Tannic acid enhances postharvest resistance of Korla fragrant pears to Alternaria alternata by modulating membrane lipid and reactive oxygen species metabolism

preprint OA: closed
Full text JSON View at publisher
Full text 178,315 characters · extracted from preprint-html · click to expand
Tannic acid enhances postharvest resistance of Korla fragrant pears to Alternaria alternata by modulating membrane lipid and reactive oxygen species metabolism | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Tannic acid enhances postharvest resistance of Korla fragrant pears to Alternaria alternata by modulating membrane lipid and reactive oxygen species metabolism Yisong Tang, Weida Zhang, Wanting Yang, Tongrui Sun, Jiankang Cao, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9259312/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 10 You are reading this latest preprint version Abstract Tannic acid (TA), a naturally occurring polyphenol, exhibits broad-spectrum antimicrobial and antioxidant activities. This study elucidates the mechanisms by which TA controls Alternaria alternata in Korla fragrant pears. In vitro, TA at 10 mg mL-1 directly inhibited fungal growth by inducing hyphal deformation. In vivo, TA treatment significantly attenuated blackhead disease development. The underlying protective mechanism involved two coordinated pathways: First, TA enhanced the activity and gene expression of key antioxidant enzymes (APX, GR, CAT, SOD), sustaining the AsA-GSH cycle to scavenge excessive reactive oxygen species (ROS). Second, TA suppressed the activity and gene expression of lipid-degrading enzymes (LOX, lipase, PLC, PLD, PLA2) while elevating fatty acid desaturase (FADS) activity. This regulation preserved membrane lipids (phosphatidylcholine, phosphatidylinositol, and unsaturated fatty acids), reduced harmful metabolites (phosphatidic acid, free fatty acids, and malondialdehyde), and thereby maintained membrane integrity. Our findings demonstrate that TA functions as a multi-target postharvest treatment, primarily through the dual regulation of redox homeostasis and membrane lipid metabolism to reinforce fruit resistance. Biological sciences/Biochemistry Biological sciences/Biotechnology Biological sciences/Microbiology Biological sciences/Plant sciences Tannic acid Korla fragrant pear Alternaria alternata Reactive oxygen species Membrane lipid metabolism Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction In recent years, blackhead disease has emerged in Korla fragrant pear ( Pyrus bretschneideri Rehd) during large-scale storag 1 . This disease primarily affects the fruit calyx, starting with concentrated black spots that quickly spread to the core, causing lesions and extreme softening of the flesh. Eventually, a honeycomb-like black mycelial layer forms, accompanied by oozing viscous black juice, severely deteriorating storage qualit 2 . Effective and safe methods to manage this disease are urgently needed. Tannic acid (TA) – a hydrolyzable polyphenol ubiquitously distributed in vascular plants – exhibits particular promise through its multifaceted antimicrobial properties and GRAS (Generally Recognized As Safe) status in food applications 3 ,4 . The antimicrobial efficacy of TA primarily stems from its protein-denaturing capacity, which mediates astringent, antiviral, and antibacterial effects via structural disruption of microbial membranes and enzymes 5 . Numerous studies demonstrate TA’s broad-spectrum inhibitory effects against phytopathogens such as Phomopsis mangiferae , Ralstonia solanacearum , and Penicillium digitatum , with particular efficacy in postharvest disease management 6 . Notably, Zhu et al 7 . reported 70% suppression of Penicillium digitatum -induced citrus green mold through TA application, while Thuy et al 8 . documented its bactericidal action against Ralstonia solanacearum in tomato bacterial wilt. Beyond direct antimicrobial activity, TA’s antioxidant potential, attributed to its abundant phenolic hydroxyl groups and conjugated aromatic system, enables effective ROS scavenging and oxidative stress mitigation. 6 This function was exemplified by Wang et al 9 ., who demonstrated that 10 mg L -1 TA treatment enhanced antioxidant defenses and reduced ROS accumulation in tea plants under stress conditions. Despite these recognized properties, the potential of TA in managing postharvest diseases in horticultural products remains underexplored. This knowledge gap highlights the need to investigate TA’s regulatory mechanisms on both pathogen viability and host redox balance during fungal infection. A substantial body of research has demonstrated that cell membrane damage is a primary factor contributing to postharvest diseases in fruit and vegetables 10 . The degradation of membrane lipids, coupled with diminished antioxidant capacity, compromises the structural integrity of cellular membranes, thereby accelerating the onset and progression of postharvest pathologies. Elevated membrane lipid metabolism results in the accumulation of SFAs and a corresponding loss of membrane fluidity and stability, which may further exacerbate disease development 1 1 . For example, in peaches and longans treated with H 2 O 2 , increased activities of enzymes involved in membrane lipid metabolism lead to accelerated lipid breakdown and a more rapid deterioration of fruit quality 1 2 . In contrast, suppression of LOX, PLD, and PLC activities in apples inoculated with Penicillium expansum has been shown to increase levels of PI and PC, reduce concentrations of SFAs and PA, preserve membrane integrity, and delay disease symptoms 1 3 . The rapid production of ROS, commonly referred to as an oxidative burst, represents an early plant defense mechanism in response to pathogen invasion 1 4 . However, excessive accumulation of ROS can induce lipid peroxidation, leading to irreversible damage to the cellular membrane system. Moreover, MDA, a secondary product of lipid peroxidation, can modify membrane constituents through protein cross-linking and structural denaturation, thereby compromising membrane integrity 1 5 ,1 6 . It has been documented that upon infection by Penicillium digitatum , apples exhibit significant ROS generation and MDA accumulation, resulting in plasma membrane disruption in fruit pulp and an increase in lesion expansion 1 4 . Furthermore, Lin et al 1 7 . demonstrated that Penicillium digitatum exacerbates disease progression in citrus fruits by suppressing the activity of ROS-scavenging enzymes, which contributes to sustained ROS accumulation. A. alternata , the primary pathogen responsible for Korla fragrant pear blackhead disease, induces membrane lipid peroxidation and compromises antioxidant capacity and fruit disease resistance 1,2 . However, research on how TA modulates pear resistance to A. alternata through regulating ROS levels and membrane lipid metabolism remains limited. This study examines the effects of TA treatment on the ROS production-scavenging system, key enzyme activities associated with membrane lipid metabolism, and changes in membrane fatty acid and phospholipid composition in infected fruit, offering novel insights into strategies for preventing blackhead disease and extending postharvest storage. Results Effect of TA treatment on the growth and mycelial morphology of A. alternata In the CK group (0 mg mL - ¹ TA), the fungal colony nearly covered the PDA plate after 7 days. TA inhibited A. alternata mycelial growth dose-dependently (Fig. 1A). At 10.0 mg mL - ¹ TA, mycelial diameter (25.73 mm) was significantly reduced compared to 5.0 mg mL - ¹ (31.43 mm), with no significant further reduction at higher concentrations (Fig. 1B). Inhibitory rates at 10.0, 12.5, and 15.0 mg mL - ¹ TA were no significant differences (Fig. 1C). The dose-response relationship followed a logistic model, yielding a 7-day IC₅₀ of 3.86 mg mL⁻¹. Optical microscopy revealed neat, sparsely branched mycelia at the colony edge in the CK group (Fig. 1D). In contrast, TA-treated mycelia appeared twisted, thinner, and more intertwined; this altered morphology was consistent across all tested concentrations (Fig. 1E-I). Collectively, TA treatment significantly altered A. alternata colony and mycelial growth. Screening for optimal concentration of TA for in vivo inhibition of A . alternata Treatment with 10 mg mL -1 TA significantly reduced A. alternata -induced lesion diameter in pear fruit by 53.39% compared to CK (Fig. 2A, Table 1). Higher TA concentrations did not further reduce lesions. Consequently, 10 mg mL -1 TA was selected for subsequent analyses of ROS and membrane lipid metabolism. Effect s of TA on FDI , CMP , and MDA of Korla fragrant pears infected by A . alternata FDI increased throughout storage in all treated fragrant pear fruit (Fig. 2B–C). Lesions were absent in the CK and TA groups during the first 3 days, after which FDI gradually increased. The Aa group exhibited the highest FDI, reaching levels 2.02 times higher than CK and 1.17 times higher than TA by day 15. CMP was lower in the TA group than in the Aa group. By day 15, CK group CMP reached only 66.00% of Aa group and 79.13% of TA group levels (Fig. 3A). MDA content increased slightly in CK group but sharply in Aa group during storage; TA treatment suppressed this accumulation (Fig. 3B). On day 12, Aa group MDA content was 34.57% higher than CK group and 12.61% higher than TA group. Effect s of TA on endogenous TA content of Korla fragrant pears infected by A . a lternata Endogenous TA content steadily decreased in the Aa group, whereas CK group fluctuated and TA group declined initially before increasing (Fig. 3C). The TA group maintained significantly higher endogenous TA than both CK and Aa groups at all timepoints except day 9. By day 15, TA content in the TA group exceeded CK group by 30.71% and Aa group by 64.98%. Effect s of TA on O 2 -· , H 2 O 2 , ·OH content s and ROS scavenging enzyme activit y of Korla fragrant pears infected by A . alternata The fragrant pear fruit inoculated with A. alternata showed higher O 2 -· , H 2 O 2 , and ·OH content than the CK group, and all values showed an increasing trend (Fig. 3D-F). Remarkably, the O 2 -· , H 2 O 2 , and ·OH content in TA group was 22.25%, 10.96%, and 10.34% lower than that in the Aa group, respectively, on day 15. In the Aa group, SOD and CAT activities peaked on day 9 and day 6, respectively, whereas in the TA group, peaks occurred later, on day 12 and day 9 (Fig. 3G-H). By day 15, SOD and CAT activities were 1.18 times and 1.17 times higher in the TA group than in the Aa group. APX activity in the CK group increased continuously (Fig. 3I), reaching levels 56.98% and 29.07% higher than in the Aa and TA groups, respectively, on day 15. GR activity in the CK group reached 1.35 U g⁻¹ on day 15; the Aa and TA groups exhibited 65% and 87% of this activity level, respectively (Fig. 3J). Effect s of TA on membrane phospholipid content and membrane phospholipid degradation product of Korla fragrant pears infected by A . alternata The PC content in the Aa group was lower than in the TA group, except on days 9 and 12 (Fig. 4A). The PI content trend in fragrant pear fruit mirrored that of PC content (Fig. 4B). On day 15, PI content in the CK and TA groups was 111.79% and 85.52% higher, respectively, compared to the Aa group. Membrane lipid degradation products (PA, DAG, FFAs) exhibited distinct accumulation patterns (Fig. 4C-E). PA content in the Aa group increased significantly until day 9, then declined sharply, falling 42.86% below TA group by day 15 (Fig. 4C). DAG content was consistently higher in Aa group than TA group, peaking at 39.43% higher (day 3) and 36.89% higher (day 9) (Fig. 4D). FFAs content increased during storage, with Aa showing the highest accumulation. TA treatment inhibited this increase, resulting in Aa group FFAs being 1.47 times higher than CK and 1.25 times higher than TA on day 15 (Fig. 4E). Effect of TA on the membrane lipid metabolism enzyme activit y in of Korla fragrant pears infected by A . alternata Phospholipase activities differed significantly among groups (Fig. 4F-H). On day 12, PLA2 activity in the Aa group exceeded CK group by 30.21% and TA group by 19.87%, while PLC activity showed similar trends, surpassing CK group by 60.00% and TA group by 26.73%. By day 15, PLD activity in the Aa group was 1.45-fold higher than CK group and 1.15-fold higher than TA group. Lipase activity in the Aa group exceeded CK group by 41.00% and TA group by 15.03% on day 15 (Fig. 4I). LOX activity was consistently higher in Aa group, peaking at 29.81% above CK group and 21.05% above TA group on day 12 (Fig. 4J). Conversely, FADS activity peaked then declined (Fig. 4K), with Aa group reaching only 64.66% of CK and 72.81% of TA levels by day 15. Effect of TA on the membrane fatty acid content, IUFA, and U/S level of Korla fragrant pears infected by A . alternata SFAs (C 16:0 , C 17:0 , C 18:0 ) accumulated progressively during storage, while C 20:0 peaked then declined (Table 2). Conversely, key USFAs (C 18:1 , C 18:2 , C 18:3 ) decreased throughout storage. Compared to CK group, the Aa group exhibited elevated SFAs and reduced USFAs across all timepoints; TA treatment significantly mitigated these alterations. Both the U/S ratio and IUFA showed a decreasing trend during storage, especially after inoculation with A. alternata . TA treatment delayed this decline (Table. 2). By day 15, the U/S ratio in the Aa group was 53.24% lower than the CK and 28.63% lower than the TA group. Similarly, IUFA was 30.49% lower than the CK and 16.38% lower than the TA group. Effect of TA on gene relative expression of antioxidant and membrane lipid metabolism related enzymes of Korla fragrant pears infected by A . alternata Inoculation with A. alternata induced significant upregulation of antioxidant-related genes ( PbrSOD, PbrCAT, PbrAPX , and PbrGR ) during the early storage phase (days 0–6) (Fig. 5). However, transcriptional levels of these genes in the Aa group exhibited a sharp decline starting at day 9, with expression values becoming significantly lower than those in both CK and TA groups by day 15. Gene expression patterns of membrane lipid metabolism-related enzymes closely paralleled their corresponding enzymatic activity trends. Pathogen inoculation markedly upregulated PbrPLC, PbrPLD, Pbrlipase , and PbrLOX expression while suppressing PbrFAD2 . Especially on the 6th day, the expression levels of PbrPLC, PbrPLD, Pbrlipase and PbrLOX in Aa group were 3.24 times, 3.09 times, 6.28 times, 5.48 times and 4.04 times, 1.64 times, 2.24 times and 1.41 times of CK and TA groups, respectively. TA treatment significantly attenuated the decline in PbrFAD2 expression throughout the experimental period. Discussion A. alternata is a typical pathogenic fungus that produces A. alternata rot in a variety of fruits, which can result in major issues with food safety and financial losses 2 3 . Research has demonstrated that TA, a naturally occurring polyphenol which originates from a variety of sources, is environmentally friendly, nontoxic, and has been proven to have wide-ranging antibacterial effects 2 4,25,26 . Thus, TA was utilized as a bactericidal agent in this study to explore its influence on the prevention and control of fragrant pear postharvest blackhead disease and to clarify the antibacterial mechanism of TA from the perspective of ROS metabolism and membrane lipid metabolism. In the present study, A. alternata colon development was considerably reduced by TA (IC 50 = 3.86 mg mL -1 ). The growth inhibition rate of A. alternata was 67.71% at a TA concentration of 10 mg mL -1 (Fig. 1C). Meanwhile, TA caused changes in mycelial morphology, such as with more numerous and thinner mycelial branches that were intertwined mycelial branches (Fig. 1D-I). In addition, 10 mg mL -1 TA significantly inhibited the expansion of the diameter of the disease spot on fragrant pear fruit, with a control effect of 53.39% (Fig. 2A and Table 1). Similarly, previous study reported that TA inhibits Penicillium digitatum infection in citrus fruit 7 . Furthermore, 5 mg mL -1 TA decreased the incidence of apple fruit and strongly suppressed the growth of A. alternata mycelium in apples 27 . These results demonstrate that TA exhibits considerable potential for the prevention and control of postharvest blackhead disease in fragrant pears. It should be noted that even in the in vitro antibacterial experiment on PDA plates, TA also exhibits a relatively high requirement for inhibitory concentration. This indicates its different mode of action from traditional synthetic bactericides. Specifically, TA does not act via a single highly lethal target but functions as a multi-target disruptor, reversibly binding to disrupt the membrane structure, enzyme function, and metal ion homeostasis of pathogenic bacteria. This mode necessitates reaching a certain critical concentration to achieve a better inhibitory effect. More importantly, the PDA culture medium itself emerges as an important interfering factor. Its abundant protein and polysaccharide components will non-specifically bind to and consume a large quantity of TA, leading to a significant decrease in the effective concentration of free TA compared to the added concentration. This can also be corroborated by the studies of Zhu et al. 7 and Wang et al. 27 The ROS burst represents an early defense response in plants, where pathogen invasion triggers massive ROS production that directly exerts toxic effects on pathogens while simultaneously functioning as crucial signaling molecules. These ROS modulate the activity of defense-related enzymes and regulate gene expression patterns, thereby enhancing disease resistance in fruit and vegetables 1 9 . During the initial experimental phase, Aa group exhibited significant elevation in ROS levels (O 2 -· , H 2 O 2 , and ·OH), indicating rapid activation of the fruit’s ROS-mediated defense mechanisms following pathogen challenge (Fig. 3D-F). Notably, both Aa and TA groups demonstrated dramatic ROS accumulation after 6 days post-inoculation. This phenomenon can be attributed to the burst of ROS and the disruption of the antioxidant system induced by pathogen colonization, leading to diminished antioxidant enzyme activity and an impaired capacity to scavenge reactive oxygen species 2 8 . TA treatment effectively attenuated the ROS accumulation rate, potentially through its abundant phenolic hydroxyl groups that confer superior antioxidant properties. Intriguingly, our study revealed that TA application induced endogenous TA biosynthesis in fragrant pear fruits (Fig. 3C). This observation aligns with previous findings by He et al. 2 9 , who demonstrated that TA enhances storage quality in Moringa oleifera leaves by maintaining antioxidant capacity. Similarly, Liu et al. 30 reported that TA could enhance the free radical scavenging capacity of cucumber seedlings and induce the activities of antioxidant enzymes, such as SOD and CAT. These studies demonstrate that exogenous TA treatment synergistically enhances the resistance of fragrant pear fruit to A. alternata by promoting the biosynthesis of endogenous TA and augmenting antioxidant capacity. Plants possess sophisticated ROS-scavenging systems that regulate intracellular redox homeostasis, thereby minimizing oxidative damage and maintaining cellular integrity 1 5 . The enzymatic antioxidant system, comprising SOD, CAT, APX, and GR, forms the primary defense line in higher plants. SOD catalyzes the dismutation of O 2 -· into H₂O₂ and O₂, while CAT subsequently decomposes H₂O₂ into H₂O and O₂, collectively mitigating ROS accumulation and protecting cellular membranes from oxidative damage 31 . Furthermore, GR and APX maintain ROS balance by regulating the AsA and GSH redox cycle in fruit 2 2 . In this study, the Aa group exhibited an