Growth Differentiation Factor 15 (GDF15) Expression in the Heart After Myocardial Infarction and Cardioprotective Effect of Pre-Ischemic rGDF15 Administration

Growth Differentiation Factor 15 (GDF15) Expression in the Heart After Myocardial Infarction and Cardioprotective Effect of Pre-Ischemic rGDF15 Administration | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Growth Differentiation Factor 15 (GDF15) Expression in the Heart After Myocardial Infarction and Cardioprotective Effect of Pre-Ischemic rGDF15 Administration Geoffrey Dogon, Eve Rigal, Eliot Potel, Marie Josse, Luc Rochette, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3963740/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 8 You are reading this latest preprint version Abstract Clinical data consider growth differentiation factor-15 GDF15 as a prognostically unfavourable biomarker in cardiovascular diseases, while experimental studies suggest its cardioprotective potential. This study focuses on the direct cardiac effects of GDF15 during ischemia-reperfusion (I/R) injury in Wistar male rats, employing concentrations relevant to patients at high cardiovascular risk. Initially, we examined circulating levels and heart tissue expression of GDF15 in rats subjected to I/R and Sham operations in vivo. Subsequently, we evaluated the cardiac effects of GDF15 both in vivo and ex vivo, administering recombinant GDF15 either before ischemia (preconditioning) or at the onset of reperfusion (postconditioning). We compared infarct sizes and recovery of cardiac contractile parameters between control and rGDF15 treated rats. Contrary to our expectations, I/R did not elevate GDF15 plasma levels compared to Sham-operated rats. However, cardiac expression at both protein and mRNA levels increased in the infarcted zone of the ischemic heart after 24 hours of reperfusion. Notably, preconditioning with rGDF15 exhibited a cardioprotective effect, reducing infarct size both in vivo and ex vivo, while enhancing the recovery of cardiac contractile parameters ex vivo. However, postconditioning with rGDF15 did not alter infarct size or the recovery of contractile parameters either in vivo or ex vivo. These findings reveal, for the first time, that short-term exogenous administration of rGDF15 before ischemia, at physiologically relevant levels, protects the heart against I/R injury in both in vivo and ex vivo settings. The latter situation suggests that rGDF15 can operate independently of the inflammatory, endocrine and nervous systems, presenting GDF15 as a direct and potent cardioprotective properties against ischemia-reperfusion injury. Biological sciences/Physiology/Cardiovascular biology Health sciences/Cardiology GDF-15 Ischemia-reperfusion injury heart preconditioning cardioprotection Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction The macrophage inhibitory cytokine-1 (MIC-1), also known as Growth and Differentiation Factor 15 (GDF15), stands out as a distinct member of the transforming growth factor superfamily (TGF-β) 1 . Initially produced as a ≈ 40 kDa pro-peptide monomer, it undergoes processing into a biologically active mature homodimer of ≈ 25 kDa. This mature form can be either be secreted or stored within the matrix 2 . Contrary to traditional TGF-β members, recent research highlights that GDF15 does not bind to TGF-β receptors. Instead, it interacts with the endogenous receptor GDNF-family α-like (GFRAL), exclusively present in the hindbrain 3 – 6 . Activation of GFRAL by GDF15 induces metabolic functions, notably influencing appetite and regulating body mass, further emphasizing its uniqueness within the TGF-β superfamily. This distinctive profile suggests that GDF15 might be more appropriately classified within the GDNF family. GDF15 plays diverse and significant roles in various pathophysiological conditions, including cancer, inflammation, and cardiovascular diseases. It is emerging as a pivotal biomarker, particularly in identifying patients at risk of poor prognosis. While its expression is typically low in healthy tissues, including the heart, pathological circumstances such as cardiovascular (CV) comorbidities, oxidative stress, or hypoxia significantly increase its expression. Notably, patients with atrial fibrillation, heart failure, atherosclerosis and, most predominantly, coronary artery diseases (CAD) exhibit higher GDF15 levels. In contrast to some other cardiovascular biomarkers, GDF15 plasma levels remain remarkably stable both in the acute setting and during the stabilizing period in CAD patients, providing valuable short- to long-term prognostic information. Patients admitted with elevated GDF15 concentrations (> 1,800 ng/L) face an increased risk of all-cause mortality, CV mortality and myocardial infarction (MI) 7 , even after adjusting for classic biomarkers such as hs-troponin T, cystatin C, hs-CRP and NT-proBNP 8 , 9 . Despite its expression in the infarcted myocardium, the correlation between GDF15 and myocardial damage or function is still a subject of debate 10 – 12 . Experimental research has revealed an elevation in GDF15 levels in the blood after MI and ischemic stroke, accompanied by increased GDF15 pro-peptide expression in the surrounding ischemic area. In vitro studies have demonstrated that cardiomyocytes produce GDF15 under hypoxia and in response to other stressors such as pro-inflammatory cytokines, oxidative stress, and mechanical stretch. Intriguingly, GDF15 exhibits cardioprotective properties by reducing cardiomyocytes apoptosis during simulated ischemia-reperfusion (I/R) through activation of the PI3K-Akt signalling pathway, despite the absence of an identified cardiac GDF15 receptor to date. In vivo studies with GDF15 deficient mice revealed increased infarct sizes and a higher number of apoptotic cardiomyocyte after I/R 10,13 . Those effects are believed to be primarily mediated through the regulation of inflammation by modulating leukocyte infiltration in the infarcted area 14 and promoting immune tolerance 15 . This study initially sought to analyse the expression and secretion kinetics of GDF15 in response to myocardial I/R. Subsequently, we investigated its direct cardiac effects in both in vivo and ex vivo models of I/R, utilizing recombinant GDF15 concentrations relevant to patients with a high CV risk, so as to assess the potential suitability of rGDF15 a therapeutic strategy in the context of myocardial infarction. Materials & methods Animals Wistar Han male rats (8–9 weeks, Charles River) were utilized for experiments. All animals received humane care, and study protocols were in compliance with institutional guidelines. The investigation adhered to Directive 2010/63/EU of the European Parliament and the Guide for the Care of Laboratory Animals published by the US Nation Institutes of Health (NIH Publication No. 85 − 23, revised 1996) and was approved by the local ethics committee (Comité d’Ethique de l’Expérimentation Animale Université Bourgogne Franche-Comté, Dijon, France, protocol agreement number: APAFIS#16546-2018082915228167v4). The present study is in accordance with ARRIVE guidelines. Animals were housed at 21 ± 2°C with a constant humidity of 55 ± 10%, following a light/dark cycle of 12 h, and had free access to water and a standard diet ad libitum . 1. Assessment of GDF15 expression after in vivo ischemia reperfusion injury In vivo ischemia reperfusion surgery Rats were deeply anesthetized with isoflurane for 2 minutes in an induction box (2 L/min, 5% Isoflurane) and then transferred to a mask (0.6 L/min, 2% Isoflurane) and injected with buprenorphine (0.075 mg/kg). A lidocaine/prilocaine was applied to the incision site as a local anaesthetic (ANESDERM 5%). Once complete nociception loss was achieved, animals were intubated and ventilated (VentElite 55-7040, Harvard Apparatus). A left thoracotomy was realized between the 3rd and 4th intercostal space. A 6.0 silk suture (K889H, Ethicon) was placed under the left anterior descending (LAD) coronary artery, tightened and knotted on a catheter to interrupt blood flow and to induce 30 minutes of ischemia. The knot was then released and the catheter removed to initiate reperfusion. Subsequently, the rib cage was closed with a 5.0 prolene suture (EH7229H, Ethicon), and pleural void was eliminated by aspirating excess air with a syringe. After skin closure with a 5.0 prolene suture (7475H, Ethicon), animals were awakened and placed in a 37°C incubator until they fully recovered (Cimuka PD30SH, Ducatillon). Sham-operated animals underwent an identical procedure, with the only difference being that the knot was loosely tied. During surgery, blood samples were collected at various time points from the ventral caudal artery or in the inferior vena cava depending on whether the animal was sacrificed just after. The samples were collected in tubes containing lithium heparin (15.1673, Sarstedt) and centrifuged 5 min at 5,000 G to isolate the plasma. The plasma was then rapidly frozen in liquid nitrogen and stored at -80°C until further analysis. After 24 h of reperfusion, rats were re-anesthetized with isoflurane and intubated following the previously describe procedure. The chest was reopened, and the heart was removed. The left ventricle was divided into two distinct regions: the first contained the ischemic zone (IZ), and the second corresponding to the non-ischemic remote zone (RZ). Tissues were promptly weighted, flash-frozen in liquid nitrogen, and stored at -80°C until further processing. Enzyme-linked immunosorbent assay (ELISA) Circulating GDF15 concentrations were determined in thawed plasma samples using a commercial ELISA kit (MGD150, Bio-Techne) following the manufacturer’s protocol. Briefly, samples were incubated in a microplate coated with mouse/rat monoclonal GDF15 antibody for 2 hours at room temperature (RT). After multiple washes, a primary mouse/rat GDF15 antibody conjugated to horseradish peroxidase was added to each well and incubated for an additional 2 hours at RT and before another wash. Colorimetric revelation was initiated by a mix of hydrogen peroxide and tetramethylbenzidine and stopped by the addition of hydrochloric acid. The optical density of each well was immediately determined using a spectrophotometer VICTOR 3 (Perkin Elmer) at 450 nm. Quantitative real-time PCR (RT-qPCR) analysis Total RNA was extracted from frozen rat left ventricles using NucleoZOL reagent (NucleoSpin® RNA Set for NucleoZOL MACHEREY-NAGEL). RNA quality and integrity were assessed using a Nanodrop and an Agilent 2100 Bioanalyzer (G2939B, Agilent), respectively. Reverse transcription was performed using the PrimeScript RT reagent kit (RR037B, TaKaRa) following the manufacturer’s protocol. RT-qPCR was carried out with 2 µl of cDNA using the SYBR-Green PCR Master-Mix (Applied Biosystems) and both sense and antisense primers (5 mM) in a final volume of 20 µL, utilizing a StepOne-Real-Time PCR system (Applied Biosystems). Data were analysed using relative quantification, normalized against GAPDH mRNA as the housekeeping gene, and presented as fold change compared to the RZ of Sham operated rats. Primers used for the amplification of rats’ genes are provided in Table 1 . Table 1 Primers sequences for RT-qPCR. Gene Primer Sequence Length (bp) GDF15 Forward 5’- CGAGAGGACTCGAACTCAGA-3’ 71 Reverse 5’- CCCAATCTCACCTCTGGACT-3’ GAPDH Forward 5’- AAGGTCATCCCAGAGCTGAA − 3’ 138 Reverse 5’- CTGCTTCACCACCTTCTTGA − 3’ Western blot analysis Heart tissues were lysed with the Precellys® homogenizer combined with the Cryolys module (Bertin technologies), with zirconium beads (ZROB10, Next Advance) in 10 volumes of radioimmunoprecipitation assay (R0278, Sigma-Aldrich) buffer containing protease and phosphatase inhibitors (A32961, ThermoFisher) at 4°C. Homogenates were then centrifuged at 10,000 g for 15 min at 4°C to separate proteins from cells debris, and supernatant protein concentration was measured using the Lowry method. Equal protein amounts were loaded and separated on a sodium dodecylsulfate-polyacrylamide (SDS-PAGE) TGX Stain-Free FastCast gel electrophoresis (TGX Stain-Free FastCast Acrylamide kit 12%, 1610175, Bio-Rad) under reducing and denaturing conditions. Proteins were then transferred to a polyvinylidene difluoride (PVDF) membrane using the Turbo Transblot technology. After blocking non-specific binding sites with 5% non-fat milk in 0.1% PBS/TWEEN 20 for 1 hour at RT, membranes were incubated overnight at 4°C with primary antibodies against anti-GDF15 (1:500, ab206414, Abcam). Membranes were washed three times for 5 min with 0.1% PBS/TWEEN 20 and then incubated for1 hour at RT with anti-rabbit IgG HRP-linked secondary antibody (7074, Cell Signaling). Detection of antibodies reactivity was performed with WesternBright™ Sirius substrate (K-12043, Advansta) using the Chemidoc imaging system (Bio-Rad). Each revealed band was normalized by the total amount of proteins loaded on the corresponding lane obtained with the stain-free technology. Gels were run in duplicate, and chemiluminescence measurements were analysed with Image Lab software (version 6.1.0, Bio-Rad). 