Tissue resident memory T cells triggered recurrent psoriasiform dermatitis dependent on RELA/p52 signaling in mice

preprint OA: closed
Full text JSON View at publisher
Full text 91,434 characters · extracted from preprint-html · click to expand
Tissue resident memory T cells triggered recurrent psoriasiform dermatitis dependent on RELA/p52 signaling in mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Tissue resident memory T cells triggered recurrent psoriasiform dermatitis dependent on RELA/p52 signaling in mice Yukang Lin, Jiaying Chen, Han Du, Yuchao Chen, Zhaolin Liu, Xuejia Li, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7412527/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Immunological memory triggered recurrence is the critical challenge in treating psoriasis. Tissue resident memory T (Trm) cells is the primary pacemaker in recurrent psoriasiform dermatitis, but the mechanism of activating Trm cells is still unclear. In this study, imiquimod induced recurrent psoriatic mice were established to reveal the phenotype of different Trm cells. Then, CD8 + /CD4 + Tcm cells injection and NF-κB inhibitor/agonist were used to investigate the role and mechanism of Trm in recurrent psoriasis. Mice displayed severe dermatitis, high PASI scores and inflammatory cytokines after repeated imiquimod treatment. The CD8 + Trm cells ,but not CD4 + Trm cells, were elevated in skin of recurrent psoriatic mice. The CD8 + Tcm cells injection elicited more severe psoriatic symptom than imiquimod treatment alone, which indicate CD8 + Trm cells is critical participant in psoriatic recurrence. Meanwhile, the phosphorylated of NF-κB p52 and NF-κB p65 (RELA) both were enhanced in skin of imiquimod induced recurrent psoriatic mice. On the contrary, NF-κB inhibitor/agonist significantly suppressed/restore the dermatitis and CD8 + Trm cells in recurrent psoriatic mice. Hence, canonical and non-canonical NF-κB signaling both may contribute to activate CD8 + Trm cells in recurrent psoriasis. Psoriasis recurrence tissue resident memory T cells NF-κB signaling imiquimod. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Psoriasis is a chronic, papulosquamous dermatitis and associated with many other complications. Over 125 million people are affected with psoriasis worldwide [1] . Disorder of immune system is the primary pathogenesis of psoriasis. Although immunosuppressant and biological therapy display satisfactory effects in treating psoriasis [2] . But most of patients still suffer from the torment of recurrence [3] . Revealing the pathogenic mechanism is critical for preventing recurrent psoriasis. Memory T cells mediated immunological memory play crucial role in immnue response of psoriatic recurrence. Part of T cells can differentiate into effector memory T (Tem) cells, central memory T (Tcm) cells and tissue resident memory T (Trm) cells [4] . Unlike Tem/Tcm cells that circulate between blood and lymph nodes (LNs), Trm cells show low migration and long-term survival in peripheral tissues, such as the skin [3,5] . Although cutaneous Trm cells provide rapid immune protection to prevent previous pathogen infections, but it also trigger the pro-inflammatory responses in recurrent inflammatory dermatosis [6-8] . In psoriasis, cutaneous Trm cells can persist after effective treatment and promote psoriatic recurrence by producing inflammatory cytokines, including IL-17A [9,10] . Hence, inhibiting the generation/retention of Trm cells in skin could be a reasonable strategy to prevent psoriatic recurrence. But the crucial mechanism of activating cutaneous Trm cells in recurrent psoriasis is still unclear. The nuclear factor-κB (NF-κB) family is the classic protein complex in modulating both innate and adaptive immunity [11] . It is essential in lymphocyte activation and survival by regulating transcription of a large number of genes [12] . Activating NF-κB can be identified through canonical and non-canonical NF-κB signalling pathways [12] . The canonical NF-κB signalling activate NF-κB p50, RELA and c-REL. The non-canonical NF-κB signalling activate NF-κB p52 and RELB [12] . These protein complex are bound and inactive with inhibitors of NF-κB (IκBs) [11] . Once activation, IκB proteins will be degraded and release the NF-κB associated proteins to translocate [11] . In previous researches, NF-κB signalling play a critical role in generation and maintenance of effector and memory T cells [13-15] . However, the effects of NF-κB signalling in activation of Trm cells in psoriasis is still unknown. In this study, a repeated imiquimod induced recurrent psoriatic mice model was established to identify the phenotype of different type (CD4 + and CD8 + ) of Trm cells. Then, Tcm cells injection and NF-κB inhibitor/agonist were used to investigate the role of CD8 + Trm cells and effects of NF-κB signaling in recurrent psoriasis. Materials and methods All Experimental procedure of animal studies were conducted by the Ethics Committee of the Second Affliated Hospital of Guangzhou University of Chinese Medicine. (No. 2021004). Reagents Imiquimod cream was obtained from Mingxin Pharmaceutical Co., Ltd (Sichuan, China). CU-T12-9 and NIK SMI 1 were obtained from MedChemExpress (Shanghai, China). Recombinant murine IL-15 (rIL-15) was obtained from PeproTech (Rocky Hill, USA). Recurrent psoriatic mice model Seven-weeks-old male Balb/c mice were obtained from Guangdong Medical Laboratory Animal Center (Guangzhou, China). Mice were housed under pathogen-free conditions in a temperature-controlled room illuminated for 12 h every day and received humane care. Mice were divide into control, imiquimod (IMQ)-vaselin and IMQ-IMQ group. After back hair was shaved, all mice except control group were treated 62.5 mg/day IMQ for 7 consecutive days. After immunologic tolerance for 14 days, mice of IMQ-vaselin group were received vaselin treatment for another 7 consecutive days. The mice of IMQ-IMQ group were received 20.8 mg/day IMQ for 7 consecutive days to induced the recurrent psoriasis ( Fig. 1A ). The Psoriasis Area and Severity Index (PASI) was recorded to evaluated the level of dermatitis [16] . Histology Skin tissues were fixed in formaldehyde, paraffin-embedded, sectioned, and stained with hematoxylin and eosin. Biochemical assays Skin tissues were homogenized in RIPA lysis buffer. Cutaneous IL-17A, IL-15, IL-6 and TNF-α both were determined by commercial ELISA kits (Boster, China). Flow cytometric analysis (FACS) FACS protocol was determined by our previous research [16] . LNs and spleen of mice were homogenized. Cells were harvested. Then cells were stained with anti-CD4 PE Antibody(Clone GK1.5, eBioscience, USA), anti-CD8a FITC Antibody (Clone 53-6.7, eBioscience, USA), anti-CD44 eFluor™ 450 Antibody (Clone IM7, eBioscience, USA) and anti-CD62L APC Antibody (Clone MEL-14, eBioscience, USA). Skin tissues were digested with collagenase type I (Sigma, Aldrich, USA) and DNase (Solarbio, Shanghai, China). After erythrocyte lysis, cells were stained with anti-CD8a Alexa Fluor™ 700 Antibody (Clone 53-6.7, eBioscience, USA), anti-CD103 PE Antibody (Clone 2E7, eBioscience, USA).anti-CD69 PE-Cyanine7 Antibody (Clone H1.2F3, eBioscience, USA), anti-CD4 Alexa Fluor™ 700 Antibody(Clone GK1.5, eBioscience, USA), anti-CLA PE Antibody (Clone HECA-452 ,BioLegend, Beijing,China), anti-CD44 eFluor™ 450 Antibody (Clone IM7, eBioscience, USA) and anti-CD62L APC Antibody (Clone MEL-14, eBioscience, USA). Finally, cells were analyzed by a flow cytometer (NovoCyte Quanteon, Agilent, USA). Real-time polymerase chain reaction (PCR) Skin tissues were homogenized in TRIzol reagent (Invitrogen, Carlsbad, USA). Tocal RNA was isolated and synthesized into single standard cDNA. Finally, Quantitative real-time PCR was determined with a ViiA 7 Dx (Applied Biosystems, Carlsbad, USA) using SYBR Premix ExTaqTM Π (Takara Bio Incorporation, Tokyo, Japan).The primer sequences are shown below: CXCL9 Forward: CTCGGCAAATGTGAAGAAGCTGA,CXCL9 Reverse: TTCCTTGAACGACGACGACTTTGG; IL-15 Forward: TCCATCTCGTGCTACTTGTGTTTCC, IL-15 Reverse: TCCCTATGGCCCTCATTCTCACTG; CXCL10 Forward: TGCCGTCATTTTCTGCCTCATCC, CXCL10 Reverse: CACATTCTGGAGGAAGTCCTTGG; CXCR3 Forward: CAGCCCTCTACAGCCTCCTCTTC, CXCR3 Reverse: TACAGCCAGGTGGAGCAGGAAG; β-actin Forward: TGTCCACCTTCCAGCAGATGT, β-actin Reverse: TGTCCACCTTCCAGCAGATGT. Western blot Skin tissues were homogenized in RIPA lysis buffer as aforementioned protocol. Total protein was isolated and fractionated by SDS-PAGE. After protein was transferred to PVDF membrane, membranes were blocked and incubated with anti-GAPDH (Cell Signaling Technology, Boston, USA), anti-p-NF-κB-p65 (Cell Signaling Technology, Boston, USA), anti-p-NF-κB-p52 (Cell Signaling Technology, Boston, USA), anti-p-TRAF2 and anti-p-p38 MAPK (Cell Signaling Technology, Boston, USA). After incubating with respective secondary antibodies, membranes were visualized in a Bio-Rad Gel imaging system and analyzed using Image Lab software. CD8 + /CD4 + Tcm cells and rIL-15 treatment Mice were divided into control, IMQ-IMQ, CD8 + Tcm, CD4 + Tcm, and rIL-15 group. Mice except control group were induced recurrent psoriasis mice as aforementioned methods. Then, mice of CD8 + Tcm or CD4 + Tcm group were injected with exogenous CD4+ or CD8 + Tcm cells (1×10 ^6 ) at day 21 respectively. Mice of rIL-15 group were received recombinant murine IL-15 ( i.p., 0.1 μg/mouse) at day 21, 24, 27. These Tcm cells were isolated from mice treated with IMQ on day 21. ( Fig. 4A ). NF- κB inhibitor/agonist treatment Mice were divided into control, IMQ-IMQ, NIK SMI 1 and CU-T12-9 group. Mice except control group were induced recurrent psoriasis as aforementioned methods. Mice of NIK SMI 1 and CU-T12-9 group were received 20 mg/kg NIK SMI 1 ( i.p. ) or 60 mg/kg CU-T12-9 ( i.p. ) at day 21, 24, 27, respectively. Data analysis All results were expressed as means ± standard deviation. Data were analyzed by Kolmogorov-Smirnov and Mann-Whitney U test for normal distribution analysis. Data from more than two groups were analyzed by one-way ANOVA. Student’s t test was performed to identify differences between two groups. P<0.05 was considered significant. Results Repeated IMQ-induced recurrent psoriatic mice After treating with repeated IMQ, obviously papulosquamous plaques and bleeding were observed in mice back, as well as severe epidermal hyperplasia ( Fig. 1B ). Mice of IMQ-IMQ group also showed higher PASI scores than control group ( Fig. 1C ), which indicated recurrent psoriatic mice have been established. Meanwhile, cutaneous inflammatory cytokines (IL-17A, IL-6, TNF-α) were elevated in IMQ-IMQ group ( Fig. 1C ). These data suggested