PRDM15 regulates differentiation and proliferation of hematopoietic stem cells

PRDM15 regulates differentiation and proliferation of hematopoietic stem cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article PRDM15 regulates differentiation and proliferation of hematopoietic stem cells Ernesto Guccione, Nesteene Param, Alex Rialdi, Nayeli Guiterrez Trejo, and 12 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7956606/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Hematopoietic stem cells (HSCs) sustain lifelong hematopoiesis through a tightly regulated balance of self-renewal, proliferation and differentiation, particularly under stress conditions. Here, we identify PRDM15, a transcription factor with well described roles in early embryonic development, as a crucial regulator of hematopoiesis during stress responses. While PRDM15 deletion is tolerated at steady state in adult hematopoiesis, its absence severely impairs bone marrow reconstitution following transplantation, causing sustained reduction in bone marrow cellularity and differentiation blocks. Notably, PRDM15-deleted bone marrow exhibited an accumulation of stem and progenitor cells, indicating a block in lineage differentiation. Furthermore, in competitive transplantation assays, PRDM15-deficient cells were unable to compete with wild-type counterparts, demonstrating a profound loss of fitness. Transcriptomic and epigenomic analyses reveal PRDM15 as a critical regulator of differentiation and proliferation of HSCs. Mechanistically, PRDM15 directly regulates the expression of several key genes involved in proliferation and differentiation pathways, including the transcription factor Cux1 . Cux1 overexpression partially rescues colony-forming ability of PRDM15-deficient HSCs. These findings establish PRDM15 as a pivotal stress-responsive regulator of HSC differentiation and survival, with implications for therapeutic modulation of hematopoiesis. Biological sciences/Developmental biology/Haematopoiesis Biological sciences/Molecular biology/Transcriptomics Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 INTRODUCTION The tight regulation of HSCs self-renewal versus differentiation trajectories is driven by cytokine signaling 1 – 6 , transcriptional- 7–10 and metabolic- regulation 11 , 12 and is essential to ensure the production of hematopoietic cells throughout an animal’s lifespan. This regulation is dose- and context-dependent, and we have yet to identify all factors involved in this central process 13 . Several members of the PRDM (PRDI-BF1 and RIZ homology domain-containing) family have been characterized as key transcriptional regulators of hematopoiesis 14 . For instance, PRDM3 is essential for the maintenance of both fetal and adult HSCs, albeit not lineage commitment 15 . PRDM16 is a key regulator of early hematopoiesis by regulating the cell cycle and the levels of reactive oxygen species 16 , 17 . Downstream lineage commitment is also influenced by PRDMs. PRDM2, typically expressed in mature myeloid and CD34 + cells, acts as a tumor suppressor in chronic myeloid leukemia 18 . Another family member, PRDM1 (also known as BLIMP1), regulates terminal differentiation of B cells and T cells 19 – 21 . PRDM15 has been initially characterized as an essential transcription factor both for the maintenance of embryonic stem cells naïve state by modulating the MAPK-ERK and WNT pathway 22 and for developmental patterning via regulation of NOTCH and WNT/PCP pathways 23 . Notably, while PRDM15 is critical for embryogenesis, with deletion leading to embryonic lethality between E12.5 - E14.5 in the mouse 23 , its presence is dispensable in adult mice maintained in a sterile environment 24 . While PRDM15 has yet not been directly implicated in hematopoiesis, it was additionally characterized as a key factor promoting MYC-driven B cell lymphomagenesis. In B cell lymphomas, PRDM15 is required to rewire their metabolism by regulating the mTOR/PI3K pathway, and targeted PRDM15 depletion in lymphoma cells results in tumor regression 24 . Given the link between mTOR/PI3K and normal hematopoiesis 25 , we decided to specifically explore PRDM15’s role in conditions in which HSCs or progenitors would be forced to reconstitute the entire blood system 26 , 27 . To investigate this, we first deleted PRDM15 in isolated fetal liver CD34 + HSPCs, prior to transplantation into sub-lethally irradiated mice. Loss of PRDM15 led to decrease bone marrow engraftment. Next, to gain mechanistic insights we switched to murine experimental models. We transplanted PRDM15 fl/fl ;R26 cre/cre and PRDM15 fl/fl ;Vav cre bone marrow into lethally irradiated wild-type recipients. In the R26 cre/cre model, tamoxifen-induced PRDM15 deletion led to a sustained reduction in bone marrow cellularity from week 1 through week 28. Similarly, PRDM15 loss in the Vav cre model resulted in decreased CD45 + cells and reduced mature hematopoietic populations. Notably, PRDM15-deleted bone marrow exhibited an accumulation of stem and progenitor cells without changes in proliferation, indicating a block in lineage differentiation. Furthermore, in competitive transplantation assays, PRDM15-deficient cells were unable to compete with wild-type counterparts, demonstrating a functional disadvantage. Transcriptomic profiling of hematopoietic stem and progenitor cells revealed downregulation of differentiation and proliferation pathways. Cux1 , a directly bound and regulated PRDM15-target, is a transcription factor that regulates cell cycle progression 28 29 , DNA damage 30 and chromosomal stability 31 . Cux1 is also known as a key regulator of HSC quiescence and proliferation 32 – 34 . These findings establish PRDM15 as a critical regulator of hematopoiesis under proliferative stress, partially acting through transcriptional control of Cux1 in hematopoietic stem and progenitor cells. RESULTS PRDM15 deletion in human HSPCs decreases bone marrow engraftment. To investigate the role of PRDM15 in human hematopoiesis, we first examined its expression in HSCs and mature lineages 35 . PRDM15 is highly expressed in human hematopoietic cells, with increased expression in HSPCs compared to mature cells, like band cells, polymorphonuclear cells and monocytes ( Fig. 1a ). While no changes in hematopoiesis were explored or reported in human with biallelic PRDM15 loss-of-function variants, families with such mutations have been identified with Galloway-Mowat syndrome (GAMOS) or holoprosencephaly (HPE), demonstrating that loss of PRDM15 disrupts normal renal and brain development 23 , 36 . To determine if PRDM15 deletion alters HSPCs function, we isolated fetal liver CD34 + HSPCs, induced CRISPR/Cas9 mediated PRDM15 deletion and transplanted cells into sub-lethally irradiated NSG mice. Engraftment efficiency was analyzed at week 10 post-transplant ( Fig. 1b ). When PRDM15 is deleted in HSPCs, CD45 + engraftment is significantly decreased compared to wildtype control ( Fig. 1c ). PRDM15 deletion efficiency was 54.7% effective prior to xenotransplantation ( Supplementary Fig. 1a ). Levels of PRDM15 deletion decreased to an average of 21.46% suggesting that residual wildtype cells out-compete PRDM15 deficient HSPCS ( Supplementary Fig. 1b ). These findings show that PRDM15 regulates bone marrow engraftment and may play a role in hematopoietic differentiation. Having established that PRDM15 deficiency affects human hematopoietic function, we next sought to explore the underlying mechanisms of this activity using murine models. PRDM15 is required for bone marrow reconstitution and stem cell differentiation. To investigate the role of PRDM15 in murine hematopoiesis, we first examined its expression in HSCs and mature lineages. PRDM15 was ubiquitously expressed across all hematopoietic stem and progenitor cells (HSPCs) and mature counterparts with notably decreased expression in monocytes ( Supplementary Fig. 2a ). To directly asses the functional relevance of PRDM15 in hematopoiesis, we generated tamoxifen-inducible PRDM15 fl/fl ;R26 cre/cre mice and transplanted their bone marrow into lethally irradiated CD45.1 recipients ( Fig. 2a ). Following tamoxifen administration post engraftment, PRDM15 deletion resulted in significant and sustained reduction in total bone marrow cellularity from 1 to 28 weeks ( Fig. 2b ), suggesting that PRDM15 is required to maintain normal hematopoietic output. To determine whether HSPCs were affected by PRDM15 loss, we performed flow cytometry on lineage-negative (Lin-) cells 1 week post tamoxifen injection. PRDM15 deletion caused marked accumulation of LT-HSC, ST-HSC, MPPs, and GMPs ( Fig. 2c-d ), with no significant changes in CMP, MEP and CLP ( Fig. 2d and Supplementary Fig. 2b). Mature hematopoietic cells, especially granulocytes and monocytes, showed significant reductions in peripheral blood, spleen, and bone marrow ( Fig. 2e ) whereas the lymphoid and dendritic cell compartment remained unaffected ( Fig. 2f). The accumulation of HSPCs accompanied by a reduction in mature cells suggests a differentiation block, particularly within the GMP population. Gating strategy is summarized in Supplementary Fig. 2c-d. By 12 weeks post tamoxifen injection, progenitor cell frequencies returned to baseline, however reduction in the B cell and monocyte populations reflect delayed lymphoid differentiation defects ( Supplementary Fig. 2e-f ). Together, these findings demonstrate that PRDM15 is essential for proper HSPC differentiation and is required for both myeloid and lymphoid lineage generation. PRDM15 deletion impairs immune recovery after proliferative stress. Building on these observations, we examined the role of PRDM15 specifically in hematopoietic cells using the PRDM15 fl/fl ;Vav cre model, targeting PRDM15 deletion specifically to hematopoietic cells ( Fig. 3a and Supplementary Fig. 3a ). Under steady-state conditions, these mice displayed near-normal hematopoiesis, indicating PRDM15 is dispensable under homeostatic conditions ( Supplementary Fig. 3b ). However, following transplantation into irradiated hosts, PRDM15 fl/fl ;Vav cre exhibited a pronounced inability to repopulate mature immune lineages in CD45.1 hosts 4–8 weeks post transplantation compared to wildtype Vav cre ( Fig. 3b ). Specifically, Monocytes, T- and B-cells were significantly reduced at 4–8 weeks post-transplant, while neutrophils returned to baseline levels at week 8 post-transplant ( Fig. 3c). This suggest that induced proliferative stress, which we mimicked here through bone marrow transplantation, enhances PRDM15 defects. In this model, proliferative stress is sustained for 4–8 weeks post transplantation and resolves by around 12–16 weeks. In the bone marrow compartment, we enriched HSPCs by sorting for c-Kit positivity. Since c-Kit expression decreases during maturation, c-Kit + and c-Kit- fractions were analysed as enriched immature and mature populations respectively 37 . At 4 weeks post-transplant, PRDM15 fl/fl ;Vav cre exhibited increased frequencies in the LKS (comprises LT-HSC, ST-HSCs and MPPs), LT-HSC