The spillover of floral fungi across ecological boundaries

preprint OA: closed
Full text JSON View at publisher
Full text 65,178 characters · extracted from preprint-html · click to expand
The spillover of floral fungi across ecological boundaries | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL This is a preprint and has not been peer reviewed. Data may be preliminary. 23 February 2026 V1 Latest version Share on The spillover of floral fungi across ecological boundaries Authors : Rebecca Nelson 0000-0002-9574-0241 [email protected] , Gillian Bergmann , Emma Jochim , and Fernanda Valdovinos 0000-0002-5270-5286 Authors Info & Affiliations https://doi.org/10.22541/au.177187884.44401097/v1 206 views 143 downloads Contents Abstract Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract Which ecological processes assemble diverse floral fungal communities across habitat and host boundaries remains an open question. Three ecological hypotheses that may explain fungal diversity are: (H1) species sorting and environmental filtering when fungal relative abundances differ by plant species, (H2) plant and pollinator diversity begets fungal diversity, and (H3) cross-habitat fungal spillover. Using amplicon sequencing of the ITS1 region, we tested these hypotheses in floral fungi communities for three generalist wildflower species in patchy habitat mosaics of serpentine and non-serpentine grasslands. Our findings suggest some evidence for our first and third hypotheses. In accordance with our first hypothesis, yeasts were more abundant on clover, while filamentous fungi were more abundant on goldfields and vetch and overall community composition varied between host species. In contrast to our second hypothesis, plant and pollinator diversity did not correlate with fungal diversity except for with the aster goldfields. In accordance with our third hypothesis, wildflower species in different habitats shared abundant fungal taxa, suggesting evidence of fungal spillover across habitats. Species sorting and fungal spillover may interact to assemble floral fungal communities, challenging assumptions that plant and pollinator diversity beget fungal diversity. Introduction Which ecological processes maintain diverse ecological communities endures as a fundamental question (May 1982, Valdovinos 2019, Simha et al. 2022, Dritz et al. 2023). This question is particularly relevant for microbial communities, which form various symbiotic relationships with plants but are understudied for conservation (Turley et al. 2020, Burgess and Schaeffer 2022, Gilbert et al. 2025). For example, diverse floral fungi communities can play a cryptic but essential role in determining pollination outcomes under global changes (Fei et al. 2022, Burgess and Schaeffer 2022, Steffan et al. 2024). Pollinator-dispersed floral fungi can alter the chemistry and nutrition of floral rewards for pollinators, having both positive and negative effects on plant reproduction (Vannette and Fukami 2018, Vannette 2020) and pollinator health (Pozo et al. 2020, Rutkowski et al. 2022, 2023). Despite the relevance of floral fungi for pollination outcomes, questions remain about how floral fungal communities assemble across multi-host landscapes. Three ecological processes that may contribute to floral fungal community assembly are: (1) species sorting and environmental filtering (Zemenick et al. 2021), (2) ‘diversity begets diversity’ (Ponisio et al. 2016, de Vega et al. 2021), and (3) cross-habitat organismal spillover (Borremans et al. 2019, Sokolov 2024). Understanding the relative interplay of these three processes in determining fungal composition can help link plant-pollinator interactions to fungal communities. Species sorting and environmental filtering occurs when different fungal taxa establish on different host plant species, producing variation in fungal composition and diversity across plant species (Zemenick et al. 2021). Species sorting and environmental filtering can structure floral fungal communities across host plant species due to differences in floral host environment (Qian et al. 2021), pollinator visitation of flowers (Morris et al. 2020, de Vega et al. 2021, Wei et al. 2021), and their interactions. Trait-matching of floral traits with pollinator tongue length can influence pollinator foraging behavior and consequently the dispersal of floral fungi across plant species (Peralta et al. 2020, Francis et al. 2023). Species sorting mechanisms, however, do not account for effects of floral and pollinator diversity on fungi at a community scale. The ‘diversity begets diversity’ hypothesis (Hutchinson 1959, Rosenzweig 1995, Maynard et al. 2017, Madi et al. 2020, San Roman and Wagner 2021) suggests that increases in plant, pollinator, and plant-pollinator interaction diversity would drive increases in floral fungi diversity. For example, increases in floral richness, floral abundance, and vegetation heterogeneity can increase the diversity of pollinators and their network interactions with plants (Williams 2011, Ponisio et al. 2016, Kaiser-Bunbury et al. 2017, Hackett et al. 2024), which may consequently enhance fungal diversity ( in bacteria, Zemenick et al. 2021). From a network perspective, diversity of plant-pollinator interactions can be measured through the amount of interaction evenness and ecological generalization (Dormann et al. 2008). A mutualist that interacts with multiple, different partners is considered an ecological generalist (Dormann et al. 2008). Increased network interaction evenness and generalization could increase fungal diversity by increasing visits from a greater variety of pollinator vectors. For generalist plant species that act as network hubs, fungal diversity may be connected to nestedness, a core property of plant-pollinator networks. Nestedness is the tendency for generalist pollinators (plants) to interact with both generalist and specialist plants (pollinators) (Bascompte et al. 2003, Bastolla et al. 2009). Under increased network nestedness, generalist plants as network hubs attract both generalist and specialist pollinator partners (Bascompte et al. 2003, Bastolla et al. 2009). Increased network nestedness could increase fungal transmission throughout the network if generalist flower hubs act as super transmitters of microbes because they are closely linked to many other plant and pollinator species in the network. For these generalist flower hubs, increased individual contribution of a floral hub species to network nestedness may increase fungal diversity through higher fungal diversity in the species pool dispersed by generalist pollinators (but see Smith et al. 2024). The ‘diversity begets diversity’ hypothesis, however, does not consider that spillover of organisms across habitats may homogenize diversity (Magrach et al. 2017, Scherer-Lorenzen et al. 2022). The spillover of pollinators and pollinator-dispersed floral fungi across ecological boundaries could increase sharing of fungi across habitats and plant species. Spillover can either subsidize plant-pollinator community diversity through increasing pollinator abundance and diversity (Artz and Waddington 2006, Ekroos et al. 2008), or homogenize the community in cases with dominant pollinator species (Magrach et al. 2017, Peller and Altermatt 2024, Nelson et al. 2025). Spillover can extend the effects of invasive plant species on community diversity beyond habitat boundaries (Magrach et al. 2017, Peller and Altermatt 2024). To examine the relative interplay of species sorting, ‘diversity begets diversity’, and spillover in explaining fungal diversity, we compared the fungal communities of three generalist floral hosts that can act as network