23 15:04:49","extension":"mp4","order_by":13,"title":"","display":"","copyAsset":false,"role":"supplement","size":8207419,"visible":true,"origin":"","legend":"Extended Data movie 1","description":"","filename":"Extendeddatamovie1.mp4","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/cbc56426b2d679e006e594df.mp4"},{"id":83355478,"identity":"e4d507a8-cb0b-49c6-9d6c-06b7f723ca3f","added_by":"auto","created_at":"2025-05-23 15:04:49","extension":"mp4","order_by":14,"title":"","display":"","copyAsset":false,"role":"supplement","size":4053054,"visible":true,"origin":"","legend":"Extended Data movie 2","description":"","filename":"Extendeddatamovie2.mp4","url":"https://assets-eu.researchsquare.com/files/rs-6648864/v1/8d84691756234cc1fa477880.mp4"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Cofilin-1 is a Redox-Sensitive Guard of the NLRP3 Inflammasome","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eThe inflammasome is an intracellular multiprotein complex that plays a crucial role in the inflammatory response by promoting the maturation and release of the proinflammatory cytokines interleukin (IL)-1β and IL-18\u003csup\u003e1\u003c/sup\u003e.\u0026nbsp;The NLRP3 inflammasome is the most extensively studied inflammasome\u0026nbsp;and has been demonstrated to be activated by a diverse array of pathogen-associated or danger-associated molecular patterns (PAMPs, DAMPs).\u0026nbsp;NLRP3 is composed of an N-terminal pyrin domain (PYD), a central NACHT domain (that in turn comprises a fish-specific NACHT-associated [FISNA] domain, a\u0026nbsp;nucleotide-binding domain [NBD] that mediates ATP hydrolysis, two helical domains [HD1 and HD2], and a winged helix domain [WHD]), and a C-terminal leucine rich repeat (LRR) domain\u003csup\u003e2, 3\u003c/sup\u003e.\u0026nbsp;Missense mutations in the gene encoding NLRP3 cause\u0026nbsp;a spectrum of dominantly inherited or \u003cem\u003ede\u003c/em\u003e \u003cem\u003enovo\u003c/em\u003e autoinflammatory diseases known as\u0026nbsp;the cryopyrin-associated periodic syndromes\u0026nbsp;(CAPS)\u0026nbsp;characterized by recurrent episodes of fevers, urticarial skin rash, varying degrees of arthralgia/arthritis, neutrophil-mediated inflammation, an intense acute-phase response, and, at the severe end of the spectrum, central nervous system (CNS) inflammation\u003csup\u003e4, 5\u003c/sup\u003e. The activation of the NLRP3 inflammasome also has been implicated in various inflammatory and autoimmune diseases, such as gout\u003csup\u003e6\u003c/sup\u003e, atherosclerosis\u003csup\u003e7\u003c/sup\u003e, type 2 diabetes\u003csup\u003e8\u003c/sup\u003e, Alzheimer's disease\u003csup\u003e9, 10\u003c/sup\u003e, and pericarditis\u003csup\u003e11, 12\u003c/sup\u003e. Understanding the regulation and signaling pathways of NLRP3 inflammasome activation is crucial for developing therapeutic strategies to target inflammatory diseases.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn the canonical pathway, the activation of the NLRP3 inflammasome involves two distinct signals.\u0026nbsp;The initial signal, also known as the priming signal, induces the expression of components of the NLRP3 inflammasome, including NLRP3 itself and pro-IL-1β, in response to inflammatory cytokines or PAMPs, such as lipopolysaccharide (LPS), from bacteria. Under normal conditions, NLRP3 is thought to be maintained in a closed or inactive conformation, resembling a “cage”, preventing spontaneous activation and inappropriate inflammation\u003csup\u003e13\u003c/sup\u003e. However, upon exposure to certain danger signals, such as microbial components, environmental irritants, or endogenous danger signals from damaged cells, the inactive NLRP3 undergoes conformational changes, leading to its activation. These danger signals are believed to disrupt the stability of the inactive conformation and promote the assembly of the NLRP3 inflammasome complex. In addition to the activation signal, interaction of NLRP3 with NEK7 and hydrolysis of ATP by an ATPase activity on the NBD of NLRP3 are required prior to activation of the NLRP3 inflammasome\u003csup\u003e14, 15\u003c/sup\u003e.\u0026nbsp;In response to the activation signals, three not necessarily mutually exclusive intracellular signaling pathways have been proposed for NLRP3 inflammasome activation:\u0026nbsp;potassium efflux\u003csup\u003e16\u003c/sup\u003e, generation of reactive oxygen species (ROS) from mitochondria\u003csup\u003e17\u003c/sup\u003e, and cathepsin B released from ruptured lysosomes\u003csup\u003e18\u003c/sup\u003e. Recent data strongly suggest that multiple activation signals, in addition to the priming signal, are required for NLRP3 activation, and that this redundancy serves as a safeguard\u003csup\u003e19\u003c/sup\u003e. Despite the diversity of activating signals, ROS has been suggested as a major factor in NLRP3 inflammasome activation since many extracellular NLRP3 activators induce ROS generation.\u0026nbsp;Moreover, monocytes from CAPS patients exhibit elevated ROS levels even in the absence of external stimulation\u003csup\u003e20, 21\u003c/sup\u003e.\u0026nbsp;However, the molecular mechanism by which a change in cellular redox state leads to NLRP3 inflammasome activation, as well as the molecular pathogenesis of CAPS, has not been elucidated.\u003c/p\u003e\n\u003cp\u003eROS production from macrophages is an important component of the innate immune response against bacterial infections or their components (PAMPs), highlighting the dynamic interplay between host immune cells and pathogens during the infectious process. There is no evidence for post-translational modification of NLRP3 by ROS, nor for direct interaction of activators with NLRP3. This suggests that ROS might modulate NLRP3 inflammasome activation indirectly through an ROS-sensing molecule that binds NLRP3, as seen in the activation mechanism of the pyrin inflammasome, in which there is liberation of inhibitory 14-3-3 proteins from pyrin in response to upstream RhoA GTPase inactivation by certain bacterial toxins\u003csup\u003e22\u003c/sup\u003e. To study the mechanism of NLRP3 inflammasome activation by ROS and the molecular pathogenesis of CAPS, we screened for NLRP3-interacting proteins that inhibit inflammasome activation, and identified an actin-binding protein, cofilin-1. Cofilin-1 is one of the major regulators of actin dynamics by mediating filament severing and polymerization and its activity is regulated by phosphorylation and oxidation. We found that cofilin-1 regulates NLRP3 inflammasome activation by sensing alterations in the redox milieu independently of its actin-regulating activity. Moreover, we identified oxidation-resistant cofilin-1 peptides that are potent inhibitors of the NLRP3 inflammasome, thereby raising the possibility of a new class of NLRP3-blocking agents.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cstrong\u003eNLRP3 interacts with cofilin-1, and the interaction is substantially diminished by ATP.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo identify negative regulators of the NLRP3 inflammasome, we screened proteins that interact with NLRP3 and dissociate after NLRP3 inflammasome activation. NLRP3 protein complexes were pulled down with an NLRP3-specific antibody from lysates of bone-marrow-derived macrophages (BMDMs) treated with LPS alone or with ATP after LPS priming. Immunoprecipitated complexes were separated on PAGE, and we found a band around 20 kDa that was present only in lysates of LPS-primed WT BMDMs but not in ATP-treated WT BMDMs nor NLRP3-deficient BMDMs (Fig. 1a). Mass spectrometry analysis identified five proteins in the ~20 kDa band, of which three proteins, including myosin regulatory light chain 12B (MYL12b), actin-related protein 2/3 complex subunit 4 (ARPC4), and cofilin-1 disappeared when the inflammasome was activated by ATP (Fig. 1b). Subsequent immunoblot analysis revealed that cofilin-1 is an interacting partner of NLRP3 in LPS-primed BMDMs while MYL12b and ARPC4 did not associate with NLRP3 (Fig. 1c). The interaction of cofilin-1 with NLRP3 was confirmed in a reciprocal co-immunoprecipitation assay with a cofilin-1 specific antibody (Fig. 1d). Cofilin-1 is a 19 kDa actin-severing enzyme that binds to actin, and NLRP3 is also known to bind to actin\u003csup\u003e23\u003c/sup\u003e. Thus, to examine whether the interaction of cofilin-1 and NLRP3 is due to direct binding or indirect binding mediated by actin, an \u003cem\u003ein vitro\u003c/em\u003e pull-down assay was performed using purified recombinant cofilin-1 and NLRP3. Indeed, we observed that recombinant cofilin-1 was co-immunoprecipitated with recombinant NLRP3, and vice versa, which indicates a direct interaction of cofilin-1 with NLRP3 (Fig. 1e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCofilin-1 is a negative regulator of the NLRP3 inflammasome.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe NLRP3 inflammasome is activated by a wide range of pathogen-associated or danger-associated molecular patterns (PAMPs, DAMPs), including several microbial molecules, particulates, ion fluxes, as well as ATP. Thus, we examined the effect of various NLRP3 inflammasome activators on the NLRP3-cofilin-1 interaction. As seen in cells treated with ATP, the NLRP3-cofilin-1 interaction was also substantially decreased by nigericin, monosodium urate (MSU) crystals, KH7 (an adenylate cyclase inhibitor), or extracellular calcium\u003csup\u003e24\u003c/sup\u003e (Fig. 2a). Given that cofilin-1 is dissociated from NLRP3 upon its activation signals, we hypothesized that cofilin-1 may suppress the NLRP3 inflammasome.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo examine the role of cofilin-1 in NLRP3 inflammasome activation further, the cofilin-1 gene (\u003cem\u003eCfl1\u003c/em\u003e) was knocked down in mouse BMDMs by short interfering RNA (siRNA). Knockdown of \u003cem\u003eCfl1\u003c/em\u003e in LPS-primed WT BMDMs induced spontaneous IL-1β release, which was dependent on the NLRP3 inflammasome, but independent on the NLRC4 (IPAF, ICE protease-activating factor), pyrin, or AIM2 (absent in melanoma 2) inflammasomes (Fig. 2b and Extended Data Fig. 1a). Moreover, we observed that IL-1β release from the BMDMs with \u003cem\u003eCfl1\u003c/em\u003e knockdown was substantially increased in response to NLRP3 inflammasome activators, ATP or nigericin, but not by NLRC4 or AIM2 inflammasome activators, flagellin or double-stranded DNA (dsDNA), respectively (Fig 2c). Taken together, these results indicate that cofilin-1 specifically suppresses NLRP3 inflammasome activation.