and CLP, accompanied with reduced CMPs ( Fig. 3d ). With no significant changes in ST-HSCs, MPPs, GMP and MEPs ( Supplementary Fig. 3c ) This failure in differentiation resulted in reduced total numbers of mature cells in whole blood ( Fig. 3c ) and decreased B cell frequencies in the bone marrow ( Fig. 3e ). By 16 weeks post-transplant, when proliferative stress has subsided, the effects of PRDM15 deletion on bone marrow counts are comparable to wildtype indicating that the phenotype is specific to exposure to proliferative stress ( Supplementary Fig. 3d ). Together, these results demonstrate that PRDM15 is required for efficient hematopoeitic regeneration under proliferative stress, acting to sustain proper HSPC differentiation and maturation. PRDM15 Deletion Reduces HSC Fitness Under Competitive Stress. To assess whether the observed increase in LT-HSC reflected enhanced stem cell fitness, we performed a competitive transplantation assay, in which PRDM15 fl/fl ;Vav cre (CD45.2) or Vav cre (CD45.2) cells are co transplanted with wildtype (CD45.1) cells into irradiated CD45.1/CD45.2 heterozygous mice. Peripheral blood was analyzed at weeks 4, 8 and 12 post-transplant to track the changes in CD45 levels in circulation ( Fig. 3f ). PRDM15 deletion leads to loss of competitive repopulating ability compared to wildtype cells, shown by significantly reduced bone marrow engraftment ( Fig. 3g ). These findings indicate that PRDM15 loss impairs the ability of immature hematopoietic cells to sustain competitive engraftment under stress conditions. These results highlight PRDM15 as a key regulator of hematopoietic stem cell fitness and as required for effective reconstitution. Transcriptomic Analyses Reveal Key Differentiation and Metabolic Pathways Regulated by PRDM15. PRDM15 fl/fl ;Vav cre and Vav cre bone marrow samples 4 weeks post transplantation were sorted into c-Kit + or c-Kit- cells, which enriched for immature or mature cells, respectively, and processed for RNA-sequencing. Transcriptomic analysis of these sorted hematopoietic populations revealed gene expression changes upon PRDM15 deletion ( Supplementary Fig. 4a). In c-Kit + cells, PRDM15 deletion leads to 131 upregulated genes and 43 downregulated genes ( Fig. 4a and Supplementary Table S1 ). Pathways associated with metabolism like glycolytic process through glucose 6-phosphate (e.g. Foxk1) and positive regulation of reactive oxygen species (ROS) (e.g. Lcn2) are downregulate and pathways associated with lymphocyte homeostasis, especially B cell differentiation (e.g. Rag1) are upregulated in PRDM15 depleted cells ( Fig. 4c and Supplementary Table S3 ). The mature hematopoeitic cells (i.e. c-Kit-) similarly displayed extensive gene dysregulation with 242 upregulated genes and 44 downregulated genes upon PRDM15 deletion (Fig. 4b and Supplementary Table S2 ). The pathways downregulated in the mature compartment are associated with myeloid immunity and granulocyte activation (e.g. Gata2 and Il1b) , while the upregulated genes are associated with erythrocyte development (e.g. Hba-a1 and Hbb-bs) and heme metabolic process (e.g. Hmox1) ( Fig. 4d and Supplementary Table S4 ). Together, these findings indicate that PRDM15 supports hematopoietic homeostasis by maintaining transcriptional programs required for differentiation, and metabolic balance, particularly under conditions of proliferative stress. To determine the direct targets for PRDM15 in hematopoietic cells, we performed ChIP seq (Chromatin Immunoprecipitation Sequencing) on sorted c-Kit + and c-Kit- bone marrow cells. Given that both PRDM15 fl/fl ;R26 cre/cre and PRDM15 fl/fl ;Vav cre models displayed similar phenotypes, we used bone marrow cells derived from Vav cre bone marrow cells to dissect PRDM15-dependent transcriptional regulation. We took Vav cre bone marrow cells 4 weeks after transplant to replicate the PRDM15 binding activity during proliferative stress. In c-Kit + cells, PRDM15 was bound to 109 unique genomic locations, predominantly located at gene promoter regions ( Fig. 4e,f and Supplementary Table S5 ). In c-Kit- cells, PRDM15 instead bound to 1396 unique peaks primarily promoters and distal intergenic regions (Fig. 4g,h and Supplementary Table S6). PRDM15 regulates HSC differentiation and proliferation partially through Cux1. Within the bound and regulated targets, we noted genes of interest with known activity in hematopoiesis, like Wwox, Cited2 , and Cux1 32–34,38-41 ( Fig. 5a and Supplementary Table S7 ). PRDM15 negatively regulates Wwox and PRDM15 positive regulates Cited2 and Cux1. We next decided to focus on Cux1 as an important target due to its role in quiescence and proliferation of HSCs 32 – 34 . Cux1 expression decreases after PRDM15 deletion ( Fig. 5b ) and PRDM15 binds strongly to the Cux1 promoter region which was verified by ChIP qPCR with positive and negative controls. ( Fig. 5c and Supplementary Fig. 5a-b ). To test if PRDM15 activity is associated with Cux1 , we overexpressed the full length Cux1 gene in either PRDM15 deleted or wildtype HSCs and performed a colony forming assay. Since CUX1 protein undergoes proteolytic processing to produce multiple isoforms with distinct functions 42 , we used the full-length p200 CUX1 construct, acknowledging that it will undergo proteolytic processing in cells. Our aim was to assess the overall CUX1 activity regardless of which isoform mediates the effect. After infection with lentiviral vector containing Cux1 gene and selecting for GFP positive cells, HSCs were plated into methylcellulose plates and colonies were counted after 12–14 days, as described previously 43 ( Fig. 5d ). As expected, PRDM15 deleted HSCs formed less colonies compared to wildtype HSCs (Fig. 5e ), while Cux1 overexpression, which was verified by qPCR ( Supplementary Fig. 5c ), partially rescued colony formation in PRDM15 deleted HCSs. The partial rescue is likely due to the fact that PRDM15 regulates the expression of multiple target genes known to play a role in hematopoietic cell activity (e.g. Wwox 38 , 39 , Cited2 40,41 ) , ultimately, demonstrating that PRDM15 activity in HSCs is at least partially driven by regulation of Cux1 expression. DISCUSSION Our study identifies PRDM15 as an essential transcriptional regulator of HSC differentiation and survival, particularly under proliferative stress conditions such as bone marrow reconstitution. While PRDM15 appears dispensable in steady-state hematopoiesis, confirming its dispensability in adult mice 24 , proliferative demands during transplantation stress reveal its crucial role in maintaining effective lineage commitment and differentiation. Mechanistically, PRDM15 regulates key metabolic and differentiation pathways essential for proper hematopoietic regeneration. Notably, PRDM15 maintains insulin signaling and key lipid metabolic pathways, crucial to sustaining stem cell differentiation and proliferation. Disruption of these pathways likely contributes to the differentiation blockade observed in PRDM15-deficient cells. Beyond its metabolic role, PRDM15 directly regulates transcriptional programs that control quiescence and self-renewal. The identification of Cux1 as a direct transcriptional target of PRDM15 establishes a novel regulatory axis linking PRDM15 to control of quiescence and proliferation in stem cells. Downregulation of Cux1 following PRDM15 deletion may partially account for observed differentiation defects. Notably, Cux1 knockout in the mice leads to transient hematopoeitic expansion, followed by reduction of HSCs and ultimately bone marrow failure. Cux1 deletion lead to HSC exit from quiescence and HSC exhaustion 32 . In contrast, PRDM15 deletion results in reduced, but not abolished, Cux1 expression producing a milder phenotype. This partial downregulation likely preserves limited Cux1 activity, mitigating the extent of hematopoietic exhaustion. Furthermore, Cux1 overexpression only partially rescued colony-forming potential after PRDM15 deletion, implying that additional downstream targets contribute to PRDM15-mediated regulation of hematopoiesis. Future studies should explore these targets to better define PRDM15’s broader regulatory network. For example, Cited2 may represent a key mediator, as its activity influences HSC metabolism by promoting a shift from glycolysis to oxidative phosphorylation, which is associated with HSC exit from quiescence. 44 Interestingly, CUX1 expression is also decreased in PRDM15-deficient B cell lymphoma models, where loss of PRDM15 impairs lymphomagenesis 24 . This shared regulation suggests that CUX1 acts as a downstream effector of PRDM15, linking its transcriptional control in both normal hematopoiesis and oncogenic contexts. Clinically, these findings highlight the potential implications of PRDM15 dysfunction in situations demanding rapid hematopoietic recovery, such as post-chemotherapy or post-transplantation settings. PRDM15 modulation may offer therapeutic avenues for enhancing stem cell resilience and differentiation during hematopoietic stress. In conclusion, our work underscores PRDM15’s role as a key transcription regulator, orchestrating stem cell differentiation and survival under proliferative stress, offering novel therapeutic potential for hematopoietic regeneration and disease management. METHODS Animal models and genotyping The Prdm15 fl/fl ;R26 cre/cre mice have been described in detail (Mzoughi, Nature Genetics 2017). To develop PRDM15 FF vav-cre+ animals, Prdm15 fl/fl ;R26 cre/cre was bred to remove R26 cre/cre . The resulting animals were bred with B6.Cg-Commd10 Tg(Vav1-icre)A2Kio /J (Jax: 008610) to develop Prdm15 fl/fl ;Vav cre animals. CD45.1 (B6.SJL-Ptprca Pepcb/BoyJ) and CD45.1/CD45.2 were bred in house. To genotype, tails were digested in lysis buffer (100 mM sodium chloride, 25 mM EDTA, 10 mM Tris buffer (pH 8.0), 0.5% SDS, 0.2 mg/ml Proteinase K). Following incubation at 56 °C overnight, samples were heated at 98 o C for 10 minutes and resuspended in nuclease free water. 