hubs for pollinators across patchy grassland mosaics within a global biodiversity hotspot. In California grassland mosaics, diverse, native wildflower species grow on serpentine soils, where low nutrients and high heavy metal concentrations deter invasive plants from establishing (Harrison et al. 2006), while a few invasive wildflowers species dominate nutrient-rich, non-serpentine soils (Seabloom et al. 2003). Pollinators can spill over between non-serpentine vs. serpentine grasslands (Nelson et al. 2025). We sampled floral fungal communities in two native serpentine generalist wildflower species ( Trifolium fucatum and Lasthenia californica ) and one invasive non-serpentine generalist wildflower species ( Vicia villosa ) to test the following hypotheses: (H1) floral fungal diversity and composition will differ among plant species due to species sorting and environmental filtering, (H2) increased plant diversity and abundance, increased pollinator diversity and abundance, and a more generalized, nested network structure will correlate with increased floral fungal diversity in accordance with the “diversity begets diversity” hypothesis, and (H3) in accordance with the hypothesis that spillover structures fungal communities, shared fungi will spill over across serpentine-non-serpentine boundaries and such spillover will increase with increased invasion of the focal non-serpentine wildflower species. Methods Study System This study took place at the McLaughlin Reserve in the North Inner Coast Range of California, where a mosaic of native wildflower-dominated serpentine grasslands and invaded non-serpentine grasslands occur within a patchy landscape (38.86N, -122.41W). The area experiences a Mediterranean climate with hot, dry summers and cool, wet winters. We focused on a pair of co-blooming native-invasive plants in the family Fabaceae. In April-May, the invasive legume hairy vetch ( Vicia villosa , Fabaceae) grows in non-serpentine soils and co-flowers with the native serpentine legume bull clover ( Trifolium fucatum , Fabaceae). As legumes, hairy vetch and bull clover have a similar long, pea-shaped floral morphology and niche, primarily attracting long-tongued bees (Harmon‐Threatt and Kremen 2015, Gibson et al. 2019). We also included the co-blooming native goldfield ( Lasthenia californica, Asteraceae) in our sampling as an outgroup. Goldfields have smaller, flat composite flowers and a different niche than the legumes, primarily attracting short-tongued bees and flies (Hendrickson et al. 2018). Vetch flowers appear purple in color, bull clover flowers appear beige in color, and goldfields appear yellow in color to the human eye (Fig. S1). All three focal plant species can act as generalist hubs for pollinators, attracting a diversity of both generalist and specialist pollinator species. Study Design We did an observational study of six meadows that contained naturally occurring serpentine-non-serpentine boundaries in April-May 2022 (Table S1). We surveyed sites at least 100 m apart to minimize the movement of pollinators between meadows. We used vegetation and soil maps to identify meadows with ecological boundaries between serpentine and non-serpentine soils that spanned a gradient of vetch invasion. We measured vetch invasion by counting the number of vetch floral units at a given site and then calculating the amount of vetch floral units within a 250 m radius of a focal meadow (Nelson et al. 2025). We recorded the latitude and longitude of each meadow. Pollinator and Network data To estimate pollinator, plant, and plant-pollinator network richness, abundance, and structure, we surveyed pollinator visitation during calm, non-windy, sunny to partly sunny conditions. A floral visit occurred if a floral visitor contacted the reproductive parts of the flower. We netted voucher specimens of floral visitors, which were identified by experts at the Bohart Museum of Entomology (Thomas Zavortink for bees and Socrates Letana for flies). We estimated the abundance of inflorescences as floral units within each focal patch using a log binned method (Mola and Williams 2018). We defined a floral unit as a single flower head or part of a multiple head from which a medium sized bee would have to fly rather than walk to reach another unit of the same species (Lopezaraiza–Mikel et al. 2007). We surveyed community-level plant pollinator interactions along fixed transects, surveying all plant-pollinator interactions (which pollinator morphospecies visited which plant species) within 1 m of the transect, every five meters in proportion to meadow size (Lopezaraiza–Mikel et al. 2007, Nelson et al. 2025). We recorded pollinator abundance as the number of observed visits made to a given plant species. At the same time, we recorded the identity of all flowering plants within 1 m of the transect and recorded abundance in floral units (Lopezaraiza–Mikel et al. 2007). Methods and morphospecies information for plant-pollinator interaction dataset are further detailed in Nelson et al. (2025). Sample collection and preparation for fungal amplicon sequencing We collected whole flowerheads from our focal species. Using a sterilized scissor, we cut flowerheads into plastic bags held underneath the flower head without directly touching the flowerhead. We sterilized the scissor between sampling each flowerhead. For each meadow, we collected at least six vetch flowers and six goldfield flowers. For each meadow, we collected at least six clover flowers at varying distances from vetch: 0 M, 1 M, 5 M, 10, and 50 M. We stored flowers at -20 °C and -80 °C until we prepared fungal amplicon sequencing libraries. We washed fungal DNA off the flowers using a protocol adapted from Zemenick et al. (2021). Briefly, we submerged individual flowers in 5 mL of sterile phosphate buffered saline (PBS) with 0.001% TWEEN20 and soaked them for 45 minutes in a rotary shaker at 250 rpm. We then centrifuged the solutions for 10 minutes at 12,000 rpm, poured off the supernatant, transferred floral tissues to separate tubes, and resuspended the microbial pellets in 500 \(\mu\)L of sterile water. We extracted fungal DNA from these pellets using PowerSoil (QIAGEN, Germantown MD) kits according to the manufacturer’s protocol. To confirm the presence of sufficient fungal DNA, we prepared the following PCR reactions using ITS1-F-F (5’ CTTGGTCATTTAGAGGAAGTAA 3’) and ITS1-F-R (5’ GCTGCGTTCTTCATCGATGC 3’) primers: \(\mu\)L of GoTaq Green polymerase mix (Promega, Madison WI), 8 \(\mu\)L of DNA-free water, 1 \(\mu\)L of each primer at 10 \(\mu\)M and 5 \(\mu\)L of template DNA for a total volume of 25 \(\mu\)L. We ran these reactions under the following thermal cycler conditions: initial denaturation at 94\(\textcelsius\) for 120 seconds, 30 cycles of 94\(\textcelsius\) for 30 seconds, 50\(\textcelsius\) for 60 seconds and 68\(\textcelsius\) for 90 seconds, followed by a final elongation at 68\(\textcelsius\) for 10 minutes. We verified the results of the PCR reactions with gel electrophoresis, where sufficient fungal DNA was defined by the presence of a band. We then sent the DNA extracts with fungal DNA present to Novogene (Sacramento, CA) for 250 bp paired-end sequencing of the ITS1-F region (same primers as above) on the Illumina NovaSeq platform in June 2024 and March 2025. A total of 21 Goldfield, 98 Clover and 33 Vetch had sufficiently sequenced DNA. We included the following controls in our sequencing runs: three extraction controls that were sterile water, and three sampling controls that were blanks with which we performed DNA extractions on. The blanks came from empty plastic bags that we had stored with our sample bags. Bioinformatics processing