that psoriasiform dermatitis emerge in repeated IMQ induced recurrent psoriatic mice. T memory cells in spleen and LNs of primary psoriatic mice In order to investigate the phenotype of T memory cells, we determined the Tcm and Tem in spleen and LNs of IMQ induced priamry psoriatic mice at day 7 ( Fig. 1A ). Both CD8 + Tcm and Tem cells were increased in spleen and LNs of primary psoriatic mice at Day7 ( Fig. 2A, B ). On the other hand, CD4 + Tcm and Tem cells also were enhanced in spleen and LNs of psoriatic mice ( Fig. 2C, D ). These data indicated that both CD4 + and CD8 + T memory cells were activated in first onset of psoriasis. These memory cells may further differentiate into Trm cells and persist in skin [17] . Cutaneous Trm cells in recurrent psoriatic mice After verifying the Tem and Tcm cells in priamry psoriatic mice, we further explored the Trm cells in skin of recurrent psoriatic mice. CD103, CD69 and CLA are the biomarker of Trm cells. The CD8 + CD103 + , CD8 + CD69 + and CD8 + CLA + Trm cells both were increased in skin of IMQ-IMQ induced recurrent psoriatic mice ( Fig. 3A, C ). Interestingly, there were not significantly difference of the CD4 + CD69 + Trm cells between control group and IMQ-IMQ group ( Fig. 3B, C ). These data suggested CD8 + Trm cells but not CD4 + Trm cells are more important in recurrent psoriasis. This is also in accordance with previous research revealed CD8 + Trm cells generate IL-17A to promote local skin inflammation in psoriasis [18] . On the other hand, cutaneous genes expression of IL-15, CXCR3, CXCL9 and CXCL10 both were up-regulated in recurrent psoriatic mice ( Fig. 3D ). These genes both were associated with recruitment of T cells and generation of Trm cells [3,19-21] . Hence, we assume CD8 + Trm cells are activated and contribute to recurrence of psoriasiform dermatitis. Treating recovery psoriatic mice with CD8 + Tcm, CD4 + Tcm cells or rIL-15 In order to validate the effects of CD8 + memory cells in recurrent psoriasis, we separated the CD8 + Tcm and CD4 + Tcm cells from the first onset of psoriatic mice and injected into recurrent psoriatic mice ( Fig. 4A ). After injection of CD8 + Tcm cells, mice exhibited more severe psoriatic symptom than IMQ-IMQ induced recurrent psoriatic mice ( Fig. 4B, D ). Cutaneous IL-17A, IL-15, IL-6 and TNF-α also were enhanced with CD8 + Tcm cells treatment more than IMQ-IMQ induced recurrent psoriatic mice ( Fig. 4C ). However, injection of CD4 + Tcm cells only display similar psoriatic symptom with IMQ-IMQ induced recurrent psoriatic mice ( Fig. 4B-D ). Meanwhile, mice treating with rIL-15 also exhibited psoriasiform dermatitis, high PASI scores and inflammatory cytokines as well as CD8 + Tcm group ( Fig. 4B-D ). IL-15 is the key cytokine to promote generation and survival of Trm cells in skin [22-26] . Hence, we consider IL-15 induced CD8 + Trm cells, but not CD4 + Trm cells, trigger the recurrent psoriasis. Canonical and non-canonical NF-κB in recurrent psoriatic mice In order to reveal the mechanism of activating Trm cells in recurrent psoriasis, the protein expression of classic NF-κB and MAPK were determined. The phosphorylated regulatory factor of canonical NF-κB p65 (RELA) and non-canonical NF-κB p52 both were up-regulated in IMQ-IMQ induced recurrent psoriatic mice ( Fig. 5A-C ). Hence, both canonical and non-canonical NF-κB signaling may contribute to activation of Trm cells. TRAF2 is the receptor of TRAF family which can be activated by TNF family members. TRAF2 also is the adaptor protein in activating NF-κB through various downstream signaling mechanism, including mitogen-activated protein kinase (MAPK) [27,28] . But, the phosphorylated level of pMAPK p38 and pTRAF2 in skin were similar in control group and IMQ-IMQ group ( Fig. 5D-F ). Treating recovery psoriatic mice with NF-κB inhibitor and agonist IMQ-IMQ induced recurrent psoriatic mice were received NF-κB inhibitor (NIK SMI 1) or NF-κB agonist (CU-T12-9) to validated the role of NF-κB signaling in Trm cells associated recurrent psoriasis. After treating with NIK SMI 1, the papulosquamous plaques, PASI scores and epidermal hyperplasia both were normalized in recurrent psoriatic mice ( Fig. 6A, B ). The cutaneous IL-17A, IL-6 IL-15 and TNF-α were reduced with NIK SMI 1 treatment ( Fig. 6C ). Finally, CD8 + CD103 + and CD8 + CD69 + Trm cells in skin also were decreased by NIK SMI 1 treatment ( Fig. 6D, E ). On the contrary, mice of CU-T12-9 group did not exhibited more severe psoriatic symptom than IMQ-IMQ group ( Fig. 6A-E ). All these data indicate NF-κB signaling play a crucial role in generation of CD8 + Trm cell and recurrent psoriasis. Discussion T memory cells triggered inflammatory responses is the primary pathogenesis and challenge of treating recurrent psoriasis. Once naive T cells are activated by dendritic cells, fraction of T cells will differentiated into Tcm and Tem cells [4] . In inflammatory dermatosis, these T memory cells can further differentiate to Trm cells and persist in skin for long time [17] . These cutaneous Trm cells can rapidly response to previous pathogens and promote recurrence of psoriasis. In this study, CD4 + and CD8 + Tem and Tcm both were increased in spleen and LNs in primary psoriatic mice, which means T memory cells are activated and persisted in lymphoid organs. These memory cells can further migrate to skin and differentiate into Trm cells [3,17] . In order to elicit this immunological memory effects in psoriasis, we established recurrent psoriatic mice through different dosage of IMQ. In our previous and this studies, only 1/3 dosage of IMQ can induce severe psoriasiform dermatitis as primary psoriasis [16,37] . Meanwhile, Trm cells were enriched in skin of psoriatic mice [16,37] . This phenotype validate Trm associated immunological memory trigger the recurrence of psoriasis. Trm cells express various biomarkers, including CD69, CD103 and CLA [3] . CD103 and CLA can bind with E-selectin and P-selectin, which promote retention of Trm cells in skin [29,30] . On the other hand, CD69 attenuates S1P induced re-circulation to prevent homing of Trm cells [31] . Then the blood vasculature system is still disturbed in convalescence after psoriasis and further promote Trm cells retain in skin [32,33] . In this research, we found only CD8 + Trm cells, but not CD4 + Trm cells, increased in skin of recurrent psoriatic mice. This finding is in accordance with previous research reported CD8 + Trm cells generate IL-17A to promote local skin inflammation in psoriasis [18] . Meanwhile, cutaneous IL-15, CXCR3, CXCL9 and CXCL10 also were enhanced in recurrent psoriatic mice. IL-15 is a crucial cytokine in recruitment and maintenance of Trm cells through several signaling [22-26] . The CXCR3 can facilitate Trm cells generation [19] . In addition, CXCL9 and CXCL10 both can activate Trm cells by different pathways [20,21] . These results suggest CD8 + Trm cells associated inflammatory response may be the primary reason of recurrent psoriasis. In order to estimate which kind of Trm cells play the dominant role in recurrent psoriasis, mice were received the CD8 + Tcm cells or CD4 + Tcm cells from first onset of psoriatic mice. Mice displayed more severe psoriasiform dermatitis with injection of CD8 + Tcm cells than IMQ-IMQ group. These results further verify CD8 + Tcm cells, but not CD4 + Tcm cells, trigger the recurrent psoriasis. Meanwhile, rIL-15 treatment also showed similar psoriasiform dermatitis with mice after injection of CD8 + Tcm cells. In psoriasis, IL-15 is produced by skin keratinocytes, DCs, and fibroblasts and promote activation of Trm cells [34,35] . This finding further validate rIL-15 associated generation of CD8 + T memory cells contribute to recurrent psoriasis. Revealing the molecular mechanism of activation of Trm is the basis in preventing recurrent psoriasis. NF-κB protein complex is the classic regulator in immune responses of lymphocytes. Activity of NF-κB protein complex is associated with IκB kinase (IKK) complex. Upon stimulation of IKKγ, IκB family will be phosphorylated, ubiquitylation and proteasomal degradation. After that, NF‑κB family members will be released and nuclear translocated [11] . Based on canonical and non-canonical NF-κB signaling different submit will be released. For canonical NF-κB signaling, p105 will degrade into p50, p65 (RELA) and c-REL. For non-canonical NF-κB signaling, p100 will degrade into p52 and RELB [11] . These submits modulate generation and maintenance of effector and memory T cell through various mechanisms. In vitiligo, reactive oxygen species activate canonical NF-κB signaling in keratinocytes which secrete IL-15 to activate CD8 + Tem cells [36] . Hence, we assumed NF-κB signaling also could be the key regulator in generation of CD8 + Trm cells in recurrent psoriasis. In IMQ-IMQ induced recurrent psoriatic mice, both p-NF-κB p65 (RELA) and p-NF-κB p52 were up-regulated in skin. However, expression of p-TRAF2 and pMAPK p38 were invariant in skin of psoriatic mice. These results indicate both canonical and non-canonical NF-κB signaling may contribute to activation of CD8 + Trm cells in recurrent psoriasis. But the upstream regulator is unclear in recurrent psoriasis. Finally, the NF-κB inhibitor (NIK SMI 1) or NF-κB agonist (CU-T12-9) were used to verify the role of NF-κB signaling in CD8 + Trm cells and recurrent psoriasis. The NIK SMI 1 significantly ameliorated the symptom of psoriasis in recurrent psoriatic mice. NIK SMI 1 also reduced the level of inflammatory cytokines and CD8 + Trm cells close to normal group, which means activity of CD8 + Trm cells mainly dependents on the NF-κB signaling. On the other hand, CU-T12-9 could not deteriorate the symptom and CD8 + Trm cells retention in recurrent psoriatic mice, which indicate NF-κB signaling have been fully activated in recurrent psoriatic mice. These data confirmed NF-κB signaling play the dominant role in CD8 + Trm cells associated recurrent psoriasis, at least in IMQ-IMQ induced recurrent psoriasis. In conclusion, activating canonical and non-canonical NF-κB signaling may promote generation of CD8 + Trm cells in skin and elicit recurrent psoriasiform dermatitis in imiquimod induced psoriatic mice. This mechanism could be a novel potential target for preventing recurrence of psoriasis. Declarations Author contribution H. Liu and S. Xu designed the research protocol. Y. Lin, J. Chen, H. Du and H. Liu implemented the research. Y. Chen, Z. Liu and X. Li analyzed data. S. Xu, H. Liu and Y. Lin wrote the manuscript. Y. Li, F. Qiu and H. Cao revised the manuscript. All authors read and approved the final study. Acknowledgement