100 ng of template DNA, 500 nM primers, and DreamTaq Green PCR master mix (Thermo Scientific #K10820) were combined for PCR. All primers are listed in Supplementary Table S8 . The following cycling conditions were used: 95 °C for 5 min; 34 cycles of 95 °C for 45 s, 60 °C for 30 s and 72 °C for 40 s; 72 °C for 5 min. Whole blood was collected by submandibular bleeds. Bleeds were performed every 4 weeks harvesting a maximum of 10% of circulating blood volume. For PRDM15 fl/fl ;R26 cre/cre experiments, 1.5mg of tamoxifen was administered intraperitoneally in adult mice (6-8weeks) for 3 consecutive days. R26 cre/cre was used as control for PRDM15 fl/fl ;R26 cre/cre and was injected with the same dose as the experimental mice. Bone Marrow and Spleen Single Cell Isolation Bone marrow was harvested by isolating the femur and the tibia. The femur and tibia are disconnected by removing the connecting cartilage. The epiphysis is moved to flush bone marrow from the medullary cavity of the femur and tibia. A 10CC syringe filled with cold DMEM with 10% FBS, 1% P/S, 1% HEPES, 1% non-essential amino acids, 1% sodium pyruvate and 0.143mM 2- β -mercaptoethanol, is used to flush bone marrow cells out of long bones. Resulting bone marrow was gently homogenized through a 70uM filter. The cells were incubated in red cell lysis buffer for 30 seconds. Cells are resuspended depending on final analysis or if cells will be used for transplantation. Spleen single cell isolation was performed by homogenizing the spleen into a 70uM cell filter with a plunger into cold PBS. After initial spin, cells were incubated in red cell lysis buffer for 30 seconds. The cells are filtered a second time with a 40uM cell filter. After the final spin, cells are resuspended depending on final analysis. Recombination PCR Recombination PCR. To confirm the deletion of the Prdm15 floxed exon (exon 4) following activation of Cre-recombinase, genomic DNA from cells was isolated using the Qiagen DNeasy blood & Tissue kit (cat. No. 69506). DNA was isolated from mouse tissues according to the genotyping protocol described above. The following primers were used for amplification: Fwd-AAGACATTGGGTGCACAG, Rev-GGCTTCTGGGGTTCACTTT. The following cycling conditions were used for PCRs: an initial incubation at 95 °C for 5 min, followed by 36 cycles of denaturation (45s at 95°C), annealing (30s at 57°C), elongation (2 min at 72 °C), and a terminal incubation at 72 °C for 7 min. KIT isolation Single cell bone marrow suspension cells were sorted into c-Kit+ and c-Kit- populations with Miltenyi Biotec Beads. CD117 MicroBeads (Catalog Number – 130-097-146) were incubated with bone marrow cells for 15 minutes at 4 o C. Spin the cells and resuspend in PBS Buffer (PBS, 0.5% FBS, 2mM EDTA). Placed Miltenyi columns in appropriate magnetic field and transferred resuspended cells into Miltenyi columns. Washed with PBS buffer until negative fraction clears columns. Removed column from magnetic field and flushed positive cells out of Miltenyi columns with PBS buffer and plunger. Mouse Bone Marrow Transplant CD45.1 animals (B6.SJL-Ptprca Pepcb/BoyJ) were pretreated with neomycin at a dose of 1mg/ml in drinking water, 1 week prior to irradiation and transplant. Animals were irradiated twice within 3-4 hours at 550 cGy and 500 cGy with a total radiation dose of 1050 cGy. 24 hours after the first dose of radiation, 5E6 of total bone marrow cells in 200ul of PBS are transplanted retro orbitally. Animals are anesthetized with isoflurane. Irradiated animals continued to be treated with neomycin for 2 weeks post-transplant, providing fresh neomycin every 2 days to ensure antibiotics are not degraded. Experimental analysis was performed after 1 month post-transplant to allow for engraftment. For competition studies, CD45.1 animals were crossed to CD45.2 B6 animals to produce CD45.1/CD45.2 heterozygotes. CD45.1/CD45.2 animals were irradiated at age 10-12 weeks old. Mice were irradiated as described above. 2.5E6 of CD45.1 WT bone marrow cells were harvested at 6-8 weeks old and combined with 2.5E6 of Prdm15 fl/fl Vav cre or Vav cre bone marrow cells. Cells were injected retro-orbitally. Experimental analysis was performed 1 month after transplantation to allow for engraftment. Blood samples were collected at weeks 4, 8, 12 and 16. Flow cytometry of whole blood, bone marrow and spleen For whole blood immunostaining, 20ul of blood whole blood were used and stained with antibody cocktail resuspended in FACS buffer (PBS, 2% FBS, 1mM EDTA). After 30 minutes of staining, blood is resuspended in eBioscience 1-step Fix/Lyse Solution (Catalog Number - 00-5333-54) for 30 minutes. Whole blood and solution were spun at 700g for 5 mins and resuspended in FACS buffer for flow cytometry acquisition. To determine absolute number of cells, Precision Count Beads (Catalog Number – 424902) were added and the published equation was used to calculate total number of cells. Single cell bone marrow and spleen samples were stained with antibody cocktail resuspended in FACS buffer for 30 minutes. The following antibodies were used: Monoclonal anti-CD11b, SuperBright 436, clone M1/70, Invitrogen, Cat# 62-0112-82 Monoclonal anti-CD8, BV510, clone 53-6.7, Biolegend, Cat# 100751 Monoclonal anti-CD19, BV570, clone 6D5, Biolegend, Cat# 115535 Monoclonal anti- I-A/I-E, BV605, clone M5/114.15.2, Biolegend, Cat# 107639 Monoclonal anti-NK1.1, BV650, clone PK136, Biolegend, Cat# 108736 Monoclonal anti-CD45, BV750, clone 30-F11, Biolegend, Cat# 103157 Monoclonal anti-CD3, Alexa Fluor 532, clone 17A2, Invitrogen, Cat# 58-0032-82 Monoclonal anti-CD4, PerCP, clone GK1.5, Biolegend, Cat# 100432 Monoclonal anti-CD11c, PerCP/Cyanine 5.5, clone N418, Biolegend, Cat# 117328 Monoclonal anti-NKp46, PE/Dazzle 594, clone 29A1.4, Biolegend, Cat# 137630 Monoclonal anti-Ly-6G, PE/Cyanine 7, clone 1A8, Biolegend, Cat # 127618 Monoclonal anti-Ki67, Alexa Fluor 700, clone B56, BD, Cat# 561277 Monoclonal anti-CD45.2, BUV661, clone 104, BD, Cat# 741516 Monoclonal anti-CD135, BV421, clone A2F10, Biolegend, Cat# 135315 Monoclonal anti-CD117, BV650, clone 2B8, Biolegend, Cat# 105853 Monoclonal anti-CD16/32. BV711, clone 93, Biolegend, Cat# 101337 Monoclonal anti-CD45.1, PerCP-Cy5.5, clone A20, Biolegend, Cat# 110727 Monoclonal anti-CD34, PE, clone HM34, Biolegend, Cat# 128609 Monoclonal anti-CD217, APC, clone PAJ-17R, Invitrogen, Cat# 17-7182-82 Monoclonal anti-Ly6A/E, BUV395, Clone D7, Invitrogen, Cat# 363-5981-82 LIVE/DEAD Fixable Dead Cell Stain Kit, Invitrogen, Cat# L23105 Centrifuge the cells after 30 minutes and incubate with 4% paraformaldehyde (PFA) for 30 minutes in room temperature. Wash the cells with FACS buffer and resuspend fixed cells in FACS buffer for acquisition. Stained samples were acquired with AuroraCS. Antibodies were titrated with splenocytes prior to experiment. RNAseq At least 500,000 cells snap-frozen bone marrow cells were used for the RNA sequencing protocol. The cells were lysed and homogenized with Trizol. The lysate was incubated and centrifuged with chloroform. After centrifuge separation, transferred aqueous upper layer into a new tube and bind RNA by adding one volume of 70% ethanol. Transferred mixture into Spin Cartridges from PureLink RNA MiniKit (Invitrogen), spin and wash the column. Performed DNase treatment by adding DNase mixture to column. After incubation columns were washed per PureLink RNA MiniKit protocol. The RNA were quantified with Qubit RNA High Sensitivity Assay (Invitrogen) and quality was determined by Agilent Tape Station. Only RNA samples with RNA Integrity Number equivalent (RIN e ) scores greater than 7 were used for further sequencing and analysis. Library preparation was per- formed following the TruSeq RNA sample preparation v2 guide (Illumina). Raw sequencing read quality was assessed using FastQC v0.11.9. Adapter trimming and removal of low-quality bases were performed with Trim Galore v0.6.6. Trimmed reads were aligned to the mouse genome GRCm39 (GENCODE v34) using the STAR aligner v2.7.10a in solo/single-cell mode, following guidelines from the Deplancke Lab GitHub repository. Gene-level count tables were generated in R using the Matrix v1.6-5 and tidyverse v2.0.0 packages and served as input for differential expression analysis with DESeq2 v1.42.1. Genes were considered differentially expressed when the adjusted p -value 0.5. Gene Set Enrichment Analysis (GSEA) was performed using the fgsea v1.28.0 package in R, ranking genes by the DESeq2 Wald statistic and testing against the GO:BP library (Gene Ontology Consortium, 2023). Plots were generated using ggplot2 v3.5.2. ChIPseq All steps of ChIP experiments were carried at 4 °C in the presence of protease inhibitors, unless stated otherwise. In brief, 10 million cells were fixed in 1% formaldehyde for 10 min at RT. The reaction was quenched by adding glycine to a final concentration of 0.125 M. The cells were washed in PBS, harvested in SDS lysis buffer and frozen at −80 °C overnight. The next day, the cells were pelleted by centrifugation, resuspended in ice-cold IP buffer and sonicated for 10 cycles of (30 s ON/60 s OFF) with Diagenode Bioruptor Homogenizer to obtain chromatin fragments of ~300–800 bp. The lysates were precleared for 4 h in a 1:1 A/G Dynabeads mix (blocked in 5 mg/ml lipid-free BSA). The beads were removed by centrifugation and samples were incubated with PRDM15 antibody with rotation overnight at 4 °C. The next day, pre-washed dynabeads were added, and the samples were incubated with rotation for 4h at 4°C. The beads were then pelleted by centrifugation and washed. The immunoprecipitated DNA was eluted in 1% SDS and 0.1 M NaHCO3, and the samples were de- crosslinked overnight at 65 °C. The eluted material was purified with MinElute PCR purification Kit (Qiagen 28804), and the DNA was resuspended in T- buffer (10 mM Tris–HCl, pH 8). ChIP qPCR was used to validate results. ChIP qPCR Cux1 Primers: Forward: GGCCGCCATCTTGAGACATA Reverse: TCAGGCTTCGGACTCCATG Spry1 Primers: (Positive Control) Forward: GGCAATCGACTTTTGTTAGAGCGT Reverse: AAACCCCTGCGTGCTGAGCACT Cad Primers: (Negative Control) Forward: GGCTGCTTGCGCCGT Reverse: CAGAGCCCTAAGCGTAGTGAGC ChIP sequencing and bioinformatics: Raw sequencing read quality was assessed using FastQC v0.11.9. Adapter trimming and removal of low-quality bases were performed using Trim Galore v0.6.6. Trimmed reads were aligned to the mouse reference genome GRCm39 (Gencode M34) using Bowtie2 v2.4.4 with default parameters. Read alignment quality was assessed using FastQC and aligned reads were filtered to retain those with MAPQ ≥20, excluding mitochondrial reads and those mapping to unplaced or random contigs, using SAMtools v1.11. PCR duplicates were removed using Picard v3.1.1. bamCoverage from deepTools v3.2.1 was used to generate normalized coverage tracks with parameters –normalizeUsingRPKM –binsize 10. Peak calling was performed using MACS3 v3.0.2 with a q-value threshold of 0.05, selected after evaluating multiple cutoffs. Peaks were called for both treatment and input samples against an IgG control. To identify treatment-specific binding events, peaks overlapping with input-derived peaks were removed. Resulting peaks were filtered against ENCODE blacklist regions for mm39 using BEDTools v2.31.0. Genomic annotation of peak regions was performed using ChIPseeker with UCSC mm39 knownGene annotations. Motif enrichment was performed using HOMER v4.10 (findMotifsGenome.pl) with default parameters. For ckit− , the analysis was restricted to the top 200 peaks ranked by fold enrichment. For ckit+ , all identified peaks were used without further subsetting. Gene Ontology (GO) enrichment analysis was carried out using the clusterProfiler 4.10.1 R package with the org.Mm.eg.db database, focusing on Biological Process terms. Results were filtered at an adjusted p -value < 0.05 using the Benjamini–Hochberg correction. Rescue Experiments with CUX1 Overexpression Rescue experiments performed with bone marrow cells from PRDM15 fl/fl Vav cre or Vav cre sorted for LKS cells. LKS cells were plated at 150,000-200,000 cells per mL in SFEM-medium with thrombopoietic (100ng/mL), SCF (100ng/mL), Flt3 ligand (50ng/mL), IL7 (50ng/mL) and 1% penicillin/streptomycin. After overnight incubation, cells were plated in RetroNectin coated plate and infected with lentivirus containing Cux1 overexpression plasmid. Plasmid procured from VectorBuilder with full length Cux1 (NM_001291233.2) overexpression controlled by EF1alpha promoter and an EGFP marker. 