\u003c/p\u003e\n\u003cp\u003eTo investigate the structural basis of the NLRP3–cofilin-1 interaction, we modeled the full-length complex using AlphaFold3\u003csup\u003e25\u003c/sup\u003e. The predicted structure revealed a well-defined binding interface between cofilin-1 and both the NBD and LRR domain of NLRP3, comprising 46 atomic contacts within 5 Å (Fig. 2d and Extended Data Movie1). To dissect domain-specific interactions, additional models were generated with cofilin-1 bound to individual NLRP3 domains. The highest predicted binding affinity was observed with the combined NBD–LRR region, yielding a binding free energy (ΔG) of –20.6 kcal/mol and a dissociation constant (Kd) of 3.0 × 10⁻\u003csup\u003e15\u003c/sup\u003e M (Extended Data Table 1). Consistent with this prediction, pull-down assays using NLRP3 constructs lacking individual domains demonstrated that the interaction with cofilin-1 is mediated through the NBD and LRR domains of NLRP3 (Fig. 2e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBecause the NBD of NLRP3 is the most frequent site of CAPS-associated mutations, we next examined how disease-associated variants affect its interaction with cofilin-1. The interaction between cofilin-1 and eight NLRP3 missense mutations—validated as pathogenic in the international INFEVERS registry (https://infevers.umai-montpellier.fr/web/search.php?n=4) and distributed across the NBD and LRR domains—was markedly diminished compared to wild-type NLRP3 or a variant of uncertain significance (Fig. 2f and Extended Data Fig. 1b). Structural modeling of these eight mutations in complex with wild-type cofilin-1 predicted reduced binding affinity for all substitutions (ΔΔG_binding \u0026lt; 0) (Extended Data Fig. 1c,d, and Extended Data Table 2). Taken together, these results suggest that the spontaneous inflammasome activation observed in myeloid cells from CAPS patients may result from diminished inhibition of NLRP3 activation by cofilin-1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe interaction of cofilin-1 with NLRP3 depends on redox states of cofilin-1.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDespite the diverse range of activators for the NLRP3 inflammasome, mitochondrial ROS generation is a common cellular response that plays a critical role in inflammasome activation\u003csup\u003e17\u003c/sup\u003e. Thiol groups of cysteines are among the most prominent targets for ROS-mediated oxidation in proteins\u003csup\u003e26\u003c/sup\u003e. The human or mouse cofilin-1 molecules contain four cysteine residues - Cys39, Cys80, Cys139, and Cys147 - that are potential targets for ROS. It has been reported that oxidation of these cysteines leads to the formation of intramolecular disulfide bridges, which cause conformational changes of cofilin-1 and prevent its phosphorylation at Ser3\u003csup\u003e27, 28, 29\u003c/sup\u003e.\u0026nbsp;Taken together, these observations suggest that NLRP3 inflammasome activators may induce cofilin-1 oxidation, leading to the formation of intramolecular disulfide bonds (Fig 3a).\u003c/p\u003e\n\u003cp\u003eTo determine the redox status of cofilin-1 in response to NLRP3 inflammasome activators, we analyzed BMDMs by immunoblot using a monoclonal antibody that recognizes an epitope between Cys39 and Cys80 of cofilin-1 when cofilin-1 is in its reduced state (Extended Data Fig. 2a-c). We found that cofilin-1 in ATP- or nigericin-treated BMDMs was not readily detectable using the monoclonal antibody under non-reducing conditions, whereas it was detectable under reducing conditions (Fig. 3b). We also observed a loss of Ser3 phosphorylation of cofilin-1 upon treatment of BMDMs with ATP or nigericin (Fig. 3b), which is also evidence for cofilin-1 oxidation by NLRP3 activators\u003csup\u003e27\u003c/sup\u003e. To further investigate the role of ROS on cofilin-1 oxidation and NLRP3 inflammasome activation, we blocked ROS in ATP-treated BMDMs with an antioxidant, luteolin. In LPS-primed BMDMs, ATP-induced caspase-1 activation and IL-1β release were substantially diminished at the doses of luteolin that decreased oxidized cofilin-1 (Fig. 3c). It is noteworthy that LPS-induced priming, the expression of NLRP3 and pro-IL-1β were not attenuated by luteolin (Fig. 3c). Furthermore, in the luteolin-treated BMDMs, cofilin-1 was not dissociated from NLRP3 by ATP (Fig. 3d). These data suggest that the reduced form of cofilin-1 binds to NLRP3 to suppress its activation, and that cofilin-1 is dissociated from NLRP3 when cofilin-1 is oxidized by ROS generated by NLRP3 activators. Indeed, in an \u003cem\u003ein vitro\u003c/em\u003e pull-down assay with recombinant cofilin-1 and NLRP3, the NLRP3-cofilin-1 interaction was decreased in a dose-dependent manner by H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e that is known to oxidize cofilin-1 \u003cem\u003ein vitro\u003c/em\u003e\u003csup\u003e27\u003c/sup\u003e (Fig. 3e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExtracellular potassium and MCC950 inhibit dissociation of cofilin-1 from NLRP3.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNext, we investigated how the interaction of cofilin-1 with NLRP3 is affected by the NLRP3 inflammasome inhibitors, MCC950 (also named CRID3)\u003csup\u003e30\u003c/sup\u003e and high concentrations of extracellular potassium\u003csup\u003e16\u003c/sup\u003e. Consistent with previous studies, in LPS-primed BMDMs, ATP-driven IL-1β release was significantly inhibited by 100 nM of MCC950 or 25 mM of KCl. Interestingly, with\u0026nbsp;both inhibitors, cofilin-1 remained bound to NLRP3 without being dissociated in ATP-treated BMDMs (Fig. 4a). Moreover, in the inhibitor-treated cells, cofilin-1 remained in the reduced form without being oxidized by ATP-induced ROS (Fig. 4a).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMCC950 stabilizes the inactive state of NLRP3 by binding to a cleft spanned by the NBD, HD1, WHD, HD2, and transition LRR subdomains, precluding the conformational changes required for ATP-binding\u003csup\u003e2\u003c/sup\u003e, and possibly inhibiting the formation of the C39-C80 disulfide bond in the bound cofilin-1. In an \u003cem\u003ein\u0026nbsp;\u003c/em\u003evitro pull-down assay, we observed that MCC950 had no appreciable effect on the binding of recombinant NLRP3 to recombinant cofilin-1 (Fig. 4b). The \u003cem\u003ein vitro\u003c/em\u003e pull-down assay also demonstrated that potassium is not necessary for the NLRP3-cofilin-1 direct interaction, as the assay was conducted in a potassium-free buffer\u0026nbsp;(Fig. 4b). However, extracellular potassium significantly suppressed ATP-induced ROS production in LPS-primed BMDMs (Fig. 4c,d), suggesting an indirect mechanism by which high concentrations of extracellular potassium may prevent the dissociation of cofilin-1 from NLRP3.\u003c/p\u003e\n\u003cp\u003eTo gain further insight into the role of potassium and ROS in NLRP3 inflammasome activation, we examined the effects of high concentrations of extracellular potassium or antioxidant on inflammasome activation in\u0026nbsp;mutation-positive CAPS patients’ PBMCs, in which NLRP3 is constitutively activated\u003csup\u003e24\u003c/sup\u003e. Contrary to a previous study with BMDMs from KI-mice harboring CAPS-associated mutations\u003csup\u003e31\u003c/sup\u003e, extracellular potassium substantially blocked IL-1β release from LPS-primed CAPS PBMCs in a dose-dependent manner (Fig. 4e). Moreover, we also observed dose-dependent inhibition of IL-1β release by luteolin in the LPS-primed CAPS PBMCs (Fig. 4f).\u0026nbsp;Taken together, these results are consistent with the hypothesis that\u0026nbsp;cofilin-1 regulates the NLRP3 inflammasome by sensing ROS.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOxidation-resistant C39A/C80A mutant cofilin-1 suppresses NLRP3 inflammasome activation.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate cysteine residues of cofilin-1 that regulate the interaction with NLRP3 in response to ROS \u003cem\u003ein vivo\u003c/em\u003e, we have generated cofilin-1 knockout (KO) and four knockin (KI) mice bearing oxidation-resistant cysteine to alanine mutations (C39A, C80A, C139A, and C147A) for each of the four cysteine residues. Homozygotes for cofilin-1 KO (\u003cem\u003eCof1\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e) and C80A KI (\u003cem\u003eCof1\u003c/em\u003e\u003csup\u003eC80A/C80A\u003c/sup\u003e) mice were embryonic lethal while \u003cem\u003eCof1\u003c/em\u003e\u003csup\u003eC39A/C39A\u003c/sup\u003e, \u003cem\u003eCof1\u003c/em\u003e\u003csup\u003eC139A/C139A\u003c/sup\u003e, and \u003cem\u003eCof1\u003c/em\u003e\u003csup\u003eC147A/C147A\u0026nbsp;\u003c/sup\u003emice were produced and developed normally (Extended Data Fig. 3a-e). Considering that oxidation of cysteines of cofilin-1 results in the formation of an intramolecular disulfide bond between the two cysteines, we hypothesized that alanine substitution of a cysteine involved in disulfide bond formation may inhibit the dissociation of cofilin-1 from NLRP3 by ROS and subsequently suppress inflammasome activation. However, no suppression of NLRP3 inflammasome activation by ATP was observed in LPS-primed BMDMs of all mutant KI mice, \u003cem\u003eCof1\u003c/em\u003e\u003csup\u003eC39A/C39A\u003c/sup\u003e, \u003cem\u003eCof1\u003c/em\u003e\u003csup\u003eC139A/C139A\u003c/sup\u003e, \u003cem\u003eCof1\u003c/em\u003e\u003csup\u003eC147A/C147A\u003c/sup\u003e, and \u003cem\u003eCof1\u003c/em\u003e\u003csup\u003eWT/C80A\u003c/sup\u003e (Extended Data Fig. 3b-e). These results suggest that when cofilin-1 is oxidized by NLRP3 activators, more than one disulfide bond may form, leading to the dissociation of cofilin-1 from NLRP3.\u003c/p\u003e\n\u003cp\u003eIn addition to the Cys39-Cys80 intramolecular bonds, cofilin-1 has been shown to form dimers \u003cem\u003ein vitro\u003c/em\u003e through intermolecular disulfide bonding when oxidized\u003csup\u003e32\u003c/sup\u003e. To examine whether cofilin-1 can be dimerized by intermolecular disulfide bonds \u003cem\u003ein vivo\u003c/em\u003e, we expressed two kinds of cofilin-1 proteins each labeled with two different tags, myc or V5, in BMDMs. No intermolecular interaction was observed between WT cofilin-1 proteins, whereas cofilin-1 mutants with alanine substitutions at Cys39 (C39A) or Cys80 (C80A) interacted each other and the interaction was increased when the cells were treated with ATP (Extended Data Fig. 4a and Fig 5a). However, cofilin-1 failed to interact with itself when both Cys39 and Cys80 were substituted with alanine (Fig 5a). These data indicate that Cys39 and Cys80 of WT cofilin-1 preferentially form an intramolecular disulfide bond, but when one of the cysteine residues is mutated, the remaining cysteine forms a disulfide bond with that of another cofilin-1 (Extended Data Fig. 4b).