NLRP3 Inflammasome Regulates Th17/Treg Cell Balance in Experimental Autoimmune Myocarditis

NLRP3 Inflammasome Regulates Th17/Treg Cell Balance in Experimental Autoimmune Myocarditis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article NLRP3 Inflammasome Regulates Th17/Treg Cell Balance in Experimental Autoimmune Myocarditis Lijun Su, Nan Qu, Lili Chen, Yuying Lin, Huiwen Mo, Yanlan Huang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6771802/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective This study aimed to investigate whether the NLRP3 inflammasome modulates the Th17/Treg cell balance in experimental autoimmune myocarditis (EAM). Methods BALB/c mice were immunized subcutaneously with purified cardiac myosin heavy chain-α to induce EAM, injected NLRP3 inhibitor (MCC950) or PBS into the EAM mice by intraperitoneal injection. Splenic CD4⁺ T cells were isolated for in vitro culture. Myocardial inflammation was evaluated by HE staining. Th17/Treg ratios were analyzed by flow cytometry in cardiac tissue and cultured cells. RORγt and Foxp3 mRNA expression was measured by RT-PCR and IL-17/IL-10 levels by ELISA. Results Our study demonstrates that NLRP3 inhibition significantly attenuates myocardial inflammatory cell infiltration and preserves cardiac architecture in EAM mice. The EAM group exhibited significantly increased Th17/Treg ratios and RORγt mRNA expression in myocardial tissue compared to both MCC950-treated and control groups while demonstrating markedly decreased Foxp3 mRNA levels. In vitro experiments using cultured CD4 + T cells revealed substantially higher Th17 cell proportions, RORγt expression, and IL-17 secretion in the EAM group versus MCC950-treated cells, accompanied by significantly reduced Treg cell frequencies, Foxp3 mRNA levels, and IL-10 production. Conclusion During the pathogenesis of experimental autoimmune myocarditis (EAM), the NLRP3 inflammasome promotes Th17 cell differentiation while suppressing Treg cell development. Inhibition of the NLRP3 inflammasome restores the Th17/Treg balance and mitigates myocardial injury. These findings suggest that the NLRP3 inflammasome is a critical signaling hub in modulating immune responses in EAM. Targeting NLRP3 may represent a novel immunotherapeutic strategy for myocarditis. Autoimmune myocarditis NLRP3 inflammasome Th17 Treg Balance Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Myocarditis, an inflammatory cardiomyopathy induced by infectious or non-infectious factors, represents a leading cause of sudden cardiac death in adolescents, with viral infections being the most prevalent etiology[ 1 , 2 ]. Even after viral clearance, disease progression often continues due to autoimmune responses. Autoimmune myocarditis, the second phase of post-viral myocarditis, leads to dilated cardiomyopathy (DCM) and chronic heart failure in up to 20% of patients [ 3 ]. Experimental autoimmune myocarditis (EAM) is a widely used animal model for studying autoimmune myocarditis, as it mimics the pathological features of the second phase of viral myocarditis while eliminating potential viral RNA interference. Growing evidence indicates that Th17 cells, rather than Th1 cells, serve as key mediators in various inflammatory and autoimmune diseases, including systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), psoriasis, and inflammatory bowel disease [ 4 – 6 ]. In contrast to Th17 cells, Treg cells maintain immune homeostasis and promote tissue repair following inflammatory responses. The Th17/Treg balance plays a pivotal role in immune regulation, particularly in cardiac pathology. Therapeutic strategies targeting this imbalance by suppressing Th17 cell differentiation while enhancing Treg cell development may offer novel interventions for autoimmune-mediated diseases. The NLRP3 inflammasome is a cytoplasmic multiprotein complex involved in innate immune responses. Emerging evidence demonstrates its pivotal role as a molecular mediator in regulating Th17/Treg balance across various immune disorders, including arthritis and autoimmune prostatitis[ 7 – 9 ]. The NLRP3 inflammasome detects cellular damage through damage-associated molecular patterns (DAMPs) and pathogen-associated molecular patterns (PAMPs), initiating a signaling cascade to exert its biological effects. Upon activation by pattern recognition receptors (PRRs) and secondary signals (e.g., LPS or pathogenic microorganisms), NLRP3 oligomerizes and recruits downstream components. This leads to the cleavage of pro-caspase-1 into its active form, which subsequently processes IL-1β and IL-18 into their mature forms. These cytokines are then released through pores formed by the cytoplasmic protein gasdermin D (GSDMD), simultaneously mediating pyroptosis.[ 10 , 11 ]. Recent studies reveal that NLRP3 inflammasome activation promotes sterile myocardial inflammation in cardiometabolic diseases like atherosclerosis and cardiomyopathy by amplifying immune responses[ 12 ]. Importantly, NLRP3-mediated IL-1 signaling critically regulates early Th17 stabilization and Treg-to-Th17 conversion.[ 10 , 13 , 14 ]. Furthermore, the NLRP3 inflammasome modulates Treg cell stability by regulating their apoptotic process. [ 15 , 16 ]. Studies demonstrate concurrent NLRP3 inflammasome activation and Th17 cell elevation in EAM, with Spearman correlation analysis confirming their close association in viral myocarditis (VMC)[ 17 , 18 ]. Experimental studies confirm NLRP3 inflammasome activation in both EAM and VMC. Mechanistically, viral RNA triggers TLR3/TLR4-mediated NF-kB signaling to upregulate NLRP3 and pro-IL-1β expression, while mitochondrial dysfunction promotes calpain-1 activation and ROS accumulation, collectively activating the NLRP3 inflammasome. [ 19 – 21 ]. However, whether activated NLRP3 inflammasome directly induces myocardial inflammation by disrupting Th17/Treg balance in EAM remains unclear. As IL-1β bridges innate and adaptive immunity, the regulatory role of its upstream activator NLRP3 in Th17/Treg differentiation during EAM requires further investigation. In this study, we established an EAM mouse model by immunizing mice with purified cardiac myosin heavy chain-α (MyHC-α614–629) emulsified in complete Freund's adjuvant. [ 22 ] We investigated NLRP3 inflammasome's regulatory role in Th17/Treg balance by comparing MCC950-treated mice (a specific NLRP3 inhibitor) with EAM controls through comprehensive assessments of myocardial inflammation severity, Th17/Treg cell ratios, and expression levels of their characteristic transcription factors RORγt and Foxp3. Materials and Methods Experimental Animals Male BALB/c mice (4–6 weeks old) were obtained from Charles River Laboratory Animal Technology Limited (Beijing, China). All experimental procedures were conducted in strict accordance with the protocols approved by the Institutional Animal Care and Use Committee of the First Affiliated Hospital of Guangxi Medical University, China, and were performed following the National Institutes of Health (NIH) guidelines for the care and use of laboratory animals. Groups To induce experimental autoimmune myocarditis (EAM), BALB/c mice received subcutaneous injections of 200µl MyHC-ɑ614–629 (1g/ml) emulsified 1:1 with complete Freund’s adjuvant (CFA) on days 0 and 7(day 0 = initial immunization). Control mice were injected with PBS instead. For NLRP3 inflammasome inhibition, mice were intraperitoneally administered MyHC-ɑ614–629 alongside MCC950 (10 mg/kg) immunization. All mice were randomly assigned to 14-day or 21-day observation groups. Histological Analysis Cardiac tissues were fixed in 10% phosphate-buffered formalin, paraffin-embedded, and sectioned at 5µm thickness. Sections were stained with hematoxylin and eosin (H&E) following standard protocols. Histopathological evaluation was performed using light microscopy (400× magnification). Myocardial and splenic tissues Mononuclear Cell Preparation The harvested hearts and spleens were immediately placed in cold PBS, minced, and digested with 0.1% collagenase II (Sigma-Aldrich, St. Louis, MO, USA) at 37°C for 30 min. The tissue homogenate was filtered through a nylon mesh to obtain single-cell suspensions, followed by red blood cell lysis. After PBS washing, cells were resuspended in RPMI 1640 (1.0×10⁶ cells/mL) and viability was assessed using eFluor 780 (eBioscience, San Diego, CA, USA). Flow cytometric analysis Cardiac single-cell suspensions were prepared as described above. Cells were incubated with fluorescently labeled monoclonal antibodies at 4°C for 30 min in the dark, fixed and permeabilized following the manufacturer’s instructions (BD Biosciences, San Diego, CA, USA). Simultaneously, Isotype control antibodies (eBioscience, San Diego, CA, USA) were used to account for nonspecific antibody binding and minimize background staining. The following antibodies were added: mouse anti-CD4 FITC-conjugated mAbs, anti-CD4 APC-Cyanine 7-conjugated mAbs, anti-CD25 FITC-conjugated mAbs, anti-IL-17 PE-A-conjugated mAbs and anti-Foxp3 APC-conjugated mAbs (all eBioscience, San Diego, CA, USA). Following a final wash, samples were analyzed on a BD FACSCanto II flow cytometer (BD Biosciences) and were analyzed using FlowJo 7.6 software. RT-qPCR Total RNA was extracted from cardiac tissues and cells using TRIzol® (Invitrogen) followed by cDNA synthesis with a reverse transcription kit. RT-qPCR was performed on an ABI 7500 system using TB Green® Premix EX Taq™ II (TaKaRa, Japan) with the following conditions: pre-denaturation at 95°C for 30 s, 40 cycles of 95°C for 5 s, 55°C for 30 s, and 72°C for 30 s. All primers were designed as follows: GAPDH (forward: 5′- TGTGTCCGTCGTGGATCTGA − 3′, reverse: 5′- TTGCTGTTGAAGTCGCAGGAG − 3′), RORγt (forward: 5′- TCTGCAAG ACTCATCGACAAGG − 3′, reverse :5′- CACATGTTGGCTGCACAGG − 3′), Foxp3 (forward: 5′- CACCCAGGAAAGACAGCAACC-3′, reverse: 5′- GCA AGAGCTCTTGTCCATTGA-3′) (all Sangon Biotech, Shanghai). GAPDH was used as the internal reference gene, and relative gene expression was calculated using the 2-ΔΔCT method. Cell Culture and Grouping Mice from the EAM and MCC950 groups were sacrificed at day 21, and splenic single-cell suspensions were prepared as described. Naive CD4 + T cells were isolated using the specific naive CD4 + T cell isolation kit ( Miltenyi Biotec, Bergisch Gladbach, Germany)and cultured in 24-well plates at 1×10⁶ cells/well in complete DMEM medium supplemented with 10% FBS and 1% penicillin-streptomycin. The cells were divided into four experimental groups: Th17-polarized EAM group, Th17-polarized MCC950 group, Treg-polarized EAM group, and Treg-polarized MCC950 group. All wells were stimulated with anti-CD3 (5 µg/mL) and anti-CD28 (2 µg/mL). The 24-well plate was divided into four experimental groups and cultured with their respective polarization factors. The differentiation conditions were as follows: Th17: IL-2 ( 10 ng / m L )、IL − 1 β ( 10 ng / m L )、IL − 6 ( 20 ng / m L )、IL − 23 ( 20 ng / m L )、TGF - β ( 2 ng / m L )、Anti -IL − 4 mAb ( 10µg / m L )、Anti -IFN - γ mAb ( 10µg / m L );Treg༚TGF - β1 (3 ng / ml) and IL − 2 (2 ng / ml) (all eBioscience, San Diego, CA, USA). The Cells were cultured at 37°C with 5% CO₂ for 5 days before analysis. ELISA The protein levels of IL-17 and IL-10 in cell culture supernatants were quantified using enzyme-linked immunosorbent assay (ELISA) with specific antibodies (eBioscience, USA). Samples’ absorbance readings were taken at 450 nm following the manufacturer’s protocol. Protein concentrations were determined by extrapolation from standard curves. Statistical Analysis Data were analyzed using GraphPad Prism 9.0 software. Independent samples t-tests were used for comparisons between two groups, while one-way ANOVA was applied for multi-group comparisons. All data are presented as mean ± standard deviation (SD). A p-value < 0.05 was considered statistically significant. Results NLRP3 inflammasome inhibition attenuates EAM progression HE-stained myocardial sections revealed temporal pathological changes in EAM mice. At day 14, focal inflammation appeared in subepicardial and perivascular regions (Fig. 1a), progressing to widespread infiltration with necrosis and structural disruption by day 21 (Fig. 1b). MCC950 treatment prevented early inflammation (day 14) and significantly reduced late-stage infiltration (day 21) while preserving myocardial architecture (Fig. 1a, b), demonstrating NLRP3 inhibition's protective effect against EAM-induced cardiac injury. NLRP3 Inflammasome Inhibition Ameliorates Th17/Treg Imbalance in EAM Building on the observed reduction in myocardial inflammation following NLRP3 suppression, we investigated Th17/Treg dynamics in EAM progression. Flow cytometry revealed significant Th17/Treg imbalance as early as day 14 in EAM mice, with elevated Th17 (P < 0.05) and reduced Treg proportions (P < 0.05) versus controls (Fig. 2a-b). This imbalance persisted at day 21 (P 0.05) while Tregs increased markedly (P < 0.01; Fig. 2e). MCC950 treatment effectively modulated this axis, demonstrating lower Th17 (P < 0.05) and higher Treg proportions (P < 0.05) than EAM groups at both timepoints (Fig. 2a-d). Notably, NLRP3 inhibition progressively restored the Th17/Treg balance toward control levels, with further Th17 reduction (P < 0.05) and significant Treg elevation (P < 0.05) by day 21 (Fig. 2e). Our results demonstrate that EAM progression is characterized by sustained Th17/Treg imbalance, with persistently elevated Th17 cells likely driving myocardial inflammatory injury. MCC950 treatment demonstrated significant therapeutic effects by simultaneously suppressing Th17 cell infiltration and promoting Treg cell expansion, particularly during the late disease phase (3 weeks). This coordinated immunomodulation effectively restored the Th17/Treg balance and consequently alleviated cardiac inflammation and tissue damage. NLRP3 inflammasome regulates Th17/Treg differentiation through transcriptional modulation Given the critical role of specific transcription factors (ROR-γt/Foxp3) in Th17/Treg cell differentiation, we examined their mRNA expression patterns to elucidate NLRP3's regulatory effects. Compared with control groups, EAM mice showed significantly elevated ROR-γt mRNA levels throughout the disease course (P < 0.05 at both 14 and 21 days), which were effectively normalized by MCC950 treatment (Fig. 3a, b). For Foxp3 mRNA, while EAM mice exhibited higher expression than controls NLRP3 Inflammasome Polarizes Naive CD4 + T Cells Toward Th17 Lineage To investigate NLRP3's role in Th17/Treg differentiation, we isolated naive CD4 + T cells from day 21 EAM and MCC950-treated mice for in vitro polarization assays. After 5-day culture, MCC950-treated cells showed significantly lower Th17 frequencies (p < 0.01) and higher Treg proportions (p < 0.01) compared to EAM controls (Fig. 4a-b). Flow cytometry analysis revealed that NLRP3 inflammasome activity promotes Th17 polarization while its inhibition shifts CD4 + T cell differentiation toward Treg lineage, demonstrating NLRP3's pivotal role in governing the Th17/Treg balance. To assess the functional status of differentiated Th17/Treg cells, we quantified their signature cytokines IL-17 and IL-10 by ELISA. ELISA analysis revealed significantly higher IL-17 but lower IL-10 levels in EAM versus MCC950-treated groups (P < 0.01; Fig. 4c), confirming that NLRP3 activation not only promotes Th17 differentiation but also enhances their inflammatory cytokine production while suppressing Treg-associated anti-inflammatory activity. Mirroring in vivo findings, MCC950-treated cells exhibited significantly lower ROR-γt (P < 0.01) and higher Foxp3 mRNA levels (P < 0.01) versus EAM controls during CD4 + T cell differentiation (Fig. 4d), confirming that NLRP3 intrinsically regulates Th17/Treg lineage commitment through transcriptional control in isolated naive T cells. Discussion Persistent inflammatory cell infiltration, particularly Th17 cells, significantly contributes to cardiomyocyte dysfunction and the progression to chronic myocardiopathy in myocarditis [ 1 , 2 ]. Peripheral tolerance mechanisms regulate autoreactive T-cell activation, where Treg-mediated maintenance of immune tolerance and tissue repair alleviates inflammatory damage in autoimmune diseases [ 23 , 24 ]. Our study revealed peak disease activity at week 2 in EAM mice, characterized by significant Th17 cell infiltration and reduced Treg cell proportions, resulting in Th17/Treg imbalance. During progression to DCM, peripheral CD4 + T cells predominantly exhibited Th1/Th17 phenotypes, with IL-17A playing a key pathogenic role in disease advancement[ 25 ]. Thus, Th17/Treg imbalance likely drives autoimmune myocarditis progression. Notably, the observed week 3 Treg cell increase in EAM group. These findings suggest that Th17/Treg imbalance critically drives the progression from acute myocarditis to chronic cardiomyopathy. Therapeutic strategies restoring this balance through Th17 suppression and Treg induction may represent a promising treatment approach. The NLRP3 inflammasome plays a well-established role in inflammatory disease pathogenesis. As an innate immune sensor, activated NLRP3 undergoes transcriptional upregulation and facilitates PYD domain interactions between NLRP3 and the adaptor protein ASC[ 26 ]. ASC bridges NLRP3 and caspase-1 to form the inflammasome complex, which activates caspase-1 to process IL-1β/IL-18 for GSDMD-mediated release through pyroptosis[ 27 ]. Previous studies have established that the NLRP3 inflammasome promotes inflammatory cell infiltration, primarily through its downstream product IL-1β which drives inflammatory cell recruitment. [ 28 , 29 ]. NLRP3 inflammasome inhibition significantly reduced myocardial inflammatory cell infiltration, with HE staining showing preserved cardiac architecture. MCC950 treatment decreased Th1/Th17 cell frequencies and IFN-γ/IL-17A levels while increasing Treg cell proportion and IL-10 production in mice[ 26 , 30 ]. Our findings suggest that the NLRP3 inflammasome contributes to immune dysregulation in EAM, and its inhibition plays a crucial role in myocardial repair and remodeling. Sun et al. demonstrated that the NLRP3 inflammasome disrupts Th17/Treg balance by promoting Th17 differentiation and inducing Treg apoptosis, while NLRP3 inhibition effectively reduces Th17 cells and prevents IL-21-mediated Treg loss[ 9 , 14 , 31 ]. Thus, we propose that the therapeutic effects of NLRP3 inhibition in EAM are mediated, at least in part, through restoration of Th17/Treg balance. Our data support this mechanism, showing that NLRP3 inhibition decreases myocardial Th17 infiltration and increases Treg levels in EAM, with progressive Th17 decline and Treg expansion over time, accelerating restoration of the Th17/Treg balance in cardiac tissue. This suggests NLRP3 sustains myocardial inflammation through Th17/Treg imbalance. Existing literature reveals a feedforward loop between NLRP3 and Th17 cells: IL-1β promotes Th17 differentiation, while IL-17 upregulates NLRP3/caspase-1 in dendritic cells [ 18 ]. NLRP3-derived IL-1β drives autoreactive effector T-cell proliferation, impairs FoxP3 + Treg function and thymic development and amplifies Th17 differentiation via precursor IL-1β activation, concurrently suppressing Treg quantity and function[ 32 , 33 ]. NLRP3 inflammasome activation drives IL-1β maturation, amplifying Th17 differentiation while suppressing Treg development and function. Th17 and Treg cells regulate immunity and inflammation through antigen-dependent activation and cytokine-driven differentiation [ 34 – 37 ]. The polarization of naïve CD4 + T cells requires TCR signaling and lineage-specific cytokines, with RORγt (Th17) and Foxp3 (Treg) serving as master transcriptional regulators[ 38 , 39 ]. IL-15 regulates the Foxp3 (Treg)/RORγt (Th17) expression balance in CD4 + T cells, demonstrating their antagonistic roles in T cell differentiation [ 40 ]. In EAM, we observed that both transcription factors are initially activated, but disease progression shows divergent expression patterns: RORγt increases while Foxp3 declines, explaining sustained Th17 infiltration. MCC950 treatment normalizes this imbalance by suppressing RORγt mRNA to healthy levels while enhancing Foxp3 expression, thereby promoting Th17/Treg equilibrium. Consistent with our findings, NLRP3 inhibition similarly modulates RORγt/Foxp3 in murine asthma models [ 9 ]. NLRP3 impairs Foxp3 transcriptional activity via interaction with nuclear import protein Kpna2, where NLRP3 overexpression reduces both Foxp3 expression and Treg abundance[ 41 ]. Concurrently, IL-1β suppresses SOCS3 (a feedback inhibitor of STAT3 tyrosine phosphorylation), thereby amplifying the magnitude and duration of STAT3 activation by Th17-polarizing cytokines and antagonizing IL-2/STAT5-mediated Th17 suppression[ 42 ]. Our results demonstrate that the NLRP3 inflammasome differentially regulates Th17 and Treg lineage-committing transcription factors, driving their divergent cellular frequencies. Th17 and Treg cells share a common naïve CD4 + T cell precursor with developmental plasticity. Their divergent differentiation is governed by graded TGF-β concentrations and interleukin signals that reciprocally regulate their opposing transcriptional programs[ 36 , 43 , 44 ]. While sharing core signaling pathways, these subsets exhibit context-dependent interconversion under specific inflammatory conditions [ 36 , 45 ]. Our findings demonstrate this cellular plasticity: NLRP3 inflammasome inhibition redirects CD4 + T cell differentiation from Th17 to Treg lineage, accompanied by a cytokine shift from IL-17 to IL-10 production. Studies demonstrate that NLRP3 inflammasome-derived IL-1β and IL-18 synergize with IL-23 to drive IL-17 production by CD4 + αβ effector memory T cells in autoimmune pathogenesis[ 46 ]. The NLRP3 inflammasome disrupts Th17/Treg balance via IL-1β-mediated STAT3 phosphorylation, driving conversion of intermediate 17 + Treg cells into Th17 cells[ 8 ]. Intriguingly, recent tumor studies reveal an inflammasome-independent NLRP3 pathway that promotes Th17-to-Treg-like conversion (increased Foxp3/IL-10)[ 47 ]. However, in proinflammatory milieus (high IL-1β/IL-6 e.g.), this alternative pathway may be overshadowed by canonical NLRP3 activation, exacerbating Th17 bias in EAM. MCC950 treatment reduces mature IL-1β, potentially enabling unassembled NLRP3 to facilitate Th17-to-Treg reprogramming through the non-canonical pathway. Thus, the NLRP3 inflammasome may regulate Th17/Treg balance by steering CD4 + T cell differentiation, promoting Th17 expansion while concurrently suppressing Treg function in EAM. Conclusion In summary, the NLRP3 inflammasome critically regulates Th17/Treg balance during EAM pathogenesis by modulating lineage-determining transcription factors (RORγt and Foxp3) to steer CD4 + T cell differentiation. These findings nominate NLRP3 inhibition as a viable strategy for reestablishing immune homeostasis in myocarditis. Declarations Funding This research was funded by the Natural Science Foundation of Guangxi Province, China (2020JJB140049). Competing Interests The authors have no relevant financial or non-financial interests to disclose. Author Contributions All authors contributed to the study conception and design. Lijun Su carried out experiments and prepared the manuscript. Material preparation and analysis were performed by Nan Qu and Lili Chen. Yuying Lin and Huiwen Mo carried out data collection.Yanlan Huang conceived, designed, coordinated the study, and reviewed the manuscript. All authors read and approved the final manuscript. References Shen, Y., Q. C. Kan, W. Xu, Y. W. Chu, and S. D. Xiong. 2009. Coxsackievirus B3 infection induced viral myocarditis by regulating the expression pattern of chemokines in cardiac myocytes. Iran J Allergy Asthma Immunol Lasrado, N., and J. Reddy. 2020. An overview of the immune mechanisms of viral myocarditis. Reviews In Medical Virology . https://doi.org/10.1002/rmv.2131 Zhang, Y., X. Zhou, S. Chen, X. Sun, and C. Zhou. 2023. Immune mechanisms of group B coxsackievirus induced viral myocarditis. Virulence . https://doi.org/10.1080/21505594.2023.2180951 Berry, S. P. D., C. Dossou, A. Kashif, N. Sharifinejad, G. Azizi, H. Hamedifar, A. Sabzvari, and Z. Zian. 2022. The role of IL-17 and anti-IL-17 agents in the immunopathogenesis and management of autoimmune and inflammatory diseases. International Immunopharmacology . https://doi.org/10.1016/j.intimp.2021.108402 Yasuda, K., Y. Takeuchi, and K. Hirota. 2019. The pathogenicity of Th17 cells in autoimmune diseases. Seminars In Immunopathology . https://doi.org/10.1007/s00281-019-00733-8 Zhu, S., and Y. Qian. 2012. IL-17/IL-17 receptor system in autoimmune disease: mechanisms and therapeutic potential. Clin Sci (Lond) . https://doi.org/10.1042/cs20110496 Pan, Y., Y. Wu, Y. Liu, P. Wang, H. Huang, J. Jin, Y. Fang, S. Huang, Z. Fan, and H. Yu. 2024. Long non-coding RNA ENSMUST00000197208 promotes a shift in the Th17/Treg ratio via the P2X7R-NLRP3 inflammasome axis in collagen-induced arthritis. Immunologic Research . https://doi.org/10.1007/s12026-023-09439-4 Liu, X., J. Chen, S. Yue, C. Zhang, J. Song, H. Liang, C. Liang, and X. Chen. 2024. NLRP3-mediated IL-1β in regulating the imbalance between Th17 and Treg in experimental autoimmune prostatitis. Scientific Reports . https://doi.org/10.1038/s41598-024-69512-2 Chen, L., W. Hou, F. Liu, R. Zhu, A. Lv, W. Quan, and S. Mao. 2022. Blockade of NLRP3/Caspase-1/IL-1β Regulated Th17/Treg Immune Imbalance and Attenuated the Neutrophilic Airway Inflammation in an Ovalbumin-Induced Murine Model of Asthma. J Immunol Res . https://doi.org/10.1155/2022/9444227 Evavold, C. L., and J. C. Kagan. 2018. How Inflammasomes Inform Adaptive Immunity. Journal Of Molecular Biology . https://doi.org/10.1016/j.jmb.2017.09.019 Fu, J., and H. Wu. 2023. Structural Mechanisms of NLRP3 Inflammasome Assembly and Activation. Annual Review Of Immunology . https://doi.org/10.1146/annurev-immunol-081022-021207 Cho, S., F. Ying, and G. Sweeney. 2023. Sterile inflammation and the NLRP3 inflammasome in cardiometabolic disease. Biomedical Journal . https://doi.org/10.1016/j.bj.2023.100624 Chung, Y., S. H. Chang, G. J. Martinez, X. O. Yang, R. Nurieva, H. S. Kang, L. Ma, S. S. Watowich, A. M. Jetten, Q. Tian, and C. Dong. 2009. Critical regulation of early Th17 cell differentiation by interleukin-1 signaling. Immunity . https://doi.org/10.1016/j.immuni.2009.02.007 Deng, J., X. Q. Yu, and P. H. Wang. 2019. Inflammasome activation and Th17 responses. Molecular Immunology . https://doi.org/10.1016/j.molimm.2018.12.024 Chang, L., H. Wu, W. Huang, Y. Li, Y. Chen, X. Li, Z. Yao, X. Chen, X. Lai, R. Zheng, Z. Huang, X. Wu, and G. Zhang. 2023. IL-21 induces pyroptosis of Treg cells via Akt–mTOR–NLRP3–caspase 1 axis in eosinophilic chronic rhinosinusitis. Journal of Allergy and Clinical Immunology . https://doi.org/10.1016/j.jaci.2023.04.013 Wang, K., J. Liu, J. Yue, L. Zhou, H. Mao, J. Li, Z. Sun, Z. Chen, and L. Zhang. 2024. Nlrp3 inflammasome drives regulatory T cell depletion to accelerate periapical bone erosion. International Endodontic Journal . https://doi.org/10.1111/iej.14062 Liang, W., B. K. Xie, P. W. Ding, M. Wang, J. Yuan, X. Cheng, and Y. H. Liao, M. Yu. 2021. Sacubitril/Valsartan Alleviates Experimental Autoimmune Myocarditis by Inhibiting Th17 Cell Differentiation Independently of the NLRP3 Inflammasome Pathway. Frontiers In Pharmacology . https://doi.org/10.3389/fphar.2021.727838 Chen, J., F. Yang, S. Shi, X. Liu, F. Qin, X. Wei, Y. Huang, W. Liang, L. Miao, and O. Andrukhov. 2021. The Severity of CVB3-Induced Myocarditis Can Be Improved by Blocking the Orchestration of NLRP3 and Th17 in Balb/c Mice. Mediators of Inflammation . https://doi.org/10.1155/2021/5551578 Wang, Y., B. Gao, and S. Xiong. 2014. Involvement of NLRP3 inflammasome in CVB3-induced viral myocarditis. American Journal Of Physiology Heart And Circulatory Physiology . https://doi.org/10.1152/ajpheart.00441.2014 Bao, J., T. Sun, Y. Yue, and S. Xiong. 2019. Macrophage NLRP3 inflammasome activated by CVB3 capsid proteins contributes to the development of viral myocarditis. Molecular Immunology . https://doi.org/10.1016/j.molimm.2019.07.012 Liu, X., M. Li, Z. Chen, Y. Yu, H. Shi, Y. Yu, Y. Wang, R. Chen, and J. Ge. 2022. Mitochondrial calpain-1 activates NLRP3 inflammasome by cleaving ATP5A1 and inducing mitochondrial ROS in CVB3-induced myocarditis. Basic Research in Cardiology . https://doi.org/10.1007/s00395-022-00948-1 Massilamany, C., A. Gangaplara, D. Steffen, and J. Reddy. 2011. Identification of novel mimicry epitopes for cardiac myosin heavy chain-α that induce autoimmune myocarditis in A/J mice. Cellular Immunology . https://doi.org/10.1016/j.cellimm.2011.08.013 Kimura, A., and T. Kishimoto. 2010. IL-6: regulator of Treg/Th17 balance. European Journal Of Immunology . https://doi.org/10.1002/eji.201040391 Wen, S., L. He, Z. Zhong, R. Zhao, S. Weng, H. Mi, and F. Liu. 2021. Stigmasterol Restores the Balance of Treg/Th17 Cells by Activating the Butyrate-PPARγ Axis in Colitis. Frontiers In Immunology . https://doi.org/10.3389/fimmu.2021.741934 Nindl, V., R. Maier, D. Ratering, R. De Giuli, R. Züst, V. Thiel, E. Scandella, F. Di Padova, M. Kopf, M. Rudin, T. Rülicke, and B. Ludewig. 2012. Cooperation of Th1 and Th17 cells determines transition from autoimmune myocarditis to dilated cardiomyopathy. European Journal Of Immunology . https://doi.org/10.1002/eji.201142209 Shao, B.-Z., Z.-Q. Xu, B.-Z. Han, D.-F. Su, and C. Liu. 2015. NLRP3 inflammasome and its inhibitors: a review. Frontiers in Pharmacology . https://doi.org/10.3389/fphar.2015.00262 Fu, J., and H. Wu. 2023. Structural Mechanisms of NLRP3 Inflammasome Assembly and Activation. Annual Review of Immunology . https://doi.org/10.1146/annurev-immunol-081022-021207 Kawaguchi, M., M. Takahashi, T. Hata, Y. Kashima, F. Usui, H. Morimoto, A. Izawa, Y. Takahashi, J. Masumoto, J. Koyama, M. Hongo, T. Noda, J. Nakayama, J. Sagara, S.i. Taniguchi, and U. Ikeda. 2011. Inflammasome activation of cardiac fibroblasts is essential for myocardial ischemia/reperfusion injury. Circulation . https://doi.org/10.1161/circulationaha.110.982777 Payne, F. M., A. R. Dabb, J. C. Harrison, and I. A. Sammut. 2024. Inhibitors of NLRP3 Inflammasome Formation: A Cardioprotective Role for the Gasotransmitters Carbon Monoxide, Nitric Oxide, and Hydrogen Sulphide in Acute Myocardial Infarction. International Journal of Molecular Sciences . https://doi.org/10.3390/ijms25179247 Xu, K.-Y., S. Tong, C.-Y. Wu, X.-C. Ding, J.-L. Chen, Y. Ming, and S.-H. Wang. 2020. Nlrp3 Inflammasome Inhibitor MCC950 Ameliorates Obliterative Bronchiolitis by Inhibiting Th1/Th17 Response and Promoting Treg Response After Orthotopic Tracheal Transplantation in Mice. Transplantation . https://doi.org/10.1097/tp.0000000000003208 Sun, H. G., Q. Jiang, W. J. Fan, X. Y. Shen, Z. W. Wang, and X. Wang. 2023. TAGAP activates Th17 cell differentiation by promoting RhoA and NLRP3 to accelerate rheumatoid arthritis development. Clinical And Experimental Immunology . https://doi.org/10.1093/cei/uxad084 O'Sullivan, B. J., H. E. Thomas, S. Pai, P. Santamaria, Y. Iwakura, R. J. Steptoe, T. W. H. Kay, and R. Thomas. 2006. IL-1 beta breaks tolerance through expansion of CD25 + effector T cells. Journal of Immunology (Baltimore, Md.: 1950) . https://doi.org/10.4049/jimmunol.176.12.7278 Nikolouli, E., Y. Elfaki, S. Herppich, C. Schelmbauer, M. Delacher, C. Falk, I. A. Mufazalov, A. Waisman, M. Feuerer, and J. Huehn. 2021. Recirculating IL-1R2 + Tregs fine-tune intrathymic Treg development under inflammatory conditions. Cellular & Molecular Immunology . https://doi.org/10.1038/s41423-019-0352-8 Veldhoen, M., R. J. Hocking, C. J. Atkins, R. M. Locksley, and B. Stockinger. 2006. TGFbeta in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells. Immunity . https://doi.org/10.1016/j.immuni.2006.01.001 Yasuda, K., Y. Takeuchi, and K. Hirota. 2019. The pathogenicity of Th17 cells in autoimmune diseases. Seminars In Immunopathology . https://doi.org/10.1007/s00281-019-00733-8 Bettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L. Weiner, and V. K. Kuchroo. 2006. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature . https://doi.org/10.1038/nature04753 Stockinger, B., M. Veldhoen, and B. Martin. 2007. Th17 T cells: linking innate and adaptive immunity. Seminars In Immunology . https://doi.org/10.1016/j.smim.2007.10.008 Yamane, H., and W. E. Paul. 2013. Early signaling events that underlie fate decisions of naive CD4(+) T cells toward distinct T-helper cell subsets. Immunological Reviews . https://doi.org/10.1111/imr.12032 Zhu, X., and J. Zhu. 2020. CD4 T Helper Cell Subsets and Related Human Immunological Disorders. International Journal of Molecular Sciences . https://doi.org/10.3390/ijms21218011 Tosiek, M. J., L. Fiette, S. El Daker, G. Eberl, and A. A. Freitas. 