This study was supported by National Natural Science Foundation of China (Grant No. 82304842), Science and Technology Planning Project of Guangdong Province(No. 2023B1212060063), Guangzhou Municipal Science and Technology Bureau (2025A03J1082) , Guangdong Provincial Administration of Traditional Chinese Medicine (20251468), Maoming Municipal Science and Technology Bureau (2024kjcxLX038) and Guangdong Provincial Basic and Applied Basic Research Foundation (No.2025A1515010295 and No.2025A1515010807). Data available statement Data will be made available on request. Declaration of competing interest The authors declare that they have no known competing fnancial interests or personal relationships that could have appeared to influence the work reported in this paper. References Greb, J. E., Goldminz, A. M., Elder, J. T., Lebwohl, M. G., Gladman, D. D., Wu, J. J., Mehta, N. N., Finlay, A. Y., & Gottlieb, A. B. (2016). Psoriasis. Nature reviews. Disease primers, 2, 16082. https://doi.org/10.1038/nrdp.2016.82 Griffiths, C. E. M., Armstrong, A. W., Gudjonsson, J. E., & Barker, J. N. W. N. (2021). Psoriasis. Lancet (London, England), 397(10281), 1301–1315. https://doi.org/10.1016/S0140-6736(20)32549-6 Chen, L., & Shen, Z. (2020). Tissue-resident memory T cells and their biological characteristics in the recurrence of inflammatory skin disorders. Cellular & molecular immunology, 17(1), 64–75. https://doi.org/10.1038/s41423-019-0291-4 Watanabe, R., Gehad, A., Yang, C., Scott, L. L., Teague, J. E., Schlapbach, C., Elco, C. P., Huang, V., Matos, T. R., Kupper, T. S., & Clark, R. A. (2015). Human skin is protected by four functionally and phenotypically discrete populations of resident and recirculating memory T cells. Science translational medicine, 7(279), 279ra39. https://doi.org/10.1126/scitranslmed.3010302 Migayron, L., Merhi, R., Seneschal, J., & Boniface, K. (2024). Resident memory T cells in nonlesional skin and healed lesions of patients with chronic inflammatory diseases: Appearances can be deceptive. The Journal of allergy and clinical immunology, 153(3), 606–614. https://doi.org/10.1016/j.jaci.2023.11.017 Tokura, Y., Phadungsaksawasdi, P., Kurihara, K., Fujiyama, T., & Honda, T. (2021). Pathophysiology of Skin Resident Memory T Cells. Frontiers in immunology, 11, 618897. https://doi.org/10.3389/fimmu.2020.618897 Ryan, G. E., Harris, J. E., & Richmond, J. M. (2021). Resident Memory T Cells in Autoimmune Skin Diseases. Frontiers in immunology, 12, 652191. https://doi.org/10.3389/fimmu.2021.652191 Liu, Y., Wang, H., Taylor, M., Cook, C., Martínez-Berdeja, A., North, J. P., Harirchian, P., Hailer, A. A., Zhao, Z., Ghadially, R., Ricardo-Gonzalez, R. R., Grekin, R. C., Mauro, T. M., Kim, E., Choi, J., Purdom, E., Cho, R. J., & Cheng, J. B. (2022). Classification of human chronic inflammatory skin disease based on single-cell immune profiling. Science immunology, 7(70), eabl9165. https://doi.org/10.1126/sciimmunol.abl9165 Matos, T. R., O'Malley, J. T., Lowry, E. L., Hamm, D., Kirsch, I. R., Robins, H. S., Kupper, T. S., Krueger, J. G., & Clark, R. A. (2017). Clinically resolved psoriatic lesions contain psoriasis-specific IL-17-producing αβ T cell clones. The Journal of clinical investigation, 127(11), 4031–4041. https://doi.org/10.1172/JCI93396 Cheuk, S., Wikén, M., Blomqvist, L., Nylén, S., Talme, T., Ståhle, M., & Eidsmo, L. (2014). Epidermal Th22 and Tc17 cells form a localized disease memory in clinically healed psoriasis. Journal of immunology (Baltimore, Md. : 1950), 192(7), 3111–3120. https://doi.org/10.4049/jimmunol.1302313 Sun S. C. (2017). The non-canonical NF-κB pathway in immunity and inflammation. Nature reviews. Immunology, 17(9), 545–558. https://doi.org/10.1038/nri.2017.52 Li, Q., & Verma, I. M. (2002). NF-kappaB regulation in the immune system. Nature reviews. Immunology, 2(10), 725–734. https://doi.org/10.1038/nri910 Yu, J., Zhou, X., Nakaya, M., Jin, W., Cheng, X., & Sun, S. C. (2014). T cell-intrinsic function of the noncanonical NF-κB pathway in the regulation of GM-CSF expression and experimental autoimmune encephalomyelitis pathogenesis. Journal of immunology (Baltimore, Md. : 1950), 193(1), 422–430. https://doi.org/10.4049/jimmunol.1303237 Li, Y., Wang, H., Zhou, X., Xie, X., Chen, X., Jie, Z., Zou, Q., Hu, H., Zhu, L., Cheng, X., Brightbill, H. D., Wu, L. C., Wang, L., & Sun, S. C. (2016). Cell intrinsic role of NF-κB-inducing kinase in regulating T cell-mediated immune and autoimmune responses. Scientific reports, 6, 22115. https://doi.org/10.1038/srep22115 Rowe, A. M., Murray, S. E., Raué, H. P., Koguchi, Y., Slifka, M. K., & Parker, D. C. (2013). A cell-intrinsic requirement for NF-κB-inducing kinase in CD4 and CD8 T cell memory. Journal of immunology (Baltimore, Md. : 1950), 191(7), 3663–3672. https://doi.org/10.4049/jimmunol.1301328 Chen, Y., Yan, Y., Liu, H., Qiu, F., Liang, C. L., Zhang, Q., Huang, R. Y., Han, L., Lu, C., & Dai, Z. (2020). Dihydroartemisinin ameliorates psoriatic skin inflammation and its relapse by diminishing CD8+ T-cell memory in wild-type and humanized mice. Theranostics, 10(23), 10466–10482. https://doi.org/10.7150/thno.45211 Osborn, J. F., Hobbs, S. J., Mooster, J. L., Khan, T. N., Kilgore, A. M., Harbour, J. C., & Nolz, J. C. (2019). Central memory CD8+ T cells become CD69+ tissue-residents during viral skin infection independent of CD62L-mediated lymph node surveillance. PLoS pathogens, 15(3), e1007633. https://doi.org/10.1371/journal.ppat.1007633 Cheuk, S., Schlums, H., Gallais Sérézal, I., Martini, E., Chiang, S. C., Marquardt, N., Gibbs, A., Detlofsson, E., Introini, A., Forkel, M., Höög, C., Tjernlund, A., Michaëlsson, J., Folkersen, L., Mjösberg, J., Blomqvist, L., Ehrström, M., Ståhle, M., Bryceson, Y. T., & Eidsmo, L. (2017). CD49a Expression Defines Tissue-Resident CD8+ T Cells Poised for Cytotoxic Function in Human Skin. Immunity, 46(2), 287–300. https://doi.org/10.1016/j.immuni.2017.01.009 Christopherson, K., 2nd, & Hromas, R. (2001). Chemokine regulation of normal and pathologic immune responses. Stem cells (Dayton, Ohio), 19(5), 388–396. https://doi.org/10.1634/stemcells.19-5-388 Wu, X., Cheong, L. Y., Yuan, L., Jin, L., Zhang, Z., Xiao, Y., Zhou, Z., Xu, A., Hoo, R. L., & Shu, L. (2024). Islet-Resident Memory T Cells Orchestrate the Immunopathogenesis of Type 1 Diabetes through the FABP4-CXCL10 Axis. Advanced science (Weinheim, Baden-Wurttemberg, Germany), 11(30), e2308461. https://doi.org/10.1002/advs.202308461 Garrido-Martin, E. M., Mellows, T. W. P., Clarke, J., Ganesan, A. P., Wood, O., Cazaly, A., Seumois, G., Chee, S. J., Alzetani, A., King, E. V., Hedrick, C. C., Thomas, G., Friedmann, P. S., Ottensmeier, C. H., Vijayanand, P., & Sanchez-Elsner, T. (2020). M1hot tumor-associated macrophages boost tissue-resident memory T cells infiltration and survival in human lung cancer. Journal for immunotherapy of cancer, 8(2), e000778. https://doi.org/10.1136/jitc-2020-000778 Sowell, R. T., & Marzo, A. L. (2015). Resident-Memory CD8 T Cells and mTOR: Generation, Protection, and Clinical Importance. Frontiers in immunology, 6, 38. https://doi.org/10.3389/fimmu.2015.00038 Becker, T. C., Wherry, E. J., Boone, D., Murali-Krishna, K., Antia, R., Ma, A., & Ahmed, R. (2002). Interleukin 15 is required for proliferative renewal of virus-specific memory CD8 T cells. The Journal of experimental medicine, 195(12), 1541–1548. https://doi.org/10.1084/jem.20020369 Mackay, L. K., Stock, A. T., Ma, J. Z., Jones, C. M., Kent, S. J., Mueller, S. N., Heath, W. R., Carbone, F. R., & Gebhardt, T. (2012). Long-lived epithelial immunity by tissue-resident memory T (TRM) cells in the absence of persisting local antigen presentation. Proceedings of the National Academy of Sciences of the United States of America, 109(18), 7037–7042. https://doi.org/10.1073/pnas.1202288109 Kaech, S. M., Tan, J. T., Wherry, E. J., Konieczny, B. T., Surh, C. D., & Ahmed, R. (2003). Selective expression of the interleukin 7 receptor identifies effector CD8 T cells that give rise to long-lived memory cells. Nature immunology, 4(12), 1191–1198. https://doi.org/10.1038/ni1009 Schluns, K. S., Kieper, W. C., Jameson, S. C., & Lefrançois, L. (2000). Interleukin-7 mediates the homeostasis of naïve and memory CD8 T cells in vivo. Nature immunology, 1(5), 426–432. https://doi.org/10.1038/80868 Kelliher, M. A., Grimm, S., Ishida, Y., Kuo, F., Stanger, B. Z., & Leder, P. (1998). The death domain kinase RIP mediates the TNF-induced NF-kappaB signal. Immunity, 8(3), 297–303. https://doi.org/10.1016/s1074-7613(00)80535-x Yang, J., Lin, Y., Guo, Z., Cheng, J., Huang, J., Deng, L., Liao, W., Chen, Z., Liu, Z., & Su, B. (2001). The essential role of MEKK3 in TNF-induced NF-kappaB activation. Nature immunology, 2(7), 620–624. https://doi.org/10.1038/89769 Cepek, K. L., Shaw, S. K., Parker, C. M., Russell, G. J., Morrow, J. S., Rimm, D. L., & Brenner, M. B. (1994). Adhesion between epithelial cells and T lymphocytes mediated by E-cadherin and the alpha E beta 7 integrin. Nature, 372(6502), 190–193. https://doi.org/10.1038/372190a0 Clark, R. A., Chong, B., Mirchandani, N., Brinster, N. K., Yamanaka, K., Dowgiert, R. K., & Kupper, T. S. (2006). The vast majority of CLA+ T cells are resident in normal skin. Journal of immunology (Baltimore, Md. : 1950), 176(7), 4431–4439. https://doi.org/10.4049/jimmunol.176.7.4431 Mackay, L. K., Braun, A., Macleod, B. L., Collins, N., Tebartz, C., Bedoui, S., Carbone, F. R., & Gebhardt, T. (2015). Cutting edge: CD69 interference with sphingosine-1-phosphate receptor function regulates peripheral T cell retention. Journal of immunology (Baltimore, Md. : 1950), 194(5), 2059–2063. https://doi.org/10.4049/jimmunol.1402256 Stinco, G., Buligan, C., Maione, V., Valent, F., & Patrone, P. (2013). Videocapillaroscopic findings in the microcirculation of the psoriatic plaque during etanercept therapy. Clinical and experimental dermatology, 38(6), 633–637. https://doi.org/10.1111/ced.12036 Micali, G., Lacarrubba, F., Santagati, C., Egan, C. G., Nasca, M. R., & Musumeci, M. L. (2016). Clinical, ultrasound, and videodermatoscopy monitoring of psoriatic patients following biological treatment. Skin research and technology : official journal of International Society for Bioengineering and the Skin (ISBS) [and] International Society for Digital Imaging of Skin (ISDIS) [and] International Society for Skin Imaging (ISSI), 22(3), 341–348. https://doi.org/10.1111/srt.12271 Gallais Sérézal, I., Hoffer, E., Ignatov, B., Martini, E., Zitti, B., Ehrström, M., & Eidsmo, L. (2019). A skewed pool of resident T cells triggers psoriasis-associated tissue responses in never-lesional skin from patients with psoriasis. The