The asymmetrical ROS-METTL3-ESR1 axis in paraspinal muscle progenitor cells determines the progression of adolescent idiopathic scoliosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The asymmetrical ROS-METTL3-ESR1 axis in paraspinal muscle progenitor cells determines the progression of adolescent idiopathic scoliosis Xiexiang Shao, Bin Li, Amila Kuati, Jinkui Cai, Junlin Yang, Xingzuan Lin This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6683773/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 05 Mar, 2026 Read the published version in Experimental & Molecular Medicine → Version 1 posted 10 You are reading this latest preprint version Abstract Background Adolescent idiopathic scoliosis (AIS) is the most common spinal deformity, yet its precise etiology remains elusive. Our previous research highlighted the pivotal role of asymmetrical ESR1 expression of paraspinal muscle stem/progenitor cells in the progression of AIS. However, the widespread distribution of ESR1 in various organs and tissues limits its safety and efficacy as a therapeutic target, it is imperative to delve deeper into the regulatory mechanisms governing the asymmetric ESR1 expression in para-spinal muscle stem/progenitor cells to uncover safer and more effective treatment strategies for AIS. Methods Real-time quantitative PCR, immunofluorescence staining, Western blot, MeRIP-qPCR, m6A-seq, and reactive oxygen species (ROS) detection were employed to confirm the asymmetrical ROS-METTL3-ESR1 axis in paraspinal muscle progenitor cells of AIS patients. A unilateral oxidative stress-induced scoliosis mouse model was constructed for in vivo validation and rescue experiments. Results In this study, elevated level of ROS in the concave paraspinal muscles was discovered in AIS patients. The increased ROS decreased expression of m6A methyltransferase METTL3, which further diminished the expression of ESR1 by m6A dependent manner in concave paraspinal muscle stem/progenitor cells. Thus, asymmetrical ROS-METTL3-ESR1 axis in paraspinal muscle stem/progenitor cells played a crucial role in initiation and development of AIS. Furthermore, the antioxidant and methyl donor betaine could effectively mitigate the differentiation defects of concave muscle stem/progenitor cells and alleviated the progression of scoliosis through targeting ROS-METTL3-ESR1 axis. Conclusions: The unilateral oxidative stress is one of the causes of AIS by asymmetry ROS-METTL3-ESR1 axis in paraspinal muscle stem cells. Reducing ROS and increasing the expression of METTL3 in paraspinal muscle stem cells at concave side may be a new therapeutic strategy for AIS. Biological sciences/Molecular biology/Epigenetics/DNA methylation Health sciences/Anatomy/Musculoskeletal system/Muscle/Skeletal muscle Adolescent idiopathic scoliosis Oxidative stress N6-methyladenosine Muscle stem cells Betaine Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background Adolescent idiopathic scoliosis (AIS) is the predominant form of three-dimensional spinal deformities with a lateral spine curvature of at least 10°, affecting approximately 0.5–5.2% of adolescents worldwide 1 , 2 . AIS is more prevalent in females (female/male ratio: 1.5:1–3:1) and tends to progress during puberty growth spurt 3 , 4 . Although mild AIS patients can lead normal lives without serious complications, those with severe spinal deformities may suffer from chronic back pain, cardiorespiratory dysfunction and potentially life-threatening conditions 5 – 7 . A variety of factors have been suggested as contributors to AIS, including genetic, hormonal, musculoskeletal and environmental influences. However, the exact mechanism of AIS remains elusive 8 . The spinal musculature has been proposed as an important factor in the occurrence and development of AIS since 1970s 9 . The paravertebral muscles act as a pivotal role in maintaining spinal stability, and their imbalance is believed to contribute to spine biomechanical instability and result in the initiation and development of a scoliotic curve in AIS 10 . Biopsies obtained from the bilateral paravertebral muscle show apparent pathological changes on the concave side of the spine, including type I fiber atrophy, fibrosis and fatty infiltration 11 , 12 . The asymmetry of these muscles is also found by magnetic resonance imaging, biomechanical tests and electromyographic detection, which has been reported to be associated with AIS 8 , 13 , 14 . However, extensive research has focused on morphological studies, further investigation is needed to understand the underlying mechanisms that lead to paravertebral muscle asymmetry. Genome-wide association studies (GWAS) have identified PAX3 and MYOD1, which are pivotal transcription factors in muscle growth and regeneration, as susceptibility genes for AIS. Furthermore, studies have documented the asymmetric expression of PAX3 and MYOD1 in AIS patients 15 – 17 . Significantly, our previous research revealed that asymmetrical ESR1 expression in paravertebral muscles is crucial in the progression of AIS and suggested a potential therapeutic approach using Raloxifene, a FDA approved selective estrogen receptor modulator 18 . However, given that ESR1 is expressed in numerous tissues and organs, the paramount concerns are the safety and efficacy of Raloxifene administration 19 , 20 . Consequently, it is imperative to delve deeper into the regulatory mechanisms governing the asymmetric ESR1 expression in para-spinal muscle stem/progenitor cells to uncover safer and more effective treatment strategies for AIS. As an important component of the epigenetic landscape, N6-methyladenine (m6A) stands out as the most prevalent internal modification on eukaryotic mRNA, exerting a pivotal influence on mRNA stability and the regulation of gene expression 21 – 23 . METTL3, a key m6A methyltransferase, is implicated in a multitude of biological processes, notably including the maintenance of muscle function 24 – 26 . Recent studies have shown that METTL3-mediated m 6 A modification regulates the myoblast transition from proliferation to differentiation 27 . Another study revealed that METTL3 is essential to stabilize MyoD mRNA level in myoblasts for skeletal muscle differentiation 28 . Overall, these results suggest METTL3 plays an important role in muscle progenitor cell proliferation and differentiation 29 . In our study, elevated reactive oxygen species (ROS) in the concave para-spinal muscles was discovered in AIS patients. The increased ROS decreased expression of m6A methyltransferase METTL3, which further diminished the expression of ESR1 by m6A dependent manner in concave paraspinal muscle stem/progenitor cells. Finally, decreased expression of ESR1 caused defects in the differentiation of concave muscle stem/progenitor cells and exacerbating the severity of scoliosis. Furthermore, we employed betaine (trimethyl glycine), a stable and non-toxic compound known for its potent antioxidant properties and its ability to enhance m6A methylation 30 – 34 , to effectively mitigate the differentiation defects of concave muscle stem/progenitor cells and alleviate the progression of scoliosis through targeting ROS-METTL3-ESR1 axis. These findings elucidate the mechanism behind the asymmetric ESR1 expression in para-spinal muscle stem/progenitor cells and suggest a safer and more viable therapeutic approach for AIS. Methods Animals All experimental procedures were approved by local institutional animal care and use committee (Approval no. XHEC-F-2024-042). Female mice were used for all the animal experiment. The Pax7-CreERT2 mice were sourced from Jackson Laboratory (cat#011763), while the Mettl3 flox/flox mice were procured from Gem Pharmatech (cat# T006659). Muscle stem cell-specific gene knockout was achieved by administering intraperitoneal injections of 100μL of a 10 mg/mL tamoxifen solution (ABCONE, cat#T56488) every 48 hours for a period of one week. Bipedal mouse models were prepared as detailed in previous reports 50 . For the establishment of the scoliosis mouse model, 3-week-old bipedal mice received unilateral intramuscular injections of 100μL 100μM H 2 O 2 (Sigma, cat#HX0640) at the left side and 100 μL PBS at the right side of the para-spinal muscle, which were carried out twice weekly for a duration of three weeks. In these oxidative stress-induced scoliosis mouse models, intramuscular injections of 10nM Betaine (Vokai Biotechnology, cat#E11074) were administered to the concave para-spinal muscle twice weekly for two weeks. Assessments of spinal alignment and para-spinal muscle size were conducted two weeks after the final betaine injection. Human samples Bilateral paraspinal muscles that were discarded during surgery at the level of the apical vertebra were collected as previously described 51 . The harvesting procedure posed no additional risk to the patients. The study was granted approval by the local institutional ethics committee (Approval No. XHEC-D-2019-093), and written informed consent was obtained from all participants and, where applicable, their legal guardians. Isolation of muscle stem/progenitor cells Muscle stem/progenitor cells were isolated according to previously established methods 18,52 . In summary, muscle tissues were sectioned and enzymatically dissociated using collagenase II and dispase (Worthington Biochemical, 700-800 U/mL, cat#LS004177; Life Technologies, 11 U/mL, cat#17105-041). The resulting digest was passed through a 40-μm cell strainer (BD Falcon, cat#352340). For human cells, the suspension was incubated with the following antibodies for 45 minutes at 4 °C: PE-Cy5 anti-human CD45 (BD Pharmingen, cat#555484, diluted 1:25), PerCP-Cy5.5 anti-human CD31 (BioLegend, cat#303132, diluted 1:100), AF-488 anti-human CD29 (BioLegend, cat#303016, diluted 1:100), and BV421 anti-human CD56 (BD, cat#562751, diluted 1:100). For mouse cells, the suspension was stained with APC anti-mouse CD31 (BioLegend, cat#102510, diluted 1:100), APC anti-mouse CD45 (BioLegend, cat#103112, diluted 1:100), FITC anti-mouse Sca1 (BioLegend, cat#108106, diluted 1:100), and Biotin anti-mouse VCAM1 (BioLegend, cat#105703, diluted 1:100) for the same duration and temperature. All cell suspensions were washed with PBS and subsequently stained with PE/Cy7 Streptavidin (BioLegend, cat#405206, diluted 1:100) for 15 minutes. Finally, CD31- CD45- CD29+ CD56+ human muscle stem/progenitor cells and CD31- CD45- Sca1- VCAM1+ murine muscle stem cells were obtained by BD Influx sorter (BD Biosciences) Cell culture and treatment Primary human muscle stem/progenitor cells were cultured in F10 basal medium (Gibco, cat#11550043) with 20% fetal bovine serum (FBS, Gibco, cat#10-013-CV) and 2.5 ng/mL bFGF (R&D, cat#233-FB-025). Mouse muscle stem cells were cultured in F10 basal medium (Gibco, cat#11550043) with 20% FBS (Gibco, cat#10-013CV), 2.5 ng/mL bFGF (R&D, cat#233-FB-025), 5 ng/mL IL-1α (Peprotech, cat#211-11 A), 5 ng/mL IL-13(Peprotech, cat#210-13), 5 ng/mL IFN-γ (Peprotech, cat#315-05), 5 ng/mL TNF-α (Peprotech, cat#315-01 A), and 1% penicillin-streptomycin (Gibco, cat#15140-122) in collagen-coated dishes at 37 °C in 5% CO2. The differentiation medium was Dulbecco’s Modified Eagle Medium (DMEM, Gibco, cat#11965118) with 2% horse serum (HyClone, cat#HYCLSH30074.03HI) and 1% penicillin-streptomycin (Gibco, cat#15140-122). For the H 2 O 2 treatment, the procedure was carried out as previously detailed. Muscle stem cells were subjected to 100 μmol/L H 2 O 2 (Sigma, cat#HX0640) during myogenic differentiation. This group of cells was designated as the oxidative stress group (OS). For betaine treatment, the human muscle stem/progenitor cells isolated from paravertebral muscles were treated with 10nM Betaine (Vokai Biotechnology, cat#E11074) during myogenic differentiation. RNA-sequencing Total RNA extraction from paraspinal muscle samples and stem/progenitor cells, collected from both the convex and concave regions, was performed utilizing the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, cat#E7530L) was entrusted with the task of constructing RNA libraries. Next, a cDNA library was prepared using a non-stranded method. Paired-end sequencing was performed on a NovaSeq 6000 sequencer with a 2×150bp read length. Subsequently, clean paired-end reads were aligned to the GRCh38.98 reference genome using HISAT2, and gene abundances were quantified with RSEM (http://deweylab.biostat.wisc.edu/rsem/). Gene Ontology (GO) analyses were performed using Goatools (https://github.com/tanghaibao/Goatools). The selection of the top Gene Ontology (GO) categories was informed by the associated P values, which indicate the statistical significance of the identified gene functions and biological processes. RNA extraction and Real-Time RT-qPCR Total RNA was isolated employing Trizol Reagent (Invitrogen, Carlsbad, CA, USA). Synthesis of complementary DNA (cDNA) was carried out using the PrimeScript Master Mix (TaKaRa, Kyodo, Japan), following the manufacturer's protocol. Quantitative detection of mRNA expression was facilitated by the SYBR Premix Ex Taq™ II Kit (TaKaRa, Kyodo, Japan). The specific primer sequences utilized in this process are detailed in Table 1. Table 1. The primer sequences of 5 specific primers of ESR1 for MeRIP-qPCR. Primer Name Forward (5′-3′) Reverse (5′-3′) Human GAPDH CAAGGCTGAGAACGGGAAGC AGGGGGCAGAGATGATGACC Human METTL 3 TTGTCTCCAACCTTCCGTAGT CCAGATCAGAGAGGTGGTGTAG Human ESR1 CCCACTCAACAGCGTGTCTC CGTCGATTATCTGAATTTGGCCT Human MYH1 GGGAGACCTAAAATTGGCTCAA TTGCAGACCGCTCATTTCAAA Human MYH3 ATTGCTTCGTGGTGGACTCAA GGCCATGTCTTCGATCCTGTC Human CKM ATGCCATTCGGTAACACCCAC GCTTCTTGTAGAGTTCAAGGGTC Human MYOG GGGGAAAACTACCTGCCTGTC AGGCGCTCGATGTACTGGAT Mouse Gapdh ACCCAGAAGACTGTGGATGG ACACATTGGGGGTAGGAACA Mouse Esr1 CCCGCCTTCTACAGGTCTAAT CTTTCTCGTTACTGCTGGACAG Mouse Myh1 GCGAATCGAGGCTCAGAACAA GTAGTTCCGCCTTCGGTCTTG Mouse Myh3 ATGAGTAGCGACACCGAGATG ACAAAGCAGTAGGTTTTGGCAT Mouse Ckm GGCAACACCCACAACAAGTTC CCTTGAAGACCGTGTAGGACT Mouse MyoG GAGACATCCCCCTATTTCTACCA GCTCAGTCCGCTCATAGCC Western blot analysis and protein extraction Cells and tissues were lysed using RIPA buffer supplemented with protease inhibitors (Beyotime Biotech, cat#P0013B, cat#P1005). Protein concentrations were quantified by the bicinchoninic acid (BCA) assay (Beyotime Biotech, cat#P0012). Protein expression levels were assessed via western blotting, as previously described. Briefly, the proteins were then transferred onto polyvinylidene fluoride (PVDF) membranes (MilliporeSigma, USA) after separated on SDS-polyacrylamide gels. Following overnight incubation with the primary antibodies and secondary antibodies. The primary antibodies employed in these analyses targeted ESR1 (Abcam, cat#A19665), METTL3 (Abcam, cat# ab195352, 1:1000), and GAPDH (Cell Signaling Technology, cat#2118S, 1:5000). Chemiluminescent signals were visualized and photographed by Classical ChemiDoc Imager (SHST, China). m6A sequencing (m6A‑seq) and data analysis The m6A sequencing was conducted by (CloudSeq Biotech, Shanghai, China). The raw sequencing reads were initially mapped to the reference mouse genome (mm10) using the Hisat2 software. Subsequently, the mapped reads from the IP and input libraries were analyzed using the R package exomePeak to identify significant m6A peaks and differential peaks, setting the significance threshold of FDR (False Discovery Rate)≤0.05. Finally, the IGV software was employed for visualization. Methylated RNA immunoprecipitation (MeRIP)-qPCR The m6A RNA Methylation Fragment Enrichment Kit (Epigentek, P-9018) was employed for the MeRIP studies, with all procedures strictly adhering to the manufacturer's guidelines. In brief, 2 μg of RNA samples were set aside as the input control, while 18 μg of RNA samples, m6A antibody, and affinity beads was mixed and then vortexed at room temperature for 90 minutes to facilitate m6A RNA immunocapture. Subsequently, a cleavage enzyme mix was employed to generate RNA fragments. The proteinase K and an RNA purification solution were added to eliminate excess proteins and isolate m6A-enriched RNA. Ultimately, the immunoprecipitated m6A RNA was obtained using elution buffer. The m6A enrichment in ESR1 mRNA was quantified by RT-qPCR and normalized to the input levels. The specific primers used for screening are presented in Table 2. Table 2. The primer sequences of 5 specific primers of ESR1 for MeRIP-qPCR. Primer Name Forward (5′-3′) Reverse (5′-3′) Esr1-Seg1 TTCTGACAATCGACGCCAGAA TCTTAAAGAAAGCCTTGCAGCC Esr1-Seg2 GATAAGCACTTCATAATGGCTCCA CATGTTGCTATAGGAATGCAAGC Esr1-Seg3 GTCACAATGAACCTGCAAGC ATTCTCCACATTTCTCCCTTACT Esr1-Seg4 GAGTCCTTTGAACAAGGGGAT CCCATCATATCTCAATGGAGTTC Esr1-Seg5 TAGCTAATGGGTCAGTGGGTTCT AGATGGGATAATGTAAAACCCTCC Luciferase reporter assay The luciferase reporter assay was applied to find the functional methylation site in ESR1. The pmiRGLO vector (MIAOLING BIOLOGY, P0198) was used as plasmid vector. The wild type 3’UTR of ESR1 (ESR1-3’UTR-WT) or mutant 3’UTR of ESR1 (ESR1-3’UTR-Mut) was inserted behind the F-luc coding region, respectively. The transfection of pmiRGLO-ESR1-3’UTR-WT and pmiRGLO-ESR1-3’UTR-Mut (A to G mutation at position 2409) into cells was facilitated using Lipo3000 reagent (Invitrogen). Subsequent luciferase assays were carried out with the Dual-Luciferase Reporter Assay Kit (Yeasen Biotechnology, 11402ES60)), following the protocol provided by the kit. RNA and protein stability analysis To perform RNA stability assay, actinomycin D (MCE, cat#HY-17559, 5 μg/ml) was added to inhibit the mRNA transcription of muscle stem/progenitor cells for 0, 3, 6, 9, 12h 53 . The total RNA was collected and reverse-transcribed into cDNA. The ESR1 RNA levels were determined using RT-qPCR, and the RNA degradation rate was calculated with GAPDH served as normalization reference. To evaluate protein stability, Muscle stem/progenitor cells were treated with cycloheximide (MCE, cat#HY-12302, 100μg/mL) to inhibit protein synthesis. Then the total protein was collected at specific time points at 0, 3, 6, 9, and 12 hours for subsequent analysis. ESR1 and GAPDH protein expression was assessed using western blotting 54 . Measurement of ROS levels The assessment of total ROS levels was conducted using the ROS detection assay kit (BestBio, China, cat#BB-460512). Briefly, the homogenate was made from 20mg of fresh muscle tissues from paravertebral of AIS patients and centrifuged at 4 °C for 10 minutes. 