of the fungal amplicon sequencing library All bioinformatics and statistical analyses were performed in R version 4.4.1 (R Core Team 2024). We received the raw fungal sequence data from Novogene in a demultiplexed format with primers trimmed. We first filtered out erroneous reads with the DADA2 package (Callahan et al. 2016) using an expected error threshold (maxEE) of 2 reads on either end. We then dereplicated duplicate sequences, learned errors and denoised the sequence composition of the samples, and removed chimeras. Next, we assigned taxonomy to the resulting amplicon sequencing variants (ASVs, a proxy for species) with the IdTaxa (Murali et al. 2018) function using the UNITE (Kõljalg et al. 2005) database. We compiled this taxonomy with the sequence table and metadata into a phyloseq (McMurdie and Holmes 2013) object. Following compiling, we filtered out putative contaminants using the Decontam (Davis et al. 2018) package with a probability threshold of 0.3. We also filtered out samples with a sequencing depth below 2,000 reads, and ASVs that were present in less than 2.5% of samples ( i.e. raretons). Finally, we converted the read counts to relative abundances and assigned putative ecology and morphology with the FUNGuildR package (Nguyen et al. 2016). The final phyloseq object contained a total of 11,186,204 reads across 98 clover samples, 33 vetch samples and 21 goldfield samples. Data Analysis We checked all models for normality and heteroskedasticity where appropriate. To test whether species sorting produces differences in fungal communities across plant species (H1), we tested for an effect of plant species on fungal ASV richness using a Kruskal-Wallis test and post-hoc Dunn pairwise comparisons with a Bonferroni correction. We conducted the Dunn pairwise comparisons using the ‘dunnTest’ function in FSA v0.10.0 (Ogle et al. 2020). We also tested for plant species effects on fungal Shannon diversity using an ANOVA and Tukey post hoc tests. Next, we tested whether fungal community composition varied by plant species using a Permutational Analysis of Variance (PerMANOVA) based on Bray-Curtis dissimilarity indices in vegan v2.7.1 (Okansen et al. 2019). We then tested whether ASV abundance was correlated with variation in fungal community composition using the ‘envfit’ function in vegan. Finally, we identified ASVs that were differentially abundant in vetch or goldfield samples compared to clover samples using ANCOM-BC2 v2.10.1 (Lin and Peddada 2020). To test whether plant and pollinator diversity begets fungal diversity (H2), for each plant species at the site-level, we tested for effects of the following predictors on fungal Shannon diversity and ASV richness: plant species richness, focal plant species floral abundance, pollinator-morphospecies richness of floral visitors on a given focal plant species, pollinator abundance (total number of visits) to a focal plant species, size-corrected network nestedness (NODFc), individual contribution of a focal plant species to network nestedness, network specialization, and individual plant species-level specialization using linear models. We qualitatively checked models for homoschedascity and normality of residuals. We aggregated fungal diversity metrics to means by site and plant species. We calculated NODFc using maxNODF v1.0.0 (Hoeppke and Simmons 2021). We calculated interaction Shannon diversity (H’), network specialization (H2’), individual plant contributions to nestedness in plant-pollinator networks, and individual plant species-level specialization (d’) using bipartite v2.21 (Dormann et al. 2008). Nestedness, the degree to which mutualists attract both generalist and specialist partners, is a network metric associated with structural stability of mutualistic networks in cases where core network hub species are retained (Bascompte et al. 2003). Shannon diversity of interactions measures interaction evenness in the network (Dormann et al. 2008). Specialization measures how specialized interactions are relative to their expected abundance, with low specialization meaning a network is more generalized (Dormann et al. 2008). To test whether vetch invasion correlates to fungal cross-habitat spillover (H3), we tested for effects of meadow vetch invasion level, distance of clover from vetch within a meadow, and their interaction on fungal Shannon diversity using ANOVAs. We tested for similar effects on fungal ASV richness using Kruskal-Wallis tests. We then tested if vetch invasion level was correlated with fungal community composition in clover samples using Non-Metric Multidimensional Scaling (NMDS) ordination and a PERMANOVA test. We also tested for effects of clover distance from vetch on fungal community composition within each invasion level using the same tests. Next, we identified fungal ASVs that were shared between plant species using UpSetR v1.4.0 (Conway et al. 2017). To determine whether spillovers were dispersal limited, we identified the percentage of ASVs in clover communities that were shared with vetch at different distances from invasion boundaries using UpSet plots. In addition to measuring overlaps with UpSet plots, we identified core ASVs across plant species based on occupancy-abundance indices using the ‘core’ function in microbiome v1.30.1 (Lahti and Shetty 2018). These indices calculate the prevalence (i.e. percentage of samples across groups where an ASV is present) and average relative abundance of each ASV, and then ASVs are ranked based on said indices at multiple detection thresholds. Results Species Sorting Hypothesis (H1): yeasts sort to clover, while filamentous fungi sort to goldfields and vetch Fungal Shannon diversity and community composition differed by floral species (Fig. 1A-B). When we compared species pairs across all meadows, bull clover flowers hosted lower fungal Shannon diversity than both the goldfield flowers and the hairy vetch, while fungal Shannon diversity did not differ between goldfield and hairy vetch flowers (Fig. 1A). Fungal community composition also differed between host species (Fig. 1B). These differences were correlated with the relative abundances of ASVs in the genera Cladosporium, Alternaria and Podosphaera , which were more abundant in vetch and goldfield flowers (Fig. 1B). These differences also correlated with the relative abundance of ASVs in the genera Sporobolomyces, Papiliotrema, Vishniacozyma and Filobasidium , which were more abundant in bull clover flowers (Fig. 1B). However, fungal beta diversity did not differ between plant species (betadispers: F=1.972, p=0.139), nor did fungal ASV richness (chi-squared = 2.6872, df = 2, p-value = 0.26). Twelve fungal genera were differentially abundant in vetch and goldfields compared to clover (Fig. 1C, Table S2). Relative to clover, vetch had lower abundances of Papiliotrema , Vishniacozyma , Cystofilobasidium, Protomyces and Talaromyces , and higher abundances of Penicillium , Chalastospora , and Alternaria ( Fig. 1C, Table S2). Relative to clover, goldfields had depleted Filobasidium, Papiliotrema , and Protomyces, but enriched Alternaria (Fig. 1C, Table S2). Interestingly, genera enriched in bull clover flowers had yeast or dimorphic growth forms, while the genera enriched in hairy vetch or goldfield flowers had filamentous growth forms (Table S2, Fig. S2). Diversity Begets Diversity Hypothesis (H2): effects of meadow diversity on fungal diversity vary by host species When comparing site-level mean fungal ASV richness and Shannon diversity to site-level plant diversity, pollinator diversity and network metrics, our findings generally did not support the hypothesis that these metrics beget fungal diversity (Table 2, Fig. 