293T were transfected to produce lentivirus containing plasmids. Cells infected with lentivirus were sorted by GFP expression and plated in MethoCult ( M3434 ) at 5,000 cells per 3 mL split into duplicates. Colonies counted after 12-14 days. Colonies were counted by 3 separate individuals to ensure colony count trends are consistent. CUX1 overexpression was verified by qPCR (Primers listed on Supplementary Table S8 ) of methylcellulose colonies. PRDM15 Knockout in Human HSPCs Fetal liver CD34+ HSPCs were sorted and cultured 96 well round-bottom plates (VWR) for 48 hours in serum-free X-VIVO 10 medium (Lonza) supplemented with 1 % bovine serum albumin fraction V (Roche), 1x L-glutamine (Thermo Fisher), 1x penicillin-streptomycin (Thermo Fisher) and the following cytokines (Biotechne): FLT3 Ligand (100 ng/mL), G-CSF (10 ng/mL), SCF (100 ng/mL), TPO (15 ng/mL) and IL-6 (10 ng/mL)(here you can cite our recent preprint paper: PMID: 40166161). CRISPR/Cas9 RNP electroporations were performed using chemically synthesized gRNAs (IDT), recombinant Cas9 nuclease (IDT), and the 4D-Nucleofector (Lonza). For the preparation of the RNP complex, Alt-R CRISPR/Cas9 crRNA and tracrRNA (IDT) were reconstituted to a concentration of 200 μM in TE Buffer (IDT). The crRNA and tracrRNA were then mixed in a 1:1 ratio and annealed using a thermocycler at 95° C for 5 min, followed by cooling to room temperature. For each electroporation reaction, 1.2 μl of crRNA:tracrRNA complex, 1.7 μl of Cas9 protein, and 2.1 μl of PBS (Cytiva) were combined in a low-binding Eppendorf tube and incubated at room temperature for 15 min to form the complex. After incubation,1 μl of 100 μM electroporation enhancer (IDT) was added to the mixture. Pre-cultured cells were washed with pre-warmed PBS and centrifuged at 350 x g for 10 min. Approximately 2.5x10 5 cells were resuspended in 20 μl of Buffer P3 (Lonza) per reaction and added to the tube containing the CRISPR/Cas9 gRNA RNP complex. The mixture was thoroughly mixed by pipetting and then transferred to the electroporation chamber (Lonza). The cells were electroporated using the 4D-Nucleofector with the program DZ-100. Immediately following electroporation, 180 μl of pre-warmed X-VIVO 10 medium (as described above) was added to the electroporation chamber, and cells were transferred to a 96-well round-bottom plate. The electroporated cells were allowed to recover overnight at 37° C in a tissue culture incubator. Then, cells were transplanted into sublethally irradiated NSG mice via intrafemoral injection. 10 weeks post-transplantation, the mice were euthanized, and bone marrow cells were isolated. Human cells engraftment, different human cell populations were subsequently analyzed by flow cytometry. Engraftment was considered positive if the human CD45+ engraftment level in the bone marrow was greater than 1%, with the population presenting as dense clusters rather than dispersed signals. PRDM15 gRNA gRNA-1: CCCAGAAAACAGCGCCCCCG gRNA-2: CTCATGTCTTTTGAAGCTGC Control (OR2W5) gRNA gRNA-1: GACAACCAGGAGGACGCACT gRNA-2: CTCCCGGTGTGGACGTCGCA genotyping primers PRDM15-F: ACAGTCACACGACCGTATCAG PRDM15-R: TGGAAGGGGCTGTCAAGTAG OR2W5-F: TCGGCCTGGACTGGAGAAAA OR2W5-R: GAGACCACTGTGAGGTGAGA Antibodies used in this in vivo experiment: Mouse monoclonal anti-CD45, V500, clone HI30, BD, Cat#560777 Mouse monoclonal anti-CD3, FITC, clone SK7, BD, Cat#349201 Mouse monoclonal anti-CD19, PE-Cy7, clone HIB19, BD, Cat#560728 Mouse monoclonal anti-CD33, BV711, clone WM53,BD. Cat#563171 Mouse monoclonal anti-CD34, APC-Cy7, clone 581,BD, Custom conjugation Mouse monoclonal anti-CD117, APC, clone 104D2, BD, Cat#333233 Mouse monoclonal anti-CD41, PE-Cy5, clone P2, Beckman Coulter, Cat#6607116 Mouse monoclonal anti-GlyA, PE, clone KC16, Beckman Coulter, Cat# IM2211U Mouse monoclonal anti-CD71, BV650, clone L01.1, BD, Cat#745273 Declarations ACKNOWLEDGMENTS Research reported in this publication was supported by ISMMS seed fund to EG NICHD/NIH grant R01CA248984 to EG. The authors gratefully acknowledge use of the services and facilities of the Tisch Cancer Institute supported by the NCI Cancer Center Support Grant (P30 CA196521). This work was supported in part by the Bioinformatics for Next Generation Sequencing (BiNGS) shared resource facility within the Tisch Cancer Institute at the Icahn School of Medicine at Mount Sinai, which is partially supported by NIH grant P30CA196521. This work was also supported in part through the computational resources and staff expertise provided by Scientific Computing at the Icahn School of Medicine at Mount Sinai and supported by the Clinical and Translational Science Awards (CTSA) grant UL1TR004419 from the National Center for Advancing Translational Sciences. Research reported in this paper was in part supported by the Office of Research Infrastructure of the National Institutes of Health under award number S10OD026880. We are grateful to the members of the Dean’s Flow Cytometry CORE at Mount Sinai. The following figure panels were created in BioRender: 1b, 2a, 2c 3a, 3f, and 5d. Author contributions EG and NJP conceptualized the project, designed experiments and supervised research with the help of DDS. NJP and EG wrote the manuscript, with critical inputs from all authors. NJP, and KW performed the experiments and acquired the data. NJP, AR, HZ and KM prepared ChIP-seq and RNA-seq experiments and libraries. NGT and MFP performed computational and omics analysis with input from EG and NJP. DLO provided guidance for flow cytometry data collection and acquisition. All authors provided scientific input and contributed to writing the materials and methods. Competing Interests The Guccione laboratory received research funds from AZ and Prelude Therapeutics (for unrelated projects), EG is a cofounder shareholder, consultant, and advisory board member of Prometeo Therapeutics. The remaining authors declare no competing interests. References Thorén, L. A. et al. Kit regulates maintenance of quiescent hematopoietic stem cells. J Immunol 180 , 2045-2053 (2008). https://doi.org:10.4049/jimmunol.180.4.2045 Yoshihara, H. et al. Thrombopoietin/MPL signaling regulates hematopoietic stem cell quiescence and interaction with the osteoblastic niche. Cell Stem Cell 1 , 685-697 (2007). https://doi.org:10.1016/j.stem.2007.10.020 Brenet, F., Kermani, P., Spektor, R., Rafii, S. & Scandura, J. M. TGFβ restores hematopoietic homeostasis after myelosuppressive chemotherapy. J Exp Med 210 , 623-639 (2013). https://doi.org:10.1084/jem.20121610 Essers, M. A. G. et al. IFNα activates dormant haematopoietic stem cells in vivo. Nature 458 , 904-908 (2009). https://doi.org:10.1038/nature07815 Schuettpelz, L. G. et al. G-CSF regulates hematopoietic stem cell activity, in part, through activation of Toll-like receptor signaling. Leukemia 28 , 1851-1860 (2014). https://doi.org:10.1038/leu.2014.68 Maillard, I. et al. Canonical notch signaling is dispensable for the maintenance of adult hematopoietic stem cells. Cell Stem Cell 2 , 356-366 (2008). https://doi.org:10.1016/j.stem.2008.02.011 Ichikawa, M. et al. AML-1 is required for megakaryocytic maturation and lymphocytic differentiation, but not for maintenance of hematopoietic stem cells in adult hematopoiesis. Nat Med 10 , 299-304 (2004). https://doi.org:10.1038/nm997 Kataoka, K. et al. Evi1 is essential for hematopoietic stem cell self-renewal, and its expression marks hematopoietic cells with long-term multilineage repopulating activity. J Exp Med 208 , 2403-2416 (2011). https://doi.org:10.1084/jem.20110447 Dakic, A. et al. PU.1 regulates the commitment of adult hematopoietic progenitors and restricts granulopoiesis. J Exp Med 201 , 1487-1502 (2005). https://doi.org:10.1084/jem.20050075 Tothova, Z. et al. FoxOs are critical mediators of hematopoietic stem cell resistance to physiologic oxidative stress. Cell 128 , 325-339 (2007). https://doi.org:10.1016/j.cell.2007.01.003 Ito, K. & Ito, K. Hematopoietic stem cell fate through metabolic control. Exp Hematol 64 , 1-11 (2018). https://doi.org:10.1016/j.exphem.2018.05.005 Cao, J. et al. Deciphering the metabolic heterogeneity of hematopoietic stem cells with single-cell resolution. Cell Metab 36 , 209-221.e206 (2024). https://doi.org:10.1016/j.cmet.2023.12.005 Wang, Z. et al. Interplay between cofactors and transcription factors in hematopoiesis and hematological malignancies. Signal Transduction and Targeted Therapy 6 , 24 (2021). https://doi.org:10.1038/s41392-020-00422-1 Fog, C. K., Galli, G. G. & Lund, A. H. PRDM proteins: important players in differentiation and disease. Bioessays 34 , 50-60 (2012). https://doi.org:10.1002/bies.201100107 Goyama, S. et al. Evi-1 is a critical regulator for hematopoietic stem cells and transformed leukemic cells. Cell Stem Cell 3 , 207-220 (2008). https://doi.org:10.1016/j.stem.2008.06.002 Aguilo, F. et al. Prdm16 is a physiologic regulator of hematopoietic stem cells. Blood 117 , 5057-5066 (2011). https://doi.org:10.1182/blood-2010-08-300145 Chuikov, S., Levi, B. P., Smith, M. L. & Morrison, S. J. Prdm16 promotes stem cell maintenance in multiple tissues, partly by regulating oxidative stress. Nat Cell Biol 12 , 999-1006 (2010). https://doi.org:10.1038/ncb2101 Lakshmikuttyamma, A. et al. RIZ1 is potential CML tumor suppressor that is down-regulated during disease progression. J Hematol Oncol 2 , 28 (2009). https://doi.org:10.1186/1756-8722-2-28 Shaffer, A. L. et al. Blimp-1 orchestrates plasma cell differentiation by extinguishing the mature B cell gene expression program. Immunity 17 , 51-62 (2002). https://doi.org:10.1016/s1074-7613(02)00335-7 Rutishauser, R. L. et al. Transcriptional repressor Blimp-1 promotes CD8(+) T cell terminal differentiation and represses the acquisition of central memory T cell properties. Immunity 31 , 296-308 (2009). https://doi.org:10.1016/j.immuni.2009.05.014 Śledzińska, A. et al. Regulatory T Cells Restrain Interleukin-2- and Blimp-1-Dependent Acquisition of Cytotoxic Function by CD4(+) T Cells. Immunity 52 , 151-166.e156 (2020). https://doi.org:10.1016/j.immuni.2019.12.007 Mzoughi, S. et al. PRDM15 safeguards naive pluripotency by transcriptionally regulating WNT and MAPK-ERK signaling. Nat Genet 49 , 1354-1363 (2017). https://doi.org:10.1038/ng.3922 Mzoughi, S. et al. PRDM15 loss of function links NOTCH and WNT/PCP signaling to patterning defects in holoprosencephaly. Sci Adv 6 , eaax9852 (2020). https://doi.org:10.1126/sciadv.aax9852 Mzoughi, S. et al. PRDM15 is a key regulator of metabolism critical to sustain B-cell lymphomagenesis. Nat Commun 11 , 3520 (2020). https://doi.org:10.1038/s41467-020-17064-0 Martelli, A. M. et al. The emerging role of the