2016. IL-15-dependent balance between Foxp3 and RORγt expression impacts inflammatory bowel disease. Nature Communications . https://doi.org/10.1038/ncomms10888 Park, S.-H., S. Ham, A. Lee, A. Möller, and T. S. Kim. 2019. NLRP3 negatively regulates Treg differentiation through Kpna2-mediated nuclear translocation. The Journal of Biological Chemistry . https://doi.org/10.1074/jbc.RA119.010545 Basu, R., S. K. Whitley, S. Bhaumik, C. L. Zindl, T. R. Schoeb, E. N. Benveniste, W. S. Pear, R. D. Hatton, and C. T. Weaver. 2015. IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the TH17 cell-iTreg cell balance. Nature Immunology . https://doi.org/10.1038/ni.3099 Lee, G. R. 2018. The Balance of Th17 versus Treg Cells in Autoimmunity. International Journal Of Molecular Sciences . https://doi.org/10.3390/ijms19030730 Kubick, N., M. Lazarczyk, N. Strzałkowska, A. Charuta, J. O. Horbańczuk, M. Sacharczuk, and M. E. Mickael. 2023. Factors regulating the differences in frequency of infiltration of Th17 and Treg of the blood-brain barrier. Immunogenetics . https://doi.org/10.1007/s00251-023-01310-y Zhou, L., J. E. Lopes, M. M. Chong, I. I. Ivanov, R. Min, G. D. Victora, Y. Shen, J. Du, Y. P. Rubtsov, A. Y. Rudensky, S. F. Ziegler, and D. R. Littman. 2008. TGF-beta-induced Foxp3 inhibits T(H)17 cell differentiation by antagonizing RORgammat function. Nature . https://doi.org/10.1038/nature06878 Dungan, L. S., and K. H. Mills. 2011. Caspase-1-processed IL-1 family cytokines play a vital role in driving innate IL-17. Cytokine . https://doi.org/10.1016/j.cyto.2011.07.007 Accogli, T., C. Hibos, L. Milian, M. Geindreau, C. Richard, E. Humblin, R. Mary, S. Chevrier, E. Jacquin, A. Bernard, F. Chalmin, C. Paul, B. Ryffel, L. Apetoh, R. Boidot, M. Bruchard, F. Ghiringhelli, and F. Vegran. 2025. The intrinsic expression of NLRP3 in Th17 cells promotes their protumor activity and conversion into Tregs. Cellular & Molecular Immunology . https://doi.org/10.1038/s41423-025-01281-y Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6771802","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":465330188,"identity":"5254968e-8149-486e-9a51-54df7be283b2","order_by":0,"name":"Lijun Su","email":"","orcid":"","institution":"First Affiliated Hospital of GuangXi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Lijun","middleName":"","lastName":"Su","suffix":""},{"id":465330190,"identity":"465c0170-0ceb-4fba-bc68-abdf54a50bf7","order_by":1,"name":"Nan Qu","email":"","orcid":"","institution":"Ruikang Hospital Affiliated to Guangxi University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Nan","middleName":"","lastName":"Qu","suffix":""},{"id":465330192,"identity":"8378baf6-c5f4-4f58-bcc6-69874b8eda68","order_by":2,"name":"Lili Chen","email":"","orcid":"","institution":"First Affiliated Hospital of GuangXi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Lili","middleName":"","lastName":"Chen","suffix":""},{"id":465330194,"identity":"1bd93e70-615a-4afb-8b20-4be188874ff3","order_by":3,"name":"Yuying Lin","email":"","orcid":"","institution":"First Affiliated Hospital of GuangXi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yuying","middleName":"","lastName":"Lin","suffix":""},{"id":465330195,"identity":"06073144-b78b-4764-baad-73e95a2df6c0","order_by":4,"name":"Huiwen Mo","email":"","orcid":"","institution":"First Affiliated Hospital of GuangXi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Huiwen","middleName":"","lastName":"Mo","suffix":""},{"id":465330198,"identity":"4c54005e-76f8-4bef-8f21-8b90ca83434c","order_by":5,"name":"Yanlan Huang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyklEQVRIiWNgGAWjYBACAwbmBgkGg39y/MzMBx8QqYURqKXggLFkO1uyAQlaPhxINDjPYyZAlBZzicTGm18M7iQYH2YwY2CosYkmqMVyRmKztYzBszyzwwxpDxiOpeU2EHTYjcQ2aQkD5mKgluMGjA2HideSuLmZsU2CaC2SHwwOJ25gZmYjUsuZh83WDAZpxhKH2ZgNEojyy/Hkgzd//LGR4+8///HBhxobwloYBBIYmHlgnASCykGA/wAD4w+iVI6CUTAKRsGIBQATXEOSF0RBMAAAAABJRU5ErkJggg==","orcid":"","institution":"First Affiliated Hospital of GuangXi Medical University","correspondingAuthor":true,"prefix":"","firstName":"Yanlan","middleName":"","lastName":"Huang","suffix":""}],"badges":[],"createdAt":"2025-05-29 01:53:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6771802/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6771802/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":83825733,"identity":"82110051-80fb-4442-ab47-b03075a11217","added_by":"auto","created_at":"2025-06-03 10:07:48","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":451490,"visible":true,"origin":"","legend":"\u003cp\u003eInhibition of the NLRP3 inflammasome effectively suppresses myocardial inflammatory cell infiltration and cardiac injury.\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003ea\u003c/strong\u003e) HE-stained sections of different groups at day 14. (\u003cstrong\u003eb\u003c/strong\u003e) HE-stained sections of different groups at day 21. All sections are from myocardial tissue, magnification 400x.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6771802/v1/0e5026578cc290ed66e374f4.png"},{"id":83825729,"identity":"188cc1a2-1bb5-4d70-a23a-f2a86f750a53","added_by":"auto","created_at":"2025-06-03 10:07:48","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":272851,"visible":true,"origin":"","legend":"\u003cp\u003eTh17/Treg cell imbalance in the EAM mouse model is alleviated by NLRP3 inflammasome inhibition, reducing Th17 levels and increasing Treg cell numbers.(\u003cstrong\u003ea-d\u003c/strong\u003e) Flow cytometry plots and percentages of IL-17A+ CD4+ cells (Th17) in the 14-day (\u003cstrong\u003ea\u003c/strong\u003e) and 21-day (\u003cstrong\u003eb\u003c/strong\u003e) subgroups, and percentages of CD25+Foxp3+ CD4+ cells (Treg) in the 14-day (\u003cstrong\u003ec\u003c/strong\u003e) and 21-day (\u003cstrong\u003ed\u003c/strong\u003e) subgroups.(\u003cstrong\u003ee\u003c/strong\u003e) Comparison of Th17 (A) and Treg (B) cell proportions across groups at both time points. Data are presented as mean ± SD, n = 4. *p \u0026lt; 0.05, **p \u0026lt; 0.01 vs. control group; ^p \u0026lt; 0.05 vs. EAM group; NS indicates no statistical significance.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6771802/v1/f2ebdaef5468e73a85049d90.png"},{"id":83825728,"identity":"50e74226-6a1e-408e-b48e-e61a325cba7c","added_by":"auto","created_at":"2025-06-03 10:07:48","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":101642,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of NLRP3 inflammasome inhibition on Th17/Treg cell-specific transcription factors. (\u003cstrong\u003ea\u003c/strong\u003e) Expression levels of ROR-γt mRNA and Foxp3 mRNA in the 14-day subgroup. (\u003cstrong\u003eb\u003c/strong\u003e) Expression levels of ROR-γt mRNA and Foxp3 mRNA in the 21-day subgroup across different groups. (\u003cstrong\u003ec\u003c/strong\u003e) Comparison of ROR-γt mRNA and Foxp3 mRNA expression levels across groups at both time points. Data are presented as mean ± SD, n = 4. NS indicates no statistical significance; *p \u0026lt; 0.05, **p \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6771802/v1/adcfc771db8e57fb8880e294.png"},{"id":83825731,"identity":"0736ff24-1eba-41b3-8284-7d87d831b8eb","added_by":"auto","created_at":"2025-06-03 10:07:48","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":233850,"visible":true,"origin":"","legend":"\u003cp\u003eInhibition of NLRP3 shifted the differentiation of naïve CD4+ T cells toward a Treg phenotype in vitro. (a) Representative flow cytometry plots and quantitative analysis of Th17 cell differentiation in EAM versus MCC950-treated groups; (b) Representative flow cytometry plots and quantitative analysis of Treg cell differentiation in EAM versus MCC950-treated groups; (c) Secreted IL-17 and IL-10 protein levels in culture supernatants; (d) RORγt and Foxp3 mRNA expression levels. Data are presented as mean ± SD. NS indicates no statistical significance; *p \u0026lt; 0.05, **p \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6771802/v1/7869af87a88dea2fe753f5e0.png"},{"id":84332195,"identity":"6e868405-e6a6-43ee-bb27-e079622df2a3","added_by":"auto","created_at":"2025-06-10 16:16:50","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1463399,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6771802/v1/095fc63d-7e04-4491-9578-6d4065bff978.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"NLRP3 Inflammasome Regulates Th17/Treg Cell Balance in Experimental Autoimmune Myocarditis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMyocarditis, an inflammatory cardiomyopathy induced by infectious or non-infectious factors, represents a leading cause of sudden cardiac death in adolescents, with viral infections being the most prevalent etiology[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Even after viral clearance, disease progression often continues due to autoimmune responses. Autoimmune myocarditis, the second phase of post-viral myocarditis, leads to dilated cardiomyopathy (DCM) and chronic heart failure in up to 20% of patients [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Experimental autoimmune myocarditis (EAM) is a widely used animal model for studying autoimmune myocarditis, as it mimics the pathological features of the second phase of viral myocarditis while eliminating potential viral RNA interference. Growing evidence indicates that Th17 cells, rather than Th1 cells, serve as key mediators in various inflammatory and autoimmune diseases, including systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), psoriasis, and inflammatory bowel disease [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. In contrast to Th17 cells, Treg cells maintain immune homeostasis and promote tissue repair following inflammatory responses. The Th17/Treg balance plays a pivotal role in immune regulation, particularly in cardiac pathology. Therapeutic strategies targeting this imbalance by suppressing Th17 cell differentiation while enhancing Treg cell development may offer novel interventions for autoimmune-mediated diseases.\u003c/p\u003e \u003cp\u003eThe NLRP3 inflammasome is a cytoplasmic multiprotein complex involved in innate immune responses. Emerging evidence demonstrates its pivotal role as a molecular mediator in regulating Th17/Treg balance across various immune disorders, including arthritis and autoimmune prostatitis[\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The NLRP3 inflammasome detects cellular damage through damage-associated molecular patterns (DAMPs) and pathogen-associated molecular patterns (PAMPs), initiating a signaling cascade to exert its biological effects. Upon activation by pattern recognition receptors (PRRs) and secondary signals (e.g., LPS or pathogenic microorganisms), NLRP3 oligomerizes and recruits downstream components. This leads to the cleavage of pro-caspase-1 into its active form, which subsequently processes IL-1β and IL-18 into their mature forms. These cytokines are then released through pores formed by the cytoplasmic protein gasdermin D (GSDMD), simultaneously mediating pyroptosis.