2, Suppl. Fig. S3-5). We only detected two correlations that supported the ‘diversity begets diversity’ hypothesis, both in goldfields. Goldfield fungal richness increased with increasing plant richness (Fig. 2A), and goldfield fungal Shannon Diversity increased with increasing goldfield floral abundance (Table 2, Suppl. Fig. S4). In all other cases, fungal diversity either was not correlated with or decreased with increasing plant richness and abundance (Table 2, Fig. 2). Likewise, fungal diversity did not correlate with pollinator richness and abundance except for a negative relationship between pollinator abundance and clover fungal richness (Table 2, Fig. 2, Suppl. Fig S3). Contrary to our second hypothesis, fungal Shannon diversity on both vetches and clovers decreased with increasing overall size-corrected plant-pollinator network nestedness (NODFc) (Table 2, Fig. 2C). Neither fungal diversity metric was correlated with network interaction Shannon diversity (H’), size-corrected network nestedness (NODFc), individual focal plant species contribution to network nestedness, network-level specialization (H2’), or plant species-level specialization (d’) (Table 2, Fig. 2C, Fig. S4-5). Spillover Hypothesis (H3): abundant fungal taxa spill over across habitats We found that 444 ASVs (16.45% of those compared) were shared between the vetch and the clover communities (Fig. 3A). These shared ASVs represented 90.5% and 83.5% of the reads in clover and vetch communities respectively (Suppl Fig, S6A). Additionally, 311 ASVs (11.83% of those compared) were shared between the clover and goldfields communities (Fig. 3A). These shared ASVs represented 85.9% and 94.7% of the reads in clover and goldfield communities respectively (Suppl Fig, S6A). Finally, 274 ASVs (17.05% of those compared) were shared between non-serpentine vetch and serpentine goldfield (Fig. 3A). These ASVs represented 77.9% and 94.0% of the reads in vetch and goldfield communities respectively (Suppl Fig S6A). Across these comparisons, 210 ASVs (6.5% of those compared) were shared between all three host species (Fig. 3A). The ASVs shared across all plant species included those in the genera Vishniacozyma, Cladosporium, Alternaria and others (Suppl Fig. S6B). When we investigated the overlap in fungal communities between clover and vetch flowers, we found that distance from vetch and invasion level did not significantly affect the number of shared ASVs (Suppl Fig. S7A). Additionally, we found that vetch invasion level did not affect Shannon diversity in clover communities (Suppl Fig. S7B). However, Shannon diversity decreased with increasing distance from vetch at medium invasion sites, and while it increased slightly with increasing distance from vetch at high invasion sites (Fig. 3B). When we compared community composition across sites, we found that clover communities differed by vetch invasion level (Fig. 3C). These differences were correlated with the relative abundance of filamentous fungi (e.g. Cladosporium, Alternaria ) in communities from high invasion sites, and the relative abundance of yeast fungi (e.g. Vishniacozyma victoriae, Filobasidium stepposum, Papiliotrema ) at low and medium invasion sites (Fig. 3C). Likewise, clover beta diversity differed by vetch invasion level (betadisp, F=4.6594, p=0.012), with pairwise differences between high and low invasion levels (Tukey HSD, p=0.013). However, clover communities did not vary by distance from vetch within each invasion level (Suppl. Fig. S7). Discussion We surveyed two native and one invasive plant species across six meadows to evaluate the effects of host identity, plant and pollinator diversity and spillover on floral fungal communities. In support of our first hypothesis, we found that fungal composition differed among plant species. Contrary to our second hypothesis, fungal diversity generally did not increase with plant diversity, pollinator diversity and plant-pollinator network generalization. In support of our third hypothesis, floral taxa were shared between serpentine and non-serpentine plant species, suggesting evidence of fungal spillover across serpentine-non-serpentine habitat boundaries. However, contrary to our expectations, spillover did not vary with proximity of clover to vetch or with the amount of vetch at the boundary. Ultimately, our finding that floral fungi spill over across plant community boundaries suggests the relevance of considering the interplay of species sorting vs. cross-habitat spillover in explaining fungal diversity and composition. Evidence of environmental filtering between host species (H1) Consistent with prior studies on floral bacteria and fungi (Qian et al. 2020, de Vega et al. 2021, Zemenick et al. 2021), we found strong differences in floral fungi composition across plant species: yeasts sorted to clover, while filamentous fungi sorted to goldfields and vetch. This finding suggests that environmental filtering may assemble fungal communities in flowers. Strong plant species level differences in floral fungi may be shaped by floral traits (Remus-Emsermann et al. 2012, Morris et al. 2020, Zemenick et al. 2021, Qian et al. 2021), the regional fungal species pools in serpentine and non-serpentine soils (Schechter and Bruns 2012, Meindl et al. 2013), and pollinator visitation (Zemenick et al. 2018, Wei et al. 2021, Adler et al. 2021). Specifically, clover fungal communities were distinct from both the vetch, with which it shared pollinators but occurred on a different soil type, and from the goldfields, with which it had less overlap in pollinators but shared a soil type. This could be due to differences in nectar availability and composition, UV light reflectance and floral longevity (Adler et al. 2020), which could have differential effects on the growth of yeasts and filamentous fungi (de Vega and Herrera 2012). Notably, we did not detect Metschnikowia yeast species across our samples, which are a common member of nectar microbial communities (Pozo et al. 2011, Vannette 2020). This is likely because we used ITS-1F primers to sequence the communities in our study, which prevents plant amplification but has mismatches with Metschnikowia sequences (Martin et al. 2025). While previous studies have observed differences in growth and dispersal between floral yeast fungi and bacteria (e.g. Vannette et al. 2021), comparisons of yeasts and filamentous fungi are limited. Future work on floral fungi could determine how variation in these traits across plant communities differentially affects the colonization of flowers by yeast and filamentous fungi. Little evidence for the “diversity begets diversity” hypothesis (H2) Although goldfield fungal diversity increased with increasing plant richness and goldfield floral abundance, we otherwise found that plant diversity, pollinator diversity, and network interaction Shannon diversity and generalization did not beget fungal diversity. In contrast, past work has shown that plant community diversity, structure and variation in plant traits can explain patterns of microbial diversity (Zemenick et al. 2021, Adler et al. 2021, Steffan et al. 2024) and that increased plant abundance and pollinator visitation increases microbial diversity (Wei et al. 2021). Moreover, our findings differ from prior work showing that the diversity, rate, and timing of pollinator visitation can drive the assembly of floral microbial communities (de Vega et al. 2021, Chappell et al. 2022, Francis et al. 2023). Differences in the time scale of plant and pollinator vs. fungal data may explain that lack of correlation between the two in our study. Plant and pollinator diversity was totaled over the full flowering season, while