2. Assessment of GDF15 cardioprotective effect in vivo In vivo conditioning protocols During surgery, rats were injected with either 0.9% saline or 2.5 µg/kg of rGDF15 in the dorsal penile vein. The injection was administered 20 min before the transient ligation of the LAD coronary artery (preconditioning protocol) or after 28 min of ischemia (postconditioning protocol; Fig. 1 ). Transient regional ischemia was induced in rats by in vivo ligation of the left anterior descending (LAD) coronary artery for 30 minutes followed by 24 h of reperfusion. (A) Preconditioning protocol involved intravenous injection of saline (control) or rGDF15 (2.5 µg/kg) 20 minutes before ischemia; (B) Postconditioning protocol included intravenous injection of saline (control) or rGDF15 (2.5 µg/kg) 2 minutes before reperfusion (after 28 minutes of ischemia). Hearts were then harvested to determine the infarct size. In vivo infarct size quantification After 24 h of reperfusion, rats were anesthetized again with isoflurane, intubated, and the chest was reopened. The cardiac suture left in place was retied to recreate the same ischemia. A 5% Evans’ blue saline solution was injected in the inferior vena cava to dye every normally perfused tissue in blue, leaving the area at risk (AAR) uncoloured. Immediately afterward, heart was harvested, and the left ventricle (LV) was isolated, slightly frozen for 15 min, and sliced into four 1 mm-thick slices from the apex to the ischemic suture. Each slice was then weighted and scanned to determine the area at risk as the percentage of the undyed area by the LV total area. Slices were incubated for 12 minutes in a 2% solution of 1,3,5-Triphenyltetrazolium chloride (TTC, T-8877, Sigma-Aldrich) in phosphate buffer (pH = 7.4) at 37°C, then transferred in 10% formalin for 1 hour at RT. Heart slices were mounted between two microscope glass slides to scan both faces. Digital images were analysed with ImageJ software (version 1.53c, NIH). The infarct size was reported as a percentage of the area at risk. 3. Evaluation of GDF15 cardioprotective effect ex vivo Isolated perfused heart preparation The perfusion medium was a modified Krebs-Henseleit bicarbonate buffer containing the following in mmoles/L: 118 NaCl, 25 NaHCO 3 , 1.2 KH 2 PO 4 , 1.2 MgSO 4 ·7H 2 O, 3.96 KCl, 2 CaCl 2 ·2H 2 O and 5.5 glucose. It was filtered through a 0.45 µm filter (HAWP04700, Merck KGaA) to avoid any particulate contaminants and constantly gassed with 95% 0 2 and 5% CO 2 , maintaining an adjusted end-pH of 7.4 ± 0.05 at 37°C. Rats were deeply anesthetized with isoflurane for 2 minutes in an induction box (2 L/min, 5% Isoflurane) then transferred to a mask (0.6 L/min, 3% Isoflurane) and injected with heparin (500 IU/kg, i.p.) to prevent blood clotting. After the loss of all nociceptive reflexes, the chest of the animal was opened and the heart was quickly removed and placed in a cold perfusion buffer bath (4°C) until all contraction ceased. The heart was immediately cannulated by the aorta on the Langendorff system and retrogradely perfused with Krebs-Henseleit perfusion buffer at a constant pressure of 80 mmHg and temperature of 37°C. An elastic water-filled latex balloon (73-3479, Harvard Apparatus) connected to a pressure transducer was introduced into the LV to measure intra-ventricular pressures. The balloon was inflated to obtain an initial left ventricular end-diastolic pressure (LVDP) of 8–13 mmHg and left unchanged. The following functional parameters were recorded: heart rate (HR), left ventricular end-systolic pressure (LVSP), LVDP, left ventricular developed pressure (LVDevP = LVSP - LVDP) and the first derivative of the LVDevP: the left ventricular maximal pressure development (+ dP/dt) and left ventricular minimal pressure development (-dP/dt) (PowerLab®, LabChart® System, ADInstruments). Coronary flow (CF) was measured by time-point collection of the effluent. Ex vivo conditioning protocols Hearts were allowed to stabilize for approximately 10–15 min before recording basal cardiac parameters. During the 10 minutes of basal measurements, isolated hearts were either perfused with either 4 mM HCl (as control perfusion, rGDF15 diluent) or 2 µg/L rGDF15 (8944-GD, Bio-Techne) in the preconditioning protocol. Alternatively, in the postconditioning protocol, perfusion was done during the first 10 minutes of reperfusion. In both protocols, control and rGDF15 perfusion were adjusted to 1/100th of the coronary flow (Fig. 2). Ex vivo infarct size quantification At the end of the 2-hour reperfusion period, hearts were removed from the Langendorff system, promptly dried, weighted, and briefly frozen for 15 min to firm the muscle. Subsequently, the total ventricular area was divided into 6 transverse sections, each 1 mm-thick, and incubated with TTC to evaluate infarct size, as described before. Infarct area was calculated as the percentage of the total ventricular area. 4. Statistical analysis Data sets were analysed using SigmaPlot (version 12.5, Systat Software), and statistical significance was considered when P < 0.05. Normality and homoscedasticity of data sets were verified before applying parametric tests; therefore, differences between two groups were assessed by a Student’s t-test. GDF15 pharmacokinetic was statistically evaluated by a one-way ANOVA for repeated measures, and ex vivo heart function by a two-way ANOVA for repeated measures, followed by a Tukey’s post hoc analysis, as indicated in each figure. Data are represented as mean ± SEM. Results 1. GDF15 is expressed at the gene and protein level in the ischemic zone after in vivo myocardial infarction During surgery, preischemic GDF15 circulating levels were around 200 ng/L in both groups of rats: 283 ± 24 ng/L in Sham, 211 ± 24 ng/L in I/R groups (Fig. 3 A). At the end of myocardial ischemia, just before reperfusion, GDF-15 plasma levels increased to above 950 ng/L. Then, 30 minutes after starting reperfusion, GDF15 peaked around 1,600 ng/L both in I/R and sham-operated rats (1,568 ± 383 ng/L in Sham, 1,609 ± 131 ng/L in I/R groups). 24 hours after reperfusion, GDF15 levels returned to their preischemic levels in both groups (205 ± 13 ng/L in Sham, 255 ± 24 ng/L in I/R groups). In hearts collected 24 h after reperfusion, there was an increase in GDF15 mRNA expression observed in the IZ of hearts from I/R rats, but not in those from sham-operated rats (Fig. 3 B). Additionally, in I/R hearts, there was an increase in pro-GDF15 expression in both the RZ and the IZ, while in the IZ, a six-fold increase in mature GDF15 expression was observed (Fig. 3 C, Fig. 3 D). 2. rGDF15 preconditioning, not postconditioning, improves myocardial I/R injury In order to assess whether GDF15 exerts cardioprotective effects during in vivo myocardial I/R injury, recombinant GDF15 (rGDF15) was administrated intravenously before or after post-ischemic reperfusion. Our objective was to achieve GDF15 concentrations relevant to those observed in patients with a high CV risk, i.e 2,000 to 4,000 ng/L 16,17 . For this purpose, we conducted pharmacokinetics assays in anesthetized rats intravenously injected with 2.5 µg/mL rGDF15. Baseline GDF15 circulating levels were similar in the control and GDF15 groups, at 239 ± 13 ng/L and 271 ± 26 ng/L, respectively (Fig. 4). Immediately after rGDF15 injection, GDF15 plasma levels increased to levels above 20,000 ng/L. However, 20 min after injection, GDF15 levels reached 4,013 ± 528 ng/L in the GDF15 group while remaining stable at 211 ± 23 ng/L in the control group. 24 h after rGDF15 injection, control and GDF15 groups returned to similar baseline levels around 204 ± 13 ng/L and 233 ± 24 ng/L, respectively (Fig. 4). The cardioprotective effects of rGDF15 in both pre- and postconditioning protocols were evaluated in vivo as described above. 24 h after ischemia, the AAR, determined by Evans’ blue dye injection, did not differ between the control and GDF15 groups in both pre- and postconditioning protocol groups (Fig. 5 A and C). Consequently, infarct sizes could be rigorously compared between the groups. In the preischemic protocol, rGDF15 reduced infarct size (65 ± 5% in the control group vs. 42 ± 6% in GDF15 groups, p < 0.01, Fig. 5 B). However, in the postconditioning protocol, both experimental groups displayed a similar necrotic area (61 ± 5% of the AAR in the control group vs. 67 ± 3% in the GDF15 group, Fig. 5 D). 3. rGDF15 preconditioning, not postconditioning, improves ex vivo heart recovery after I/R To consolidate our findings, we extended our protocol to an ex vivo model to assess the potential protective effect of rGDF-15 independently of neural, humoral or inflammatory response regulators. During the basal period, where the isolated hearts were perfused with or without rGDF15, all measured parameters were similar between the two groups (Fig. 6 ). When perfusion was stopped to induce ischemia, hearts rapidly stopped beating, decreasing their contractile parameters to zero (HR, LVDevP and ± dP/dt, Fig. 6 A, C, D and E). At the onset of reperfusion, isolated hearts exhibited a slight transient peak and drop-off before gradually recovering their contractile functions over time. The recovery was only partial in both groups, reaching 30–40% of their initial LVDevP and ± dP/dt, with the maximum of recovery at 60 min of reperfusion, followed by gradual decline due to the limitations of the ex vivo model (Fig. 6 B). However, hearts perfused with rGDF15 prior to total ischemia demonstrated a better recovery of LVDevP, +dP/dt and -dP/dt during the early reperfusion period. Hearts perfused with rGDF15 displayed an improved recovery of HR during early reperfusion, attributed to fewer episodes of arrythmia and a better return to sinus rhythm (Fig. 6 E). At the end of the 2-hour reperfusion, TTC staining of heart slices revealed a greater infarct size in the control group than in the rGDF15 group: 60 ± 4% and 45 ± 4% of the LV, respectively (Fig. 6 F). We also assessed the ex vivo post-ischemic effects of rGDF15 by perfusing it during the first 10 minutes of reperfusion. During the basal period, all measured parameter (LVDevP, ±dP/dt and HR) were comparable between the two groups (Fig. 7 A, C, D and E). Following 30 min of total ischemia, we observed a similar pattern of recovery in functional parameters as described in our previous set of ex vivo experiments (Fig. 7 B). However, no significant differences were identified between the control and GDF15 groups in any of the monitored parameters. At the end of reperfusion, the infarct sizes in the control group were 52 ± 6% of the total ventricular area, and were did not differ from the GDF15 group, which measured at 51 ± 5% (Fig. 7 F). Discussion The present study reveals GDF15 as a cardioprotective cytokine induced in response to myocardial I/R injury, in line with previous findings. Our work demonstrates the expression of GDF15 in the heart tissue following in vivo ischemia-reperfusion injury and suggests a potential role for rGDF15 as a rescue molecule. Surprisingly, the elevation of plasma GDF15 during reperfusion did not differ between I/R and Sham-operated rats, which runs counter to clinical data. To our knowledge, there is no in vivo data on systemic GDF15 secretion in response to cardiac I/R surgery. However, this aligns with the stress-sensor role of GDF15, secreted into the circulation in response to injuries, cellular damage, oxidative stress and inflammation, which are common elements induced by cardiac surgery. It has been proposed that catecholamines, released during acute myocardial or cerebral ischemia, may remotely induce GDF15 secretion 18 . In a recent study, local anaesthetics such as lidocaine were shown to upregulate GDF15 production in HeLa cultured cells 19 , suggesting lidocaine use in our surgical procedure could contribute to the GDF15 secretion observed in both I/R and Sham rats. Additionally, two studies indicate that coronary artery bypass grafting in patients increases GDF15 plasma level by 2.5- or 3-fold compared to anaesthesia induction level 20 , 21 . These findings suggest that thoracic surgery itself induces GDF15 secretion. In our model, the initial plasma level of GDF15 was very low (≈ 200 ng/L), which can be explained by the fact that rats were young and healthy individuals. However, we observed a 10-fold GDF15 increase after 30 min I/R followed by 30 min of reperfusion. Patients from clinical studies present stable coronary artery disease and other cardiovascular history; hence, their GDF15 baseline level is already elevated (≈ 1,000 ng/L), and even increased after thoracic surgery, but to a lesser extent than that observed in rats. Our study reveals that I/R upregulates GDF15 transcription in the ischemic part of the heart compared to its RZ after 24 h of reperfusion, while no differences were observable in Sham-operated rats. This finding is consistent with observations by Zhang and Kempf in an I/R mouse model, where GDF15 mRNA was exclusively upregulated in the infarcted area after 1 h of ischemia, reaching a transcriptional peak at 24 h of reperfusion 10 , 22 . Interestingly, Kempf et al . also demonstrated that only a permanent ligation of the LAD induced GDF15 mRNA upregulation in the RZ, suggesting that GDF15 may be expressed remotely when stress signals reach a certain level. At the protein level, I/R rats exhibited an increase in pro-GDF15 in the RZ and a strong trend in the IZ compared to Sham rats after 24 h of reperfusion. These results align with expression kinetics reported by other groups, showing an increase in pro-GDF15 in the ischemic heart compared to Sham mice after 4 h of reperfusion, peaking at 24 h. In vitro studies also demonstrated that cardiomyocytes in culture produce pro-GDF15 in simulated I/R, both in the supernatant and in cell lysate 10 . Interestingly, mature GDF15 was only detected in supernatants after either 6 hours of hypoxia or 3 hours of hypoxia followed by 3 hours of reoxygenation in vitro , suggesting rapid and efficient secretion into the circulation in response to in vivo I/R. However, we did not observe any in vivo difference in circulating GDF15 between our Sham and I/R groups, which might be attributed to the surgical procedure mentioned above. Nonetheless, our work describes, for the first time, a cardiac expression of mature GDF15 in response to in vivo I/R. I/R hearts exhibited a significant six-fold increase in mature GDF15 in the IZ 24 hours after the onset of reperfusion, but no difference in the RZ. The presence of biologically active mature GDF15 after I/R supports a cardioprotective and anti-hypertrophic role, consistent with previous findings 23 . GDF15’s cardioprotective properties primarily involve inhibiting pro-inflammatory leukocyte recruitment in the infarcted area 14 , 22 , 24 . Mechanistically, GDF15 activates the small GTPase Cdc42 and inhibits the small GTPase Rap1, resulting in the inhibition of conformational action and clustering of β2 integrins on leukocytes, thus suppressing their ability to bind onto endothelial ICAM-1 22 . Consequently, GDF15-deficient mice subjected to ischemia displayed increased leukocyte recruitment in the infarcted zone, leading to higher mortality and a greater infarct size with more apoptotic cardiomyocytes. Conversely, GDF15 over-expression in mice reduced I/R injury by lowering the number of apoptotic cells, reducing neutrophil infiltration, and decreasing pro-inflammatory cytokine expression in the heart 13 . In our in vivo and ex vivo models, preischemic rGDF15 administration also reduced the infarct size. However, its anti-inflammatory effects may not fully explain the cardioprotective effect observed ex vivo , as this experimental condition isolates the heart from the blood, neuronal, humoral