initial rapid surge in ROS levels accompanied by transient upregulation of antioxidant enzyme activities and their relative gene expressions from day 0 to day 6. However, significant decline in the radical scavenging abilities of antioxidant enzyme activities were observed post-day 6, indicating that pathogen invasion initially activates antioxidant defenses but ultimately overwhelms the system as infection progresses. This progressive antioxidant system failure led to ROS overaccumulation and accelerated disease spread. In contrast, TA treatment modulated regulates the enzyme-based antioxidant system, effectively maintaining lower ROS levels. These findings align with Wang et al. 9 , who demonstrated that TA can activate the antioxidant defense of tea plants by enhancing the activities of antioxidant enzymes such as SOD, POD, CAT, and APX, thereby suppressing ROS accumulation and improving stress tolerance. Excessive ROS accumulation triggers membrane lipid peroxidation, ultimately compromising the structural and functional integrity of cellular membranes. Previous studies have documented that pathogen invasion induces phospholipid degradation, reduces membrane fluidity, disrupts cellular compartmentalization, and accelerates fruit deterioration 1 9 . As fundamental components of membrane architecture, phospholipids not only maintain membrane fluidity and selective permeability but also participate in cellular signaling processes 2 8 . Based on their cleavage specificity towards phospholipid ester bonds, phospholipases are classified into three major types: PLA, PLC, and PLD. These enzymes (PLA2, PLD, and PLC) hydrolyze membrane phospholipids (PI and PC) to generate PA and DAG while releasing FFAs. Notably, PA can activate NADPH oxidase activity, thereby promoting ROS generation and ultimately leading to membrane dysfunction 31 , 32 . In present study, Aa group fragrant pears exhibited significant reductions in PC and PI contents accompanied by upregulated activities and gene expressions of PLA2, PLD, and PLC (Figs. 4-5). These changes resulted in substantial accumulation of PA, DAG, and FFAs, accelerating membrane disintegration and disease progression. However, TA treatment markedly attenuated these pathological trends, suggesting its capacity to inhibit phospholipase activities and related gene expressions, thereby suppressing phospholipid degradation. This finding aligns with previous reports showing accelerated PC, PI degradation and PA synthesis in longan fruits infected by Lasiodiplodia theobromae and Phomopsis longanae , which elevated PLD, lipase, and LOX activities, subsequently promoting membrane peroxidation products and ROS accumulation 21 , 33 . The research by Chen et al. 3 4 also confirmed that inhibiting the PLD and PLC activities of the Phomopsis longanae -infected longans can delay the decomposition of PC and PI and maintain membrane integrity, which further corroborates our proposed mechanism. A hallmark of membrane lipid peroxidation manifests as reduced IUFA in cellular membranes 20 . Fatty acids not only influence membrane structural integrity but also participate in plant systemic defense responses. Xing and Chin 3 5 demonstrated that specific USFAs (C 16:1 , C 18:2 , C 18:3 ) directly inhibit Verticillium dahliae growth, with elevated USFAs levels enhancing eggplant resistance against pathogens. Similarly, Cao et al. 3 6 reported that higher USFAs contents (particularly C 18:2 and C 18:3 ) reduced natural disease incidence in ‘Qingzhong’ loquat fruit. In our study, Aa group exhibited significant IUFA reduction from day 6 post-inoculation (Table 2), accompanied by an increase in FDI (Fig. 2C), progressive activation of lipase and LOX activities, and substantial alterations in the fatty acid profile. These changes included the continuous depletion of USFAs (C 18:1 , C 18:2 , C 18:3 ) and the accumulation of SFAs (C 16:0 , C 17:0 , C 18:0 , C 20:0 ) (Table 2). Conversely, TA treatment effectively suppressed lipase and LOX activation rates while maintaining higher FADS activity, thereby reducing USFA-to-SFA conversion. We propose that the underlying mechanism involves dual inhibition of LOX by TA: chelation of non-heme iron (Fe²⁺ and Fe³⁺) at the catalytic center, which blocks oxygen binding, and antioxidant-mediated reduction of Fe³⁺ to Fe²⁺, disrupting the enzyme’s redox cycle 3 7 . This LOX inhibition likely underlies TA’s capacity to decelerate fatty acid saturation and enhance A . alternata resistance in fragrant pears. These observations align with Gong et al. 1 3 , who demonstrated that by reducing the activities of LOX, PLD, and PLC in Penicillium expansum -infected apples, the accumulation of PA could be delayed while maintaining the levels of PC, PI, and USFAs, thereby preserving membrane integrity and disease resistance. Our findings collectively propose that TA-mediated LOX suppression represents a critical strategy for mitigating membrane peroxidation and enhancing postharvest pathogen resistance in fruit and vegetables. As shown in Fig. 6, the proposed mechanism framework highlights the dual role of TA in regulating membrane lipid metabolism and ROS homeostasis to counteract A. alternata philoxeroides infection. CMP and MDA contents are usually used to assess the structural integrity of cell membranes and the degree of membrane lipid peroxidation 2 8 . The CMP and MDA contents in the TA-treated fruits were both lower than those in the Aa group, indicating that TA treatment significantly maintained cell membrane integrity and reduced membrane lipid peroxidation. Additionally, the correlation analysis in the Aa group showed that the contents of PC and PI were negatively correlated with H 2 O 2 (r = -0.90; r = -0.84), O 2 ·- production rate (r = -0.91; r = -0.87), ·OH (r = -0.85; r = -0.87), MDA (r = -0.87; r = -0.69), CMP (r = -0.79; r = -0.75), LOX (r = -0.70; r = -0.72), Lipase (r = -0.79; r = -0.87), PLD (r = -0.35; r = -0.55), PLC (r = -0.51; r = -0.64), and PLA2 (r = -0.51; r = -0.64). In contrast, the contents of DAG and FFAs were positively correlated with these indicators (Fig. 7). The endogenous TA content was negatively correlated with FDI (r = -0.89), H 2 O 2 (r = -0.99), O 2 ·- production rate (r = -0.98), ·OH (r = -0.96), MDA (r = -0.96), and CMP (r = -0.94), while positively correlated with PC (r = 0.86) and PI (r = 0.82). In this study, TA treatment maintained relatively low CMP, MDA, and ROS contents, while the activities of antioxidant enzymes were relatively high. At the same time, TA treatment inhibited the activities of membrane lipid oxidation-related enzymes such as LOX, LPS, PLD, and PLC, maintained high contents of endogenous TA and membrane phospholipids, enhanced resistance to Alternaria, and thus significantly reduced FDI. To effectively induce the disease resistance of Korla fragrant pears, a relatively high concentration of exogenous TA (10 mg mL -1 ) is requisite. This phenomenon is primarily ascribed to its mode of action as an inducer and the constraints in practical application. Firstly, as an inducer, TA can activate the intricate ROS and membrane lipid metabolism defense network within Korla fragrant pears, which necessitates reaching a critical signal intensity threshold 38,39 . Secondly, the physicochemical properties of TA impede its efficiency during application. It readily binds non - specifically to organic matrices at fruit wounds, and its relatively large molecular weight (1700 Da) restricts its penetration into the tissue. This is directly corroborated by our endogenous TA content data (0.06-0.15 mg g -1 ), indicating that the majority of TA is consumed before reaching the target site. Therefore, a higher exogenous treatment concentration is essential to overcome these losses and ensure that there are sufficient active molecules to initiate plant defense. This understanding also indicates future optimization directions. By modifying TA (such as via nano-encapsulation or preparing metal complexes), its stability, targeting, and penetration efficiency can be improved, which is anticipated to significantly reduce its effective application concentration. Methods Preparation of fruit materials, spore suspension, and TA reagent The pathogenic fungus A. alternata , previously isolated by our group, was activated and cultured in PDA medium at 28 °C and relative humidity of 70 ± 5% for 7 days. Spores were collected by scraping with a sterile glass rod, filtered through sterile gauze, and adjusted to a concentration of 10 6 spores mL -1 for storage. Korla fragrant pears harvested in September 2023 (Korla, Xinjiang, China) were transported to Shihezi University’s postharvest laboratory. Uniform, defect-free fruit were surface-sterilized with 2% (v/v) sodium hypochlorite (2 min), rinsed with sterile distilled water, and air-dried. Based on preliminary efficacy screening, 10 mg mL - ¹ TA was selected for treatment. Four equidistant wounds (5 mm diameter × 5 mm depth) were created per fruit equator using a sterile borer. The 240 fruit were divided into three groups: (1) control check (CK) group, in which each wound was injected with 20 µL sterile distilled water and then injected with 20 µL sterile distilled water 30 min later; (2) A. alternata ( Aa ) group, in which each wound was first injected with 20 µL of sterile distilled water and then with 20 µL of spore suspension (1 × 10 6 spores mL -1 ) after 30 min; and (3) A. alternata +TA (TA) group, in which each wound was first injected with 20 µL of 10 mg mL -1 TA solution and then with 20 µL of spore suspension (1 × 10 6 spores mL -1 ) at 30 min later. After the solution was completely absorbed, the fragrant pear fruit was placed in a sterilized glass container and stored at 25 ± 2 ℃, relative humidity of 85 ±5%. All indexes were measured at 0, 3, 6, 9, 12, and 15 days. Pulp tissue samples of about 1 cm wide and 5 mm deep around the junction of diseased and healthy tissues around the wound, stored at -80 ℃ for subsequent use in the determination of various indexes. Effect of TA treatment on the growth and mycelial morphology of A. alternata Colony growth inhibition rate PDA medium without TA was used as control. A. alternata hyphal disc (7 mm) was inoculated on PDA medium containing different concentrations of TA (0.1, 0.2, 0.4, 0.8, 1.6, 2.0, 2.5, 3.2, 5.0, 7.5, 10.0, 12.5, 15.0 mg mL -1 ) for 7 d and cultured at 28 ℃. At day 7, the colony diameter of A. alternata was recorded using the cross method. The formula for calculating colony growth inhibition rate is as follows: Inhibition rate (%) = [d 0 - d t )/d 0 ] × 100% Where d 0 is the net growth in the control group and d t is the net growth in the TA treatment groups with different concentrations. Mycelial morphology TA concentrations below 5.0 mg mL -1 had little inhibitory effect on A. alternata mycelial growth (inhibition rate < 50%). Therefore, mycelial morphology was observed only at 5.0, 7.5, 10.0, 12.5, and 15.0 mg mL -1 TA. A. alternata hyphal discs (7 mm diameter) were inoculated on PDA medium with these five TA concentrations and cultured at 28 °C for 3 days. Morphology was observed under a microscope (Suzhou BTG Photoelectric Technology Co., Ltd.). Screening for the optimal concentration of TA for in vivo inhibition A . alternata Two wounds (5 mm deep × 5 mm wide) were made along the equator of the pear fruit with a sterile hole punch. The fruit were randomly divided into five groups, and 20 µL of 5.0, 7.5, 10.0, 12.5, and 15.0 mg mL -1 TA solution was injected into the wounds, respectively. After 30 min, 20 µL of a spore suspension containing 1 × 10 6 spores mL -1 was injected into each wound; after the solution was fully absorbed at room temperature, all fruit were placed in sterilized polyethylene bags and stored at 25 ± 2 ℃. The pathological changes in fragrant pear fruit were observed every day, and the diameter of disease spots was recorded on day 6. Each treatment was performed in triplicate, with 10 fruit per replicate. The inhibitory effect of TA on the development of fragrant pear fruit rot was calculated as follows: Control effect (%) = [(d 0 -d t )/d 0 ] × 100% Where d 0 and d t were lesion diameters in the control group and TA treatment group, respectively. Effect of TA treatment on FDI, CMP and MDA of Korla fragrant pears infected by A . alternata FDI was calculated according to the formula reported in Sun et al 1 8 . The disease severity was categorized into five degrees based on the proportion of the lesion area on the pear fruit: Grade 0 = no lesion; Grade 1 = disease spot area <25%; Grade 2 = 25% ≤ lesion area < 50%; Grade 3 = 50% ≤ lesion area < 75%; and Grade 4 = lesion area ≥75%. The following formula was used to determine the diseases index: ∑ (disease grade × number of fruit of this grade)/(highest disease grade × total number of fruit). CMP was determined using the method described in Lin et al 1 9 . MDA content (nmol g -1 ) was measured using the experimental method described in Lin et al 20 . Effect of TA treatment on endogenous TA content of Korla fragrant pears infected by A . alternata Endogenous TA content was determined according to the manufacturer’s instructions of the assay kit (Suzhou Grace Biotechnology Co., Ltd., Jiangsu, China). The results were expressed as mg g -1 . Effect of TA treatment on O 2 -· , H 2 O 2 , ·OH content s and ROS scavenging enzyme activity of Korla fragrant pears infected by A . alternata The O 2 -· , H 2 O 2 , and ·OH content (expressed in nmol g -1 , µg g -1 , and pg g -1 , respectively) was determined according to the manufacturer’s instructions of the assay kit (Enzyme Biotechnology, Co., Ltd., Shanghai, China). The activities of SOD, CAT, APX, and GR (expressed in U g −1 ) were determined according to the method introduced in the Enzyme Biotechnology, Co., Ltd., Shanghai, China. Effect of TA treatment on membrane phospholipid content and membrane phospholipid degradation product of Korla fragrant pears infected by A . alternata The PC, PI, PA, DAG, and FFAs content (expressed in pg g -1 , pg g -1 , nmol g -1 , ng g -1 , and nmol g -1 , respectively) was determined according to the protocol provided by Enzyme Biotechnology, Co., Ltd., Shanghai, China. Effect of TA treatment on phospholipid metabolic enzyme activity of Korla fragrant pears infected by A . alternata PLA2, PLD, PLC, lipase, LOX, and FADS activity (expressed in U g −1 ) was determined according to the method introduced in the Enzyme Biotechnology, Co., Ltd., Shanghai, China. Effect of TA treatment on membrane fatty acids content s, IUFA and U/S of Korla fragrant pears infected by A . alternata Two grams of frozen pear pulp was pulverized and mixed with 5 mL n-hexane. The mixture was extracted at 60 ℃ for 30 min, then cooled to room temperature and centrifuged at 10000 × g. The supernatant was dried with nitrogen gas, and 0.2 mL n-hexane was added to adjust the concentration to 0.5 mg mL -1 . Next, 0.2 mL of 0.5 mol L -1 sodium methoxide solution was added and shaken for 10 min. Then, 0.2 mL saturated sodium chloride solution was added, and the mixture was allowed to stratify. The supernatant was analyzed by GC-MS for 37 types of fatty acid methyl esters. The capillary column SP-2560 (100 m × 0.25 mm × 0.20 µm) was used by Agilent 7890B gas chromatographic spectrometer. The initial temperature of the chromatographic column was set at 140 ℃, held for 5 min, heated at 10 ℃ min -1 to 200 ℃, held for 30 min, and then heated at 4 ℃ min -1 to 240 ℃, held at this temperature for 19 min, a total of 70 min. Carrier gas: high purity helium, column flow rate 0.7 mL min -1 , inlet temperature 270 ℃. Mass spectrometry (Agilent 7000D) conditions: EI source 70 eV, ion source temperature 230 ℃, mass spectrum transmission line temperature 270 ℃, and quadrupole temperature 150 ℃. IUFA and U/S were calculated according to the previously reported formula Zhang et al. 2 1 : IUFA = ∑ (USFAs relative content × corresponding number of double bonds). qRT-PCR analysis According to the method of Tang et al. 2 2 , the gene relative expression of PbrFAD2, Pbr LOX, Pbrlipase , Pbr PLD, Pbr PLC, Pbr SOD, Pbr CAT, Pbr APX , and Pbr GR were analyzed using real-time fluorescence quantitative PCR. The design of specific primers is shown in Table 3, and these data were processed according to the 2 -△△Ct method. Statistical analyses Each experiment was repeated three times. Statistical significance was assessed using one-way ANOVA with Duncan’s multiple range test for multiple comparisons in SPSS 20.0. Data are presented as mean ± standard error. Graphs were plotted using Origin 2021. Abbreviations Alternaria alternata , A. alternata ; Ascorbic acid, AsA; Ascorbate peroxidase, APX ; 2,2’-Azinobis-(3-ethylbenzthiazoline-6-sulphonate), ABTS; Cell membrane permeability, CMP ; Catalase, CAT; Diacylglycerol, DAG; 1,1-Diphenyl-2-picrylhydrazyl radical 2,2-Diphenyl-1-(2,4,6-trinitrophenyl)hydrazyl, DPPH; Fruit disease index, FDI; Free fatty acids, FFAs; Fatty acids, FAs; Fatty acid desaturation enzymes, FADS; Glutathione, GSH; Glutathione reductase, GR; Hydrogen peroxide, H 2 O 2 ; Hydroxyl radicals, ·OH; Index of unsaturated fatty acids, IUFA; Lipoxygenase, LOX; Malondialdehyde, MDA; Phosphatidylcholine, PC; Phosphatidylinositol, PI; Phosphatidic acid, PA; Phospholipase A2, PLA2; Phospholipase C, PLC; Phospholipase D, PLD; Reactive oxygen species, ROS; Ratio of unsaturated fatty acids to saturated fatty acids, U/S; Saturated fatty acids, SFAs; Superoxide anion, O 2 - · ; Superoxide dismutase, SOD; Tannic acid, TA; Unsaturated fatty acids, USFAs Declarations Funding This work was supported by the National Science Foundation of China (32060561); The second group of Tianshan Talent Training Program (2023TSYCQNTJ0012); Bintuan Science and Technology Program (2022DB006, 2023CB007-14); Shihezi University Science and Technology Program (CXBJ202107); Eighth Division Science and Technology Program (2023TD02); The earmarked fund for XJARS-07. Author Contributions T.Y. : Conceptualization, Investigation, Methodology, Writing − original draft. Z.W. : Investigation, Methodology. Y.W. : Software, Data curation. S.T. : Software, Formal analysis. C.J. : Investigation. C.S. : Conceptualization, Supervision, Project administration, Validation. C.G. : Writing − review & editing, Conceptualization, Funding acquisition, Resources, Supervision, Formal analysis. Competing interests The authors declare no competing interests. Data Availability The datasets used during the current study are available from the corresponding author on reasonable request. References Sun, T. et al. Postharvest UV-C irradiation inhibits blackhead disease by inducing disease resistance and reducing mycotoxin production in ‘Korla’ fragrant pear ( Pyrus sinkiangensis ). Int. J. Food Microbiol . 362 , 109485 (2022). Yang, W. et al. Development of defense system and secondary metabolites of Korla fragrant pear during Alternaria alternata infection. Postharvest Biol. Technol . 212 , 112865 (2024). Guo, Z., Xie, W., Lu, J., Guo, X. & Zhao, L. Tannic Acid-based Metal Phenolic Networks for Bio-applications: A Review. J. Mater. Chem. B . 9 20 (2021 ) . Pizzi, A. Tannins medical / pharmacological and related applications: A critical review. Sustainable Chem. Pharm . 22 , 100481 (2021 ) . Soares, S., Brando, E., Guerreiro, C., Soares, S. & Freitas, V. D. Tannins in Food: Insights into the Molecular Perception of Astringency and Bitter Taste. Molecules . 25 (11), 2590 (2020 ) . Farha, A. K. et al. Tannins as an alternative to antibiotics. Food Biosci . 38 , 100751 (2020). Zhu, C., Lei, M., Andargie, M., Zeng, J. & Li, J. Antifungal activity and mechanism of action of tannic acid against Penicillium digitatum . Physiol. Mol. Plant Pathol . 107 , 46-50 (2019). Thuy. et al. Antibacterial activity of tannins isolated from Sapium baccatum extract and use for control of tomato bacterial wilt. PLOS ONE . 