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBased on these data, we generated a structural model of oxidized cofilin-1 with Rosetta\u003csup\u003e33\u003c/sup\u003e, a bioinformatic tool, and manually introduced a disulfide bond between Cys39 and Cys80 using ChimeraX (version 1.9)\u003csup\u003e34\u003c/sup\u003e (Fig 5b). Structural alignment of the reduced and oxidized cofilin-1 revealed conformational differences (Fig. 5b and Extended Data Movie 2). Quantitative analysis showed a 558 Ų reduction in total solvent-accessible surface area in the oxidized form (Extended Data Table 3), indicative of a more compact tertiary structure following disulfide bond formation between Cys39 and Cys80. To assess the impact of cofilin-1 oxidation on its interaction with NLRP3, we conducted docking simulations using the HADDOCK2.4 web server\u003csup\u003e35\u003c/sup\u003e and selected the top-ranked cluster based on scoring parameters (Extended Data Table 4). The oxidized cofilin-1–NLRP3 complex displayed a significantly higher HADDOCK score (–52.5 ± 2.5) compared to the reduced form (–89.3 ± 1.9), along with increased van der Waals energy and a reduced buried surface area (Extended Data Table 5), indicating a weakened interaction following oxidation. These structural and computational analyses support a regulatory role for the Cys39–Cys80 disulfide bond in modulating cofilin-1–NLRP3 binding.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTherefore, we next generated mouse macrophage J774A.1 cells ectopically expressing all combinations of mutant cofilin-1 proteins in which each of the two cysteines was substituted with alanine by retroviral transduction. Consistent with the BMDMs of the KI-mice, no inhibition of ATP-induced IL-1β\u0026nbsp;release was observed in retroviral-transduced J774A.1 cells expressing mutant cofilin-1 with a single cysteine to alanine substitution (Fig. 5c). However, the level of IL-1β released by ATP was significantly reduced in the cells expressing cofilin-1 with C39A/C80A double mutations among the J774A.1 cells expressing cofilin-1 with two cysteine-to-alanine mutations (Fig. 5c).\u0026nbsp;In contrast, AIM2 inflammasome activation induced by dsDNA and NLRC4 inflammasome activation induced by flagellin were not suppressed by\u0026nbsp;C39A/C80A mutant cofilin-1 (Fig. 5c). These data indicate that oxidation of both Cys39 and Cys80 in cofilin-1 is required for NLRP3 inflammasome activation and C39A/C80A mutant cofilin-1 suppresses NLRP3. Consistent with this hypothesis, in a pull-down assay with BMDMs ectopically expressing WT and mutant cofilin-1 proteins, we observed that the C39A/C80A mutant cofilin-1 was not dissociated from NLRP3 by ATP, while cofilin-1 with a single mutation, C39A or C80A, was dissociated from NLRP3 by ATP, as was WT cofilin-1 (Fig. 5d).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFour amino acid residues from 101 to 104 of cofilin-1 are essential for interaction with NLRP3.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCofilin-1 is a 19 kDa protein consisting of 166 amino acids, most of which comprise an actin‐depolymerizing factor homology (ADF‐H) domain containing a nuclear localization signal and a phosphatidylinositol 4,5-bisphosphate [PI(4,5)P\u003csub\u003e2\u003c/sub\u003e] binding site (Fig. 6a). To determine the motif through which cofilin-1 binds to NLRP3, we pulled down recombinant GST fusion proteins containing the N-terminal (aa 2-84), middle (aa 41-127), or C-terminal (aa 85-166) half, or the full length cofilin-1, from lysates of LPS-primed differentiated U937 cells expressing endogenous NLRP3. Immunoblot analysis for NLRP3 revealed that the middle and C-terminal halves of cofilin-1 bound to NLRP3 (Fig. 6a, left panel). Since there is an overlapping region between the middle and C-terminal halves, we hypothesized that residues 85-127 harbor an NLRP3-binding motif. Indeed, no binding defect with NLRP3 was observed when the C-terminal end of cofilin-1 was deleted up to aa 135 (Fig. 6a, left panel), but in contrast, a binding defect with NLRP3 was observed when the C-terminal half was deleted from its N-terminus up to aa 105 (Fig. 6a, right panel). Taken together with the observation that the C-terminal portion of cofilin-1 with aa 100-166 still binds to NLRP3\u0026nbsp;(Fig. 6a, right panel), the binding motif of cofilin-1 for NLRP3 could be localized between aa 100 and aa 105.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWe also found that a cofilin-1 fragment (aa 95-127) consisting of 33 amino acid residues from 95 to 127, which includes the putative binding motif, strongly binds to NLRP3 (Fig. 6a).\u0026nbsp;To determine the amino acid sequence of the binding motif, each amino acid residue from 99 to 106 of the aa 95-127 fragment was substituted with alanine or threonine. The cofilin-1 fragment spanning amino acids 95–127 failed to interact with NLRP3 when individual residues at positions 101 to 104 were substituted, indicating that the core binding motif comprises Phe101-Ile102-Phe103-Trp104 (Fig. 6b).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo evaluate the structural and energetic contributions of this motif to NLRP3 binding, \u003cem\u003ein silico\u003c/em\u003e modeling of full-length cofilin-1 variants containing alanine substitutions at each position was performed. All four alanine substitutions resulted in marked reductions in both the intrinsic stability of cofilin-1 and the thermodynamic stability of the cofilin-1–NLRP3 complex. Additionally, binding affinity, as estimated by ΔΔG binding values, was consistently decreased across all variants, supporting the critical role of this aromatic and hydrophobic motif in mediating high-affinity interactions with NLRP3 (Fig. 6c,d and Extended Data Table 6). In contrast, substitution of Phe103 with tyrosine (F103Y) preserved the hydrophobic character and resulted in minimal changes in complex stability (ΔΔG binding = –0.09 kcal/mol) (Fig. 6c,d and Extended Data Table 6). Further, F103Y was predicted to have milder impact by AlphaMissense\u003csup\u003e36\u003c/sup\u003e, CADD\u003csup\u003e37\u003c/sup\u003e, and REVEL\u003csup\u003e38\u003c/sup\u003e, suggesting that an aromatic amino acid at this site is tolerated (Extended Data Table 7). This prediction was experimentally validated by a pull-down assay, which showed that the F103Y mutation within the 95–127 fragment did not compromise NLRP3 binding (Fig. 6e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCofilin-1 blocks ATPase activity of NLRP3\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe next investigated how the NLRP3 inflammasome is inhibited by the cofilin-1 binding. Given that cofilin-1 binds to the NBD, which has ATPase activity, and that ATP hydrolysis is essential for NLRP3 inflammasome assembly\u003csup\u003e39, 40\u003c/sup\u003e and activation, we hypothesized that cofilin-1 may inhibit NLRP3 inflammasome activation by suppressing the ATPase activity of the NLRP3 NBD. In an assay measuring ATP hydrolysis, we observed that full-length cofilin-1 significantly suppressed the ATPase activity of NLRP3 (Fig. 7a). Moreover, the ATPase activity of NLRP3 was significantly suppressed by the WT aa 95-127 fragment, but not by a mutant fragment with a substitution of Phe103 to alanine (aa 95-127 F103A), which did not bind to NLRP3 (Fig. 6b and Fig. 7a). These results demonstrate that cofilin-1 binds to the NBD of NLRP3 and thereby blocks the ATPase activity of NLRP3.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePeptides from cofilin-1 inhibit NLRP3 inflammasome activation.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cofilin-1 fragment comprising aa 95-127 contains the NLRP3-binding motif but lacks the cysteines responsible for regulating cofilin-1 dissociation from NLRP3 through oxidation-mediated disulfide bond formation. As expected, we observed that the binding of this fragment to NLRP3 remained unaffected by H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, while the binding of full length cofilin-1 was decreased by H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (Fig. 7b), suggesting that fragment aa 95-127 could be utilized as an inhibitor for the NLRP3 inflammasome. To investigate the impact of the aa 95-127 fragment on the NLRP3 inflammasome, we initially synthesized this fragment in peptide form along with another peptide corresponding to aa 134-166 of cofilin-1, excluding the NLRP3-binding motif. To avoid unintended activation of the AIM2 inflammasome during transfection, we delivered these peptides into BMDMs from AIM2 deficient mice. ATP- or nigericin-induced IL-1β release and caspase-1 activation were markedly inhibited by aa 95-127 but not by aa 134-166, whereas NLRC4 inflammasome activation induced by flagellin was not suppressed by aa 95-127 (Fig. 7c).\u003c/p\u003e\n\u003cp\u003eAs demonstrated previously, substitution of phenylalanine with alanine at position 103 (F103A) within the cofilin-1 fragment (aa 95–127) abrogated binding to NLRP3, whereas replacement with tyrosine (F103Y) preserved the interaction (Fig. 6b,e). Consistent with these binding data, the F103A-containing peptide (aa 95–127) failed to inhibit NLRP3 inflammasome activation. In contrast, the F103Y variant, which maintained NLRP3 binding, effectively suppressed NLRP3 inflammasome activity while exhibiting no inhibitory effect on the NLRC4 inflammasome (Fig. 7d). Additionally, we observed that the constitutive inflammasome activation of CAPS PBMCs was also substantially suppressed by peptides aa 95-127 or aa 95-127 F103Y, but not by peptide aa 95-127 F103A (Fig. 7e). Taken together, these data strongly support the proposal of a role for cofilin-1 in suppressing the NLRP3 inflammasome and suggest that fragment aa 95-127 of cofilin-1 potentially serves as an inhibitor for the NLRP3 inflammasome. Moreover, this finding holds significant promise for the development of therapeutic interventions targeting NLRP3-mediated inflammatory diseases, offering a novel approach to managing several acquired inflammatory diseases in which the NLRP3 inflammasome has been implicated.