190 μL of supernatant was collected and incubated with 10 μL of BBcellProbeTM O11 ROS probe in a 96-well plate at 37 °C in the dark for 45 minutes. Multifunction microplate reader (Multiskan GO, Thermo Scientific, USA) was employed to measure ROS levels at an excitation/emission wavelength of 488/530 nm. Global RNA m6A content quantification The global m6A modification level in total RNA was determined following the protocol of the m6A RNA Methylation Quantification Kit (MEIMIAN, China, cat#MM-2109H1). In summary, 200 ng of RNA was aliquoted into the assay wells, followed by the addition of the appropriately diluted detection antibody solution. The m6A levels were then quantified through colorimetric analysis by measuring the absorbance at 450 nm and correlating the results with the standard curve provided. Immunohistology and immunofluorescent staining Fresh muscle tissues were embedded in OCT and sectioned using a cryostat (Leica, cat#CM1860) to produce 10 μm thick slices. Both the tissue sections and cultured cells were fixed with 4% paraformaldehyde (Sigma-Aldrich, cat#30525) for 15 minutes and permeabilized with 0.1% Triton X-100 for 10 minutes at room temperature. Following this, they were blocked with 1% BSA (Beyotime Biotechnology, cat#ST023). Subsequently, the sections and cells were incubated with anti-Laminin (Abcam, cat#ab11575, diluted 1:500) or anti- MyHC (Millipore, cat#05-716, diluted 1:1000) primary antibodies overnight. Alexa 488 or Alexa 594-conjugated anti-mouse or anti-rabbit secondary antibodies (Invitrogen, cat#A11034, cat#A11005, diluted 1:1000) were applied to visualize the target protein. 4',6-Diamidino-2-phenylindole (DAPI, Vector Laboratories, cat#H-1200) was used for nuclear counterstaining, and the samples were finally mounted using an anti-fluorescence mounting medium (Vector Laboratories, cat#H-1200). Measurement of myofibers and myotubes A minimum of five random visual fields were randomly selected and assessed for each sample. Laminin staining delineated the boundaries of myofibers, while MyHC staining outlined the contours of myotubes. The Image J software was employed to enumerate cell nuclei (both total cell nuclei and those within myotubes) and to measure the cross-sectional area of the myofibers. All imaging analysis and evaluation were conducted by investigators in a blinded fashion to ensure objectivity. X-ray assessment X-ray assessment was performed for anesthetized mice to evaluate spinal alignment as described in previous reports 50 . Radiographic images in both coronal and sagittal planes were captured using the Faxitron X-ray specimen radiography system (MX-20, USA). The images were independently evaluated by two certified spine surgeons who were blinded to the study conditions, focusing on measuring the Cobb angles in coronal and sagittal plane. Statistical analysis All experiments were performed at least three times to ensure reproducibility. Data points and error bars depicted in the graphs represented the mean values ± standard deviation (SD). Statistical comparisons between groups were made using a two-tailed Student’s t-test, as implemented in GraphPad Prism 7 software. A P value less than 0.05 was considered to indicate statistical significance. *P < 0.05; **P < 0.01; ***P < 0.001; ns, indicated no significant changes. Results The muscle stem/progenitor cells are exposed to high ROS circumstance with suppressed METTL3 expression in concave side of AIS patients. To analyze the features of bilateral paraspinal muscles, we first conducted RNA sequencing analysis. The GO enrichment analysis demonstrated heightened expression of genes associated with inflammation and reactive oxygen species (ROS), as well as diminished expression of genes related to muscle function and development, specifically on the concave side of AIS patients (Fig. 1 a, b). Subsequent measurements of ROS levels of bilateral paraspinal muscle also validated the RNA-Seq findings that there was significantly increased level of concave paraspinal muscle for AIS patients, while no difference was identified for bilateral paraspinal muscles for congenital scoliosis (CS) patients (Fig. 1 c). These initial findings suggested that muscle stem/progenitor cells on the concave side of AIS patients were subjected to oxidative stress. To further elucidate the expression profile difference of bilateral muscle stem/progenitor cells, we performed and analyzed RNA-Seq on these cells. Consistently, GO enrichment analysis also revealed an increase in terms related to inflammatory infiltration and redox reactions (Fig. 1 d). In addition, it was worth noting that downregulated genes enriched terms associated with RNA methyltransferase activity (Fig. 1 e), while the key m6A methyltransferase METTL3 was identified as one of a significantly decreased genes among the GO term RNA methyltransferase activity (Fig. 1 f). We subsequently corroborated the RNA-Seq results using RT-qPCR and western blot analyses at both the mRNA and protein levels, which consistently showed decreased METTL3 expression in muscle stem/progenitor cells on the concave side of AIS patients (Fig. 1 g, h). In contrast, no such variation in METTL3 was observed in para-spinal muscle stem/progenitor cells from control subjects (CS patients) (Fig. 1 g). Since METTL3 acts as a major writer of m6A modification, we then assessed the global m6A methylation levels in muscle stem/progenitor cells from both sides. The results demonstrated a reduction in global m6A level in cells from the concave side when compared to the convex side, while para-spinal muscle stem/progenitor cells from congenital scoliosis patients did not exhibit asymmetric m6A level. Collectively, these findings underscored the muscle stem/progenitor cells were exposed to high ROS circumstance with suppressed METTL3 expression in concave side of AIS patients High levels of ROS could impair the myogenesis of muscle stem/progenitor cells by suppressing the expression of METTL3. Given the results that the muscle stem/progenitor cells on the concave side of AIS patients are exposed to high ROS circumstance with decreased METTL3, we hypothesized that heightened ROS activity may suppress the expression of METTL3, consequently impairing the differentiation of these cells. To test this hypothesis, we first established a high ROS cell model using 100µM H 2 O 2 to investigate its effects on freshly isolated human primary muscle stem/progenitor cells from para spinal muscles. Following treatment with H 2 O 2 , the expression of METTL3 was significantly decreased in both mRNA and protein levels tested by RT-qPCR, immunofluorescent staining and western blot tests (Fig. 2 a-d). Thus, high levels of ROS significantly suppressed the expression of METTL3 in muscle stem/progenitor cells. To further explore the potential role of Mettl3 in myogenesis of muscle stem/progenitor cells, we generated muscle stem cell specific Mettl3 knockout (KO) mice by administering intraperitoneal tamoxifen injections to Pax7-CreERT2; Mettl3 flox/flox mice at three weeks old (Fig. 2 e). The isolation of muscle stem cells was carried out as previously described, and the KO efficiency of Mettl3 was confirmed through RT-qPCR and western blot tests (Fig. 2 f, g). The para-spinal myofiber size in Mettl3 KO mice was observed to be smaller compared to that of wild-type (WT) mice at eight weeks old (Fig. 2 h, i). We then investigated the role of Mettl3 in myogenic differentiation. Muscle stem cells derived from Mettl3 WT and KO mice were induced to differentiate for 48 hours. The immunofluorescent staining of MyHC revealed a decrease in myotube size and differentiation efficiency in Mettl3 KO cells (Fig. 2 j, k). Consistently, the expression of differentiation markers, including Myh1, Myh3, Ckm, and MyoG, was also found to be decreased (Fig. 2 l). Together, these results suggested that high levels of ROS led to a decrease in METTL3 expression in muscle stem/progenitor cells, which further impaired the myogenic differentiation ability. Mettl3-mediated m6A modification regulates Esr1 mRNA stability. Mettl3 plays a significant role in post transcription regulation through m6A modification. Building on our previous research highlighting the critical role of asymmetrical ESR1 expression in the progression of AIS patients, we then further investigated the functional relationship between Mettl3 and Esr1. We assessed Esr1 levels in muscle stem cells from Mettl3 knockout (KO) mice using RT-qPCR and western blot tests, which revealed a significant reduction in Esr1 levels at both the mRNA and protein levels (Fig. 3 a, b). These data indicated Mett3 could regulate the expression level of Esr1 by m6A dependent manner. To characterize the potential mechanism of how m6A methylation regulated Esr1, we firstly conducted a SRAMP analysis ( http://www.cuilab.cn/sramp/ ) to identify potential m6A modification loci on Esr1 35 . The analysis indicated the presence of five possible m6A modification loci along full length of Esr1 (Fig. 3 c). Subsequently, we conducted MeRIP-seq analysis on Mettl3 KO and WT MuSCs. The m6A methylation peak calling was obtained using the algorithm exomePeak. The results show that Esr1 was modified by m6A methylation, with a significant decrease in m6A enrichment in the region of chromosome 10 from positions 4997271to 5005633 (Fig. 3 d, e). The predicted functional m6A modification site 2, the 2409 bp A was also located in this region (Fig. 3 c). To further validate the effective m6A modification segments within Esr1, we designed five specific primer pairs to amplify discrete regions corresponding to five predicted loci and performed MeRIP-qPCR tests. The results indicated that Esr1-seg2 (including the 2nd potential m6A methylation sites located in the 3’UTR region of Esr1) displayed a high level of m6A methylation in WT MuSCs, while show a significant decrease in m6A levels on Esr1 in Mettl3 KO MuSCs, supporting that Esr1 could be a target for Mettl3 mediated m6A methylation in MuSCs (Fig. 3 f). To verify the potential m6A modification site (2409bp), we employed luciferase reporter assays. The wild type (WT) Esr1-3’UTR and mutant (Mut, A to G mutation at position 2409bp) Esr1-3’UTR were inserted behind the F-luc coding region in the luciferase reporter plasmids (Fig. 3 g). The luciferase activity is obviously lower in Mettl3 KO MuSCs than in WT MuSCs when transfected with Esr1-WT plasmid. There was no luciferase activity difference between WT and Mettl KO MuSCs when transfected with Esr1-3’UTR Mut plasmid, suggesting that the second loci of Esr1 acted as the effective site governing Esr1 m6A modifications (Fig. 3 h). To further investigate the impact of Mettl3 mediated m6A modification on Esr1 expression, mRNA stability test was performed and the result showed that knockout of Mettl3 significantly reduced the stability of Esr1 mRNA after Actinomycin D treatment (Fig. 3 i). Additionally, protein stability assays revealed that Mettl3 KO did not affect the protein stability of Esr1 (Fig. 3 j-l). These results indicate that Mettl3 regulates Esr1 expression by stabilizing mRNA in post-transcription level. In summary, these data indicated Mettl3-mediated m6A modification could regulate Esr1 mRNA stability and ultimately affect Esr1 expression. Unilateral oxidative stress of para-spinal muscle leads to scoliosis through ROS-Mettl3-Esr1. We proceeded to investigate whether unilateral oxidative stress of paraspinal muscle could enhance the propensity for scoliosis in vivo using a bipedal mouse model. H 2 O 2 , known to elevate ROS levels as previously reported 36 , was injected into the left side of the para-spinal muscles, while PBS served as a control and was injected into the right side. This regimen was maintained for three weeks, with injections administered twice weekly (Fig. 4 a). Two weeks after treatment, spinal alignment was assessed using X-ray and the results revealed that the group receiving unilateral H 2 O 2 injections exhibited more severe spinal malformations in both the coronal and sagittal planes compared to the group receiving bilateral PBS injections (Fig. 4 b-d). Then the para-spinal muscles from both sides were collected for further analysis. Both global m6A level evaluation and MeRIP-qPCR for target functional modification site indicated that m6A activity was significantly reduced on the concave para-spinal muscle stem/progenitor cells relative to the convex side (Fig. 4 e, f). Western blot analyses also demonstrated decreased protein levels of Mettl3 and Esr1 on the concave para-spinal muscle stem/progenitor cells compared to the convex side (Fig. 4 g), verifying the suppressed Mettl3-Esr1 axis by accumulated ROS. Additionally, the myofiber size on the side injected with H 2 O 2 was found to be smaller than that on the PBS injected side (Fig. 4 h, i), indicating impaired paraspinal muscle growth after oxidative stress. Taken together, these findings suggest that unilateral oxidative stress of paraspinal muscle para-spinal muscles can lead to scoliosis in vivo through ROS-Mettl3-Esr1 axis. The betaine could mitigate the differentiation defects of muscle stem/progenitor cells on the concave side. In view of the results that unilateral oxidative stress of para-spinal muscle could lead to scoliosis through ROS-METTL3-ESR1 axis by m6A dependent manner, enhancing antioxidant capacity and m6A modification levels may counteract the downregulation of ESR1 in muscle stem cells on the concave side, offering a potential therapeutic approach for AIS. Betaine (trimethyl glycine), a stable and non-toxic compound widely utilized in pharmaceuticals, health product research, feed additives, and other industries, is recognized for its potent antioxidant properties 30 – 32 . Furthermore, as a methyl donor, betaine can also significantly enhance m6A modification levels 33 , 34 . Thus, betaine was used to explore its potential rescue effect for concave paraspinal muscle stem/progenitor cells. Expectedly, the immunofluorescent staining of MyHC showed betaine mitigated the differentiation defects of human muscle stem/progenitor cells on the concave side (Fig. 5 a, b). Consistently, the mRNA expression of MYH1, MYH3, CKM, and MYOG tested by RT-qPCR also showed the same results (Fig. 5 c). In addition, both global m6A level evaluation and MeRIP-qPCR for target functional modification site demonstrated an increase in m6A activity in these cells following betaine treatment (Fig. 5 d, e). Western blot tests also revealed an increase in Esr1 protein levels in concave paraspinal muscle stem/progenitor cells after betaine treatment (Fig. 5 f). These results suggested that betaine could serve as a promising therapeutic agent to effectively rescue the differentiation defects of human muscle stem/progenitor cells on the concave side. Betaine alleviates the progression of scoliosis in vivo through ROS-Mettl3-Esr1 axis. Given that betaine has the capacity to correct the differentiation deficiencies in muscle stem/progenitor cells derived from the concave side paraspinal muscle, we set out to investigate its potential as a treatment for scoliosis in vivo. The scoliosis mouse model was first established by unilateral injection of H 2 O 2 as described in Fig. 4 a. Two weeks after H 2 O 2 injection (8 weeks old), betaine was administered to the concave side twice weekly for two weeks, with PBS being injected into the opposite side as a control. A separate control group received bilateral PBS injections twice weekly for the same duration (Fig. 6 a). The spinal alignment evaluation was performed with time points at 5th week and 9th week after first injection (Fig. 6 a). The X-ray evaluation for spinal alignment indicated that betaine treatment significantly ameliorated spinal deformities in both the coronal and sagittal planes when compared data at 5th week and 9th week (Fig. 6 b-d). Subsequently, para-spinal muscles from both sides were collected for further analysis at 9th week. The myofiber size on the concave side in the betaine-injected group was larger compared to that in the control group (Fig. 6 e, f). Additionally, the ROS intensity was notably reduced on the concave side in the betaine treatment group, indicating the robust antioxidant capacity of betaine in vivo (Fig. 6 g). Then fresh paraspinal muscle stem cells were isolated. Both global m6A level evaluation and MeRIP-qPCR for target functional modification site revealed an increase in m6A activity on the concave paraspinal muscle stem cells following betaine treatment (Fig. 6 h, i). Furthermore, western blot tests confirmed that protein levels of Mettl3 and Esr1 were also elevated on the concave side post-betaine treatment (Fig. 6 j). These data demonstrated betaine could elevate the m6A modification levels of Esr1 and thus upregulate the expression level in muscle stem cells on the concave side. Taken together, betaine could serve as a promising therapeutic agent for the treatment of AIS through ROS-Mettl3-Esr1 axis. Discussion AIS is a prevalent and unexplained spinal deformity. Among the myriad theories proposed to unravel its pathogenesis, muscle imbalance has emerged as a significant contender in the etiology of AIS. Our previous research revealed differential ESR1 expression of paraspinal muscle stem/progenitor cells, which further established a correlation between asymmetric myogenesis and the onset and progression of AIS. Nevertheless, numerous challenges persist in translating these findings into practical applications. Therefore, it is imperative to further investigate the regulatory mechanisms underlying the asymmetric ESR1 expression to uncover safer and more efficacious treatment strategies for AIS. In this current study, we found that the expression of ESR1 of concave paraspinal muscle stem/progenitor cells can be modulated by METTL3 mediated m6A modification. High ROS level in concave para-spinal muscle of AIS