12 (7) , e0181499 (2017 ) . Wang, Y. et al. Exogenous tannic acid relieves imidacloprid-induced oxidative stress in tea tree by activating antioxidant responses and the flavonoid biosynthetic pathway. Ecotoxicol. Environ. Saf . 266 , 115557 (2023). He, M. et al. Alleviation of pericarp browning in harvested litchi fruit by synephrine hydrochloride in relation to membrane lipids metabolism. Postharvest Biol. Technol . 166 , 111223 (2020). He, Y. et al. Fatty acid metabolic flux and lipid peroxidation homeostasis maintain the biomembrane stability to improve citrus fruit storage performance. Food Chem . 292 , 314-324 (2019). Lin, Y. et al. Hydrogen peroxide-induced changes in activities of membrane lipids-degrading enzymes and contents of membrane lipids composition in relation to pulp breakdown of longan fruit during storage. Food Chem . 297 , 124955 (2019). Gong, D. et al. Benzothiadiazole treatment inhibits membrane lipid metabolism and straight-chain volatile compound release in Penicillium expansum -inoculated apple fruit. Postharvest Biol. Technol . 181 , 111671 (2021). Guo, M. et al. Ferulic acid enhanced resistance against blue mold of Malus domestica by regulating reactive oxygen species and phenylpropanoid metabolism. Postharvest Biol. Technol . 202 , 112378 (2023). Sang, Y. et al. Influences of low temperature on the postharvest quality and antioxidant capacity of winter jujube ( Zizyphus jujuba Mill. cv. Dongzao). LWT--Food Sci. Technol . 154 , 112876 (2022). Tian, S., Qin, G. & Li, B. Reactive oxygen species involved in regulating fruit senescence and fungal pathogenicity. Plant Mol. Biol . 82 (6) , 593-602 (2013). Lin, Y. et al. Melatonin decreases resistance to postharvest green mold on citrus fruit by scavenging defense-related reactive oxygen species. Postharvest Biol. Technol . 153 , 21-30 (2019). Sun, P. et al. Proteomic analysis of ‘Korla’ fragrant pear responsed during early infection of Alternaria alternata . Sci. Hortic . 314 , 111951 (2023). Lin, L. et al. Metabolisms of ROS and membrane lipid participate in Pestalotiopsis microspora -induced disease occurrence of harvested Chinese olives. Postharvest Biol. Technol . 210 , 112720 (2024). Lin, Y. et al. The roles of metabolism of membrane lipids and phenolics in hydrogen peroxide-induced pericarp browning of harvested longan fruit. Postharvest Biol. Technol . 111 , 53-61 (2016). Zhang, S. et al. Lasiodiplodia theobromae (Pat.) Griff. & Maubl.-induced disease development and pericarp browning of harvested longan fruit in association with membrane lipids metabolism. Food Chem . 244 , 93-101 (2018). Tang, Y. et al. Induction of luteolin on postharvest color change and phenylpropanoid metabolism pathway in winter jujube fruit ( Ziziphus jujuba Mill. cv. Dongzao). Plant Physiol. Biochem . 215 , 108984 (2024). Sun, T. et al. Alternaria alternata stimulates blackhead disease development of ‘Korla’ fragrant pear ( Pyrus bretschneideri Rehd) by regulating energy status and respiratory metabolism. Postharvest Biol. Technol . 202 , 112386 (2023). Payne, D. E., Martin, N. R., Parzych, K. R., Rickard, A. H. & Boles, B. R. Tannic acid inhibits Staphylococcus aureus surface colonization in an IsaA-dependent manner. Infect. Immun . 81 (2) , 496-504 (2013). Hancock, V., Dahl, M., Vejborg, R. M. & Klemm, P. Dietary plant components ellagic acid and tannic acid inhibit Escherichia coli biofilm formation. J. Med. Microbiol . 59 (4) , 496-498 (2010). Perelshtein, I. et al. Tannic acid NPs – Synthesis and immobilization onto a solid surface in a one-step process and their antibacterial and anti-inflammatory properties. Ultrason. Sonochem . 21 (6) , 1916-1920 (2014). Wang, H. et al. Tannic acid exerts antifungal activity in vitro and in vivo against Alternaria alternata causing postharvest rot on apple fruit. Postharvest Biol. Technol. 125 , 102012 (2023). Yang, W. et al. MeJA and MeSA alleviate black rot in winter jujube caused by Alternaria tenuissima by regulating membrane lipid and reactive oxygen metabolism. Postharvest Biol. Technol . 219 , 113275 (2025). He, L. et al. Improving fermentation, protein preservation and antioxidant activity of Moringa oleifera leaves silage with gallic acid and tannin acid. Bioresour. Technol . 297 , 122390 (2020). Liu, T. et al. Clothianidin loaded TA/Fe (III) controlled-release granules: improve pesticide bioavailability and alleviate oxidative stress. J. Hazard. Mater . 416 , 125861 (2021). Han, Z. et al. The Effect of Environmental pH during Trichothecium roseum (Pers.:Fr.) Link Inoculation of Apple Fruits on the Host Differential Reactive Oxygen Species Metabolism. Antioxidants . 10 (5) , 692 (2021). Shuai, L. et al. Role of phospholipase C in banana in response to anthracnose infection. Food Sci. Nutr. 8 (2) , 1038-1045 (2020). Wang, H. et al. The Changes in Metabolisms of Membrane Lipids and Phenolics Induced by Phomopsis longanae Chi Infection in Association with Pericarp Browning and Disease Occurrence of Postharvest Longan Fruit. J. Agric. Food Chem . 66 (48) , 12794-12804 (2018). Chen, Y. et al. Salicylic acid treatment suppresses Phomopsis longanae Chi -induced disease development of postharvest longan fruit by modulating membrane lipid metabolism. Postharvest Biol. Technol . 164 , 111168 2020. Xing, J., Chin, C.-K. Modification of fatty acids in eggplant affects its resistance to Verticilliumdahliae . Physiol. Mol. Plant Pathol . 56 (5) , 217-225 (2000). Cao, S., Yang, Z., Cai, Y. & Zheng, Y. Antioxidant enzymes and fatty acid composition as related to disease resistance in postharvest loquat fruit. Food Chem . 163 , 92-96 (2014). Eze, S. O. O.; Nwanguma, B. C. Effects of Tannin Extract from Gongronema latifolium Leaves on Lipoxygenase Cucumeropsis manii Seeds. J. Chem . 2013 (1) , 864095 (2013). Liu, H. et al. Allyl Isothiocyanate in the Volatiles of Brassica juncea Inhibits the Growth of Root Rot Pathogens of Panax notoginseng by Inducing the Accumulation of ROS. J. Agric. Food Chem . 69 (46) , 13713-13723 (2021). Li, Z. et al. The Jasmonic Acid Signaling Pathway is Associated with Terpinen-4-ol-Induced Disease Resistance against Botrytis cinerea in Strawberry Fruit. J. Agric. Food Chem . 69 (36) , 10678-10687 (2021). Tables Table 1 Effects of different concentrations of TA treatment on lesion development by A. alternata inoculated fragrant pear fruit. TA (g L -1 ) Lesion diameter (mm) Control effect (%) 0 12.70 ± 0.36 a - 5.0 7.12 ± 0.22 b 43.94 ± 2.76 a 7.5 6.69 ± 0.34 c 47.32 ± 3.39 b 10.0 5.92 ± 0.24 d 53.39 ± 0.68 c 12.5 5.97 ± 0.12 d 52.99 ± 1.99 c 15.0 6.08 ± 0.14 d 52.13 ± 2.00 c Talbe. 2 Content of fatty acids in the Korla fragrant pear samples. Fatty acids Fatty acids content (μg g -1 ) 0 d 3d 6d 9d 12d 15d CK Aa TA CK Aa TA CK Aa TA CK Aa TA CK Aa TA Palmitic acid (C 16:0 ) 30.85 ±0.72 a 34.53 ±0.96 a 38.21 ±0.87 a 36.16 ±0.26 a 35.96 ±0.33 a 29.77 ±0.91 b 37.72 ±0.34 a 40.32 ±0.66 b 46.21 ±0.33 a 42.14 ±0.87 b 41.28 ±0.37 b 50.12 ±0.27 a 39.11 ±0.37 b 41.88 ±0.87 c 58.85 ±0.48 a 51.32 ±0.55 b Heptadecanoic acid (C 17:0 ) 1.64 ±0.10 a 1.98 ±0.04 b 1.94 ±0.03 b 2.95 ±0.02 a 2.09 ±0.06 b 2.42 ±0.03 a 1.80 ±0.06 c 2.65 ±0.05 b 3.15 ±0.07 a 2.84 ±0.04 b 2.76 ±0.07 b 2.65 ±0.05 b 2.90 ±0.06 a 2.84 ±0.07 b 3.74 ±0.05 a 2.73 ±0.06 b Stearic acid (C 18:0 ) 3.82 ±0.11 a 4.28 ±0.12 b 5.25 ±0.16 a 4.16 ±0.17 b 5.15 ±0.19 b 5.25 ±0.15 b 5.86 ±0.26 a 6.28 ±0.16 c 8.56 ±0.24 a 7.12 ±0.16 b 5.44 ±0.14 c 8.35 ±0.19 a 6.07 ±0.21 b 6.99 ±0.17 c 9.54 ±0.19 a 7.95 ±0.18 b Eicosanoic acid (C 20:0 ) 1.23 ±0.05 a 1.46 ±0.05 b 1.97 ±0.03 a 1.44 ±0.03 b 1.67 ±0.02 a 1.43 ±0.01 b 1.23 ±0.02 c 1.49 ±0.02 c 2.16 ±0.05 a 1.96 ±0.05 b 1.76 ±0.03 b 2.54 ±0.05 a 1.87 ±0.03 b 1.37 ±0.03 a 0.99 ±0.03 b 1.26 ±0.02 a Oleic acid (C 18:1 ) 6.29 ±0.25 a 7.97 ±0.20 a 5.56 ±0.19 b 5.1 ±0.18 b 8.44 ±0.18 a 5.81 ±0.20 c 7.44 ±0.16 b 6.21 ±0.17 a 4.21 ±0.15 c 5.26 ±0.13 b 5.89 ±0.18 a 3.18 ±0.13 c 4.96 ±0.18 b 6.55 ±0.18 a 4.12 ±0.15 b 4.92 ±0.16 b Linoleic acid (C 18:2 ) 75.70 ±1.59 a 85.05 ±1.68 a 85.21 ±2.15 a 79.2 ±2.00 b 88.42 ±1.77 a 74.81 ±1.78 b 63.91 ±1.66 c 72.79 ±2.12 a 50.26 ±1.36 c 62.19 ±2.74 b 63.87 ±2.37 a 39.14 ±2.88 b 59.14 ±1.99 a 68.33 ±2.78 a 43.13 ±2.54 c 53.06 ±2.12 b Linolenic acid (C 18:3 ) 6.24 ±0.26 a 6.76 ±0.15 a 6.37 ±0.18 b 5.49 ±0.15 c 7.22 ±0.13 a 6.53 ±0.11 b 6.44 ±0.12 b 5.32 ±0.15 a 4.11 ±0.22 b 5.30 ±0.25 a 4.41 ±0.12 a 3.57 ±0.15 c 4.16 ±0.12 a 5.50 ±0.10 a 4.53 ±0.18 b 4.77 ±0.22 b U/S 2.35 ±0.05 a 2.36 ±0.03 a 2.05 ±0.03 b 2.01 ±0.04 b 2.32 ±0.02 a 2.24 ±0.02 a 1.67 ±0.05 b 1.66 ±0.02 a 0.98 ±0.04 c 1.35 ±0.03 b 1.45 ±0.03 a 0.72 ±0.05 b 1.37 ±0.02 a 1.51 ±0.02 a 0.71 ±0.05 c 0.99 ±0.03 b IUFA 1.40 ±0.02 a 1.40 ±0.03 a 1.35 ±0.01 a 1.34 ±0.02 a 1.39 ±0.02 a 1.39 ±0.02 a 1.24 ±0.02 a 1.24 ±0.01 a 0.99 ±0.02 c 1.15 ±0.03 b 1.17 ±0.01 a 0.84 ±0.02 b 1.15 ±0.01 a 1.20 ±0.02 a 0.83 ±0.01 c 1.00 ±0.02 b Note: Different letters (a, b, c) in the figure indicated that there were signifcant differences among the three treatment groups on the same day according to the Duncan multiple re test ( P < 0.05). T able 3 Primer sequences for qRT-PCR G ene G ene ID Primer sequence Actin Actin-7 F:CTCCCAGGGCTGTGTTTCCTA R:CTCCATGTCATCCCAGTTGCT PbrS OD LOC103953790 F:AGAGCAAGCCCAGAATCCTT R:TTGAACTTGATGGCGCTCTG Pbr CAT LOC125472895 F:CCTCGTGGTTTTGCAGTGAA R:CGAATAGGAAGGCGAACGTG Pbr APX LOC103934327 F:CAAGGAGCGTTCTGGATTCG R:CTTCGTCCGCAGCATAAGTC Pbr GR LOC103963516 F:GTACTGTTTGCCACTGGTCG R:ATCGCGGTAATCTGGTTTGC Pbr PLD LOC103966454 F:TTTGGGCAGAGCATACAGGA R:CGGAATAGCCTTCACCTTGC Pbr PLC LOC103963201 F:TGAAATTCCACAGCTACGCG R:ACCTCCTTCACGAACCTCTG Pbrlipase LOC103960045 F:TCATCTGGGGAGAGCATGAC R:ACTGTAGGGAGAGGGTCGAT Pbr LOX LOC103965359 F:AGGGTTTCTCTGCAGCTCAT R:TTCGAGTGTGACGGTCTTGA PbrFAD2 LOC103958977 F:TGCGCACCATTTGTTCTCAA R:CTTTCTTGGCACCCTCATCG Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 09 May, 2026 Reviews received at journal 07 May, 2026 Reviews received at journal 05 May, 2026 Reviewers agreed at journal 15 Apr, 2026 Reviewers agreed at journal 15 Apr, 2026 Reviewers agreed at journal 13 Apr, 2026 Reviewers invited by journal 06 Apr, 2026 Editor assigned by journal 06 Apr, 2026 Submission checks completed at journal 03 Apr, 2026 First submitted to journal 29 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9259312","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":619571863,"identity":"524fe49c-034e-4275-b08c-148ced84e35b","order_by":0,"name":"Yisong Tang","email":"","orcid":"","institution":"Shihezi University","correspondingAuthor":false,"prefix":"","firstName":"Yisong","middleName":"","lastName":"Tang","suffix":""},{"id":619571864,"identity":"9ba24eea-4f8d-49dc-b35f-f4bf3bee3d14","order_by":1,"name":"Weida Zhang","email":"","orcid":"","institution":"Shihezi University","correspondingAuthor":false,"prefix":"","firstName":"Weida","middleName":"","lastName":"Zhang","suffix":""},{"id":619571865,"identity":"67e2f2ed-8088-4213-9193-9e7a2a09015f","order_by":2,"name":"Wanting Yang","email":"","orcid":"","institution":"Shihezi University","correspondingAuthor":false,"prefix":"","firstName":"Wanting","middleName":"","lastName":"Yang","suffix":""},{"id":619571866,"identity":"d4169acb-341f-45d4-bf2c-8dd4b5a64f77","order_by":3,"name":"Tongrui Sun","email":"","orcid":"","institution":"Shihezi University","correspondingAuthor":false,"prefix":"","firstName":"Tongrui","middleName":"","lastName":"Sun","suffix":""},{"id":619571867,"identity":"606a2593-8758-41f8-99bd-ecb58864ce48","order_by":4,"name":"Jiankang Cao","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jiankang","middleName":"","lastName":"Cao","suffix":""},{"id":619571868,"identity":"bcea1cbe-79b9-4c6e-afdd-9125db0f31a7","order_by":5,"name":"Shaobo Cheng","email":"","orcid":"","institution":"Shihezi University","correspondingAuthor":false,"prefix":"","firstName":"Shaobo","middleName":"","lastName":"Cheng","suffix":""},{"id":619571869,"identity":"51432630-392b-4e74-9082-c964cb7e8a79","order_by":6,"name":"Guogang Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAt0lEQVRIiWNgGAWjYHACxgcJBjY8/PwNxGthNnhQkCYjOeMA8VrYBB98OGxj0JBApHr+/uXXGBIMzvMYMBxg/PAxhwgtEjfelAH9cpvHnLmBWXLmNiK0GEicSTcAabFsOMDGzEukljSJBINzPAYHEojVwt9+DKjlAAlaJG7wMAMdlswjOeNgM3F+4e8//vDhjz929vz8zQc/fCRGC4NEjgGUxdhAjHqQNccfEKlyFIyCUTAKRiwAAHS8OPigpDL0AAAAAElFTkSuQmCC","orcid":"","institution":"Shihezi University","correspondingAuthor":true,"prefix":"","firstName":"Guogang","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2026-03-29 13:55:41","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9259312/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9259312/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":106643389,"identity":"2dd8786c-4fa4-478f-8ce0-5ff5ced0fb41","added_by":"auto","created_at":"2026-04-10 19:05:40","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":6636073,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of 0.1, 0.2, 0.4, 0.8, 1.6, 2.0, 2.5, 3.2, 5.0, 7.5, 10.0, 12.5, and 15.0 mg mL\u003csup\u003e-1\u003c/sup\u003e TA on colony growth (A), colony diameter (B), and inhibition rate (C) of \u003cem\u003eA. alternata\u003c/em\u003e in vitro. Effects of 0, 5.0, 7.5, 10.0, 12.5, and 15.0 mg mL\u003csup\u003e-1\u003c/sup\u003e TA on mycelial morphology of \u003cem\u003eA. alternata\u003c/em\u003e in vitro (D-I). Values followed by different superscripts (a-i) are significantly different (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-9259312/v1/b244ee4d04b1d23d7ed922d9.png"},{"id":106643390,"identity":"78171156-e57d-499c-9c8d-6287bcdfe1c7","added_by":"auto","created_at":"2026-04-10 19:05:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1708361,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of 0, 5.0, 7.5, 10.0, 12.5, and 15.0 mg mL\u003csup\u003e-1\u003c/sup\u003e TA on the diameter lesions in infected with \u003cem\u003eA. alternata\u003c/em\u003e fragrant pear fruit on the day 6 (A). Effect of 10.0 mg mL\u003csup\u003e-1\u003c/sup\u003e TA on the diameter in lesions infected with \u003cem\u003eA. alternata\u003c/em\u003e fragrant pear fruit (B). Effect of 10.0 mg mL\u003csup\u003e-1\u003c/sup\u003e TA on the FDI in infected with \u003cem\u003eA. alternata\u003c/em\u003e fragrant pear fruit (C).\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-9259312/v1/fefac99202fdc90310a1927a.png"},{"id":106643391,"identity":"0dd943ca-d1de-484a-b9f3-2cd1a8298d39","added_by":"auto","created_at":"2026-04-10 19:05:40","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1323514,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of 10.0 mg mL\u003csup\u003e-1\u003c/sup\u003e TA on CMP (A), MDA contant (B), Endogenous TA content (C), O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-·\u003c/sup\u003e content (D), H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e content (E), ·OH content (F), SOD (G), CAT (H), APX (I), GR (J), Capability of eliminating ABTS radical (K), Capability of eliminating DPPH radical (L), AsA content (M), GSH content (N) in infected with \u003cem\u003eA. alternata\u003c/em\u003e fragrant pear fruit. Values followed by different superscripts (a-c) are significantly different (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05) at the same sampling time.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-9259312/v1/4af912f2e77f7343e1c71435.png"},{"id":106727604,"identity":"c304ffcb-2017-4522-828a-a2911e654c1d","added_by":"auto","created_at":"2026-04-12 18:39:28","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1399178,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of 10.0 mg mL\u003csup\u003e-1\u003c/sup\u003e TA on PC content (A), PI content (B), PA content (C), DAG content (D), FFAs content (E), PLA2 (F), PLC (G), PLD (H), Lipase (I), LOX (J) and FADS (K) in infected with \u003cem\u003eA. alternata\u003c/em\u003e fragrant pear fruit. Values followed by different superscripts (a-c) are significantly different (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05) at the same sampling time.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-9259312/v1/4ac397bbd4a98b500581e0b0.png"},{"id":106643393,"identity":"97599826-957c-4f94-9bc4-9ba9b4876dee","added_by":"auto","created_at":"2026-04-10 19:05:40","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3733284,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of 10.0 mg mL\u003csup\u003e-1\u003c/sup\u003e TA on relative expression of \u003cem\u003ePbrSOD\u003c/em\u003e (A), \u003cem\u003ePbrCAT\u003c/em\u003e (B), \u003cem\u003ePbrAPX\u003c/em\u003e (C), \u003cem\u003ePbrGR\u003c/em\u003e (D), \u003cem\u003ePbrPLC\u003c/em\u003e (E), \u003cem\u003ePbrPLD\u003c/em\u003e (F), \u003cem\u003ePbrlipase\u003c/em\u003e (G), \u003cem\u003ePbrLOX\u003c/em\u003e (H), and \u003cem\u003ePbrFAD2\u003c/em\u003e (I) in infected with \u003cem\u003eA. alternata\u003c/em\u003e fragrant pear fruit. Values followed by different superscripts (a-c) are significantly different (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05) at the same sampling time.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-9259312/v1/d8529033fc58cd994c104554.png"},{"id":106727235,"identity":"f97be595-0fd3-4d77-b488-bded7ff6b3d4","added_by":"auto","created_at":"2026-04-12 18:38:24","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2354196,"visible":true,"origin":"","legend":"\u003cp\u003eDiagram of the possible mechanism of TA delaying the development of fragrant pear blackhead disease, the upper arrow indicates the up-regulation of the indicator, the lower arrow indicates the inhibitory effect of the indicator, the red color indicates the role played by \u003cem\u003eA. alternata\u003c/em\u003e and the green color indicates the role played by TA.\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-9259312/v1/90976ef4e380dd13f979d127.png"},{"id":106643395,"identity":"43598ccc-590c-47eb-9f9d-a195c8adfe5c","added_by":"auto","created_at":"2026-04-10 19:05:40","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":2417143,"visible":true,"origin":"","legend":"\u003cp\u003eHeatmap of Pearson’s correlation based on the detected indicators in CK group fragrant pear fruit (A), \u003cem\u003eAa\u003c/em\u003e group fragrant pear fruit (B), and TA group fragrant pear fruit (C). Blue expresses negative correlation, and red expresses positive correlation, and the magnitude of the value indicates the degree of significance of the correlation.\u003c/p\u003e","description":"","filename":"image8.png","url":"https://assets-eu.researchsquare.com/files/rs-9259312/v1/2a04a3adb48e8f83c5f276b9.png"},{"id":106959583,"identity":"4d889c4e-e1f0-461d-9d99-3c53130a7c5a","added_by":"auto","created_at":"2026-04-15 09:11:50","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":23313793,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9259312/v1/45d31696-9470-4d0f-816c-3bec6f2c68d3.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Tannic acid enhances postharvest resistance of Korla fragrant pears to Alternaria alternata by modulating membrane lipid and reactive oxygen species metabolism","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIn recent years, blackhead disease has emerged in Korla fragrant pear (\u003cem\u003ePyrus bretschneideri\u003c/em\u003e Rehd) during large-scale storag\u003csup\u003e1\u003c/sup\u003e. This disease primarily affects the fruit calyx, starting with concentrated black spots that quickly spread to the core, causing lesions and extreme softening of the flesh. Eventually, a honeycomb-like black mycelial layer forms, accompanied by oozing viscous black juice, severely deteriorating storage qualit\u003csup\u003e2\u003c/sup\u003e. Effective and safe methods to manage this disease are urgently needed.