or immune systems. Our data suggest a cardiac-specific effect of GDF15, potentially interacting directly with an unknow receptor, as GFRAL is not expressed in the heart, or indirectly via other mediators. Unfortunately, studies exploring GDF15 pathways in cardiomyocytes in vitro have mainly used commercial human rGDF15 (rhGDF15), which may be contaminated by TGF-β, as reported by several authors 25 – 27 . Olsen et al. demonstrated that some rhGDF15 batches were activating TGF-β receptors and their canonical Smad pathway. Moreover, TGF-β signalling also includes non-canonical signalling protein like ERK, Akt and mTOR, all implicated in cardioprotective processes 28 , 29 and activated by rhGDF15 in vitro . Due to this contamination issue, results from studies potentially using contaminated rhGDF15 have been questioned. As a precaution, we will not cite these experiments. However, it is important to note that batches of rGDF15 amplified in TGF-β-deprived hosts, such as E. Coli, do not exhibit this contamination. This consideration motivated our choice to use this type of recombinant protein. Therefore, apart from the regulation of leukocyte recruitment, little is known about the intracellular cardioprotective mechanisms of GDF15. A study using GDF15 overexpressing mice in a cold I/R heart grafting context reported that GDF15 promoted Foxo3a phosphorylation (p-Foxo3a) through PI3K/Akt activation and NF-κB inhibition 13 . These two kinases are members of the reperfusion injury salvage kinase (RISK), one the two major cardioprotective pathways known to limit reperfusion injuries and cell death by inhibiting mitochondrial transition pore opening (mPTP) 30 . Foxo3a is a transcription factor that regulates the cell cycle, autophagy and pro-apoptotic genes, and its translocation to the cytoplasm upon phosphorylation promotes cell survival after renal, cerebral and cardiac I/R 31–34 . Moreover, NF-κB is a complex pro-inflammatory transcription factor, and specific cardiac inhibition of NF-κB has shown cardioprotective effects in both ex vivo and in vivo I/R models 35 , 36 . Finally, we reported that rGDF15 failed to protect the heart when administered at the onset of reperfusion both in vivo and ex vivo , despite its beneficial effect when used before ischemia as a preconditioning compound. Pharmacological cardioprotection is a challenging task as it must selectively address cardiomyocytes dysfunctions induced by ischemia and reperfusion without adversely affecting other physiological process. There are three main pathways for achieving this, represented by the survivor activating factor enhancement (SAFE) pathway, RISK pathway and NO/PKG pathway, all ultimately leading to mitochondrial protection and survival 37 . For instance, volatile anaesthetics (isoflurane, sevoflurane and desflurane) are known to be cardioprotective molecules both in pre- and postconditioning, capable of activating RISK, SAFE and NO pathways 37 . However, one study reported that isoflurane induced a different gene expression profile depending on whether it was used as pre- or postconditioning after ex vivo myocardial I/R 38 . It should also be borne in mind that interactions can be found between cardioprotective molecules. Desflurane and propofol have been reported to be cardioprotective individually, but their combination abolished their effectiveness in cardiac conditioning 39 . As we used isoflurane during the surgery, interaction between isoflurane and our protocol of GDF15 administration during myocardial I/R can be hypothesized. Finally, preconditioning can be seen as a mechanism that delays the development of infarct size, while postconditioning actually decreases the infarct size 40 . We can, therefore, assume that GDF15 can prevent ischemic dysregulations of cardiomyocytes but cannot rescue them. Furthermore, the spatiotemporal organization of RISK, SAFE and NO/PKG pathways is not completely elucidated yet, resulting in disparities between pre- and postconditioning 41 . This is why the most promising pharmacological cardioprotective molecules should activate several protective pathways, ensuring mitochondrial protection via redundant pathways and enabling better and broader cardioprotective efficiency 37 , 42 , 43 . It is also to be noted that the exploration of the GDF15 cardioprotective abilities in our animal models is limited by the usage of isoflurane, a well-known cardioprotective molecule. However, data from our laboratory showed that isoflurane cardioprotection on the ex vivo Langendorff model was abolished by 30 min of ischemia, motivating our choice of this ischemia duration (data not shown). Conclusions Our study underscores the myocardial production of GDF15 during ischemia-reperfusion, and reveals its potential ability to elicit preischemic cardioprotection in both in vivo and ex vivo settings. Intriguingly, these findings suggest mechanisms that operate independently of the immune, endocrine, or nervous systems. However, administering recombinant GDF15 (rGDF15) at reperfusion failed to confer beneficial effects, implying its limited capacity to counteract the detrimental changes established during ischemia. However, the cardioprotective potential of GDF15 may find application in other situations, such as conditions involving stroke-heart syndrome. While our study sheds light on the preischemic cardioprotective effects of GDF15, the specific pathways underlying its protective mechanisms remain largely unexplored. A crucial step for future research may involve investigating its potential to protect the mitochondria, offering a comprehensive understanding of its beneficial capacities. This knowledge could pave the way for therapeutic strategies, especially in the context of cardiovascular diseases and related complications. Declarations Declaration of competing interest The authors declare no competing interests. Data availability The data and support of these findings is available through contacting the corresponding author. Contributions G.D and C.V. designed the study; E.P performed the RT-qPCR experiments; G.D. performed the in vivo , ex vivo and molecular experiments, analysed the data and interpreted them; E.R. and M.J. assisted in the data collection and in designing the experimental protocols; G.D. wrote the first draft; L.R., Y.B. and C.V. revised and edited the manuscript. All authors approved the final version of the paper. Acknowledgements The authors thank Ivan Porcherot, Sandy Guner, Océane Gruson and Samy Belaid for technical assistance. Funding sources This study has been supported by funding from the French Ministry of Research, from the Regional Council of Burgundy, from the Association Bourguignonne de Cardiologie, and from the Regional University Hospital and Faculty of Health Sciences and from the ANR (SMOG15-CE17-009-01). References Bootcov, M. R. et al. MIC-1, a novel macrophage inhibitory cytokine, is a divergent member of the TGF-beta superfamily. Proc Natl Acad Sci U S A 94 , 11514-11519, doi:10.1073/pnas.94.21.11514 (1997). Bauskin, A. R. et al. The TGF-beta superfamily cytokine MIC-1/GDF15: secretory mechanisms facilitate creation of latent stromal stores. J Interferon Cytokine Res 30 , 389-397, doi:10.1089/jir.2009.0052 (2010). Emmerson, P. J. et al. The metabolic effects of GDF15 are mediated by the orphan receptor GFRAL. Nat Med 23 , 1215-1219, doi:10.1038/nm.4393 (2017). Hsu, J. Y. et al. Non-homeostatic body weight regulation through a brainstem-restricted receptor for GDF15. Nature 550 , 255-259, doi:10.1038/nature24042 (2017). Mullican, S. E. et al. GFRAL is the receptor for GDF15 and the ligand promotes weight loss in mice and nonhuman primates. Nat Med 23 , 1150-1157, doi:10.1038/nm.4392 (2017). Yang, L. et al. GFRAL is the receptor for GDF15 and is required for the anti-obesity effects of the ligand. Nat Med 23 , 1158-1166, doi:10.1038/nm.4394 (2017). Hagstrom, E. et al. Growth differentiation factor-15 level predicts major bleeding and cardiovascular events in patients with acute coronary syndromes: results from the PLATO study. Eur Heart J 37 , 1325-1333, doi:10.1093/eurheartj/ehv491 (2016). Zhang, S. et al. Prognostic value of growth differentiation factor-15 in patients with coronary artery disease: A meta-analysis and systematic review. Front Cardiovasc Med 10 , 1054187, doi:10.3389/fcvm.2023.1054187 (2023). Bonaca, M. P. et al. Growth differentiation factor-15 and risk of recurrent events in patients stabilized after acute coronary syndrome: observations from PROVE IT-TIMI 22. Arterioscler Thromb Vasc Biol 31 , 203-210, doi:10.1161/ATVBAHA.110.213512 (2011). Kempf, T. et al. The transforming growth factor-beta superfamily member growth-differentiation factor-15 protects the heart from ischemia/reperfusion injury. Circ Res 98 , 351-360, doi:10.1161/01.RES.0000202805.73038.48 (2006). Lok, S. I. et al. Circulating growth differentiation factor-15 correlates with myocardial fibrosis in patients with non-ischaemic dilated cardiomyopathy and decreases rapidly after left ventricular assist device support. Eur J Heart Fail 14 , 1249-1256, doi:10.1093/eurjhf/hfs120 (2012). Ahmad, T. et al. Effects of left ventricular assist device support on biomarkers of cardiovascular stress, fibrosis, fluid homeostasis, inflammation, and renal injury. JACC Heart Fail 3 , 30-39, doi:10.1016/j.jchf.2014.06.013 (2015). Zhang, Y. et al. Over-expression of growth differentiation factor 15 (GDF15) preventing cold ischemia reperfusion (I/R) injury in heart transplantation through Foxo3a signaling. Oncotarget 8 , 36531-36544, doi:10.18632/oncotarget.16607 (2017). Kempf, T. et al. GDF-15 is an inhibitor of leukocyte integrin activation required for survival after myocardial infarction in mice. Nat Med 17 , 581-588, doi:10.1038/nm.2354 (2011). Zhang, Y. et al. GDF15 Regulates Malat-1 Circular RNA and Inactivates NFkappaB Signaling Leading to Immune Tolerogenic DCs for Preventing Alloimmune Rejection in Heart Transplantation. Front Immunol 9 , 2407, doi:10.3389/fimmu.2018.02407 (2018). Breniere, C. et al. Growth Differentiation Factor-15 (GDF-15) Is Associated With Mortality in Ischemic Stroke Patients Treated With Acute Revascularization Therapy. Front Neurol 10 , 611, doi:10.3389/fneur.2019.00611 (2019). Meloux, A. et al. Association Between Growth Differentiation Factor-15 and Heart Failure Complicating Acute Myocardial Infarction. . Cardiol Cardiovasc Med 4 , 773-789 (2020). Meloux, A. et al. Ischemic Stroke Increases Heart Vulnerability to Ischemia-Reperfusion and Alters Myocardial Cardioprotective Pathways. Stroke 49 , 2752-2760, doi:10.1161/STROKEAHA.118.022207 (2018). Haraguchi-Suzuki, K. et al. Local anesthetic lidocaine-inducible gene, growth differentiation factor-15 suppresses the growth of cancer cell lines. Sci Rep 12 , 14520, doi:10.1038/s41598-022-18572-3 (2022). Kahli, A. et al. Growth differentiation factor-15 (GDF-15) levels are associated with cardiac and renal injury in patients undergoing coronary artery bypass grafting with cardiopulmonary bypass. PLoS One 9 , e105759, doi:10.1371/journal.pone.0105759 (2014). Bouchot, O. et al. Low Circulating Levels of Growth Differentiation Factor-15 Before Coronary Artery Bypass Surgery May Predict Postoperative Atrial Fibrillation. J Cardiothorac Vasc Anesth 29 , 1131-1139, doi:10.1053/j.jvca.2015.01.023 (2015). Zhang, M. et al. Growth differentiation factor 15 may protect the myocardium from no‑reflow by inhibiting the inflammatory‑like response that predominantly involves neutrophil infiltration. Mol Med Rep 13 , 623-632, doi:10.3892/mmr.2015.4573 (2016). Xu, J. et al. GDF15/MIC-1 functions as a protective and antihypertrophic factor released from the myocardium in association with SMAD protein activation. Circ Res 98 , 342-350, doi:10.1161/01.RES.0000202804.84885.d0 (2006). Rainer, P. P. et al. Cardiomyocyte-specific transforming growth factor beta suppression blocks neutrophil infiltration, augments multiple cytoprotective cascades, and reduces early mortality after myocardial infarction. Circ Res 114 , 1246-1257, doi:10.1161/CIRCRESAHA.114.302653 (2014). Olsen, O. E., Skjaervik, A., Stordal, B. F., Sundan, A. & Holien, T. TGF-beta contamination of purified recombinant GDF15. PLoS One 12 , e0187349, doi:10.1371/journal.pone.0187349 (2017). Tsai, V. W. W., Husaini, Y., Sainsbury, A., Brown, D. A. & Breit, S. N. The MIC-1/GDF15-GFRAL Pathway in Energy Homeostasis: Implications for Obesity, Cachexia, and Other Associated Diseases. Cell Metab 28 , 353-368, doi:10.1016/j.cmet.2018.07.018 (2018). Breit, S. N., Tsai, V. W. & Brown, D. A. Targeting Obesity and Cachexia: Identification of the GFRAL Receptor-MIC-1/GDF15 Pathway. Trends Mol Med 23 , 1065-1067, doi:10.1016/j.molmed.2017.10.005 (2017). Sciarretta, S., Forte, M., Frati, G. & Sadoshima, J. New Insights Into the Role of mTOR Signaling in the Cardiovascular System. Circ Res 122 , 489-505, doi:10.1161/CIRCRESAHA.117.311147 (2018). Li, D. Y. et al. Role of ERK1/2 in the anti-apoptotic and cardioprotective effects of nitric oxide after myocardial ischemia and reperfusion. Apoptosis 11 , 923-930, doi:10.1007/s10495-006-6305-6 (2006). Yellon, D. M., Beikoghli Kalkhoran, S. & Davidson, S. M. The RISK pathway leading to mitochondria and cardioprotection: how everything started. Basic Res Cardiol 118 , 22, doi:10.1007/s00395-023-00992-5 (2023). Song, J. et al. Inhibition of FOXO3a/BIM signaling pathway contributes to the protective effect of salvianolic acid A against cerebral ischemia/reperfusion injury. Acta Pharm Sin B 9 , 505-515, doi:10.1016/j.apsb.2019.01.010 (2019). Xie, Y. et al. Ischemic preconditioning attenuates ischemia/reperfusion-induced kidney injury by activating autophagy via the SGK1 signaling pathway. Cell Death Dis 9 , 338, doi:10.1038/s41419-018-0358-7 (2018). Juhasz, B. et al. Bromelain induces cardioprotection against ischemia-reperfusion injury through Akt/FOXO pathway in rat myocardium. Am J Physiol Heart Circ Physiol 294 , H1365-1370, doi:10.1152/ajpheart.01005.2007 (2008). Qi, X. F. et al. Involvement of the FoxO3a pathway in the ischemia/reperfusion injury of cardiac microvascular endothelial cells. Exp Mol Pathol 95 , 242-247, doi:10.1016/j.yexmp.2013.08.003 (2013). Haudek, S. B. et al. Overexpression of cardiac I-kappaBalpha prevents endotoxin-induced myocardial dysfunction. Am J Physiol Heart Circ Physiol 280 , H962-968, doi:10.1152/ajpheart.2001.280.3.H962 (2001). Zhang, X. Q. et al. Cardiomyocyte-specific p65 NF-kappaB deletion protects the injured heart by preservation of calcium handling. Am J Physiol Heart Circ Physiol 305 , H1089-1097, doi:10.1152/ajpheart.00067.2013 (2013). Roth, S. et al. Pharmacological Conditioning of the Heart: An Update on Experimental Developments and Clinical Implications. Int J Mol Sci 22 , doi:10.3390/ijms22052519 (2021). Lucchinetti, E., da Silva, R., Pasch, T., Schaub, M. C. & Zaugg, M. Anaesthetic preconditioning but not postconditioning prevents early activation of the deleterious cardiac remodelling programme: evidence of opposing genomic responses in cardioprotection by pre- and postconditioning. Br J Anaesth 95 , 140-152, doi:10.1093/bja/aei155 (2005). Heiberg, J., Royse, C. F., Royse, A. G. & Andrews, D. T. Propofol Attenuates the Myocardial Protection Properties of Desflurane by Modulating Mitochondrial Permeability Transition. Anesth Analg 127 , 387-397, doi:10.1213/ANE.0000000000003450 (2018). Heusch, G. Cardioprotection: chances and challenges of its translation to the clinic. Lancet 381 , 166-175, doi:10.1016/S0140-6736(12)60916-7 (2013). Duicu, O. M., Angoulvant, D. & Muntean, D. M. Cardioprotection against myocardial reperfusion injury: successes, failures, and perspectives. Can J Physiol Pharmacol 91 , 657-662, doi:10.1139/cjpp-2013-0048 (2013). Moss, N. C. et al. Inhibitory kappa B kinase-beta is a target for specific nuclear factor kappa B-mediated delayed cardioprotection. J Thorac Cardiovasc Surg 136 , 1274-1279, doi:10.1016/j.jtcvs.2008.07.041 (2008). Onai, Y. et al. Inhibition of NF-kappaB improves left ventricular remodeling and cardiac dysfunction after myocardial infarction. Am J Physiol Heart Circ Physiol 292 , H530-538, doi:10.1152/ajpheart.00549.2006 (2007). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 25 Mar, 2024 Reviews received at journal 22 Mar, 2024 Reviewers agreed at journal 12 Mar, 2024 Reviewers invited by journal 12 Mar, 2024 Editor assigned by journal 12 Mar, 2024 Editor invited by journal 07 Mar, 2024 Submission checks completed at journal 07 Mar, 2024 First submitted to journal 17 Feb, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3963740","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":278059366,"identity":"6b5e6ad0-d359-43fd-954b-039fe7635404","order_by":0,"name":"Geoffrey Dogon","email":"","orcid":"","institution":"University of Bourgogne","correspondingAuthor":false,"prefix":"","firstName":"Geoffrey","middleName":"","lastName":"Dogon","suffix":""},{"id":278059367,"identity":"d12051b1-3403-4236-9e8f-21e1ad92d3f9","order_by":1,"name":"Eve Rigal","email":"","orcid":"","institution":"University of Bourgogne","correspondingAuthor":false,"prefix":"","firstName":"Eve","middleName":"","lastName":"Rigal","suffix":""},{"id":278059368,"identity":"952b9b1f-0fd9-41a1-9eb1-b48a5ad8bd4f","order_by":2,"name":"Eliot Potel","email":"","orcid":"","institution":"University of Bourgogne","correspondingAuthor":false,"prefix":"","firstName":"Eliot","middleName":"","lastName":"Potel","suffix":""},{"id":278059369,"identity":"17a9d919-25a7-4e7c-9e8a-57f9f2e555d8","order_by":3,"name":"Marie Josse","email":"","orcid":"","institution":"University of Bourgogne","correspondingAuthor":false,"prefix":"","firstName":"Marie","middleName":"","lastName":"Josse","suffix":""},{"id":278059370,"identity":"f051c83d-d4d9-4ca1-905d-c5aa0b4993ef","order_by":4,"name":"Luc Rochette","email":"","orcid":"","institution":"University of Bourgogne","correspondingAuthor":false,"prefix":"","firstName":"Luc","middleName":"","lastName":"Rochette","suffix":""},{"id":278059371,"identity":"3490c036-bab5-4fa6-aa91-f2e839fd67a8","order_by":5,"name":"Yannick Bejot","email":"","orcid":"","institution":"University of Bourgogne","correspondingAuthor":false,"prefix":"","firstName":"Yannick","middleName":"","lastName":"Bejot","suffix":""},{"id":278059372,"identity":"06838bbd-0e0a-4d58-824b-1fdc96b08056","order_by":6,"name":"Catherine Vergely","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABA0lEQVRIie3QMUvDQBTA8RcOkiVy6wvqd7gQqB1Kg9/khYOuDgVx6BAQzqXQ9YqfQRAE57rU5bBrphJwlwRFMokpbUGHXjsK3n97x/sdxwG4XH+3LnAA/8dBby9BiPJfZHAAEbNDCddyXn9cYfZQkF/Watmf8LunEmi5+/piIG9PDGaPBQXxVA3lVL9JATTcSURoEhapFbn4PD5SJEVhOug1ZCGLdxZ9tQ/T5G/JWQNkIcGYeXWO2T2uSV8sxh2wEXxWCYM5JtqUQaxfiCIdJkgWwq/Zq9eMeqeTm/bHqktKOTdxVVnIKhYCnOebIcux3bYDAK8BSLdDCny2Z9/lcrn+W981CFKi1ww3NgAAAABJRU5ErkJggg==","orcid":"","institution":"University of Bourgogne","correspondingAuthor":true,"prefix":"","firstName":"Catherine","middleName":"","lastName":"Vergely","suffix":""}],"badges":[],"createdAt":"2024-02-17 10:15:46","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3963740/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3963740/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":52549106,"identity":"38ca49cb-ae1c-465d-ad81-ae283ec84518","added_by":"auto","created_at":"2024-03-12 20:01:48","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":106596,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eIn vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e myocardial ischemia reperfusion experimental protocols\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eTransient regional ischemia was induced in rats by \u003cem\u003ein vivo\u003c/em\u003e ligation of the left anterior descending (LAD) coronary artery for 30 minutes followed by 24 h of reperfusion. (A) Preconditioning protocol involved intravenous injection of saline (control) or rGDF15 (2.5 µg/kg) 20 minutes before ischemia; (B) Postconditioning protocol included intravenous injection of saline (control) or rGDF15 (2.5 µg/kg) 2 minutes before reperfusion (after 28 minutes of ischemia). Hearts were then harvested to determine the infarct size.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-3963740/v1/eb80d23bdbdd3c540f43dea7.png"},{"id":52549105,"identity":"c24ac852-264e-4b1f-8fe6-1b5c63823a10","added_by":"auto","created_at":"2024-03-12 20:01:47","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":111126,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eEx vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e myocardial ischemia reperfusion experimental protocols\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eTransient global ischemia was induced by stopping the supply of Krebs-Henseleit buffer in isolated perfused rat hearts for 30 minutes, followed by 2 h of reperfusion. \u003cstrong\u003e(A)\u003c/strong\u003e Preconditioning protocol : saline (control) or rGDF15 (2 µg/L) were perfused 10 minutes before ischemia; \u003cstrong\u003e(B)\u003c/strong\u003e Postconditioning protocol: which saline (control) or rGDF15 (2 µg/L) were perfused during the initial 10 minutes of reperfusion. Functional parameters (coronary flow, left ventricular pressures, heart rate) were measured throughout the experiment. At the end of the procedure, the heart’s infarct size was determined.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-3963740/v1/1aa024aff1602cc1473b9ce4.png"},{"id":52549103,"identity":"9741d611-5988-4fbe-a916-8f7278bb65b5","added_by":"auto","created_at":"2024-03-12 20:01:47","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":281127,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGDF15 circulating levels and cardiac expression in response to myocardial I/R or Sham operation in rats\u003c/strong\u003e. \u003cstrong\u003e(A) \u003c/strong\u003eGDF15 plasma levels before ischemia, after 30 min and 24 h of reperfusion; \u003cstrong\u003e(B)\u003c/strong\u003e GDF15 mRNA expression\u003cstrong\u003e \u003c/strong\u003ein the remote and the ischemic zone of the ischemic heart after 24 h of reperfusion. **P\u0026lt;0.01 vs remote zone using ANOVA; \u003cstrong\u003e(C)\u003c/strong\u003e Pro- and mature GDF15 protein expression in the remote and the ischemic zone of the ischemic heart after 24 h of reperfusion. *P\u0026lt;0.05 vs Sham using Student test; \u003cstrong\u003e(D)\u003c/strong\u003e Pro- and mature GDF15 chemiluminescence from the total protein blotted.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-3963740/v1/af0d203ca58ce4d0092637df.png"},{"id":52549441,"identity":"d5cd0a1e-a48e-4037-9e97-11dd2b8f5059","added_by":"auto","created_at":"2024-03-12 20:09:47","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":82558,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePlasma levels of GDF15 after intravenous injection of 2.5 µg/kg rGDF-15\u003c/strong\u003e. ***P\u0026lt;0.001 vs. basal levels using one-way ANOVA for repeated measures followed by Holm-Sidak’s post-hoc analysis.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-3963740/v1/62ebb8d15651ade45ffe8598.png"},{"id":52549442,"identity":"483a1b4b-2104-4a80-9921-db1b0111099d","added_by":"auto","created_at":"2024-03-12 20:09:48","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":189893,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eArea at risk (A, C) and infarct size (B, D) \u003c/strong\u003eassessment after 24 h of reperfusion following 30 minutes of LAD coronary artery ligation in rats intravenously injected with saline (control) or rGDF15 (2.5 µg/kg) either \u003cstrong\u003e(A, B) \u003c/strong\u003e20 minutes before ischemia: preconditioning protocol; or \u003cstrong\u003e(C, D)\u003c/strong\u003e 2 minutes before reperfusion: post conditioning protocol. **P\u0026lt;0.01 vs control group using Student test.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-3963740/v1/0804853aee1aefef978f1442.png"},{"id":52549109,"identity":"d6938f1e-ee72-4b75-a436-2f86b906ca7d","added_by":"auto","created_at":"2024-03-12 20:01:48","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":889962,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEvolution of contractile parameters\u003c/strong\u003e \u003cstrong\u003eof isolated perfused hearts \u003c/strong\u003eduring the ex vivo control and rGDF15 \u003cstrong\u003epreconditioning \u003c/strong\u003eprotocol, along with their corresponding infarct sizes. \u003cstrong\u003e(A)\u003c/strong\u003eLVDevP; \u003cstrong\u003e(B)\u003c/strong\u003e LVDevP recovery during the 2-hour reperfusion (normalized by the mean baseline LVDevP); \u003cstrong\u003e(C)\u003c/strong\u003e +dP/dt; \u003cstrong\u003e(D)\u003c/strong\u003e -dP/dt; \u003cstrong\u003e(E)\u003c/strong\u003e Heart rate; \u003cstrong\u003e(F)\u003c/strong\u003e Infarct size at the end of the 2-hour reperfusion. *P\u0026lt;0.05 vs control group using two-way ANOVA for repeated measures with Tukey’s post hoc analysis.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-3963740/v1/711254bd2eb0e89c3e28abe6.png"},{"id":52549108,"identity":"c029b574-1f40-454e-b296-08385f3a7718","added_by":"auto","created_at":"2024-03-12 20:01:48","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":760280,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEvolution of contractile parameters\u003c/strong\u003e \u003cstrong\u003eof isolated perfused hearts \u003c/strong\u003eduring the ex vivo control and rGDF15 \u003cstrong\u003epost-conditioning\u003c/strong\u003e protocol, along with their corresponding infarct sizes. \u003cstrong\u003e(A) \u003c/strong\u003eLVDevP; \u003cstrong\u003e(B)\u003c/strong\u003e LVDevP recovery during the 2-hour reperfusion; \u003cstrong\u003e(C)\u003c/strong\u003e +dP/dt; \u003cstrong\u003e(D)\u003c/strong\u003e -dP/dt; \u003cstrong\u003e(E)\u003c/strong\u003e Heart rate; \u003cstrong\u003e(F) \u003c/strong\u003eInfarct size at the end of the 2-hour reperfusion.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-3963740/v1/64f40c485bb032d72346b3de.png"},{"id":52549514,"identity":"7172d2bf-ab83-48f3-b20a-6c9a163b1d3e","added_by":"auto","created_at":"2024-03-12 20:17:48","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2234500,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3963740/v1/ef9b549f-d4a5-4e6b-87e9-6de797bef3d1.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Growth Differentiation Factor 15 (GDF15) Expression in the Heart After Myocardial Infarction and Cardioprotective Effect of Pre-Ischemic rGDF15 Administration","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe macrophage inhibitory cytokine-1 (MIC-1), also known as Growth and Differentiation Factor 15 (GDF15), stands out as a distinct member of the transforming growth factor superfamily (TGF-β) \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Initially produced as a\u0026thinsp;\u0026asymp;\u0026thinsp;40 kDa pro-peptide monomer, it undergoes processing into a biologically active mature homodimer of \u0026asymp;\u0026thinsp;25 kDa. This mature form can be either be secreted or stored within the matrix\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Contrary to traditional TGF-β members, recent research highlights that GDF15 does not bind to TGF-β receptors. Instead, it interacts with the endogenous receptor GDNF-family α-like (GFRAL), exclusively present in the hindbrain\u003csup\u003e\u003cspan additionalcitationids=\"CR4 CR5\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Activation of GFRAL by GDF15 induces metabolic functions, notably influencing appetite and regulating body mass, further emphasizing its uniqueness within the TGF-β superfamily. This distinctive profile suggests that GDF15 might be more appropriately classified within the GDNF family.