patients decreased the expression of METTL3 and thus inhibited expression of ESR1 by m6A dependent manner. Moreover, improving the antioxidant defenses and m6A methylation levels effectively reversed the downregulation of ESR1 and bolstered the differentiation capacity of muscle stem cells on the concave side. By rectifying the imbalance in ROS intensity and m6A levels between bilateral para-spinal muscles using the naturally derived substance betaine, we were able to ameliorate the progression of scoliosis, offering a promising therapeutic strategy for AIS. A pivotal discovery in our study is the correlation between elevated ROS levels and reduced m6A levels on the concave side of the para-spinal muscles. Prior research has shown that oxidative stress exerts a dual effect on skeletal muscle: while moderate levels can be beneficial, excessive ROS can lead to impaired muscle force and muscle atrophy 37 – 40 . Concurrently, muscle atrophy, a characteristic of the concave side para-spinal muscles in AIS patients, suggests a potential link between ROS and AIS. Although previous studies have indicated higher ROS levels in AIS patients compared to controls, the precise role of ROS in the asymmetry of spinal muscles remains elusive 41 . To our best knowledge, it is the first study that reported a significant increase in ROS intensity in the concave side para-spinal muscles of AIS patients. To ensure the rigor of our findings, we included an age-matched congenital scoliosis group as a stringent control, which allowed us to isolate the specific impact of ROS on the concave side in the context of AIS. In tandem with the observed increase in ROS intensity, we also noted a significant decrease in m6A levels on the concave side of AIS patients and further tests revealed that METTL3 played a key role in this process. The m6A modification, orchestrated by METTL3, is essential for maintaining muscle mass and ensuring hypertrophic performance 25 . Moreover, many studies showed different methylation levels are associated with AIS curve severity tightly 42 , 43 . The concurrent asymmetry in ROS and METTL3 levels warrants deeper exploration. It has been documented that abnormally elevated ROS levels in human epidermal cells and embryonic lung fibroblasts can downregulate the expression of specific genes through METTL3-mediated m6A modification 44 . Our study identified a similar regulatory pattern in muscle stem/progenitor cells. These findings suggested that the myogenesis defects observed on the concave side of AIS patients could be orchestrated by a reduction in METTL3 levels, which is a consequence of the high ROS environment. Further results in current study verified that there was m6A modification site in Esr1 gene, with 2409bp showing functional interaction with Mettl3. The disproportionately high incidence of AIS in females suggests a strong link between estrogen and the condition. Building on our previous work that established a connection between asymmetric ESR1 expression and the onset and progression of AIS, our current research has uncovered that ESR1 can be regulated by METTL3, which is influenced by the ROS environment. This discovery sheds light on a novel target for addressing the imbalance in para-spinal muscles of AIS patients, potentially offering a new avenue for therapeutic intervention. Physical exercise and bracing management were routinely recommended for AIS patients with a Cobb angle less than 40 degrees 45 . However, lack of effective theoretical guidance leads to a variety of treatment modalities, making it challenging to assess their efficacy 46 , 47 . Moreover, the long and painful treatment courses lead to poor patient compliance 48 , 49 . Mechanism independent drug therapy revealed in this study might provide a safer and more practical strategy to treat AIS. Betaine, a naturally occurring and non-toxic compound widely utilized in the pharmaceutical industry, has been recognized as a potent antioxidant and primary source of S-adenosylmethionine (SAM), the principal methyl group donor for N6-methyladenosine (m6A) mRNA methylation 30 , 31 . Given these attributes, betaine emerges as an ideal candidate for mitigating the progression of scoliotic curves and could pave the way for the development of effective AIS treatments. The utility, safety, and feasibility of betaine in clinical AIS treatment merit further investigation. Conclusions This study unravels elevated level of ROS in the concave paraspinal muscle and decreased expression of m6A methyltransferase METTL3, which further diminished the expression of ESR1 by m6A dependent manner, caused by increased ROS in concave paraspinal muscle stem/progenitor cells of AIS patients. Finally, decreased expression of ESR1 caused defects in the differentiation of concave muscle stem/progenitor cells and exacerbating the severity of scoliosis. Thus, asymmetrical ROS-METTL3-ESR1 axis in paraspinal muscle stem/progenitor cells played a crucial role in initiation and development of AIS. Furthermore, the antioxidant and methyl donor betaine could effectively mitigate the differentiation defects of concave muscle stem/progenitor cells and alleviated the progression of scoliosis through targeting ROS-METTL3-ESR1 axis. These findings elucidated the mechanism behind the asymmetric ESR1 expression in para-spinal muscle stem/progenitor cells and suggested treatment of betaine could be a safer and more viable therapeutic approach for AIS. Declarations Ethics approval and consent to participate All animal experimental procedures were approved by local institutional animal care and use committee (Approval no. XHEC-F-2024-042). All human experiments were granted approval by the local institutional ethics committee (Approval No. XHEC-D-2019-093), and written informed consent was obtained from all participants and, where applicable, their legal guardians. Consent for publication All authors have read and approved the final version of the manuscript and consent to its publication. Availability of data and material The authors confirm that all data generated and analyzed during this study are either included in this published article or available from the corresponding authors upon reasonable request. Competing interest The authors declare that they have no competing interests. Funding This work was supported by the National Natural Science Foundation of China (grant numbers 82302657 and 82472789). Authors' contributions Li Bin: Conceptualization, Investigation, Methodology, Visualization, Data curation, Writing–original draft, Writing–review & editing. Amila Kuati: Conceptualization, Investigation, Methodology, Visualization, Writing–original draft. Cai Jinkui: Investigation, Methodology, Data curation, Writing–review & editing. Yang Junlin: Conceptualization, Methodology, Writing–original draft, Writing–review & editing. Lin Xingzuan: Conceptualization, Formal analysis, Visualization, Methodology, Supervision, Writing–original draft, Writing–review & editing. Shao Xiexiang: Conceptualization, Formal analysis, Methodology, Visualization, Funding acquisition, Supervision, Writing–original draft, Writing–review & editing. Acknowledgements Not applicable. References Pérez-Machado G, Berenguer-Pascual E, Bovea-Marco M, Rubio-Belmar PA, García-López E, Garzón MJ et al. From genetics to epigenetics to unravel the etiology of adolescent idiopathic scoliosis. Bone 2020; 140 : 115563. Dunn J, Henrikson NB, Morrison CC, Blasi PR, Nguyen M, Lin JS. Screening for Adolescent Idiopathic Scoliosis: Evidence Report and Systematic Review for the US Preventive Services Task Force. JAMA 2018; 319 : 173. Kim W, Porrino JA, Hood KA, Chadaz TS, Klauser AS, Taljanovic MS. Clinical Evaluation, Imaging, and Management of Adolescent Idiopathic and Adult Degenerative Scoliosis. Curr Probl Diagn Radiol 2019; 48 : 402–414. Marya S, Tambe AD, Millner PA, Tsirikos AI. Adolescent idiopathic scoliosis : a review of aetiological theories of a multifactorial disease. Bone Jt J 2022; 104-B : 915–921. Wang X, Yue M, Cheung JPY, Cheung PWH, Fan Y, Wu M et al. Impaired glycine neurotransmission causes adolescent idiopathic scoliosis. J Clin Invest . Sarwark JF, Castelein RM, Maqsood A, Aubin C-E. The Biomechanics of Induction in Adolescent Idiopathic Scoliosis: Theoretical Factors. 2019; 101 . Peng Y, Wang S-R, Qiu G-X, Zhang J-G, Zhuang Q-Y. Research progress on the etiology and pathogenesis of adolescent idiopathic scoliosis. Chin Med J (Engl) 2020; 133 : 483–493. Cheng JC, Castelein RM, Chu WC, Danielsson AJ, Dobbs MB, Grivas TB et al. Adolescent idiopathic scoliosis. Nat Rev Dis Primer 2015; 1 : 15030. Fidler MW, Jowett RL. Muscle imbalance in the aetiology of scoliosis. J Bone Joint Surg Br 1976; 58 : 200–201. Brzoska E, Kalkowski L, Kowalski K, Michalski P, Kowalczyk P, Mierzejewski B et al. Muscular Contribution to Adolescent Idiopathic Scoliosis from the Perspective of Stem Cell-Based Regenerative Medicine. Stem Cells Dev 2019; 28 : 1059–1077. Wajchenberg M, Martins DE, Luciano R de P, Puertas EB, Del Curto D, Schmidt B et al. Histochemical analysis of paraspinal rotator muscles from patients with adolescent idiopathic scoliosis: a cross-sectional study. Medicine (Baltimore) 2015; 94 : e598. Shao X, Chen J, Yang J, Sui W, Deng Y, Huang Z et al. Fiber Type-Specific Morphological and Cellular Changes of Paraspinal Muscles in Patients with Severe Adolescent Idiopathic Scoliosis. Med Sci Monit 2020; 26 . doi:10.12659/MSM.924415. Fan Y, To MK-T, Yeung EHK, Kuang G-M, Liang R, Cheung JPY. Electromyographic Discrepancy in Paravertebral Muscle Activity Predicts Early Curve Progression of Untreated Adolescent Idiopathic Scoliosis. Asian Spine J 2023; 17 : 922–932. Yeung KH, Man GCW, Shi L, Hui SCN, Chiyanika C, Lam TP et al. Magnetic Resonance Imaging-Based Morphological Change of Paraspinal Muscles in Girls With Adolescent Idiopathic Scoliosis. Spine 2019; 44 : 1356. Zhu Z, Xu L, Leung-Sang Tang N, Qin X, Feng Z, Sun W et al. Genome-wide association study identifies novel susceptible loci and highlights Wnt/beta-catenin pathway in the development of adolescent idiopathic scoliosis. Hum Mol Genet 2017; 26 : 1577–1583. Zhu Z, Tang NL-S, Xu L, Qin X, Mao S, Song Y et al. Genome-wide association study identifies new susceptibility loci for adolescent idiopathic scoliosis in Chinese girls. Nat Commun 2015; 6 : 8355. Qin X, He Z, Yin R, Qiu Y, Zhu Z. Abnormal paravertebral muscles development is associated with abnormal expression of PAX3 in adolescent idiopathic scoliosis. Eur Spine J 2020; 29 : 737–743. Shao X, Fu X, Yang J, Sui W, Li S, Yang W et al. The asymmetrical ESR1 signaling in muscle progenitor cells determines the progression of adolescent idiopathic scoliosis. Cell Discov 2023; 9 : 44. Lung DK, Reese RM, Alarid ET. Intrinsic and Extrinsic Factors Governing the Transcriptional Regulation of ESR1. Horm Cancer 2020; 11 : 129–147. Wang N, Zhang X, Rothrauff BB, Fritch MR, Chang A, He Y et al. Novel role of estrogen receptor-α on regulating chondrocyte phenotype and response to mechanical loading. Osteoarthritis Cartilage 2022; 30 : 302–314. Jiang X, Liu B, Nie Z, Duan L, Xiong Q, Jin Z et al. The role of m6A modification in the biological functions and diseases. Signal Transduct Target Ther 2021; 6 : 74. Yu B, Liu J, Zhang J, Mu T, Feng X, Ma R et al. Regulatory role of RNA N6-methyladenosine modifications during skeletal muscle development. Front Cell Dev Biol 2022; 10 : 929183. Oerum S, Meynier V, Catala M, Tisné C. A comprehensive review of m6A/m6Am RNA methyltransferase structures. Nucleic Acids Res 2021; 49 : 7239–7255. Fiorentino F, Menna M, Rotili D, Valente S, Mai A. METTL3 from Target Validation to the First Small-Molecule Inhibitors: A Medicinal Chemistry Journey. J Med Chem 2023; 66 : 1654–1677. Petrosino JM, Hinger SA, Golubeva VA, Barajas JM, Dorn LE, Iyer CC et al. The m6A methyltransferase METTL3 regulates muscle maintenance and growth in mice. Nat Commun 2022; 13 : 168. Liu S, Zhuo L, Wang J, Zhang Q, Li Q, Li G et al. METTL3 plays multiple functions in biological processes. . Gheller BJ, Blum JE, Fong EHH, Malysheva OV, Cosgrove BD, Thalacker-Mercer AE. A defined N6-methyladenosine (m6A) profile conferred by METTL3 regulates muscle stem cell/myoblast state transitions. Cell Death Discov 2020; 6 : 95. Kudou K, Komatsu T, Nogami J, Maehara K, Harada A, Saeki H et al. The requirement of Mettl3-promoted MyoD mRNA maintenance in proliferative myoblasts for skeletal muscle differentiation. Open Biol 2017; 7 : 170119. Xie S-J, Lei H, Yang B, Diao L-T, Liao J-Y, He J-H et al. Dynamic m6A mRNA Methylation Reveals the Role of METTL3/14-m6A-MNK2-ERK Signaling Axis in Skeletal Muscle Differentiation and Regeneration. Front Cell Dev Biol 2021; 9 : 744171. Zhao G, He F, Wu C, Li P, Li N, Deng J et al. Betaine in Inflammation: Mechanistic Aspects and Applications. Front Immunol 2018; 9 : 1070. Chen L, Liu D, Mao M, Liu W, Wang Y, Liang Y et al. Betaine Ameliorates Acute Sever Ulcerative Colitis by Inhibiting Oxidative Stress Induced Inflammatory Pyroptosis. Mol Nutr Food Res 2022; 66 : e2200341. Chen W, Xu M, Xu M, Wang Y, Zou Q, Xie S et al. Effects of betaine on non-alcoholic liver disease. Nutr Res Rev 2022; 35 : 28–38. Yang Z-J, Huang S-Y, Zhong K-Y, Huang W-G, Huang Z-H, He T-T et al. Betaine alleviates cognitive impairment induced by homocysteine through attenuating NLRP3-mediated microglial pyroptosis in an m6A-YTHDF2-dependent manner. Redox Biol 2024; 69 : 103026. Ji C, Tao Y, Li X, Wang J, Chen J, Aniagu S et al. AHR-mediated m6A RNA methylation contributes to PM2.5-induced cardiac malformations in zebrafish larvae. J Hazard Mater 2023; 457 : 131749. Zhou Y, Zeng P, Li Y-H, Zhang Z, Cui Q. SRAMP: prediction of mammalian N 6 -methyladenosine (m 6 A) sites based on sequence-derived features. Nucleic Acids Res 2016; 44 : e91–e91. Wang Y, Gao J, Wu F, Lai C, Li Y, Zhang G et al. Biological and epigenetic alterations of mitochondria involved in cellular replicative and hydrogen peroxide-induced premature senescence of human embryonic lung fibroblasts. Ecotoxicol Environ Saf 2021; 216 : 112204. Thirupathi A, Pinho RA, Ugbolue UC, He Y, Meng Y, Gu Y. Effect of Running Exercise on Oxidative Stress Biomarkers: A Systematic Review. Front Physiol 2021; 11 : 610112. Powers SK, Ji LL, Kavazis AN, Jackson MJ. Reactive Oxygen Species: Impact on Skeletal Muscle. In: Prakash YS (ed). Comprehensive Physiology . Wiley, 2011, pp 941–969. Jackson MJ. Reactive oxygen species in sarcopenia: Should we focus on excess oxidative damage or defective redox signalling? Mol Aspects Med 2016; 50 : 33–40. Agrawal S, Chakole S, Shetty N, Prasad R, Lohakare T, Wanjari M. Exploring the Role of Oxidative Stress in Skeletal Muscle Atrophy: Mechanisms and Implications. Cureus 2023. doi:10.7759/cureus.42178. Li J, Tang M, Yang G, Wang L, Gao Q, Zhang H. Muscle Injury Associated Elevated Oxidative Stress and Abnormal Myogenesis in Patients with Idiopathic Scoliosis. Int J Biol Sci 2019; 15 : 2584–2595. Shi B, Mao S, Xu L, Li Y, Sun X, Liu Z et al. Quantitation Analysis of PCDH10 Methylation in Adolescent Idiopathic Scoliosis Using Pyrosequencing Study. Spine 2020; 45 : E373–E378. Liu G, Wang L, Wang X, Yan Z, Yang X, Lin M et al. Whole-Genome Methylation Analysis of Phenotype Discordant Monozygotic Twins Reveals Novel Epigenetic Perturbation Contributing to the Pathogenesis of Adolescent Idiopathic Scoliosis. Front Bioeng Biotechnol 2019; 7 : 364. Wu F, Zhang L, Lai C, Peng X, Yu S, Zhou C et al. Dynamic Alteration Profile and New Role of RNA m6A Methylation in Replicative and H2O2-Induced Premature Senescence of Human Embryonic Lung Fibroblasts. Int J Mol Sci 2022; 23 : 9271. Seleviciene V, Cesnaviciute A, Strukcinskiene B, Marcinowicz L, Strazdiene N, Genowska A. Physiotherapeutic Scoliosis-Specific Exercise Methodologies Used for Conservative Treatment of Adolescent Idiopathic Scoliosis, and Their Effectiveness: An Extended Literature Review of Current Research and Practice. Int J Env Res Public Health 2022. Zhang T, Huang Z, Sui W, Wei W, Shao X, Deng Y et al. Intensive bracing management combined with physiotherapeutic scoliosis-specific exercises for adolescent idiopathic scoliosis patients with a major curve ranging from 40-60° who refused surgery: a prospective cohort study. Eur J Phys Rehabil Med 2023. doi:10.23736/S1973-9087.23.07605-0. Day JM, Fletcher J, Coghlan M, Ravine T. Review of scoliosis-specific exercise methods used to correct adolescent idiopathic scoliosis. Arch Physiother 2019; 9 : 8. Kaelin AJ. Adolescent idiopathic scoliosis: indications for bracing and conservative treatments. Ann Transl Med 2020; 8 : 28–28. Negrini S, Minozzi S, Bettany-Saltikov J, Chockalingam N, Grivas TB, Kotwicki T et al. Braces for idiopathic scoliosis in adolescents. Cochrane Database Syst Rev 2015; 2015 . doi:10.1002/14651858.CD006850.pub3. Wu T, Sun X, Zhu Z, Yan H, Guo J, Cheng JCY et al. Role of Enhanced Central Leptin Activity in a Scoliosis Model Created in Bipedal Amputated Mice. Spine 2015; 40 : E1041-1045. Machida M, Dubousset J, Yamada T, Kimura J, Saito M, Shiraishi T et al. Experimental scoliosis in melatonin-deficient C57BL/6J mice without pinealectomy. J Pineal Res 2006; 41 : 1–7. Fu X, Xiao J, Wei Y, Li S, Liu Y, Yin J et al. Combination of inflammation-related cytokines promotes long-term muscle stem cell expansion. Cell Res 2015; 25 : 655–673. Ding C, Lu J, Li J, Hu X, Liu Z, Su H et al. RNA‐methyltransferase Nsun5 controls the maternal‐to‐zygotic transition by regulating maternal mRNA stability. Clin Transl Med 2022; 12 : e1137. Jang I, Niu Q, Deng S, Zhao P, Chua N. Enhancing protein stability with retained biological function in transgenic plants. Plant J 2012; 72 : 345–354. Additional Declarations There is no conflict of interest Cite Share Download PDF Status: Published Journal Publication published 05 Mar, 2026 Read the published version in Experimental & Molecular Medicine → Version 1 posted Editorial decision: revise 05 Aug, 2025 Review # 2 received at journal 04 Aug, 2025 Reviewer # 2 agreed at journal 29 Jul, 2025 Review # 1 received at journal 10 Jul, 2025 Reviewer # 1 agreed at journal 30 Jun, 2025 