phosphatidylinositol 3-kinase/Akt/mammalian target of rapamycin signaling network in normal myelopoiesis and leukemogenesis. Biochim Biophys Acta 1803 , 991-1002 (2010). https://doi.org:10.1016/j.bbamcr.2010.04.005 Orkin, S. H. & Zon, L. I. Hematopoiesis: an evolving paradigm for stem cell biology. Cell 132 , 631-644 (2008). https://doi.org:10.1016/j.cell.2008.01.025 Weissman, I. L. & Shizuru, J. A. The origins of the identification and isolation of hematopoietic stem cells, and their capability to induce donor-specific transplantation tolerance and treat autoimmune diseases. Blood 112 , 3543-3553 (2008). https://doi.org:10.1182/blood-2008-08-078220 Coqueret, O., Bérubé, G. & Nepveu, A. The mammalian Cut homeodomain protein functions as a cell-cycle-dependent transcriptional repressor which downmodulates p21WAF1/CIP1/SDI1 in S phase. Embo j 17 , 4680-4694 (1998). https://doi.org:10.1093/emboj/17.16.4680 Harada, R. et al. Genome-wide location analysis and expression studies reveal a role for p110 CUX1 in the activation of DNA replication genes. Nucleic Acids Res 36 , 189-202 (2008). https://doi.org:10.1093/nar/gkm970 Vadnais, C. et al. CUX1 transcription factor is required for optimal ATM/ATR-mediated responses to DNA damage. Nucleic Acids Research 40 , 4483-4495 (2012). https://doi.org:10.1093/nar/gks041 Sansregret, L. et al. Cut homeobox 1 causes chromosomal instability by promoting bipolar division after cytokinesis failure. Proceedings of the National Academy of Sciences 108 , 1949-1954 (2011). https://doi.org:doi:10.1073/pnas.1008403108 An, N. et al. Gene dosage effect of CUX1 in a murine model disrupts HSC homeostasis and controls the severity and mortality of MDS. Blood 131 , 2682-2697 (2018). https://doi.org:10.1182/blood-2017-10-810028 Martinez, T. C. et al. CUX1 restrains latent hematopoietic stem cell plasticity by suppressing stem cell-intrinsic inflammatory pathways. Blood (2025). https://doi.org:10.1182/blood.2024026815 Liu, W. et al. CUX1 regulates human hematopoietic stem cell chromatin accessibility via the BAF complex. Cell Rep 43 , 114227 (2024). https://doi.org:10.1016/j.celrep.2024.114227 Gíslason, M. H. et al. BloodSpot 3.0: a database of gene and protein expression data in normal and malignant haematopoiesis. Nucleic Acids Res 52 , D1138-d1142 (2024). https://doi.org:10.1093/nar/gkad993 Mann, N. et al. Mutations in PRDM15 Are a Novel Cause of Galloway-Mowat Syndrome. J Am Soc Nephrol 32 , 580-596 (2021). https://doi.org:10.1681/asn.2020040490 Miettinen, M. & Lasota, J. KIT (CD117): A Review on Expression in Normal and Neoplastic Tissues, and Mutations and Their Clinicopathologic Correlation. Applied Immunohistochemistry & Molecular Morphology 13 , 205-220 (2005). https://doi.org:10.1097/01.pai.0000173054.83414.22 Ludes-Meyers, J. H. et al. WWOX hypomorphic mice display a higher incidence of B-cell lymphomas and develop testicular atrophy. Genes Chromosomes Cancer 46 , 1129-1136 (2007). https://doi.org:10.1002/gcc.20497 Cui, Z. et al. The role of the WWOX gene in leukemia and its mechanisms of action. Oncol Rep 29 , 2154-2162 (2013). https://doi.org:10.3892/or.2013.2361 Lawson, H. et al. CITED2 coordinates key hematopoietic regulatory pathways to maintain the HSC pool in both steady-state hematopoiesis and transplantation. Stem Cell Reports 16 , 2784-2797 (2021). https://doi.org:10.1016/j.stemcr.2021.10.001 Chen, Y., Haviernik, P., Bunting, K. D. & Yang, Y. C. Cited2 is required for normal hematopoiesis in the murine fetal liver. Blood 110 , 2889-2898 (2007). https://doi.org:10.1182/blood-2007-01-066316 Liu, N. et al. CUX1, A Controversial Player in Tumor Development. Frontiers in Oncology Volume 10 - 2020 (2020). https://doi.org:10.3389/fonc.2020.00738 LaFleur, M. W. et al. X-CHIME enables combinatorial, inducible, lineage-specific and sequential knockout of genes in the immune system. Nature Immunology 25 , 178-188 (2024). https://doi.org:10.1038/s41590-023-01689-6 Du, J. et al. Cited2 Is Required For The Maintenance Of Glycolytic Metabolism In Adult Hematopoietic Stem Cells. Blood 122 , 794 (2013). https://doi.org:https://doi.org/10.1182/blood.V122.21.794.794 Additional Declarations Yes there is potential Competing Interest. The Guccione laboratory received research funds from AZ and Prelude Therapeutics (for unrelated projects), EG is a cofounder shareholder, consultant, and advisory board member of Prometeo Therapeutics. The remaining authors declare no competing interests. Supplementary Files SupplementalTableNJPSubmitted.xlsx Supplementary tables Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7956606","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":538169861,"identity":"e69ef7e9-db7d-49e1-8a09-bcf185c1ec1e","order_by":0,"name":"Ernesto Guccione","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9klEQVRIiWNgGAWjYBAC+wZkXgIQ80PZjA0M2IEBXCmMlmwgSQtY5AAhLdJnDz78+cOGQT4i+eGHBxV35IyvHX/86QaDjeyGA9i12PPlJRvzJKQxGN5IM5ZIOPPM2Ox2jpl0DkOaMS4tBjw8ZtIMCYcZDGfksDEkth1O3HY7h405h+FwIh4t5j9/IGmp3zw7/fHnHIb/+LSYMfAAtchLQLQkGEgDUQ7DAXxajKV50tJ4DHiegfxy2HAG2C8GycYzcXm/h8fw4w8bGzn59uSHH39UHJbnBzuswk62D4cWGOAxQFVggF85GMg3EKFoFIyCUTAKRiYAAD+tWhhUWY0vAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0001-7764-5307","institution":"Icahn School of Medicine at Mount Sinai","correspondingAuthor":true,"prefix":"","firstName":"Ernesto","middleName":"","lastName":"Guccione","suffix":""},{"id":538169862,"identity":"cdda4979-e50a-4959-aa79-4a3806d42df5","order_by":1,"name":"Nesteene Param","email":"","orcid":"","institution":"Icahn School of Medicine at Mount Sinai","correspondingAuthor":false,"prefix":"","firstName":"Nesteene","middleName":"","lastName":"Param","suffix":""},{"id":538169863,"identity":"1ef21fc4-a8da-4ca1-a541-798bc5cadd05","order_by":2,"name":"Alex Rialdi","email":"","orcid":"","institution":"Icahn School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Alex","middleName":"","lastName":"Rialdi","suffix":""},{"id":538169864,"identity":"8d7b8b9d-bd0e-47a0-b504-c1589b28ee54","order_by":3,"name":"Nayeli Guiterrez Trejo","email":"","orcid":"https://orcid.org/0000-0002-3057-8167","institution":"Icahn School of Medicine at Mount Sinai","correspondingAuthor":false,"prefix":"","firstName":"Nayeli","middleName":"Guiterrez","lastName":"Trejo","suffix":""},{"id":538169865,"identity":"8992fe46-2067-4d5c-b206-323744c2332a","order_by":4,"name":"Max Fortescue-Poole","email":"","orcid":"","institution":"Icahn School of Medicine at Mount Sinai","correspondingAuthor":false,"prefix":"","firstName":"Max","middleName":"","lastName":"Fortescue-Poole","suffix":""},{"id":538169866,"identity":"912b8393-ce17-4b7f-876e-77e1b91a9fcb","order_by":5,"name":"Ke Wang","email":"","orcid":"","institution":"Icahn School of Medicine at Mount Sinai","correspondingAuthor":false,"prefix":"","firstName":"Ke","middleName":"","lastName":"Wang","suffix":""},{"id":538169867,"identity":"37355113-7790-4500-b11d-65ff857402a1","order_by":6,"name":"Habiba Zorgati","email":"","orcid":"","institution":"Icahn School of Medicine at Mount Sinai","correspondingAuthor":false,"prefix":"","firstName":"Habiba","middleName":"","lastName":"Zorgati","suffix":""},{"id":538169868,"identity":"a26dd17b-5fd7-4918-8512-168c137328f8","order_by":7,"name":"Daniel Lozano-Ojalvo","email":"","orcid":"","institution":"INSTITUTO DE INVESTIGACION EN CIENCIAS DE LA ALIMENTACION","correspondingAuthor":false,"prefix":"","firstName":"Daniel","middleName":"","lastName":"Lozano-Ojalvo","suffix":""},{"id":538169869,"identity":"4404367d-7f2d-4250-9368-34964be789e5","order_by":8,"name":"Magan Schwarz","email":"","orcid":"","institution":"Icahn School of Medicine at Mount Sinai","correspondingAuthor":false,"prefix":"","firstName":"Magan","middleName":"","lastName":"Schwarz","suffix":""},{"id":538169870,"identity":"c8881743-38a1-4cc1-992d-78cbbbae9f09","order_by":9,"name":"Francesco Cantatore","email":"","orcid":"https://orcid.org/0000-0002-2078-0206","institution":"Icahn School of Medicine at Mount Sinai","correspondingAuthor":false,"prefix":"","firstName":"Francesco","middleName":"","lastName":"Cantatore","suffix":""},{"id":538169871,"identity":"44ecf8f6-7b32-4abf-b0c5-985a2eabaca6","order_by":10,"name":"Frank Fonseca","email":"","orcid":"","institution":"Icahn School of Medicine at Mount Sinai","correspondingAuthor":false,"prefix":"","firstName":"Frank","middleName":"","lastName":"Fonseca","suffix":""},{"id":538169872,"identity":"5c6211e9-a808-4a09-aa60-c00f04ea7a2e","order_by":11,"name":"Kensey Portman","email":"","orcid":"","institution":"Icahn School of Medicine at Mount Sinai","correspondingAuthor":false,"prefix":"","firstName":"Kensey","middleName":"","lastName":"Portman","suffix":""},{"id":538169873,"identity":"0d8c0b7b-28e0-49dc-bd37-a914cdcd8743","order_by":12,"name":"Kevin Mohammed","email":"","orcid":"","institution":"Icahn School of Medicine at Mount Sinai","correspondingAuthor":false,"prefix":"","firstName":"Kevin","middleName":"","lastName":"Mohammed","suffix":""},{"id":538169874,"identity":"7b077a34-c2f2-4a9b-b206-e47a604d401d","order_by":13,"name":"David Dominguez-sola","email":"","orcid":"https://orcid.org/0000-0001-9569-8402","institution":"Icahn School of Medicine at Mount Sinai","correspondingAuthor":false,"prefix":"","firstName":"David","middleName":"","lastName":"Dominguez-sola","suffix":""},{"id":538169875,"identity":"72c65e6b-3964-46ce-924d-ec2b0b00d809","order_by":14,"name":"Slim Mzoughi","email":"","orcid":"https://orcid.org/0000-0002-5158-0389","institution":"Mt Sinai","correspondingAuthor":false,"prefix":"","firstName":"Slim","middleName":"","lastName":"Mzoughi","suffix":""},{"id":538169876,"identity":"6e6657c2-815f-42d7-b3d1-89e53027aa14","order_by":15,"name":"Elvin Wagenblast","email":"","orcid":"https://orcid.org/0000-0002-0709-2759","institution":"Icahn School of Medicine at Mount Sinai","correspondingAuthor":false,"prefix":"","firstName":"Elvin","middleName":"","lastName":"Wagenblast","suffix":""}],"badges":[],"createdAt":"2025-10-27 11:52:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7956606/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7956606/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":94989260,"identity":"f0a230c3-6274-46ec-ac08-e08140f0daa2","added_by":"auto","created_at":"2025-11-03 07:12:31","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":133455,"visible":true,"origin":"","legend":"","description":"","filename":"MainPaperNJPSubmitted.docx","url":"https://assets-eu.researchsquare.com/files/rs-7956606/v1/5326cbe55f15aad96e34598a.docx"},{"id":94978008,"identity":"ae1544f6-30ab-4f05-8052-d72c05f6b77f","added_by":"auto","created_at":"2025-11-03 04:10:00","extension":"json","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15479,"visible":true,"origin":"","legend":"","description":"","filename":"NCOMMS2584937.json","url":"https://assets-eu.researchsquare.com/files/rs-7956606/v1/068c9830e5ab556416cbc02a.json"},{"id":94978010,"identity":"a6d7240c-8113-40d0-bf54-81db80450172","added_by":"auto","created_at":"2025-11-03 04:10:00","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":121689,"visible":true,"origin":"","legend":"","description":"","filename":"NCOMMS25849370enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7956606/v1/6c6f008d2de1d2da87e88619.xml"},{"id":94978015,"identity":"b0b6d5f2-928a-443f-a5d9-6777882d9be2","added_by":"auto","created_at":"2025-11-03 04:10:01","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":41695100,"visible":true,"origin":"","legend":"","description":"","filename":"MainPaperFigures20251024.