[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Recent studies reveal that NLRP3 inflammasome activation promotes sterile myocardial inflammation in cardiometabolic diseases like atherosclerosis and cardiomyopathy by amplifying immune responses[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Importantly, NLRP3-mediated IL-1 signaling critically regulates early Th17 stabilization and Treg-to-Th17 conversion.[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Furthermore, the NLRP3 inflammasome modulates Treg cell stability by regulating their apoptotic process. [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Studies demonstrate concurrent NLRP3 inflammasome activation and Th17 cell elevation in EAM, with Spearman correlation analysis confirming their close association in viral myocarditis (VMC)[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Experimental studies confirm NLRP3 inflammasome activation in both EAM and VMC. Mechanistically, viral RNA triggers TLR3/TLR4-mediated NF-kB signaling to upregulate NLRP3 and pro-IL-1β expression, while mitochondrial dysfunction promotes calpain-1 activation and ROS accumulation, collectively activating the NLRP3 inflammasome. [\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. However, whether activated NLRP3 inflammasome directly induces myocardial inflammation by disrupting Th17/Treg balance in EAM remains unclear. As IL-1β bridges innate and adaptive immunity, the regulatory role of its upstream activator NLRP3 in Th17/Treg differentiation during EAM requires further investigation.\u003c/p\u003e \u003cp\u003eIn this study, we established an EAM mouse model by immunizing mice with purified cardiac myosin heavy chain-α (MyHC-α614\u0026ndash;629) emulsified in complete Freund's adjuvant. [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] We investigated NLRP3 inflammasome's regulatory role in Th17/Treg balance by comparing MCC950-treated mice (a specific NLRP3 inhibitor) with EAM controls through comprehensive assessments of myocardial inflammation severity, Th17/Treg cell ratios, and expression levels of their characteristic transcription factors RORγt and Foxp3.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003eExperimental Animals\u003c/p\u003e \u003cp\u003eMale BALB/c mice (4\u0026ndash;6 weeks old) were obtained from Charles River Laboratory Animal Technology Limited (Beijing, China). All experimental procedures were conducted in strict accordance with the protocols approved by the Institutional Animal Care and Use Committee of the First Affiliated Hospital of Guangxi Medical University, China, and were performed following the National Institutes of Health (NIH) guidelines for the care and use of laboratory animals.\u003c/p\u003e \u003cp\u003eGroups\u003c/p\u003e \u003cp\u003eTo induce experimental autoimmune myocarditis (EAM), BALB/c mice received subcutaneous injections of 200\u0026micro;l MyHC-ɑ614\u0026ndash;629 (1g/ml) emulsified 1:1 with complete Freund\u0026rsquo;s adjuvant (CFA) on days 0 and 7(day 0\u0026thinsp;=\u0026thinsp;initial immunization). Control mice were injected with PBS instead. For NLRP3 inflammasome inhibition, mice were intraperitoneally administered MyHC-ɑ614\u0026ndash;629 alongside MCC950 (10 mg/kg) immunization. All mice were randomly assigned to 14-day or 21-day observation groups.\u003c/p\u003e \u003cp\u003eHistological Analysis\u003c/p\u003e \u003cp\u003eCardiac tissues were fixed in 10% phosphate-buffered formalin, paraffin-embedded, and sectioned at 5\u0026micro;m thickness. Sections were stained with hematoxylin and eosin (H\u0026amp;E) following standard protocols. Histopathological evaluation was performed using light microscopy (400\u0026times; magnification).\u003c/p\u003e \u003cp\u003eMyocardial and splenic tissues Mononuclear Cell Preparation\u003c/p\u003e \u003cp\u003eThe harvested hearts and spleens were immediately placed in cold PBS, minced, and digested with 0.1% collagenase II (Sigma-Aldrich, St. Louis, MO, USA) at 37\u0026deg;C for 30 min. The tissue homogenate was filtered through a nylon mesh to obtain single-cell suspensions, followed by red blood cell lysis. After PBS washing, cells were resuspended in RPMI 1640 (1.0\u0026times;10⁶ cells/mL) and viability was assessed using eFluor 780 (eBioscience, San Diego, CA, USA).\u003c/p\u003e \u003cp\u003eFlow cytometric analysis\u003c/p\u003e \u003cp\u003eCardiac single-cell suspensions were prepared as described above. Cells were incubated with fluorescently labeled monoclonal antibodies at 4\u0026deg;C for 30 min in the dark, fixed and permeabilized following the manufacturer\u0026rsquo;s instructions (BD Biosciences, San Diego, CA, USA). Simultaneously, Isotype control antibodies (eBioscience, San Diego, CA, USA) were used to account for nonspecific antibody binding and minimize background staining. The following antibodies were added: mouse anti-CD4 FITC-conjugated mAbs, anti-CD4 APC-Cyanine 7-conjugated mAbs, anti-CD25 FITC-conjugated mAbs, anti-IL-17 PE-A-conjugated mAbs and anti-Foxp3 APC-conjugated mAbs (all eBioscience, San Diego, CA, USA). Following a final wash, samples were analyzed on a BD FACSCanto II flow cytometer (BD Biosciences) and were analyzed using FlowJo 7.6 software.\u003c/p\u003e \u003cp\u003eRT-qPCR\u003c/p\u003e \u003cp\u003eTotal RNA was extracted from cardiac tissues and cells using TRIzol\u0026reg; (Invitrogen) followed by cDNA synthesis with a reverse transcription kit. RT-qPCR was performed on an ABI 7500 system using TB Green\u0026reg; Premix EX Taq\u0026trade; II (TaKaRa, Japan) with the following conditions: pre-denaturation at 95\u0026deg;C for 30 s, 40 cycles of 95\u0026deg;C for 5 s, 55\u0026deg;C for 30 s, and 72\u0026deg;C for 30 s. All primers were designed as follows: GAPDH (forward: 5\u0026prime;- TGTGTCCGTCGTGGATCTGA \u0026minus;\u0026thinsp;3\u0026prime;, reverse: 5\u0026prime;- TTGCTGTTGAAGTCGCAGGAG \u0026minus;\u0026thinsp;3\u0026prime;), RORγt (forward: 5\u0026prime;- TCTGCAAG ACTCATCGACAAGG \u0026minus;\u0026thinsp;3\u0026prime;, reverse :5\u0026prime;- CACATGTTGGCTGCACAGG \u0026minus;\u0026thinsp;3\u0026prime;), Foxp3 (forward: 5\u0026prime;- CACCCAGGAAAGACAGCAACC-3\u0026prime;, reverse: 5\u0026prime;- GCA AGAGCTCTTGTCCATTGA-3\u0026prime;) (all Sangon Biotech, Shanghai). GAPDH was used as the internal reference gene, and relative gene expression was calculated using the 2-ΔΔCT method.\u003c/p\u003e \u003cp\u003eCell Culture and Grouping\u003c/p\u003e \u003cp\u003eMice from the EAM and MCC950 groups were sacrificed at day 21, and splenic single-cell suspensions were prepared as described. Naive CD4\u0026thinsp;+\u0026thinsp;T cells were isolated using the specific naive CD4\u0026thinsp;+\u0026thinsp;T cell isolation kit ( Miltenyi Biotec, Bergisch Gladbach, Germany)and cultured in 24-well plates at 1\u0026times;10⁶ cells/well in complete DMEM medium supplemented with 10% FBS and 1% penicillin-streptomycin. The cells were divided into four experimental groups: Th17-polarized EAM group, Th17-polarized MCC950 group, Treg-polarized EAM group, and Treg-polarized MCC950 group. All wells were stimulated with anti-CD3 (5 \u0026micro;g/mL) and anti-CD28 (2 \u0026micro;g/mL). The 24-well plate was divided into four experimental groups and cultured with their respective polarization factors. The differentiation conditions were as follows: Th17: IL-2 ( 10 ng / m L )、IL \u0026minus;\u0026thinsp;1 β ( 10 ng / m L )、IL \u0026minus;\u0026thinsp;6 ( 20 ng / m L )、IL \u0026minus;\u0026thinsp;23 ( 20 ng / m L )、TGF - β ( 2 ng / m L )、Anti -IL \u0026minus;\u0026thinsp;4 mAb ( 10\u0026micro;g / m L )、Anti -IFN - γ mAb ( 10\u0026micro;g / m L );Treg༚TGF - β1 (3 ng / ml) and IL \u0026minus;\u0026thinsp;2 (2 ng / ml) (all eBioscience, San Diego, CA, USA). The Cells were cultured at 37\u0026deg;C with 5% CO₂ for 5 days before analysis.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eELISA\u003c/h2\u003e \u003cp\u003eThe protein levels of IL-17 and IL-10 in cell culture supernatants were quantified using enzyme-linked immunosorbent assay (ELISA) with specific antibodies (eBioscience, USA). Samples\u0026rsquo; absorbance readings were taken at 450 nm following the manufacturer\u0026rsquo;s protocol. Protein concentrations were determined by extrapolation from standard curves.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eData were analyzed using GraphPad Prism 9.0 software. Independent samples t-tests were used for comparisons between two groups, while one-way ANOVA was applied for multi-group comparisons. All data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). A p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eNLRP3 inflammasome inhibition attenuates EAM progression\u003c/p\u003e\n\u003cp\u003eHE-stained myocardial sections revealed temporal pathological changes in EAM mice. At day 14, focal inflammation appeared in subepicardial and perivascular regions (Fig. 1a), progressing to widespread infiltration with necrosis and structural disruption by day 21 (Fig. 1b). MCC950 treatment prevented early inflammation (day 14) and significantly reduced late-stage infiltration (day 21) while preserving myocardial architecture (Fig. 1a, b), demonstrating NLRP3 inhibition\u0026apos;s protective effect against EAM-induced cardiac injury.\u003c/p\u003e\n\u003cp\u003eNLRP3 Inflammasome Inhibition Ameliorates Th17/Treg Imbalance in EAM\u003c/p\u003e\n\u003cp\u003eBuilding on the observed reduction in myocardial inflammation following NLRP3 suppression, we investigated Th17/Treg dynamics in EAM progression. Flow cytometry revealed significant Th17/Treg imbalance as early as day 14 in EAM mice, with elevated Th17 (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and reduced Treg proportions (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) versus controls (Fig.\u0026nbsp;2a-b). This imbalance persisted at day 21 (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;2c-d), though Th17 cells showed a non-significant decreasing trend (8.84\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43%, P\u0026thinsp;\u0026gt;\u0026thinsp;0.05) while Tregs increased markedly (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01; Fig.\u0026nbsp;2e). MCC950 treatment effectively modulated this axis, demonstrating lower Th17 (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and higher Treg proportions (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) than EAM groups at both timepoints (Fig.\u0026nbsp;2a-d). Notably, NLRP3 inhibition progressively restored the Th17/Treg balance toward control levels, with further Th17 reduction (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and significant Treg elevation (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) by day 21 (Fig.\u0026nbsp;2e).\u003c/p\u003e\n\u003cp\u003eOur results demonstrate that EAM progression is characterized by sustained Th17/Treg imbalance, with persistently elevated Th17 cells likely driving myocardial inflammatory injury. MCC950 treatment demonstrated significant therapeutic effects by simultaneously suppressing Th17 cell infiltration and promoting Treg cell expansion, particularly during the late disease phase (3 weeks). This coordinated immunomodulation effectively restored the Th17/Treg balance and consequently alleviated cardiac inflammation and tissue damage.