fungal data came from samples from specific days within the flowering season. Moreover, honey bees ( Apis mellifera ) were a highly abundant pollinator on vetch and bull clover (Nelson et al. 2025) and thus may have homogenized fungal composition on flowers rather than diversified it. In other words, honey bees may transport a single set of fungal taxa among flowers. Honey bees can remain constant to a single floral species when foraging, visiting the same plant species over and over, which may lead them to disperse a homogenized set of fungi (Hill et al. 1997). Fungi may also have entered the flower’s surface through wind or non-pollinator modes of dispersal. We further found that fungal diversity decreased with higher nestedness of plant-pollinator networks in vetch and clover communities but not in goldfield fungal communities. This finding suggests that plant-pollinator network structure may potentially mediate fungal diversity, as has been previously shown in bacterial communities (Zemenick et al. 2021). Other findings have demonstrated no relationship between plant-pollinator network structure and microbial communities (Smith et al. 2024). Increased nestedness confers structural stability to plant-pollinator networks unless core mutualistic hubs are lost from the network (Bascompte and Jordano 2007, Valdovinos et al. 2016). Contrary to our hypothesis, however, we found a negative correlation between fungal diversity and nestedness in vetch and clovers. Alternatively, nested networks may homogenize fungal diversity through the effects of generalist pollinator species that host lower diversity microbiota (Gaiarsa et al. 2022, Kueneman et al. 2023). Future work could aim to better elucidate the relationship between plant-pollinator network structure and floral fungal diversity by probing the mechanisms that underly this pattern via field experiments in patchy landscapes. Vetch invasion level and distance from invasion boundaries have mixed impacts on fungal spillover (H3) We found evidence of cross-habitat spillover of floral fungi between non-serpentine vetch and serpentine clover. Our finding suggests that floral fungi can disperse across plant-community and edaphic boundaries. This finding is consistent with evidence of microbe spillover at aquatic-terrestrial boundaries (Pechal and Benbow 2016, Wisnoski et al. 2020) and of pathogens across the wildland-urban interface (Borremans et al. 2019). Fungi may be dispersed across the serpentine-non-serpentine boundary by shared pollinators between vetch and clover that spill over (Nelson et al. 2025) or through passive dispersal by wind. However, the amount of invasive vetch at the boundary and distance of clover from the boundary did not alter the amount of overlap in shared fungi between plant species. This may reflect the fact that the most frequent floral visitors of clover and vetch, honey bees and bumble bees ( Bombus spp. ) (Nelson et al. 2025), can fly far distances when foraging and can visit most flowers within a given meadow (Mola and Williams 2018, 2019). One limitation of our work is that we do not know the direction of fungal spillover. Future mechanistic experiments could examine which direction floral fungi move across serpentine-non-serpentine habitat boundaries. The amount of invasive vetch at the boundary, proximity of clover to invasive vetch, and their interaction was associated with clover fungal diversity. At medium vetch invasion levels, fungal diversity on clover decreased with increasing distance from vetch, while at high invasion levels, fungal diversity on clover increased with increasing distance from vetch. These findings suggest that fungal diversity on serpentine clovers may be spatially structured in relation to the serpentine-non-serpentine boundary. At high invasion levels, diversity increases with distance from vetch. However, we see a different pattern at medium levels of invasion, perhaps due to clover being relatively more abundant than vetch at medium invasion levels. Higher abundance of yeasts at low and medium-invasion sites may be because yeasts grow faster and therefore could outcompete molds. In contrast, floral microbe communities in South Africa were structured by pollinator type rather than spatial location, but the spatial scale assessed was broader (de Vega et al. 2021). Spatial variation in microbe communities may arise from how highly, mobile foraging pollinators move between flowers within a meadow, dispersing microbes from flower to flower (Francis et al. 2021). Future work could further investigate how spatial processes such as habitat fragmentation (Haddad et al. 2015), plant and pollinator metacommunity structure (Amarasekare 2004, Leibold et al. 2004, Wang 2019), and resource-subsidy dynamics across ecological boundaries (Polis et al. 1997, Borremans et al. 2019, Zamorano et al. 2020) drive the assembly, diversity, and structure of floral microbe communities. Ultimately, our findings that floral fungi spill over across plant community boundaries suggest the relevance of considering the interplay of species sorting vs. spillover in explaining fungal diversity and composition. In addition to temporal processes such as priority effects (Fukami 2015, Toju et al. 2018, Chappell et al. 2022), spatial heterogeneity (Hackett et al. 2024) and consequent movement of pollinators across ecological boundaries (Artz and Waddington 2006, Garibaldi et al. 2013, Magrach et al. 2017) may play an important but overlooked role in assembling floral fungal communities. Future work could aim to test the mechanisms that underlie these patterns in microbial community assembly (Gilbert et al. 2025), by understanding the direction of microbe spillover, vectors of microbe spillover and consequent effects of spillover on plant fitness. Figures Figure 1. Evidence of species sorting of floral fungi by host plant species. (A) Fungal Shannon diversity by host plant species. T refers to clover ( Trifolium fucatum ). L refers to goldfields ( Lasthenia californica ). V refers to vetch ( Vicia villosa ). P-values are shown for comparisons between plant species. (B) Nonmetric multidimensional scaling plot of floral fungal communities with Bray-Curtis dissimilarity used for NMDS. Colors correspond to floral species with L. californica in gold, V. villosa in purple, and T. fucatum in pink. Arrows show relationships of abundant fungal taxa in relation to NMDS space. (C) Heatmap of pairwise comparisons of log-fold fungal abundance of fungal taxa between host plant species. Red indicates a fungal taxon is enriched in the other plant species (vetch and goldfield) relative to T. fucatum , while blue indicates a fungal taxon is enriched in T. fucatum relative to the other plant species. Figure 2. Plant and pollinator diversity do not beget fungal diversity. Mean site-level flowering plant richness vs. (A) fungal ASV richness and (B) fungal Shannon diversity. Site-level pollinator morphospecies richness vs. (C) fungal ASV richness and (D) fungal Shannon diversity. Size-corrected network nestedness vs. (E) fungal ASV richness and (F) fungal Shannon diversity. Goldfields ( L. californica ) (L) is colored in gold, vetch ( V. villosa ) (V) in purple, and clover ( T. fucatum ) (T) in pink. Solid lines denote statistically significant relationships (p0.05). Figure 3 . Abundant fungal taxa spill over across habitat boundaries. (A) UpSet plot identifying the number of ASVs shared between clover ( T. fucatum ), goldfield ( L. californica ) and vetch communities ( V. villosa ). Numbers show fungal ASV richness. (B) The effects of vetch invasion level (low, medium, high) and distance from non-serpentine vetch (0-1 m, 5-10 m, 50 m) on fungal