Journal of allergy and clinical immunology, 143(4), 1444–1454. https://doi.org/10.1016/j.jaci.2018.08.048 Martini, E., Wikén, M., Cheuk, S., Gallais Sérézal, I., Baharom, F., Ståhle, M., Smed-Sörensen, A., & Eidsmo, L. (2017). Dynamic Changes in Resident and Infiltrating Epidermal Dendritic Cells in Active and Resolved Psoriasis. The Journal of investigative dermatology, 137(4), 865–873. https://doi.org/10.1016/j.jid.2016.11.033 Chen, X., Guo, W., Chang, Y., Chen, J., Kang, P., Yi, X., Cui, T., Guo, S., Xiao, Q., Jian, Z., Li, K., Gao, T., Li, S., Liu, L., & Li, C. (2019). Oxidative stress-induced IL-15 trans-presentation in keratinocytes contributes to CD8+ T cells activation via JAK-STAT pathway in vitiligo. Free radical biology & medicine, 139, 80–91. https://doi.org/10.1016/j.freeradbiomed.2019.05.011 Chen, Y., Liu, H., Yan, Y., Chen, H., Ye, S., Qiu, F., Liang, C. L., Zhang, Q., Zheng, F., Han, L., Lu, C., & Dai, Z. (2024). Methotrexate and electrostimulation cooperate to alleviate the relapse of psoriasiform skin inflammation by suppressing memory T cells. Biochemical pharmacology, 219, 115979. https://doi.org/10.1016/j.bcp.2023.115979 Additional Declarations No competing interests reported. Supplementary Files RawdataofWesternBlot.pptx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7412527","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":507830168,"identity":"15307a68-bceb-40f6-bc9e-1db365b638ff","order_by":0,"name":"Yukang Lin","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yukang","middleName":"","lastName":"Lin","suffix":""},{"id":507830169,"identity":"c0a8ad85-fd75-4480-a4d4-6f67d3dbf12e","order_by":1,"name":"Jiaying Chen","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Jiaying","middleName":"","lastName":"Chen","suffix":""},{"id":507830170,"identity":"0cc7a597-3f0d-4b2e-a859-1359815405ae","order_by":2,"name":"Han Du","email":"","orcid":"","institution":"Maoming Hospital of Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Han","middleName":"","lastName":"Du","suffix":""},{"id":507830173,"identity":"fdf8edb9-a635-4a95-9105-0117affe3106","order_by":3,"name":"Yuchao Chen","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yuchao","middleName":"","lastName":"Chen","suffix":""},{"id":507830177,"identity":"4565b57a-6f26-4eb2-aa11-e3877e30a482","order_by":4,"name":"Zhaolin Liu","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Zhaolin","middleName":"","lastName":"Liu","suffix":""},{"id":507830178,"identity":"22e07697-606f-4523-8025-6b4b3c1701fb","order_by":5,"name":"Xuejia Li","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xuejia","middleName":"","lastName":"Li","suffix":""},{"id":507830180,"identity":"30718d45-4e48-46d5-8b5e-68a97675e441","order_by":6,"name":"Yongdan Li","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yongdan","middleName":"","lastName":"Li","suffix":""},{"id":507830181,"identity":"7ceb8c2e-5e54-40cf-82f3-611a32c69e50","order_by":7,"name":"Feifei Qiu","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Feifei","middleName":"","lastName":"Qiu","suffix":""},{"id":507830183,"identity":"db7f316a-e27b-498d-8222-d63c6cd9e6f0","order_by":8,"name":"Hongying Cao","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Hongying","middleName":"","lastName":"Cao","suffix":""},{"id":507830184,"identity":"d92e5862-7aba-438f-bda0-58c07cb0c159","order_by":9,"name":"Siyuan Xu","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Siyuan","middleName":"","lastName":"Xu","suffix":""},{"id":507830185,"identity":"84aea7fa-ae94-490b-bab0-f76cae70bc04","order_by":10,"name":"Huazhen Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzUlEQVRIiWNgGAWjYBACg/sH2BgSGGxgfGYitBwAa0kjVQsDw2FStBxsYGN42Hbebv6M5KcbGCqsExvYzx7Aq8X+MAMbQ2Lb7eTGGWlmNxjOpCc28OQl4LflGFQLs0QO2w3GtsOJDRI8Bvi1nAFrOZfMBtbyjxgtN8BaDtjxgLU0EKWFsY0h4VxyggTPM7MbCcfSjdt4cghouX/4+McfZXb28u3Jz258qLGW7Wc/g18LAwNjA4hMBJMJQMxGQD0c2BOrcBSMglEwCkYgAAAqjEXRkhGEvgAAAABJRU5ErkJggg==","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Huazhen","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2025-08-20 02:08:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7412527/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7412527/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":90382376,"identity":"df7b188d-71b7-46c5-b213-b513a9c2e4d0","added_by":"auto","created_at":"2025-09-02 06:52:46","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":24211356,"visible":true,"origin":"","legend":"\u003cp\u003eImiquimod (IMQ) induced recurrent psoriatic mice. Flow chart of IMQ inducing recurrent psoriasis (A), visualized and H\u0026amp;E staining images of dorsal skin (B), cutaneous PASI scores, IL-17A, IL-6 and TNF-α of psoriatic mice (C). Values are means ± SD, n=6 per group. \u003cem\u003e*P\u0026lt;0.05,\u003c/em\u003e \u003cem\u003e**P\u0026lt;0.01\u003c/em\u003e versus control group.\u003c/p\u003e","description":"","filename":"Figures01.png","url":"https://assets-eu.researchsquare.com/files/rs-7412527/v1/b7d4b0f0dfeb0e42799f3781.png"},{"id":90384138,"identity":"ef293e1e-a71b-495b-987c-d72aa509c5bd","added_by":"auto","created_at":"2025-09-02 07:08:46","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":12684584,"visible":true,"origin":"","legend":"\u003cp\u003eMemory T cells in IMQ induced priamry psoriatic mice. Distribution of dot plots of CD8 central memory T (Tcm) cells and effector memory T (Tem) cells from lymph node (LN) and spleen of psoriatic mice (A), average percentages of CD8\u003csup\u003e+\u003c/sup\u003e CD44\u003csup\u003e+ \u003c/sup\u003eCD62L\u003csup\u003e+\u003c/sup\u003e Tcm cells and CD8\u003csup\u003e+ \u003c/sup\u003eCD44\u003csup\u003e+ \u003c/sup\u003eCD62L\u003csup\u003e-\u003c/sup\u003e Tem cells (B), distribution of dot plots of CD4 Tcm cells and Tem cells from LN and spleen of psoriatic mice (C), average percentages of CD4\u003csup\u003e+\u003c/sup\u003e CD44\u003csup\u003e+ \u003c/sup\u003eCD62L\u003csup\u003e+\u003c/sup\u003e Tcm cells and CD4\u003csup\u003e+ \u003c/sup\u003eCD44\u003csup\u003e+ \u003c/sup\u003eCD62L\u003csup\u003e-\u003c/sup\u003e Tem cells (D). Values are means ± SD, n=3 per group. \u003cem\u003e*P\u0026lt;0.05,\u003c/em\u003e \u003cem\u003e**P\u0026lt;0.01\u003c/em\u003e versus control group.\u003c/p\u003e","description":"","filename":"Figures02.png","url":"https://assets-eu.researchsquare.com/files/rs-7412527/v1/76f13def3752e5434f1939ad.png"},{"id":90383549,"identity":"c77d0775-283d-4b30-83f6-5b1771536843","added_by":"auto","created_at":"2025-09-02 07:00:46","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":14912811,"visible":true,"origin":"","legend":"\u003cp\u003eTissue resident memory T (Trm) cells in IMQ induced recurrent psoriatic mice. Distribution of dot plots of CD8 Trm cells (A) and CD4 Trm cells (B) from skin of psoriatic mice, average percentages of CD8\u003csup\u003e+\u003c/sup\u003e CLA\u003csup\u003e+\u003c/sup\u003e, CD8\u003csup\u003e+\u003c/sup\u003e CD69\u003csup\u003e+\u003c/sup\u003e, CD8\u003csup\u003e+\u003c/sup\u003e CD103\u003csup\u003e+\u003c/sup\u003e Trm cells and CD4\u003csup\u003e+\u003c/sup\u003e CD69\u003csup\u003e+\u003c/sup\u003e Trm cells (C), cutaneous gene expression of IL-15, CXCR3, CXCL9, and CXCL10 of psoriatic mice (D). Values are means ± SD, n=3 per group in A-C, n=6 per group in D. \u003cem\u003e*P\u0026lt;0.05,\u003c/em\u003e \u003cem\u003e**P\u0026lt;0.01\u003c/em\u003e versus control group.\u003c/p\u003e","description":"","filename":"Figures03.png","url":"https://assets-eu.researchsquare.com/files/rs-7412527/v1/617dd9feab72d167ed5453e6.png"},{"id":90382377,"identity":"7cb952ce-4d78-4f9a-8c01-7ed6523b2c95","added_by":"auto","created_at":"2025-09-02 06:52:46","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":34952286,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of\u003cstrong\u003e \u003c/strong\u003eCD8\u003csup\u003e+\u003c/sup\u003e Tcm and CD4\u003csup\u003e+\u003c/sup\u003e Tcm cells in recurrent psoriatic mice. Flow chart of CD8\u003csup\u003e+\u003c/sup\u003e Tcm/CD4\u003csup\u003e+\u003c/sup\u003e Tcm/recombinant IL-15 in recurrent psoriatic mice (A), PASI scores of recurrent psoriatic mice (B), cutaneous IL-17A, IL-6, IL-15 and TNF-α of psoriatic mice (C), visualized and H\u0026amp;E staining images of dorsal skin (D). Values are means ± SD, n=5 per group. \u003cem\u003e*P\u0026lt;0.05,\u003c/em\u003e \u003cem\u003e**P\u0026lt;0.01\u003c/em\u003e versus control group, \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u0026lt;0.05,\u003c/em\u003e\u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u0026lt;0.01 \u003c/em\u003eversus IMQ-IMQ group.\u003c/p\u003e","description":"","filename":"Figures04.png","url":"https://assets-eu.researchsquare.com/files/rs-7412527/v1/15982d10c92fca779a23abc8.png"},{"id":90382372,"identity":"d592b4cd-d1a8-4b3c-b572-e0fb475e8f9e","added_by":"auto","created_at":"2025-09-02 06:52:46","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":8279915,"visible":true,"origin":"","legend":"\u003cp\u003eProtein expression of NF-κB signaling in IMQ induced recurrent psoriatic mice. Protein bands of p-NF-κB p52 and p-NF-κB p65 (A), average phosphorylated level of p-NF-κB p52 (B) and p-NF-κB p65 (C), protein bands of p-TRAF2 and p-p38MAPK (D), average phosphorylated level of p-TRAF2 (E) and p-p38MAPK (F). Values are means ± SD, n=3 per group. \u003cem\u003e*P\u0026lt;0.05,\u003c/em\u003e \u003cem\u003e**P\u0026lt;0.01\u003c/em\u003e versus control group.\u003c/p\u003e","description":"","filename":"Figures05.png","url":"https://assets-eu.researchsquare.com/files/rs-7412527/v1/e55a4e0be61e3d6591223b95.png"},{"id":90382378,"identity":"693bce7a-8738-4690-b6d1-eae59daab2bc","added_by":"auto","created_at":"2025-09-02 06:52:46","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":36786654,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of NF-κB inhibitor and agonist in IMQ induced recurrent psoriatic mice. Visualized and H\u0026amp;E staining images of dorsal skin (A) and PASI scores (B), cutaneous IL-17A, IL-6, IL-15 and TNF-α expression (C), distribution of dot plots of CD8 Trm cells (D) and average percentages of CD8\u003csup\u003e+ \u003c/sup\u003eCD69\u003csup\u003e+\u003c/sup\u003e, CD8\u003csup\u003e+ \u003c/sup\u003eCD103\u003csup\u003e+ \u003c/sup\u003eTrm cells in skin of recurrent psoriatic mice. Values are means ± SD, n=5-6 per group. \u003cem\u003e*P\u0026lt;0.05,\u003c/em\u003e \u003cem\u003e**P\u0026lt;0.01\u003c/em\u003e versus control group, \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u0026lt;0.05, \u003c/em\u003e\u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u0026lt;0.01 \u003c/em\u003eversus IMQ-IMQ group.