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eThrough an unbiased proteomic approach complemented with structural modeling, this paper presents, to our knowledge for the first time, strong evidence that cofilin-1 binds to NLRP3 and blocks the activation of the NLRP3 inflammasome, that cofilin-1 oxidation provides a mechanism for sensing intracellular ROS and releasing tonic NLRP3 inhibition, and that specific oxidation-resistant cofilin-1-derived peptides inhibit NLRP3 inflammasome activation. Our data add substantially to the emerging concept of homeostatic regulation of innate immunity\u003csup\u003e41\u003c/sup\u003e, and may also extend our abilities to functionally validate NLRP3 variants in a systematic fashion\u003csup\u003e3, 42\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eThe NLRP3 inflammasome is remarkable in its ability to respond to a broad spectrum of stimuli, including pathogens, cellular damage, metabolic stress, and environmental stressors. Rather than directly binding to these activators, NLRP3 detects intracellular physiological changes, such as potassium efflux and ROS generation, that regulate its activation. Our biochemical and modeling data demonstrate that cofilin-1 directly binds to both the NBD and LRR domains of NLRP3 in resting macrophages, perhaps accounting for the distribution of disease-associated \u003cem\u003eNLRP3\u0026nbsp;\u003c/em\u003evariants, and prevents inflammasome activation. However, upon ROS-induced oxidative stress, cofilin-1 undergoes oxidation, leading to its dissociation from NLRP3 and subsequent inflammasome activation. Blocking cofilin-1 oxidation through cysteine mutations or antioxidant treatment resulted in sustained binding to NLRP3 and suppression of inflammasome activation, highlighting the critical role of redox reactions in this regulatory process.\u003c/p\u003e\n\u003cp\u003eOur study also provides new mechanistic insights into CAPS-associated mutant NLRP3 activation. The actin-severing activity of cofilin-1 appears to be dispensable for NLRP3 inflammasome activation as the actin-severing activity is inhibited when the cysteines of colfilin-1 are oxidized\u003csup\u003e27, 29\u003c/sup\u003e. Moreover, our data demonstrate that peptides containing the NLRP3-binding motif, but lacking actin-severing activity, effectively suppress inflammasome activation, indicating that cofilin-1 modulates NLRP3 independently of cytoskeletal remodeling. We observed that mutant NLRP3 proteins causing CAPS exhibit significantly reduced binding to cofilin-1 compared to wild-type NLRP3, suggesting that impaired cofilin-1-mediated regulation contributes to the constitutive activation of these mutants. This finding further strengthens the concept that loss of negative regulatory mechanisms, rather than merely increased sensitivity to activators, plays a key role in the pathogenesis of CAPS. Our previous study of the pyrin inflammasome in familial Mediterranean fever (FMF) revealed a similar regulatory mechanism, in which the binding of inhibitory 14-3-3 proteins to mutant pyrin was substantially reduced compared to their binding to wild-type pyrin\u003csup\u003e22\u003c/sup\u003e. These findings suggest that, like the pyrin inflammasome, NLRP3 inflammasome activation follows a guard-type mechanism conserved in plant defense, in which host sensors detect common physiological disturbances rather than directly recognizing pathogen-associated molecular patterns, allowing the immune system to respond broadly to a wide range of infections and cellular stressors\u003csup\u003e43\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThioredoxin-interacting protein (TXNIP) has been proposed to be required for NLRP3 activation in response to ROS through direct interaction in islet cells\u003csup\u003e44\u003c/sup\u003e. However, the role of TXNIP as a positive regulator mediating ROS-induced NLRP3 activation remains controversial. TXNIP activation primarily enhances IL-1\u0026beta; mRNA and intracellular pro-IL-1\u0026beta; levels rather than directly promoting IL-1\u0026beta; secretion\u003csup\u003e45\u003c/sup\u003e, and in BMDMs from TXNIP KO mice, no significant difference in IL-1\u0026beta; release was observed in response to inflammasome activators\u003csup\u003e46\u003c/sup\u003e. In contrast, our BMDM data demonstrate that cofilin-1 knockdown induces NLRP3 inflammasome activation without exogenous stimulation and enhanced ATP- or nigericin-induced NLRP3 inflammasome activation. Cofilin-1 oxidation may also create an autocrine positive feedback loop because oxidized cofilin-1 translocates to mitochondria, leading to mitochondrial dysfunction and increased ROS generation\u003csup\u003e47, 48\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eImportantly, we identified a conserved motif (Phe-Ile-Phe-Trp, residues 101-104) in cofilin-1 that is essential for NLRP3 binding. An oxidation-resistant synthetic peptide containing this NLRP3-binding motif but not the cysteine residues that are oxidized by ROS effectively suppressed IL-1\u0026beta; release induced by both CAPS-associated NLRP3 mutations and canonical inflammasome activators. This finding opens new avenues for therapeutic development, as peptides mimicking this binding interface could serve as potential inhibitors of excessive NLRP3 activation, with a potentially broader impact than biologics that target IL-1b, IL-18, or Gasdermin D individually. Challenges of targeted-delivery remain, but RNA-based systems appear potentially feasible\u003csup\u003e49, 50\u003c/sup\u003e. Although MCC950 and related congeners represent another attractive approach, it is likely there will be a need for alternatives in patients who are unresponsive to\u003csup\u003e3\u003c/sup\u003e or intolerant of\u003csup\u003e51, 52\u003c/sup\u003e these agents. Given the broad involvement of NLRP3 in various inflammatory diseases, including gout\u003csup\u003e6\u003c/sup\u003e, type 2 diabetes\u003csup\u003e8\u003c/sup\u003e, atherosclerosis\u003csup\u003e7\u003c/sup\u003e, Alzheimer\u0026rsquo;s disease\u003csup\u003e9, 10\u003c/sup\u003e, and pericarditis\u003csup\u003e11, 12\u003c/sup\u003e, targeting the NLRP3-cofilin-1 interaction may represent an important opportunity for treating a spectrum of autoinflammatory and acquired inflammatory conditions.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eACKNOWLEDGMENTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Intramural Research Programs of the National Human Genome Research Institute. This research was also supported by the Korean Health Technology R\u0026amp;D Project, Ministry of Health and Welfare, South Korea (HR22C173405) and the National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIT) (RS-2023-00217595).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eFu, J., Schroder, K. \u0026amp; Wu, H. Mechanistic insights from inflammasome structures. \u003cem\u003eNat. Rev. Immunol.\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e,518-535 (2024).\u003c/li\u003e\n\u003cli\u003eHochheiser, I.V.\u003cem\u003e et al.\u003c/em\u003e Structure of the NLRP3 decamer bound to the cytokine release inhibitor CRID3. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e604\u003c/strong\u003e,184-189 (2022).\u003c/li\u003e\n\u003cli\u003eFeng, S.\u003cem\u003e et al.\u003c/em\u003e Mechanisms of NLRP3 activation and inhibition elucidated by functional analysis of disease-associated variants. \u003cem\u003eNat. Immunol.\u003c/em\u003e \u003cstrong\u003e26\u003c/strong\u003e,511-523 (2025).\u003c/li\u003e\n\u003cli\u003eHoffman, H.M., Mueller, J.L., Broide, D.H., Wanderer, A.A. \u0026amp; Kolodner, R.D. Mutation of a new gene encoding a putative pyrin-like protein causes familial cold autoinflammatory syndrome and Muckle-Wells syndrome. \u003cem\u003eNat. Genet.\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e,301-305 (2001).\u003c/li\u003e\n\u003cli\u003eAksentijevich, I.\u003cem\u003e et al.\u003c/em\u003e De novo CIAS1 mutations, cytokine activation, and evidence for genetic heterogeneity in patients with neonatal-onset multisystem inflammatory disease (NOMID): a new member of the expanding family of pyrin-associated autoinflammatory diseases. \u003cem\u003eArthritis Rheum.\u003c/em\u003e \u003cstrong\u003e46\u003c/strong\u003e,3340-3348 (2002).\u003c/li\u003e\n\u003cli\u003eMartinon, F., Petrilli, V., Mayor, A., Tardivel, A. \u0026amp; Tschopp, J. Gout-associated uric acid crystals activate the NALP3 inflammasome. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e440\u003c/strong\u003e,237-241 (2006).\u003c/li\u003e\n\u003cli\u003eDuewell, P.\u003cem\u003e et al.\u003c/em\u003e NLRP3 inflammasomes are required for atherogenesis and activated by cholesterol crystals. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e464\u003c/strong\u003e,1357-1361 (2010).\u003c/li\u003e\n\u003cli\u003eVandanmagsar, B.\u003cem\u003e et al.\u003c/em\u003e The NLRP3 inflammasome instigates obesity-induced inflammation and insulin resistance. \u003cem\u003eNature medicine\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e,179-188 (2011).\u003c/li\u003e\n\u003cli\u003eHalle, A.\u003cem\u003e et al.\u003c/em\u003e The NALP3 inflammasome is involved in the innate immune response to amyloid-beta. \u003cem\u003eNat. Immunol.\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e,857-865 (2008).\u003c/li\u003e\n\u003cli\u003eHeneka, M.T.\u003cem\u003e et al.\u003c/em\u003e NLRP3 is activated in Alzheimer\u0026apos;s disease and contributes to pathology in APP/PS1 mice. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e493\u003c/strong\u003e,674-678 (2013).\u003c/li\u003e\n\u003cli\u003eMauro, A.G.\u003cem\u003e et al.\u003c/em\u003e The Role of NLRP3 Inflammasome in Pericarditis: Potential for Therapeutic Approaches. \u003cem\u003eJACC Basic Transl Sci\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e,137-150 (2021).\u003c/li\u003e\n\u003cli\u003eVecchie, A.\u003cem\u003e et al.\u003c/em\u003e Interleukin-1 and the NLRP3 Inflammasome in Pericardial Disease. \u003cem\u003eCurr Cardiol Rep\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e,157 (2021).\u003c/li\u003e\n\u003cli\u003eAndreeva, L.\u003cem\u003e et al.\u003c/em\u003e NLRP3 cages revealed by full-length mouse NLRP3 structure control pathway activation. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e184\u003c/strong\u003e,6299-6312 e6222 (2021).\u003c/li\u003e\n\u003cli\u003eHe, Y., Zeng, M.Y., Yang, D., Motro, B. \u0026amp; Nunez, G. NEK7 is an essential mediator of NLRP3 activation downstream of potassium efflux. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e530\u003c/strong\u003e,354-357 (2016).\u003c/li\u003e\n\u003cli\u003eShi, H.\u003cem\u003e et al.\u003c/em\u003e NLRP3 activation and mitosis are mutually exclusive events coordinated by NEK7, a new inflammasome component. \u003cem\u003eNat. Immunol.\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e,250-258 (2016).\u003c/li\u003e\n\u003cli\u003ePetrilli, V.\u003cem\u003e et al.\u003c/em\u003e Activation of the NALP3 inflammasome is triggered by low intracellular potassium concentration. \u003cem\u003eCell Death Differ.\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e,1583-1589 (2007).\u003c/li\u003e\n\u003cli\u003eZhou, R., Yazdi, A.S., Menu, P. \u0026amp; Tschopp, J. A role for mitochondria in NLRP3 inflammasome activation. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e469\u003c/strong\u003e,221-225 (2011).\u003c/li\u003e\n\u003cli\u003eBruchard, M.\u003cem\u003e et al.\u003c/em\u003e Chemotherapy-triggered cathepsin B release in myeloid-derived suppressor cells activates the Nlrp3 inflammasome and promotes tumor growth. \u003cem\u003eNature medicine\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e,57-64 (2013).\u003c/li\u003e\n\u003cli\u003eSaller, B.S.\u003cem\u003e et al.\u003c/em\u003e Acute suppression of mitochondrial ATP production prevents apoptosis and provides an essential signal for NLRP3 inflammasome activation. \u003cem\u003eImmunity\u003c/em\u003e \u003cstrong\u003e58\u003c/strong\u003e,90-107 e111 (2025).\u003c/li\u003e\n\u003cli\u003eTassi, S.\u003cem\u003e et al.\u003c/em\u003e Altered redox state of monocytes from cryopyrin-associated periodic syndromes causes accelerated IL-1beta secretion. \u003cem\u003eProc. Natl. Acad. Sci. USA.\u003c/em\u003e \u003cstrong\u003e107\u003c/strong\u003e,9789-9794 (2010).\u003c/li\u003e\n\u003cli\u003eBalow, J.E., Jr.\u003cem\u003e et al.\u003c/em\u003e Microarray-based gene expression profiling in patients with cryopyrin-associated periodic syndromes defines a disease-related signature and IL-1-responsive transcripts. \u003cem\u003eAnnals of the rheumatic diseases\u003c/em\u003e \u003cstrong\u003e72\u003c/strong\u003e,1064-1070 (2013).\u003c/li\u003e\n\u003cli\u003ePark, Y.H., Wood, G., Kastner, D.L. \u0026amp; Chae, J.J. Pyrin inflammasome activation and RhoA signaling in the autoinflammatory diseases FMF and HIDS. \u003cem\u003eNat. Immunol.\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e,914-921 (2016).\u003c/li\u003e\n\u003cli\u003eBurger, D., Fickentscher, C., de Moerloose, P. \u0026amp; Brandt, K.J. F-actin dampens NLRP3 inflammasome activity via Flightless-I and LRRFIP2. \u003cem\u003eSci Rep\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e,29834 (2016).\u003c/li\u003e\n\u003cli\u003eLee, G.S.\u003cem\u003e et al.\u003c/em\u003e The calcium-sensing receptor regulates the NLRP3 inflammasome through Ca2+ and cAMP. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e492\u003c/strong\u003e,123-127 (2012).\u003c/li\u003e\n\u003cli\u003eAbramson, J.\u003cem\u003e et al.\u003c/em\u003e Accurate structure prediction of biomolecular interactions with AlphaFold 3. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e630\u003c/strong\u003e,493-500 (2024).\u003c/li\u003e\n\u003cli\u003eFinkel, T. Signal transduction by reactive oxygen species. \u003cem\u003eJ. Cell Biol.\u003c/em\u003e \u003cstrong\u003e194\u003c/strong\u003e,7-15 (2011).\u003c/li\u003e\n\u003cli\u003eKlemke, M.\u003cem\u003e et al.\u003c/em\u003e Oxidation of cofilin mediates T cell hyporesponsiveness under oxidative stress conditions. \u003cem\u003eImmunity\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e,404-413 (2008).\u003c/li\u003e\n\u003cli\u003eKlejnot, M.\u003cem\u003e et al.\u003c/em\u003e Analysis of the human cofilin 1 structure reveals conformational changes required for actin binding. \u003cem\u003eActa Crystallogr D Biol Crystallogr\u003c/em\u003e \u003cstrong\u003e69\u003c/strong\u003e,1780-1788 (2013).\u003c/li\u003e\n\u003cli\u003eCameron, J.M.\u003cem\u003e et al.\u003c/em\u003e Polarized cell motility induces hydrogen peroxide to inhibit cofilin via cysteine oxidation. \u003cem\u003eCurr. Biol.\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e,1520-1525 (2015).\u003c/li\u003e\n\u003cli\u003eColl, R.C.\u003cem\u003e et al.\u003c/em\u003e A small-molecule inhibitor of the NLRP3 inflammasome for the treatment of inflammatory diseases. \u003cem\u003eNature medicine\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e,248-255 (2015).\u003c/li\u003e\n\u003cli\u003eMunoz-Planillo, R.\u003cem\u003e et al.\u003c/em\u003e K(+) efflux is the common trigger of NLRP3 inflammasome activation by bacterial toxins and particulate matter. \u003cem\u003eImmunity\u003c/em\u003e \u003cstrong\u003e38\u003c/strong\u003e,1142-1153 (2013).\u003c/li\u003e\n\u003cli\u003ePfannstiel, J.\u003cem\u003e et al.\u003c/em\u003e Human cofilin forms oligomers exhibiting actin bundling activity. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e \u003cstrong\u003e276\u003c/strong\u003e,49476-49484 (2001).\u003c/li\u003e\n\u003cli\u003eLeaver-Fay, A.\u003cem\u003e et al.\u003c/em\u003e ROSETTA3: an object-oriented software suite for the simulation and design of macromolecules. \u003cem\u003eMethods Enzymol\u003c/em\u003e \u003cstrong\u003e487\u003c/strong\u003e,545-574 (2011).\u003c/li\u003e\n\u003cli\u003eGoddard, T.D.\u003cem\u003e et al.\u003c/em\u003e UCSF ChimeraX: Meeting modern challenges in visualization and analysis. \u003cem\u003eProtein Sci\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e,14-25 (2018).\u003c/li\u003e\n\u003cli\u003eHonorato, R.V.\u003cem\u003e et al.\u003c/em\u003e The HADDOCK2.4 web server for integrative modeling of biomolecular complexes. \u003cem\u003eNature protocols\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e,3219-3241 (2024).\u003c/li\u003e\n\u003cli\u003eCheng, J.\u003cem\u003e et al.\u003c/em\u003e Accurate proteome-wide missense variant effect prediction with AlphaMissense. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e381\u003c/strong\u003e,eadg7492 (2023).\u003c/li\u003e\n\u003cli\u003eSchubach, M., Maass, T., Nazaretyan, L., Roner, S. \u0026amp; Kircher, M. CADD v1.7: using protein language models, regulatory CNNs and other nucleotide-level scores to improve genome-wide variant predictions. \u003cem\u003eNucleic acids research\u003c/em\u003e \u003cstrong\u003e52\u003c/strong\u003e,D1143-D1154 (2024).\u003c/li\u003e\n\u003cli\u003eIoannidis, N.M.\u003cem\u003e et al.\u003c/em\u003e REVEL: An Ensemble Method for Predicting the Pathogenicity of Rare Missense Variants. \u003cem\u003eAmerican journal of human genetics\u003c/em\u003e \u003cstrong\u003e99\u003c/strong\u003e,877-885 (2016).\u003c/li\u003e\n\u003cli\u003eDuncan, J.A.\u003cem\u003e et al.\u003c/em\u003e Cryopyrin/NALP3 binds ATP/dATP, is an ATPase, and requires ATP binding to mediate inflammatory signaling. \u003cem\u003eProc. Natl. Acad. Sci. USA.\u003c/em\u003e \u003cstrong\u003e104\u003c/strong\u003e,8041-8046 (2007).\u003c/li\u003e\n\u003cli\u003eBrinkschulte, R.\u003cem\u003e et al.\u003c/em\u003e ATP-binding and hydrolysis of human NLRP3. \u003cem\u003eCommun Biol\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e,1176 (2022).\u003c/li\u003e\n\u003cli\u003eListon, A. \u0026amp; Masters, S.L. Homeostasis-altering molecular processes as mechanisms of inflammasome activation. \u003cem\u003eNat. Rev. Immunol.\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e,208-214 (2017).\u003c/li\u003e\n\u003cli\u003eCosson, C.\u003cem\u003e et al.\u003c/em\u003e Functional diversity of NLRP3 gain-of-function mutants associated with CAPS autoinflammation. \u003cem\u003eJ. Exp. Med.\u003c/em\u003e \u003cstrong\u003e221\u003c/strong\u003e (2024).\u003c/li\u003e\n\u003cli\u003eJones, J.D. \u0026amp; Dangl, J.L. The plant immune system. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e444\u003c/strong\u003e,323-329 (2006).\u003c/li\u003e\n\u003cli\u003eZhou, R., Tardivel, A., Thorens, B., Choi, I. \u0026amp; Tschopp, J. Thioredoxin-interacting protein links oxidative stress to inflammasome activation. \u003cem\u003eNat. Immunol.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e,136-140 (2010).\u003c/li\u003e\n\u003cli\u003eKoenen, T.B.\u003cem\u003e et al.\u003c/em\u003e Hyperglycemia activates caspase-1 and TXNIP-mediated IL-1beta transcription in human adipose tissue. \u003cem\u003eDiabetes\u003c/em\u003e \u003cstrong\u003e60\u003c/strong\u003e,517-524 (2011).\u003c/li\u003e\n\u003cli\u003eMasters, S.L.\u003cem\u003e et al.\u003c/em\u003e Activation of the NLRP3 inflammasome by islet amyloid polypeptide provides a mechanism for enhanced IL-1beta in type 2 diabetes. \u003cem\u003eNat. Immunol.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e,897-904 (2010).\u003c/li\u003e\n\u003cli\u003eKlamt, F.\u003cem\u003e et al.\u003c/em\u003e Oxidant-induced apoptosis is mediated by oxidation of the actin-regulatory protein cofilin. \u003cem\u003eNat Cell Biol\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e,1241-1246 (2009).\u003c/li\u003e\n\u003cli\u003eHoffmann, L.\u003cem\u003e et al.\u003c/em\u003e Cofilin1 oxidation links oxidative distress to mitochondrial demise and neuronal cell death. \u003cem\u003eCell Death Dis\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e,953 (2021).\u003c/li\u003e\n\u003cli\u003ePaunovska, K., Loughrey, D. \u0026amp; Dahlman, J.E. Drug delivery systems for RNA therapeutics. \u003cem\u003eNat Rev Genet\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e,265-280 (2022).\u003c/li\u003e\n\u003cli\u003eTaya, T., Kami, D., Teruyama, F., Matoba, S. \u0026amp; Gojo, S. Peptide-encoding gene transfer to modulate intracellular protein-protein interactions. \u003cem\u003eMol Ther Methods Clin Dev\u003c/em\u003e \u003cstrong\u003e32\u003c/strong\u003e,101226 (2024).\u003c/li\u003e\n\u003cli\u003eLi, H.\u003cem\u003e et al.\u003c/em\u003e Therapeutic potential of MCC950, a specific inhibitor of NLRP3 inflammasome. \u003cem\u003eEur J Pharmacol\u003c/em\u003e \u003cstrong\u003e928\u003c/strong\u003e,175091 (2022).\u003c/li\u003e\n\u003cli\u003eTang, F.\u003cem\u003e et al.\u003c/em\u003e First-in-human phase 1 trial evaluating safety, pharmacokinetics, and pharmacodynamics of NLRP3 inflammasome inhibitor, GDC-2394, in healthy volunteers. \u003cem\u003eClin Transl Sci\u003c/em\u003e\u003cstrong\u003e16\u003c/strong\u003e,1653-1666 (2023).