\u003c/p\u003e\n\u003cp\u003eTannic acid (TA) \u0026ndash; a hydrolyzable polyphenol ubiquitously distributed in vascular plants \u0026ndash; exhibits particular promise through its multifaceted antimicrobial properties and GRAS (Generally Recognized As Safe) status in food applications\u003csup\u003e3\u003c/sup\u003e\u003csup\u003e,4\u003c/sup\u003e. The antimicrobial efficacy of TA primarily stems from its protein-denaturing capacity, which mediates astringent, antiviral, and antibacterial effects via structural disruption of microbial membranes and enzymes\u003csup\u003e5\u003c/sup\u003e. Numerous studies demonstrate TA\u0026rsquo;s broad-spectrum inhibitory effects against phytopathogens such as\u0026nbsp;\u003cem\u003ePhomopsis mangiferae\u003c/em\u003e,\u0026nbsp;\u003cem\u003eRalstonia solanacearum\u003c/em\u003e, and\u0026nbsp;\u003cem\u003ePenicillium digitatum\u003c/em\u003e, with particular efficacy in postharvest disease management\u003csup\u003e6\u003c/sup\u003e. Notably, Zhu et al\u003csup\u003e7\u003c/sup\u003e. reported 70% suppression of\u0026nbsp;\u003cem\u003ePenicillium digitatum\u003c/em\u003e-induced citrus green mold through TA application, while Thuy et al\u003csup\u003e8\u003c/sup\u003e. documented its bactericidal action against\u0026nbsp;\u003cem\u003eRalstonia solanacearum\u003c/em\u003e in tomato bacterial wilt. Beyond direct antimicrobial activity, TA\u0026rsquo;s antioxidant potential, attributed to its abundant phenolic hydroxyl groups and conjugated aromatic system, enables effective ROS scavenging and oxidative stress mitigation.\u003csup\u003e6\u003c/sup\u003e This function was exemplified by Wang et al\u003csup\u003e9\u003c/sup\u003e., who demonstrated that 10 mg L\u003csup\u003e-1\u003c/sup\u003e TA treatment enhanced antioxidant defenses and reduced ROS accumulation in tea plants under stress conditions. Despite these recognized properties, the potential of TA in managing postharvest diseases in horticultural products remains underexplored. This knowledge gap highlights the need to investigate TA\u0026rsquo;s regulatory mechanisms on both pathogen viability and host redox balance during fungal infection.\u003c/p\u003e\n\u003cp\u003eA substantial body of research has demonstrated that cell membrane damage is a primary factor contributing to postharvest diseases in fruit and vegetables\u003csup\u003e10\u003c/sup\u003e. The degradation of membrane lipids, coupled with diminished antioxidant capacity, compromises the structural integrity of cellular membranes, thereby accelerating the onset and progression of postharvest pathologies. Elevated membrane lipid metabolism results in the accumulation of SFAs and a corresponding loss of membrane fluidity and stability, which may further exacerbate disease development\u003csup\u003e1\u003c/sup\u003e\u003csup\u003e1\u003c/sup\u003e. For example, in peaches and longans treated with H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, increased activities of enzymes involved in membrane lipid metabolism lead to accelerated lipid breakdown and a more rapid deterioration of fruit quality\u003csup\u003e1\u003c/sup\u003e\u003csup\u003e2\u003c/sup\u003e. In contrast, suppression of LOX, PLD, and PLC activities in apples inoculated with\u0026nbsp;\u003cem\u003ePenicillium expansum\u003c/em\u003e has been shown to increase levels of PI and PC, reduce concentrations of SFAs and PA, preserve membrane integrity, and delay disease symptoms\u003csup\u003e1\u003c/sup\u003e\u003csup\u003e3\u003c/sup\u003e. The rapid production of ROS, commonly referred to as an oxidative burst, represents an early plant defense mechanism in response to pathogen invasion\u003csup\u003e1\u003c/sup\u003e\u003csup\u003e4\u003c/sup\u003e. However, excessive accumulation of ROS can induce lipid peroxidation, leading to irreversible damage to the cellular membrane system. Moreover, MDA, a secondary product of lipid peroxidation, can modify membrane constituents through protein cross-linking and structural denaturation, thereby compromising membrane integrity\u003csup\u003e1\u003c/sup\u003e\u003csup\u003e5\u003c/sup\u003e\u003csup\u003e,1\u003c/sup\u003e\u003csup\u003e6\u003c/sup\u003e. It has been documented that upon infection by\u0026nbsp;\u003cem\u003ePenicillium digitatum\u003c/em\u003e, apples exhibit significant ROS generation and MDA accumulation, resulting in plasma membrane disruption in fruit pulp and an increase in lesion expansion\u003csup\u003e1\u003c/sup\u003e\u003csup\u003e4\u003c/sup\u003e. Furthermore, Lin et al\u003csup\u003e1\u003c/sup\u003e\u003csup\u003e7\u003c/sup\u003e. demonstrated that\u0026nbsp;\u003cem\u003ePenicillium digitatum\u003c/em\u003e exacerbates disease progression in citrus fruits by suppressing the activity of ROS-scavenging enzymes, which contributes to sustained ROS accumulation.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eA. alternata\u003c/em\u003e, the primary pathogen responsible for Korla fragrant pear blackhead disease, induces membrane lipid peroxidation and compromises antioxidant capacity and fruit disease resistance\u003csup\u003e1,2\u003c/sup\u003e. However, research on how TA modulates pear resistance to\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e through regulating ROS levels and membrane lipid metabolism remains limited. This study examines the effects of TA treatment on the ROS production-scavenging system, key enzyme activities associated with membrane lipid metabolism, and changes in membrane fatty acid and phospholipid composition in infected fruit, offering novel insights into strategies for preventing blackhead disease and extending postharvest storage.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eEffect of TA treatment on the growth and mycelial morphology of \u003cem\u003eA. alternata\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the CK group (0 mg mL\u003csup\u003e-\u003c/sup\u003e\u0026sup1; TA), the fungal colony nearly covered the PDA plate after 7 days. TA inhibited\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e mycelial growth dose-dependently (Fig.\u0026nbsp;1A). At 10.0 mg mL\u003csup\u003e-\u003c/sup\u003e\u0026sup1; TA, mycelial diameter (25.73 mm) was significantly reduced compared to 5.0 mg mL\u003csup\u003e-\u003c/sup\u003e\u0026sup1; (31.43 mm), with no significant further reduction at higher concentrations (Fig.\u0026nbsp;1B). Inhibitory rates at 10.0, 12.5, and 15.0 mg mL\u003csup\u003e-\u003c/sup\u003e\u0026sup1; TA were no significant differences\u0026nbsp;(Fig.\u0026nbsp;1C). The dose-response relationship followed a logistic model, yielding a 7-day IC₅₀ of 3.86 mg mL⁻\u0026sup1;.\u003c/p\u003e\n\u003cp\u003eOptical microscopy revealed neat, sparsely branched mycelia at the colony edge in the CK group (Fig. 1D). In contrast, TA-treated mycelia appeared twisted, thinner, and more intertwined; this altered morphology was consistent across all tested concentrations (Fig. 1E-I). Collectively, TA treatment significantly altered\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e colony and mycelial growth.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eScreening for optimal concentration of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eTA\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;for in vivo inhibition of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eA\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e.\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;alternata\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTreatment with 10 mg mL\u003csup\u003e-1\u003c/sup\u003e TA significantly reduced\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e-induced lesion diameter in pear fruit by 53.39% compared to CK (Fig. 2A, Table 1). Higher TA concentrations did not further reduce lesions. Consequently, 10 mg mL\u003csup\u003e-1\u003c/sup\u003e TA was selected for subsequent analyses of ROS and membrane lipid metabolism.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect\u003c/strong\u003e\u003cstrong\u003es\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eTA\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;on\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eFDI\u003c/strong\u003e\u003cstrong\u003e,\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eCMP\u003c/strong\u003e\u003cstrong\u003e,\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eand\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eMDA of Korla fragrant pears infected by\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eA\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e.\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;alternata\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFDI increased throughout storage in all treated fragrant pear fruit (Fig. 2B\u0026ndash;C). Lesions were absent in the CK and TA groups during the first 3 days, after which FDI gradually increased. The\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group exhibited the highest FDI, reaching levels 2.02\u0026nbsp;times\u0026nbsp;higher than CK and 1.17\u0026nbsp;times\u0026nbsp;higher than TA by day 15.\u003c/p\u003e\n\u003cp\u003eCMP was lower in the TA group than in the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group. By day 15, CK group CMP reached only 66.00% of\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003egroup and 79.13% of TA group levels (Fig. 3A). MDA content increased slightly in CK group but sharply in\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group\u0026nbsp;during storage; TA treatment suppressed this accumulation (Fig.\u0026nbsp;3B). On day 12,\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group MDA content was 34.57% higher than CK\u0026nbsp;group and 12.61% higher than TA\u0026nbsp;group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect\u003c/strong\u003e\u003cstrong\u003es\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eTA\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;on\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eendogenous TA\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;content of Korla fragrant pears infected by\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eA\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e.\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003ea\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003elternata\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEndogenous TA content steadily decreased in the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group, whereas CK group fluctuated and TA group declined initially before increasing (Fig. 3C). The TA group maintained significantly higher endogenous TA than both CK and\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e groups at all timepoints except day 9. By day 15, TA content in the TA group exceeded CK group\u0026nbsp;by 30.71% and\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003egroup by 64.98%.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect\u003c/strong\u003e\u003cstrong\u003es\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eTA\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;on O\u003c/strong\u003e\u003cstrong\u003e\u003csub\u003e2\u003c/sub\u003e\u003c/strong\u003e\u003cstrong\u003e\u003csup\u003e-\u0026middot;\u003c/sup\u003e\u003c/strong\u003e\u003cstrong\u003e, H\u003c/strong\u003e\u003cstrong\u003e\u003csub\u003e2\u003c/sub\u003e\u003c/strong\u003e\u003cstrong\u003eO\u003c/strong\u003e\u003cstrong\u003e\u003csub\u003e2\u003c/sub\u003e\u003c/strong\u003e\u003cstrong\u003e, \u0026middot;OH content\u003c/strong\u003e\u003cstrong\u003es\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;and\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eROS scavenging enzyme activit\u003c/strong\u003e\u003cstrong\u003ey\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;of\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eKorla fragrant pears infected by\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eA\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e.\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;alternata\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe fragrant pear fruit inoculated with\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e showed higher O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-\u0026middot;\u003c/sup\u003e, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, and \u0026middot;OH content than the\u0026nbsp;CK\u0026nbsp;group, and all values showed an increasing trend\u0026nbsp;(Fig.\u0026nbsp;3D-F). Remarkably,\u0026nbsp;the O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-\u0026middot;\u003c/sup\u003e, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e,\u0026nbsp;and \u0026middot;OH content in\u003cem\u003e\u0026nbsp;\u003c/em\u003eTA group was 22.25%, 10.96%, and 10.34% lower than that in the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group, respectively, on day 15.\u003c/p\u003e\n\u003cp\u003eIn the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group, SOD and CAT activities peaked on day 9 and day 6, respectively, whereas in the TA group, peaks occurred later, on day 12 and day 9 (Fig. 3G-H). By day 15, SOD and CAT activities were 1.18 times and 1.17 times higher in the TA group than in the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group. APX activity in the CK group increased continuously (Fig.\u0026nbsp;3I), reaching levels 56.98% and 29.07% higher than in the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e and TA groups, respectively, on day 15. GR activity in the CK group reached 1.35 U g⁻\u0026sup1; on day 15; the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e and TA groups exhibited 65% and 87% of this activity level, respectively (Fig.\u0026nbsp;3J).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect\u003c/strong\u003e\u003cstrong\u003es\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eTA\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;on membrane phospholipid content\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eand\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003emembrane phospholipid degradation product\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eof Korla fragrant pears infected by\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eA\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e.\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;alternata\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe PC content in the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group was lower than in the TA group, except on days 9 and 12 (Fig. 4A). The PI content trend in fragrant pear fruit mirrored that of PC content (Fig. 4B). On day 15, PI content in the CK and TA groups was 111.79% and 85.52% higher, respectively, compared to the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group.\u003c/p\u003e\n\u003cp\u003eMembrane lipid degradation products (PA, DAG, FFAs) exhibited distinct accumulation patterns (Fig. 4C-E). PA content in the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group increased significantly until day 9, then declined sharply, falling 42.86% below TA\u0026nbsp;group by day 15 (Fig.\u0026nbsp;4C). DAG content was consistently higher in\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003egroup than TA\u0026nbsp;group, peaking at 39.43% higher (day 3) and 36.89% higher (day 9) (Fig.\u0026nbsp;4D). FFAs content increased during storage, with\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e showing the highest accumulation. TA treatment inhibited this increase, resulting in\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003egroup FFAs being 1.47\u0026nbsp;times\u0026nbsp;higher than CK and 1.25\u0026nbsp;times\u0026nbsp;higher than TA on day 15 (Fig.\u0026nbsp;4E).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eTA\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;on\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ethe\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003emembrane lipid metabolism enzyme\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eactivit\u003c/strong\u003e\u003cstrong\u003ey\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ein\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eof Korla fragrant pears infected by\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eA\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e.\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;alternata\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePhospholipase activities differed significantly among groups (Fig.\u0026nbsp;4F-H). On day 12, PLA2 activity in the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group exceeded CK\u0026nbsp;group\u0026nbsp;by 30.21% and TA\u0026nbsp;group\u0026nbsp;by 19.87%, while PLC activity showed similar trends, surpassing CK\u0026nbsp;group\u0026nbsp;by 60.00% and TA\u0026nbsp;group\u0026nbsp;by 26.73%. By day 15, PLD activity in the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group was 1.45-fold higher than CK\u0026nbsp;group\u0026nbsp;and 1.15-fold higher than TA\u0026nbsp;group.\u003c/p\u003e\n\u003cp\u003eLipase activity in the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group exceeded CK group\u0026nbsp;by 41.00% and TA group\u0026nbsp;by 15.03% on day 15 (Fig.\u0026nbsp;4I). LOX activity was consistently higher in\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003egroup, peaking at 29.81% above CK\u0026nbsp;group and 21.05% above TA\u0026nbsp;group on day 12 (Fig.\u0026nbsp;4J). Conversely, FADS activity peaked then declined (Fig.\u0026nbsp;4K), with\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group\u0026nbsp;reaching only 64.66% of CK and 72.81% of TA levels by day 15.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eTA\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;on the membrane fatty acid content, IUFA, and U/S level of Korla fragrant pears infected by\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eA\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e.\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;alternata\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSFAs\u0026nbsp;(C\u003csub\u003e16:0\u003c/sub\u003e, C\u003csub\u003e17:0\u003c/sub\u003e, C\u003csub\u003e18:0\u003c/sub\u003e) accumulated progressively during storage, while C\u003csub\u003e20:0\u003c/sub\u003e peaked then declined (Table 2). Conversely, key USFAs (C\u003csub\u003e18:1\u003c/sub\u003e, C\u003csub\u003e18:2\u003c/sub\u003e, C\u003csub\u003e18:3\u003c/sub\u003e) decreased throughout storage. Compared to CK\u0026nbsp;group, the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group exhibited elevated SFAs and reduced USFAs across all timepoints; TA treatment significantly mitigated these alterations.\u003c/p\u003e\n\u003cp\u003eBoth the U/S ratio and IUFA showed a decreasing trend during storage, especially after inoculation with\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e. TA treatment delayed this decline\u0026nbsp;(Table.\u0026nbsp;2). By day 15, the U/S ratio in the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group was 53.24% lower than the CK and 28.63% lower than the TA group. Similarly, IUFA was 30.49% lower than the CK and 16.38% lower than the TA group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of TA on gene relative expression of antioxidant and membrane lipid metabolism related enzymes\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eof Korla fragrant pears infected by\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eA\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e.