\u003c/p\u003e\n\u003cp\u003eNLRP3 inflammasome regulates Th17/Treg differentiation through transcriptional modulation\u003c/p\u003e\n\u003cp\u003eGiven the critical role of specific transcription factors (ROR-\u0026gamma;t/Foxp3) in Th17/Treg cell differentiation, we examined their mRNA expression patterns to elucidate NLRP3\u0026apos;s regulatory effects. Compared with control groups, EAM mice showed significantly elevated ROR-\u0026gamma;t mRNA levels throughout the disease course (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 at both 14 and 21 days), which were effectively normalized by MCC950 treatment (Fig. 3a, b). For Foxp3 mRNA, while EAM mice exhibited higher expression than controls\u003c/p\u003e\n\u003cp\u003eNLRP3 Inflammasome Polarizes Naive CD4\u0026thinsp;+\u0026thinsp;T Cells Toward Th17 Lineage\u003c/p\u003e\n\u003cp\u003eTo investigate NLRP3\u0026apos;s role in Th17/Treg differentiation, we isolated naive CD4\u0026thinsp;+\u0026thinsp;T cells from day 21 EAM and MCC950-treated mice for in vitro polarization assays. After 5-day culture, MCC950-treated cells showed significantly lower Th17 frequencies (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and higher Treg proportions (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) compared to EAM controls (Fig. 4a-b). Flow cytometry analysis revealed that NLRP3 inflammasome activity promotes Th17 polarization while its inhibition shifts CD4\u0026thinsp;+\u0026thinsp;T cell differentiation toward Treg lineage, demonstrating NLRP3\u0026apos;s pivotal role in governing the Th17/Treg balance. To assess the functional status of differentiated Th17/Treg cells, we quantified their signature cytokines IL-17 and IL-10 by ELISA. ELISA analysis revealed significantly higher IL-17 but lower IL-10 levels in EAM versus MCC950-treated groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01; Fig. 4c), confirming that NLRP3 activation not only promotes Th17 differentiation but also enhances their inflammatory cytokine production while suppressing Treg-associated anti-inflammatory activity. Mirroring in vivo findings, MCC950-treated cells exhibited significantly lower ROR-\u0026gamma;t (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and higher Foxp3 mRNA levels (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) versus EAM controls during CD4\u0026thinsp;+\u0026thinsp;T cell differentiation (Fig. 4d), confirming that NLRP3 intrinsically regulates Th17/Treg lineage commitment through transcriptional control in isolated naive T cells.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003ePersistent inflammatory cell infiltration, particularly Th17 cells, significantly contributes to cardiomyocyte dysfunction and the progression to chronic myocardiopathy in myocarditis [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Peripheral tolerance mechanisms regulate autoreactive T-cell activation, where Treg-mediated maintenance of immune tolerance and tissue repair alleviates inflammatory damage in autoimmune diseases [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Our study revealed peak disease activity at week 2 in EAM mice, characterized by significant Th17 cell infiltration and reduced Treg cell proportions, resulting in Th17/Treg imbalance. During progression to DCM, peripheral CD4\u0026thinsp;+\u0026thinsp;T cells predominantly exhibited Th1/Th17 phenotypes, with IL-17A playing a key pathogenic role in disease advancement[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Thus, Th17/Treg imbalance likely drives autoimmune myocarditis progression. Notably, the observed week 3 Treg cell increase in EAM group. These findings suggest that Th17/Treg imbalance critically drives the progression from acute myocarditis to chronic cardiomyopathy. Therapeutic strategies restoring this balance through Th17 suppression and Treg induction may represent a promising treatment approach.\u003c/p\u003e \u003cp\u003eThe NLRP3 inflammasome plays a well-established role in inflammatory disease pathogenesis. As an innate immune sensor, activated NLRP3 undergoes transcriptional upregulation and facilitates PYD domain interactions between NLRP3 and the adaptor protein ASC[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. ASC bridges NLRP3 and caspase-1 to form the inflammasome complex, which activates caspase-1 to process IL-1β/IL-18 for GSDMD-mediated release through pyroptosis[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Previous studies have established that the NLRP3 inflammasome promotes inflammatory cell infiltration, primarily through its downstream product IL-1β which drives inflammatory cell recruitment. [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. NLRP3 inflammasome inhibition significantly reduced myocardial inflammatory cell infiltration, with HE staining showing preserved cardiac architecture. MCC950 treatment decreased Th1/Th17 cell frequencies and IFN-γ/IL-17A levels while increasing Treg cell proportion and IL-10 production in mice[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Our findings suggest that the NLRP3 inflammasome contributes to immune dysregulation in EAM, and its inhibition plays a crucial role in myocardial repair and remodeling.\u003c/p\u003e \u003cp\u003eSun et al. demonstrated that the NLRP3 inflammasome disrupts Th17/Treg balance by promoting Th17 differentiation and inducing Treg apoptosis, while NLRP3 inhibition effectively reduces Th17 cells and prevents IL-21-mediated Treg loss[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Thus, we propose that the therapeutic effects of NLRP3 inhibition in EAM are mediated, at least in part, through restoration of Th17/Treg balance. Our data support this mechanism, showing that NLRP3 inhibition decreases myocardial Th17 infiltration and increases Treg levels in EAM, with progressive Th17 decline and Treg expansion over time, accelerating restoration of the Th17/Treg balance in cardiac tissue. This suggests NLRP3 sustains myocardial inflammation through Th17/Treg imbalance. Existing literature reveals a feedforward loop between NLRP3 and Th17 cells: IL-1β promotes Th17 differentiation, while IL-17 upregulates NLRP3/caspase-1 in dendritic cells [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. NLRP3-derived IL-1β drives autoreactive effector T-cell proliferation, impairs FoxP3\u0026thinsp;+\u0026thinsp;Treg function and thymic development and amplifies Th17 differentiation via precursor IL-1β activation, concurrently suppressing Treg quantity and function[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. NLRP3 inflammasome activation drives IL-1β maturation, amplifying Th17 differentiation while suppressing Treg development and function.\u003c/p\u003e \u003cp\u003eTh17 and Treg cells regulate immunity and inflammation through antigen-dependent activation and cytokine-driven differentiation [\u003cspan additionalcitationids=\"CR35 CR36\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. The polarization of na\u0026iuml;ve CD4\u0026thinsp;+\u0026thinsp;T cells requires TCR signaling and lineage-specific cytokines, with RORγt (Th17) and Foxp3 (Treg) serving as master transcriptional regulators[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. IL-15 regulates the Foxp3 (Treg)/RORγt (Th17) expression balance in CD4\u0026thinsp;+\u0026thinsp;T cells, demonstrating their antagonistic roles in T cell differentiation [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In EAM, we observed that both transcription factors are initially activated, but disease progression shows divergent expression patterns: RORγt increases while Foxp3 declines, explaining sustained Th17 infiltration. MCC950 treatment normalizes this imbalance by suppressing RORγt mRNA to healthy levels while enhancing Foxp3 expression, thereby promoting Th17/Treg equilibrium. Consistent with our findings, NLRP3 inhibition similarly modulates RORγt/Foxp3 in murine asthma models [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. NLRP3 impairs Foxp3 transcriptional activity via interaction with nuclear import protein Kpna2, where NLRP3 overexpression reduces both Foxp3 expression and Treg abundance[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Concurrently, IL-1β suppresses SOCS3 (a feedback inhibitor of STAT3 tyrosine phosphorylation), thereby amplifying the magnitude and duration of STAT3 activation by Th17-polarizing cytokines and antagonizing IL-2/STAT5-mediated Th17 suppression[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Our results demonstrate that the NLRP3 inflammasome differentially regulates Th17 and Treg lineage-committing transcription factors, driving their divergent cellular frequencies.\u003c/p\u003e \u003cp\u003eTh17 and Treg cells share a common na\u0026iuml;ve CD4\u0026thinsp;+\u0026thinsp;T cell precursor with developmental plasticity. Their divergent differentiation is governed by graded TGF-β concentrations and interleukin signals that reciprocally regulate their opposing transcriptional programs[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. While sharing core signaling pathways, these subsets exhibit context-dependent interconversion under specific inflammatory conditions [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Our findings demonstrate this cellular plasticity: NLRP3 inflammasome inhibition redirects CD4\u0026thinsp;+\u0026thinsp;T cell differentiation from Th17 to Treg lineage, accompanied by a cytokine shift from IL-17 to IL-10 production. Studies demonstrate that NLRP3 inflammasome-derived IL-1β and IL-18 synergize with IL-23 to drive IL-17 production by CD4\u0026thinsp;+\u0026thinsp;αβ effector memory T cells in autoimmune pathogenesis[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. The NLRP3 inflammasome disrupts Th17/Treg balance via IL-1β-mediated STAT3 phosphorylation, driving conversion of intermediate 17\u0026thinsp;+\u0026thinsp;Treg cells into Th17 cells[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Intriguingly, recent tumor studies reveal an inflammasome-independent NLRP3 pathway that promotes Th17-to-Treg-like conversion (increased Foxp3/IL-10)[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. However, in proinflammatory milieus (high IL-1β/IL-6 e.g.), this alternative pathway may be overshadowed by canonical NLRP3 activation, exacerbating Th17 bias in EAM. MCC950 treatment reduces mature IL-1β, potentially enabling unassembled NLRP3 to facilitate Th17-to-Treg reprogramming through the non-canonical pathway. Thus, the NLRP3 inflammasome may regulate Th17/Treg balance by steering CD4\u0026thinsp;+\u0026thinsp;T cell differentiation, promoting Th17 expansion while concurrently suppressing Treg function in EAM.