\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"METHODS","content":"\u003cp\u003e\u003cstrong\u003eReagents\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUltra-pure flagellin (tlrl-pstfla), ATP (tlrl-atpl), poly (dA:dT) (tlrl-patn), nigericin (tlrl-nig), MSU (tlrl-msu), and ultra-pure LPS (tlrl-3pelps) were obtained from InvivoGen. Luteolin (2874), MCC950 (5479), and KH7 (3834) were from Tocris Bioscience. Recombinant human NLRP3 protein (TP320952) was from Origene and recombinant human Cofilin-1 protein (CF01) was from Cytoskeleton.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe used 8- to 16-week-old male and female mice (\u003cem\u003eMus musculus\u003c/em\u003e) on a C57BL/6J background in our experiments. Wild-type (WT) C57BL/6J mice were obtained from the Jackson Laboratory. Pyrin-KO (\u003cem\u003eMefv\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e) mice have been described previously\u003csup\u003e16\u003c/sup\u003e. ASC-, NLRP3-, and NLRC4-knockout (KO) mice were gifts from V.M. Dixit (Genentech Inc.). Caspase-1 KO mice were from R. Flavell (Yale University). AIM2 KO mice were from E. Alnemri (Thomas Jefferson University). In each experiment, experimental and control mice were age and sex matched, with both male and female mice used depending on availability. All animal studies were performed in accordance with US National Institutes of Health guidelines and were approved by the Institutional Animal Care and Use Committee of the National Human Genome Research Institute.\u003c/p\u003e\n\u003cp\u003eCofilin-1-Deficient Mice were generated using a targeting construct by inserting a 4.3 kb genomic fragment encompassing upstream and exon 1 (5\u0026rsquo; arm), 3.0-kb genomic fragment encompassing exon 2-4 flanking two loxP with neomycin resistant cassette, and 4.0-kb genomic fragment of downstream of \u003cem\u003ecof1\u003c/em\u003e. (3\u0026rsquo; arm) into pPNT-double loxP. Linearized constructs were introduced into embryonic stem (ES) cells of C57BL/6 background. G418-resistant clones were screened for homologous recombination by PCR. Heterozygotes generated from founders were crossed with EIIa-Cre transgenic mice (Jackson Laboratory) to remove exon 2-4 with the neo cassette.\u003c/p\u003e\n\u003cp\u003eFour knockin (KI) mice bearing oxidation-resistant cysteine to alanine mutations (C39A, C80A, C139A, and C147A) for each of the four cysteine residues in cofilin-1 were generated by homology-directed repair (HDR) using CRISPR-Cas9 genome editing. Single guide RNAs (sgRNAs) were 5\u0026rsquo;-GGTGCTCTTTTGCCTGAGTG-3\u0026rsquo; for C39A, 5\u0026rsquo;-TTGCATCATAGAGTGCATAG-3\u0026rsquo; for C80A, 5\u0026rsquo;-ATTACAAGCTAACTGCTACG-3\u0026rsquo;\u0026nbsp;for C139A, and\u0026nbsp;5\u0026rsquo;-GGTCAAGGACCGCTGCACCC-3\u0026rsquo;\u0026nbsp;for C147A. HDR donor oligonucleotides were\u0026nbsp;5\u0026rsquo;-CAAAAGTGGTGTAGGGGTCGTCCACAGTCTGCCCCACATCTCCTACCAGGATCTCCTTGCCCTCCTCCAGGATGATGTTCTTCTTGTCTTCACTCAGTGCAAAGAGCACCGCCTTCTTGCGTTTCTTCACTTCTTC-3\u0026rsquo;\u0026nbsp;for C39A,\u0026nbsp;5\u0026rsquo;-CATCCTGGAGGAGGGCAAGGAGATCCTGGTAGGAGATGTGGGGCAGACTGTGGACGACCCCTACACCACTTTTGTCAAGATGCTGCCAGACAAGGACGCGCGCTATGCACTCTATGATGCAACCTATGAGACCAAG-3\u0026rsquo;\u0026nbsp;for C80A, 5\u0026rsquo;-GAGGTGGCTCACAAAGGCTTGCCCTCCAGGGAAATGACGGCGCTGCCACCTAGTTTCTCTGCCAGGGTGCAGCGGTCCTTGACCTCTTCGTACGCGTTAGCTTGTAATTCATGCTTGATTCCTACAGGGTG-3\u0026rsquo;\u0026nbsp;for C139A, and 5\u0026rsquo;-AAATGACGGCGCTGCCACCTAGTTTCTCTGCAAGGGTGGCGCGGTCCTTGACCTCCTCGTAGCAGTTAGCTTGTAATTCATGCTTGATTCCTACAGGGTGAAAAGAGAGCAGTGAGCAGGAAGCACTGGGG-3\u0026rsquo;\u0026nbsp;for C147A. Cas9, sgRNA, and HDR donor oligonucleotides were transfected to mouse embryos at 0.5 day post coitum by electroporation. Electroporated zygotes were transferred to the oviducts of pseudopregnant females on the day of the vaginal plug.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePatients\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBlood specimens from 5 CAPS patients were drawn after obtaining informed consent under a protocol approved by the National Institute of Arthritis and Musculoskeletal and Skin Diseases/National Institute of Diabetes and Digestive and Kidney Diseases Institutional Review Board.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell preparation\u003c/strong\u003e\u003cstrong\u003e, inflammasome activation and immunoblot\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBone marrow progenitors were isolated from the tibia and femur of 8\u0026ndash;16-week-old male or female mice. The isolated progenitors were differentiated into macrophages (BMDMs) by culturing in Iscove\u0026apos;s Modified Dulbecco\u0026apos;s Media (IMDM; Gibco) supplemented with 20 ng/ml M-CSF (PeproTech), 10% heat-inactivated fetal bovine serum (FBS; Invitrogen), 1 mM sodium pyruvate (Invitrogen), 100 U/ml penicillin (Invitrogen), and 100 \u0026mu;g/ml streptomycin (Invitrogen). The differentiation process was carried out for 7 days in a humidified incubator at 37\u0026deg;C with 5% CO₂. BMDMs were replated in 12-well plates (1.0 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells per well) in\u0026nbsp;DMEM\u0026nbsp;(Invitrogen)\u0026nbsp;containing 10% FBS and antibiotics.1 day prior to experiments. Human peripheral blood mononuclear cells (PBMCs) were isolated by LSM-Lymphocyte Separation Medium (50494, MP Biomedicals) from freshly drawn peripheral venous blood from patients, and plated in 12-well plates(2.0 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells per well)\u0026nbsp;in RPMI 1640 (Invitrogen)\u0026nbsp;containing 10% FBS and antibiotics. cDNAs encoding\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eWT\u0026nbsp;or various mutant cofilin-1\u0026nbsp;was cloned into pLNCX2 vector (631503,Takara) and then transfected into RetroPack PT67 cells (631510, Takara). The cell culture medium of the transfected PT67 cells, which\u0026nbsp;contain viral particles, was collected by filtration with a low protein-binding0.22-\u0026mu;m syringe filter. The viral particle-containing medium was transferred\u0026nbsp;to\u0026nbsp;J774 cells\u0026nbsp;for viral infection in the presence of polybrene (8 \u0026mu;g ml\u0026minus;1). Cells\u0026nbsp;were centrifuged at 1,200\u003cem\u003eg\u0026nbsp;\u003c/em\u003efor 90 min at 32 \u0026deg;C and incubated for 8 h. Transduced\u0026nbsp;J774\u0026nbsp;cells were selected with G418 (800 \u0026mu;g ml\u003csup\u003e\u0026minus;1\u003c/sup\u003e) for 3 weeks\u0026nbsp;and replated in 12-well plates (1.0 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells per well) in\u0026nbsp;DMEM\u0026nbsp;containing 10% FBS and antibiotics.1 day prior to experiments. BMDMs, PBMCs, or J774 cells were primed with 1 \u0026mu;g\u0026nbsp;ml\u003csup\u003e-1\u003c/sup\u003e LPS for 3 h. For AIM2 or NLRC4 inflammasome activation, 1 \u0026mu;g\u0026nbsp;ml\u003csup\u003e-1\u003c/sup\u003eof dsDNA with 2.5 \u0026mu;l\u0026nbsp;ml\u003csup\u003e-1\u003c/sup\u003e of Lipofectamine 2000 (Invitrogen) or 0.5 \u0026mu;g\u0026nbsp;ml\u003csup\u003e-1\u003c/sup\u003e flagellin with 25 \u0026mu;l\u0026nbsp;ml\u003csup\u003e-1\u003c/sup\u003e DOTAP (Sigma), respectively, were mixed in Opti-MEM and incubated for 10 min before treating the cells. For NLRP3 inflammasome activation, cells were treated with ATP (5 mM), nigericin (10 \u0026micro;M), MSU (200 \u0026micro;g ml\u003csup\u003e-1\u003c/sup\u003e), KH7 (50 \u0026micro;M), and CaCl\u003csub\u003e2\u003c/sub\u003e (1 mM). None of the reagents in these experiments induced cytotoxicity as confirmed by LDH assay (K311-400, BioVision).\u003c/p\u003e\n\u003cp\u003eCell culture supernatants were collected, and cells were lysed with M-PER mammalian protein extraction reagent (78501, Thermo Fisher Scientific). Lysates and supernatants were analyzed by immunoblot with antibodies to human IL-1\u0026beta; (AF-201-NA, R\u0026amp;D Systems); mouse IL-1\u0026beta; (AF-401-NA, R\u0026amp;D Systems); cofilin-1 (sc-33779, rabbit polyclonal; sc-53934, mouse monoclonal, specific for reduced cofilin-1; sc-376476, mouse monoclonal, Santa Cruz Biotechnology); MYL12B (sc-130331 Santa Cruz Biotechnology); ARPC4 (ab217056, abcam); human Caspase-1 (p20) (AG-20B-0048, Adipogen Life Sciences); mouse Caspase-1 (p20) (AG-20B-0042, Adipogen Life Sciences); actin (sc-1615HRP; Santa Cruz Biotechnology); myc (sc-40HRP, Santa Cruz Biotechnology); NLRP3 (AG-20B-0014-C100, Adipogen; 15101, Cell Signaling); or V5 (R961-25, Thermo Fisher scientific). Released IL-1\u0026beta; was also measured in supernatants by ELISA (MLB00C, R\u0026amp;D Systems).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMass-Compatible Silver Staining and Mass Spectrometry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eImmunoprecipitated protein samples with NLRP3 specific antibody were separated on a 4-20 % SDS-polyacrylamide gel. The gel was fixed in 50% methanol and 12% acetic acid for 30 min, followed by washing with 50% ethanol for 20 min and then with 10% ethanol for 10 min. The gel was sensitized with 0.02% sodium thiosulfate for 1 min and washed with distilled water (D.W) three times. Staining was performed with 0.1% silver nitrate for 30 min in the dark, followed by three quick washes with D.W. Development was carried out in a solution containing 2% sodium carbonate and 0.04% formaldehyde until protein bands became visible. The reaction was halted by incubating the gel in 5% acetic acid for 10 minutes, followed by thorough rinsing with distilled water. The stained bands were then excised from the gel using a clean scalpel, digested in-gel with sequencing grade modified trypsin, and analyzed on a NanoLC-ESI-MS/MS system, a service provided by ProtTech, Phoenixville, PA. The mass spectrometric data was used to search against the most recent non-redundant protein database (NR database) from NCBI with ProtTech\u0026rsquo;s ProtQuest software suite.