Reviewers invited by journal 04 Jun, 2025 Submission checks completed at journal 03 Jun, 2025 First submitted to journal 02 Jun, 2025 Unknown event 18 May, 2025 Editor assigned by journal 16 May, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6683773","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":466215115,"identity":"15c849d2-50a6-4a67-a52e-09050125334f","order_by":0,"name":"Xiexiang Shao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/0lEQVRIiWNgGAWjYDACCRBhwMDABqI/NoBIxsYDRGthnNkA4jM2EKEFCph5GyB8vFrkZzc/fMxTYJPYx3728GvbHTZ1uu2HgbbU2ETj0mJw55ix4QyDNGM2nrw069wzaRJmZxKBWo6l5Tbg0iKRYCbxweCwHBtDjplxbtthCbMDQC2MDYdxapGfkf5NIsHgPw8b/xszY0uQlvMP8WthuJEDsuWAHJtEjvFjRpCWGwRsMbiRUwz0S7Ixm8QbM8betjTJbTeAtiTg8QvQYRsf8/yxS5zfn2P84WebDb/Z+fSHDz7U2OB2GBJgQ8RRAhHKQYD5A5EKR8EoGAWjYIQBAEVqXZERCPMSAAAAAElFTkSuQmCC","orcid":"","institution":"Xinhua Hospital affiliated to Shanghai Jiao Tong University School of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Xiexiang","middleName":"","lastName":"Shao","suffix":""},{"id":466215116,"identity":"3e8e15ff-9fcb-4478-8659-14e5d3bfed9e","order_by":1,"name":"Bin Li","email":"","orcid":"","institution":"Department of Spine Surgery, Xin Hua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Bin","middleName":"","lastName":"Li","suffix":""},{"id":466215117,"identity":"20cb7b56-2868-42f9-bad5-492403334297","order_by":2,"name":"Amila Kuati","email":"","orcid":"","institution":"Peking University Third Hospital","correspondingAuthor":false,"prefix":"","firstName":"Amila","middleName":"","lastName":"Kuati","suffix":""},{"id":466215118,"identity":"e31a55d6-3ac5-4400-9939-5c2a7214bcf0","order_by":3,"name":"Jinkui Cai","email":"","orcid":"","institution":"Wuhan Third Hospital, Tongren Hospital of Wuhan University","correspondingAuthor":false,"prefix":"","firstName":"Jinkui","middleName":"","lastName":"Cai","suffix":""},{"id":466215119,"identity":"bf94e1bc-fb80-4e4b-8f64-98332926c2cc","order_by":4,"name":"Junlin Yang","email":"","orcid":"","institution":"Department of Spine Surgery, Xin Hua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Junlin","middleName":"","lastName":"Yang","suffix":""},{"id":466215120,"identity":"4b03a3da-ded8-4cb1-831a-b330c7469b03","order_by":5,"name":"Xingzuan Lin","email":"","orcid":"","institution":"Peking University Third Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xingzuan","middleName":"","lastName":"Lin","suffix":""}],"badges":[],"createdAt":"2025-05-17 00:00:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6683773/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6683773/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s12276-026-01658-7","type":"published","date":"2026-03-05T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":84275790,"identity":"24ab47c5-1499-487e-98f1-06bedfe68438","added_by":"auto","created_at":"2025-06-10 05:38:10","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2007355,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe muscle stem/progenitor cells are exposed to high ROS circumstance with suppressed METTL3 expression in concave side of AIS patients. a, b \u003c/strong\u003eBubble chart of GO analysis of upregulated and down regulated genes in paraspinal muscle tissues harvested from the concave side when compared with those from convex side in AIS patients (n=3). \u003cstrong\u003ec\u003c/strong\u003e Relative ROS intensity in bilateral para-spinal muscles derived from patients with congenital scoliosis (CS, n = 10) and adolescent idiopathic scoliosis (AIS, n = 9). ***P \u0026lt; 0.001; ns indicated no significant changes.\u003cstrong\u003e d, e\u003c/strong\u003e Bubble chart of GO analysis of upregulated and down regulated genes in muscle stem/progenitor cells harvested from concave paraspinal muscles when compared those from convex paraspinal muscles in AIS patients. \u003cstrong\u003ef \u003c/strong\u003eHeat map representation of downregulated genes in concave paraspinal muscle stem/progenitor cells in GO term RNA methyltransferase activity. \u003cstrong\u003eg\u003c/strong\u003e Relative mRNA expression of METTL3 in bilateral muscle stem/progenitor cells harvested from the patients with CS (n=10) and AIS (n=9). **P \u0026lt; 0.01; ns indicated no significant changes.\u003cstrong\u003e h\u003c/strong\u003e The protein level of METTL3 of bilateral muscle stem/progenitor cells harvested from patients with AIS. GAPDH was served as internal reference.\u003cstrong\u003e i \u003c/strong\u003eThe relative global m\u003csup\u003e6\u003c/sup\u003eA level in bilateral muscle stem/progenitor cells harvested from the patients with CS (n=10) and AIS (n=9)..\u0026nbsp;**P \u0026lt; 0.01; ns indicated no significant changes.\u003c/p\u003e","description":"","filename":"figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-6683773/v1/7eef678f79050e1ccf39300b.png"},{"id":84277179,"identity":"b6c8814f-beae-4f50-b06d-31e625a22141","added_by":"auto","created_at":"2025-06-10 06:01:24","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2908974,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHigh levels of ROS could impair the myogenesis of muscle stem/progenitor cells by suppressing the expression of METTL3. a\u003c/strong\u003e Relative mRNA expression of METTL3 in human primary muscle stem/progenitor cells treated with or without H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e. \u003cstrong\u003eb, c\u003c/strong\u003e Representative immunofluorescent staining and relative statistical analysis of human primary muscle stem/progenitor cells treated with or without H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e. Green indicated METTL3; Blue indicated DAPI staining of nuclei. The merged images were shown. Scale bars: 100 μm. ***P \u0026lt; 0.001. \u003cstrong\u003ed\u003c/strong\u003e The protein level of METTL3 and ESR1 in human primary muscle stem/progenitor cells treated with or without H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e. GAPDH was served as internal reference. \u003cstrong\u003ee\u003c/strong\u003e The diagram of generation of Pax7-CreERT2; Mettl3 flox/flox mice \u003cstrong\u003ef, g\u003c/strong\u003e The relative mRNA and protein expression level of Mettl3 in muscle stem cell isolated from Mettl3 flox/flox mice (WT) and Pax7-CreERT2; Mettl3 flox/flox mice (KO). \u003cstrong\u003eh\u003c/strong\u003e Representative immunofluorescent staining of cryosection of para-spinal muscle derived from Mettl3 WT and KO mice, respectively. Green indicated laminin. Scale bars: 50 μm. \u003cstrong\u003ei\u003c/strong\u003e Statistical analysis of cross-sectional area of para-spinal muscle derived from Mettl3 WT and KO mice, respectively. At least 500 fibers were analyzed for each sample. n = 5. **P \u0026lt; 0.01. \u003cstrong\u003ej \u003c/strong\u003eRepresentative immunofluorescent staining of myotubes differentiated from muscle stem cells isolated from Mettl3 WT and KO mice, respectively. Red indicated MyHC; Blue indicated DAPI staining of nuclei. The merged images were shown. Scale bars: 100μm. \u003cstrong\u003ek\u003c/strong\u003e Quantification of percentage of nuclei in MyHC+\u0026nbsp;cells. ***P \u0026lt; 0.001. \u003cstrong\u003el \u003c/strong\u003eRelative\u003cstrong\u003e \u003c/strong\u003emRNA\u003cstrong\u003e \u003c/strong\u003eexpression levels of myogenic differentiation markers. Total RNA was extracted from myotubes differentiated from muscle stem cells isolated from WT and KO mice and then RT-qPCR analysis was performed. n = 3. ***P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-6683773/v1/b3254ad7c03a9034461c66b0.png"},{"id":84277157,"identity":"4681f3ae-892b-4df5-b40b-b42bccfd6b9a","added_by":"auto","created_at":"2025-06-10 06:00:51","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2286314,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMettl3-mediated m6A modification regulates Esr1 mRNA stability. a\u003c/strong\u003e Relative mRNA expression of Esr1 in muscle stem cell isolated from Pax7-CreERT2; Mettl3 flox/flox (WT) and Pax7-CreERT2; Mettl3 KO (KO) mice. **P \u0026lt; 0.01. \u003cstrong\u003eb\u003c/strong\u003e The protein level of Esr1 and Mettl3 in muscle stem cell isolated from WT and KO mice. \u003cstrong\u003ec\u003c/strong\u003e Potential m6A modification sites on Esr1 mRNA predicted by SRAMP. \u003cstrong\u003ed \u003c/strong\u003eThe MeRIP-Seq showing m6A peak results of Esr1 in Mettl3 flox/flox and Mettl3 KO MuSCs. \u003cstrong\u003ee\u003c/strong\u003e Detailed gene sequence about the m6A peak of Esr1 located at chromosome 10: 5001574-5001961. The predicted functional m6a modification site 2409bp A (highlighted) was also located in this gene sequence. \u003cstrong\u003ef\u003c/strong\u003e MeRIP-qPCR experiment of 5 segments on Esr1. ***P \u0026lt; 0.001. \u003cstrong\u003eg\u003c/strong\u003e Schematic representation of Luciferase reporter assays. Wild-type (WT) Esr1-3’UTR, or mutant of the 2nd potential site (Mut: AGACT to AGGCT) Esr1-3’UTR was individually inserted behind the F-luc coding region in luciferase reporter. \u003cstrong\u003eh\u003c/strong\u003eThe result of relative luciferase activity. **P \u0026lt; 0.01; ns indicated no significant changes. \u003cstrong\u003ei\u003c/strong\u003e Results of mRNA stability assay. Esr1 mRNA level were determined by RT-qPCR in muscle stem cells from WT and KO mice after actinomycin D treatment (normalized to 0 h). ***P \u0026lt; 0.001. \u003cstrong\u003ej-l \u003c/strong\u003eResults of protein stability assay. Esr1 protein levels were determined by western blot tests in muscle stem cells from WT and KO mice after Cycloheximide treatment (normalized to 0 h).\u003c/p\u003e","description":"","filename":"figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-6683773/v1/214ff2c60347303425fe1e01.png"},{"id":84275794,"identity":"01950056-ec15-4f3c-ba1e-74bea52e55b8","added_by":"auto","created_at":"2025-06-10 05:38:10","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1857557,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUnilateral oxidative stress of para-spinal muscle leads to scoliosis through ROS-Mettl3-Esr1 axis. a\u003c/strong\u003e The diagram of unilateral oxidative stress (OS) treatment in bipedal mice model. The spinal alignment was evaluated 5 weeks after the first injection. \u003cstrong\u003eb\u003c/strong\u003e X-ray images for spinal alignment in bilateral PBS and unilateral oxidative stress (OS) group 5 weeks after the first injection. \u003cstrong\u003ec, d\u003c/strong\u003e Statistical analysis of Cobb angle and kyphosis in coronal and sagittal plane for bilateral PBS group (n = 6) and unilateral oxidative stress (OS) group (n = 6). **P \u0026lt; 0.01; ***P \u0026lt; 0.001. \u003cstrong\u003ee\u003c/strong\u003e The relative global m\u003csup\u003e6\u003c/sup\u003eA level in bilateral muscle stem/progenitor cells harvested from muscle tissues harvested from the concave and convex paraspinal muscles in unilateral OS mice. ***P \u0026lt; 0.001. \u003cstrong\u003ef\u003c/strong\u003e The MeRIP-qPCR result for target m6A modification site in bilateral muscle stem/progenitor cells harvested from muscle tissues harvested from the concave and convex paraspinal muscles in unilateral OS mice. **P \u0026lt; 0.01. \u003cstrong\u003eg \u003c/strong\u003eThe protein level of Mettl3 and Esr1 in muscle stem/progenitor cells from the concave and convex side of unilateral OS mice. \u003cstrong\u003eh\u003c/strong\u003e Representative immunofluorescent staining of bilateral para-spinal muscle sections from unilateral OS group. Green indicated laminin; Blue indicated DAPI staining of nuclei. The merged images were shown. Scale bars: 100μm. \u003cstrong\u003ei\u003c/strong\u003e Statistical analysis of the CSA of myofibers from unilateral OS group. At least 400 fibers were analyzed for each sample. Error bars indicated standard deviation (n = 6). **P \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-6683773/v1/d3eff610d5f8abe1205b1fe3.png"},{"id":84275815,"identity":"e2a84f8c-0f0b-4630-9ea2-1628d78ed626","added_by":"auto","created_at":"2025-06-10 05:38:11","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1976169,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe betaine could mitigate the differentiation defects of muscle stem/progenitor cells on the concave side. a\u003c/strong\u003e Representative immunofluorescent staining of myotubes differentiated from human muscle stem/progenitor cells treated with betaine. Human muscle stem/progenitor cells were isolated from convex and concave side of AIS patients. Red indicated MyHC; blue indicated DAPI staining of nuclei. The merged images were shown. Scale bars: 100 μm. \u003cstrong\u003eb\u003c/strong\u003e Quantification of percentage of nuclei in MyHC+\u0026nbsp;cells. ***P \u0026lt; 0.001. \u003cstrong\u003ec\u003c/strong\u003e Relative mRNA expression levels of myogenic differentiation markers. Total RNA was extracted from myotubes differentiated from muscle stem/progenitor cells with different treatments followed by RT-qPCR analysis. n = 3. ***P \u0026lt; 0.001. \u003cstrong\u003ed \u003c/strong\u003eThe global content of m\u003csup\u003e6\u003c/sup\u003eA of myotubes differentiated from muscle stem/progenitor cells with different treatments.\u0026nbsp;***P \u0026lt; 0.001. \u003cstrong\u003ee\u003c/strong\u003e MeRIP-qPCR result for target m6A modification site in muscle stem/progenitor cells with different treatments. **P \u0026lt; 0.01; ***P \u0026lt; 0.001. \u003cstrong\u003ef\u003c/strong\u003e The protein expression level of Esr1 in muscle stem/progenitor cells with different treatments.\u003c/p\u003e","description":"","filename":"figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-6683773/v1/eb339b78ec71cd87395cc428.png"},{"id":84278039,"identity":"6dd2319a-2fcc-4e2b-ac84-8d2a5bd3f4a2","added_by":"auto","created_at":"2025-06-10 06:04:59","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2480175,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBetaine alleviates the progression of scoliosis in vivo through ROS-Mettl3-Esr1 axis. a\u003c/strong\u003e The diagram of betaine rescue strategy for unilateral oxidative stress induced bipedal mice model.\u003cstrong\u003e b\u003c/strong\u003e X-ray images for spinal alignment in control and betaine group 2 weeks after the last treatment. \u003cstrong\u003ec, d\u003c/strong\u003e Statistical analysis of Cobb angle and kyphosis in coronal and sagittal plane for control group (n = 6) and betaine group (n = 6). **P \u0026lt; 0.01; ***P \u0026lt; 0.001; ns indicated no significant changes.\u003cstrong\u003e e\u003c/strong\u003e Representative immunofluorescent staining of para-spinal muscle sections from control group and betaine group. Green indicated laminin; Blue indicated DAPI staining of nuclei. The merged images were shown. Scale bars: 100 μm. \u003cstrong\u003ef\u003c/strong\u003e Statistical analysis of the cross-sectional area (CSA) of myofibers in concave paraspinal muscle from control group and betaine group. At least 400 fibers were analyzed for each sample. Error bars indicated standard deviation (n = 6). **P \u0026lt; 0.01.\u003cstrong\u003e g\u003c/strong\u003e Relative ROS intensity in concave para-spinal muscles derived from control group and betaine group. ***P \u0026lt; 0.001.\u003cstrong\u003e h\u003c/strong\u003e The global content of m\u003csup\u003e6\u003c/sup\u003eA in concave paraspinal muscle stem/progenitor cells from control group and betaine group. **P \u0026lt; 0.01. \u003cstrong\u003ei\u003c/strong\u003e MeRIP-qPCR result for target m6A modification site in concave paraspinal muscle stem/progenitor cells from control group and betaine group. *P \u0026lt; 0.05; ***P \u0026lt; 0.001. \u003cstrong\u003ej \u003c/strong\u003eThe protein expression of Mettl3 and Esr1 in concave paraspinal muscle stem/progenitor cells from control group and betaine group.\u003c/p\u003e","description":"","filename":"figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-6683773/v1/2dcdb53485f0cfb5da575caf.png"},{"id":104052997,"identity":"f627c7fc-889f-4020-b240-ee6be99defd1","added_by":"auto","created_at":"2026-03-06 08:08:12","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":13942430,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6683773/v1/d893cb1f-1a0e-4b17-ac35-6ca723d21926.pdf"}],"financialInterests":"There is no conflict of interest","formattedTitle":"The asymmetrical ROS-METTL3-ESR1 axis in paraspinal muscle progenitor cells determines the progression of adolescent idiopathic scoliosis","fulltext":[{"header":"Background","content":"\u003cp\u003eAdolescent idiopathic scoliosis (AIS) is the predominant form of three-dimensional spinal deformities with a lateral spine curvature of at least 10\u0026deg;, affecting approximately 0.5\u0026ndash;5.2% of adolescents worldwide\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. AIS is more prevalent in females (female/male ratio: 1.5:1\u0026ndash;3:1) and tends to progress during puberty growth spurt\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Although mild AIS patients can lead normal lives without serious complications, those with severe spinal deformities may suffer from chronic back pain, cardiorespiratory dysfunction and potentially life-threatening conditions\u003csup\u003e\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. A variety of factors have been suggested as contributors to AIS, including genetic, hormonal, musculoskeletal and environmental influences. However, the exact mechanism of AIS remains elusive\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe spinal musculature has been proposed as an important factor in the occurrence and development of AIS since 1970s\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. The paravertebral muscles act as a pivotal role in maintaining spinal stability, and their imbalance is believed to contribute to spine biomechanical instability and result in the initiation and development of a scoliotic curve in AIS\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Biopsies obtained from the bilateral paravertebral muscle show apparent pathological changes on the concave side of the spine, including type I fiber atrophy, fibrosis and fatty infiltration\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. The asymmetry of these muscles is also found by magnetic resonance imaging, biomechanical tests and electromyographic detection, which has been reported to be associated with AIS\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e,\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. However, extensive research has focused on morphological studies, further investigation is needed to understand the underlying mechanisms that lead to paravertebral muscle asymmetry.