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, the NLRP3 inflammasome critically regulates Th17/Treg balance during EAM pathogenesis by modulating lineage-determining transcription factors (RORγt and Foxp3) to steer CD4\u0026thinsp;+\u0026thinsp;T cell differentiation. These findings nominate NLRP3 inhibition as a viable strategy for reestablishing immune homeostasis in myocarditis.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by the Natural Science Foundation of Guangxi Province, China (2020JJB140049).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design. Lijun Su carried out experiments and prepared the manuscript. Material preparation and analysis were performed by Nan Qu and Lili Chen. Yuying Lin and Huiwen Mo carried out data collection.Yanlan Huang conceived, designed, coordinated the study, and reviewed the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eShen, Y., Q. C. Kan, W. Xu, Y. W. Chu, and S. D. Xiong. 2009. Coxsackievirus B3 infection induced viral myocarditis by regulating the expression pattern of chemokines in cardiac myocytes. \u003cem\u003eIran J Allergy Asthma Immunol\u003c/em\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLasrado, N., and J. Reddy. 2020. An overview of the immune mechanisms of viral myocarditis. \u003cem\u003eReviews In Medical Virology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/rmv.2131\u003c/span\u003e\u003cspan address=\"10.1002/rmv.2131\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, Y., X. Zhou, S. Chen, X. Sun, and C. Zhou. 2023. Immune mechanisms of group B coxsackievirus induced viral myocarditis. \u003cem\u003eVirulence\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/21505594.2023.2180951\u003c/span\u003e\u003cspan address=\"10.1080/21505594.2023.2180951\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerry, S. P. D., C. Dossou, A. Kashif, N. Sharifinejad, G. Azizi, H. Hamedifar, A. Sabzvari, and Z. Zian. 2022. The role of IL-17 and anti-IL-17 agents in the immunopathogenesis and management of autoimmune and inflammatory diseases. \u003cem\u003eInternational Immunopharmacology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.intimp.2021.108402\u003c/span\u003e\u003cspan address=\"10.1016/j.intimp.2021.108402\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYasuda, K., Y. Takeuchi, and K. Hirota. 2019. The pathogenicity of Th17 cells in autoimmune diseases. \u003cem\u003eSeminars In Immunopathology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00281-019-00733-8\u003c/span\u003e\u003cspan address=\"10.1007/s00281-019-00733-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu, S., and Y. Qian. 2012. IL-17/IL-17 receptor system in autoimmune disease: mechanisms and therapeutic potential. \u003cem\u003eClin Sci (Lond)\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1042/cs20110496\u003c/span\u003e\u003cspan address=\"10.1042/cs20110496\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePan, Y., Y. Wu, Y. Liu, P. Wang, H. Huang, J. Jin, Y. Fang, S. Huang, Z. Fan, and H. Yu. 2024. Long non-coding RNA ENSMUST00000197208 promotes a shift in the Th17/Treg ratio via the P2X7R-NLRP3 inflammasome axis in collagen-induced arthritis. \u003cem\u003eImmunologic Research\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12026-023-09439-4\u003c/span\u003e\u003cspan address=\"10.1007/s12026-023-09439-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, X., J. Chen, S. Yue, C. Zhang, J. Song, H. Liang, C. Liang, and X. Chen. 2024. NLRP3-mediated IL-1β in regulating the imbalance between Th17 and Treg in experimental autoimmune prostatitis. \u003cem\u003eScientific Reports\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-024-69512-2\u003c/span\u003e\u003cspan address=\"10.1038/s41598-024-69512-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, L., W. Hou, F. Liu, R. Zhu, A. Lv, W. Quan, and S. Mao. 2022. Blockade of NLRP3/Caspase-1/IL-1β Regulated Th17/Treg Immune Imbalance and Attenuated the Neutrophilic Airway Inflammation in an Ovalbumin-Induced Murine Model of Asthma. \u003cem\u003eJ Immunol Res\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2022/9444227\u003c/span\u003e\u003cspan address=\"10.1155/2022/9444227\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEvavold, C. L., and J. C. Kagan. 2018. How Inflammasomes Inform Adaptive Immunity. \u003cem\u003eJournal Of Molecular Biology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jmb.2017.09.019\u003c/span\u003e\u003cspan address=\"10.1016/j.jmb.2017.09.019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu, J., and H. Wu. 2023. Structural Mechanisms of NLRP3 Inflammasome Assembly and Activation. \u003cem\u003eAnnual Review Of Immunology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev-immunol-081022-021207\u003c/span\u003e\u003cspan address=\"10.1146/annurev-immunol-081022-021207\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCho, S., F. Ying, and G. Sweeney. 2023. Sterile inflammation and the NLRP3 inflammasome in cardiometabolic disease. \u003cem\u003eBiomedical Journal\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bj.2023.100624\u003c/span\u003e\u003cspan address=\"10.1016/j.bj.2023.100624\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChung, Y., S. H. Chang, G. J. Martinez, X. O. Yang, R. Nurieva, H. S. Kang, L. Ma, S. S. Watowich, A. M. Jetten, Q. Tian, and C. Dong. 2009. Critical regulation of early Th17 cell differentiation by interleukin-1 signaling. \u003cem\u003eImmunity\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.immuni.2009.02.007\u003c/span\u003e\u003cspan address=\"10.1016/j.immuni.2009.02.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng, J., X. Q. Yu, and P. H. Wang. 2019. Inflammasome activation and Th17 responses. \u003cem\u003eMolecular Immunology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.molimm.2018.12.024\u003c/span\u003e\u003cspan address=\"10.1016/j.molimm.2018.12.024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang, L., H. Wu, W. Huang, Y. Li, Y. Chen, X. Li, Z. Yao, X. Chen, X. Lai, R. Zheng, Z. Huang, X. Wu, and G. Zhang. 2023. IL-21 induces pyroptosis of Treg cells via Akt\u0026ndash;mTOR\u0026ndash;NLRP3\u0026ndash;caspase 1 axis in eosinophilic chronic rhinosinusitis. \u003cem\u003eJournal of Allergy and Clinical Immunology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jaci.2023.04.013\u003c/span\u003e\u003cspan address=\"10.1016/j.jaci.2023.04.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, K., J. Liu, J. Yue, L. Zhou, H. Mao, J. Li, Z. Sun, Z. Chen, and L. Zhang. 2024. Nlrp3 inflammasome drives regulatory T cell depletion to accelerate periapical bone erosion. \u003cem\u003eInternational Endodontic Journal\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/iej.14062\u003c/span\u003e\u003cspan address=\"10.1111/iej.14062\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang, W., B. K. Xie, P. W. Ding, M. Wang, J. Yuan, X. Cheng, and Y. H. Liao, M. Yu. 2021. Sacubitril/Valsartan Alleviates Experimental Autoimmune Myocarditis by Inhibiting Th17 Cell Differentiation Independently of the NLRP3 Inflammasome Pathway. \u003cem\u003eFrontiers In Pharmacology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphar.2021.727838\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2021.727838\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, J., F. Yang, S. Shi, X. Liu, F. Qin, X. Wei, Y. Huang, W. Liang, L. Miao, and O. Andrukhov. 2021. The Severity of CVB3-Induced Myocarditis Can Be Improved by Blocking the Orchestration of NLRP3 and Th17 in Balb/c Mice. \u003cem\u003eMediators of Inflammation\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2021/5551578\u003c/span\u003e\u003cspan address=\"10.1155/2021/5551578\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Y., B. Gao, and S. Xiong. 2014. Involvement of NLRP3 inflammasome in CVB3-induced viral myocarditis. \u003cem\u003eAmerican Journal Of Physiology Heart And Circulatory Physiology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/ajpheart.00441.2014\u003c/span\u003e\u003cspan address=\"10.1152/ajpheart.00441.2014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBao, J., T. Sun, Y. Yue, and S. Xiong. 2019. Macrophage NLRP3 inflammasome activated by CVB3 capsid proteins contributes to the development of viral myocarditis. \u003cem\u003eMolecular Immunology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.molimm.2019.07.012\u003c/span\u003e\u003cspan address=\"10.1016/j.molimm.2019.07.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, X., M. Li, Z. Chen, Y. Yu, H. Shi, Y. Yu, Y. Wang, R. Chen, and J. Ge. 2022. Mitochondrial calpain-1 activates NLRP3 inflammasome by cleaving ATP5A1 and inducing mitochondrial ROS in CVB3-induced myocarditis. \u003cem\u003eBasic Research in Cardiology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00395-022-00948-1\u003c/span\u003e\u003cspan address=\"10.1007/s00395-022-00948-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMassilamany, C., A. Gangaplara, D. Steffen, and J. Reddy. 2011. Identification of novel mimicry epitopes for cardiac myosin heavy chain-α that induce autoimmune myocarditis in A/J mice. \u003cem\u003eCellular Immunology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cellimm.2011.08.013\u003c/span\u003e\u003cspan address=\"10.1016/j.cellimm.2011.08.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKimura, A., and T. Kishimoto. 2010. IL-6: regulator of Treg/Th17 balance. \u003cem\u003eEuropean Journal Of Immunology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/eji.201040391\u003c/span\u003e\u003cspan address=\"10.1002/eji.201040391\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWen, S., L. He, Z. Zhong, R. Zhao, S. Weng, H. Mi, and F. Liu. 2021. Stigmasterol Restores the Balance of Treg/Th17 Cells by Activating the Butyrate-PPARγ Axis in Colitis. \u003cem\u003eFrontiers In Immunology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2021.741934\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2021.741934\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNindl, V., R. Maier, D. Ratering, R. De Giuli, R. Z\u0026uuml;st, V. Thiel, E. Scandella, F. Di Padova, M. Kopf, M. Rudin, T. R\u0026uuml;licke, and B. Ludewig. 2012. Cooperation of Th1 and Th17 cells determines transition from autoimmune myocarditis to dilated cardiomyopathy. \u003cem\u003eEuropean Journal Of Immunology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/eji.201142209\u003c/span\u003e\u003cspan address=\"10.1002/eji.201142209\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShao, B.-Z., Z.-Q. Xu, B.-Z. Han, D.-F. Su, and C. Liu. 2015. NLRP3 inflammasome and its inhibitors: a review. \u003cem\u003eFrontiers in Pharmacology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphar.2015.00262\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2015.00262\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu, J., and H. Wu. 2023. Structural Mechanisms of NLRP3 Inflammasome Assembly and Activation. \u003cem\u003eAnnual Review of Immunology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev-immunol-081022-021207\u003c/span\u003e\u003cspan address=\"10.1146/annurev-immunol-081022-021207\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKawaguchi, M., M. Takahashi, T. Hata, Y. Kashima, F. Usui, H. Morimoto, A. Izawa, Y. Takahashi, J. Masumoto, J. Koyama, M. Hongo, T. Noda, J. Nakayama, J. Sagara, S.i. Taniguchi, and U. Ikeda. 