Shannon diversity on serpentine clovers. (C) Fungal composition of clovers by site and vetch invasion level. Each meadow site has a different shape. Points are colored by vetch invasion level. \defaultfontfeatures Scale=MatchLowercase \defaultfontfeatures[]Ligatures=TeX,Scale=1 \UseMicrotypeSet[protrusion]basicmath Table 1. Correlations between site-level mean fungal diversity and plant, pollinator and network properties. L refers to goldfields, T refers to bull clover, and V refers to vetch. Two metrics of fungal diversity: ASV richness (rich) and ASV Shannon diversity (Shannon) were used. Estimates of model slopes as effect size are given along with standard error, t-value, p-value, and R2. An alpha level of 0.05 was used to evaluate statistical significance. L rich Site_Plant_Richness 4.330 0.686 6.313 0.008 0.930 L rich Mean_Floral_Abundance 0.011 0.004 2.648 0.077 0.700 L rich NODFc 27.519 16.671 1.651 0.197 0.476 L rich Pollinator_Richness 0.537 0.412 1.305 0.283 0.362 L rich Pollinator_Abundance 0.082 0.063 1.312 0.281 0.364 L rich Ind_Nestedness_Contribution 4.789 2.412 1.985 0.141 0.568 L rich H’ 16.360 12.212 1.340 0.273 0.374 L rich H2’ -129.833 71.937 -1.805 0.169 0.521 L rich d’ 73.722 97.847 0.753 0.506 0.159 L shannon Site_Plant_Richness 0.020 0.015 1.396 0.257 0.394 L shannon Mean_Floral_Abundance 0.000 0.000 3.494 0.040 0.803 L shannon NODFc -0.001 0.166 -0.008 0.994 0.000 L shannon Pollinator_Richness 0.001 0.004 0.313 0.775 0.032 L shannon Pollinator_Abundance 0.000 0.001 0.304 0.781 0.030 L shannon Ind_Nestedness_Contribution 0.020 0.024 0.858 0.454 0.197 L shannon H’ 0.032 0.110 0.288 0.792 0.027 L shannon H2’ -0.031 0.751 -0.041 0.970 0.001 L shannon d’ 0.987 0.520 1.897 0.154 0.545 T rich Site_Plant_Richness 0.172 0.446 0.386 0.719 0.036 T rich Mean_Floral_Abundance -0.004 0.001 -2.848 0.047 0.670 T rich NODFc 4.611 6.702 0.688 0.529 0.106 T rich Pollinator_Richness -0.824 0.384 -2.148 0.098 0.536 T rich Pollinator_Abundance -0.039 0.010 -3.879 0.018 0.790 T rich Ind_Nestedness_Contribution -3.036 1.865 -1.628 0.179 0.398 T rich H’ 7.473 4.331 1.726 0.160 0.427 T rich H2’ -48.155 35.623 -1.352 0.248 0.314 T rich d’ -32.113 14.654 -2.191 0.094 0.546 T shannon Site_Plant_Richness -0.017 0.004 -3.973 0.016 0.798 T shannon Mean_Floral_Abundance 0.000 0.000 0.365 0.733 0.032 T shannon NODFc -0.276 0.060 -4.610 0.010 0.842 T shannon Pollinator_Richness -0.004 0.012 -0.326 0.761 0.026 T shannon Pollinator_Abundance 0.000 0.000 0.132 0.901 0.004 T shannon Ind_Nestedness_Contribution -0.026 0.049 -0.533 0.622 0.066 T shannon H’ -0.172 0.086 -1.994 0.117 0.499 T shannon H2’ 0.352 0.897 0.393 0.714 0.037 T shannon d’ 0.126 0.458 0.275 0.797 0.019 V rich Site_Plant_Richness -0.477 1.251 -0.381 0.722 0.035 V rich Mean_Floral_Abundance 0.006 0.005 1.142 0.317 0.246 V rich NODFc -9.061 19.351 -0.468 0.664 0.052 V rich Pollinator_Richness 1.379 1.954 0.706 0.519 0.111 V rich Pollinator_Abundance 0.059 0.058 1.018 0.366 0.206 V rich Ind_Nestedness_Contribution 0.769 5.670 0.136 0.899 0.005 V rich H’ -7.931 15.543 -0.510 0.637 0.061 V rich H2’ -16.838 120.281 -0.140 0.895 0.005 V rich d’ -23.160 49.863 -0.464 0.666 0.051 V shannon Site_Plant_Richness -0.018 0.009 -1.935 0.125 0.484 V shannon Mean_Floral_Abundance 0.000 0.000 0.736 0.502 0.119 V shannon NODFc -0.346 0.103 -3.357 0.028 0.738 V shannon Pollinator_Richness -0.002 0.021 -0.107 0.920 0.003 V shannon Pollinator_Abundance 0.000 0.001 0.528 0.625 0.065 V shannon Ind_Nestedness_Contribution 0.029 0.056 0.524 0.628 0.064 V shannon H’ -0.246 0.106 -2.318 0.081 0.573 V shannon H2’ 0.605 1.185 0.510 0.637 0.061 V shannon d’ -0.571 0.434 -1.316 0.259 0.302 References https://doi.org/10.1101/2025.09.18.677159 Adler, L. S., Irwin, R. E., McArt, S. H. and Vannette, R. L. 2020. Floral traits affecting the transmission of beneficial and pathogenic pollinator-associated microbes. - Current Opinion in Insect Science in press.Adler, L. S., Irwin, R. E., McArt, S. H. and Vannette, R. L. 2021. Floral traits affecting the transmission of beneficial and pathogenic pollinator-associated microbes. - Current Opinion in Insect Science 44: 1–7.Amarasekare, P. 2004. Spatial dynamics of mutualistic interactions. - Journal of Animal Ecology 73: 128–142.Artz, D. R. and Waddington, K. D. 2006. The Effects of Neighbouring Tree Islands on Pollinator Density and Diversity, and on Pollination of a Wet Prairie Species, Asclepias lanceolata (Apocynaceae). - Journal of Ecology 94: 597–608.Bascompte, J. and Jordano, P. 2007. Plant-animal mutualistic networks: the architecture of biodiversity. - Annual review of ecology, evolution, and systematics: 567–593.Bascompte, J., Jordano, P., Melián, C. J. and Olesen, J. M. 2003. The nested assembly of plant–animal mutualistic networks. - Proceedings of the National Academy of Sciences 100: 9383–9387.Bastolla, U., Fortuna, M. A., Pascual-García, A., Ferrera, A., Luque, B. and Bascompte, J. 2009. The architecture of mutualistic networks minimizes competition and increases biodiversity. - Nature 458: 1018–1020.Borremans, B., Faust, C., Manlove, K. R., Sokolow, S. H. and Lloyd-Smith, J. O. 2019. Cross-species pathogen spillover across ecosystem boundaries: mechanisms and theory. - Philosophical Transactions of the Royal Society B: Biological Sciences 374: 20180344.Burgess, E. C. and Schaeffer, R. N. 2022. The Floral Microbiome and Its Management in Agroecosystems: A Perspective. - J. Agric. Food Chem. 70: 9819–9825.Callahan, B. J., McMurdie, P. J., Rosen, M. J., Han, A. W., Johnson, A. J. A. and Holmes, S. P. 2016. DADA2: High-resolution sample inference from Illumina amplicon data. - Nature Methods 13: 581–583.Chappell, C. R., Dhami, M. K., Bitter, M. C., Czech, L., Herrera Paredes, S., Barrie, F. B., Calderón, Y., Eritano, K., Golden, L.-A., Hekmat-Scafe, D., Hsu, V., Kieschnick, C., Malladi, S., Rush, N. and Fukami, T. 2022. Wide-ranging consequences of priority effects governed by an overarching factor (ML Coleman, MC Schuman, and LS Bittleston, Eds.). - eLife 11: e79647.Conway, J. R., Lex, A. and Gehlenborg, N. 2017. UpSetR: an R package for the visualization of intersecting sets and their properties (J Hancock, Ed.). - Bioinformatics 33: 2938–2940.Davis, N. M., Proctor, D. M., Holmes, S. P., Relman, D. A. and Callahan, B. J. 2018. Simple statistical identification and removal of contaminant sequences in marker-gene and metagenomics data. - Microbiome 6: 226.de Vega, C. and Herrera, C. M. 2012. Relationships among nectar-dwelling yeasts, flowers and ants: patterns and incidence on nectar traits. - Oikos 121: 1878–1888.de Vega, C., Álvarez-Pérez, S., Albaladejo, R. G., Steenhuisen, S.-L., Lachance, M.