\u003c/p\u003e \u003cp\u003eGDF15 plays diverse and significant roles in various pathophysiological conditions, including cancer, inflammation, and cardiovascular diseases. It is emerging as a pivotal biomarker, particularly in identifying patients at risk of poor prognosis. While its expression is typically low in healthy tissues, including the heart, pathological circumstances such as cardiovascular (CV) comorbidities, oxidative stress, or hypoxia significantly increase its expression. Notably, patients with atrial fibrillation, heart failure, atherosclerosis and, most predominantly, coronary artery diseases (CAD) exhibit higher GDF15 levels. In contrast to some other cardiovascular biomarkers, GDF15 plasma levels remain remarkably stable both in the acute setting and during the stabilizing period in CAD patients, providing valuable short- to long-term prognostic information. Patients admitted with elevated GDF15 concentrations (\u0026gt;\u0026thinsp;1,800 ng/L) face an increased risk of all-cause mortality, CV mortality and myocardial infarction (MI)\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e, even after adjusting for classic biomarkers such as hs-troponin T, cystatin C, hs-CRP and NT-proBNP\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Despite its expression in the infarcted myocardium, the correlation between GDF15 and myocardial damage or function is still a subject of debate\u003csup\u003e\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eExperimental research has revealed an elevation in GDF15 levels in the blood after MI and ischemic stroke, accompanied by increased GDF15 pro-peptide expression in the surrounding ischemic area. \u003cem\u003eIn vitro\u003c/em\u003e studies have demonstrated that cardiomyocytes produce GDF15 under hypoxia and in response to other stressors such as pro-inflammatory cytokines, oxidative stress, and mechanical stretch. Intriguingly, GDF15 exhibits cardioprotective properties by reducing cardiomyocytes apoptosis during simulated ischemia-reperfusion (I/R) through activation of the PI3K-Akt signalling pathway, despite the absence of an identified cardiac GDF15 receptor to date. \u003cem\u003eIn vivo\u003c/em\u003e studies with GDF15 deficient mice revealed increased infarct sizes and a higher number of apoptotic cardiomyocyte after I/R\u003csup\u003e10,13\u003c/sup\u003e. Those effects are believed to be primarily mediated through the regulation of inflammation by modulating leukocyte infiltration in the infarcted area\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e and promoting immune tolerance\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThis study initially sought to analyse the expression and secretion kinetics of GDF15 in response to myocardial I/R. Subsequently, we investigated its direct cardiac effects in both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003eex vivo\u003c/em\u003e models of I/R, utilizing recombinant GDF15 concentrations relevant to patients with a high CV risk, so as to assess the potential suitability of rGDF15 a therapeutic strategy in the context of myocardial infarction.\u003c/p\u003e"},{"header":"Materials \u0026 methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003eAnimals\u003c/h2\u003e\n\u003cp\u003eWistar Han male rats (8\u0026ndash;9 weeks, Charles River) were utilized for experiments. All animals received humane care, and study protocols were in compliance with institutional guidelines. The investigation adhered to Directive 2010/63/EU of the European Parliament and the Guide for the Care of Laboratory Animals published by the US Nation Institutes of Health (NIH Publication No. 85\u0026thinsp;\u0026minus;\u0026thinsp;23, revised 1996) and was approved by the local ethics committee (Comit\u0026eacute; d\u0026rsquo;Ethique de l\u0026rsquo;Exp\u0026eacute;rimentation Animale Universit\u0026eacute; Bourgogne Franche-Comt\u0026eacute;, Dijon, France, protocol agreement number: APAFIS#16546-2018082915228167v4). The present study is in accordance with ARRIVE guidelines. Animals were housed at 21\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C with a constant humidity of 55\u0026thinsp;\u0026plusmn;\u0026thinsp;10%, following a light/dark cycle of 12 h, and had free access to water and a standard diet \u003cem\u003ead libitum\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e1. Assessment of GDF15 expression after\u003c/strong\u003e \u003cstrong\u003ein vivo\u003c/strong\u003e \u003cstrong\u003eischemia reperfusion injury\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIn vivo\u003c/strong\u003e \u003cstrong\u003eischemia reperfusion surgery\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRats were deeply anesthetized with isoflurane for 2 minutes in an induction box (2 L/min, 5% Isoflurane) and then transferred to a mask (0.6 L/min, 2% Isoflurane) and injected with buprenorphine (0.075 mg/kg). A lidocaine/prilocaine was applied to the incision site as a local anaesthetic (ANESDERM 5%). Once complete nociception loss was achieved, animals were intubated and ventilated (VentElite 55-7040, Harvard Apparatus). A left thoracotomy was realized between the 3rd and 4th intercostal space. A 6.0 silk suture (K889H, Ethicon) was placed under the left anterior descending (LAD) coronary artery, tightened and knotted on a catheter to interrupt blood flow and to induce 30 minutes of ischemia. The knot was then released and the catheter removed to initiate reperfusion. Subsequently, the rib cage was closed with a 5.0 prolene suture (EH7229H, Ethicon), and pleural void was eliminated by aspirating excess air with a syringe. After skin closure with a 5.0 prolene suture (7475H, Ethicon), animals were awakened and placed in a 37\u0026deg;C incubator until they fully recovered (Cimuka PD30SH, Ducatillon). Sham-operated animals underwent an identical procedure, with the only difference being that the knot was loosely tied.\u003c/p\u003e\n\u003cp\u003eDuring surgery, blood samples were collected at various time points from the ventral caudal artery or in the inferior vena cava depending on whether the animal was sacrificed just after. The samples were collected in tubes containing lithium heparin (15.1673, Sarstedt) and centrifuged 5 min at 5,000 G to isolate the plasma. The plasma was then rapidly frozen in liquid nitrogen and stored at -80\u0026deg;C until further analysis.\u003c/p\u003e\n\u003cp\u003eAfter 24 h of reperfusion, rats were re-anesthetized with isoflurane and intubated following the previously describe procedure. The chest was reopened, and the heart was removed. The left ventricle was divided into two distinct regions: the first contained the ischemic zone (IZ), and the second corresponding to the non-ischemic remote zone (RZ). Tissues were promptly weighted, flash-frozen in liquid nitrogen, and stored at -80\u0026deg;C until further processing.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n\u003ch2\u003eEnzyme-linked immunosorbent assay (ELISA)\u003c/h2\u003e\n\u003cp\u003eCirculating GDF15 concentrations were determined in thawed plasma samples using a commercial ELISA kit (MGD150, Bio-Techne) following the manufacturer\u0026rsquo;s protocol. Briefly, samples were incubated in a microplate coated with mouse/rat monoclonal GDF15 antibody for 2 hours at room temperature (RT). After multiple washes, a primary mouse/rat GDF15 antibody conjugated to horseradish peroxidase was added to each well and incubated for an additional 2 hours at RT and before another wash. Colorimetric revelation was initiated by a mix of hydrogen peroxide and tetramethylbenzidine and stopped by the addition of hydrochloric acid. The optical density of each well was immediately determined using a spectrophotometer VICTOR\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e (Perkin Elmer) at 450 nm.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n\u003ch2\u003eQuantitative real-time PCR (RT-qPCR) analysis\u003c/h2\u003e\n\u003cp\u003eTotal RNA was extracted from frozen rat left ventricles using NucleoZOL reagent (NucleoSpin\u0026reg; RNA Set for NucleoZOL MACHEREY-NAGEL). RNA quality and integrity were assessed using a Nanodrop and an Agilent 2100 Bioanalyzer (G2939B, Agilent), respectively. Reverse transcription was performed using the PrimeScript RT reagent kit (RR037B, TaKaRa) following the manufacturer\u0026rsquo;s protocol. RT-qPCR was carried out with 2 \u0026micro;l of cDNA using the SYBR-Green PCR Master-Mix (Applied Biosystems) and both sense and antisense primers (5 mM) in a final volume of 20 \u0026micro;L, utilizing a StepOne-Real-Time PCR system (Applied Biosystems). Data were analysed using relative quantification, normalized against GAPDH mRNA as the housekeeping gene, and presented as fold change compared to the RZ of Sham operated rats. Primers used for the amplification of rats\u0026rsquo; genes are provided in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003ePrimers sequences for RT-qPCR.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGene\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003ePrimer\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eSequence\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eLength (bp)\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eGDF15\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eForward\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5\u0026rsquo;- CGAGAGGACTCGAACTCAGA-3\u0026rsquo;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e71\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eReverse\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5\u0026rsquo;- CCCAATCTCACCTCTGGACT-3\u0026rsquo;\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eGAPDH\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eForward\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5\u0026rsquo;- AAGGTCATCCCAGAGCTGAA \u0026minus;\u0026thinsp;3\u0026rsquo;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e138\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eReverse\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5\u0026rsquo;- CTGCTTCACCACCTTCTTGA \u0026minus;\u0026thinsp;3\u0026rsquo;\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n\u003ch2\u003eWestern blot analysis\u003c/h2\u003e\n\u003cp\u003eHeart tissues were lysed with the Precellys\u0026reg; homogenizer combined with the Cryolys module (Bertin technologies), with zirconium beads (ZROB10, Next Advance) in 10 volumes of radioimmunoprecipitation assay (R0278, Sigma-Aldrich) buffer containing protease and phosphatase inhibitors (A32961, ThermoFisher) at 4\u0026deg;C. Homogenates were then centrifuged at 10,000 g for 15 min at 4\u0026deg;C to separate proteins from cells debris, and supernatant protein concentration was measured using the Lowry method.\u003c/p\u003e\n\u003cp\u003eEqual protein amounts were loaded and separated on a sodium dodecylsulfate-polyacrylamide (SDS-PAGE) TGX Stain-Free FastCast gel electrophoresis (TGX Stain-Free FastCast Acrylamide kit 12%, 1610175, Bio-Rad) under reducing and denaturing conditions. Proteins were then transferred to a polyvinylidene difluoride (PVDF) membrane using the Turbo Transblot technology. After blocking non-specific binding sites with 5% non-fat milk in 0.1% PBS/TWEEN 20 for 1 hour at RT, membranes were incubated overnight at 4\u0026deg;C with primary antibodies against anti-GDF15 (1:500, ab206414, Abcam).\u003c/p\u003e\n\u003cp\u003eMembranes were washed three times for 5 min with 0.1% PBS/TWEEN 20 and then incubated for1 hour at RT with anti-rabbit IgG HRP-linked secondary antibody (7074, Cell Signaling). Detection of antibodies reactivity was performed with WesternBright\u0026trade; Sirius substrate (K-12043, Advansta) using the Chemidoc imaging system (Bio-Rad). Each revealed band was normalized by the total amount of proteins loaded on the corresponding lane obtained with the stain-free technology. Gels were run in duplicate, and chemiluminescence measurements were analysed with Image Lab software (version 6.1.0, Bio-Rad).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2. Assessment of GDF15 cardioprotective effect\u003c/strong\u003e \u003cstrong\u003ein vivo\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIn vivo\u003c/strong\u003e \u003cstrong\u003econditioning protocols\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDuring surgery, rats were injected with either 0.9% saline or 2.5 \u0026micro;g/kg of rGDF15 in the dorsal penile vein. The injection was administered 20 min before the transient ligation of the LAD coronary artery (preconditioning protocol) or after 28 min of ischemia (postconditioning protocol; Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eTransient regional ischemia was induced in rats by \u003cem\u003ein vivo\u003c/em\u003e ligation of the left anterior descending (LAD) coronary artery for 30 minutes followed by 24 h of reperfusion. (A) Preconditioning protocol involved intravenous injection of saline (control) or rGDF15 (2.5 \u0026micro;g/kg) 20 minutes before ischemia; (B) Postconditioning protocol included intravenous injection of saline (control) or rGDF15 (2.5 \u0026micro;g/kg) 2 minutes before reperfusion (after 28 minutes of ischemia). Hearts were then harvested to determine the infarct size.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIn vivo\u003c/strong\u003e \u003cstrong\u003einfarct size quantification\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter 24 h of reperfusion, rats were anesthetized again with isoflurane, intubated, and the chest was reopened. The cardiac suture left in place was retied to recreate the same ischemia. A 5% Evans\u0026rsquo; blue saline solution was injected in the inferior vena cava to dye every normally perfused tissue in blue, leaving the area at risk (AAR) uncoloured. Immediately afterward, heart was harvested, and the left ventricle (LV) was isolated, slightly frozen for 15 min, and sliced into four 1 mm-thick slices from the apex to the ischemic suture. Each slice was then weighted and scanned to determine the area at risk as the percentage of the undyed area by the LV total area. Slices were incubated for 12 minutes in a 2% solution of 1,3,5-Triphenyltetrazolium chloride (TTC, T-8877, Sigma-Aldrich) in phosphate buffer (pH\u0026thinsp;=\u0026thinsp;7.4) at 37\u0026deg;C, then transferred in 10% formalin for 1 hour at RT. Heart slices were mounted between two microscope glass slides to scan both faces. Digital images were analysed with ImageJ software (version 1.53c, NIH). The infarct size was reported as a percentage of the area at risk.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3. Evaluation of GDF15 cardioprotective effect\u003c/strong\u003e \u003cstrong\u003eex vivo\u003c/strong\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n\u003ch2\u003eIsolated perfused heart preparation\u003c/h2\u003e\n\u003cp\u003eThe perfusion medium was a modified Krebs-Henseleit bicarbonate buffer containing the following in mmoles/L: 118 NaCl, 25 NaHCO\u003csub\u003e3\u003c/sub\u003e, 1.2 KH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 1.2 MgSO\u003csub\u003e4\u003c/sub\u003e\u0026middot;7H\u003csub\u003e2\u003c/sub\u003eO, 3.96 KCl, 2 CaCl\u003csub\u003e2\u003c/sub\u003e\u0026middot;2H\u003csub\u003e2\u003c/sub\u003eO and 5.5 glucose. It was filtered through a 0.45 \u0026micro;m filter (HAWP04700, Merck KGaA) to avoid any particulate contaminants and constantly gassed with 95% 0\u003csub\u003e2\u003c/sub\u003e and 5% CO\u003csub\u003e2\u003c/sub\u003e, maintaining an adjusted end-pH of 7.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05 at 37\u0026deg;C.