\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;alternata\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInoculation with\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e induced significant upregulation of antioxidant-related genes (\u003cem\u003ePbrSOD, PbrCAT, PbrAPX\u003c/em\u003e, and\u0026nbsp;\u003cem\u003ePbrGR\u003c/em\u003e) during the early storage phase (days 0\u0026ndash;6) (Fig. 5). However, transcriptional levels of these genes in the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group exhibited a sharp decline starting at day 9, with expression values becoming significantly lower than those in both CK and TA groups by day 15. Gene expression patterns of membrane lipid metabolism-related enzymes closely paralleled their corresponding enzymatic activity trends. Pathogen inoculation markedly upregulated\u0026nbsp;\u003cem\u003ePbrPLC, PbrPLD, Pbrlipase\u003c/em\u003e, and\u0026nbsp;\u003cem\u003ePbrLOX\u003c/em\u003e expression while suppressing\u0026nbsp;\u003cem\u003ePbrFAD2\u003c/em\u003e. Especially on the 6th day, the expression levels of\u0026nbsp;\u003cem\u003ePbrPLC, PbrPLD, Pbrlipase\u003c/em\u003e and\u0026nbsp;\u003cem\u003ePbrLOX\u003c/em\u003e in\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group were 3.24 times, 3.09 times, 6.28 times, 5.48 times and 4.04 times, 1.64 times, 2.24 times and 1.41 times of CK and TA groups, respectively.\u0026nbsp;TA treatment significantly attenuated the decline in\u0026nbsp;\u003cem\u003ePbrFAD2\u003c/em\u003e expression throughout the experimental period.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e\u003cem\u003eA. alternata\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003eis a typical pathogenic fungus that produces\u003cem\u003e\u0026nbsp;A. alternata\u003c/em\u003e rot in a variety of fruits, which can result in major issues with food safety and financial losses\u003csup\u003e2\u003c/sup\u003e\u003csup\u003e3\u003c/sup\u003e. Research has demonstrated that TA, a naturally occurring polyphenol which originates from a variety of sources, is environmentally friendly, nontoxic, and has been proven to have wide-ranging antibacterial effects\u003csup\u003e2\u003c/sup\u003e\u003csup\u003e4,25,26\u003c/sup\u003e. Thus, TA was utilized as a bactericidal agent in this study to explore its influence on the prevention and control of fragrant pear postharvest blackhead disease and to clarify the antibacterial mechanism of TA from the perspective of ROS metabolism and membrane lipid metabolism. In the present study,\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e colon development was considerably reduced by TA (IC\u003csub\u003e50\u003c/sub\u003e = 3.86\u0026nbsp;mg mL\u003csup\u003e-1\u003c/sup\u003e). The growth inhibition rate of\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e was 67.71% at a TA concentration of 10\u0026nbsp;mg mL\u003csup\u003e-1\u003c/sup\u003e (Fig.\u0026nbsp;1C). Meanwhile,\u0026nbsp;TA caused changes in mycelial morphology, such as\u0026nbsp;with\u0026nbsp;more numerous and thinner mycelial branches\u0026nbsp;that were\u0026nbsp;intertwined mycelial branches (Fig.\u0026nbsp;1D-I). In addition, 10\u0026nbsp;mg mL\u003csup\u003e-1\u003c/sup\u003e TA significantly inhibited the expansion of the diameter of the disease spot on fragrant pear fruit, with a control effect of 53.39% (Fig.\u0026nbsp;2A and Table 1). Similarly, previous study reported that TA inhibits\u0026nbsp;\u003cem\u003ePenicillium digitatum\u003c/em\u003e infection in citrus fruit\u003csup\u003e7\u003c/sup\u003e. Furthermore, 5\u0026nbsp;mg mL\u003csup\u003e-1\u003c/sup\u003e TA decreased the incidence of apple fruit and strongly suppressed the growth of\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e mycelium in apples\u003csup\u003e27\u003c/sup\u003e. These results demonstrate that\u0026nbsp;TA\u0026nbsp;exhibits considerable potential for the prevention and control of postharvest blackhead disease in fragrant pears.\u0026nbsp;It should be noted that even in the in vitro antibacterial experiment on PDA plates, TA also exhibits a relatively high requirement for inhibitory concentration. This indicates its different mode of action from traditional synthetic bactericides. Specifically, TA does not act via a single highly lethal target but functions as a multi-target disruptor, reversibly binding to disrupt the membrane structure, enzyme function, and metal ion homeostasis of pathogenic bacteria. This mode necessitates reaching a certain critical concentration to achieve a better inhibitory effect. More importantly, the PDA culture medium itself emerges as an important interfering factor. Its abundant protein and polysaccharide components will non-specifically bind to and consume a large quantity of TA, leading to a significant decrease in the effective concentration of free TA compared to the added concentration. This can also be corroborated by the studies of Zhu et al.\u003csup\u003e7\u003c/sup\u003e and Wang et al.\u003csup\u003e27\u003c/sup\u003e\u003c/p\u003e\n\u003cp\u003eThe ROS burst represents an early defense response in plants, where pathogen invasion triggers massive ROS production that directly exerts toxic effects on pathogens while simultaneously functioning as crucial signaling molecules. These ROS modulate the activity of defense-related enzymes and regulate gene expression patterns, thereby enhancing disease resistance in fruit and vegetables\u003csup\u003e1\u003c/sup\u003e\u003csup\u003e9\u003c/sup\u003e. During the initial experimental phase,\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group\u0026nbsp;exhibited significant elevation in ROS levels (O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-\u0026middot;\u003c/sup\u003e, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, and \u0026middot;OH), indicating rapid activation of the fruit\u0026rsquo;s ROS-mediated defense mechanisms following pathogen challenge\u0026nbsp;(Fig. 3D-F). Notably, both\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e and TA groups demonstrated dramatic ROS accumulation after 6 days post-inoculation. This phenomenon can be attributed to the burst of ROS and the disruption of the antioxidant system induced by pathogen colonization, leading to diminished antioxidant enzyme activity and an impaired capacity to scavenge reactive oxygen species\u003csup\u003e2\u003c/sup\u003e\u003csup\u003e8\u003c/sup\u003e.\u0026nbsp;TA treatment effectively attenuated the ROS accumulation rate, potentially through its abundant phenolic hydroxyl groups that confer superior antioxidant properties. Intriguingly, our study revealed that TA application induced endogenous TA biosynthesis in fragrant pear fruits\u0026nbsp;(Fig. 3C).\u0026nbsp;This observation aligns with previous findings by\u0026nbsp;He et al.\u003csup\u003e2\u003c/sup\u003e\u003csup\u003e9\u003c/sup\u003e, who demonstrated that TA enhances storage quality in\u0026nbsp;\u003cem\u003eMoringa oleifera\u003c/em\u003e leaves by maintaining antioxidant capacity. Similarly, Liu et al.\u003csup\u003e30\u003c/sup\u003e reported that TA could enhance the free radical scavenging capacity of cucumber seedlings and induce the activities of antioxidant enzymes, such as SOD and CAT.\u0026nbsp;These studies demonstrate that exogenous TA treatment synergistically enhances the resistance of fragrant pear fruit to\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e by promoting the biosynthesis of endogenous TA and augmenting antioxidant capacity.\u003c/p\u003e\n\u003cp\u003ePlants possess sophisticated ROS-scavenging systems that regulate intracellular redox homeostasis, thereby minimizing oxidative damage and maintaining cellular integrity\u003csup\u003e1\u003c/sup\u003e\u003csup\u003e5\u003c/sup\u003e. The enzymatic antioxidant system, comprising SOD,\u0026nbsp;CAT,\u0026nbsp;APX, and GR,\u0026nbsp;forms the primary defense line in higher plants. SOD catalyzes the dismutation of O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-\u0026middot;\u003c/sup\u003e into H₂O₂ and O₂, while CAT subsequently decomposes H₂O₂ into H₂O and O₂, collectively mitigating ROS accumulation and protecting cellular membranes from oxidative damage\u003csup\u003e31\u003c/sup\u003e. Furthermore, GR and APX maintain ROS balance by regulating the AsA and GSH redox cycle in fruit\u003csup\u003e2\u003c/sup\u003e\u003csup\u003e2\u003c/sup\u003e.\u0026nbsp;In this study, the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group exhibited an initial rapid surge in ROS levels accompanied by transient upregulation of antioxidant enzyme activities and their relative gene expressions from day 0 to day 6. However, significant decline in the radical scavenging abilities of antioxidant enzyme activities were observed post-day 6, indicating that pathogen invasion initially activates antioxidant defenses but ultimately overwhelms the system as infection progresses. This progressive antioxidant system failure led to ROS overaccumulation and accelerated disease spread. In contrast, TA treatment modulated regulates the enzyme-based antioxidant system, effectively maintaining lower ROS levels.\u0026nbsp;These findings align with Wang et al.\u003csup\u003e9\u003c/sup\u003e, who demonstrated that TA can activate the antioxidant defense of tea plants by enhancing the activities of antioxidant enzymes such as SOD, POD, CAT, and APX, thereby suppressing ROS accumulation and improving stress tolerance.\u003c/p\u003e\n\u003cp\u003eExcessive ROS accumulation triggers membrane lipid peroxidation, ultimately compromising the structural and functional integrity of cellular membranes. Previous studies have documented that pathogen invasion induces phospholipid degradation, reduces membrane fluidity, disrupts cellular compartmentalization, and accelerates fruit deterioration\u003csup\u003e1\u003c/sup\u003e\u003csup\u003e9\u003c/sup\u003e. As fundamental components of membrane architecture, phospholipids not only maintain membrane fluidity and selective permeability but also participate in cellular signaling processes\u003csup\u003e2\u003c/sup\u003e\u003csup\u003e8\u003c/sup\u003e. Based on their cleavage specificity towards phospholipid ester bonds, phospholipases are classified into three major types: PLA, PLC, and PLD. These enzymes (PLA2, PLD, and PLC) hydrolyze membrane phospholipids (PI and PC) to generate PA and DAG while releasing FFAs. Notably, PA can activate NADPH oxidase activity, thereby promoting ROS generation and ultimately leading to membrane dysfunction\u003csup\u003e31\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e32\u003c/sup\u003e.\u0026nbsp;In present study,\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group\u0026nbsp;fragrant pears exhibited significant reductions in PC and PI contents accompanied by upregulated activities and gene expressions of PLA2, PLD, and PLC\u0026nbsp;(Figs. 4-5). These changes resulted in substantial accumulation of PA, DAG, and FFAs, accelerating\u0026nbsp;membrane disintegration and disease progression. However, TA treatment markedly attenuated these pathological trends, suggesting its capacity to inhibit phospholipase activities and related gene expressions, thereby suppressing phospholipid degradation.\u0026nbsp;This finding aligns with previous reports showing accelerated PC,\u0026nbsp;PI\u0026nbsp;degradation\u0026nbsp;and PA synthesis in longan fruits infected by\u0026nbsp;\u003cem\u003eLasiodiplodia theobromae\u003c/em\u003e and\u0026nbsp;\u003cem\u003ePhomopsis longanae\u003c/em\u003e, which elevated PLD, lipase, and LOX activities, subsequently promoting membrane peroxidation products and ROS accumulation\u003csup\u003e21\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e33\u003c/sup\u003e.\u0026nbsp;The research by Chen et al.\u003csup\u003e3\u003c/sup\u003e\u003csup\u003e4\u003c/sup\u003e also confirmed that inhibiting the PLD and PLC activities of the\u0026nbsp;\u003cem\u003ePhomopsis longanae\u003c/em\u003e-infected longans can delay the decomposition of PC and PI and maintain membrane integrity, which further corroborates our proposed mechanism.\u003c/p\u003e\n\u003cp\u003eA hallmark of membrane lipid peroxidation manifests as reduced IUFA in cellular membranes\u003csup\u003e20\u003c/sup\u003e. Fatty acids not only influence membrane structural integrity but also participate in plant systemic defense responses. Xing and Chin\u003csup\u003e3\u003c/sup\u003e\u003csup\u003e5\u003c/sup\u003e demonstrated that specific USFAs (C\u003csub\u003e16:1\u003c/sub\u003e, C\u003csub\u003e18:2\u003c/sub\u003e, C\u003csub\u003e18:3\u003c/sub\u003e) directly inhibit\u0026nbsp;\u003cem\u003eVerticillium dahliae\u003c/em\u003e growth, with elevated USFAs\u0026nbsp;levels enhancing eggplant resistance against pathogens. Similarly, Cao et al.\u003csup\u003e3\u003c/sup\u003e\u003csup\u003e6\u003c/sup\u003e reported that higher USFAs\u0026nbsp;contents (particularly C\u003csub\u003e18:2\u003c/sub\u003e and C\u003csub\u003e18:3\u003c/sub\u003e) reduced natural disease incidence in\u0026nbsp;\u0026lsquo;Qingzhong\u0026rsquo;\u0026nbsp;loquat fruit. In our study,\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group\u0026nbsp;exhibited significant IUFA reduction from day 6 post-inoculation\u0026nbsp;(Table 2), accompanied by an increase in FDI (Fig.\u0026nbsp;2C), progressive activation of lipase and LOX activities, and substantial alterations in the fatty acid profile.\u0026nbsp;These changes included the continuous depletion of USFAs\u0026nbsp;(C\u003csub\u003e18:1\u003c/sub\u003e, C\u003csub\u003e18:2\u003c/sub\u003e, C\u003csub\u003e18:3\u003c/sub\u003e) and the accumulation of SFAs (C\u003csub\u003e16:0\u003c/sub\u003e, C\u003csub\u003e17:0\u003c/sub\u003e, C\u003csub\u003e18:0\u003c/sub\u003e, C\u003csub\u003e20:0\u003c/sub\u003e) (Table 2). Conversely, TA treatment effectively suppressed lipase\u0026nbsp;and\u0026nbsp;LOX activation rates while maintaining higher FADS activity, thereby reducing USFA-to-SFA conversion. We propose that the underlying mechanism involves dual inhibition of LOX by TA: chelation of non-heme iron (Fe\u0026sup2;⁺\u0026nbsp;and\u0026nbsp;Fe\u0026sup3;⁺) at the catalytic center, which blocks oxygen binding, and antioxidant-mediated reduction of Fe\u0026sup3;⁺ to Fe\u0026sup2;⁺, disrupting the enzyme\u0026rsquo;s redox cycle\u003csup\u003e3\u003c/sup\u003e\u003csup\u003e7\u003c/sup\u003e. This LOX inhibition likely underlies TA\u0026rsquo;s capacity to decelerate fatty acid saturation and enhance\u0026nbsp;\u003cem\u003eA\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e\u003cem\u003e\u0026nbsp;alternata\u003c/em\u003e resistance in fragrant pears.\u0026nbsp;These observations align with Gong et al.\u003csup\u003e1\u003c/sup\u003e\u003csup\u003e3\u003c/sup\u003e, who demonstrated that by reducing the activities of LOX, PLD, and PLC in\u0026nbsp;\u003cem\u003ePenicillium expansum\u003c/em\u003e-infected apples, the accumulation of PA could be delayed while maintaining the levels of PC, PI, and USFAs, thereby preserving membrane integrity and disease resistance.\u0026nbsp;Our findings collectively propose that TA-mediated LOX suppression represents a critical strategy for mitigating membrane peroxidation and enhancing postharvest pathogen resistance in fruit and vegetables.\u0026nbsp;As shown in Fig. 6, the proposed mechanism framework highlights the dual role of TA in regulating membrane lipid metabolism and ROS homeostasis to counteract\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e philoxeroides infection.\u003c/p\u003e\n\u003cp\u003eCMP and MDA contents are usually used to assess the structural integrity of cell membranes and the degree of membrane lipid peroxidation\u003csup\u003e2\u003c/sup\u003e\u003csup\u003e8\u003c/sup\u003e. The CMP and MDA contents in the TA-treated fruits were both lower than those in the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group, indicating that TA treatment significantly maintained cell membrane integrity and reduced membrane lipid peroxidation. Additionally, the correlation analysis in the\u0026nbsp;\u003cem\u003eAa\u003c/em\u003e group showed that the contents of PC and PI were negatively correlated with H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (r = -0.90; r = -0.84), O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026middot;-\u003c/sup\u003e production rate (r = -0.91; r = -0.87), \u0026middot;OH (r = -0.85; r = -0.87), MDA (r = -0.87; r = -0.69), CMP (r = -0.79; r = -0.75), LOX (r = -0.70; r = -0.72), Lipase (r = -0.79; r = -0.87), PLD (r = -0.35; r = -0.55), PLC (r = -0.51; r = -0.64), and PLA2 (r = -0.51; r = -0.64). In contrast, the contents of DAG and FFAs were positively correlated with these indicators (Fig.\u0026nbsp;7). The endogenous TA content was negatively correlated with FDI (r = -0.89), H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (r = -0.99), O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026middot;-\u003c/sup\u003e production rate (r = -0.98), \u0026middot;OH (r = -0.96), MDA (r = -0.96), and CMP (r = -0.94), while positively correlated with PC (r = 0.86) and PI (r = 0.82). In this study, TA treatment maintained relatively low CMP, MDA, and ROS contents, while the activities of antioxidant enzymes were relatively high. At the same time, TA treatment inhibited the activities of membrane lipid oxidation-related enzymes such as LOX, LPS, PLD, and PLC, maintained high contents of endogenous TA and membrane phospholipids, enhanced resistance to Alternaria, and thus significantly reduced FDI.\u003c/p\u003e\n\u003cp\u003eTo effectively induce the disease resistance of Korla fragrant pears, a relatively high concentration of exogenous TA (10 mg mL\u003csup\u003e-1\u003c/sup\u003e) is requisite. This phenomenon is primarily ascribed to its mode of action as an inducer and the constraints in practical application. Firstly, as an inducer, TA can activate the intricate ROS and membrane lipid metabolism defense network within Korla fragrant pears, which necessitates reaching a critical signal intensity threshold\u003csup\u003e38,39\u003c/sup\u003e. Secondly, the physicochemical properties of TA impede its efficiency during application. It readily binds non - specifically to organic matrices at fruit wounds, and its relatively large molecular weight (1700 Da) restricts its penetration into the tissue. This is directly corroborated by our endogenous TA content data (0.06-0.15 mg g\u003csup\u003e-1\u003c/sup\u003e), indicating that the majority of TA is consumed before reaching the target site. Therefore, a higher exogenous treatment concentration is essential to overcome these losses and ensure that there are sufficient active molecules to initiate plant defense. This understanding also indicates future optimization directions. By modifying TA (such as via nano-encapsulation or preparing metal complexes), its stability, targeting, and penetration efficiency can be improved, which is anticipated to significantly reduce its effective application concentration.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003ePreparation of fruit materials, spore suspension, and\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eTA\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;reagent\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe pathogenic fungus\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e, previously isolated by our group, was activated and cultured in PDA medium at 28 \u0026deg;C and relative humidity of 70\u0026nbsp;\u0026plusmn;\u0026nbsp;5%\u0026nbsp;for 7 days. Spores were collected by scraping with a sterile glass rod, filtered through sterile gauze, and adjusted to a concentration of\u0026nbsp;10\u003csup\u003e6\u003c/sup\u003e spores mL\u003csup\u003e-1\u003c/sup\u003e for storage.\u003c/p\u003e\n\u003cp\u003eKorla fragrant pears harvested in September 2023 (Korla, Xinjiang, China) were transported to Shihezi University\u0026rsquo;s postharvest laboratory. Uniform, defect-free fruit were surface-sterilized with 2% (v/v) sodium hypochlorite (2 min), rinsed with sterile distilled water, and air-dried. Based on preliminary efficacy screening, 10 mg mL\u003csup\u003e-\u003c/sup\u003e\u0026sup1; TA was selected for treatment. Four equidistant wounds (5 mm diameter \u0026times; 5 mm depth) were created per fruit equator using a sterile borer.