-A., Johnson, S. D. and Herrera, C. M. 2021. The role of plant–pollinator interactions in structuring nectar microbial communities. - Journal of Ecology 109: 3379–3395.Dormann, C. F., Gruber, B. and Fründ, J. 2008. Introducing the bipartite Package: Analysing Ecological Networks. - Interaction 1.0.2413793: 8–11.Dritz, S., Nelson, R. A. and Valdovinos, F. S. 2023. The role of intra-guild indirect interactions in assembling plant-pollinator networks. - Nat Commun 14: 5797.Ekroos, J., Piha, M. and Tiainen, J. 2008. Role of organic and conventional field boundaries on boreal bumblebees and butterflies. - Agriculture, Ecosystems & Environment 124: 155–159.Fei, S., Kivlin, S. N., Domke, G. M., Jo, I., LaRue, E. A. and Phillips, R. P. 2022. Coupling of plant and mycorrhizal fungal diversity: its occurrence, relevance, and possible implications under global change. - New Phytologist 234: 1960–1966.Francis, J. S., Tatarko, A. R., Richman, S. K., Vaudo, A. D. and Leonard, A. S. 2021. Microbes and pollinator behavior in the floral marketplace. - Current Opinion in Insect Science 44: 16–22.Francis, J. S., Mueller, T. G. and Vannette, R. L. 2023. Intraspecific variation in realized dispersal probability and host quality shape nectar microbiomes. - New Phytologist 240: 1233–1245.Fukami, T. 2015. Historical Contingency in Community Assembly: Integrating Niches, Species Pools, and Priority Effects. - Annual Review of Ecology, Evolution, and Systematics 46: 1–23.Gaiarsa, M. P., Rehan, S., Barbour, M. A. and McFrederick, Q. S. 2022. Individual Dietary Specialization in a Generalist Bee Varies across Populations but Has No Effect on the Richness of Associated Microbial Communities. - The American Naturalist 200: 730–737.Garibaldi, L. A., Steffan-Dewenter, I., Winfree, R., Aizen, M. A., Bommarco, R., Cunningham, S. A., Kremen, C., Carvalheiro, L. G., Harder, L. D., Afik, O., Bartomeus, I., Benjamin, F., Boreux, V., Cariveau, D., Chacoff, N. P., Dudenhöffer, J. H., Freitas, B. M., Ghazoul, J., Greenleaf, S., Hipólito, J., Holzschuh, A., Howlett, B., Isaacs, R., Javorek, S. K., Kennedy, C. M., Krewenka, K. M., Krishnan, S., Mandelik, Y., Mayfield, M. M., Motzke, I., Munyuli, T., Nault, B. A., Otieno, M., Petersen, J., Pisanty, G., Potts, S. G., Rader, R., Ricketts, T. H., Rundlöf, M., Seymour, C. L., Schüepp, C., Szentgyörgyi, H., Taki, H., Tscharntke, T., Vergara, C. H., Viana, B. F., Wanger, T. C., Westphal, C., Williams, N. and Klein, A. M. 2013. Wild Pollinators Enhance Fruit Set of Crops Regardless of Honey Bee Abundance. - Science 339: 1608–1611.Gilbert, J. A., Peixoto, R. S., Scholz, A. H., Dominguez Bello, M. G., Korsten, L., Berg, G., Singh, B., Boetius, A., Wang, F., Greening, C., Wrighton, K., Bordenstein, S., Jansson, J. K., Lennon, J. T., Souza, V., Thomas, T., Cowan, D., Crowther, T. W., Nguyen, N., Harper, L., Haraoui, L.-P., Ishaq, S. L. and Redford, K. 2025. Launching the IUCN Microbial Conservation Specialist Group as a global safeguard for microbial biodiversity. - Nat Microbiol: 1–2.Hackett, T. D., Sauve, A. M. C., Maia, K. P., Montoya, D., Davies, N., Archer, R., Potts, S. G., Tylianakis, J. M., Vaughan, I. P. and Memmott, J. 2024. Multi-habitat landscapes are more diverse and stable with improved function. - Nature 633: 114–119.Haddad, N. M., Brudvig, L. A., Clobert, J., Davies, K. F., Gonzalez, A., Holt, R. D., Lovejoy, T., Sexton, J. O., Austin, M. P., Collins, C. D., Cook, W. M., Damschen, E. I., Ewers, R., Foster, B. L., Jenkens, C. N., King, A. J., Laurance, W. F., Levey, D. J., Margules, C. R., Melbourne, B. A., Nicholls, A. O, Orrock, J. L., Song, D. X., and Townshend, J.R. 2015. Habitat fragmentation and its lasting impact on Earth’s ecosystems | Science Advances. - Science in press.Harrison, S., Safford, H. D., Grace, J. B., Viers, J. H. and Davies, K. F. 2006. Regional and Local Species Richness in an Insular Environment: Serpentine Plants in California. - Ecological Monographs 76: 41–56.Hill, P. S. M., Wells, P. H. and Wells, H. 1997. Spontaneous flower constancy and learning in honey bees as a function of colour. - Animal Behaviour 54: 615–627.Hoeppke, C. and Simmons, B. I. 2021. maxnodf: An R package for fair and fast comparisons of nestedness between networks. - Methods in Ecology and Evolution 12: 580–585.Hutchinson, G. E. 1959. Homage to Santa Rosalia or Why Are There So Many Kinds of Animals? - The American Naturalist 93: 145–159.Kaiser-Bunbury, C. N., Mougal, J., Whittington, A. E., Valentin, T., Gabriel, R., Olesen, J. M. and Blüthgen, N. 2017. Ecosystem restoration strengthens pollination network resilience and function. - Nature 542: 223–227.Kõljalg, U., Larsson, K.-H., Abarenkov, K., Nilsson, R. H., Alexander, I. J., Eberhardt, U., Erland, S., Høiland, K., Kjøller, R., Larsson, E., Pennanen, T., Sen, R., Taylor, A. F. S., Tedersoo, L. and Vrålstad, T. 2005. UNITE: a database providing web-based methods for the molecular identification of ectomycorrhizal fungi. - New Phytologist 166: 1063–1068.Kueneman, J. G., Bonadies, E., Thomas, D., Roubik, D. W. and Wcislo, W. T. 2023. Neotropical bee microbiomes point to a fragmented social core and strong species-level effects. - Microbiome 11: 150.Lahti, L. and Shetty, S. 2018. Introduction to the microbiome R package.Leibold, M. A., Holyoak, M., Mouquet, N., Amarasekare, P., Chase, J. M., Hoopes, M. F., Holt, R. D., Shurin, J. B., Law, R., Tilman, D., Loreau, M. and Gonzalez, A. 2004. The metacommunity concept: a framework for multi-scale community ecology. - Ecology Letters 7: 601–613.Lin, H. and Peddada, S. D. 2020. Analysis of compositions of microbiomes with bias correction. - Nat Commun 11: 3514.Lopezaraiza–Mikel, M. E., Hayes, R. B., Whalley, M. R. and Memmott, J. 2007. The impact of an alien plant on a native plant–pollinator network: an experimental approach. - Ecology Letters 10: 539–550.Madi, N., Vos, M., Murall, C. L., Legendre, P. and Shapiro, B. J. 2020. Does diversity beget diversity in microbiomes? (D Weigel, E Kemen, and BE Wolfe, Eds.). - eLife 9: e58999.Magrach, A., González-Varo, J. P., Boiffier, M., Vilà, M. and Bartomeus, I. 2017. Honeybee spillover reshuffles pollinator diets and affects plant reproductive success. - Nat Ecol Evol 1: 1299–1307.Martin, A. N., Stuligross, C., Williams, N. M., Noroian, H. M. and Vannette, R. 2025. Floral microbes provisioned by Osmia lignaria establish in larval food stores, but do not affect bee development or survival.: 2025.08.15.670587.May, R. M. 1982. Mutualistic interactions among species. - Nature 296: 803–804.Maynard, D. S., Bradford, M. A., Lindner, D. L., van Diepen, L. T. A., Frey, S. D., Glaeser, J. A. and Crowther, T. W. 2017. Diversity begets diversity in competition for space. - Nat Ecol Evol 1: 1–8.McMurdie, P. J. and Holmes, S. 2013. phyloseq: An R Package for Reproducible Interactive Analysis and Graphics of Microbiome Census Data. - PLOS ONE 8: e61217.Meindl, G. A., Bain, D. J. and Ashman, T.-L. 2013. Edaphic factors and plant–insect interactions: direct and indirect effects of serpentine soil on florivores and pollinators. - Oecologia 173: 1355–1366.Mola, J. M. and Williams, N. M. 2018. Fire-induced change in floral abundance, density, and phenology benefits bumble bee foragers. - Ecosphere 9: e02056.Mola, J. M. and Williams, N. M. 2019. A review of methods for the study of bumble bee movement. - Apidologie 50: 497–514.Morris, M. M., Frixione, N. J., Burkert, A. C., Dinsdale, E. A. and Vannette, R. L. 2020. Microbial abundance, composition, and function in nectar are shaped by flower visitor identity. - FEMS Microbiology Ecology 96: fiaa003.Murali, A., Bhargava, A. and Wright, E. S. 2018. IDTAXA: a novel approach for accurate taxonomic classification of microbiome sequences. - Microbiome 6: 140.Nelson, R. A., Williams, N., Valdovinos, F. and Harrison, S. 2025. Invasive plants affect native plant pollination through pollinator-mediated cross-boundary effects.: 2025.09.18.677159. Nguyen, N. H., Song, Z., Bates, S. T., Branco, S., Tedersoo, L., Menke, J., Schilling, J. S. and Kennedy, P. G. 2016. FUNGuild: An open annotation tool for parsing fungal community datasets by ecological guild. - Fungal Ecology 20: 241–248.Ogle, D., Wheeler, P. and Dinno, A. 2020. Package “FSA.”Okansen, J., Blanchet, F. G., Friendly, M., Kindt, R., Legendre, P., McGlinn, D., Minchin, P. R., O’Hara, R. B., Simpson, G. L., Solymos, P., Stevens, M. H. H., Szoecs, E. and Wagner, H. 2019. vegan: Community ecology package.Pechal, J. L. and Benbow, M. E. 2016. Microbial ecology of the salmon necrobiome: evidence salmon carrion decomposition influences aquatic and terrestrial insect microbiomes. - Environmental Microbiology 18: 1511–1522.Peller, T. and Altermatt, F. 2024. Invasive species drive cross-ecosystem