\u003c/p\u003e\n\u003cp\u003eRats were deeply anesthetized with isoflurane for 2 minutes in an induction box (2 L/min, 5% Isoflurane) then transferred to a mask (0.6 L/min, 3% Isoflurane) and injected with heparin (500 IU/kg, i.p.) to prevent blood clotting. After the loss of all nociceptive reflexes, the chest of the animal was opened and the heart was quickly removed and placed in a cold perfusion buffer bath (4\u0026deg;C) until all contraction ceased. The heart was immediately cannulated by the aorta on the Langendorff system and retrogradely perfused with Krebs-Henseleit perfusion buffer at a constant pressure of 80 mmHg and temperature of 37\u0026deg;C. An elastic water-filled latex balloon (73-3479, Harvard Apparatus) connected to a pressure transducer was introduced into the LV to measure intra-ventricular pressures. The balloon was inflated to obtain an initial left ventricular end-diastolic pressure (LVDP) of 8\u0026ndash;13 mmHg and left unchanged. The following functional parameters were recorded: heart rate (HR), left ventricular end-systolic pressure (LVSP), LVDP, left ventricular developed pressure (LVDevP\u0026thinsp;=\u0026thinsp;LVSP - LVDP) and the first derivative of the LVDevP: the left ventricular maximal pressure development (+\u0026thinsp;dP/dt) and left ventricular minimal pressure development (-dP/dt) (PowerLab\u0026reg;, LabChart\u0026reg; System, ADInstruments). Coronary flow (CF) was measured by time-point collection of the effluent.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEx vivo\u003c/strong\u003e \u003cstrong\u003econditioning protocols\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHearts were allowed to stabilize for approximately 10\u0026ndash;15 min before recording basal cardiac parameters. During the 10 minutes of basal measurements, isolated hearts were either perfused with either 4 mM HCl (as control perfusion, rGDF15 diluent) or 2 \u0026micro;g/L rGDF15 (8944-GD, Bio-Techne) in the preconditioning protocol. Alternatively, in the postconditioning protocol, perfusion was done during the first 10 minutes of reperfusion. In both protocols, control and rGDF15 perfusion were adjusted to 1/100th of the coronary flow (Fig.\u0026nbsp;2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEx vivo\u003c/strong\u003e \u003cstrong\u003einfarct size quantification\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAt the end of the 2-hour reperfusion period, hearts were removed from the Langendorff system, promptly dried, weighted, and briefly frozen for 15 min to firm the muscle. Subsequently, the total ventricular area was divided into 6 transverse sections, each 1 mm-thick, and incubated with TTC to evaluate infarct size, as described before. Infarct area was calculated as the percentage of the total ventricular area.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n\u003ch2\u003e4. Statistical analysis\u003c/h2\u003e\n\u003cp\u003eData sets were analysed using SigmaPlot (version 12.5, Systat Software), and statistical significance was considered when \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Normality and homoscedasticity of data sets were verified before applying parametric tests; therefore, differences between two groups were assessed by a Student\u0026rsquo;s t-test. GDF15 pharmacokinetic was statistically evaluated by a one-way ANOVA for repeated measures, and \u003cem\u003eex vivo\u003c/em\u003e heart function by a two-way ANOVA for repeated measures, followed by a Tukey\u0026rsquo;s post hoc analysis, as indicated in each figure. Data are represented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e1. GDF15 is expressed at the gene and protein level in the ischemic zone after\u003c/strong\u003e \u003cstrong\u003ein vivo\u003c/strong\u003e \u003cstrong\u003emyocardial infarction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDuring surgery, preischemic GDF15 circulating levels were around 200 ng/L in both groups of rats: 283\u0026thinsp;\u0026plusmn;\u0026thinsp;24 ng/L in Sham, 211\u0026thinsp;\u0026plusmn;\u0026thinsp;24 ng/L in I/R groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA). At the end of myocardial ischemia, just before reperfusion, GDF-15 plasma levels increased to above 950 ng/L. Then, 30 minutes after starting reperfusion, GDF15 peaked around 1,600 ng/L both in I/R and sham-operated rats (1,568\u0026thinsp;\u0026plusmn;\u0026thinsp;383 ng/L in Sham, 1,609\u0026thinsp;\u0026plusmn;\u0026thinsp;131 ng/L in I/R groups). 24 hours after reperfusion, GDF15 levels returned to their preischemic levels in both groups (205\u0026thinsp;\u0026plusmn;\u0026thinsp;13 ng/L in Sham, 255\u0026thinsp;\u0026plusmn;\u0026thinsp;24 ng/L in I/R groups).\u003c/p\u003e\n\u003cp\u003eIn hearts collected 24 h after reperfusion, there was an increase in GDF15 mRNA expression observed in the IZ of hearts from I/R rats, but not in those from sham-operated rats (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB). Additionally, in I/R hearts, there was an increase in pro-GDF15 expression in both the RZ and the IZ, while in the IZ, a six-fold increase in mature GDF15 expression was observed (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC, Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2. rGDF15 preconditioning, not postconditioning, improves myocardial I/R injury\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn order to assess whether GDF15 exerts cardioprotective effects during \u003cem\u003ein vivo\u003c/em\u003e myocardial I/R injury, recombinant GDF15 (rGDF15) was administrated intravenously before or after post-ischemic reperfusion. Our objective was to achieve GDF15 concentrations relevant to those observed in patients with a high CV risk, i.e 2,000 to 4,000 ng/L\u003csup\u003e16,17\u003c/sup\u003e. For this purpose, we conducted pharmacokinetics assays in anesthetized rats intravenously injected with 2.5 \u0026micro;g/mL rGDF15. Baseline GDF15 circulating levels were similar in the control and GDF15 groups, at 239\u0026thinsp;\u0026plusmn;\u0026thinsp;13 ng/L and 271\u0026thinsp;\u0026plusmn;\u0026thinsp;26 ng/L, respectively (Fig.\u0026nbsp;4). Immediately after rGDF15 injection, GDF15 plasma levels increased to levels above 20,000 ng/L. However, 20 min after injection, GDF15 levels reached 4,013\u0026thinsp;\u0026plusmn;\u0026thinsp;528 ng/L in the GDF15 group while remaining stable at 211\u0026thinsp;\u0026plusmn;\u0026thinsp;23 ng/L in the control group. 24 h after rGDF15 injection, control and GDF15 groups returned to similar baseline levels around 204\u0026thinsp;\u0026plusmn;\u0026thinsp;13 ng/L and 233\u0026thinsp;\u0026plusmn;\u0026thinsp;24 ng/L, respectively (Fig.\u0026nbsp;4).\u003c/p\u003e\n\u003cp\u003eThe cardioprotective effects of rGDF15 in both pre- and postconditioning protocols were evaluated \u003cem\u003ein vivo\u003c/em\u003e as described above. 24 h after ischemia, the AAR, determined by Evans\u0026rsquo; blue dye injection, did not differ between the control and GDF15 groups in both pre- and postconditioning protocol groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA and C). Consequently, infarct sizes could be rigorously compared between the groups. In the preischemic protocol, rGDF15 reduced infarct size (65\u0026thinsp;\u0026plusmn;\u0026thinsp;5% in the control group vs. 42\u0026thinsp;\u0026plusmn;\u0026thinsp;6% in GDF15 groups, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eB). However, in the postconditioning protocol, both experimental groups displayed a similar necrotic area (61\u0026thinsp;\u0026plusmn;\u0026thinsp;5% of the AAR in the control group vs. 67\u0026thinsp;\u0026plusmn;\u0026thinsp;3% in the GDF15 group, Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eD).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3. rGDF15 preconditioning, not postconditioning, improves\u003c/strong\u003e \u003cstrong\u003eex vivo\u003c/strong\u003e \u003cstrong\u003eheart recovery after I/R\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo consolidate our findings, we extended our protocol to an \u003cem\u003eex vivo\u003c/em\u003e model to assess the potential protective effect of rGDF-15 independently of neural, humoral or inflammatory response regulators. During the basal period, where the isolated hearts were perfused with or without rGDF15, all measured parameters were similar between the two groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e). When perfusion was stopped to induce ischemia, hearts rapidly stopped beating, decreasing their contractile parameters to zero (HR, LVDevP and \u0026plusmn;\u0026thinsp;dP/dt, Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA, C, D and E). At the onset of reperfusion, isolated hearts exhibited a slight transient peak and drop-off before gradually recovering their contractile functions over time. The recovery was only partial in both groups, reaching 30\u0026ndash;40% of their initial LVDevP and \u0026plusmn;\u0026thinsp;dP/dt, with the maximum of recovery at 60 min of reperfusion, followed by gradual decline due to the limitations of the \u003cem\u003eex vivo\u003c/em\u003e model (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eB). However, hearts perfused with rGDF15 prior to total ischemia demonstrated a better recovery of LVDevP, +dP/dt and -dP/dt during the early reperfusion period. Hearts perfused with rGDF15 displayed an improved recovery of HR during early reperfusion, attributed to fewer episodes of arrythmia and a better return to sinus rhythm (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eE). At the end of the 2-hour reperfusion, TTC staining of heart slices revealed a greater infarct size in the control group than in the rGDF15 group: 60\u0026thinsp;\u0026plusmn;\u0026thinsp;4% and 45\u0026thinsp;\u0026plusmn;\u0026thinsp;4% of the LV, respectively (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eF).\u003c/p\u003e\n\u003cp\u003eWe also assessed the \u003cem\u003eex vivo\u003c/em\u003e post-ischemic effects of rGDF15 by perfusing it during the first 10 minutes of reperfusion. During the basal period, all measured parameter (LVDevP, \u0026plusmn;dP/dt and HR) were comparable between the two groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eA, C, D and E). Following 30 min of total ischemia, we observed a similar pattern of recovery in functional parameters as described in our previous set of \u003cem\u003eex vivo\u003c/em\u003e experiments (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eB). However, no significant differences were identified between the control and GDF15 groups in any of the monitored parameters. At the end of reperfusion, the infarct sizes in the control group were 52\u0026thinsp;\u0026plusmn;\u0026thinsp;6% of the total ventricular area, and were did not differ from the GDF15 group, which measured at 51\u0026thinsp;\u0026plusmn;\u0026thinsp;5% (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eF).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe present study reveals GDF15 as a cardioprotective cytokine induced in response to myocardial I/R injury, in line with previous findings. Our work demonstrates the expression of GDF15 in the heart tissue following \u003cem\u003ein vivo\u003c/em\u003e ischemia-reperfusion injury and suggests a potential role for rGDF15 as a rescue molecule. Surprisingly, the elevation of plasma GDF15 during reperfusion did not differ between I/R and Sham-operated rats, which runs counter to clinical data. To our knowledge, there is no \u003cem\u003ein vivo\u003c/em\u003e data on systemic GDF15 secretion in response to cardiac I/R surgery. However, this aligns with the stress-sensor role of GDF15, secreted into the circulation in response to injuries, cellular damage, oxidative stress and inflammation, which are common elements induced by cardiac surgery. It has been proposed that catecholamines, released during acute myocardial or cerebral ischemia, may remotely induce GDF15 secretion\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. In a recent study, local anaesthetics such as lidocaine were shown to upregulate GDF15 production in HeLa cultured cells\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e, suggesting lidocaine use in our surgical procedure could contribute to the GDF15 secretion observed in both I/R and Sham rats. Additionally, two studies indicate that coronary artery bypass grafting in patients increases GDF15 plasma level by 2.5- or 3-fold compared to anaesthesia induction level\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. These findings suggest that thoracic surgery itself induces GDF15 secretion. In our model, the initial plasma level of GDF15 was very low (\u0026asymp;\u0026thinsp;200 ng/L), which can be explained by the fact that rats were young and healthy individuals. However, we observed a 10-fold GDF15 increase after 30 min I/R followed by 30 min of reperfusion. Patients from clinical studies present stable coronary artery disease and other cardiovascular history; hence, their GDF15 baseline level is already elevated (\u0026asymp;\u0026thinsp;1,000 ng/L), and even increased after thoracic surgery, but to a lesser extent than that observed in rats.\u003c/p\u003e \u003cp\u003eOur study reveals that I/R upregulates GDF15 transcription in the ischemic part of the heart compared to its RZ after 24 h of reperfusion, while no differences were observable in Sham-operated rats. This finding is consistent with observations by Zhang and Kempf in an I/R mouse model, where GDF15 mRNA was exclusively upregulated in the infarcted area after 1 h of ischemia, reaching a transcriptional peak at 24 h of reperfusion\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. Interestingly, Kempf \u003cem\u003eet al\u003c/em\u003e. also demonstrated that only a permanent ligation of the LAD induced GDF15 mRNA upregulation in the RZ, suggesting that GDF15 may be expressed remotely when stress signals reach a certain level. At the protein level, I/R rats exhibited an increase in pro-GDF15 in the RZ and a strong trend in the IZ compared to Sham rats after 24 h of reperfusion. These results align with expression kinetics reported by other groups, showing an increase in pro-GDF15 in the ischemic heart compared to Sham mice after 4 h of reperfusion, peaking at 24 h. \u003cem\u003eIn vitro\u003c/em\u003e studies also demonstrated that cardiomyocytes in culture produce pro-GDF15 in simulated I/R, both in the supernatant and in cell lysate\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Interestingly, mature GDF15 was only detected in supernatants after either 6 hours of hypoxia or 3 hours of hypoxia followed by 3 hours of reoxygenation \u003cem\u003ein vitro\u003c/em\u003e, suggesting rapid and efficient secretion into the circulation in response to \u003cem\u003ein vivo\u003c/em\u003e I/R. However, we did not observe any \u003cem\u003ein vivo\u003c/em\u003e difference in circulating GDF15 between our Sham and I/R groups, which might be attributed to the surgical procedure mentioned above. Nonetheless, our work describes, for the first time, a cardiac expression of mature GDF15 in response to \u003cem\u003ein vivo\u003c/em\u003e I/R. I/R hearts exhibited a significant six-fold increase in mature GDF15 in the IZ 24 hours after the onset of reperfusion, but no difference in the RZ.