\u0026nbsp;The 240 fruit were divided into three groups: (1) control\u0026nbsp;check (CK)\u0026nbsp;group, in which each wound was injected with 20 \u0026micro;L sterile distilled water and then injected with 20 \u0026micro;L sterile distilled water 30 min later; (2)\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e (\u003cem\u003eAa\u003c/em\u003e)\u0026nbsp;group, in which each wound was first injected with 20 \u0026micro;L of sterile distilled water and then with 20 \u0026micro;L of spore suspension (1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e spores mL\u003csup\u003e-1\u003c/sup\u003e) after 30 min; and (3)\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e+TA\u0026nbsp;(TA)\u0026nbsp;group, in which each wound was first injected with 20 \u0026micro;L of 10\u0026nbsp;mg mL\u003csup\u003e-1\u003c/sup\u003e TA solution and then with 20 \u0026micro;L of spore suspension (1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e spores mL\u003csup\u003e-1\u003c/sup\u003e) at 30 min later. After the solution was completely absorbed, the fragrant pear fruit was placed in a sterilized glass container and stored at 25 \u0026plusmn; 2 ℃, relative humidity of 85\u0026nbsp;\u0026plusmn;5%.\u0026nbsp;All\u0026nbsp;indexes were measured at 0, 3, 6, 9, 12, and 15 days. Pulp tissue samples of about 1 cm wide and 5 mm deep\u0026nbsp;around\u0026nbsp;the junction of diseased and healthy tissues around the wound, stored at -80 ℃ for subsequent use in the determination of various indexes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of TA treatment on the growth and mycelial morphology of \u003cem\u003eA. alternata\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eColony growth inhibition rate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePDA medium without TA was used as control.\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e hyphal disc (7 mm) was inoculated on PDA medium containing different concentrations of TA (0.1, 0.2, 0.4, 0.8, 1.6, 2.0, 2.5, 3.2, 5.0, 7.5, 10.0, 12.5, 15.0\u0026nbsp;mg mL\u003csup\u003e-1\u003c/sup\u003e) for 7 d and cultured at 28 ℃.\u0026nbsp;At\u0026nbsp;day\u0026nbsp;7, the colony diameter of\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e was recorded using the cross method. The formula for calculating colony growth inhibition rate is as follows:\u003c/p\u003e\n\u003cp\u003eInhibition rate (%) =\u0026nbsp;[d\u003csub\u003e0\u003c/sub\u003e -\u0026nbsp;d\u003csub\u003et\u003c/sub\u003e)/d\u003csub\u003e0\u003c/sub\u003e] \u0026times; 100%\u003c/p\u003e\n\u003cp\u003eWhere d\u003csub\u003e0\u003c/sub\u003e is the net growth in the control group and d\u003csub\u003et\u003c/sub\u003e is the net growth in the TA treatment groups with different concentrations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMycelial morphology\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTA concentrations below 5.0 mg mL\u003csup\u003e-1\u003c/sup\u003e had little inhibitory effect on\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e mycelial growth (inhibition rate \u0026lt; 50%). Therefore, mycelial morphology was observed only at 5.0, 7.5, 10.0, 12.5, and 15.0 mg mL\u003csup\u003e-1\u003c/sup\u003e TA.\u0026nbsp;\u003cem\u003eA. alternata\u003c/em\u003e hyphal discs (7 mm diameter) were inoculated on PDA medium with these five TA concentrations and cultured at 28 \u0026deg;C for 3 days. Morphology was observed under a microscope\u0026nbsp;(Suzhou BTG Photoelectric Technology Co., Ltd.).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eScreening for the optimal concentration of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eTA\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;for in vivo inhibition\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eA\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e.\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;alternata\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTwo wounds (5 mm deep \u0026times; 5 mm wide) were made along the equator of the pear\u0026nbsp;fruit\u0026nbsp;with a sterile hole punch. The\u0026nbsp;fruit\u0026nbsp;were randomly divided into five groups, and 20 \u0026micro;L of 5.0, 7.5, 10.0, 12.5, and 15.0\u0026nbsp;mg mL\u003csup\u003e-1\u003c/sup\u003e TA solution was injected into the wounds, respectively. After 30 min, 20 \u0026micro;L of a spore suspension containing 1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e spores mL\u003csup\u003e-1\u003c/sup\u003e was injected into each wound; after the solution was fully absorbed at room temperature, all\u0026nbsp;fruit\u0026nbsp;were placed in sterilized polyethylene bags\u0026nbsp;and stored at 25 \u0026plusmn; 2\u0026nbsp;℃. The pathological changes in fragrant pear\u0026nbsp;fruit\u0026nbsp;were observed every day, and the diameter of disease spots was recorded on day 6. Each treatment was performed in triplicate, with 10\u0026nbsp;fruit per replicate. The inhibitory effect of TA on the development of fragrant pear fruit rot was calculated as follows:\u003c/p\u003e\n\u003cp\u003eControl effect (%) = [(d\u003csub\u003e0\u003c/sub\u003e-d\u003csub\u003et\u003c/sub\u003e)/d\u003csub\u003e0\u003c/sub\u003e] \u0026times; 100%\u003c/p\u003e\n\u003cp\u003eWhere d\u003csub\u003e0\u003c/sub\u003e and d\u003csub\u003et\u003c/sub\u003e were lesion diameters in the control group and TA treatment group, respectively.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of TA\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003etreatment\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eon FDI, CMP and MDA of Korla fragrant pears infected by\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eA\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e.\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;alternata\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFDI was calculated according to the formula reported in Sun et al\u003csup\u003e1\u003c/sup\u003e\u003csup\u003e8\u003c/sup\u003e. The disease severity was categorized into five degrees based on the proportion of the lesion area on the pear fruit: Grade 0 = no lesion; Grade 1 = disease spot area \u0026lt;25%; Grade 2 = 25% \u0026le; lesion area \u0026lt; 50%; Grade 3 = 50% \u0026le; lesion area \u0026lt; 75%; and Grade 4 = lesion area \u0026ge;75%. The following formula was used to determine the diseases index:\u0026nbsp;\u0026sum;\u0026nbsp;(disease grade \u0026times; number of\u0026nbsp;fruit\u0026nbsp;of this grade)/(highest disease grade \u0026times; total number of\u0026nbsp;fruit).\u003c/p\u003e\n\u003cp\u003eCMP was determined using the method described in Lin et al\u003csup\u003e1\u003c/sup\u003e\u003csup\u003e9\u003c/sup\u003e.\u0026nbsp;MDA content (nmol g\u003csup\u003e-1\u003c/sup\u003e) was measured using the experimental method described in Lin et al\u003csup\u003e20\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of TA\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003etreatment\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;on\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eendogenous TA\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003econtent of Korla fragrant pears infected by\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eA\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e.\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;alternata\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEndogenous TA content\u0026nbsp;was determined according to the manufacturer\u0026rsquo;s instructions of the assay kit (Suzhou Grace Biotechnology Co., Ltd.,\u0026nbsp;Jiangsu, China). The results were expressed as mg\u0026nbsp;g\u003csup\u003e-1\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of TA\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003etreatment\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;on O\u003c/strong\u003e\u003cstrong\u003e\u003csub\u003e2\u003c/sub\u003e\u003c/strong\u003e\u003cstrong\u003e\u003csup\u003e-\u0026middot;\u003c/sup\u003e\u003c/strong\u003e\u003cstrong\u003e, H\u003c/strong\u003e\u003cstrong\u003e\u003csub\u003e2\u003c/sub\u003e\u003c/strong\u003e\u003cstrong\u003eO\u003c/strong\u003e\u003cstrong\u003e\u003csub\u003e2\u003c/sub\u003e\u003c/strong\u003e\u003cstrong\u003e, \u0026middot;OH content\u003c/strong\u003e\u003cstrong\u003es\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eand\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eROS scavenging enzyme activity\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eof Korla fragrant pears infected by\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eA\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e.\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;alternata\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-\u0026middot;\u003c/sup\u003e, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, and \u0026middot;OH content (expressed in nmol g\u003csup\u003e-1\u003c/sup\u003e, \u0026micro;g g\u003csup\u003e-1\u003c/sup\u003e, and pg g\u003csup\u003e-1\u003c/sup\u003e, respectively) was determined according to the manufacturer\u0026rsquo;s instructions of the assay kit (Enzyme Biotechnology, Co., Ltd., Shanghai, China).\u003c/p\u003e\n\u003cp\u003eThe activities\u0026nbsp;of SOD,\u0026nbsp;CAT,\u0026nbsp;APX,\u0026nbsp;and\u0026nbsp;GR (expressed in U g\u003csup\u003e\u0026minus;1\u003c/sup\u003e) were\u0026nbsp;determined according to the method introduced in the Enzyme Biotechnology, Co., Ltd., Shanghai, China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of TA\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003etreatment\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;on membrane phospholipid content and membrane phospholipid\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003edegradation product of Korla fragrant pears infected by\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eA\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e.\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;alternata\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe PC, PI, PA, DAG, and FFAs\u0026nbsp;content (expressed in pg g\u003csup\u003e-1\u003c/sup\u003e, pg g\u003csup\u003e-1\u003c/sup\u003e, nmol g\u003csup\u003e-1\u003c/sup\u003e, ng g\u003csup\u003e-1\u003c/sup\u003e, and nmol g\u003csup\u003e-1\u003c/sup\u003e, respectively) was determined according to the protocol provided by Enzyme Biotechnology, Co., Ltd., Shanghai, China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of TA\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003etreatment\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;on phospholipid metabolic enzyme activity\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eof Korla fragrant pears infected by\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eA\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e.\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;alternata\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePLA2, PLD, PLC, lipase, LOX, and FADS activity (expressed in U g\u003csup\u003e\u0026minus;1\u003c/sup\u003e) was determined according to the method introduced in the Enzyme Biotechnology, Co., Ltd., Shanghai, China.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of TA\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003etreatment\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;on membrane fatty acids\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003econtent\u003c/strong\u003e\u003cstrong\u003es, IUFA and U/S\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eof Korla fragrant pears infected by\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eA\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e.\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;alternata\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTwo grams of frozen pear pulp was pulverized and mixed with 5 mL n-hexane. The mixture was extracted at 60 ℃ for 30 min, then cooled to room temperature and centrifuged at 10000 \u0026times; g. The supernatant was dried with nitrogen gas, and 0.2 mL n-hexane was added to adjust the concentration to 0.5 mg mL\u003csup\u003e-1\u003c/sup\u003e. Next, 0.2 mL of 0.5 mol L\u003csup\u003e-1\u003c/sup\u003e sodium methoxide solution was added and shaken for 10 min. Then, 0.2 mL saturated sodium chloride solution was added, and the mixture was allowed to stratify. The supernatant was analyzed by GC-MS for 37 types of fatty acid methyl esters.\u003c/p\u003e\n\u003cp\u003eThe capillary column SP-2560 (100 m \u0026times; 0.25 mm \u0026times; 0.20 \u0026micro;m) was used by Agilent 7890B gas chromatographic spectrometer. The initial temperature of the chromatographic column was set at 140 ℃, held for 5 min, heated at 10 ℃\u0026nbsp;min\u003csup\u003e-1\u003c/sup\u003e to 200 ℃, held for 30 min, and then heated at 4 ℃\u0026nbsp;min\u003csup\u003e-1\u003c/sup\u003e to 240 ℃, held at this temperature for 19 min, a total of 70 min. Carrier gas: high purity helium, column flow rate 0.7\u0026nbsp;mL min\u003csup\u003e-1\u003c/sup\u003e, inlet temperature 270 ℃. Mass spectrometry\u0026nbsp;(Agilent 7000D)\u0026nbsp;conditions: EI source 70 eV,\u0026nbsp;ion source temperature 230 ℃,\u0026nbsp;mass spectrum transmission line temperature 270 ℃,\u0026nbsp;and quadrupole temperature 150 ℃.\u003c/p\u003e\n\u003cp\u003eIUFA and U/S were calculated according to the previously reported formula Zhang et al.\u003csup\u003e2\u003c/sup\u003e\u003csup\u003e1\u003c/sup\u003e:\u003c/p\u003e\n\u003cp\u003eIUFA\u0026nbsp;=\u0026nbsp;\u0026sum; (USFAs\u0026nbsp;relative content \u0026times; corresponding number of double bonds).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eqRT-PCR analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAccording to the method of Tang et al.\u003csup\u003e2\u003c/sup\u003e\u003csup\u003e2\u003c/sup\u003e, the\u0026nbsp;gene relative expression of\u0026nbsp;\u003cem\u003ePbrFAD2,\u003c/em\u003e \u003cem\u003ePbr\u003c/em\u003e\u003cem\u003eLOX,\u0026nbsp;\u003c/em\u003e\u003cem\u003ePbrlipase\u003c/em\u003e\u003cem\u003e,\u0026nbsp;\u003c/em\u003e\u003cem\u003ePbr\u003c/em\u003e\u003cem\u003ePLD,\u0026nbsp;\u003c/em\u003e\u003cem\u003ePbr\u003c/em\u003e\u003cem\u003ePLC,\u0026nbsp;\u003c/em\u003e\u003cem\u003ePbr\u003c/em\u003e\u003cem\u003eSOD,\u0026nbsp;\u003c/em\u003e\u003cem\u003ePbr\u003c/em\u003e\u003cem\u003eCAT,\u0026nbsp;\u003c/em\u003e\u003cem\u003ePbr\u003c/em\u003e\u003cem\u003eAPX\u003c/em\u003e, and\u0026nbsp;\u003cem\u003ePbr\u003c/em\u003e\u003cem\u003eGR\u003c/em\u003e were analyzed using real-time fluorescence quantitative PCR. The design of specific primers is shown in Table\u0026nbsp;3, and these data were processed according to the 2\u003csup\u003e-△△Ct\u003c/sup\u003e method.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analyses\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEach experiment was repeated three times. Statistical significance was assessed using one-way ANOVA with Duncan\u0026rsquo;s multiple range test for multiple comparisons in SPSS 20.0. Data are presented as mean \u0026plusmn; standard error. Graphs were plotted using Origin 2021.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003e\u003cem\u003eAlternaria alternata\u003c/em\u003e\u003cem\u003e,\u0026nbsp;\u003c/em\u003e\u003cem\u003eA. alternata\u003c/em\u003e;\u003cem\u003e\u0026nbsp;\u003c/em\u003eAscorbic acid, AsA;\u003cem\u003e\u0026nbsp;\u003c/em\u003eAscorbate peroxidase, APX\u003cem\u003e;\u0026nbsp;\u003c/em\u003e2,2\u0026rsquo;-Azinobis-(3-ethylbenzthiazoline-6-sulphonate),\u0026nbsp;ABTS;\u003cem\u003e\u0026nbsp;\u003c/em\u003eCell membrane permeability,\u0026nbsp;CMP\u003cem\u003e;\u0026nbsp;\u003c/em\u003eCatalase,\u0026nbsp;CAT;\u0026nbsp;Diacylglycerol,\u0026nbsp;DAG;\u0026nbsp;1,1-Diphenyl-2-picrylhydrazyl radical 2,2-Diphenyl-1-(2,4,6-trinitrophenyl)hydrazyl,\u0026nbsp;DPPH;\u0026nbsp;Fruit disease index,\u0026nbsp;FDI;\u0026nbsp;Free fatty acids,\u0026nbsp;FFAs;\u0026nbsp;Fatty acids,\u0026nbsp;FAs;\u0026nbsp;Fatty acid desaturation enzymes,\u0026nbsp;FADS;\u0026nbsp;Glutathione,\u0026nbsp;GSH;\u0026nbsp;Glutathione reductase,\u0026nbsp;GR;\u0026nbsp;Hydrogen peroxide,\u0026nbsp;H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e;\u0026nbsp;Hydroxyl radicals,\u0026nbsp;\u0026middot;OH;\u0026nbsp;Index of unsaturated fatty acids,\u0026nbsp;IUFA;\u0026nbsp;Lipoxygenase,\u0026nbsp;LOX;\u0026nbsp;Malondialdehyde,\u0026nbsp;MDA;\u0026nbsp;Phosphatidylcholine,\u0026nbsp;PC;\u0026nbsp;Phosphatidylinositol,\u0026nbsp;PI;\u0026nbsp;Phosphatidic acid,\u0026nbsp;PA;\u0026nbsp;Phospholipase A2,\u0026nbsp;PLA2;\u0026nbsp;Phospholipase C,\u0026nbsp;PLC;\u0026nbsp;Phospholipase D,\u0026nbsp;PLD;\u0026nbsp;Reactive oxygen species,\u0026nbsp;ROS;\u0026nbsp;Ratio of unsaturated fatty acids to saturated fatty acids,\u0026nbsp;U/S; Saturated fatty acids,\u0026nbsp;SFAs;\u0026nbsp;Superoxide anion, O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-\u003c/sup\u003e\u003csup\u003e\u0026middot;\u003c/sup\u003e; Superoxide dismutase, SOD; Tannic acid, TA; Unsaturated fatty acids, USFAs\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Science Foundation of China (32060561); The second group of Tianshan Talent Training Program (2023TSYCQNTJ0012); Bintuan Science and Technology Program (2022DB006, 2023CB007-14); Shihezi University Science and Technology Program (CXBJ202107); Eighth Division Science and Technology Program (2023TD02); The earmarked fund for XJARS-07.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eT.Y. : Conceptualization, Investigation, Methodology, Writing \u0026minus; original draft. Z.W. : Investigation, Methodology. Y.W. : Software, Data curation. S.T. : Software, Formal analysis. C.J. : Investigation. C.S. : Conceptualization, Supervision, Project administration, Validation. C.G. : Writing \u0026minus; review \u0026amp; editing, Conceptualization, Funding acquisition, Resources, Supervision, Formal analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSun, T. et al. Postharvest UV-C irradiation inhibits blackhead disease by inducing disease resistance and reducing mycotoxin production in \u0026lsquo;Korla\u0026rsquo; fragrant pear (\u003cem\u003ePyrus sinkiangensis\u003c/em\u003e). \u003cem\u003eInt. J. Food Microbiol\u003c/em\u003e. \u003cstrong\u003e\u003cem\u003e362\u003c/em\u003e\u003c/strong\u003e, 109485 (2022).\u003c/li\u003e\n\u003cli\u003eYang, W. et al. Development of defense system and secondary metabolites of Korla fragrant pear during \u003cem\u003eAlternaria alternata\u003c/em\u003e infection. \u003cem\u003ePostharvest Biol. Technol\u003c/em\u003e. \u003cstrong\u003e\u003cem\u003e212\u003c/em\u003e\u003c/strong\u003e, 112865 (2024).