effects worldwide. - Nat Ecol Evol: 1–11.Peralta, G., Vázquez, D. P., Chacoff, N. P., Lomáscolo, S. B., Perry, G. L. W. and Tylianakis, J. M. 2020. Trait matching and phenological overlap increase the spatio‐temporal stability and functionality of plant–pollinator interactions (R Irwin, Ed.). - Ecology Letters 23: 1107–1116.Polis, G. A., Anderson, W. B. and Holt, R. D. 1997. Toward an Integration of Landscape and Food Web Ecology: The Dynamics of Spatially Subsidized Food Webs. - Annual Review of Ecology, Evolution, and Systematics 28: 289–316.Ponisio, L. C., Wilkin, K., M’Gonigle, L. K., Kulhanek, K., Cook, L., Thorp, R., Griswold, T. and Kremen, C. 2016. Pyrodiversity begets plant–pollinator community diversity. - Global Change Biology 22: 1794–1808.Pozo, M. I., Herrera, C. M. and Bazaga, P. 2011. Species Richness of Yeast Communities in Floral Nectar of Southern Spanish Plants. - Microb Ecol 61: 82–91.Pozo, M. I., Kemenade, G., Oystaeyen, A., Aledón‐Catalá, T., Benavente, A., Van den Ende, W., Wäckers, F. and Jacquemyn, H. 2020. The impact of yeast presence in nectar on bumble bee behavior and fitness. - Ecol Monogr in press.Qian, X., Li, X., Li, H. and Zhang, D. 2020. Floral fungal-bacterial community structure and co-occurrence patterns in four sympatric island plant species. - Fungal Biology in press.Qian, X., Li, X., Li, H. and Zhang, D. 2021. Floral fungal-bacterial community structure and co-occurrence patterns in four sympatric island plant species. - Fungal Biology 125: 49–61.R Core Team 2024. R: A language and environment for statistical computing.Remus-Emsermann, M. N. P., Tecon, R., Kowalchuk, G. A. and Leveau, J. H. J. 2012. Variation in local carrying capacity and the individual fate of bacterial colonizers in the phyllosphere. - ISME J 6: 756–765.Rosenzweig, M. L. 1995. Species diversity in space and time.Rutkowski, D., Litsey, E., Maalouf, I. and Vannette, R. L. 2022. Bee‐associated fungi mediate effects of fungicides on bumble bees. - Ecological Entomology 47: 411–422.Rutkowski, D., Weston, M. and Vannette, R. L. 2023. Bees just wanna have fungi: a review of bee associations with nonpathogenic fungi. - FEMS Microbiology Ecology 99: fiad077.San Roman, M. and Wagner, A. 2021. Diversity begets diversity during community assembly until ecological limits impose a diversity ceiling. - Molecular Ecology 30: 5874–5887.Schechter, S. P. and Bruns, T. D. 2012. Edaphic sorting drives arbuscular mycorrhizal fungal community assembly in a serpentine/non-serpentine mosaic landscape. - Ecosphere 3: art42.Scherer-Lorenzen, M., Gessner, M. O., Beisner, B. E., Messier, C., Paquette, A., Petermann, J. S., Soininen, J. and Nock, C. A. 2022. Pathways for cross-boundary effects of biodiversity on ecosystem functioning. - Trends in Ecology & Evolution 37: 454–467.Seabloom, E. W., Harpole, W. S., Reichman, O. J. and Tilman, D. 2003. Invasion, competitive dominance, and resource use by exotic and native California grassland species. - Proceedings of the National Academy of Sciences 100: 13384–13389.Simha, A., Pardo-De la Hoz, C. J. and Carley, L. N. 2022. Moving beyond the “Diversity Paradox”: The Limitations of Competition-Based Frameworks in Understanding Species Diversity. - The American Naturalist 200: 89–100.Smith, G. P., Cohen, H., Zorn, J. F., McFrederick, Q. S. and Ponisio, L. C. 2024. Plant–pollinator network architecture does not impact intraspecific microbiome variability. - Molecular Ecology 33: e17306.Sokolov, N. 2024. The Dynamics and Emergence of Shared Viruses in Honey Bees and Native Bees.Steffan, S. A., Dharampal, P. S., Kueneman, J. G., Keller, A., Argueta-Guzmán, M. P., McFrederick, Q. S., Buchmann, S. L., Vannette, R. L., Edlund, A. F., Mezera, C. C., Amon, N. and Danforth, B. N. 2024. Microbes, the ‘silent third partners’ of bee–angiosperm mutualisms. - Trends in Ecology & Evolution 39: 65–77.Toju, H., Vannette, R. L., Gauthier, M.-P. L., Dhami, M. K. and Fukami, T. 2018. Priority effects can persist across floral generations in nectar microbial metacommunities. - Oikos 127: 345–352.Turley, N. E., Bell-Dereske, L., Evans, S. E. and Brudvig, L. A. 2020. Agricultural land-use history and restoration impact soil microbial biodiversity. - Journal of Applied Ecology 57: 852–863.Valdovinos, F. S. 2019. Mutualistic networks: moving closer to a predictive theory. - Ecology Letters 22: 1517–1534.Valdovinos, F. S., Brosi, B. J., Briggs, H. M., Moisset de Espanés, P., Ramos-Jiliberto, R. and Martinez, N. D. 2016. Niche partitioning due to adaptive foraging reverses effects of nestedness and connectance on pollination network stability. - Ecology Letters 19: 1277–1286.Vannette, R. L. 2020a. The Floral Microbiome: Plant, Pollinator, and Microbial Perspectives.: 24.Vannette, R. L. 2020b. The Floral Microbiome: Plant, Pollinator, and Microbial Perspectives.: 24.Vannette, R. L. and Fukami, T. 2018. Contrasting effects of yeasts and bacteria on floral nectar traits. - Annals of Botany 121: 1343–1349.Vannette, R. L., McMunn, M. S., Hall, G. W., Mueller, T. G., Munkres, I. and Perry, D. 2021. Culturable bacteria are more common than fungi in floral nectar and are more easily dispersed by thrips, a ubiquitous flower visitor. - FEMS Microbiology Ecology 97: fiab150.Wang, Y. 2019. Pollination-mutualisms in a two-patch system with dispersal. - Journal of Theoretical Biology 476: 51–61.Wei, N., Russell, A. L., Jarrett, A. R. and Ashman, T.-L. 2021. Pollinators mediate floral microbial diversity and microbial network under agrochemical disturbance. - Molecular Ecology 30: 2235–2247.Williams, N. M. 2011. Restoration of Nontarget Species: Bee Communities and Pollination Function in Riparian Forests. - Restoration Ecology 19: 450–459.Wisnoski, N. I., Muscarella, M. E., Larsen, M. L., Peralta, A. L. and Lennon, J. T. 2020. Metabolic insight into bacterial community assembly across ecosystem boundaries. - Ecology in press.Zamorano, J., Bartomeus, I., Grez, A. A. and Garibaldi, L. A. 2020. Field margin floral enhancements increase pollinator diversity at the field edge but show no consistent spillover into the crop field: a meta-analysis. - Insect Conservation and Diversity 13: 519–531.Zemenick, A. T., Rosenheim, J. A. and Vannette, R. L. 2018. Legitimate visitors and nectar robbers of Aquilegia formosa have different effects on nectar bacterial communities. - Ecosphere in press.Zemenick, A. T., Vannette, R. L. and Rosenheim, J. A. 2021. Linked networks reveal dual roles of insect dispersal and species sorting for bacterial communities in flowers. - Oikos 130: 697–707. Information & Authors Information Version history V1 Version 1 23 February 2026 Copyright This work is licensed under a Non Exclusive No Reuse License. Keywords cross-ecosystem effects diversity floral fungi pollinators spillover yeast Authors Affiliations Rebecca Nelson 0000-0002-9574-0241 [email protected] University of California Davis View all articles by this author Gillian Bergmann Leibniz Institute for Agricultural Engineering and Bioeconomy View all articles by this author Emma Jochim University of California Davis View all articles by this author Fernanda Valdovinos 0000-0002-5270-5286 UC Davis View all articles by this author Metrics & Citations Metrics Article Usage 206 views 143 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Rebecca Nelson, Gillian Bergmann, Emma Jochim, et al. The spillover of floral fungi across ecological boundaries. Authorea . 23 February 2026. DOI: https://doi.org/10.22541/au.177187884.44401097/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.177187884.44401097/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9fe1c33619f78650',t:'MTc3OTE3OTY2Ng=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00