\u003c/p\u003e \u003cp\u003eThe presence of biologically active mature GDF15 after I/R supports a cardioprotective and anti-hypertrophic role, consistent with previous findings\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. GDF15\u0026rsquo;s cardioprotective properties primarily involve inhibiting pro-inflammatory leukocyte recruitment in the infarcted area\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. Mechanistically, GDF15 activates the small GTPase Cdc42 and inhibits the small GTPase Rap1, resulting in the inhibition of conformational action and clustering of β2 integrins on leukocytes, thus suppressing their ability to bind onto endothelial ICAM-1\u003csup\u003e22\u003c/sup\u003e. Consequently, GDF15-deficient mice subjected to ischemia displayed increased leukocyte recruitment in the infarcted zone, leading to higher mortality and a greater infarct size with more apoptotic cardiomyocytes. Conversely, GDF15 over-expression in mice reduced I/R injury by lowering the number of apoptotic cells, reducing neutrophil infiltration, and decreasing pro-inflammatory cytokine expression in the heart\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. In our \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003eex vivo\u003c/em\u003e models, preischemic rGDF15 administration also reduced the infarct size. However, its anti-inflammatory effects may not fully explain the cardioprotective effect observed \u003cem\u003eex vivo\u003c/em\u003e, as this experimental condition isolates the heart from the blood, neuronal, humoral or immune systems. Our data suggest a cardiac-specific effect of GDF15, potentially interacting directly with an unknow receptor, as GFRAL is not expressed in the heart, or indirectly via other mediators. Unfortunately, studies exploring GDF15 pathways in cardiomyocytes \u003cem\u003ein vitro\u003c/em\u003e have mainly used commercial human rGDF15 (rhGDF15), which may be contaminated by TGF-β, as reported by several authors\u003csup\u003e\u003cspan additionalcitationids=\"CR26\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Olsen \u003cem\u003eet al.\u003c/em\u003e demonstrated that some rhGDF15 batches were activating TGF-β receptors and their canonical Smad pathway. Moreover, TGF-β signalling also includes non-canonical signalling protein like ERK, Akt and mTOR, all implicated in cardioprotective processes\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e,\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e and activated by rhGDF15 \u003cem\u003ein vitro\u003c/em\u003e. Due to this contamination issue, results from studies potentially using contaminated rhGDF15 have been questioned. As a precaution, we will not cite these experiments. However, it is important to note that batches of rGDF15 amplified in TGF-β-deprived hosts, such as E. Coli, do not exhibit this contamination. This consideration motivated our choice to use this type of recombinant protein.\u003c/p\u003e \u003cp\u003eTherefore, apart from the regulation of leukocyte recruitment, little is known about the intracellular cardioprotective mechanisms of GDF15. A study using GDF15 overexpressing mice in a cold I/R heart grafting context reported that GDF15 promoted Foxo3a phosphorylation (p-Foxo3a) through PI3K/Akt activation and NF-κB inhibition\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. These two kinases are members of the reperfusion injury salvage kinase (RISK), one the two major cardioprotective pathways known to limit reperfusion injuries and cell death by inhibiting mitochondrial transition pore opening (mPTP)\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Foxo3a is a transcription factor that regulates the cell cycle, autophagy and pro-apoptotic genes, and its translocation to the cytoplasm upon phosphorylation promotes cell survival after renal, cerebral and cardiac I/R\u003csup\u003e31\u0026ndash;34\u003c/sup\u003e. Moreover, NF-κB is a complex pro-inflammatory transcription factor, and specific cardiac inhibition of NF-κB has shown cardioprotective effects in both \u003cem\u003eex vivo\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e I/R models\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e,\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eFinally, we reported that rGDF15 failed to protect the heart when administered at the onset of reperfusion both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003eex vivo\u003c/em\u003e, despite its beneficial effect when used before ischemia as a preconditioning compound. Pharmacological cardioprotection is a challenging task as it must selectively address cardiomyocytes dysfunctions induced by ischemia and reperfusion without adversely affecting other physiological process. There are three main pathways for achieving this, represented by the survivor activating factor enhancement (SAFE) pathway, RISK pathway and NO/PKG pathway, all ultimately leading to mitochondrial protection and survival\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. For instance, volatile anaesthetics (isoflurane, sevoflurane and desflurane) are known to be cardioprotective molecules both in pre- and postconditioning, capable of activating RISK, SAFE and NO pathways\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. However, one study reported that isoflurane induced a different gene expression profile depending on whether it was used as pre- or postconditioning after \u003cem\u003eex vivo\u003c/em\u003e myocardial I/R\u003csup\u003e38\u003c/sup\u003e. It should also be borne in mind that interactions can be found between cardioprotective molecules. Desflurane and propofol have been reported to be cardioprotective individually, but their combination abolished their effectiveness in cardiac conditioning\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. As we used isoflurane during the surgery, interaction between isoflurane and our protocol of GDF15 administration during myocardial I/R can be hypothesized. Finally, preconditioning can be seen as a mechanism that delays the development of infarct size, while postconditioning actually decreases the infarct size\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. We can, therefore, assume that GDF15 can prevent ischemic dysregulations of cardiomyocytes but cannot rescue them. Furthermore, the spatiotemporal organization of RISK, SAFE and NO/PKG pathways is not completely elucidated yet, resulting in disparities between pre- and postconditioning\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. This is why the most promising pharmacological cardioprotective molecules should activate several protective pathways, ensuring mitochondrial protection via redundant pathways and enabling better and broader cardioprotective efficiency\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e,\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e,\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. It is also to be noted that the exploration of the GDF15 cardioprotective abilities in our animal models is limited by the usage of isoflurane, a well-known cardioprotective molecule. However, data from our laboratory showed that isoflurane cardioprotection on the \u003cem\u003eex vivo\u003c/em\u003e Langendorff model was abolished by 30 min of ischemia, motivating our choice of this ischemia duration (data not shown).\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eOur study underscores the myocardial production of GDF15 during ischemia-reperfusion, and reveals its potential ability to elicit preischemic cardioprotection in both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003eex vivo\u003c/em\u003e settings. Intriguingly, these findings suggest mechanisms that operate independently of the immune, endocrine, or nervous systems. However, administering recombinant GDF15 (rGDF15) at reperfusion failed to confer beneficial effects, implying its limited capacity to counteract the detrimental changes established during ischemia. However, the cardioprotective potential of GDF15 may find application in other situations, such as conditions involving stroke-heart syndrome.\u003c/p\u003e \u003cp\u003eWhile our study sheds light on the preischemic cardioprotective effects of GDF15, the specific pathways underlying its protective mechanisms remain largely unexplored. A crucial step for future research may involve investigating its potential to protect the mitochondria, offering a comprehensive understanding of its beneficial capacities. This knowledge could pave the way for therapeutic strategies, especially in the context of cardiovascular diseases and related complications.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eDeclaration of competing interest\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003eData availability\u003c/p\u003e\n\u003cp\u003eThe data and support of these findings is available through contacting the corresponding author.\u003c/p\u003e\n\u003cp\u003eContributions\u003c/p\u003e\n\u003cp\u003eG.D and C.V. designed the study; E.P performed the RT-qPCR experiments; G.D. performed the \u003cem\u003ein vivo\u003c/em\u003e, \u003cem\u003eex vivo\u003c/em\u003e and molecular experiments, analysed the data and interpreted them; E.R. and M.J. assisted in the data collection and in designing the experimental protocols; G.D. wrote the first draft; L.R., Y.B. and C.V. revised and edited the manuscript. All authors approved the final version of the paper.\u003c/p\u003e\n\u003cp\u003eAcknowledgements\u003c/p\u003e\n\u003cp\u003eThe authors thank Ivan Porcherot, Sandy Guner, Oc\u0026eacute;ane Gruson and Samy Belaid for technical assistance.\u003c/p\u003e\n\u003cp\u003eFunding sources\u003c/p\u003e\n\u003cp\u003eThis study has been supported by funding from the French Ministry of Research, from the Regional Council of Burgundy, from the Association Bourguignonne de Cardiologie, and from the Regional University Hospital and Faculty of Health Sciences and from the ANR (SMOG15-CE17-009-01).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBootcov, M. R.\u003cem\u003e et al.\u003c/em\u003e MIC-1, a novel macrophage inhibitory cytokine, is a divergent member of the TGF-beta superfamily. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e94\u003c/strong\u003e, 11514-11519, doi:10.1073/pnas.94.21.11514 (1997).\u003c/li\u003e\n\u003cli\u003eBauskin, A. R.\u003cem\u003e et al.\u003c/em\u003e The TGF-beta superfamily cytokine MIC-1/GDF15: secretory mechanisms facilitate creation of latent stromal stores. \u003cem\u003eJ Interferon Cytokine Res\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 389-397, doi:10.1089/jir.2009.0052 (2010).\u003c/li\u003e\n\u003cli\u003eEmmerson, P. J.\u003cem\u003e et al.\u003c/em\u003e The metabolic effects of GDF15 are mediated by the orphan receptor GFRAL. \u003cem\u003eNat Med\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 1215-1219, doi:10.1038/nm.4393 (2017).\u003c/li\u003e\n\u003cli\u003eHsu, J. Y.\u003cem\u003e et al.\u003c/em\u003e Non-homeostatic body weight regulation through a brainstem-restricted receptor for GDF15. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e550\u003c/strong\u003e, 255-259, doi:10.1038/nature24042 (2017).\u003c/li\u003e\n\u003cli\u003eMullican, S. E.\u003cem\u003e et al.\u003c/em\u003e GFRAL is the receptor for GDF15 and the ligand promotes weight loss in mice and nonhuman primates. \u003cem\u003eNat Med\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 1150-1157, doi:10.1038/nm.4392 (2017).\u003c/li\u003e\n\u003cli\u003eYang, L.\u003cem\u003e et al.\u003c/em\u003e GFRAL is the receptor for GDF15 and is required for the anti-obesity effects of the ligand. \u003cem\u003eNat Med\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 1158-1166, doi:10.1038/nm.4394 (2017).\u003c/li\u003e\n\u003cli\u003eHagstrom, E.\u003cem\u003e et al.\u003c/em\u003e Growth differentiation factor-15 level predicts major bleeding and cardiovascular events in patients with acute coronary syndromes: results from the PLATO study. \u003cem\u003eEur Heart J\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e, 1325-1333, doi:10.1093/eurheartj/ehv491 (2016).\u003c/li\u003e\n\u003cli\u003eZhang, S.\u003cem\u003e et al.\u003c/em\u003e Prognostic value of growth differentiation factor-15 in patients with coronary artery disease: A meta-analysis and systematic review. \u003cem\u003eFront Cardiovasc Med\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 1054187, doi:10.3389/fcvm.2023.1054187 (2023).\u003c/li\u003e\n\u003cli\u003eBonaca, M. P.\u003cem\u003e et al.\u003c/em\u003e Growth differentiation factor-15 and risk of recurrent events in patients stabilized after acute coronary syndrome: observations from PROVE IT-TIMI 22. \u003cem\u003eArterioscler Thromb Vasc Biol\u003c/em\u003e \u003cstrong\u003e31\u003c/strong\u003e, 203-210, doi:10.1161/ATVBAHA.110.213512 (2011).\u003c/li\u003e\n\u003cli\u003eKempf, T.\u003cem\u003e et al.\u003c/em\u003e The transforming growth factor-beta superfamily member growth-differentiation factor-15 protects the heart from ischemia/reperfusion injury. \u003cem\u003eCirc Res\u003c/em\u003e \u003cstrong\u003e98\u003c/strong\u003e, 351-360, doi:10.1161/01.RES.0000202805.73038.48 (2006).\u003c/li\u003e\n\u003cli\u003eLok, S. I.\u003cem\u003e et al.\u003c/em\u003e Circulating growth differentiation factor-15 correlates with myocardial fibrosis in patients with non-ischaemic dilated cardiomyopathy and decreases rapidly after left ventricular assist device support. \u003cem\u003eEur J Heart Fail\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 1249-1256, doi:10.1093/eurjhf/hfs120 (2012).\u003c/li\u003e\n\u003cli\u003eAhmad, T.