\u003c/p\u003e \u003cp\u003eGenome-wide association studies (GWAS) have identified PAX3 and MYOD1, which are pivotal transcription factors in muscle growth and regeneration, as susceptibility genes for AIS. Furthermore, studies have documented the asymmetric expression of PAX3 and MYOD1 in AIS patients\u003csup\u003e\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. Significantly, our previous research revealed that asymmetrical ESR1 expression in paravertebral muscles is crucial in the progression of AIS and suggested a potential therapeutic approach using Raloxifene, a FDA approved selective estrogen receptor modulator\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. However, given that ESR1 is expressed in numerous tissues and organs, the paramount concerns are the safety and efficacy of Raloxifene administration\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Consequently, it is imperative to delve deeper into the regulatory mechanisms governing the asymmetric ESR1 expression in para-spinal muscle stem/progenitor cells to uncover safer and more effective treatment strategies for AIS.\u003c/p\u003e \u003cp\u003eAs an important component of the epigenetic landscape, N6-methyladenine (m6A) stands out as the most prevalent internal modification on eukaryotic mRNA, exerting a pivotal influence on mRNA stability and the regulation of gene expression\u003csup\u003e\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. METTL3, a key m6A methyltransferase, is implicated in a multitude of biological processes, notably including the maintenance of muscle function\u003csup\u003e\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Recent studies have shown that METTL3-mediated m\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003eA modification regulates the myoblast transition from proliferation to differentiation\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Another study revealed that METTL3 is essential to stabilize MyoD mRNA level in myoblasts for skeletal muscle differentiation\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Overall, these results suggest METTL3 plays an important role in muscle progenitor cell proliferation and differentiation\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn our study, elevated reactive oxygen species (ROS) in the concave para-spinal muscles was discovered in AIS patients. The increased ROS decreased expression of m6A methyltransferase METTL3, which further diminished the expression of ESR1 by m6A dependent manner in concave paraspinal muscle stem/progenitor cells. Finally, decreased expression of ESR1 caused defects in the differentiation of concave muscle stem/progenitor cells and exacerbating the severity of scoliosis. Furthermore, we employed betaine (trimethyl glycine), a stable and non-toxic compound known for its potent antioxidant properties and its ability to enhance m6A methylation \u003csup\u003e\u003cspan additionalcitationids=\"CR31 CR32 CR33\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e, to effectively mitigate the differentiation defects of concave muscle stem/progenitor cells and alleviate the progression of scoliosis through targeting ROS-METTL3-ESR1 axis. These findings elucidate the mechanism behind the asymmetric ESR1 expression in para-spinal muscle stem/progenitor cells and suggest a safer and more viable therapeutic approach for AIS.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eAnimals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experimental procedures were approved by local institutional animal care and use committee (Approval no. XHEC-F-2024-042). Female mice were used for all the animal experiment. The Pax7-CreERT2 mice were sourced from Jackson Laboratory (cat#011763), while the Mettl3 flox/flox mice were procured from Gem Pharmatech (cat# T006659). Muscle stem cell-specific gene knockout was achieved by administering intraperitoneal injections of 100\u0026mu;L of a 10 mg/mL tamoxifen solution (ABCONE, cat#T56488) every 48 hours for a period of one week. Bipedal mouse models were prepared as detailed in previous reports\u003csup\u003e50\u003c/sup\u003e. For the establishment of the scoliosis mouse model, 3-week-old bipedal mice received unilateral intramuscular injections of 100\u0026mu;L 100\u0026mu;M H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (Sigma, cat#HX0640) at the left side and 100 \u0026mu;L PBS at the right side of the para-spinal muscle, which were carried out twice weekly for a duration of three weeks. In these oxidative stress-induced scoliosis mouse models, intramuscular injections of 10nM Betaine (Vokai Biotechnology, cat#E11074) were administered to the concave para-spinal muscle twice weekly for two weeks. Assessments of spinal alignment and para-spinal muscle size were conducted two weeks after the final betaine injection.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHuman samples\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBilateral paraspinal muscles that were discarded during surgery at the level of the apical vertebra were collected as previously described\u003csup\u003e51\u003c/sup\u003e. The harvesting procedure posed no additional risk to the patients. The study was granted approval by the local institutional ethics committee (Approval No. XHEC-D-2019-093), and written informed consent was obtained from all participants and, where applicable, their legal guardians.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation of muscle stem/progenitor cells\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMuscle stem/progenitor cells were isolated according to previously established methods\u003csup\u003e18,52\u003c/sup\u003e. In summary, muscle tissues were sectioned and enzymatically dissociated using collagenase II and dispase (Worthington Biochemical, 700-800 U/mL, cat#LS004177; Life Technologies, 11 U/mL, cat#17105-041). The resulting digest was passed through a 40-\u0026mu;m cell strainer (BD Falcon, cat#352340). For human cells, the suspension was incubated with the following antibodies for 45 minutes at 4 \u0026deg;C: PE-Cy5 anti-human CD45 (BD Pharmingen, cat#555484, diluted 1:25), PerCP-Cy5.5 anti-human CD31 (BioLegend, cat#303132, diluted 1:100), AF-488 anti-human CD29 (BioLegend, cat#303016, diluted 1:100), and BV421 anti-human CD56 (BD, cat#562751, diluted 1:100). For mouse cells, the suspension was stained with APC anti-mouse CD31 (BioLegend, cat#102510, diluted 1:100), APC anti-mouse CD45 (BioLegend, cat#103112, diluted 1:100), FITC anti-mouse Sca1 (BioLegend, cat#108106, diluted 1:100), and Biotin anti-mouse VCAM1 (BioLegend, cat#105703, diluted 1:100) for the same duration and temperature. All cell suspensions were washed with PBS and subsequently stained with PE/Cy7 Streptavidin (BioLegend, cat#405206, diluted 1:100) for 15 minutes. Finally, CD31- CD45- CD29+ CD56+ human muscle stem/progenitor cells and CD31- CD45- Sca1- VCAM1+ murine muscle stem cells were obtained by BD Influx sorter (BD Biosciences)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell culture and treatment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrimary human muscle stem/progenitor cells were cultured in F10 basal medium (Gibco, cat#11550043) with 20% fetal bovine serum (FBS, Gibco, cat#10-013-CV) and 2.5 ng/mL bFGF (R\u0026amp;D, cat#233-FB-025). Mouse muscle stem cells were cultured in F10 basal medium (Gibco, cat#11550043) with 20% FBS (Gibco, cat#10-013CV), 2.5 ng/mL bFGF (R\u0026amp;D, cat#233-FB-025), 5 ng/mL IL-1\u0026alpha; (Peprotech, cat#211-11 A), 5 ng/mL IL-13(Peprotech, cat#210-13), 5 ng/mL IFN-\u0026gamma; (Peprotech, cat#315-05), 5 ng/mL TNF-\u0026alpha; (Peprotech, cat#315-01 A), and 1% penicillin-streptomycin (Gibco, cat#15140-122) in collagen-coated dishes at 37 \u0026deg;C in 5% CO2. The differentiation medium was Dulbecco\u0026rsquo;s Modified Eagle Medium (DMEM, Gibco, cat#11965118) with 2% horse serum (HyClone, cat#HYCLSH30074.03HI) and 1% penicillin-streptomycin (Gibco, cat#15140-122). For the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e treatment, the procedure was carried out as previously detailed. Muscle stem cells were subjected to 100 \u0026mu;mol/L H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (Sigma, cat#HX0640) during myogenic differentiation. This group of cells was designated as the oxidative stress group (OS). For betaine treatment, the human muscle stem/progenitor cells isolated from paravertebral muscles were treated with 10nM Betaine (Vokai Biotechnology, cat#E11074) during myogenic differentiation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA-sequencing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA extraction from paraspinal muscle samples and stem/progenitor cells, collected from both the convex and concave regions, was performed utilizing the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, cat#E7530L) was entrusted with the task of constructing RNA libraries. Next, a cDNA library was prepared using a non-stranded method. Paired-end sequencing was performed on a NovaSeq 6000 sequencer with a 2\u0026times;150bp read length. Subsequently, clean paired-end reads were aligned to the GRCh38.98 reference genome using HISAT2, and gene abundances were quantified with RSEM (http://deweylab.biostat.wisc.edu/rsem/). Gene Ontology (GO) analyses were performed using Goatools (https://github.com/tanghaibao/Goatools). The selection of the top Gene Ontology (GO) categories was informed by the associated P values, which indicate the statistical significance of the identified gene functions and biological processes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA extraction and Real-Time RT-qPCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was isolated employing Trizol Reagent (Invitrogen, Carlsbad, CA, USA). Synthesis of complementary DNA (cDNA) was carried out using the PrimeScript Master Mix (TaKaRa, Kyodo, Japan), following the manufacturer\u0026apos;s protocol. Quantitative detection of mRNA expression was facilitated by the SYBR Premix Ex Taq\u0026trade; II Kit (TaKaRa, Kyodo, Japan). The specific primer sequences utilized in this process are detailed in Table 1.\u003c/p\u003e\n\u003cp\u003eTable 1. The primer sequences of 5 specific primers of ESR1 for MeRIP-qPCR.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003ePrimer Name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eForward (5\u0026prime;-3\u0026prime;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 223px;\"\u003e\n \u003cp\u003eReverse (5\u0026prime;-3\u0026prime;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eHuman \u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eCAAGGCTGAGAACGGGAAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 223px;\"\u003e\n \u003cp\u003eAGGGGGCAGAGATGATGACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eHuman \u003cem\u003eMETTL\u003c/em\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eTTGTCTCCAACCTTCCGTAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 223px;\"\u003e\n \u003cp\u003eCCAGATCAGAGAGGTGGTGTAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eHuman \u003cem\u003eESR1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eCCCACTCAACAGCGTGTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 223px;\"\u003e\n \u003cp\u003eCGTCGATTATCTGAATTTGGCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eHuman \u003cem\u003eMYH1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eGGGAGACCTAAAATTGGCTCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 223px;\"\u003e\n \u003cp\u003eTTGCAGACCGCTCATTTCAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eHuman \u003cem\u003eMYH3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eATTGCTTCGTGGTGGACTCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 223px;\"\u003e\n \u003cp\u003eGGCCATGTCTTCGATCCTGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eHuman \u003cem\u003eCKM\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eATGCCATTCGGTAACACCCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 223px;\"\u003e\n \u003cp\u003eGCTTCTTGTAGAGTTCAAGGGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eHuman \u003cem\u003eMYOG\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eGGGGAAAACTACCTGCCTGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 223px;\"\u003e\n \u003cp\u003eAGGCGCTCGATGTACTGGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eMouse \u003cem\u003eGapdh\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eACCCAGAAGACTGTGGATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 223px;\"\u003e\n \u003cp\u003eACACATTGGGGGTAGGAACA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eMouse \u003cem\u003eEsr1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eCCCGCCTTCTACAGGTCTAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 223px;\"\u003e\n \u003cp\u003eCTTTCTCGTTACTGCTGGACAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eMouse \u003cem\u003eMyh1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eGCGAATCGAGGCTCAGAACAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 223px;\"\u003e\n \u003cp\u003eGTAGTTCCGCCTTCGGTCTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eMouse \u003cem\u003eMyh3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eATGAGTAGCGACACCGAGATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 223px;\"\u003e\n \u003cp\u003eACAAAGCAGTAGGTTTTGGCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eMouse \u003cem\u003eCkm\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eGGCAACACCCACAACAAGTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 223px;\"\u003e\n \u003cp\u003eCCTTGAAGACCGTGTAGGACT \u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eMouse\u003cem\u003e\u0026nbsp;MyoG\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp\u003eGAGACATCCCCCTATTTCTACCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 223px;\"\u003e\n \u003cp\u003eGCTCAGTCCGCTCATAGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot analysis and protein extraction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells and tissues were lysed using RIPA buffer supplemented with protease inhibitors (Beyotime Biotech, cat#P0013B, cat#P1005). Protein concentrations were quantified by the bicinchoninic acid (BCA) assay (Beyotime Biotech, cat#P0012). Protein expression levels were assessed via western blotting, as previously described. Briefly, the proteins were then transferred onto polyvinylidene fluoride (PVDF) membranes (MilliporeSigma, USA) after separated on SDS-polyacrylamide gels. Following overnight incubation with the primary antibodies and secondary antibodies. The primary antibodies employed in these analyses targeted ESR1 (Abcam, cat#A19665), METTL3 (Abcam, cat# ab195352, 1:1000), and GAPDH (Cell Signaling Technology, cat#2118S, 1:5000). Chemiluminescent signals were visualized and photographed by Classical ChemiDoc Imager (SHST, China).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003em6A sequencing (m6A‑seq) and data analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe m6A sequencing was conducted by (CloudSeq Biotech, Shanghai, China). The raw sequencing reads were initially mapped to the reference mouse genome (mm10) using the Hisat2 software. Subsequently, the mapped reads from the IP and input libraries were analyzed using the R package exomePeak to identify significant m6A peaks and differential peaks, setting the significance threshold of FDR (False Discovery Rate)\u0026le;0.05. Finally, the IGV software was employed for visualization.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethylated RNA immunoprecipitation (MeRIP)-qPCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe m6A RNA Methylation Fragment Enrichment Kit (Epigentek, P-9018) was employed for the MeRIP studies, with all procedures strictly adhering to the manufacturer\u0026apos;s guidelines. In brief, 2 \u0026mu;g of RNA samples were set aside as the input control, while 18 \u0026mu;g of RNA samples, m6A antibody, and affinity beads was mixed and then vortexed at room temperature for 90 minutes to facilitate m6A RNA immunocapture. Subsequently, a cleavage enzyme mix was employed to generate RNA fragments. The proteinase K and an RNA purification solution were added to eliminate excess proteins and isolate m6A-enriched RNA. Ultimately, the immunoprecipitated m6A RNA was obtained using elution buffer. The m6A enrichment in ESR1 mRNA was quantified by RT-qPCR and normalized to the input levels. The specific primers used for screening are presented in Table 2.\u003c/p\u003e\n\u003cp\u003eTable 2. The primer sequences of 5 specific primers of ESR1 for MeRIP-qPCR.