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSite-directed mutagenesis and gene knockdown assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMutated human cofilin constructs were generated by site-directed mutagenesis using QuickChange Lightning Kit (210519-5, Agilent Technologies) according to the manufacturer\u0026apos;s instructions. siRNAs targeting mouse cofilin-1 and negative control siRNA (4390847) were purchased from Invitrogen. The siRNAs for mouse \u003cem\u003eCof1\u003c/em\u003e knockdown was 5\u0026prime;-AGGAGAUCCUGGUAGGAGATT -3\u0026prime; (s121365). For siRNA gene knockdown experiments, 50 - 250 pmol siRNA was transfected into BMDMs (1x10\u003csup\u003e6\u003c/sup\u003e cells per well) by electroporation and replated in 12-well plates. After 18 h, the siRNA-transfected cells were primed with LPS for 7 h and the culture medium was replaced with serum free medium. Cell culture supernatants and lysates were collected after 2 h and analyzed by\u0026nbsp;immunoblot or ELISA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunoprecipitation\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eand Pull-down assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLPS-primed BMDMs treated with activators or inhibitors or 293T cells transiently transfected with expression constructs for the WT, CAPS-associated mutant, or various deleted forms of NLRP3 or WT or mutant cofilin-1 were lysed in an IP lysis buffer (30 mM Tris-Cl pH 7.4, 120 mM NaCl, 2 mM KCl, 2 mM EDTA, 10% Glycerol, 0.2% NP-40). The cell lysates were incubated overnight with antibodies to cofilin-1 (sc-376476, Santa Cruz Biotechnology); NLRP3 (AG-20B-0014-C100, Adipogen); V5 (R961-25, Thermo Fisher scientific); or myc (2278, Cell Signaling Technology) followed by incubation with protein A/G beads for 1 h at 4\u0026deg;C. After washing with the IP lysis buffer or PBS, bound proteins were eluted by 2\u0026times; SDS sample buffer from the beads and analyzed by immunoblot with antibodies to cofilin-1 (sc-53934, Santa Cruz Biotechnology); NLRP3 (15101, Cell Signaling or AG-20B-0014-C100, Adipogen); V5 (R961-25, Thermo Fisher Scientific); or myc (sc-40HRP, Santa Cruz Biotechnology). For \u003cem\u003ein vitro\u003c/em\u003e GST pull-down assay, purified GST-tagged full-length and various deleted cofilin-1 were bound to glutathione magnetic agarose beads (78602, Thermo Fisher Scientific) and incubated with phorbol 12-myristate 13-acetate\u0026nbsp;(PMA) treated U937 cell lysates in a GST lysis buffer (20 mM Tris-Cl pH 8.0, 300 mM NaCl, 1 mM EDTA, 0.5% NP-40) for 30 min and washed with the GST lysis buffer and PBS. Bound proteins were eluted by 2\u0026times; SDS sample buffer from the beads and analyzed by immunoblot with antibodies to NLRP3 or GST (sc-138 HRP,\u0026nbsp;Santa Cruz Biotechnology). Recombinant cofilin-1 and NLRP3 proteins were incubated in the presence or absence of H₂O₂ for 30 min at 37\u0026deg;C, immunoprecipitated with antibodies to NLRP3, cofilin-1, or normal mouse IgG, and analyzed by immunoblot.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasurements of Intracellular\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;ROS\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;and potassium\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBMDMs were plated 6.25 \u0026times; 10\u003csup\u003e3\u003c/sup\u003e cells/well in 96 well cell culture plate or 0.3 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells/well in 4 chamber cell culture slide one day before treatment. The cells were primed with LPS (100 ng ml\u003csup\u003e-1\u003c/sup\u003e) for 3 h, then treated with 5 or 10 \u0026mu;M MitoSox\u003csup\u003eTM\u003c/sup\u003e Green or Red mitochondrial superoxide indicators (M36009, Thermo Fisher Scientific) or Asante potassium green-2 AM y(ab142806, abcam) for 10 min. Following washing with PBS, cells were treated with 5 mM ATP for 5 min co-treatment with luteolin, KCl, or MCC950. Fluorescent signals were measured by a plate reader (Victor3\u003csup\u003eTM\u003c/sup\u003e, Perkin Elmer) or captured by confocal microscopy using Confocal Laser Scanning microscope (LSM 710; Carl Zeiss) and analyzed to assess the levels of intracellular ROS.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasurement of the ATPase activity of NLRP3\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman recombinant 0.15 ug NLRP3 protein (100190; BPS Bioscience) was incubated with purified GST, GST-tagged full-length cofilin-1, or GST-tagged WT or F103A mutant aa 95-127 cofilin-1 fragment in a reaction buffer (100 mM Tris pH 7.8, 2.8 mM EDTA, 100 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 15 mM KCl, 665 mM NaCl) at RT for 1 h followed by the addition of ATP (1 mM) for 40 min at 37 ◦C. The hydrolysis of ATP by NLRP3 was measured using ADP-Glo max assay (V7001, Promega, Madison, USA) according to the manufacturer\u0026rsquo;s instruction.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTransfection of Peptides\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePeptides were chemically synthesized with \u0026gt;95% purity by custom peptide synthesis service from Biomatik Corporation, Ontario, Canada. BMDMs from AIM2-deficient mice were plated 0.5 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells/well in 12 well cell culture plate one day before transfection and PBMCs from CAPS patients were plated 2 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells/well in 12 well cell culture plate on the day of transfection. Cells were primed with LPS (1 \u0026mu;g\u0026nbsp;ml\u003csup\u003e-1\u003c/sup\u003e for BMDMs, 0.1 \u0026mu;g\u0026nbsp;ml\u003csup\u003e-1\u003c/sup\u003e for PBMCs) for 3 h and changed the culture media with 350 ul of FBS-free DMEM (BMDMs) or RPMI (PBMCs). Peptides (20 uM, final concentration) were transfected into BMDMs using the Xfect\u003csup\u003eTM\u003c/sup\u003e protein transfection reagent (631324, Takara Bio Inc.), according to the manufacturer\u0026rsquo;s instruction. After 15 min, BMDMs were treated with ATP (5 mM), nigericin (1.25 uM), or flagellin (0.5 \u0026mu;g\u0026nbsp;ml\u003csup\u003e-1\u003c/sup\u003e with 25 \u0026mu;l\u0026nbsp;ml\u003csup\u003e-1\u003c/sup\u003e DOTAP) for 30 min, and PBMCs were incubated for 1 h.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eIn-silico\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProtein structure acquisition and complex prediction.\u0026nbsp;\u003c/strong\u003eInitial monomeric structures for human cofilin-1 and NLRP3 were obtained from the AlphaFold Protein Structure Database (AF-P23528-F1 and AF-Q96P20-F1). Canonical protein sequences retrieved from UniProt (CFL1: sp|P23528|COF1_HUMAN; NLRP3: sp|Q96P20|NALP3_HUMAN) were submitted to the AlphaFold3 server using the complex prediction mode to generate de novo models of protein\u0026ndash;protein interaction\u003csup\u003e21\u003c/sup\u003e. Two configurations were modeled: full-length cofilin-1 with full-length NLRP3 (FL\u0026ndash;FL), and a C-terminal peptide of cofilin-1 (residues 95\u0026ndash;127) with full-length NLRP3 (P\u0026ndash;FL). Chain A was designated as cofilin-1 (or peptide-cofilin-1) and chain B as NLRP3 in all models. A spin movie of the cofilin-1\u0026ndash;NLRP3 complex was created using UCSF ChimeraX (version 1.9)\u003csup\u003e\u0026nbsp;31\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMutagenesis and structural analysis.\u0026nbsp;\u003c/strong\u003ePoint mutations were introduced into each model manually using PyMOL v3.0\u003csup\u003e44\u003c/sup\u003e, and mutant structures were evaluated without further energy minimization. PyMOL was also used to visualize side-chain level residue contacts and evaluate structural interaction types, including van der Waals forces, hydrophobic packing, hydrogen bonding, aromatic stacking, and ionic contacts. Both the FL\u0026ndash;FL and P\u0026ndash;FL complexes were analyzed independently. In addition, interatomic contacts within 5 \u0026Aring; were calculated for all wild-type and mutant models to quantify the number of angstrom-level interactions at the protein\u0026ndash;protein interface.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStability, flexibility, and binding prediction.\u0026nbsp;\u003c/strong\u003eThe effect of each mutation on protein stability, conformational flexibility, and protein\u0026ndash;protein binding affinity was assessed using multiple complementary \u003cem\u003ein silico\u003c/em\u003e prediction tools. Free energy changes (\u0026Delta;\u0026Delta;G) were calculated as the difference between wild-type and mutant states (\u0026Delta;\u0026Delta;G = \u0026Delta;G_WT \u0026minus; \u0026Delta;G_Mutant), where negative values reflect destabilization or reduced binding affinity [4-10]. Mutational effects on \u0026Delta;\u0026Delta;G were predicted using mCSM\u003csup\u003e45\u003c/sup\u003e, DUET\u003csup\u003e46\u003c/sup\u003e, DynaMut\u003csup\u003e47\u003c/sup\u003e, DynaMut2\u003csup\u003e48\u003c/sup\u003e, DDMut\u003csup\u003e49\u003c/sup\u003e, SDM\u003csup\u003e50\u003c/sup\u003e, and ENCoM\u003csup\u003e51\u003c/sup\u003e. ENCoM was further used to compute changes in vibrational entropy (\u0026Delta;\u0026Delta;S_vib). These predictors estimate how missense variants affect either monomeric protein stability or complex integrity using graph-based approaches and statistical models trained on experimental \u0026Delta;\u0026Delta;G measurements. Changes in protein\u0026ndash;protein binding affinity (\u0026Delta;\u0026Delta;G_binding) were estimated using DDMut-PPI\u003csup\u003e52\u003c/sup\u003e and mCSM-PPI2\u003csup\u003e53\u003c/sup\u003e. All predictions were calculated using both full-length and peptide-bound models of the Cofilin-1\u0026ndash;NLRP3 complex. A consensus approach between tools was used to evaluate overall mutation effect.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVariant impact predictions.\u0026nbsp;\u003c/strong\u003eVariants were annotated using the Ensembl Variant Effect Predictor (VEP). Pathogenicity scores were obtained from AlphaMissense\u003csup\u003e33\u003c/sup\u003e, CADD v1.7\u003csup\u003e34\u003c/sup\u003e, and REVEL\u003csup\u003e35\u003c/sup\u003e. Allele frequencies and population-level constraint metrics were derived from the gnomAD database\u003csup\u003e54\u003c/sup\u003e to assess variant rarity and potential functional impact.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDomain-level interaction prediction.\u0026nbsp;\u003c/strong\u003eTo assess which domains of NLRP3 contribute most to cofilin-1 binding, we generated models of cofilin-1 with truncated NLRP3 constructs (PYD, PYD+NACHT, LRR, NACHT+LRR). Binding affinities (\u0026Delta;G) and dissociation constants (Kd) were calculated using the PRODIGY (PROtein binDIng enerGY prediction) web server\u003csup\u003e55\u003c/sup\u003e. Interface contact types and non-interacting surfaces were also extracted for interaction profiling.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStructural modeling of oxidized cofilin-1.