\u003cem\u003e et al.\u003c/em\u003e Effects of left ventricular assist device support on biomarkers of cardiovascular stress, fibrosis, fluid homeostasis, inflammation, and renal injury. \u003cem\u003eJACC Heart Fail\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 30-39, doi:10.1016/j.jchf.2014.06.013 (2015).\u003c/li\u003e\n\u003cli\u003eZhang, Y.\u003cem\u003e et al.\u003c/em\u003e Over-expression of growth differentiation factor 15 (GDF15) preventing cold ischemia reperfusion (I/R) injury in heart transplantation through Foxo3a signaling. \u003cem\u003eOncotarget\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 36531-36544, doi:10.18632/oncotarget.16607 (2017).\u003c/li\u003e\n\u003cli\u003eKempf, T.\u003cem\u003e et al.\u003c/em\u003e GDF-15 is an inhibitor of leukocyte integrin activation required for survival after myocardial infarction in mice. \u003cem\u003eNat Med\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 581-588, doi:10.1038/nm.2354 (2011).\u003c/li\u003e\n\u003cli\u003eZhang, Y.\u003cem\u003e et al.\u003c/em\u003e GDF15 Regulates Malat-1 Circular RNA and Inactivates NFkappaB Signaling Leading to Immune Tolerogenic DCs for Preventing Alloimmune Rejection in Heart Transplantation. \u003cem\u003eFront Immunol\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 2407, doi:10.3389/fimmu.2018.02407 (2018).\u003c/li\u003e\n\u003cli\u003eBreniere, C.\u003cem\u003e et al.\u003c/em\u003e Growth Differentiation Factor-15 (GDF-15) Is Associated With Mortality in Ischemic Stroke Patients Treated With Acute Revascularization Therapy. \u003cem\u003eFront Neurol\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 611, doi:10.3389/fneur.2019.00611 (2019).\u003c/li\u003e\n\u003cli\u003eMeloux, A.\u003cem\u003e et al.\u003c/em\u003e Association Between Growth Differentiation Factor-15 and Heart Failure Complicating Acute Myocardial Infarction. . \u003cem\u003eCardiol Cardiovasc Med\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 773-789 (2020).\u003c/li\u003e\n\u003cli\u003eMeloux, A.\u003cem\u003e et al.\u003c/em\u003e Ischemic Stroke Increases Heart Vulnerability to Ischemia-Reperfusion and Alters Myocardial Cardioprotective Pathways. \u003cem\u003eStroke\u003c/em\u003e \u003cstrong\u003e49\u003c/strong\u003e, 2752-2760, doi:10.1161/STROKEAHA.118.022207 (2018).\u003c/li\u003e\n\u003cli\u003eHaraguchi-Suzuki, K.\u003cem\u003e et al.\u003c/em\u003e Local anesthetic lidocaine-inducible gene, growth differentiation factor-15 suppresses the growth of cancer cell lines. \u003cem\u003eSci Rep\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 14520, doi:10.1038/s41598-022-18572-3 (2022).\u003c/li\u003e\n\u003cli\u003eKahli, A.\u003cem\u003e et al.\u003c/em\u003e Growth differentiation factor-15 (GDF-15) levels are associated with cardiac and renal injury in patients undergoing coronary artery bypass grafting with cardiopulmonary bypass. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, e105759, doi:10.1371/journal.pone.0105759 (2014).\u003c/li\u003e\n\u003cli\u003eBouchot, O.\u003cem\u003e et al.\u003c/em\u003e Low Circulating Levels of Growth Differentiation Factor-15 Before Coronary Artery Bypass Surgery May Predict Postoperative Atrial Fibrillation. \u003cem\u003eJ Cardiothorac Vasc Anesth\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 1131-1139, doi:10.1053/j.jvca.2015.01.023 (2015).\u003c/li\u003e\n\u003cli\u003eZhang, M.\u003cem\u003e et al.\u003c/em\u003e Growth differentiation factor 15 may protect the myocardium from no‑reflow by inhibiting the inflammatory‑like response that predominantly involves neutrophil infiltration. \u003cem\u003eMol Med Rep\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 623-632, doi:10.3892/mmr.2015.4573 (2016).\u003c/li\u003e\n\u003cli\u003eXu, J.\u003cem\u003e et al.\u003c/em\u003e GDF15/MIC-1 functions as a protective and antihypertrophic factor released from the myocardium in association with SMAD protein activation. \u003cem\u003eCirc Res\u003c/em\u003e \u003cstrong\u003e98\u003c/strong\u003e, 342-350, doi:10.1161/01.RES.0000202804.84885.d0 (2006).\u003c/li\u003e\n\u003cli\u003eRainer, P. P.\u003cem\u003e et al.\u003c/em\u003e Cardiomyocyte-specific transforming growth factor beta suppression blocks neutrophil infiltration, augments multiple cytoprotective cascades, and reduces early mortality after myocardial infarction. \u003cem\u003eCirc Res\u003c/em\u003e \u003cstrong\u003e114\u003c/strong\u003e, 1246-1257, doi:10.1161/CIRCRESAHA.114.302653 (2014).\u003c/li\u003e\n\u003cli\u003eOlsen, O. E., Skjaervik, A., Stordal, B. F., Sundan, A. \u0026amp; Holien, T. TGF-beta contamination of purified recombinant GDF15. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, e0187349, doi:10.1371/journal.pone.0187349 (2017).\u003c/li\u003e\n\u003cli\u003eTsai, V. W. W., Husaini, Y., Sainsbury, A., Brown, D. A. \u0026amp; Breit, S. N. The MIC-1/GDF15-GFRAL Pathway in Energy Homeostasis: Implications for Obesity, Cachexia, and Other Associated Diseases. \u003cem\u003eCell Metab\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 353-368, doi:10.1016/j.cmet.2018.07.018 (2018).\u003c/li\u003e\n\u003cli\u003eBreit, S. N., Tsai, V. W. \u0026amp; Brown, D. A. Targeting Obesity and Cachexia: Identification of the GFRAL Receptor-MIC-1/GDF15 Pathway. \u003cem\u003eTrends Mol Med\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 1065-1067, doi:10.1016/j.molmed.2017.10.005 (2017).\u003c/li\u003e\n\u003cli\u003eSciarretta, S., Forte, M., Frati, G. \u0026amp; Sadoshima, J. New Insights Into the Role of mTOR Signaling in the Cardiovascular System. \u003cem\u003eCirc Res\u003c/em\u003e \u003cstrong\u003e122\u003c/strong\u003e, 489-505, doi:10.1161/CIRCRESAHA.117.311147 (2018).\u003c/li\u003e\n\u003cli\u003eLi, D. Y.\u003cem\u003e et al.\u003c/em\u003e Role of ERK1/2 in the anti-apoptotic and cardioprotective effects of nitric oxide after myocardial ischemia and reperfusion. \u003cem\u003eApoptosis\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 923-930, doi:10.1007/s10495-006-6305-6 (2006).\u003c/li\u003e\n\u003cli\u003eYellon, D. M., Beikoghli Kalkhoran, S. \u0026amp; Davidson, S. M. The RISK pathway leading to mitochondria and cardioprotection: how everything started. \u003cem\u003eBasic Res Cardiol\u003c/em\u003e \u003cstrong\u003e118\u003c/strong\u003e, 22, doi:10.1007/s00395-023-00992-5 (2023).\u003c/li\u003e\n\u003cli\u003eSong, J.\u003cem\u003e et al.\u003c/em\u003e Inhibition of FOXO3a/BIM signaling pathway contributes to the protective effect of salvianolic acid A against cerebral ischemia/reperfusion injury. \u003cem\u003eActa Pharm Sin B\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 505-515, doi:10.1016/j.apsb.2019.01.010 (2019).\u003c/li\u003e\n\u003cli\u003eXie, Y.\u003cem\u003e et al.\u003c/em\u003e Ischemic preconditioning attenuates ischemia/reperfusion-induced kidney injury by activating autophagy via the SGK1 signaling pathway. \u003cem\u003eCell Death Dis\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 338, doi:10.1038/s41419-018-0358-7 (2018).\u003c/li\u003e\n\u003cli\u003eJuhasz, B.\u003cem\u003e et al.\u003c/em\u003e Bromelain induces cardioprotection against ischemia-reperfusion injury through Akt/FOXO pathway in rat myocardium. \u003cem\u003eAm J Physiol Heart Circ Physiol\u003c/em\u003e \u003cstrong\u003e294\u003c/strong\u003e, H1365-1370, doi:10.1152/ajpheart.01005.2007 (2008).\u003c/li\u003e\n\u003cli\u003eQi, X. F.\u003cem\u003e et al.\u003c/em\u003e Involvement of the FoxO3a pathway in the ischemia/reperfusion injury of cardiac microvascular endothelial cells. \u003cem\u003eExp Mol Pathol\u003c/em\u003e \u003cstrong\u003e95\u003c/strong\u003e, 242-247, doi:10.1016/j.yexmp.2013.08.003 (2013).\u003c/li\u003e\n\u003cli\u003eHaudek, S. B.\u003cem\u003e et al.\u003c/em\u003e Overexpression of cardiac I-kappaBalpha prevents endotoxin-induced myocardial dysfunction. \u003cem\u003eAm J Physiol Heart Circ Physiol\u003c/em\u003e \u003cstrong\u003e280\u003c/strong\u003e, H962-968, doi:10.1152/ajpheart.2001.280.3.H962 (2001).\u003c/li\u003e\n\u003cli\u003eZhang, X. Q.\u003cem\u003e et al.\u003c/em\u003e Cardiomyocyte-specific p65 NF-kappaB deletion protects the injured heart by preservation of calcium handling. \u003cem\u003eAm J Physiol Heart Circ Physiol\u003c/em\u003e \u003cstrong\u003e305\u003c/strong\u003e, H1089-1097, doi:10.1152/ajpheart.00067.2013 (2013).\u003c/li\u003e\n\u003cli\u003eRoth, S.\u003cem\u003e et al.\u003c/em\u003e Pharmacological Conditioning of the Heart: An Update on Experimental Developments and Clinical Implications. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, doi:10.3390/ijms22052519 (2021).\u003c/li\u003e\n\u003cli\u003eLucchinetti, E., da Silva, R., Pasch, T., Schaub, M. C. \u0026amp; Zaugg, M. Anaesthetic preconditioning but not postconditioning prevents early activation of the deleterious cardiac remodelling programme: evidence of opposing genomic responses in cardioprotection by pre- and postconditioning. \u003cem\u003eBr J Anaesth\u003c/em\u003e \u003cstrong\u003e95\u003c/strong\u003e, 140-152, doi:10.1093/bja/aei155 (2005).\u003c/li\u003e\n\u003cli\u003eHeiberg, J., Royse, C. F., Royse, A. G. \u0026amp; Andrews, D. T. Propofol Attenuates the Myocardial Protection Properties of Desflurane by Modulating Mitochondrial Permeability Transition. \u003cem\u003eAnesth Analg\u003c/em\u003e \u003cstrong\u003e127\u003c/strong\u003e, 387-397, doi:10.1213/ANE.0000000000003450 (2018).\u003c/li\u003e\n\u003cli\u003eHeusch, G. Cardioprotection: chances and challenges of its translation to the clinic. \u003cem\u003eLancet\u003c/em\u003e \u003cstrong\u003e381\u003c/strong\u003e, 166-175, doi:10.1016/S0140-6736(12)60916-7 (2013).\u003c/li\u003e\n\u003cli\u003eDuicu, O. M., Angoulvant, D. \u0026amp; Muntean, D. M. Cardioprotection against myocardial reperfusion injury: successes, failures, and perspectives. \u003cem\u003eCan J Physiol Pharmacol\u003c/em\u003e \u003cstrong\u003e91\u003c/strong\u003e, 657-662, doi:10.1139/cjpp-2013-0048 (2013).\u003c/li\u003e\n\u003cli\u003eMoss, N. C.\u003cem\u003e et al.\u003c/em\u003e Inhibitory kappa B kinase-beta is a target for specific nuclear factor kappa B-mediated delayed cardioprotection. \u003cem\u003eJ Thorac Cardiovasc Surg\u003c/em\u003e \u003cstrong\u003e136\u003c/strong\u003e, 1274-1279, doi:10.1016/j.jtcvs.2008.07.041 (2008).\u003c/li\u003e\n\u003cli\u003eOnai, Y.\u003cem\u003e et al.\u003c/em\u003e Inhibition of NF-kappaB improves left ventricular remodeling and cardiac dysfunction after myocardial infarction. \u003cem\u003eAm J Physiol Heart Circ Physiol\u003c/em\u003e \u003cstrong\u003e292\u003c/strong\u003e, H530-538, doi:10.1152/ajpheart.00549.2006 (2007).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"GDF-15, Ischemia-reperfusion injury, heart, preconditioning, cardioprotection","lastPublishedDoi":"10.21203/rs.3.rs-3963740/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3963740/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eClinical data consider growth differentiation factor-15 GDF15 as a prognostically unfavourable biomarker in cardiovascular diseases, while experimental studies suggest its cardioprotective potential. This study focuses on the direct cardiac effects of GDF15 during ischemia-reperfusion (I/R) injury in Wistar male rats, employing concentrations relevant to patients at high cardiovascular risk.\u003c/p\u003e \u003cp\u003eInitially, we examined circulating levels and heart tissue expression of GDF15 in rats subjected to I/R and Sham operations in vivo. Subsequently, we evaluated the cardiac effects of GDF15 both in vivo and ex vivo, administering recombinant GDF15 either before ischemia (preconditioning) or at the onset of reperfusion (postconditioning). We compared infarct sizes and recovery of cardiac contractile parameters between control and rGDF15 treated rats.\u003c/p\u003e \u003cp\u003eContrary to our expectations, I/R did not elevate GDF15 plasma levels compared to Sham-operated rats. However, cardiac expression at both protein and mRNA levels increased in the infarcted zone of the ischemic heart after 24 hours of reperfusion. Notably, preconditioning with rGDF15 exhibited a cardioprotective effect, reducing infarct size both in vivo and ex vivo, while enhancing the recovery of cardiac contractile parameters ex vivo. However, postconditioning with rGDF15 did not alter infarct size or the recovery of contractile parameters either in vivo or ex vivo.\u003c/p\u003e \u003cp\u003eThese findings reveal, for the first time, that short-term exogenous administration of rGDF15 before ischemia, at physiologically relevant levels, protects the heart against I/R injury in both in vivo and ex vivo settings. The latter situation suggests that rGDF15 can operate independently of the inflammatory, endocrine and nervous systems, presenting GDF15 as a direct and potent cardioprotective properties against ischemia-reperfusion injury.\u003c/p\u003e","manuscriptTitle":"Growth Differentiation Factor 15 (GDF15) Expression in the Heart After Myocardial Infarction and Cardioprotective Effect of Pre-Ischemic rGDF15 Administration","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-12 20:01:43","doi":"10.21203/rs.3.rs-3963740/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-03-25T08:40:48+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-03-22T10:16:27+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"8d81550b-6f30-4b6d-89c2-1e93276345da","date":"2024-03-12T11:42:09+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-03-12T11:38:19+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-03-12T11:37:17+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-03-08T03:31:08+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-03-08T03:29:14+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-02-17T10:08:49+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"207581df-4b44-4b9b-8ef3-aeea36bfa14e","owner":[],"postedDate":"March 12th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":29287419,"name":"Biological sciences/Physiology/Cardiovascular biology"},{"id":29287420,"name":"Health sciences/Cardiology"}],"tags":[],"updatedAt":"2024-06-03T08:27:09+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-12 20:01:43","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3963740","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3963740","identity":"rs-3963740","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}