\u003c/li\u003e\n\u003cli\u003eGuo, Z., Xie, W., Lu, J., Guo, X. \u0026amp; Zhao, L. Tannic Acid-based Metal Phenolic Networks for Bio-applications: A Review. \u003cem\u003eJ. Mater. Chem. B\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e 20 (2021\u003cstrong\u003e)\u003c/strong\u003e. \u003c/li\u003e\n\u003cli\u003ePizzi, A. Tannins medical / pharmacological and related applications: A critical review. \u003cem\u003eSustainable Chem. Pharm\u003c/em\u003e. \u003cstrong\u003e\u003cem\u003e22\u003c/em\u003e\u003c/strong\u003e, 100481 (2021\u003cstrong\u003e)\u003c/strong\u003e. \u003c/li\u003e\n\u003cli\u003eSoares, S., Brando, E., Guerreiro, C., Soares, S. \u0026amp; Freitas, V. D. Tannins in Food: Insights into the Molecular Perception of Astringency and Bitter Taste. \u003cem\u003eMolecules\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e\u003cem\u003e25\u003c/em\u003e\u003c/strong\u003e (11), 2590 (2020\u003cstrong\u003e)\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eFarha, A. K. et al. Tannins as an alternative to antibiotics. \u003cem\u003eFood Biosci\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e38\u003c/strong\u003e, 100751 (2020). \u003c/li\u003e\n\u003cli\u003eZhu, C., Lei, M., Andargie, M., Zeng, J. \u0026amp; Li, J. Antifungal activity and mechanism of action of tannic acid against \u003cem\u003ePenicillium digitatum\u003c/em\u003e. \u003cem\u003ePhysiol. Mol. Plant Pathol\u003c/em\u003e. \u003cstrong\u003e107\u003c/strong\u003e, 46-50 (2019). \u003c/li\u003e\n\u003cli\u003eThuy. et al. Antibacterial activity of tannins isolated from \u003cem\u003eSapium baccatum\u003c/em\u003e extract and use for control of tomato bacterial wilt. \u003cem\u003ePLOS ONE\u003c/em\u003e. \u003cstrong\u003e12 (7)\u003c/strong\u003e, e0181499 (2017\u003cstrong\u003e)\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eWang, Y. et al. Exogenous tannic acid relieves imidacloprid-induced oxidative stress in tea tree by activating antioxidant responses and the flavonoid biosynthetic pathway. \u003cem\u003eEcotoxicol. Environ. Saf\u003c/em\u003e. \u003cstrong\u003e266\u003c/strong\u003e, 115557 (2023). \u003c/li\u003e\n\u003cli\u003eHe, M. et al. Alleviation of pericarp browning in harvested litchi fruit by synephrine hydrochloride in relation to membrane lipids metabolism. \u003cem\u003ePostharvest Biol. Technol\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e166\u003c/strong\u003e, 111223 (2020). \u003c/li\u003e\n\u003cli\u003eHe, Y. et al. Fatty acid metabolic flux and lipid peroxidation homeostasis maintain the biomembrane stability to improve citrus fruit storage performance. \u003cem\u003eFood Chem\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e292\u003c/strong\u003e, 314-324 (2019).\u003c/li\u003e\n\u003cli\u003eLin, Y. et al. Hydrogen peroxide-induced changes in activities of membrane lipids-degrading enzymes and contents of membrane lipids composition in relation to pulp breakdown of longan fruit during storage. \u003cem\u003eFood Chem\u003c/em\u003e. \u003cstrong\u003e297\u003c/strong\u003e, 124955 (2019). \u003c/li\u003e\n\u003cli\u003eGong, D. et al. Benzothiadiazole treatment inhibits membrane lipid metabolism and straight-chain volatile compound release in \u003cem\u003ePenicillium expansum\u003c/em\u003e-inoculated apple fruit. \u003cem\u003ePostharvest Biol. Technol\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e181\u003c/strong\u003e, 111671 (2021). \u003c/li\u003e\n\u003cli\u003eGuo, M. et al. Ferulic acid enhanced resistance against blue mold of \u003cem\u003eMalus domestica\u003c/em\u003e by regulating reactive oxygen species and phenylpropanoid metabolism. \u003cem\u003ePostharvest Biol. Technol\u003c/em\u003e. \u003cstrong\u003e202\u003c/strong\u003e, 112378 (2023).\u003c/li\u003e\n\u003cli\u003eSang, Y. et al. Influences of low temperature on the postharvest quality and antioxidant capacity of winter jujube (\u003cem\u003eZizyphus jujuba\u003c/em\u003e Mill. cv. Dongzao). \u003cem\u003eLWT--Food Sci. Technol\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e154\u003c/strong\u003e\u003cem\u003e, \u003c/em\u003e112876 (2022). \u003c/li\u003e\n\u003cli\u003eTian, S., Qin, G. \u0026amp; Li, B. Reactive oxygen species involved in regulating fruit senescence and fungal pathogenicity. \u003cem\u003ePlant Mol. Biol\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e82 (6)\u003c/strong\u003e, 593-602 (2013).\u003c/li\u003e\n\u003cli\u003eLin, Y. et al. Melatonin decreases resistance to postharvest green mold on citrus fruit by scavenging defense-related reactive oxygen species. \u003cem\u003ePostharvest Biol. Technol\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e153\u003c/strong\u003e, 21-30 (2019). \u003c/li\u003e\n\u003cli\u003eSun, P. et al. Proteomic analysis of \u0026lsquo;Korla\u0026rsquo; fragrant pear responsed during early infection of \u003cem\u003eAlternaria alternata\u003c/em\u003e. \u003cem\u003eSci. Hortic\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e314\u003c/strong\u003e, 111951 (2023). \u003c/li\u003e\n\u003cli\u003eLin, L. et al. Metabolisms of ROS and membrane lipid participate in \u003cem\u003ePestalotiopsis microspora\u003c/em\u003e-induced disease occurrence of harvested Chinese olives. \u003cem\u003ePostharvest Biol. Technol\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e210\u003c/strong\u003e, 112720 (2024). \u003c/li\u003e\n\u003cli\u003eLin, Y. et al. The roles of metabolism of membrane lipids and phenolics in hydrogen peroxide-induced pericarp browning of harvested longan fruit. \u003cem\u003ePostharvest Biol. Technol\u003c/em\u003e\u003cem\u003e. \u003c/em\u003e\u003cstrong\u003e111\u003c/strong\u003e, 53-61 (2016). \u003c/li\u003e\n\u003cli\u003eZhang, S. et al. \u003cem\u003eLasiodiplodia theobromae\u003c/em\u003e (Pat.) Griff. \u0026amp; Maubl.-induced disease development and pericarp browning of harvested longan fruit in association with membrane lipids metabolism. \u003cem\u003eFood Chem\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e244\u003c/strong\u003e, 93-101 (2018). \u003c/li\u003e\n\u003cli\u003eTang, Y. et al. Induction of luteolin on postharvest color change and phenylpropanoid metabolism pathway in winter jujube fruit (\u003cem\u003eZiziphus jujuba\u003c/em\u003e Mill. cv. Dongzao). \u003cem\u003ePlant Physiol. Biochem\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e215\u003c/strong\u003e, 108984 (2024). \u003c/li\u003e\n\u003cli\u003eSun, T. et al. \u003cem\u003eAlternaria alternata\u003c/em\u003e stimulates blackhead disease development of \u0026lsquo;Korla\u0026rsquo; fragrant pear (\u003cem\u003ePyrus bretschneideri\u003c/em\u003e Rehd) by regulating energy status and respiratory metabolism. \u003cem\u003ePostharvest Biol. Technol\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e202\u003c/strong\u003e, 112386 (2023). \u003c/li\u003e\n\u003cli\u003ePayne, D. E., Martin, N. R., Parzych, K. R., Rickard, A. H. \u0026amp; Boles, B. R. Tannic acid inhibits \u003cem\u003eStaphylococcus aureus\u003c/em\u003e surface colonization in an IsaA-dependent manner. \u003cem\u003eInfect. Immun\u003c/em\u003e. \u003cstrong\u003e81 (2)\u003c/strong\u003e, 496-504 (2013). \u003c/li\u003e\n\u003cli\u003eHancock, V., Dahl, M., Vejborg, R. M. \u0026amp; Klemm, P. Dietary plant components ellagic acid and tannic acid inhibit \u003cem\u003eEscherichia coli\u003c/em\u003e biofilm formation. \u003cem\u003eJ. Med. Microbiol\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e59 (4)\u003c/strong\u003e, 496-498 (2010). \u003c/li\u003e\n\u003cli\u003ePerelshtein, I. et al. Tannic acid NPs \u0026ndash; Synthesis and immobilization onto a solid surface in a one-step process and their antibacterial and anti-inflammatory properties. \u003cem\u003eUltrason. Sonochem\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e21 (6)\u003c/strong\u003e, 1916-1920 (2014). \u003c/li\u003e\n\u003cli\u003eWang, H. et al. Tannic acid exerts antifungal activity in vitro and in vivo against \u003cem\u003eAlternaria alternata\u003c/em\u003e causing postharvest rot on apple fruit. \u003cem\u003ePostharvest Biol. Technol.\u003c/em\u003e \u003cstrong\u003e125\u003c/strong\u003e, 102012 (2023).\u003c/li\u003e\n\u003cli\u003eYang, W. et al. MeJA and MeSA alleviate black rot in winter jujube caused by \u003cem\u003eAlternaria tenuissima\u003c/em\u003e by regulating membrane lipid and reactive oxygen metabolism. \u003cem\u003ePostharvest Biol. Technol\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e219\u003c/strong\u003e, 113275 (2025). \u003c/li\u003e\n\u003cli\u003eHe, L. et al. Improving fermentation, protein preservation and antioxidant activity of \u003cem\u003eMoringa oleifera\u003c/em\u003e leaves silage with gallic acid and tannin acid. \u003cem\u003eBioresour. Technol\u003c/em\u003e. \u003cstrong\u003e297\u003c/strong\u003e, 122390 (2020). \u003c/li\u003e\n\u003cli\u003eLiu, T. et al. Clothianidin loaded TA/Fe (III) controlled-release granules: improve pesticide bioavailability and alleviate oxidative stress. \u003cem\u003eJ. Hazard. Mater\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e416\u003c/strong\u003e, 125861 (2021).\u003c/li\u003e\n\u003cli\u003eHan, Z. et al. The Effect of Environmental pH during \u003cem\u003eTrichothecium roseum\u003c/em\u003e (Pers.:Fr.) Link Inoculation of Apple Fruits on the Host Differential Reactive Oxygen Species Metabolism. \u003cem\u003eAntioxidants\u003c/em\u003e. \u003cstrong\u003e10 (5)\u003c/strong\u003e, 692 (2021).\u003c/li\u003e\n\u003cli\u003eShuai, L. et al. Role of phospholipase C in banana in response to anthracnose infection. \u003cem\u003eFood Sci. Nutr.\u003c/em\u003e \u003cstrong\u003e8 (2)\u003c/strong\u003e, 1038-1045 (2020). \u003c/li\u003e\n\u003cli\u003eWang, H. et al. The Changes in Metabolisms of Membrane Lipids and Phenolics Induced by \u003cem\u003ePhomopsis longanae Chi\u003c/em\u003e Infection in Association with Pericarp Browning and Disease Occurrence of Postharvest Longan Fruit. \u003cem\u003eJ. Agric. Food Chem\u003c/em\u003e. \u003cstrong\u003e66 (48)\u003c/strong\u003e, 12794-12804 (2018). \u003c/li\u003e\n\u003cli\u003eChen, Y. et al. Salicylic acid treatment suppresses \u003cem\u003ePhomopsis longanae Chi\u003c/em\u003e-induced disease development of postharvest longan fruit by modulating membrane lipid metabolism. \u003cem\u003ePostharvest Biol. Technol\u003c/em\u003e. \u003cstrong\u003e164\u003c/strong\u003e, 111168 2020. \u003c/li\u003e\n\u003cli\u003eXing, J., Chin, C.-K. Modification of fatty acids in eggplant affects its resistance to \u003cem\u003eVerticilliumdahliae\u003c/em\u003e. \u003cem\u003ePhysiol. Mol. Plant Pathol\u003c/em\u003e. \u003cstrong\u003e56 (5)\u003c/strong\u003e, 217-225 (2000). \u003c/li\u003e\n\u003cli\u003eCao, S., Yang, Z., Cai, Y. \u0026amp; Zheng, Y. Antioxidant enzymes and fatty acid composition as related to disease resistance in postharvest loquat fruit. \u003cem\u003eFood Chem\u003c/em\u003e. \u003cstrong\u003e163\u003c/strong\u003e, 92-96 (2014). \u003c/li\u003e\n\u003cli\u003eEze, S. O. O.; Nwanguma, B. C. Effects of Tannin Extract from \u003cem\u003eGongronema latifolium\u003c/em\u003e Leaves on \u003cem\u003eLipoxygenase Cucumeropsis manii\u003c/em\u003e Seeds. \u003cem\u003eJ. Chem\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e\u003cstrong\u003e 2013 (1)\u003c/strong\u003e, 864095 (2013). \u003c/li\u003e\n\u003cli\u003eLiu, H. et al. Allyl Isothiocyanate in the Volatiles of \u003cem\u003eBrassica juncea\u003c/em\u003e Inhibits the Growth of Root Rot Pathogens of \u003cem\u003ePanax notoginseng\u003c/em\u003e by Inducing the Accumulation of ROS. \u003cem\u003eJ. Agric. Food Chem\u003c/em\u003e. \u003cstrong\u003e69 (46)\u003c/strong\u003e, 13713-13723 (2021). \u003c/li\u003e\n\u003cli\u003eLi, Z. et al. The Jasmonic Acid Signaling Pathway is Associated with Terpinen-4-ol-Induced Disease Resistance against \u003cem\u003eBotrytis cinerea\u003c/em\u003e in Strawberry Fruit. \u003cem\u003eJ. Agric. Food Chem\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e \u003cstrong\u003e69 (36)\u003c/strong\u003e, 10678-10687 (2021).\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1 Effects of different concentrations of TA treatment on lesion development by\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eA. alternata\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;inoculated fragrant pear fruit.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 149px;\"\u003e\n \u003cp\u003eTA (g L\u003csup\u003e-1\u003c/sup\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 230px;\"\u003e\n \u003cp\u003eLesion diameter (mm)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eControl effect (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 149px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 230px;\"\u003e\n \u003cp\u003e12.70 \u0026plusmn; 0.36\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 149px;\"\u003e\n \u003cp\u003e5.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 230px;\"\u003e\n \u003cp\u003e7.12 \u0026plusmn; 0.22\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003e43.94 \u0026plusmn; 2.76\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 149px;\"\u003e\n \u003cp\u003e7.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 230px;\"\u003e\n \u003cp\u003e6.69 \u0026plusmn; 0.34\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003e47.32 \u0026plusmn; 3.39\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 149px;\"\u003e\n \u003cp\u003e10.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 230px;\"\u003e\n \u003cp\u003e5.92 \u0026plusmn; 0.24\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003e53.39 \u0026plusmn; 0.68\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 149px;\"\u003e\n \u003cp\u003e12.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 230px;\"\u003e\n \u003cp\u003e5.97 \u0026plusmn; 0.12\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003e52.99 \u0026plusmn; 1.99\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 149px;\"\u003e\n \u003cp\u003e15.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 230px;\"\u003e\n \u003cp\u003e6.08 \u0026plusmn; 0.14\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003e52.13 \u0026plusmn; 2.00\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTalbe. 2 Content of fatty acids in the Korla fragrant pear samples.\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"3\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eFatty acids\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"16\"\u003e\n \u003cp\u003e\u003cstrong\u003eFatty acids content (\u0026mu;g g\u003c/strong\u003e\u003cstrong\u003e\u003csup\u003e-1\u003c/sup\u003e\u003c/strong\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003e0 d\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e3d\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e6d\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e9d\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e12d\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e15d\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eCK\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eAa\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eTA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eCK\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eAa\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eTA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eCK\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eAa\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eTA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eCK\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eAa\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eTA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eCK\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eAa\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eTA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePalmitic acid\u003c/p\u003e\n \u003cp\u003e(C\u003csub\u003e16:0\u003c/sub\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e30.85\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.72\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e34.53\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.96\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e38.21\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.87\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e36.16\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.26\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e35.96\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.33\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e29.77\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.91\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e37.72\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.34\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e40.32\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.66\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e46.21\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.33\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e42.14\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.87\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e41.28\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.37\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e50.12\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.27\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e39.11\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.37\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e41.88\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.87\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e58.85\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.48\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e51.32\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.55\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eHeptadecanoic acid\u003c/p\u003e\n \u003cp\u003e(C\u003csub\u003e17:0\u003c/sub\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.64\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.10\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.98\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.04\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.94\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.03\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.95\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.09\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.06\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.42\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.03\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.80\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.06\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.65\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.05\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3.15\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.07\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.84\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.04\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.76\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.07\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.65\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.05\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.90\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.06\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.84\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.07\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3.74\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.05\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.73\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.06\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eStearic acid\u003c/p\u003e\n \u003cp\u003e(C\u003csub\u003e18:0\u003c/sub\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3.82\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.11\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4.28\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.12\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5.25\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.16\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4.16\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.17\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5.15\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.19\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5.25\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.15\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5.86\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.26\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e6.28\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.16\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e8.56\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.24\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e7.12\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.16\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5.44\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.14\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e8.35\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.19\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e6.07\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.21\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e6.99\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.17\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e9.54\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.19\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e7.95\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.18\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eEicosanoic