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7956606/v1/a073c6fd7a1347ff1e1d1206.pdf"},{"id":94978013,"identity":"1028c7a4-f959-443c-bef6-47896b3217dd","added_by":"auto","created_at":"2025-11-03 04:10:00","extension":"xml","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":119004,"visible":true,"origin":"","legend":"","description":"","filename":"NCOMMS25849370structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7956606/v1/19f0c8ec6837b800e558f45f.xml"},{"id":94978014,"identity":"ddaf1c95-9a46-4b93-8113-f855be689ba3","added_by":"auto","created_at":"2025-11-03 04:10:00","extension":"html","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":132891,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7956606/v1/ae6628ffd87a54aaabab2fc6.html"},{"id":94978004,"identity":"e2a7e84e-6a57-45ad-9e2e-c96f732aa280","added_by":"auto","created_at":"2025-11-03 04:10:00","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":79758,"visible":true,"origin":"","legend":"\u003cp\u003ePRDM15 deletion in human HSPCs decreases bone marrow engraftment. a. PRDM15 expression in human hematopoietic\u003c/p\u003e\n\u003cp\u003ecells derived from bloodspot.eu b. Schematic for human HSPC PRDM15 deletion and xenotransplantation. c. Percent of\u003c/p\u003e\n\u003cp\u003eCD45+ engraftment in PRDM15 knockout compared to control. Unpaired t test. Error bar represent SEM. * p ≤ 0.05\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7956606/v1/9176fdd401ec036a91f6d02f.png"},{"id":94978006,"identity":"4b56b0d3-b471-48c0-9a02-917349287d6e","added_by":"auto","created_at":"2025-11-03 04:10:00","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":217515,"visible":true,"origin":"","legend":"\u003cp\u003ePRDM15 is expressed in hematopoietic stem and progenitor cells (HSPCs) and is required for complete bone\u003c/p\u003e\n\u003cp\u003emarrow reconstitution and stem cell differentiation. a. Wildtype CD45.1, 8-10 weeks old female (Host) are lethally irradiated\u003c/p\u003e\n\u003cp\u003e(1050 cGy). PRDM15fl/fl R26cre/cre or R26cre/cre females (Donor) bone marrow is transplanted into host animals retroorbitally. 1 month\u003c/p\u003e\n\u003cp\u003epost transplantation, tamoxifen is injected into host animals to induce recombination in donor bone marrow cells. Blood, spleen and\u003c/p\u003e\n\u003cp\u003ebone marrow were harvested in three timepoints, 1 week, 12 weeks and 28 weeks post tamoxifen injection. b. Bone marrow counts of\u003c/p\u003e\n\u003cp\u003ethree timepoints. 2-way anova. c. Schematic for hematopoietic development from hematopoietic stem cells (HSCs). LT-HSC (long\u003c/p\u003e\n\u003cp\u003eterm HSC), ST-HSC (short-term HSC), MPPs (multipotent progenitors), CMP (common myeliod progenitor), GMP (granulocyte-monocyte\u003c/p\u003e\n\u003cp\u003eprogenitor), MEP (megakaryocyte-erythroid progenitor), CLP (common lymphoid progenitor), Mk (megakaryocyte), RBC (red\u003c/p\u003e\n\u003cp\u003eblood cell), Neut/Eosi (Neutrophils and Eosinophils), Mono (monocytes), DC (dendritic cell), and NK (natural killer cells). d. Bone\u003c/p\u003e\n\u003cp\u003emarrow cells from reconstituted animals one week post tamoxifen injection. LT-HSC, ST-HSC, MPPs, CMP and GMP. Unpaired t-test.\u003c/p\u003e\n\u003cp\u003ee. Percentage of mature granulocytes and monocytes of whole blood, spleen, and bone marrow from PRDM15fl/fl R26cre/cre or R26cre/cre\u003c/p\u003e\n\u003cp\u003ereconstituted mice. f. Percentage of B cells, T cells and DCs in bone marrow cells, 1 week post tamoxifen. Unpaired t-test. Error bars\u003c/p\u003e\n\u003cp\u003erepresent standard error of the mean (SEM). * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7956606/v1/87a60100e863c508dae5eb64.png"},{"id":94978005,"identity":"ffbbd7e4-d4a1-40e5-85d9-a4dd73aa03bd","added_by":"auto","created_at":"2025-11-03 04:10:00","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":135006,"visible":true,"origin":"","legend":"\u003cp\u003eHematopoietic cell-specific deletion of PRDM15 causes a severe defect in bone marrow cell production and\u003c/p\u003e\n\u003cp\u003eimpairs maturation of all blood lineages. a. Wildtype CD45.1, 8-10 weeks old female (Host) are lethally irradiated (1050 cGy).\u003c/p\u003e\n\u003cp\u003ePRDM15fl/fl Vavcre or Vavcre 6-8 week old females (Donor) bone marrow is transplanted into host animals retro-orbitally b. Total counts\u003c/p\u003e\n\u003cp\u003eof CD45.2 positive cells in blood cells. Two-Way Anova. c. Total counts of whole blood at Week 4, 8, 12 and 16 in female host and\u003c/p\u003e\n\u003cp\u003edonor mice. Two-Way Anova. d. Percentage of LKS cells in CD45.2+ cells. Percentage of LT-HSC and CLP in LKS positive cells.\u003c/p\u003e\n\u003cp\u003ePercentage of CMP in LK positive cells. e. Percent of B cells in CD45.2 positive cells. Unpaired t test. f. Competition study using\u003c/p\u003e\n\u003cp\u003ePRDM15 fl/fl Vavcre or Vavcre (CD45.2 Donor) and Wildtype (CD45.1 Donor) transplanted into Wildtype (CD45.1/CD45.2 Host). g. Blood\u003c/p\u003e\n\u003cp\u003esamples analyzed for flow at Week 4, 8, and 12. Two-Way Anova. Error bars represent SEM. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001,\u003c/p\u003e\n\u003cp\u003e**** p ≤ 0.0001.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7956606/v1/173d8abf1b23bd7e55b3d039.png"},{"id":94988783,"identity":"cbee7537-cf2d-4503-a280-105af5b220de","added_by":"auto","created_at":"2025-11-03 07:10:50","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":226586,"visible":true,"origin":"","legend":"\u003cp\u003ePRDM15 deletion decreases expression of genes critical for immune differentiation and metabolism a-b. Volcano plot\u003c/p\u003e\n\u003cp\u003eof (a) cKit+ and (b) cKit- of differentially expressed genes after PRDM15 deletion 4 weeks post transplant injection. Adj p value \u0026gt;0.05\u003c/p\u003e\n\u003cp\u003eand -0.5 \u0026lt; log2FoldChange \u0026gt;0.5. c-d. Representative GSEA of PRDM15fl/fl Vavcre or Vavcre bone marrow 4 weeks post transplant in (c)\u003c/p\u003e\n\u003cp\u003ecKit+ and (d) cKit-. Red depicts downregulated and blue depicts upregulated processes. Derived from Enrichr. e-f. ChIP seq in (e) cKit+\u003c/p\u003e\n\u003cp\u003eaverage signal (top) and density plots of PRDM15 occupancy centered on peaks (bottom) and distribution of PRDM15 peaks in relation\u003c/p\u003e\n\u003cp\u003eto genes in (f) cKit+. The line plot represents the average ChIP-seq signal intensity +/- 4 kb from the peak center. g-h. ChIP seq in (g)\u003c/p\u003e\n\u003cp\u003ecKit- and distribution of PRDM15 peaks in relation to genes in (h) cKit-.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7956606/v1/7b43d163cc3ddcc957c06534.png"},{"id":94978011,"identity":"53c8de6a-dff0-4238-8ed7-d3e5169f09b6","added_by":"auto","created_at":"2025-11-03 04:10:00","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":143820,"visible":true,"origin":"","legend":"\u003cp\u003ePRDM15 regulates HSC differentiation and proliferation partially through Cux1. a, Heatmap of all deregulated genes\u003c/p\u003e\n\u003cp\u003eranked from most upregulated to most downregulated after PDRM15 deletion. Black lines indicate PRDM15 binding, highlight\u003c/p\u003e\n\u003cp\u003egenes noted to play a role in hematopoiesis. b. Cux1 relative RNA expression in Vavcre and PRDM15fl/fl Vavcre. c. PRDM15 ChIP\u003c/p\u003e\n\u003cp\u003eenrichment peaks of Cux1 promoter in cKIT+ and cKIT- bone marrow cells. d. Schematic of selection for colony forming assay.\u003c/p\u003e\n\u003cp\u003eThe bone marrow cells from PRDM15fl/fl Vavcre or Vavcre were sorted for HSCs and these HSCs were plated in media containing the\u003c/p\u003e\n\u003cp\u003ecytokines TPO, SCF, Flt3 and IL7. After cells are acclimated to media, HSCs were infected with Cux1 lentivirus overexpression\u003c/p\u003e\n\u003cp\u003evector with GFP reporter. Cells were then sorted for GFP positive and plated in methylcellulose plates. e. Total colony counts from\u003c/p\u003e\n\u003cp\u003econtrols, Vavcre and PRDM15 fl/fl Vavcre compared to Cux1 overexpression (OE) counterpart. One way anova. Error bars represent\u003c/p\u003e\n\u003cp\u003eSEM. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7956606/v1/29030efae64e2d81a0e4be18.png"},{"id":98777376,"identity":"3e38f95a-4fbc-4936-a0c5-21a0f974726b","added_by":"auto","created_at":"2025-12-22 12:26:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1919502,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7956606/v1/d6ca8948-3386-4a46-8eb6-565c577f135b.pdf"},{"id":94978007,"identity":"f1ab941e-0331-43a1-bea6-d37eddff152d","added_by":"auto","created_at":"2025-11-03 04:10:00","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":509690,"visible":true,"origin":"","legend":"Supplementary tables","description":"","filename":"SupplementalTableNJPSubmitted.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7956606/v1/7c29b964e482446c3c855f71.xlsx"}],"financialInterests":"\u003cb\u003eYes\u003c/b\u003e there is potential Competing Interest.