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePrimer Name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eForward (5\u0026prime;-3\u0026prime;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eReverse (5\u0026prime;-3\u0026prime;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eEsr1-Seg1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTTCTGACAATCGACGCCAGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTCTTAAAGAAAGCCTTGCAGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eEsr1-Seg2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGATAAGCACTTCATAATGGCTCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCATGTTGCTATAGGAATGCAAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eEsr1-Seg3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGTCACAATGAACCTGCAAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eATTCTCCACATTTCTCCCTTACT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eEsr1-Seg4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGAGTCCTTTGAACAAGGGGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCCCATCATATCTCAATGGAGTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eEsr1-Seg5\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTAGCTAATGGGTCAGTGGGTTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAGATGGGATAATGTAAAACCCTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eLuciferase reporter assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe luciferase reporter assay was applied to find the functional methylation site in ESR1. The pmiRGLO vector (MIAOLING BIOLOGY, P0198) was used as plasmid vector. The wild type 3\u0026rsquo;UTR of ESR1 (ESR1-3\u0026rsquo;UTR-WT) or mutant 3\u0026rsquo;UTR of ESR1 (ESR1-3\u0026rsquo;UTR-Mut) was inserted behind the F-luc coding region, respectively. The transfection of pmiRGLO-ESR1-3\u0026rsquo;UTR-WT and pmiRGLO-ESR1-3\u0026rsquo;UTR-Mut (A to G mutation at position 2409) into cells was facilitated using Lipo3000 reagent (Invitrogen). Subsequent luciferase assays were carried out with the Dual-Luciferase Reporter Assay Kit (Yeasen Biotechnology, 11402ES60)), following the protocol provided by the kit.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA and protein stability analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo perform RNA stability assay, actinomycin D (MCE, cat#HY-17559, 5 \u0026mu;g/ml) was added to inhibit the mRNA transcription of muscle stem/progenitor cells for 0, 3, 6, 9, 12h\u003csup\u003e53\u003c/sup\u003e. The total RNA was collected and reverse-transcribed into cDNA. The ESR1 RNA levels were determined using RT-qPCR, and the RNA degradation rate was calculated with GAPDH served as normalization reference. To evaluate protein stability, Muscle stem/progenitor cells were treated with cycloheximide (MCE, cat#HY-12302, 100\u0026mu;g/mL) to inhibit protein synthesis. Then the total protein was collected at specific time points at 0, 3, 6, 9, and 12 hours for subsequent analysis. ESR1 and GAPDH protein expression was assessed using western blotting\u003csup\u003e54\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasurement of ROS levels\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe assessment of total ROS levels was conducted using the ROS detection assay kit (BestBio, China, cat#BB-460512). Briefly, the homogenate was made from 20mg of fresh muscle tissues from paravertebral of AIS patients and centrifuged at 4 \u0026deg;C for 10 minutes. 190 \u0026mu;L of supernatant was collected and incubated with 10 \u0026mu;L of BBcellProbeTM O11 ROS probe in a 96-well plate at 37 \u0026deg;C in the dark for 45 minutes. Multifunction microplate reader (Multiskan GO, Thermo Scientific, USA) was employed to measure ROS levels at an excitation/emission wavelength of 488/530 nm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGlobal RNA m6A content quantification\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe global m6A modification level in total RNA was determined following the protocol of the m6A RNA Methylation Quantification Kit (MEIMIAN, China, cat#MM-2109H1). In summary, 200 ng of RNA was aliquoted into the assay wells, followed by the addition of the appropriately diluted detection antibody solution. The m6A levels were then quantified through colorimetric analysis by measuring the absorbance at 450 nm and correlating the results with the standard curve provided.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunohistology and immunofluorescent staining\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFresh muscle tissues were embedded in OCT and sectioned using a cryostat (Leica, cat#CM1860) to produce 10 \u0026mu;m thick slices. Both the tissue sections and cultured cells were fixed with 4% paraformaldehyde (Sigma-Aldrich, cat#30525) for 15 minutes and permeabilized with 0.1% Triton X-100 for 10 minutes at room temperature. Following this, they were blocked with 1% BSA (Beyotime Biotechnology, cat#ST023). Subsequently, the sections and cells were incubated with anti-Laminin (Abcam, cat#ab11575, diluted 1:500) or anti- MyHC (Millipore, cat#05-716, diluted 1:1000) primary antibodies overnight. Alexa 488 or Alexa 594-conjugated anti-mouse or anti-rabbit secondary antibodies (Invitrogen, cat#A11034, cat#A11005, diluted 1:1000) were applied to visualize the target protein. 4\u0026apos;,6-Diamidino-2-phenylindole (DAPI, Vector Laboratories, cat#H-1200) was used for nuclear counterstaining, and the samples were finally mounted using an anti-fluorescence mounting medium (Vector Laboratories, cat#H-1200).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasurement of myofibers and myotubes\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA minimum of five random visual fields were randomly selected and assessed for each sample. Laminin staining delineated the boundaries of myofibers, while MyHC staining outlined the contours of myotubes. The Image J software was employed to enumerate cell nuclei (both total cell nuclei and those within myotubes) and to measure the cross-sectional area of the myofibers. All imaging analysis and evaluation were conducted by investigators in a blinded fashion to ensure objectivity.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eX-ray assessment\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eX-ray assessment was performed for anesthetized mice to evaluate spinal alignment as described in previous reports\u003csup\u003e50\u003c/sup\u003e. Radiographic images in both coronal and sagittal planes were captured using the Faxitron X-ray specimen radiography system (MX-20, USA). The images were independently evaluated by two certified spine surgeons who were blinded to the study conditions, focusing on measuring the Cobb angles in coronal and sagittal plane.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments were performed at least three times to ensure reproducibility. Data points and error bars depicted in the graphs represented the mean values \u0026plusmn; standard deviation (SD). Statistical comparisons between groups were made using a two-tailed Student\u0026rsquo;s t-test, as implemented in GraphPad Prism 7 software. A P value less than 0.05 was considered to indicate statistical significance. *P \u0026lt; 0.05; **P \u0026lt; 0.01; ***P \u0026lt; 0.001; ns, indicated no significant changes.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eThe muscle stem/progenitor cells are exposed to high ROS circumstance with suppressed METTL3 expression in concave side of AIS patients.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo analyze the features of bilateral paraspinal muscles, we first conducted RNA sequencing analysis. The GO enrichment analysis demonstrated heightened expression of genes associated with inflammation and reactive oxygen species (ROS), as well as diminished expression of genes related to muscle function and development, specifically on the concave side of AIS patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, b). Subsequent measurements of ROS levels of bilateral paraspinal muscle also validated the RNA-Seq findings that there was significantly increased level of concave paraspinal muscle for AIS patients, while no difference was identified for bilateral paraspinal muscles for congenital scoliosis (CS) patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). These initial findings suggested that muscle stem/progenitor cells on the concave side of AIS patients were subjected to oxidative stress. To further elucidate the expression profile difference of bilateral muscle stem/progenitor cells, we performed and analyzed RNA-Seq on these cells. Consistently, GO enrichment analysis also revealed an increase in terms related to inflammatory infiltration and redox reactions (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed). In addition, it was worth noting that downregulated genes enriched terms associated with RNA methyltransferase activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee), while the key m6A methyltransferase METTL3 was identified as one of a significantly decreased genes among the GO term RNA methyltransferase activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ef). We subsequently corroborated the RNA-Seq results using RT-qPCR and western blot analyses at both the mRNA and protein levels, which consistently showed decreased METTL3 expression in muscle stem/progenitor cells on the concave side of AIS patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eg, h). In contrast, no such variation in METTL3 was observed in para-spinal muscle stem/progenitor cells from control subjects (CS patients) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eg). Since METTL3 acts as a major writer of m6A modification, we then assessed the global m6A methylation levels in muscle stem/progenitor cells from both sides. The results demonstrated a reduction in global m6A level in cells from the concave side when compared to the convex side, while para-spinal muscle stem/progenitor cells from congenital scoliosis patients did not exhibit asymmetric m6A level. Collectively, these findings underscored the muscle stem/progenitor cells were exposed to high ROS circumstance with suppressed METTL3 expression in concave side of AIS patients\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eHigh levels of ROS could impair the myogenesis of muscle stem/progenitor cells by suppressing the expression of METTL3.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eGiven the results that the muscle stem/progenitor cells on the concave side of AIS patients are exposed to high ROS circumstance with decreased METTL3, we hypothesized that heightened ROS activity may suppress the expression of METTL3, consequently impairing the differentiation of these cells. To test this hypothesis, we first established a high ROS cell model using 100\u0026micro;M H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e to investigate its effects on freshly isolated human primary muscle stem/progenitor cells from para spinal muscles. Following treatment with H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, the expression of METTL3 was significantly decreased in both mRNA and protein levels tested by RT-qPCR, immunofluorescent staining and western blot tests (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea-d). Thus, high levels of ROS significantly suppressed the expression of METTL3 in muscle stem/progenitor cells. To further explore the potential role of Mettl3 in myogenesis of muscle stem/progenitor cells, we generated muscle stem cell specific Mettl3 knockout (KO) mice by administering intraperitoneal tamoxifen injections to Pax7-CreERT2; Mettl3 flox/flox mice at three weeks old (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee). The isolation of muscle stem cells was carried out as previously described, and the KO efficiency of Mettl3 was confirmed through RT-qPCR and western blot tests (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ef, g). The para-spinal myofiber size in Mettl3 KO mice was observed to be smaller compared to that of wild-type (WT) mice at eight weeks old (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eh, i). We then investigated the role of Mettl3 in myogenic differentiation. Muscle stem cells derived from Mettl3 WT and KO mice were induced to differentiate for 48 hours. The immunofluorescent staining of MyHC revealed a decrease in myotube size and differentiation efficiency in Mettl3 KO cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ej, k). Consistently, the expression of differentiation markers, including Myh1, Myh3, Ckm, and MyoG, was also found to be decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003el).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTogether, these results suggested that high levels of ROS led to a decrease in METTL3 expression in muscle stem/progenitor cells, which further impaired the myogenic differentiation ability.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMettl3-mediated m6A modification regulates Esr1 mRNA stability.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eMettl3 plays a significant role in post transcription regulation through m6A modification. Building on our previous research highlighting the critical role of asymmetrical ESR1 expression in the progression of AIS patients, we then further investigated the functional relationship between Mettl3 and Esr1. We assessed Esr1 levels in muscle stem cells from Mettl3 knockout (KO) mice using RT-qPCR and western blot tests, which revealed a significant reduction in Esr1 levels at both the mRNA and protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, b). These data indicated Mett3 could regulate the expression level of Esr1 by m6A dependent manner.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo characterize the potential mechanism of how m6A methylation regulated Esr1, we firstly conducted a SRAMP analysis (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.cuilab.cn/sramp/\u003c/span\u003e\u003cspan address=\"http://www.cuilab.cn/sramp/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to identify potential m6A modification loci on Esr1\u003csup\u003e35\u003c/sup\u003e. The analysis indicated the presence of five possible m6A modification loci along full length of Esr1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). Subsequently, we conducted MeRIP-seq analysis on Mettl3 KO and WT MuSCs. The m6A methylation peak calling was obtained using the algorithm exomePeak. The results show that Esr1 was modified by m6A methylation, with a significant decrease in m6A enrichment in the region of chromosome 10 from positions 4997271to 5005633 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed, e). The predicted functional m6A modification site 2, the 2409 bp A was also located in this region (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). To further validate the effective m6A modification segments within Esr1, we designed five specific primer pairs to amplify discrete regions corresponding to five predicted loci and performed MeRIP-qPCR tests. The results indicated that Esr1-seg2 (including the 2nd potential m6A methylation sites located in the 3\u0026rsquo;UTR region of Esr1) displayed a high level of m6A methylation in WT MuSCs, while show a significant decrease in m6A levels on Esr1 in Mettl3 KO MuSCs, supporting that Esr1 could be a target for Mettl3 mediated m6A methylation in MuSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ef). To verify the potential m6A modification site (2409bp), we employed luciferase reporter assays. The wild type (WT) Esr1-3\u0026rsquo;UTR and mutant (Mut, A to G mutation at position 2409bp) Esr1-3\u0026rsquo;UTR were inserted behind the F-luc coding region in the luciferase reporter plasmids (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg). The luciferase activity is obviously lower in Mettl3 KO MuSCs than in WT MuSCs when transfected with Esr1-WT plasmid. There was no luciferase activity difference between WT and Mettl KO MuSCs when transfected with Esr1-3\u0026rsquo;UTR Mut plasmid, suggesting that the second loci of Esr1 acted as the effective site governing Esr1 m6A modifications (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eh). To further investigate the impact of Mettl3 mediated m6A modification on Esr1 expression, mRNA stability test was performed and the result showed that knockout of Mettl3 significantly reduced the stability of Esr1 mRNA after Actinomycin D treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ei). Additionally, protein stability assays revealed that Mettl3 KO did not affect the protein stability of Esr1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ej-l). These results indicate that Mettl3 regulates Esr1 expression by stabilizing mRNA in post-transcription level.\u003c/p\u003e \u003cp\u003eIn summary, these data indicated Mettl3-mediated m6A modification could regulate Esr1 mRNA stability and ultimately affect Esr1 expression.\u003c/p\u003e \u003cp\u003e \u003cb\u003eUnilateral oxidative stress of para-spinal muscle leads to scoliosis through ROS-Mettl3-Esr1.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe proceeded to investigate whether unilateral oxidative stress of paraspinal muscle could enhance the propensity for scoliosis in vivo using a bipedal mouse model. H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, known to elevate ROS levels as previously reported\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e, was injected into the left side of the para-spinal muscles, while PBS served as a control and was injected into the right side. This regimen was maintained for three weeks, with injections administered twice weekly (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). Two weeks after treatment, spinal alignment was assessed using X-ray and the results revealed that the group receiving unilateral H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e injections exhibited more severe spinal malformations in both the coronal and sagittal planes compared to the group receiving bilateral PBS injections (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb-d). Then the para-spinal muscles from both sides were collected for further analysis. Both global m6A level evaluation and MeRIP-qPCR for target functional modification site indicated that m6A activity was significantly reduced on the concave para-spinal muscle stem/progenitor cells relative to the convex side (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee, f). Western blot analyses also demonstrated decreased protein levels of Mettl3 and Esr1 on the concave para-spinal muscle stem/progenitor cells compared to the convex side (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eg), verifying the suppressed Mettl3-Esr1 axis by accumulated ROS. Additionally, the myofiber size on the side injected with H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e was found to be smaller than that on the PBS injected side (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eh, i), indicating impaired paraspinal muscle growth after oxidative stress. Taken together, these findings suggest that unilateral oxidative stress of paraspinal muscle para-spinal muscles can lead to scoliosis in vivo through ROS-Mettl3-Esr1 axis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe betaine could mitigate the differentiation defects of muscle stem/progenitor cells on the concave side.