\u003c/p\u003e","description":"","filename":"Figures06.png","url":"https://assets-eu.researchsquare.com/files/rs-7412527/v1/c7abd721013d3769ab49c039.png"},{"id":94599005,"identity":"627e89f7-8823-4f8a-8e10-2434394133f0","added_by":"auto","created_at":"2025-10-28 19:01:02","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":127514464,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7412527/v1/24619641-6b96-4971-b69a-69b70e70fc37.pdf"},{"id":90382373,"identity":"ed20ae42-8c10-4c83-a446-31dc6d17dbb8","added_by":"auto","created_at":"2025-09-02 06:52:46","extension":"pptx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":713208,"visible":true,"origin":"","legend":"","description":"","filename":"RawdataofWesternBlot.pptx","url":"https://assets-eu.researchsquare.com/files/rs-7412527/v1/1bf5b2be98c0768117e02b27.pptx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Tissue resident memory T cells triggered recurrent psoriasiform dermatitis dependent on RELA/p52 signaling in mice","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePsoriasis is a chronic, papulosquamous dermatitis and associated with many other complications. Over 125 million people are affected with psoriasis worldwide\u003csup\u003e[1]\u003c/sup\u003e. Disorder of immune system is the primary pathogenesis of psoriasis. Although immunosuppressant and biological therapy display satisfactory effects in treating psoriasis\u003csup\u003e[2]\u003c/sup\u003e. But most of patients still suffer from the torment of recurrence\u003csup\u003e[3]\u003c/sup\u003e. Revealing the pathogenic mechanism is critical for preventing recurrent psoriasis.\u003c/p\u003e\n\u003cp\u003eMemory T cells mediated immunological memory play crucial role in immnue response of psoriatic recurrence. Part of T cells can differentiate into effector memory T (Tem) cells, central memory T (Tcm) cells and tissue resident memory T (Trm) cells\u003csup\u003e[4]\u003c/sup\u003e. Unlike Tem/Tcm cells that circulate between blood and lymph nodes (LNs), Trm cells show low migration and long-term survival in peripheral tissues, such as the skin\u003csup\u003e[3,5]\u003c/sup\u003e. Although cutaneous Trm cells provide rapid immune protection to prevent previous pathogen infections, but it also trigger the pro-inflammatory responses in recurrent inflammatory dermatosis\u003csup\u003e[6-8]\u003c/sup\u003e. In psoriasis, cutaneous Trm cells can persist after effective treatment and promote psoriatic recurrence by producing inflammatory cytokines, including IL-17A\u003csup\u003e[9,10]\u003c/sup\u003e. Hence, inhibiting the generation/retention of\u0026nbsp;Trm cells in skin could be a reasonable strategy to prevent\u0026nbsp;psoriatic recurrence. But the crucial mechanism of activating\u0026nbsp;cutaneous Trm cells in recurrent psoriasis is still unclear.\u003c/p\u003e\n\u003cp\u003eThe nuclear factor-κB (NF-κB) family is the classic protein complex in modulating both innate and adaptive immunity\u003csup\u003e[11]\u003c/sup\u003e. It is essential in lymphocyte activation and survival by regulating transcription of a large number of genes\u003csup\u003e[12]\u003c/sup\u003e. Activating NF-κB can be identified through canonical and non-canonical NF-κB signalling pathways\u003csup\u003e[12]\u003c/sup\u003e. The canonical NF-κB signalling activate NF-κB p50, RELA and c-REL. The non-canonical NF-κB signalling activate NF-κB p52 and RELB\u003csup\u003e[12]\u003c/sup\u003e. These protein complex are bound and inactive with inhibitors of NF-κB (IκBs)\u003csup\u003e[11]\u003c/sup\u003e. Once activation, IκB proteins will be degraded and release the NF-κB associated proteins to translocate\u003csup\u003e[11]\u003c/sup\u003e. In previous researches, NF-κB signalling play a critical role in generation and maintenance of effector and memory T cells\u003csup\u003e[13-15]\u003c/sup\u003e. However, the effects of NF-κB signalling in activation of Trm cells in psoriasis is still unknown.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this study, a repeated imiquimod induced recurrent psoriatic mice model was established to identify the phenotype of different type (CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e) of Trm cells. Then, Tcm cells injection and NF-κB inhibitor/agonist were used to investigate the role of CD8\u003csup\u003e+\u003c/sup\u003e Trm cells and effects of NF-κB signaling in recurrent psoriasis.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eAll Experimental procedure of animal studies were conducted by the Ethics Committee of the Second Affliated Hospital of Guangzhou University of Chinese Medicine. (No. 2021004).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReagents\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eImiquimod cream was obtained from Mingxin Pharmaceutical Co., Ltd (Sichuan, China). CU-T12-9 and NIK SMI 1 were obtained from MedChemExpress (Shanghai, China). Recombinant murine IL-15 (rIL-15) was obtained from PeproTech (Rocky Hill, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRecurrent psoriatic mice model\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSeven-weeks-old male Balb/c mice were obtained from Guangdong Medical Laboratory Animal Center (Guangzhou, China). Mice were housed under pathogen-free conditions in a temperature-controlled room illuminated for 12 h every day and received humane care. Mice were divide into control, imiquimod (IMQ)-vaselin and IMQ-IMQ group. After back hair was shaved, all mice except control group were treated 62.5 mg/day IMQ for 7 consecutive days. After immunologic tolerance for 14 days, mice of IMQ-vaselin group were received vaselin treatment for another 7 consecutive days. The mice of IMQ-IMQ group were received 20.8 mg/day IMQ for 7 consecutive days to induced the recurrent psoriasis (\u003cstrong\u003eFig. 1A\u003c/strong\u003e). The Psoriasis Area and Severity Index (PASI) was recorded to evaluated the level of dermatitis\u003csup\u003e[16]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistology\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSkin tissues were fixed in formaldehyde, paraffin-embedded, sectioned, and stained with hematoxylin and eosin.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBiochemical assays\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSkin tissues were homogenized in RIPA lysis buffer. Cutaneous IL-17A, IL-15, IL-6 and TNF-α both were determined by commercial ELISA kits (Boster, China).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow cytometric analysis (FACS)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFACS protocol was determined by our previous research\u003csup\u003e[16]\u003c/sup\u003e. LNs and spleen of mice were homogenized. Cells were harvested. Then cells were stained with anti-CD4 PE Antibody(Clone GK1.5, eBioscience, USA), anti-CD8a FITC Antibody (Clone 53-6.7, eBioscience, USA), anti-CD44 eFluor™ 450 Antibody (Clone IM7, eBioscience, USA) and anti-CD62L APC Antibody (Clone MEL-14, eBioscience, USA). Skin tissues were digested with collagenase type I (Sigma, Aldrich, USA) and DNase (Solarbio, Shanghai, China). After erythrocyte lysis, cells were stained with anti-CD8a Alexa Fluor™ 700 Antibody (Clone 53-6.7, eBioscience, USA), anti-CD103 PE Antibody (Clone 2E7, eBioscience, USA).anti-CD69 PE-Cyanine7 Antibody (Clone H1.2F3, eBioscience, USA), anti-CD4 Alexa Fluor™ 700 Antibody(Clone GK1.5, eBioscience, USA), anti-CLA PE \u0026nbsp; Antibody \u0026nbsp;(Clone HECA-452 ,BioLegend, Beijing,China), anti-CD44 eFluor™ 450 Antibody (Clone IM7, eBioscience, USA) and anti-CD62L APC Antibody (Clone MEL-14, eBioscience, USA). Finally, cells were analyzed by a flow cytometer (NovoCyte Quanteon, Agilent, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReal-time polymerase chain reaction (PCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSkin tissues were homogenized in TRIzol reagent (Invitrogen, Carlsbad, USA). Tocal RNA was isolated and synthesized into single standard cDNA. Finally, Quantitative real-time PCR was determined with a ViiA 7 Dx (Applied Biosystems, Carlsbad, USA) using SYBR Premix ExTaqTM Π (Takara Bio Incorporation, Tokyo, Japan).The primer sequences are shown below:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCXCL9 Forward: CTCGGCAAATGTGAAGAAGCTGA,CXCL9 Reverse: TTCCTTGAACGACGACGACTTTGG; IL-15 Forward: TCCATCTCGTGCTACTTGTGTTTCC,\u0026nbsp;IL-15 Reverse: TCCCTATGGCCCTCATTCTCACTG; CXCL10 Forward: TGCCGTCATTTTCTGCCTCATCC,\u0026nbsp;CXCL10 Reverse: CACATTCTGGAGGAAGTCCTTGG; CXCR3 Forward: CAGCCCTCTACAGCCTCCTCTTC,\u0026nbsp;CXCR3 Reverse: TACAGCCAGGTGGAGCAGGAAG; β-actin Forward: TGTCCACCTTCCAGCAGATGT,\u0026nbsp;β-actin Reverse: TGTCCACCTTCCAGCAGATGT.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSkin tissues were homogenized in RIPA lysis buffer as aforementioned protocol. Total protein was isolated and fractionated by SDS-PAGE. After protein was transferred to PVDF membrane, membranes were blocked and incubated with anti-GAPDH (Cell Signaling Technology, Boston, USA), anti-p-NF-κB-p65 (Cell Signaling Technology, Boston, USA), anti-p-NF-κB-p52 (Cell Signaling Technology, Boston, USA), anti-p-TRAF2 and anti-p-p38 MAPK (Cell Signaling Technology, Boston, USA). After incubating with respective secondary antibodies, membranes were visualized in a Bio-Rad Gel imaging system and analyzed using Image Lab software.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCD8\u003csup\u003e+\u003c/sup\u003e/CD4\u003csup\u003e+\u0026nbsp;\u003c/sup\u003eTcm cells and rIL-15 treatment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMice were divided into control, IMQ-IMQ, CD8\u003csup\u003e+\u003c/sup\u003e Tcm, CD4\u003csup\u003e+\u003c/sup\u003e Tcm, and rIL-15 group. Mice except control group were induced recurrent psoriasis mice as aforementioned methods. Then, mice of CD8\u003csup\u003e+\u003c/sup\u003e Tcm or CD4\u003csup\u003e+\u003c/sup\u003e Tcm group were injected with exogenous CD4+ or CD8\u003csup\u003e+\u003c/sup\u003e Tcm cells (1×10\u003csup\u003e^6\u003c/sup\u003e) at day 21 respectively. Mice of rIL-15 group were received recombinant murine IL-15 (\u003cem\u003ei.p.,\u0026nbsp;\u003c/em\u003e0.1 μg/mouse) at day 21, 24, 27. These Tcm cells were isolated from mice treated with IMQ on day 21. (\u003cstrong\u003eFig. 4A\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNF-\u003c/strong\u003e\u003cstrong\u003eκB\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;inhibitor/agonist treatment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMice were divided into control, IMQ-IMQ, NIK SMI 1 and CU-T12-9 group. Mice except control group were induced recurrent psoriasis as aforementioned methods. Mice of NIK SMI 1 and CU-T12-9 group were received 20 mg/kg NIK SMI 1 (\u003cem\u003ei.p.