\u0026nbsp;\u003c/strong\u003eUsing Robetta\u003csup\u003e56\u003c/sup\u003e available at https://robetta.bakerlab.org), which utilizes the Rosetta software suite\u003csup\u003e30\u003c/sup\u003e, we submitted the monomeric structure for human cofilin-1 (AF-P23528-F1) for structural refinement to reduce the distance between Cys39 and Cys80, which were initially 11.6 \u0026Aring; apart.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eThe PDB output of Rosetta was examined using ChimeraX for the appropriate bond geometry, ensuring that the sulfur atoms of the cysteine residues were within a typical bond distance (approximately 2.0-2.5 \u0026Aring;). We verified that the final model of cofilin-1 after Robetta optimization placed Cys39 and Cys80 2.1 \u0026Aring; apart, facilitating the formation of a disulfide bond.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eWe then used ChimeraX to manually introduce a disulfide bond between the Cys39 and Cys80 residues, representing the hypothetical oxidized form of cofilin-1. The input and output cofilin-1 structures were aligned, compared, and a spin movie animation was created to illustrate the dynamic structural differences between the two conformations. Solvent accessible surface area (SASA) values for reduced and oxidized cofilin-1 models were calculated using ChimeraX. The \u0026lsquo;measure sasa\u0026rsquo; command was applied to each model using the default probe radius of 1.4 \u0026Aring; and vertex density of 2.0. Total SASA values were recorded and compared to assess conformational changes resulting from disulfide bond formation. We then used the HADDOCK2.4 web server\u003csup\u003e32\u003c/sup\u003e to generate a model for the oxidized cofilin-1\u0026ndash;NLRP3 complex. The Rosetta/ChimeraX output oxidized cofilin-1 PDB and NLRP3 PDB obtained from the AlphaFold Protein Structure Database (AF-Q96P20-F1) were used as input files. Data obtained from the Alphafold3 model of cofilin-1 and NLRP3 were used to define the probable interface residues. Among the HADDOCK output data for the oxidized cofilin-1\u0026ndash;NLRP3 complex, two clusters displayed top-ranking scores (Clusters 1 and 3; see Extended Data Table 4 for detailed comparison). Although Cluster 3 had a slightly lower average HADDOCK score, we selected Cluster 1 for subsequent analysis, as the most reliable docking solution. This decision was based on its substantially larger cluster size (49 vs. 14), indicating better sampling convergence and increased confidence in the modeled interaction. Additionally, Cluster 1 showed advantages in terms of interface quality, with stronger electrostatic energy and greater buried surface area\u0026mdash;both suggestive of a stronger and more stable interface. To enable direct comparison, we also evaluated the AlphaFold3-predicted cofilin-1\u0026ndash;NLRP3 complex using the HADDOCK scoring protocol, by submitting the pre-assembled complex structure.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData analysis, statistics and experimental replicates\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStatistical analysis was carried out using a nonparametric Mann-Whitney t test, and the unpaired two-tailed t test using Prism software (GraphPad). A P value of \u0026le; 0.05 was considered statistically significant. The number of reproduced experimental repeats is described in the relevant figure legends. The investigators were not blinded to allocation during experiments and outcome assessment, except as noted above.\u0026nbsp;\u003c/p\u003e\u003cp\u003e53.\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Schrödinger, L. The PyMOL Molecular Graphics System, Version 3.0. \u0026nbsp;(2023).\u003c/p\u003e\n\u003cp\u003e54.\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Pires, D.E., Ascher, D.B. \u0026amp; Blundell, T.L. mCSM: predicting the effects of mutations in proteins using graph-based signatures. \u003cem\u003eBioinformatics\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e,335-342 (2014).\u003c/p\u003e\n\u003cp\u003e55.\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Pires, D.E., Ascher, D.B. \u0026amp; Blundell, T.L. DUET: a server for predicting effects of mutations on protein stability using an integrated computational approach. \u003cem\u003eNucleic acids research\u003c/em\u003e \u003cstrong\u003e42\u003c/strong\u003e,W314-319 (2014).\u003c/p\u003e\n\u003cp\u003e56.\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Rodrigues, C.H., Pires, D.E. \u0026amp; Ascher, D.B. DynaMut: predicting the impact of mutations on protein conformation, flexibility and stability. \u003cem\u003eNucleic acids research\u003c/em\u003e \u003cstrong\u003e46\u003c/strong\u003e,W350-W355 (2018).\u003c/p\u003e\n\u003cp\u003e57.\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Rodrigues, C.H.M., Pires, D.E.V. \u0026amp; Ascher, D.B. DynaMut2: Assessing changes in stability and flexibility upon single and multiple point missense mutations. \u003cem\u003eProtein Sci\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e,60-69 (2021).\u003c/p\u003e\n\u003cp\u003e58.\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Zhou, Y., Pan, Q., Pires, D.E.V., Rodrigues, C.H.M. \u0026amp; Ascher, D.B. DDMut: predicting effects of mutations on protein stability using deep learning. \u003cem\u003eNucleic acids research\u003c/em\u003e \u003cstrong\u003e51\u003c/strong\u003e,W122-W128 (2023).\u003c/p\u003e\n\u003cp\u003e59.\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Worth, C.L., Preissner, R. \u0026amp; Blundell, T.L. SDM--a server for predicting effects of mutations on protein stability and malfunction. \u003cem\u003eNucleic acids research\u003c/em\u003e \u003cstrong\u003e39\u003c/strong\u003e,W215-222 (2011).\u003c/p\u003e\n\u003cp\u003e60.\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Frappier, V., Chartier, M. \u0026amp; Najmanovich, R.J. ENCoM server: exploring protein conformational space and the effect of mutations on protein function and stability. \u003cem\u003eNucleic acids research\u003c/em\u003e \u003cstrong\u003e43\u003c/strong\u003e,W395-400 (2015).\u003c/p\u003e\n\u003cp\u003e61.\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Zhou, Y., Myung, Y., Rodrigues, C.H.M. \u0026amp; Ascher, D.B. DDMut-PPI: predicting effects of mutations on protein-protein interactions using graph-based deep learning. \u003cem\u003eNucleic acids research\u003c/em\u003e \u003cstrong\u003e52\u003c/strong\u003e,W207-W214 (2024).\u003c/p\u003e\n\u003cp\u003e62.\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Rodrigues, C.H.M., Myung, Y., Pires, D.E.V. \u0026amp; Ascher, D.B. mCSM-PPI2: predicting the effects of mutations on protein-protein interactions. \u003cem\u003eNucleic acids research\u003c/em\u003e \u003cstrong\u003e47\u003c/strong\u003e,W338-W344 (2019).\u003c/p\u003e\n\u003cp\u003e63.\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Chen, S.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e A genomic mutational constraint map using variation in 76,156 human genomes. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e625\u003c/strong\u003e,92-100 (2024).\u003c/p\u003e\n\u003cp\u003e64.\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Xue, L.C., Rodrigues, J.P., Kastritis, P.L., Bonvin, A.M. \u0026amp; Vangone, A. PRODIGY: a web server for predicting the binding affinity of protein-protein complexes. \u003cem\u003eBioinformatics\u003c/em\u003e \u003cstrong\u003e32\u003c/strong\u003e,3676-3678 (2016).\u003c/p\u003e\n\u003cp\u003e65.\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Kim, D.E., Chivian, D. \u0026amp; Baker, D. Protein structure prediction and analysis using the Robetta server. \u003cem\u003eNucleic acids research\u003c/em\u003e \u003cstrong\u003e32\u003c/strong\u003e,W526-531 (2004).\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6648864/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6648864/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Mutations in NLRP3 cause a spectrum of autoinflammatory disease, cryopyrin-associated periodic syndromes (CAPS). Reactive oxygen species (ROS) play a key role in NLRP3 inflammasome activation. We identified cofilin-1, an actin-severing protein, as a negative regulator of the NLRP3 inflammasome. In resting cells, cofilin-1 directly bound NLRP3, but upon stimulation with NLRP3 inflammasome activators, it was oxidized by ROS and dissociated from NLRP3. CAPS-associated mutant NLRP3 exhibited reduced binding to cofilin-1 compared to wild-type. Residues 101–104 of cofilin-1 were critical for NLRP3 interaction. Oxidation-resistant peptides containing this NLRP3-binding motif suppressed inflammasome activation induced by endogenous CAPS-associated mutations and \u003ci\u003eex vivo\u003c/i\u003e NLRP3 activators such as ATP and nigericin, but not flagellin. Bioinformatic structural analyses corroborate a model in which cofilin-1 plays a pivotal role in NLRP3 activation by ROS and support the potential use of cofilin-1-derived peptides in patients who are unresponsive to or intolerant of other forms of NLRP3 blockade.","manuscriptTitle":"Cofilin-1 is a Redox-Sensitive Guard of the NLRP3 Inflammasome","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-23 15:04:44","doi":"10.21203/rs.3.rs-6648864/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"nature-immunology","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"ni","sideBox":"Learn more about [Nature Immunology](http://www.nature.com/ni/)","snPcode":"","submissionUrl":"","title":"Nature Immunology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature Research","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"c74384e9-083d-4721-b789-b21b2c942e41","owner":[],"postedDate":"May 23rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":48843110,"name":"Biological sciences/Immunology/Inflammation/Inflammasome"},{"id":48843111,"name":"Biological sciences/Immunology/Immunological disorders/Inflammatory diseases/Autoinflammatory syndrome"}],"tags":[],"updatedAt":"2026-03-19T07:06:26+00:00","versionOfRecord":{"articleIdentity":"rs-6648864","link":"https://doi.org/10.1038/s41590-026-02477-8","journal":{"identity":"nature-immunology","isVorOnly":false,"title":"Nature Immunology"},"publishedOn":"2026-03-18 04:00:00","publishedOnDateReadable":"March 18th, 2026"},"versionCreatedAt":"2025-05-23 15:04:44","video":"","vorDoi":"10.1038/s41590-026-02477-8","vorDoiUrl":"https://doi.org/10.1038/s41590-026-02477-8","workflowStages":[]},"version":"v1","identity":"rs-6648864","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6648864","identity":"rs-6648864","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.