acid\u003c/p\u003e\n \u003cp\u003e(C\u003csub\u003e20:0\u003c/sub\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.23\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.05\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.46\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.05\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.97\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.03\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.44\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.03\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.67\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.43\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.01\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.23\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.49\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.16\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.05\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.96\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.05\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.76\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.03\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.54\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.05\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.87\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.03\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.37\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.03\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.99\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.03\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.26\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eOleic acid\u003c/p\u003e\n \u003cp\u003e(C\u003csub\u003e18:1\u003c/sub\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e6.29\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.25\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e7.97\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.20\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5.56\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.19\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5.1\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.18\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e8.44\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.18\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5.81\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.20\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e7.44\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.16\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e6.21\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.17\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4.21\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.15\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5.26\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.13\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5.89\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.18\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3.18\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.13\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4.96\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.18\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e6.55\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.18\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4.12\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.15\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4.92\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.16\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eLinoleic acid\u003c/p\u003e\n \u003cp\u003e(C\u003csub\u003e18:2\u003c/sub\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e75.70\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;1.59\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e85.05\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;1.68\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e85.21\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;2.15\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e79.2\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;2.00\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e88.42\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;1.77\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e74.81\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;1.78\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e63.91\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;1.66\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e72.79\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;2.12\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e50.26\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;1.36\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e62.19\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;2.74\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e63.87\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;2.37\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e39.14\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;2.88\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e59.14\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;1.99\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e68.33\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;2.78\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e43.13\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;2.54\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e53.06\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;2.12\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eLinolenic acid\u003c/p\u003e\n \u003cp\u003e(C\u003csub\u003e18:3\u003c/sub\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e6.24\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.26\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e6.76\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.15\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e6.37\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.18\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5.49\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.15\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e7.22\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.13\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e6.53\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.11\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e6.44\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.12\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5.32\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.15\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4.11\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.22\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5.30\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.25\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4.41\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.12\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3.57\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.15\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4.16\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.12\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5.50\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.10\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4.53\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.18\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4.77\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.22\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eU/S\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.35\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.05\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.36\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.03\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.05\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.03\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.01\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.04\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.32\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2.24\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.67\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.05\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.66\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.98\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.04\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.35\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.03\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.45\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.03\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.72\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.05\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.37\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.51\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.71\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.05\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.99\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.03\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eIUFA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.40\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.40\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.03\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.35\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.01\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.34\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.39\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.39\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.24\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.24\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.01\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.99\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.15\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.03\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.17\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.01\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.84\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.15\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.01\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.20\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.83\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.01\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003cp\u003e\u0026plusmn;0.02\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eNote: Different letters (a, b, c) in the figure indicated that there were signifcant differences among the three treatment groups on the same day according to the Duncan multiple re test (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eT\u003c/strong\u003e\u003cstrong\u003eable\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e3\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;Primer sequences for qRT-PCR\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"104%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eG\u003c/strong\u003e\u003cstrong\u003eene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 26px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eG\u003c/strong\u003e\u003cstrong\u003eene\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;ID\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer sequence\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003eActin\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 26px;\"\u003e\n \u003cp\u003eActin-7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eF:CTCCCAGGGCTGTGTTTCCTA\u003c/p\u003e\n \u003cp\u003eR:CTCCATGTCATCCCAGTTGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003ePbrS\u003c/em\u003e\u003cem\u003eOD\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 26px;\"\u003e\n \u003cp\u003eLOC103953790\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eF:AGAGCAAGCCCAGAATCCTT\u003c/p\u003e\n \u003cp\u003eR:TTGAACTTGATGGCGCTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003ePbr\u003c/em\u003e\u003cem\u003eCAT\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 26px;\"\u003e\n \u003cp\u003eLOC125472895\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eF:CCTCGTGGTTTTGCAGTGAA\u003c/p\u003e\n \u003cp\u003eR:CGAATAGGAAGGCGAACGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003ePbr\u003c/em\u003e\u003cem\u003eAPX\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 26px;\"\u003e\n \u003cp\u003eLOC103934327\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eF:CAAGGAGCGTTCTGGATTCG\u003c/p\u003e\n \u003cp\u003eR:CTTCGTCCGCAGCATAAGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003ePbr\u003c/em\u003e\u003cem\u003eGR\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 26px;\"\u003e\n \u003cp\u003eLOC103963516\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eF:GTACTGTTTGCCACTGGTCG\u003c/p\u003e\n \u003cp\u003eR:ATCGCGGTAATCTGGTTTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003ePbr\u003c/em\u003e\u003cem\u003ePLD\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 26px;\"\u003e\n \u003cp\u003eLOC103966454\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eF:TTTGGGCAGAGCATACAGGA\u003c/p\u003e\n \u003cp\u003eR:CGGAATAGCCTTCACCTTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003ePbr\u003c/em\u003e\u003cem\u003ePLC\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 26px;\"\u003e\n \u003cp\u003eLOC103963201\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eF:TGAAATTCCACAGCTACGCG\u003c/p\u003e\n \u003cp\u003eR:ACCTCCTTCACGAACCTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003ePbrlipase\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 26px;\"\u003e\n \u003cp\u003eLOC103960045\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eF:TCATCTGGGGAGAGCATGAC\u003c/p\u003e\n \u003cp\u003eR:ACTGTAGGGAGAGGGTCGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003ePbr\u003c/em\u003e\u003cem\u003eLOX\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 26px;\"\u003e\n \u003cp\u003eLOC103965359\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eF:AGGGTTTCTCTGCAGCTCAT\u003c/p\u003e\n \u003cp\u003eR:TTCGAGTGTGACGGTCTTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003ePbrFAD2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 26px;\"\u003e\n \u003cp\u003eLOC103958977\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53px;\"\u003e\n \u003cp\u003eF:TGCGCACCATTTGTTCTCAA\u003c/p\u003e\n \u003cp\u003eR:CTTTCTTGGCACCCTCATCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"npj-science-of-food","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"npjscifood","sideBox":"Learn more about [npj Science of Food](http://www.nature.com/npjscifood/)","snPcode":"41538","submissionUrl":"https://submission.springernature.com/new-submission/41538/3","title":"npj Science of Food","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Tannic acid, Korla fragrant pear, Alternaria alternata, Reactive oxygen species, Membrane lipid metabolism","lastPublishedDoi":"10.21203/rs.3.rs-9259312/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9259312/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Tannic acid (TA), a naturally occurring polyphenol, exhibits broad-spectrum antimicrobial and antioxidant activities. This study elucidates the mechanisms by which TA controls Alternaria alternata in Korla fragrant pears. In vitro, TA at 10 mg mL-1 directly inhibited fungal growth by inducing hyphal deformation. In vivo, TA treatment significantly attenuated blackhead disease development. The underlying protective mechanism involved two coordinated pathways: First, TA enhanced the activity and gene expression of key antioxidant enzymes (APX, GR, CAT, SOD), sustaining the AsA-GSH cycle to scavenge excessive reactive oxygen species (ROS). Second, TA suppressed the activity and gene expression of lipid-degrading enzymes (LOX, lipase, PLC, PLD, PLA2) while elevating fatty acid desaturase (FADS) activity. This regulation preserved membrane lipids (phosphatidylcholine, phosphatidylinositol, and unsaturated fatty acids), reduced harmful metabolites (phosphatidic acid, free fatty acids, and malondialdehyde), and thereby maintained membrane integrity. Our findings demonstrate that TA functions as a multi-target postharvest treatment, primarily through the dual regulation of redox homeostasis and membrane lipid metabolism to reinforce fruit resistance.","manuscriptTitle":"Tannic acid enhances postharvest resistance of Korla fragrant pears to Alternaria alternata by modulating membrane lipid and reactive oxygen species metabolism","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-10 19:05:35","doi":"10.21203/rs.3.rs-9259312/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-05-09T12:08:40+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-05-07T10:07:35+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-05-05T14:43:29+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"33019400316087238373546007524926038961","date":"2026-04-15T09:25:11+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"36384328122694933530523902421867681332","date":"2026-04-15T08:46:35+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"5030063211575596194448257750292138469","date":"2026-04-13T09:35:20+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-04-06T06:42:02+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-04-06T06:39:44+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-04-03T05:21:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"npj Science of Food","date":"2026-03-29T13:45:11+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"npj-science-of-food","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"npjscifood","sideBox":"Learn more about [npj Science of Food](http://www.nature.com/npjscifood/)","snPcode":"41538","submissionUrl":"https://submission.springernature.com/new-submission/41538/3","title":"npj Science of Food","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6a8472cc-51d3-4233-b1cc-1ef85be804a8","owner":[],"postedDate":"April 10th, 2026","published":true,"recentEditorialEvents":[{"type":"decision","content":"Revision requested","date":"2026-05-09T12:08:40+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-05-07T10:07:35+00:00","index":24,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-05-05T14:43:29+00:00","index":23,"fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[{"id":65929962,"name":"Biological sciences/Biochemistry"},{"id":65929963,"name":"Biological sciences/Biotechnology"},{"id":65929964,"name":"Biological sciences/Microbiology"},{"id":65929965,"name":"Biological sciences/Plant sciences"}],"tags":[],"updatedAt":"2026-05-09T12:24:48+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-10 19:05:35","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9259312","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9259312","identity":"rs-9259312","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00