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIn view of the results that unilateral oxidative stress of para-spinal muscle could lead to scoliosis through ROS-METTL3-ESR1 axis by m6A dependent manner, enhancing antioxidant capacity and m6A modification levels may counteract the downregulation of ESR1 in muscle stem cells on the concave side, offering a potential therapeutic approach for AIS. Betaine (trimethyl glycine), a stable and non-toxic compound widely utilized in pharmaceuticals, health product research, feed additives, and other industries, is recognized for its potent antioxidant properties\u003csup\u003e\u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. Furthermore, as a methyl donor, betaine can also significantly enhance m6A modification levels\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e,\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThus, betaine was used to explore its potential rescue effect for concave paraspinal muscle stem/progenitor cells. Expectedly, the immunofluorescent staining of MyHC showed betaine mitigated the differentiation defects of human muscle stem/progenitor cells on the concave side (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea, b). Consistently, the mRNA expression of MYH1, MYH3, CKM, and MYOG tested by RT-qPCR also showed the same results (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). In addition, both global m6A level evaluation and MeRIP-qPCR for target functional modification site demonstrated an increase in m6A activity in these cells following betaine treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed, e). Western blot tests also revealed an increase in Esr1 protein levels in concave paraspinal muscle stem/progenitor cells after betaine treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ef). These results suggested that betaine could serve as a promising therapeutic agent to effectively rescue the differentiation defects of human muscle stem/progenitor cells on the concave side.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eBetaine alleviates the progression of scoliosis in vivo through ROS-Mettl3-Esr1 axis.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eGiven that betaine has the capacity to correct the differentiation deficiencies in muscle stem/progenitor cells derived from the concave side paraspinal muscle, we set out to investigate its potential as a treatment for scoliosis in vivo.\u003c/p\u003e \u003cp\u003eThe scoliosis mouse model was first established by unilateral injection of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e as described in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea. Two weeks after H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e injection (8 weeks old), betaine was administered to the concave side twice weekly for two weeks, with PBS being injected into the opposite side as a control. A separate control group received bilateral PBS injections twice weekly for the same duration (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). The spinal alignment evaluation was performed with time points at 5th week and 9th week after first injection (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). The X-ray evaluation for spinal alignment indicated that betaine treatment significantly ameliorated spinal deformities in both the coronal and sagittal planes when compared data at 5th week and 9th week (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb-d). Subsequently, para-spinal muscles from both sides were collected for further analysis at 9th week. The myofiber size on the concave side in the betaine-injected group was larger compared to that in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ee, f). Additionally, the ROS intensity was notably reduced on the concave side in the betaine treatment group, indicating the robust antioxidant capacity of betaine in vivo (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eg). Then fresh paraspinal muscle stem cells were isolated. Both global m6A level evaluation and MeRIP-qPCR for target functional modification site revealed an increase in m6A activity on the concave paraspinal muscle stem cells following betaine treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eh, i). Furthermore, western blot tests confirmed that protein levels of Mettl3 and Esr1 were also elevated on the concave side post-betaine treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ej). These data demonstrated betaine could elevate the m6A modification levels of Esr1 and thus upregulate the expression level in muscle stem cells on the concave side. Taken together, betaine could serve as a promising therapeutic agent for the treatment of AIS through ROS-Mettl3-Esr1 axis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAIS is a prevalent and unexplained spinal deformity. Among the myriad theories proposed to unravel its pathogenesis, muscle imbalance has emerged as a significant contender in the etiology of AIS. Our previous research revealed differential ESR1 expression of paraspinal muscle stem/progenitor cells, which further established a correlation between asymmetric myogenesis and the onset and progression of AIS. Nevertheless, numerous challenges persist in translating these findings into practical applications. Therefore, it is imperative to further investigate the regulatory mechanisms underlying the asymmetric ESR1 expression to uncover safer and more efficacious treatment strategies for AIS.\u003c/p\u003e \u003cp\u003eIn this current study, we found that the expression of ESR1 of concave paraspinal muscle stem/progenitor cells can be modulated by METTL3 mediated m6A modification. High ROS level in concave para-spinal muscle of AIS patients decreased the expression of METTL3 and thus inhibited expression of ESR1 by m6A dependent manner. Moreover, improving the antioxidant defenses and m6A methylation levels effectively reversed the downregulation of ESR1 and bolstered the differentiation capacity of muscle stem cells on the concave side. By rectifying the imbalance in ROS intensity and m6A levels between bilateral para-spinal muscles using the naturally derived substance betaine, we were able to ameliorate the progression of scoliosis, offering a promising therapeutic strategy for AIS.\u003c/p\u003e \u003cp\u003eA pivotal discovery in our study is the correlation between elevated ROS levels and reduced m6A levels on the concave side of the para-spinal muscles. Prior research has shown that oxidative stress exerts a dual effect on skeletal muscle: while moderate levels can be beneficial, excessive ROS can lead to impaired muscle force and muscle atrophy\u003csup\u003e\u003cspan additionalcitationids=\"CR38 CR39\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. Concurrently, muscle atrophy, a characteristic of the concave side para-spinal muscles in AIS patients, suggests a potential link between ROS and AIS. Although previous studies have indicated higher ROS levels in AIS patients compared to controls, the precise role of ROS in the asymmetry of spinal muscles remains elusive\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. To our best knowledge, it is the first study that reported a significant increase in ROS intensity in the concave side para-spinal muscles of AIS patients. To ensure the rigor of our findings, we included an age-matched congenital scoliosis group as a stringent control, which allowed us to isolate the specific impact of ROS on the concave side in the context of AIS.\u003c/p\u003e \u003cp\u003eIn tandem with the observed increase in ROS intensity, we also noted a significant decrease in m6A levels on the concave side of AIS patients and further tests revealed that METTL3 played a key role in this process. The m6A modification, orchestrated by METTL3, is essential for maintaining muscle mass and ensuring hypertrophic performance\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Moreover, many studies showed different methylation levels are associated with AIS curve severity tightly\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e,\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. The concurrent asymmetry in ROS and METTL3 levels warrants deeper exploration. It has been documented that abnormally elevated ROS levels in human epidermal cells and embryonic lung fibroblasts can downregulate the expression of specific genes through METTL3-mediated m6A modification\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. Our study identified a similar regulatory pattern in muscle stem/progenitor cells. These findings suggested that the myogenesis defects observed on the concave side of AIS patients could be orchestrated by a reduction in METTL3 levels, which is a consequence of the high ROS environment.\u003c/p\u003e \u003cp\u003eFurther results in current study verified that there was m6A modification site in Esr1 gene, with 2409bp showing functional interaction with Mettl3. The disproportionately high incidence of AIS in females suggests a strong link between estrogen and the condition. Building on our previous work that established a connection between asymmetric ESR1 expression and the onset and progression of AIS, our current research has uncovered that ESR1 can be regulated by METTL3, which is influenced by the ROS environment. This discovery sheds light on a novel target for addressing the imbalance in para-spinal muscles of AIS patients, potentially offering a new avenue for therapeutic intervention.\u003c/p\u003e \u003cp\u003ePhysical exercise and bracing management were routinely recommended for AIS patients with a Cobb angle less than 40 degrees\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. However, lack of effective theoretical guidance leads to a variety of treatment modalities, making it challenging to assess their efficacy\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e,\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. Moreover, the long and painful treatment courses lead to poor patient compliance\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e,\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. Mechanism independent drug therapy revealed in this study might provide a safer and more practical strategy to treat AIS. Betaine, a naturally occurring and non-toxic compound widely utilized in the pharmaceutical industry, has been recognized as a potent antioxidant and primary source of S-adenosylmethionine (SAM), the principal methyl group donor for N6-methyladenosine (m6A) mRNA methylation\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e,\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Given these attributes, betaine emerges as an ideal candidate for mitigating the progression of scoliotic curves and could pave the way for the development of effective AIS treatments. The utility, safety, and feasibility of betaine in clinical AIS treatment merit further investigation.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThis study unravels elevated level of ROS in the concave paraspinal muscle and decreased expression of m6A methyltransferase METTL3, which further diminished the expression of ESR1 by m6A dependent manner, caused by increased ROS in concave paraspinal muscle stem/progenitor cells of AIS patients. Finally, decreased expression of ESR1 caused defects in the differentiation of concave muscle stem/progenitor cells and exacerbating the severity of scoliosis. Thus, asymmetrical ROS-METTL3-ESR1 axis in paraspinal muscle stem/progenitor cells played a crucial role in initiation and development of AIS. Furthermore, the antioxidant and methyl donor betaine could effectively mitigate the differentiation defects of concave muscle stem/progenitor cells and alleviated the progression of scoliosis through targeting ROS-METTL3-ESR1 axis. These findings elucidated the mechanism behind the asymmetric ESR1 expression in para-spinal muscle stem/progenitor cells and suggested treatment of betaine could be a safer and more viable therapeutic approach for AIS.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experimental procedures were approved by local institutional animal care and use committee (Approval no. XHEC-F-2024-042). All human experiments were granted approval by the local institutional ethics committee (Approval No. XHEC-D-2019-093), and written informed consent was obtained from all participants and, where applicable, their legal guardians.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors have read and approved the final version of the manuscript and consent to its publication.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors confirm that all data generated and analyzed during this study are either included in this published article or available from the corresponding authors upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (grant numbers 82302657 and 82472789).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLi Bin: Conceptualization, Investigation, Methodology, Visualization, Data curation, Writing\u0026ndash;original draft, Writing\u0026ndash;review \u0026amp; editing.\u0026nbsp;Amila Kuati: Conceptualization, Investigation, Methodology, Visualization, Writing\u0026ndash;original draft.\u0026nbsp;Cai Jinkui: Investigation, Methodology, Data curation, Writing\u0026ndash;review \u0026amp; editing.\u0026nbsp;Yang Junlin: Conceptualization, Methodology, Writing\u0026ndash;original draft, Writing\u0026ndash;review \u0026amp; editing.\u0026nbsp;Lin Xingzuan: Conceptualization, Formal analysis, Visualization, Methodology, Supervision, Writing\u0026ndash;original draft, Writing\u0026ndash;review \u0026amp; editing.\u0026nbsp;Shao Xiexiang:\u0026nbsp;Conceptualization, Formal analysis, Methodology, Visualization, Funding acquisition, Supervision, Writing\u0026ndash;original draft, Writing\u0026ndash;review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eP\u0026eacute;rez-Machado G, Berenguer-Pascual E, Bovea-Marco M, Rubio-Belmar PA, Garc\u0026iacute;a-L\u0026oacute;pez E, Garz\u0026oacute;n MJ \u003cem\u003eet al.\u003c/em\u003e From genetics to epigenetics to unravel the etiology of adolescent idiopathic scoliosis. \u003cem\u003eBone\u003c/em\u003e 2020; \u003cstrong\u003e140\u003c/strong\u003e: 115563.\u003c/li\u003e\n\u003cli\u003eDunn J, Henrikson NB, Morrison CC, Blasi PR, Nguyen M, Lin JS. Screening for Adolescent Idiopathic Scoliosis: Evidence Report and Systematic Review for the US Preventive Services Task Force. \u003cem\u003eJAMA\u003c/em\u003e 2018; \u003cstrong\u003e319\u003c/strong\u003e: 173.\u003c/li\u003e\n\u003cli\u003eKim W, Porrino JA, Hood KA, Chadaz TS, Klauser AS, Taljanovic MS. Clinical Evaluation, Imaging, and Management of Adolescent Idiopathic and Adult Degenerative Scoliosis. \u003cem\u003eCurr Probl Diagn Radiol\u003c/em\u003e 2019; \u003cstrong\u003e48\u003c/strong\u003e: 402\u0026ndash;414.\u003c/li\u003e\n\u003cli\u003eMarya S, Tambe AD, Millner PA, Tsirikos AI. Adolescent idiopathic scoliosis : a review of aetiological theories of a multifactorial disease. \u003cem\u003eBone Jt J\u003c/em\u003e 2022; \u003cstrong\u003e104-B\u003c/strong\u003e: 915\u0026ndash;921.\u003c/li\u003e\n\u003cli\u003eWang X, Yue M, Cheung JPY, Cheung PWH, Fan Y, Wu M \u003cem\u003eet al.\u003c/em\u003e Impaired glycine neurotransmission causes adolescent idiopathic scoliosis. \u003cem\u003eJ Clin Invest\u003c/em\u003e.\u003c/li\u003e\n\u003cli\u003eSarwark JF, Castelein RM, Maqsood A, Aubin C-E. The Biomechanics of Induction in Adolescent Idiopathic Scoliosis: Theoretical Factors. 2019; \u003cstrong\u003e101\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003ePeng Y, Wang S-R, Qiu G-X, Zhang J-G, Zhuang Q-Y. Research progress on the etiology and pathogenesis of adolescent idiopathic scoliosis. \u003cem\u003eChin Med J (Engl)\u003c/em\u003e 2020; \u003cstrong\u003e133\u003c/strong\u003e: 483\u0026ndash;493.\u003c/li\u003e\n\u003cli\u003eCheng JC, Castelein RM, Chu WC, Danielsson AJ, Dobbs MB, Grivas TB \u003cem\u003eet al.\u003c/em\u003e Adolescent idiopathic scoliosis. \u003cem\u003eNat Rev Dis Primer\u003c/em\u003e 2015; \u003cstrong\u003e1\u003c/strong\u003e: 15030.\u003c/li\u003e\n\u003cli\u003eFidler MW, Jowett RL. Muscle imbalance in the aetiology of scoliosis. \u003cem\u003eJ Bone Joint Surg Br\u003c/em\u003e 1976; \u003cstrong\u003e58\u003c/strong\u003e: 200\u0026ndash;201.\u003c/li\u003e\n\u003cli\u003eBrzoska E, Kalkowski L, Kowalski K, Michalski P, Kowalczyk P, Mierzejewski B \u003cem\u003eet al.\u003c/em\u003e Muscular Contribution to Adolescent Idiopathic Scoliosis from the Perspective of Stem Cell-Based Regenerative Medicine. \u003cem\u003eStem Cells Dev\u003c/em\u003e 2019; \u003cstrong\u003e28\u003c/strong\u003e: 1059\u0026ndash;1077.\u003c/li\u003e\n\u003cli\u003eWajchenberg M, Martins DE, Luciano R de P, Puertas EB, Del Curto D, Schmidt B \u003cem\u003eet al.\u003c/em\u003e Histochemical analysis of paraspinal rotator muscles from patients with adolescent idiopathic scoliosis: a cross-sectional study. \u003cem\u003eMedicine (Baltimore)\u003c/em\u003e 2015; \u003cstrong\u003e94\u003c/strong\u003e: e598.\u003c/li\u003e\n\u003cli\u003eShao X, Chen J, Yang J, Sui W, Deng Y, Huang Z \u003cem\u003eet al.\u003c/em\u003e Fiber Type-Specific Morphological and Cellular Changes of Paraspinal Muscles in Patients with Severe Adolescent Idiopathic Scoliosis. \u003cem\u003eMed Sci Monit\u003c/em\u003e 2020; \u003cstrong\u003e26\u003c/strong\u003e. doi:10.12659/MSM.924415.\u003c/li\u003e\n\u003cli\u003eFan Y, To MK-T, Yeung EHK, Kuang G-M, Liang R, Cheung JPY. Electromyographic Discrepancy in Paravertebral Muscle Activity Predicts Early Curve Progression of Untreated Adolescent Idiopathic Scoliosis. \u003cem\u003eAsian Spine J\u003c/em\u003e 2023; \u003cstrong\u003e17\u003c/strong\u003e: 922\u0026ndash;932.\u003c/li\u003e\n\u003cli\u003eYeung KH, Man GCW, Shi L, Hui SCN, Chiyanika C, Lam TP \u003cem\u003eet al.