\u003c/em\u003e) or 60 mg/kg CU-T12-9 (\u003cem\u003ei.p.\u003c/em\u003e) at day 21, 24, 27, respectively.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll results were expressed as means\u0026nbsp;±\u0026nbsp;standard deviation. Data were analyzed by Kolmogorov-Smirnov and Mann-Whitney U test for normal distribution analysis. Data from more than two groups were analyzed by one-way ANOVA. Student’s t test was performed to identify differences between two groups. \u003cem\u003eP\u0026lt;0.05\u003c/em\u003e was considered significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eRepeated IMQ-induced recurrent psoriatic mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter treating with repeated IMQ, obviously papulosquamous plaques and bleeding were observed in mice back, as well as severe epidermal hyperplasia (\u003cstrong\u003eFig. 1B\u003c/strong\u003e). Mice of IMQ-IMQ group also showed higher PASI scores than control group (\u003cstrong\u003eFig. 1C\u003c/strong\u003e), which indicated recurrent psoriatic mice have been established. Meanwhile, cutaneous inflammatory cytokines (IL-17A, IL-6, TNF-α) were elevated in IMQ-IMQ group (\u003cstrong\u003eFig. 1C\u003c/strong\u003e). These data suggested that psoriasiform dermatitis emerge in repeated IMQ induced recurrent psoriatic mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eT memory cells in spleen and LNs of primary psoriatic mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn order to investigate the phenotype of T memory cells, we determined the Tcm and Tem in spleen and LNs of IMQ induced priamry psoriatic mice at day 7 (\u003cstrong\u003eFig. 1A\u003c/strong\u003e). Both CD8\u003csup\u003e+\u003c/sup\u003e Tcm and Tem cells were increased in spleen and LNs of primary psoriatic mice at Day7 (\u003cstrong\u003eFig. 2A, B\u003c/strong\u003e). On the other hand, CD4\u003csup\u003e+\u003c/sup\u003e Tcm and Tem cells also were enhanced in spleen and LNs of psoriatic mice (\u003cstrong\u003eFig. 2C, D\u003c/strong\u003e). These data indicated that both CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T memory cells were activated in first onset of psoriasis. These memory cells may further differentiate into Trm cells and persist in skin\u003csup\u003e[17]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCutaneous Trm cells in recurrent psoriatic mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter verifying the Tem and Tcm cells in priamry psoriatic mice, we further explored the Trm cells in skin of recurrent psoriatic mice. CD103, CD69 and CLA are the biomarker of Trm cells. The CD8\u003csup\u003e+\u003c/sup\u003e CD103\u003csup\u003e+\u003c/sup\u003e, CD8\u003csup\u003e+\u003c/sup\u003e CD69\u003csup\u003e+\u0026nbsp;\u003c/sup\u003eand CD8\u003csup\u003e+\u003c/sup\u003e CLA\u003csup\u003e+\u0026nbsp;\u003c/sup\u003eTrm cells both were increased in skin of IMQ-IMQ induced recurrent psoriatic mice (\u003cstrong\u003eFig. 3A, C\u003c/strong\u003e). Interestingly, there were not significantly difference of the CD4\u003csup\u003e+\u003c/sup\u003e CD69\u003csup\u003e+\u0026nbsp;\u003c/sup\u003eTrm cells between control group and IMQ-IMQ group (\u003cstrong\u003eFig. 3B, C\u003c/strong\u003e). These data suggested CD8\u003csup\u003e+\u003c/sup\u003e Trm cells but not CD4\u003csup\u003e+\u003c/sup\u003e Trm cells are more important in recurrent psoriasis. This is also in accordance with previous research revealed CD8\u003csup\u003e+\u003c/sup\u003e Trm cells generate IL-17A to promote local skin inflammation in psoriasis\u003csup\u003e[18]\u003c/sup\u003e. On the other hand, cutaneous genes expression of IL-15, CXCR3, CXCL9 and CXCL10 both were up-regulated in recurrent psoriatic mice (\u003cstrong\u003eFig. 3D\u003c/strong\u003e). These genes both were associated with recruitment of T cells and generation of Trm cells\u003csup\u003e[3,19-21]\u003c/sup\u003e. Hence, we assume CD8\u003csup\u003e+\u003c/sup\u003e Trm cells are activated and contribute to recurrence of psoriasiform dermatitis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTreating recovery psoriatic mice with CD8\u003csup\u003e+\u003c/sup\u003e Tcm, CD4\u003csup\u003e+\u003c/sup\u003e Tcm cells or rIL-15\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn order to validate the effects of CD8\u003csup\u003e+\u003c/sup\u003e memory cells in recurrent psoriasis, we separated the CD8\u003csup\u003e+\u003c/sup\u003e Tcm and CD4\u003csup\u003e+\u003c/sup\u003e Tcm cells from the first onset of psoriatic mice and injected into recurrent psoriatic mice (\u003cstrong\u003eFig. 4A\u003c/strong\u003e). After injection of CD8\u003csup\u003e+\u003c/sup\u003e Tcm cells, mice exhibited more severe psoriatic symptom than IMQ-IMQ induced recurrent psoriatic mice (\u003cstrong\u003eFig. 4B, D\u003c/strong\u003e). Cutaneous IL-17A, IL-15, IL-6 and TNF-α also were enhanced with CD8\u003csup\u003e+\u003c/sup\u003e Tcm cells treatment more than IMQ-IMQ induced recurrent psoriatic mice (\u003cstrong\u003eFig. 4C\u003c/strong\u003e). However, injection of CD4\u003csup\u003e+\u003c/sup\u003e Tcm cells only display similar psoriatic symptom with IMQ-IMQ induced recurrent psoriatic mice (\u003cstrong\u003eFig. 4B-D\u003c/strong\u003e). Meanwhile, mice treating with rIL-15 also exhibited psoriasiform dermatitis, high PASI scores and inflammatory cytokines as well as CD8\u003csup\u003e+\u003c/sup\u003e Tcm group (\u003cstrong\u003eFig. 4B-D\u003c/strong\u003e). IL-15 is the key cytokine to promote generation and survival of Trm cells in skin\u003csup\u003e[22-26]\u003c/sup\u003e. Hence, we consider IL-15 induced CD8\u003csup\u003e+\u003c/sup\u003e Trm cells, but not CD4\u003csup\u003e+\u003c/sup\u003e Trm cells, trigger the recurrent psoriasis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCanonical and non-canonical NF-κB in recurrent psoriatic mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn order to reveal the mechanism of activating Trm cells in recurrent psoriasis, the protein expression of classic NF-κB and MAPK were determined. The phosphorylated regulatory factor of canonical NF-κB p65 (RELA) and non-canonical NF-κB p52 both were up-regulated in IMQ-IMQ induced recurrent psoriatic mice (\u003cstrong\u003eFig. 5A-C\u003c/strong\u003e). Hence, both canonical and non-canonical NF-κB signaling may contribute to activation of Trm cells. TRAF2 is the receptor of TRAF family which can be activated by TNF family members. TRAF2 also is the adaptor protein in activating NF-κB through various downstream signaling mechanism, including mitogen-activated protein kinase (MAPK)\u003csup\u003e[27,28]\u003c/sup\u003e. But, the phosphorylated level of pMAPK p38 and pTRAF2 in skin were similar in control group and IMQ-IMQ group (\u003cstrong\u003eFig. 5D-F\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTreating recovery psoriatic mice with NF-κB inhibitor and agonist\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIMQ-IMQ induced recurrent psoriatic mice were received NF-κB inhibitor (NIK SMI 1) or NF-κB agonist (CU-T12-9) to validated the role of NF-κB signaling in Trm cells associated recurrent psoriasis. After treating with NIK SMI 1, the papulosquamous plaques, PASI scores and epidermal hyperplasia both were normalized in recurrent psoriatic mice (\u003cstrong\u003eFig. 6A, B\u003c/strong\u003e). The cutaneous IL-17A, IL-6 IL-15 and TNF-α were reduced with NIK SMI 1 treatment (\u003cstrong\u003eFig. 6C\u003c/strong\u003e). Finally, CD8\u003csup\u003e+\u003c/sup\u003e CD103\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e CD69\u003csup\u003e+\u0026nbsp;\u003c/sup\u003eTrm cells in skin also were decreased by NIK SMI 1 treatment (\u003cstrong\u003eFig. 6D, E\u003c/strong\u003e). On the contrary, mice of CU-T12-9 group did not exhibited more severe psoriatic symptom than IMQ-IMQ group (\u003cstrong\u003eFig. 6A-E\u003c/strong\u003e). All these data indicate NF-κB signaling play a crucial role in generation of CD8\u003csup\u003e+\u003c/sup\u003e Trm cell and recurrent psoriasis.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eT memory cells triggered inflammatory responses is the primary pathogenesis and challenge of treating recurrent psoriasis. Once naive T cells are activated by dendritic cells, fraction of T cells will differentiated into Tcm and Tem cells\u003csup\u003e[4]\u003c/sup\u003e. In inflammatory dermatosis, these T memory cells can further differentiate to Trm cells and persist in skin for long time\u003csup\u003e[17]\u003c/sup\u003e. These cutaneous Trm cells can rapidly response to previous pathogens and promote recurrence of psoriasis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this study, CD4\u003csup\u003e+\u0026nbsp;\u003c/sup\u003eand CD8\u003csup\u003e+\u0026nbsp;\u003c/sup\u003eTem and Tcm both were increased in spleen and LNs in primary psoriatic mice, which means T memory cells are activated and persisted in lymphoid organs. These memory cells can further migrate to skin and differentiate into Trm cells\u003csup\u003e[3,17]\u003c/sup\u003e. In order to elicit this immunological memory effects in psoriasis, we established recurrent psoriatic mice through different dosage of IMQ. In our previous and this studies, only 1/3 dosage of IMQ can induce severe psoriasiform dermatitis as primary psoriasis\u003csup\u003e[16,37]\u003c/sup\u003e. Meanwhile, Trm cells were enriched in skin of psoriatic mice\u003csup\u003e[16,37]\u003c/sup\u003e. This phenotype validate Trm associated immunological memory trigger the recurrence of psoriasis.\u003c/p\u003e\n\u003cp\u003eTrm cells express various biomarkers, including CD69, CD103 and CLA\u003csup\u003e[3]\u003c/sup\u003e. CD103 and CLA can bind with E-selectin and P-selectin, which promote retention of Trm cells in skin\u003csup\u003e[29,30]\u003c/sup\u003e. On the other hand, CD69 attenuates S1P induced re-circulation to prevent homing of Trm cells\u003csup\u003e[31]\u003c/sup\u003e. Then the blood vasculature system is still disturbed in convalescence after psoriasis and further promote Trm cells retain in skin\u003csup\u003e[32,33]\u003c/sup\u003e. In this research, we found only CD8\u003csup\u003e+\u003c/sup\u003e Trm cells, but not CD4\u003csup\u003e+\u0026nbsp;\u003c/sup\u003eTrm cells, increased in skin of recurrent psoriatic mice. This finding is in accordance with previous research reported CD8\u003csup\u003e+\u003c/sup\u003e Trm cells generate IL-17A to promote local skin inflammation in psoriasis\u003csup\u003e[18]\u003c/sup\u003e. \u0026nbsp;Meanwhile, cutaneous IL-15, CXCR3, CXCL9 and CXCL10 also were enhanced in recurrent psoriatic mice. IL-15 is a crucial cytokine in recruitment and maintenance of Trm cells through several signaling\u003csup\u003e[22-26]\u003c/sup\u003e. The CXCR3 can facilitate Trm cells generation\u003csup\u003e[19]\u003c/sup\u003e. In addition, CXCL9 and CXCL10 both can activate Trm cells by different pathways\u003csup\u003e[20,21]\u003c/sup\u003e. These results suggest CD8\u003csup\u003e+\u003c/sup\u003e Trm cells associated inflammatory response may be the primary reason of recurrent psoriasis.