2011. Inflammasome activation of cardiac fibroblasts is essential for myocardial ischemia/reperfusion injury. \u003cem\u003eCirculation\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/circulationaha.110.982777\u003c/span\u003e\u003cspan address=\"10.1161/circulationaha.110.982777\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePayne, F. M., A. R. Dabb, J. C. Harrison, and I. A. Sammut. 2024. Inhibitors of NLRP3 Inflammasome Formation: A Cardioprotective Role for the Gasotransmitters Carbon Monoxide, Nitric Oxide, and Hydrogen Sulphide in Acute Myocardial Infarction. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms25179247\u003c/span\u003e\u003cspan address=\"10.3390/ijms25179247\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu, K.-Y., S. Tong, C.-Y. Wu, X.-C. Ding, J.-L. Chen, Y. Ming, and S.-H. Wang. 2020. Nlrp3 Inflammasome Inhibitor MCC950 Ameliorates Obliterative Bronchiolitis by Inhibiting Th1/Th17 Response and Promoting Treg Response After Orthotopic Tracheal Transplantation in Mice. \u003cem\u003eTransplantation\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/tp.0000000000003208\u003c/span\u003e\u003cspan address=\"10.1097/tp.0000000000003208\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun, H. G., Q. Jiang, W. J. Fan, X. Y. Shen, Z. W. Wang, and X. Wang. 2023. TAGAP activates Th17 cell differentiation by promoting RhoA and NLRP3 to accelerate rheumatoid arthritis development. \u003cem\u003eClinical And Experimental Immunology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/cei/uxad084\u003c/span\u003e\u003cspan address=\"10.1093/cei/uxad084\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eO'Sullivan, B. J., H. E. Thomas, S. Pai, P. Santamaria, Y. Iwakura, R. J. Steptoe, T. W. H. Kay, and R. Thomas. 2006. IL-1 beta breaks tolerance through expansion of CD25\u0026thinsp;+\u0026thinsp;effector T cells. \u003cem\u003eJournal of Immunology (Baltimore, Md.: 1950)\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4049/jimmunol.176.12.7278\u003c/span\u003e\u003cspan address=\"10.4049/jimmunol.176.12.7278\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNikolouli, E., Y. Elfaki, S. Herppich, C. Schelmbauer, M. Delacher, C. Falk, I. A. Mufazalov, A. Waisman, M. Feuerer, and J. Huehn. 2021. Recirculating IL-1R2\u0026thinsp;+\u0026thinsp;Tregs fine-tune intrathymic Treg development under inflammatory conditions. \u003cem\u003eCellular \u0026amp; Molecular Immunology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41423-019-0352-8\u003c/span\u003e\u003cspan address=\"10.1038/s41423-019-0352-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVeldhoen, M., R. J. Hocking, C. J. Atkins, R. M. Locksley, and B. Stockinger. 2006. TGFbeta in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells. \u003cem\u003eImmunity\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.immuni.2006.01.001\u003c/span\u003e\u003cspan address=\"10.1016/j.immuni.2006.01.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYasuda, K., Y. Takeuchi, and K. Hirota. 2019. The pathogenicity of Th17 cells in autoimmune diseases. \u003cem\u003eSeminars In Immunopathology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00281-019-00733-8\u003c/span\u003e\u003cspan address=\"10.1007/s00281-019-00733-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L. Weiner, and V. K. Kuchroo. 2006. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. \u003cem\u003eNature\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature04753\u003c/span\u003e\u003cspan address=\"10.1038/nature04753\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStockinger, B., M. Veldhoen, and B. Martin. 2007. Th17 T cells: linking innate and adaptive immunity. \u003cem\u003eSeminars In Immunology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.smim.2007.10.008\u003c/span\u003e\u003cspan address=\"10.1016/j.smim.2007.10.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamane, H., and W. E. Paul. 2013. Early signaling events that underlie fate decisions of naive CD4(+) T cells toward distinct T-helper cell subsets. \u003cem\u003eImmunological Reviews\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/imr.12032\u003c/span\u003e\u003cspan address=\"10.1111/imr.12032\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu, X., and J. Zhu. 2020. CD4 T Helper Cell Subsets and Related Human Immunological Disorders. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms21218011\u003c/span\u003e\u003cspan address=\"10.3390/ijms21218011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTosiek, M. J., L. Fiette, S. El Daker, G. Eberl, and A. A. Freitas. 2016. IL-15-dependent balance between Foxp3 and RORγt expression impacts inflammatory bowel disease. \u003cem\u003eNature Communications\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ncomms10888\u003c/span\u003e\u003cspan address=\"10.1038/ncomms10888\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark, S.-H., S. Ham, A. Lee, A. M\u0026ouml;ller, and T. S. Kim. 2019. NLRP3 negatively regulates Treg differentiation through Kpna2-mediated nuclear translocation. \u003cem\u003eThe Journal of Biological Chemistry\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.RA119.010545\u003c/span\u003e\u003cspan address=\"10.1074/jbc.RA119.010545\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBasu, R., S. K. Whitley, S. Bhaumik, C. L. Zindl, T. R. Schoeb, E. N. Benveniste, W. S. Pear, R. D. Hatton, and C. T. Weaver. 2015. IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the TH17 cell-iTreg cell balance. \u003cem\u003eNature Immunology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ni.3099\u003c/span\u003e\u003cspan address=\"10.1038/ni.3099\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee, G. R. 2018. The Balance of Th17 versus Treg Cells in Autoimmunity. \u003cem\u003eInternational Journal Of Molecular Sciences\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms19030730\u003c/span\u003e\u003cspan address=\"10.3390/ijms19030730\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKubick, N., M. Lazarczyk, N. Strzałkowska, A. Charuta, J. O. Horbańczuk, M. Sacharczuk, and M. E. Mickael. 2023. Factors regulating the differences in frequency of infiltration of Th17 and Treg of the blood-brain barrier. \u003cem\u003eImmunogenetics\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00251-023-01310-y\u003c/span\u003e\u003cspan address=\"10.1007/s00251-023-01310-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou, L., J. E. Lopes, M. M. Chong, I. I. Ivanov, R. Min, G. D. Victora, Y. Shen, J. Du, Y. P. Rubtsov, A. Y. Rudensky, S. F. Ziegler, and D. R. Littman. 2008. TGF-beta-induced Foxp3 inhibits T(H)17 cell differentiation by antagonizing RORgammat function. \u003cem\u003eNature\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature06878\u003c/span\u003e\u003cspan address=\"10.1038/nature06878\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDungan, L. S., and K. H. Mills. 2011. Caspase-1-processed IL-1 family cytokines play a vital role in driving innate IL-17. \u003cem\u003eCytokine\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cyto.2011.07.007\u003c/span\u003e\u003cspan address=\"10.1016/j.cyto.2011.07.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAccogli, T., C. Hibos, L. Milian, M. Geindreau, C. Richard, E. Humblin, R. Mary, S. Chevrier, E. Jacquin, A. Bernard, F. Chalmin, C. Paul, B. Ryffel, L. Apetoh, R. Boidot, M. Bruchard, F. Ghiringhelli, and F. Vegran. 2025. The intrinsic expression of NLRP3 in Th17 cells promotes their protumor activity and conversion into Tregs. \u003cem\u003eCellular \u0026amp; Molecular Immunology\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41423-025-01281-y\u003c/span\u003e\u003cspan address=\"10.1038/s41423-025-01281-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Autoimmune myocarditis, NLRP3 inflammasome, Th17, Treg, Balance","lastPublishedDoi":"10.21203/rs.3.rs-6771802/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6771802/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eThis study aimed to investigate whether the NLRP3 inflammasome modulates the Th17/Treg cell balance in experimental autoimmune myocarditis (EAM).\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eBALB/c mice were immunized subcutaneously with purified cardiac myosin heavy chain-α to induce EAM, injected NLRP3 inhibitor (MCC950) or PBS into the EAM mice by intraperitoneal injection. Splenic CD4⁺ T cells were isolated for in vitro culture. Myocardial inflammation was evaluated by HE staining. Th17/Treg ratios were analyzed by flow cytometry in cardiac tissue and cultured cells. RORγt and Foxp3 mRNA expression was measured by RT-PCR and IL-17/IL-10 levels by ELISA.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eOur study demonstrates that NLRP3 inhibition significantly attenuates myocardial inflammatory cell infiltration and preserves cardiac architecture in EAM mice. The EAM group exhibited significantly increased Th17/Treg ratios and RORγt mRNA expression in myocardial tissue compared to both MCC950-treated and control groups while demonstrating markedly decreased Foxp3 mRNA levels. In vitro experiments using cultured CD4\u0026thinsp;+\u0026thinsp;T cells revealed substantially higher Th17 cell proportions, RORγt expression, and IL-17 secretion in the EAM group versus MCC950-treated cells, accompanied by significantly reduced Treg cell frequencies, Foxp3 mRNA levels, and IL-10 production.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eDuring the pathogenesis of experimental autoimmune myocarditis (EAM), the NLRP3 inflammasome promotes Th17 cell differentiation while suppressing Treg cell development. Inhibition of the NLRP3 inflammasome restores the Th17/Treg balance and mitigates myocardial injury. These findings suggest that the NLRP3 inflammasome is a critical signaling hub in modulating immune responses in EAM. Targeting NLRP3 may represent a novel immunotherapeutic strategy for myocarditis.\u003c/p\u003e","manuscriptTitle":"NLRP3 Inflammasome Regulates Th17/Treg Cell Balance in Experimental Autoimmune Myocarditis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-03 10:07:43","doi":"10.21203/rs.3.rs-6771802/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"55880e6b-7b9c-4392-8ec2-26f6784321c1","owner":[],"postedDate":"June 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-06-10T16:08:42+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-03 10:07:43","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6771802","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6771802","identity":"rs-6771802","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}