\u003c/em\u003e Magnetic Resonance Imaging-Based Morphological Change of Paraspinal Muscles in Girls With Adolescent Idiopathic Scoliosis. \u003cem\u003eSpine\u003c/em\u003e 2019; \u003cstrong\u003e44\u003c/strong\u003e: 1356.\u003c/li\u003e\n\u003cli\u003eZhu Z, Xu L, Leung-Sang Tang N, Qin X, Feng Z, Sun W \u003cem\u003eet al.\u003c/em\u003e Genome-wide association study identifies novel susceptible loci and highlights Wnt/beta-catenin pathway in the development of adolescent idiopathic scoliosis. \u003cem\u003eHum Mol Genet\u003c/em\u003e 2017; \u003cstrong\u003e26\u003c/strong\u003e: 1577\u0026ndash;1583.\u003c/li\u003e\n\u003cli\u003eZhu Z, Tang NL-S, Xu L, Qin X, Mao S, Song Y \u003cem\u003eet al.\u003c/em\u003e Genome-wide association study identifies new susceptibility loci for adolescent idiopathic scoliosis in Chinese girls. \u003cem\u003eNat Commun\u003c/em\u003e 2015; \u003cstrong\u003e6\u003c/strong\u003e: 8355.\u003c/li\u003e\n\u003cli\u003eQin X, He Z, Yin R, Qiu Y, Zhu Z. Abnormal paravertebral muscles development is associated with abnormal expression of PAX3 in adolescent idiopathic scoliosis. \u003cem\u003eEur Spine J\u003c/em\u003e 2020; \u003cstrong\u003e29\u003c/strong\u003e: 737\u0026ndash;743.\u003c/li\u003e\n\u003cli\u003eShao X, Fu X, Yang J, Sui W, Li S, Yang W \u003cem\u003eet al.\u003c/em\u003e The asymmetrical ESR1 signaling in muscle progenitor cells determines the progression of adolescent idiopathic scoliosis. \u003cem\u003eCell Discov\u003c/em\u003e 2023; \u003cstrong\u003e9\u003c/strong\u003e: 44.\u003c/li\u003e\n\u003cli\u003eLung DK, Reese RM, Alarid ET. Intrinsic and Extrinsic Factors Governing the Transcriptional Regulation of ESR1. \u003cem\u003eHorm Cancer\u003c/em\u003e 2020; \u003cstrong\u003e11\u003c/strong\u003e: 129\u0026ndash;147.\u003c/li\u003e\n\u003cli\u003eWang N, Zhang X, Rothrauff BB, Fritch MR, Chang A, He Y \u003cem\u003eet al.\u003c/em\u003e Novel role of estrogen receptor-\u0026alpha; on regulating chondrocyte phenotype and response to mechanical loading. \u003cem\u003eOsteoarthritis Cartilage\u003c/em\u003e 2022; \u003cstrong\u003e30\u003c/strong\u003e: 302\u0026ndash;314.\u003c/li\u003e\n\u003cli\u003eJiang X, Liu B, Nie Z, Duan L, Xiong Q, Jin Z \u003cem\u003eet al.\u003c/em\u003e The role of m6A modification in the biological functions and diseases. \u003cem\u003eSignal Transduct Target Ther\u003c/em\u003e 2021; \u003cstrong\u003e6\u003c/strong\u003e: 74.\u003c/li\u003e\n\u003cli\u003eYu B, Liu J, Zhang J, Mu T, Feng X, Ma R \u003cem\u003eet al.\u003c/em\u003e Regulatory role of RNA N6-methyladenosine modifications during skeletal muscle development. \u003cem\u003eFront Cell Dev Biol\u003c/em\u003e 2022; \u003cstrong\u003e10\u003c/strong\u003e: 929183.\u003c/li\u003e\n\u003cli\u003eOerum S, Meynier V, Catala M, Tisn\u0026eacute; C. A comprehensive review of m6A/m6Am RNA methyltransferase structures. \u003cem\u003eNucleic Acids Res\u003c/em\u003e 2021; \u003cstrong\u003e49\u003c/strong\u003e: 7239\u0026ndash;7255.\u003c/li\u003e\n\u003cli\u003eFiorentino F, Menna M, Rotili D, Valente S, Mai A. METTL3 from Target Validation to the First Small-Molecule Inhibitors: A Medicinal Chemistry Journey. \u003cem\u003eJ Med Chem\u003c/em\u003e 2023; \u003cstrong\u003e66\u003c/strong\u003e: 1654\u0026ndash;1677.\u003c/li\u003e\n\u003cli\u003ePetrosino JM, Hinger SA, Golubeva VA, Barajas JM, Dorn LE, Iyer CC \u003cem\u003eet al.\u003c/em\u003e The m6A methyltransferase METTL3 regulates muscle maintenance and growth in mice. \u003cem\u003eNat Commun\u003c/em\u003e 2022; \u003cstrong\u003e13\u003c/strong\u003e: 168.\u003c/li\u003e\n\u003cli\u003eLiu S, Zhuo L, Wang J, Zhang Q, Li Q, Li G \u003cem\u003eet al.\u003c/em\u003e METTL3 plays multiple functions in biological processes. .\u003c/li\u003e\n\u003cli\u003eGheller BJ, Blum JE, Fong EHH, Malysheva OV, Cosgrove BD, Thalacker-Mercer AE. A defined N6-methyladenosine (m6A) profile conferred by METTL3 regulates muscle stem cell/myoblast state transitions. \u003cem\u003eCell Death Discov\u003c/em\u003e 2020; \u003cstrong\u003e6\u003c/strong\u003e: 95.\u003c/li\u003e\n\u003cli\u003eKudou K, Komatsu T, Nogami J, Maehara K, Harada A, Saeki H \u003cem\u003eet al.\u003c/em\u003e The requirement of Mettl3-promoted \u003cem\u003eMyoD\u003c/em\u003e mRNA maintenance in proliferative myoblasts for skeletal muscle differentiation. \u003cem\u003eOpen Biol\u003c/em\u003e 2017; \u003cstrong\u003e7\u003c/strong\u003e: 170119.\u003c/li\u003e\n\u003cli\u003eXie S-J, Lei H, Yang B, Diao L-T, Liao J-Y, He J-H \u003cem\u003eet al.\u003c/em\u003e Dynamic m6A mRNA Methylation Reveals the Role of METTL3/14-m6A-MNK2-ERK Signaling Axis in Skeletal Muscle Differentiation and Regeneration. \u003cem\u003eFront Cell Dev Biol\u003c/em\u003e 2021; \u003cstrong\u003e9\u003c/strong\u003e: 744171.\u003c/li\u003e\n\u003cli\u003eZhao G, He F, Wu C, Li P, Li N, Deng J \u003cem\u003eet al.\u003c/em\u003e Betaine in Inflammation: Mechanistic Aspects and Applications. \u003cem\u003eFront Immunol\u003c/em\u003e 2018; \u003cstrong\u003e9\u003c/strong\u003e: 1070.\u003c/li\u003e\n\u003cli\u003eChen L, Liu D, Mao M, Liu W, Wang Y, Liang Y \u003cem\u003eet al.\u003c/em\u003e Betaine Ameliorates Acute Sever Ulcerative Colitis by Inhibiting Oxidative Stress Induced Inflammatory Pyroptosis. \u003cem\u003eMol Nutr Food Res\u003c/em\u003e 2022; \u003cstrong\u003e66\u003c/strong\u003e: e2200341.\u003c/li\u003e\n\u003cli\u003eChen W, Xu M, Xu M, Wang Y, Zou Q, Xie S \u003cem\u003eet al.\u003c/em\u003e Effects of betaine on non-alcoholic liver disease. \u003cem\u003eNutr Res Rev\u003c/em\u003e 2022; \u003cstrong\u003e35\u003c/strong\u003e: 28\u0026ndash;38.\u003c/li\u003e\n\u003cli\u003eYang Z-J, Huang S-Y, Zhong K-Y, Huang W-G, Huang Z-H, He T-T \u003cem\u003eet al.\u003c/em\u003e Betaine alleviates cognitive impairment induced by homocysteine through attenuating NLRP3-mediated microglial pyroptosis in an m6A-YTHDF2-dependent manner. \u003cem\u003eRedox Biol\u003c/em\u003e 2024; \u003cstrong\u003e69\u003c/strong\u003e: 103026.\u003c/li\u003e\n\u003cli\u003eJi C, Tao Y, Li X, Wang J, Chen J, Aniagu S \u003cem\u003eet al.\u003c/em\u003e AHR-mediated m6A RNA methylation contributes to PM2.5-induced cardiac malformations in zebrafish larvae. \u003cem\u003eJ Hazard Mater\u003c/em\u003e 2023; \u003cstrong\u003e457\u003c/strong\u003e: 131749.\u003c/li\u003e\n\u003cli\u003eZhou Y, Zeng P, Li Y-H, Zhang Z, Cui Q. SRAMP: prediction of mammalian N \u003csup\u003e6\u003c/sup\u003e -methyladenosine (m \u003csup\u003e6\u003c/sup\u003e A) sites based on sequence-derived features. \u003cem\u003eNucleic Acids Res\u003c/em\u003e 2016; \u003cstrong\u003e44\u003c/strong\u003e: e91\u0026ndash;e91.\u003c/li\u003e\n\u003cli\u003eWang Y, Gao J, Wu F, Lai C, Li Y, Zhang G \u003cem\u003eet al.\u003c/em\u003e Biological and epigenetic alterations of mitochondria involved in cellular replicative and hydrogen peroxide-induced premature senescence of human embryonic lung fibroblasts. \u003cem\u003eEcotoxicol Environ Saf\u003c/em\u003e 2021; \u003cstrong\u003e216\u003c/strong\u003e: 112204.\u003c/li\u003e\n\u003cli\u003eThirupathi A, Pinho RA, Ugbolue UC, He Y, Meng Y, Gu Y. Effect of Running Exercise on Oxidative Stress Biomarkers: A Systematic Review. \u003cem\u003eFront Physiol\u003c/em\u003e 2021; \u003cstrong\u003e11\u003c/strong\u003e: 610112.\u003c/li\u003e\n\u003cli\u003ePowers SK, Ji LL, Kavazis AN, Jackson MJ. Reactive Oxygen Species: Impact on Skeletal Muscle. In: Prakash YS (ed). \u003cem\u003eComprehensive Physiology\u003c/em\u003e. Wiley, 2011, pp 941\u0026ndash;969.\u003c/li\u003e\n\u003cli\u003eJackson MJ. Reactive oxygen species in sarcopenia: Should we focus on excess oxidative damage or defective redox signalling? \u003cem\u003eMol Aspects Med\u003c/em\u003e 2016; \u003cstrong\u003e50\u003c/strong\u003e: 33\u0026ndash;40.\u003c/li\u003e\n\u003cli\u003eAgrawal S, Chakole S, Shetty N, Prasad R, Lohakare T, Wanjari M. Exploring the Role of Oxidative Stress in Skeletal Muscle Atrophy: Mechanisms and Implications. \u003cem\u003eCureus\u003c/em\u003e 2023. doi:10.7759/cureus.42178.\u003c/li\u003e\n\u003cli\u003eLi J, Tang M, Yang G, Wang L, Gao Q, Zhang H. Muscle Injury Associated Elevated Oxidative Stress and Abnormal Myogenesis in Patients with Idiopathic Scoliosis. \u003cem\u003eInt J Biol Sci\u003c/em\u003e 2019; \u003cstrong\u003e15\u003c/strong\u003e: 2584\u0026ndash;2595.\u003c/li\u003e\n\u003cli\u003eShi B, Mao S, Xu L, Li Y, Sun X, Liu Z \u003cem\u003eet al.\u003c/em\u003e Quantitation Analysis of PCDH10 Methylation in Adolescent Idiopathic Scoliosis Using Pyrosequencing Study. \u003cem\u003eSpine\u003c/em\u003e 2020; \u003cstrong\u003e45\u003c/strong\u003e: E373\u0026ndash;E378.\u003c/li\u003e\n\u003cli\u003eLiu G, Wang L, Wang X, Yan Z, Yang X, Lin M \u003cem\u003eet al.\u003c/em\u003e Whole-Genome Methylation Analysis of Phenotype Discordant Monozygotic Twins Reveals Novel Epigenetic Perturbation Contributing to the Pathogenesis of Adolescent Idiopathic Scoliosis. \u003cem\u003eFront Bioeng Biotechnol\u003c/em\u003e 2019; \u003cstrong\u003e7\u003c/strong\u003e: 364.\u003c/li\u003e\n\u003cli\u003eWu F, Zhang L, Lai C, Peng X, Yu S, Zhou C \u003cem\u003eet al.\u003c/em\u003e Dynamic Alteration Profile and New Role of RNA m6A Methylation in Replicative and H2O2-Induced Premature Senescence of Human Embryonic Lung Fibroblasts. \u003cem\u003eInt J Mol Sci\u003c/em\u003e 2022; \u003cstrong\u003e23\u003c/strong\u003e: 9271.\u003c/li\u003e\n\u003cli\u003eSeleviciene V, Cesnaviciute A, Strukcinskiene B, Marcinowicz L, Strazdiene N, Genowska A. Physiotherapeutic Scoliosis-Specific Exercise Methodologies Used for Conservative Treatment of Adolescent Idiopathic Scoliosis, and Their Effectiveness: An Extended Literature Review of Current Research and Practice. \u003cem\u003eInt J Env Res Public Health\u003c/em\u003e 2022.\u003c/li\u003e\n\u003cli\u003eZhang T, Huang Z, Sui W, Wei W, Shao X, Deng Y \u003cem\u003eet al.\u003c/em\u003e Intensive bracing management combined with physiotherapeutic scoliosis-specific exercises for adolescent idiopathic scoliosis patients with a major curve ranging from 40-60\u0026deg; who refused surgery: a prospective cohort study. \u003cem\u003eEur J Phys Rehabil Med\u003c/em\u003e 2023. doi:10.23736/S1973-9087.23.07605-0.\u003c/li\u003e\n\u003cli\u003eDay JM, Fletcher J, Coghlan M, Ravine T. Review of scoliosis-specific exercise methods used to correct adolescent idiopathic scoliosis. \u003cem\u003eArch Physiother\u003c/em\u003e 2019; \u003cstrong\u003e9\u003c/strong\u003e: 8.\u003c/li\u003e\n\u003cli\u003eKaelin AJ. Adolescent idiopathic scoliosis: indications for bracing and conservative treatments. \u003cem\u003eAnn Transl Med\u003c/em\u003e 2020; \u003cstrong\u003e8\u003c/strong\u003e: 28\u0026ndash;28.\u003c/li\u003e\n\u003cli\u003eNegrini S, Minozzi S, Bettany-Saltikov J, Chockalingam N, Grivas TB, Kotwicki T \u003cem\u003eet al.\u003c/em\u003e Braces for idiopathic scoliosis in adolescents. \u003cem\u003eCochrane Database Syst Rev\u003c/em\u003e 2015; \u003cstrong\u003e2015\u003c/strong\u003e. doi:10.1002/14651858.CD006850.pub3.\u003c/li\u003e\n\u003cli\u003eWu T, Sun X, Zhu Z, Yan H, Guo J, Cheng JCY \u003cem\u003eet al.\u003c/em\u003e Role of Enhanced Central Leptin Activity in a Scoliosis Model Created in Bipedal Amputated Mice. \u003cem\u003eSpine\u003c/em\u003e 2015; \u003cstrong\u003e40\u003c/strong\u003e: E1041-1045.\u003c/li\u003e\n\u003cli\u003eMachida M, Dubousset J, Yamada T, Kimura J, Saito M, Shiraishi T \u003cem\u003eet al.\u003c/em\u003e Experimental scoliosis in melatonin-deficient C57BL/6J mice without pinealectomy. \u003cem\u003eJ Pineal Res\u003c/em\u003e 2006; \u003cstrong\u003e41\u003c/strong\u003e: 1\u0026ndash;7.\u003c/li\u003e\n\u003cli\u003eFu X, Xiao J, Wei Y, Li S, Liu Y, Yin J \u003cem\u003eet al.\u003c/em\u003e Combination of inflammation-related cytokines promotes long-term muscle stem cell expansion. \u003cem\u003eCell Res\u003c/em\u003e 2015; \u003cstrong\u003e25\u003c/strong\u003e: 655\u0026ndash;673.\u003c/li\u003e\n\u003cli\u003eDing C, Lu J, Li J, Hu X, Liu Z, Su H \u003cem\u003eet al.\u003c/em\u003e RNA‐methyltransferase Nsun5 controls the maternal‐to‐zygotic transition by regulating maternal mRNA stability. \u003cem\u003eClin Transl Med\u003c/em\u003e 2022; \u003cstrong\u003e12\u003c/strong\u003e: e1137.\u003c/li\u003e\n\u003cli\u003eJang I, Niu Q, Deng S, Zhao P, Chua N. Enhancing protein stability with retained biological function in transgenic plants. \u003cem\u003ePlant J\u003c/em\u003e 2012; \u003cstrong\u003e72\u003c/strong\u003e: 345\u0026ndash;354.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"experimental-and-molecular-medicine","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"emm","sideBox":"Learn more about [Experimental \u0026 Molecular Medicine](http://www.nature.com/emm/)","snPcode":"12276","submissionUrl":"https://mts-emm.nature.com/cgi-bin/main.plex","title":"Experimental \u0026 Molecular Medicine","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Adolescent idiopathic scoliosis, Oxidative stress, N6-methyladenosine, Muscle stem cells, Betaine","lastPublishedDoi":"10.21203/rs.3.rs-6683773/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6683773/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cb\u003eBackground\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAdolescent idiopathic scoliosis (AIS) is the most common spinal deformity, yet its precise etiology remains elusive. Our previous research highlighted the pivotal role of asymmetrical ESR1 expression of paraspinal muscle stem/progenitor cells in the progression of AIS. However, the widespread distribution of ESR1 in various organs and tissues limits its safety and efficacy as a therapeutic target, it is imperative to delve deeper into the regulatory mechanisms governing the asymmetric ESR1 expression in para-spinal muscle stem/progenitor cells to uncover safer and more effective treatment strategies for AIS.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMethods\u003c/b\u003e\u003c/p\u003e \u003cp\u003eReal-time quantitative PCR, immunofluorescence staining, Western blot, MeRIP-qPCR, m6A-seq, and reactive oxygen species (ROS) detection were employed to confirm the asymmetrical ROS-METTL3-ESR1 axis in paraspinal muscle progenitor cells of AIS patients. A unilateral oxidative stress-induced scoliosis mouse model was constructed for in vivo validation and rescue experiments.\u003c/p\u003e\u003cp\u003e\u003cb\u003eResults\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn this study, elevated level of ROS in the concave paraspinal muscles was discovered in AIS patients. The increased ROS decreased expression of m6A methyltransferase METTL3, which further diminished the expression of ESR1 by m6A dependent manner in concave paraspinal muscle stem/progenitor cells. Thus, asymmetrical ROS-METTL3-ESR1 axis in paraspinal muscle stem/progenitor cells played a crucial role in initiation and development of AIS. Furthermore, the antioxidant and methyl donor betaine could effectively mitigate the differentiation defects of concave muscle stem/progenitor cells and alleviated the progression of scoliosis through targeting ROS-METTL3-ESR1 axis.\u003c/p\u003e\u003cp\u003e\u003cb\u003eConclusions:\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe unilateral oxidative stress is one of the causes of AIS by asymmetry ROS-METTL3-ESR1 axis in paraspinal muscle stem cells. Reducing ROS and increasing the expression of METTL3 in paraspinal muscle stem cells at concave side may be a new therapeutic strategy for AIS.\u003c/p\u003e","manuscriptTitle":"The asymmetrical ROS-METTL3-ESR1 axis in paraspinal muscle progenitor cells determines the progression of adolescent idiopathic scoliosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-10 05:38:05","doi":"10.21203/rs.3.rs-6683773/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2025-08-05T22:58:33+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-08-04T06:36:12+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-07-29T08:57:36+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-07-10T06:26:05+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-06-30T06:04:19+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2025-06-04T05:53:10+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-06-03T05:09:53+00:00","index":"","fulltext":""},{"type":"submitted","content":"Experimental \u0026 Molecular Medicine","date":"2025-06-02T16:04:11+00:00","index":"","fulltext":""},{"type":"checksFailed","content":"","date":"2025-05-19T00:15:16+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-05-16T23:56:27+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"experimental-and-molecular-medicine","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"emm","sideBox":"Learn more about [Experimental \u0026 Molecular Medicine](http://www.nature.com/emm/)","snPcode":"12276","submissionUrl":"https://mts-emm.nature.com/cgi-bin/main.plex","title":"Experimental \u0026 Molecular Medicine","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"939076a3-8736-4b2f-8f09-24e8df8ffcec","owner":[],"postedDate":"June 10th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":49494019,"name":"Biological sciences/Molecular biology/Epigenetics/DNA methylation"},{"id":49494020,"name":"Health sciences/Anatomy/Musculoskeletal system/Muscle/Skeletal muscle"}],"tags":[],"updatedAt":"2026-03-06T08:07:59+00:00","versionOfRecord":{"articleIdentity":"rs-6683773","link":"https://doi.org/10.1038/s12276-026-01658-7","journal":{"identity":"experimental-and-molecular-medicine","isVorOnly":false,"title":"Experimental \u0026 Molecular Medicine"},"publishedOn":"2026-03-05 05:00:00","publishedOnDateReadable":"March 5th, 2026"},"versionCreatedAt":"2025-06-10 05:38:05","video":"","vorDoi":"10.1038/s12276-026-01658-7","vorDoiUrl":"https://doi.org/10.1038/s12276-026-01658-7","workflowStages":[]},"version":"v1","identity":"rs-6683773","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6683773","identity":"rs-6683773","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.