\u003c/p\u003e\n\u003cp\u003eIn order to estimate which kind of Trm cells play the dominant role in recurrent psoriasis, mice were received the CD8\u003csup\u003e+\u003c/sup\u003e Tcm cells or CD4\u003csup\u003e+\u003c/sup\u003e Tcm cells from first onset of psoriatic mice. Mice displayed more severe psoriasiform dermatitis with injection of CD8\u003csup\u003e+\u003c/sup\u003e Tcm cells than IMQ-IMQ group. These results further verify CD8\u003csup\u003e+\u003c/sup\u003e Tcm cells, but not CD4\u003csup\u003e+\u003c/sup\u003e Tcm cells, trigger the recurrent psoriasis. Meanwhile, rIL-15 treatment also showed similar psoriasiform dermatitis with mice after injection of CD8\u003csup\u003e+\u003c/sup\u003e Tcm cells. In psoriasis, IL-15 is produced by skin keratinocytes, DCs, and fibroblasts and promote activation of Trm cells\u003csup\u003e[34,35]\u003c/sup\u003e. This finding further validate rIL-15 associated generation of CD8\u003csup\u003e+\u003c/sup\u003e T memory cells contribute to recurrent psoriasis.\u003c/p\u003e\n\u003cp\u003eRevealing the molecular mechanism of activation of Trm is the basis in preventing recurrent psoriasis. NF-κB protein complex is the classic regulator in immune responses of lymphocytes. Activity of NF-κB protein complex is associated with IκB kinase (IKK) complex. Upon stimulation of IKKγ, IκB family will be phosphorylated, ubiquitylation and proteasomal degradation. After that, NF‑κB family members will \u0026nbsp;be released and nuclear translocated\u003csup\u003e[11]\u003c/sup\u003e. Based on canonical and non-canonical NF-κB signaling different submit will be released. For canonical NF-κB signaling, p105 will degrade into p50, p65 (RELA) and c-REL. For non-canonical NF-κB signaling, p100 will degrade into p52 and RELB\u003csup\u003e[11]\u003c/sup\u003e. These submits modulate generation and maintenance of effector and memory T cell through various mechanisms. In vitiligo, reactive oxygen species activate canonical NF-κB signaling in keratinocytes which secrete IL-15 to activate CD8\u003csup\u003e+\u003c/sup\u003e Tem cells\u003csup\u003e[36]\u003c/sup\u003e. Hence, we assumed NF-κB signaling also could be the key regulator in generation of CD8\u003csup\u003e+\u003c/sup\u003e Trm cells in recurrent psoriasis. In IMQ-IMQ induced recurrent psoriatic mice, both p-NF-κB p65 (RELA) and p-NF-κB p52 were up-regulated in skin. However, expression of p-TRAF2 and pMAPK p38 were invariant in skin of psoriatic mice. These results indicate both canonical and non-canonical NF-κB signaling may contribute to activation of CD8\u003csup\u003e+\u003c/sup\u003e Trm cells in recurrent psoriasis. But the upstream regulator is unclear in recurrent psoriasis.\u003c/p\u003e\n\u003cp\u003eFinally, the NF-κB inhibitor (NIK SMI 1) or NF-κB agonist (CU-T12-9) were used to verify the role of NF-κB signaling in CD8\u003csup\u003e+\u003c/sup\u003e Trm cells and recurrent psoriasis. The NIK SMI 1 significantly ameliorated the symptom of psoriasis in recurrent psoriatic mice. NIK SMI 1 also reduced the level of inflammatory cytokines and CD8\u003csup\u003e+\u003c/sup\u003e Trm cells close to normal group, which means activity of CD8\u003csup\u003e+\u003c/sup\u003e Trm cells mainly dependents on the NF-κB signaling. On the other hand, CU-T12-9 could not deteriorate the symptom and CD8\u003csup\u003e+\u003c/sup\u003e Trm cells retention in recurrent psoriatic mice, which indicate NF-κB signaling have been fully activated in recurrent psoriatic mice. These data confirmed NF-κB signaling play the dominant role in CD8\u003csup\u003e+\u003c/sup\u003e Trm cells associated recurrent psoriasis, at least in IMQ-IMQ induced recurrent psoriasis.\u003c/p\u003e\n\u003cp\u003eIn conclusion, activating canonical and non-canonical NF-κB signaling may promote generation of CD8\u003csup\u003e+\u003c/sup\u003e Trm cells in skin and elicit recurrent psoriasiform dermatitis in imiquimod induced psoriatic mice. This mechanism could be a novel potential target for preventing recurrence of psoriasis.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eH. Liu and S. Xu designed the research protocol. Y. Lin, J. Chen, H. Du and H. Liu implemented the research. Y. Chen, Z. Liu and X. Li analyzed data. S. Xu, H. Liu and Y. Lin wrote the manuscript. Y. Li, F. Qiu and H. Cao revised the manuscript. All authors read and approved the final study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by National Natural Science Foundation of China (Grant No. 82304842), Science and Technology Planning Project of Guangdong Province(No. 2023B1212060063), Guangzhou Municipal Science and Technology Bureau (2025A03J1082) , Guangdong Provincial Administration of Traditional Chinese Medicine (20251468), Maoming Municipal Science and Technology Bureau (2024kjcxLX038) and Guangdong Provincial Basic and Applied Basic Research Foundation (No.2025A1515010295 and No.2025A1515010807).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData available statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData will be made available on request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing fnancial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eGreb, J. E., Goldminz, A. M., Elder, J. T., Lebwohl, M. G., Gladman, D. D., Wu, J. J., Mehta, N. N., Finlay, A. Y., \u0026amp; Gottlieb, A. B. (2016). Psoriasis. Nature reviews. Disease primers, 2, 16082. https://doi.org/10.1038/nrdp.2016.82\u003c/li\u003e\n\u003cli\u003eGriffiths, C. E. M., Armstrong, A. W., Gudjonsson, J. E., \u0026amp; Barker, J. N. W. N. (2021). Psoriasis. Lancet (London, England), 397(10281), 1301\u0026ndash;1315. https://doi.org/10.1016/S0140-6736(20)32549-6\u003c/li\u003e\n\u003cli\u003eChen, L., \u0026amp; Shen, Z. (2020). Tissue-resident memory T cells and their biological characteristics in the recurrence of inflammatory skin disorders. Cellular \u0026amp; molecular immunology, 17(1), 64\u0026ndash;75. https://doi.org/10.1038/s41423-019-0291-4\u003c/li\u003e\n\u003cli\u003eWatanabe, R., Gehad, A., Yang, C., Scott, L. L., Teague, J. E., Schlapbach, C., Elco, C. P., Huang, V., Matos, T. R., Kupper, T. S., \u0026amp; Clark, R. A. (2015). Human skin is protected by four functionally and phenotypically discrete populations of resident and recirculating memory T cells. Science translational medicine, 7(279), 279ra39. https://doi.org/10.1126/scitranslmed.3010302\u003c/li\u003e\n\u003cli\u003eMigayron, L., Merhi, R., Seneschal, J., \u0026amp; Boniface, K. (2024). Resident memory T cells in nonlesional skin and healed lesions of patients with chronic inflammatory diseases: Appearances can be deceptive. The Journal of allergy and clinical immunology, 153(3), 606\u0026ndash;614. https://doi.org/10.1016/j.jaci.2023.11.017\u003c/li\u003e\n\u003cli\u003eTokura, Y., Phadungsaksawasdi, P., Kurihara, K., Fujiyama, T., \u0026amp; Honda, T. (2021). Pathophysiology of Skin Resident Memory T Cells. Frontiers in immunology, 11, 618897. https://doi.org/10.3389/fimmu.2020.618897\u003c/li\u003e\n\u003cli\u003eRyan, G. E., Harris, J. E., \u0026amp; Richmond, J. M. (2021). Resident Memory T Cells in Autoimmune Skin Diseases. Frontiers in immunology, 12, 652191. https://doi.org/10.3389/fimmu.2021.652191\u003c/li\u003e\n\u003cli\u003eLiu, Y., Wang, H., Taylor, M., Cook, C., Mart\u0026iacute;nez-Berdeja, A., North, J. P., Harirchian, P., Hailer, A. A., Zhao, Z., Ghadially, R., Ricardo-Gonzalez, R. R., Grekin, R. C., Mauro, T. M., Kim, E., Choi, J., Purdom, E., Cho, R. J., \u0026amp; Cheng, J. B. (2022). Classification of human chronic inflammatory skin disease based on single-cell immune profiling. Science immunology, 7(70), eabl9165. https://doi.org/10.1126/sciimmunol.abl9165\u003c/li\u003e\n\u003cli\u003eMatos, T. R., O\u0026apos;Malley, J. T., Lowry, E. L., Hamm, D., Kirsch, I. R., Robins, H. S., Kupper, T. S., Krueger, J. G., \u0026amp; Clark, R. A. (2017). Clinically resolved psoriatic lesions contain psoriasis-specific IL-17-producing \u0026alpha;\u0026beta; T cell clones. The Journal of clinical investigation, 127(11), 4031\u0026ndash;4041. https://doi.org/10.1172/JCI93396\u003c/li\u003e\n\u003cli\u003eCheuk, S., Wik\u0026eacute;n, M., Blomqvist, L., Nyl\u0026eacute;n, S., Talme, T., St\u0026aring;hle, M., \u0026amp; Eidsmo, L. (2014). Epidermal Th22 and Tc17 cells form a localized disease memory in clinically healed psoriasis. Journal of immunology (Baltimore, Md. : 1950), 192(7), 3111\u0026ndash;3120. https://doi.org/10.4049/jimmunol.1302313\u003c/li\u003e\n\u003cli\u003eSun S. C. (2017). The non-canonical NF-\u0026kappa;B pathway in immunity and inflammation. Nature reviews. Immunology, 17(9), 545\u0026ndash;558. https://doi.org/10.1038/nri.2017.52\u003c/li\u003e\n\u003cli\u003eLi, Q., \u0026amp; Verma, I. M. (2002). NF-kappaB regulation in the immune system. Nature reviews. Immunology, 2(10), 725\u0026ndash;734. https://doi.org/10.1038/nri910\u003c/li\u003e\n\u003cli\u003eYu, J., Zhou, X., Nakaya, M., Jin, W., Cheng, X., \u0026amp; Sun, S. C. (2014). T cell-intrinsic function of the noncanonical NF-\u0026kappa;B pathway in the regulation of GM-CSF expression and experimental autoimmune encephalomyelitis pathogenesis. Journal of immunology (Baltimore, Md. : 1950), 193(1), 422\u0026ndash;430. https://doi.org/10.4049/jimmunol.1303237\u003c/li\u003e\n\u003cli\u003eLi, Y., Wang, H., Zhou, X., Xie, X., Chen, X., Jie, Z., Zou, Q., Hu, H., Zhu, L., Cheng, X., Brightbill, H. D., Wu, L. C., Wang, L., \u0026amp; Sun, S. C. (2016). Cell intrinsic role of NF-\u0026kappa;B-inducing kinase in regulating T cell-mediated immune and autoimmune responses. Scientific reports, 6, 22115. https://doi.org/10.1038/srep22115\u003c/li\u003e\n\u003cli\u003eRowe, A. M., Murray, S. E., Rau\u0026eacute;, H. P., Koguchi, Y., Slifka, M. K., \u0026amp; Parker, D. C. (2013). A cell-intrinsic requirement for NF-\u0026kappa;B-inducing kinase in CD4 and CD8 T cell memory. Journal of immunology (Baltimore, Md. : 1950), 191(7), 3663\u0026ndash;3672. https://doi.org/10.4049/jimmunol.1301328\u003c/li\u003e\n\u003cli\u003eChen, Y., Yan, Y., Liu, H., Qiu, F., Liang, C. L., Zhang, Q., Huang, R. Y., Han, L., Lu, C., \u0026amp; Dai, Z. (2020). Dihydroartemisinin