\nThe Guccione laboratory received research funds from AZ and Prelude Therapeutics (for unrelated projects), EG is a cofounder shareholder, consultant, and advisory board member of Prometeo Therapeutics. The remaining authors declare no competing interests.","formattedTitle":"PRDM15 regulates differentiation and proliferation of hematopoietic stem cells","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eThe tight regulation of HSCs self-renewal versus differentiation trajectories is driven by cytokine signaling\u003csup\u003e\u003cspan additionalcitationids=\"CR2 CR3 CR4 CR5\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e, transcriptional-\u003csup\u003e7\u0026ndash;10\u003c/sup\u003e and metabolic- regulation\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e and is essential to ensure the production of hematopoietic cells throughout an animal\u0026rsquo;s lifespan. This regulation is dose- and context-dependent, and we have yet to identify all factors involved in this central process\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eSeveral members of the PRDM (PRDI-BF1 and RIZ homology domain-containing) family have been characterized as key transcriptional regulators of hematopoiesis\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. For instance, PRDM3 is essential for the maintenance of both fetal and adult HSCs, albeit not lineage commitment\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. PRDM16 is a key regulator of early hematopoiesis by regulating the cell cycle and the levels of reactive oxygen species\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. Downstream lineage commitment is also influenced by PRDMs. PRDM2, typically expressed in mature myeloid and CD34\u0026thinsp;+\u0026thinsp;cells, acts as a tumor suppressor in chronic myeloid leukemia\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Another family member, PRDM1 (also known as BLIMP1), regulates terminal differentiation of B cells and T cells \u003csup\u003e\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003ePRDM15 has been initially characterized as an essential transcription factor both for the maintenance of embryonic stem cells na\u0026iuml;ve state by modulating the MAPK-ERK and WNT pathway\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e and for developmental patterning via regulation of NOTCH and WNT/PCP pathways\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Notably, while PRDM15 is critical for embryogenesis, with deletion leading to embryonic lethality between E12.5 - E14.5 in the mouse\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e, its presence is dispensable in adult mice maintained in a sterile environment\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eWhile PRDM15 has yet not been directly implicated in hematopoiesis, it was additionally characterized as a key factor promoting MYC-driven B cell lymphomagenesis. In B cell lymphomas, PRDM15 is required to rewire their metabolism by regulating the mTOR/PI3K pathway, and targeted PRDM15 depletion in lymphoma cells results in tumor regression\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eGiven the link between mTOR/PI3K and normal hematopoiesis\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e, we decided to specifically explore PRDM15\u0026rsquo;s role in conditions in which HSCs or progenitors would be forced to reconstitute the entire blood system\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e,\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. To investigate this, we first deleted PRDM15 in isolated fetal liver CD34\u0026thinsp;+\u0026thinsp;HSPCs, prior to transplantation into sub-lethally irradiated mice. Loss of PRDM15 led to decrease bone marrow engraftment. Next, to gain mechanistic insights we switched to murine experimental models. We transplanted PRDM15\u003csup\u003efl/fl\u003c/sup\u003e;R26\u003csup\u003ecre/cre\u003c/sup\u003e and PRDM15\u003csup\u003efl/fl\u003c/sup\u003e;Vav\u003csup\u003ecre\u003c/sup\u003e bone marrow into lethally irradiated wild-type recipients. In the R26\u003csup\u003ecre/cre\u003c/sup\u003e model, tamoxifen-induced PRDM15 deletion led to a sustained reduction in bone marrow cellularity from week 1 through week 28. Similarly, PRDM15 loss in the Vav\u003csup\u003ecre\u003c/sup\u003e model resulted in decreased CD45\u0026thinsp;+\u0026thinsp;cells and reduced mature hematopoietic populations. Notably, PRDM15-deleted bone marrow exhibited an accumulation of stem and progenitor cells without changes in proliferation, indicating a block in lineage differentiation. Furthermore, in competitive transplantation assays, PRDM15-deficient cells were unable to compete with wild-type counterparts, demonstrating a functional disadvantage. Transcriptomic profiling of hematopoietic stem and progenitor cells revealed downregulation of differentiation and proliferation pathways. \u003cem\u003eCux1\u003c/em\u003e, a directly bound and regulated PRDM15-target, is a transcription factor that regulates cell cycle progression \u003csup\u003e28 29\u003c/sup\u003e, DNA damage \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e and chromosomal stability \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003eCux1\u003c/em\u003e is also known as a key regulator of HSC quiescence and proliferation \u003csup\u003e\u003cspan additionalcitationids=\"CR33\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. These findings establish PRDM15 as a critical regulator of hematopoiesis under proliferative stress, partially acting through transcriptional control of \u003cem\u003eCux1\u003c/em\u003e in hematopoietic stem and progenitor cells.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003e\u003cb\u003ePRDM15 deletion in human HSPCs decreases bone marrow engraftment.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo investigate the role of PRDM15 in human hematopoiesis, we first examined its expression in HSCs and mature lineages\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. PRDM15 is highly expressed in human hematopoietic cells, with increased expression in HSPCs compared to mature cells, like band cells, polymorphonuclear cells and monocytes (\u003cb\u003eFig.\u0026nbsp;1a\u003c/b\u003e). While no changes in hematopoiesis were explored or reported in human with biallelic \u003cem\u003ePRDM15\u003c/em\u003e loss-of-function variants, families with such mutations have been identified with Galloway-Mowat syndrome (GAMOS) or holoprosencephaly (HPE), demonstrating that loss of PRDM15 disrupts normal renal and brain development \u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e,\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eTo determine if PRDM15 deletion alters HSPCs function, we isolated fetal liver CD34\u0026thinsp;+\u0026thinsp;HSPCs, induced CRISPR/Cas9 mediated PRDM15 deletion and transplanted cells into sub-lethally irradiated NSG mice. Engraftment efficiency was analyzed at week 10 post-transplant (\u003cb\u003eFig.\u0026nbsp;1b\u003c/b\u003e). When PRDM15 is deleted in HSPCs, CD45\u0026thinsp;+\u0026thinsp;engraftment is significantly decreased compared to wildtype control (\u003cb\u003eFig.\u0026nbsp;1c\u003c/b\u003e). PRDM15 deletion efficiency was 54.7% effective prior to xenotransplantation (\u003cb\u003eSupplementary Fig.\u0026nbsp;1a\u003c/b\u003e). Levels of PRDM15 deletion decreased to an average of 21.46% suggesting that residual wildtype cells out-compete PRDM15 deficient HSPCS (\u003cb\u003eSupplementary Fig.\u0026nbsp;1b\u003c/b\u003e). These findings show that PRDM15 regulates bone marrow engraftment and may play a role in hematopoietic differentiation. Having established that PRDM15 deficiency affects human hematopoietic function, we next sought to explore the underlying mechanisms of this activity using murine models.\u003c/p\u003e\u003cp\u003e\u003cb\u003ePRDM15 is required for bone marrow reconstitution and stem cell differentiation.\u003c/b\u003e\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eTo investigate the role of PRDM15 in murine hematopoiesis, we first examined its expression in HSCs and mature lineages. PRDM15 was ubiquitously expressed across all hematopoietic stem and progenitor cells (HSPCs) and mature counterparts with notably decreased expression in monocytes (\u003cb\u003eSupplementary Fig.\u0026nbsp;2a\u003c/b\u003e).\u003c/p\u003e\u003cp\u003eTo directly asses the functional relevance of PRDM15 in hematopoiesis, we generated tamoxifen-inducible PRDM15\u003csup\u003efl/fl\u003c/sup\u003e;R26\u003csup\u003ecre/cre\u003c/sup\u003e mice and transplanted their bone marrow into lethally irradiated CD45.1 recipients (\u003cb\u003eFig.\u0026nbsp;2a\u003c/b\u003e). Following tamoxifen administration post engraftment, PRDM15 deletion resulted in significant and sustained reduction in total bone marrow cellularity from 1 to 28 weeks (\u003cb\u003eFig.\u0026nbsp;2b\u003c/b\u003e), suggesting that PRDM15 is required to maintain normal hematopoietic output.\u003c/p\u003e\u003cp\u003eTo determine whether HSPCs were affected by PRDM15 loss, we performed flow cytometry on lineage-negative (Lin-) cells 1 week post tamoxifen injection. PRDM15 deletion caused marked accumulation of LT-HSC, ST-HSC, MPPs, and GMPs (\u003cb\u003eFig.\u0026nbsp;2c-d\u003c/b\u003e), with no significant changes in CMP, MEP and CLP (\u003cb\u003eFig.\u0026nbsp;2d\u003c/b\u003e and \u003cb\u003eSupplementary Fig.\u0026nbsp;2b).\u003c/b\u003e Mature hematopoietic cells, especially granulocytes and monocytes, showed significant reductions in peripheral blood, spleen, and bone marrow (\u003cb\u003eFig.\u0026nbsp;2e\u003c/b\u003e) whereas the lymphoid and dendritic cell compartment remained unaffected (\u003cb\u003eFig.\u0026nbsp;2f).\u003c/b\u003e The accumulation of HSPCs accompanied by a reduction in mature cells suggests a differentiation block, particularly within the GMP population. Gating strategy is summarized in \u003cb\u003eSupplementary Fig.\u0026nbsp;2c-d.\u003c/b\u003e By 12 weeks post tamoxifen injection, progenitor cell frequencies returned to baseline, however reduction in the B cell and monocyte populations reflect delayed lymphoid differentiation defects (\u003cb\u003eSupplementary Fig.\u0026nbsp;2e-f\u003c/b\u003e). Together, these findings demonstrate that PRDM15 is essential for proper HSPC differentiation and is required for both myeloid and lymphoid lineage generation.\u003c/p\u003e\u003cp\u003e\u003cb\u003ePRDM15 deletion impairs immune recovery after proliferative stress.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eBuilding on these observations, we examined the role of PRDM15 specifically in hematopoietic cells using the PRDM15\u003csup\u003efl/fl\u003c/sup\u003e;Vav\u003csup\u003ecre\u003c/sup\u003e model, targeting PRDM15 deletion specifically to hematopoietic cells (\u003cb\u003eFig.\u0026nbsp;3a\u003c/b\u003e and \u003cb\u003eSupplementary Fig.\u0026nbsp;3a\u003c/b\u003e). Under steady-state conditions, these mice displayed near-normal hematopoiesis, indicating PRDM15 is dispensable under homeostatic conditions (\u003cb\u003eSupplementary Fig.\u0026nbsp;3b\u003c/b\u003e). However, following transplantation into irradiated hosts, PRDM15\u003csup\u003efl/fl\u003c/sup\u003e;Vav\u003csup\u003ecre\u003c/sup\u003e exhibited a pronounced inability to repopulate mature immune lineages in CD45.1 hosts 4\u0026ndash;8 weeks post transplantation compared to wildtype Vav\u003csup\u003ecre\u003c/sup\u003e (\u003cb\u003eFig.\u0026nbsp;3b\u003c/b\u003e). Specifically, Monocytes, T- and B-cells were significantly reduced at 4\u0026ndash;8 weeks post-transplant, while neutrophils returned to baseline levels at week 8 post-transplant (\u003cb\u003eFig.\u0026nbsp;3c).\u003c/b\u003e This suggest that induced proliferative stress, which we mimicked here through bone marrow transplantation, enhances PRDM15 defects. In this model, proliferative stress is sustained for 4\u0026ndash;8 weeks post transplantation and resolves by around 12\u0026ndash;16 weeks.\u003c/p\u003e\u003cp\u003eIn the bone marrow compartment, we enriched HSPCs by sorting for c-Kit positivity. Since c-Kit expression decreases during maturation, c-Kit\u0026thinsp;+\u0026thinsp;and c-Kit- fractions were analysed as enriched immature and mature populations respectively\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. At 4 weeks post-transplant, PRDM15\u003csup\u003efl/fl\u003c/sup\u003e;Vav\u003csup\u003ecre\u003c/sup\u003e exhibited increased frequencies in the LKS (comprises LT-HSC, ST-HSCs and MPPs), LT-HSC and CLP, accompanied with reduced CMPs (\u003cb\u003eFig.\u0026nbsp;3d\u003c/b\u003e). With no significant changes in ST-HSCs, MPPs, GMP and MEPs (\u003cb\u003eSupplementary Fig.