ameliorates psoriatic skin inflammation and its relapse by diminishing CD8+ T-cell memory in wild-type and humanized mice. Theranostics, 10(23), 10466\u0026ndash;10482. https://doi.org/10.7150/thno.45211\u003c/li\u003e\n\u003cli\u003eOsborn, J. F., Hobbs, S. J., Mooster, J. L., Khan, T. N., Kilgore, A. M., Harbour, J. C., \u0026amp; Nolz, J. C. (2019). Central memory CD8+ T cells become CD69+ tissue-residents during viral skin infection independent of CD62L-mediated lymph node surveillance. PLoS pathogens, 15(3), e1007633. https://doi.org/10.1371/journal.ppat.1007633\u003c/li\u003e\n\u003cli\u003eCheuk, S., Schlums, H., Gallais S\u0026eacute;r\u0026eacute;zal, I., Martini, E., Chiang, S. C., Marquardt, N., Gibbs, A., Detlofsson, E., Introini, A., Forkel, M., H\u0026ouml;\u0026ouml;g, C., Tjernlund, A., Micha\u0026euml;lsson, J., Folkersen, L., Mj\u0026ouml;sberg, J., Blomqvist, L., Ehrstr\u0026ouml;m, M., St\u0026aring;hle, M., Bryceson, Y. T., \u0026amp; Eidsmo, L. (2017). CD49a Expression Defines Tissue-Resident CD8+ T Cells Poised for Cytotoxic Function in Human Skin. Immunity, 46(2), 287\u0026ndash;300. https://doi.org/10.1016/j.immuni.2017.01.009\u003c/li\u003e\n\u003cli\u003eChristopherson, K., 2nd, \u0026amp; Hromas, R. (2001). Chemokine regulation of normal and pathologic immune responses. Stem cells (Dayton, Ohio), 19(5), 388\u0026ndash;396. https://doi.org/10.1634/stemcells.19-5-388\u003c/li\u003e\n\u003cli\u003eWu, X., Cheong, L. Y., Yuan, L., Jin, L., Zhang, Z., Xiao, Y., Zhou, Z., Xu, A., Hoo, R. L., \u0026amp; Shu, L. (2024). Islet-Resident Memory T Cells Orchestrate the Immunopathogenesis of Type 1 Diabetes through the FABP4-CXCL10 Axis. Advanced science (Weinheim, Baden-Wurttemberg, Germany), 11(30), e2308461. https://doi.org/10.1002/advs.202308461\u003c/li\u003e\n\u003cli\u003eGarrido-Martin, E. M., Mellows, T. W. P., Clarke, J., Ganesan, A. P., Wood, O., Cazaly, A., Seumois, G., Chee, S. J., Alzetani, A., King, E. V., Hedrick, C. C., Thomas, G., Friedmann, P. S., Ottensmeier, C. H., Vijayanand, P., \u0026amp; Sanchez-Elsner, T. (2020). M1hot tumor-associated macrophages boost tissue-resident memory T cells infiltration and survival in human lung cancer. Journal for immunotherapy of cancer, 8(2), e000778. https://doi.org/10.1136/jitc-2020-000778\u003c/li\u003e\n\u003cli\u003eSowell, R. T., \u0026amp; Marzo, A. L. (2015). Resident-Memory CD8 T Cells and mTOR: Generation, Protection, and Clinical Importance. Frontiers in immunology, 6, 38. https://doi.org/10.3389/fimmu.2015.00038\u003c/li\u003e\n\u003cli\u003eBecker, T. C., Wherry, E. J., Boone, D., Murali-Krishna, K., Antia, R., Ma, A., \u0026amp; Ahmed, R. (2002). Interleukin 15 is required for proliferative renewal of virus-specific memory CD8 T cells. The Journal of experimental medicine, 195(12), 1541\u0026ndash;1548. https://doi.org/10.1084/jem.20020369\u003c/li\u003e\n\u003cli\u003eMackay, L. K., Stock, A. T., Ma, J. Z., Jones, C. M., Kent, S. J., Mueller, S. N., Heath, W. R., Carbone, F. R., \u0026amp; Gebhardt, T. (2012). Long-lived epithelial immunity by tissue-resident memory T (TRM) cells in the absence of persisting local antigen presentation. Proceedings of the National Academy of Sciences of the United States of America, 109(18), 7037\u0026ndash;7042. https://doi.org/10.1073/pnas.1202288109\u003c/li\u003e\n\u003cli\u003eKaech, S. M., Tan, J. T., Wherry, E. J., Konieczny, B. T., Surh, C. D., \u0026amp; Ahmed, R. (2003). Selective expression of the interleukin 7 receptor identifies effector CD8 T cells that give rise to long-lived memory cells. Nature immunology, 4(12), 1191\u0026ndash;1198. https://doi.org/10.1038/ni1009\u003c/li\u003e\n\u003cli\u003eSchluns, K. S., Kieper, W. C., Jameson, S. C., \u0026amp; Lefran\u0026ccedil;ois, L. (2000). Interleukin-7 mediates the homeostasis of na\u0026iuml;ve and memory CD8 T cells in vivo. Nature immunology, 1(5), 426\u0026ndash;432. https://doi.org/10.1038/80868\u003c/li\u003e\n\u003cli\u003eKelliher, M. A., Grimm, S., Ishida, Y., Kuo, F., Stanger, B. Z., \u0026amp; Leder, P. (1998). The death domain kinase RIP mediates the TNF-induced NF-kappaB signal. Immunity, 8(3), 297\u0026ndash;303. https://doi.org/10.1016/s1074-7613(00)80535-x\u003c/li\u003e\n\u003cli\u003eYang, J., Lin, Y., Guo, Z., Cheng, J., Huang, J., Deng, L., Liao, W., Chen, Z., Liu, Z., \u0026amp; Su, B. (2001). The essential role of MEKK3 in TNF-induced NF-kappaB activation. Nature immunology, 2(7), 620\u0026ndash;624. https://doi.org/10.1038/89769\u003c/li\u003e\n\u003cli\u003eCepek, K. L., Shaw, S. K., Parker, C. M., Russell, G. J., Morrow, J. S., Rimm, D. L., \u0026amp; Brenner, M. B. (1994). Adhesion between epithelial cells and T lymphocytes mediated by E-cadherin and the alpha E beta 7 integrin. Nature, 372(6502), 190\u0026ndash;193. https://doi.org/10.1038/372190a0\u003c/li\u003e\n\u003cli\u003eClark, R. A., Chong, B., Mirchandani, N., Brinster, N. K., Yamanaka, K., Dowgiert, R. K., \u0026amp; Kupper, T. S. (2006). The vast majority of CLA+ T cells are resident in normal skin. Journal of immunology (Baltimore, Md. : 1950), 176(7), 4431\u0026ndash;4439. https://doi.org/10.4049/jimmunol.176.7.4431\u003c/li\u003e\n\u003cli\u003eMackay, L. K., Braun, A., Macleod, B. L., Collins, N., Tebartz, C., Bedoui, S., Carbone, F. R., \u0026amp; Gebhardt, T. (2015). Cutting edge: CD69 interference with sphingosine-1-phosphate receptor function regulates peripheral T cell retention. Journal of immunology (Baltimore, Md. : 1950), 194(5), 2059\u0026ndash;2063. https://doi.org/10.4049/jimmunol.1402256\u003c/li\u003e\n\u003cli\u003eStinco, G., Buligan, C., Maione, V., Valent, F., \u0026amp; Patrone, P. (2013). Videocapillaroscopic findings in the microcirculation of the psoriatic plaque during etanercept therapy. Clinical and experimental dermatology, 38(6), 633\u0026ndash;637. https://doi.org/10.1111/ced.12036\u003c/li\u003e\n\u003cli\u003eMicali, G., Lacarrubba, F., Santagati, C., Egan, C. G., Nasca, M. R., \u0026amp; Musumeci, M. L. (2016). Clinical, ultrasound, and videodermatoscopy monitoring of psoriatic patients following biological treatment. Skin research and technology : official journal of International Society for Bioengineering and the Skin (ISBS) [and] International Society for Digital Imaging of Skin (ISDIS) [and] International Society for Skin Imaging (ISSI), 22(3), 341\u0026ndash;348. https://doi.org/10.1111/srt.12271\u003c/li\u003e\n\u003cli\u003eGallais S\u0026eacute;r\u0026eacute;zal, I., Hoffer, E., Ignatov, B., Martini, E., Zitti, B., Ehrstr\u0026ouml;m, M., \u0026amp; Eidsmo, L. (2019). A skewed pool of resident T cells triggers psoriasis-associated tissue responses in never-lesional skin from patients with psoriasis. The Journal of allergy and clinical immunology, 143(4), 1444\u0026ndash;1454. https://doi.org/10.1016/j.jaci.2018.08.048\u003c/li\u003e\n\u003cli\u003eMartini, E., Wik\u0026eacute;n, M., Cheuk, S., Gallais S\u0026eacute;r\u0026eacute;zal, I., Baharom, F., St\u0026aring;hle, M., Smed-S\u0026ouml;rensen, A., \u0026amp; Eidsmo, L. (2017). Dynamic Changes in Resident and Infiltrating Epidermal Dendritic Cells in Active and Resolved Psoriasis. The Journal of investigative dermatology, 137(4), 865\u0026ndash;873. https://doi.org/10.1016/j.jid.2016.11.033\u003c/li\u003e\n\u003cli\u003eChen, X., Guo, W., Chang, Y., Chen, J., Kang, P., Yi, X., Cui, T., Guo, S., Xiao, Q., Jian, Z., Li, K., Gao, T., Li, S., Liu, L., \u0026amp; Li, C. (2019). Oxidative stress-induced IL-15 trans-presentation in keratinocytes contributes to CD8+ T cells activation via JAK-STAT pathway in vitiligo. Free radical biology \u0026amp; medicine, 139, 80\u0026ndash;91. https://doi.org/10.1016/j.freeradbiomed.2019.05.011\u003c/li\u003e\n\u003cli\u003eChen, Y., Liu, H., Yan, Y., Chen, H., Ye, S., Qiu, F., Liang, C. L., Zhang, Q., Zheng, F., Han, L., Lu, C., \u0026amp; Dai, Z. (2024). Methotrexate and electrostimulation cooperate to alleviate the relapse of psoriasiform skin inflammation by suppressing memory T cells. Biochemical pharmacology, 219, 115979. https://doi.org/10.1016/j.bcp.2023.115979\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Psoriasis, recurrence, tissue resident memory T cells, NF-κB signaling, imiquimod.","lastPublishedDoi":"10.21203/rs.3.rs-7412527/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7412527/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eImmunological memory triggered recurrence is the critical challenge in treating psoriasis. Tissue resident memory T (Trm) cells is the primary pacemaker in recurrent psoriasiform dermatitis, but the mechanism of activating Trm cells is still unclear. In this study, imiquimod induced recurrent psoriatic mice were established to reveal the phenotype of different Trm cells. Then, CD8\u003csup\u003e+\u003c/sup\u003e/CD4\u003csup\u003e+\u003c/sup\u003e Tcm cells injection and NF-κB inhibitor/agonist were used to investigate the role and mechanism of Trm in recurrent psoriasis. Mice displayed severe dermatitis, high PASI scores and inflammatory cytokines after repeated imiquimod treatment. The CD8\u003csup\u003e+\u003c/sup\u003e Trm cells ,but not CD4\u003csup\u003e+\u003c/sup\u003e Trm cells, were elevated in skin of recurrent psoriatic mice. The CD8\u003csup\u003e+\u003c/sup\u003e Tcm cells injection elicited more severe psoriatic symptom than imiquimod treatment alone, which indicate CD8\u003csup\u003e+\u003c/sup\u003e Trm cells is critical participant in psoriatic recurrence. Meanwhile, the phosphorylated of NF-κB p52 and NF-κB p65 (RELA) both were enhanced in skin of imiquimod induced recurrent psoriatic mice. On the contrary, NF-κB inhibitor/agonist significantly suppressed/restore the dermatitis and CD8\u003csup\u003e+\u003c/sup\u003e Trm cells in recurrent psoriatic mice. Hence, canonical and non-canonical NF-κB signaling both may contribute to activate CD8\u003csup\u003e+\u003c/sup\u003e Trm cells in recurrent psoriasis.\u003c/p\u003e","manuscriptTitle":"Tissue resident memory T cells triggered recurrent psoriasiform dermatitis dependent on RELA/p52 signaling in mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-02 06:52:41","doi":"10.21203/rs.3.rs-7412527/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"91f87294-4785-4cc7-ba4f-f88dd24e2153","owner":[],"postedDate":"September 2nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-09-15T16:08:42+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-02 06:52:41","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7412527","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7412527","identity":"rs-7412527","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00