\u0026nbsp;3c\u003c/b\u003e) This failure in differentiation resulted in reduced total numbers of mature cells in whole blood (\u003cb\u003eFig.\u0026nbsp;3c\u003c/b\u003e) and decreased B cell frequencies in the bone marrow (\u003cb\u003eFig.\u0026nbsp;3e\u003c/b\u003e). By 16 weeks post-transplant, when proliferative stress has subsided, the effects of PRDM15 deletion on bone marrow counts are comparable to wildtype indicating that the phenotype is specific to exposure to proliferative stress (\u003cb\u003eSupplementary Fig.\u0026nbsp;3d\u003c/b\u003e).\u003c/p\u003e\u003cp\u003eTogether, these results demonstrate that PRDM15 is required for efficient hematopoeitic regeneration under proliferative stress, acting to sustain proper HSPC differentiation and maturation.\u003c/p\u003e\u003cp\u003e\u003cb\u003ePRDM15 Deletion Reduces HSC Fitness Under Competitive Stress.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo assess whether the observed increase in LT-HSC reflected enhanced stem cell fitness, we performed a competitive transplantation assay, in which PRDM15\u003csup\u003efl/fl\u003c/sup\u003e;Vav\u003csup\u003ecre\u003c/sup\u003e (CD45.2) or Vav\u003csup\u003ecre\u003c/sup\u003e (CD45.2) cells are co transplanted with wildtype (CD45.1) cells into irradiated CD45.1/CD45.2 heterozygous mice. Peripheral blood was analyzed at weeks 4, 8 and 12 post-transplant to track the changes in CD45 levels in circulation (\u003cb\u003eFig.\u0026nbsp;3f\u003c/b\u003e). PRDM15 deletion leads to loss of competitive repopulating ability compared to wildtype cells, shown by significantly reduced bone marrow engraftment (\u003cb\u003eFig.\u0026nbsp;3g\u003c/b\u003e).\u003c/p\u003e\u003cp\u003eThese findings indicate that PRDM15 loss impairs the ability of immature hematopoietic cells to sustain competitive engraftment under stress conditions. These results highlight PRDM15 as a key regulator of hematopoietic stem cell fitness and as required for effective reconstitution.\u003c/p\u003e\u003cp\u003e\u003cb\u003eTranscriptomic Analyses Reveal Key Differentiation and Metabolic Pathways Regulated by PRDM15.\u003c/b\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003ePRDM15\u003csup\u003efl/fl\u003c/sup\u003e;Vav\u003csup\u003ecre\u003c/sup\u003e and Vav\u003csup\u003ecre\u003c/sup\u003e bone marrow samples 4 weeks post transplantation were sorted into c-Kit\u0026thinsp;+\u0026thinsp;or c-Kit- cells, which enriched for immature or mature cells, respectively, and processed for RNA-sequencing. Transcriptomic analysis of these sorted hematopoietic populations revealed gene expression changes upon PRDM15 deletion (\u003cb\u003eSupplementary Fig.\u0026nbsp;4a).\u003c/b\u003e In c-Kit\u0026thinsp;+\u0026thinsp;cells, PRDM15 deletion leads to 131 upregulated genes and 43 downregulated genes (\u003cb\u003eFig.\u0026nbsp;4a\u003c/b\u003e and \u003cb\u003eSupplementary Table S1\u003c/b\u003e). Pathways associated with metabolism like glycolytic process through glucose 6-phosphate (e.g. \u003cem\u003eFoxk1)\u003c/em\u003e and positive regulation of reactive oxygen species (ROS) (e.g. \u003cem\u003eLcn2)\u003c/em\u003e are downregulate and pathways associated with lymphocyte homeostasis, especially B cell differentiation (e.g. \u003cem\u003eRag1)\u003c/em\u003e are upregulated in PRDM15 depleted cells (\u003cb\u003eFig.\u0026nbsp;4c\u003c/b\u003e and \u003cb\u003eSupplementary Table S3\u003c/b\u003e). The mature hematopoeitic cells (i.e. c-Kit-) similarly displayed extensive gene dysregulation with 242 upregulated genes and 44 downregulated genes upon PRDM15 deletion \u003cb\u003e(Fig.\u0026nbsp;4b\u003c/b\u003e and \u003cb\u003eSupplementary Table S2\u003c/b\u003e). The pathways downregulated in the mature compartment are associated with myeloid immunity and granulocyte activation (e.g. \u003cem\u003eGata2 and Il1b)\u003c/em\u003e, while the upregulated genes are associated with erythrocyte development (e.g. \u003cem\u003eHba-a1 and Hbb-bs)\u003c/em\u003e and heme metabolic process (e.g. \u003cem\u003eHmox1)\u003c/em\u003e (\u003cb\u003eFig.\u0026nbsp;4d\u003c/b\u003e and \u003cb\u003eSupplementary Table S4\u003c/b\u003e). Together, these findings indicate that PRDM15 supports hematopoietic homeostasis by maintaining transcriptional programs required for differentiation, and metabolic balance, particularly under conditions of proliferative stress. To determine the direct targets for PRDM15 in hematopoietic cells, we performed ChIP seq (Chromatin Immunoprecipitation Sequencing) on sorted c-Kit\u0026thinsp;+\u0026thinsp;and c-Kit- bone marrow cells. Given that both PRDM15\u003csup\u003efl/fl\u003c/sup\u003e;R26\u003csup\u003ecre/cre\u003c/sup\u003e and PRDM15\u003csup\u003efl/fl\u003c/sup\u003e;Vav\u003csup\u003ecre\u003c/sup\u003e models displayed similar phenotypes, we used bone marrow cells derived from Vav\u003csup\u003ecre\u003c/sup\u003e bone marrow cells to dissect PRDM15-dependent transcriptional regulation. We took Vav\u003csup\u003ecre\u003c/sup\u003e bone marrow cells 4 weeks after transplant to replicate the PRDM15 binding activity during proliferative stress. In c-Kit\u0026thinsp;+\u0026thinsp;cells, PRDM15 was bound to 109 unique genomic locations, predominantly located at gene promoter regions (\u003cb\u003eFig.\u0026nbsp;4e,f\u003c/b\u003e and \u003cb\u003eSupplementary Table S5\u003c/b\u003e). In c-Kit- cells, PRDM15 instead bound to 1396 unique peaks primarily promoters and distal intergenic regions \u003cb\u003e(Fig.\u0026nbsp;4g,h\u003c/b\u003e and \u003cb\u003eSupplementary Table S6).\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003ePRDM15 regulates HSC differentiation and proliferation partially through\u003c/b\u003e \u003cb\u003eCux1.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWithin the bound and regulated targets, we noted genes of interest with known activity in hematopoiesis, like \u003cem\u003eWwox, Cited2\u003c/em\u003e, and \u003cem\u003eCux1\u003c/em\u003e\u003csup\u003e32\u0026ndash;34,38-41\u003c/sup\u003e (\u003cb\u003eFig.\u0026nbsp;5a\u003c/b\u003e and \u003cb\u003eSupplementary Table S7\u003c/b\u003e). PRDM15 negatively regulates \u003cem\u003eWwox\u003c/em\u003e and PRDM15 positive regulates \u003cem\u003eCited2\u003c/em\u003e and \u003cem\u003eCux1.\u003c/em\u003e We next decided to focus on \u003cem\u003eCux1 as\u003c/em\u003e an important target due to its role in quiescence and proliferation of HSCs \u003csup\u003e\u003cspan additionalcitationids=\"CR33\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003eCux1\u003c/em\u003e expression decreases after PRDM15 deletion (\u003cb\u003eFig.\u0026nbsp;5b\u003c/b\u003e) and PRDM15 binds strongly to the \u003cem\u003eCux1\u003c/em\u003e promoter region which was verified by ChIP qPCR with positive and negative controls. (\u003cb\u003eFig.\u0026nbsp;5c\u003c/b\u003e and \u003cb\u003eSupplementary Fig.\u0026nbsp;5a-b\u003c/b\u003e).\u003c/p\u003e\u003cp\u003eTo test if PRDM15 activity is associated with \u003cem\u003eCux1\u003c/em\u003e, we overexpressed the full length \u003cem\u003eCux1\u003c/em\u003e gene in either PRDM15 deleted or wildtype HSCs and performed a colony forming assay. Since CUX1 protein undergoes proteolytic processing to produce multiple isoforms with distinct functions\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e, we used the full-length p200 CUX1 construct, acknowledging that it will undergo proteolytic processing in cells. Our aim was to assess the overall CUX1 activity regardless of which isoform mediates the effect. After infection with lentiviral vector containing \u003cem\u003eCux1\u003c/em\u003e gene and selecting for GFP positive cells, HSCs were plated into methylcellulose plates and colonies were counted after 12\u0026ndash;14 days, as described previously\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e (\u003cb\u003eFig.\u0026nbsp;5d\u003c/b\u003e). As expected, PRDM15 deleted HSCs formed less colonies compared to wildtype HSCs \u003cb\u003e(Fig.\u0026nbsp;5e\u003c/b\u003e), while Cux1 overexpression, which was verified by qPCR (\u003cb\u003eSupplementary Fig.\u0026nbsp;5c\u003c/b\u003e), partially rescued colony formation in PRDM15 deleted HCSs. The partial rescue is likely due to the fact that PRDM15 regulates the expression of multiple target genes known to play a role in hematopoietic cell activity (e.g. \u003cem\u003eWwox\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e,\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e, \u003cem\u003eCited2\u003c/em\u003e\u003csup\u003e\u003cem\u003e40,41\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e)\u003c/em\u003e, ultimately, demonstrating that PRDM15 activity in HSCs is at least partially driven by regulation of \u003cem\u003eCux1\u003c/em\u003e expression.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eOur study identifies PRDM15 as an essential transcriptional regulator of HSC differentiation and survival, particularly under proliferative stress conditions such as bone marrow reconstitution. While PRDM15 appears dispensable in steady-state hematopoiesis, confirming its dispensability in adult mice \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e, proliferative demands during transplantation stress reveal its crucial role in maintaining effective lineage commitment and differentiation.\u003c/p\u003e\u003cp\u003eMechanistically, PRDM15 regulates key metabolic and differentiation pathways essential for proper hematopoietic regeneration. Notably, PRDM15 maintains insulin signaling and key lipid metabolic pathways, crucial to sustaining stem cell differentiation and proliferation. Disruption of these pathways likely contributes to the differentiation blockade observed in PRDM15-deficient cells.\u003c/p\u003e\u003cp\u003eBeyond its metabolic role, PRDM15 directly regulates transcriptional programs that control quiescence and self-renewal. The identification of \u003cem\u003eCux1\u003c/em\u003e as a direct transcriptional target of PRDM15 establishes a novel regulatory axis linking PRDM15 to control of quiescence and proliferation in stem cells. Downregulation of \u003cem\u003eCux1\u003c/em\u003e following PRDM15 deletion may partially account for observed differentiation defects. Notably, \u003cem\u003eCux1\u003c/em\u003e knockout in the mice leads to transient hematopoeitic expansion, followed by reduction of HSCs and ultimately bone marrow failure. \u003cem\u003eCux1\u003c/em\u003e deletion lead to HSC exit from quiescence and HSC exhaustion\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. In contrast, PRDM15 deletion results in reduced, but not abolished, \u003cem\u003eCux1\u003c/em\u003e expression producing a milder phenotype. This partial downregulation likely preserves limited Cux1 activity, mitigating the extent of hematopoietic exhaustion.\u003c/p\u003e\u003cp\u003eFurthermore, \u003cem\u003eCux1\u003c/em\u003e overexpression only partially rescued colony-forming potential after PRDM15 deletion, implying that additional downstream targets contribute to PRDM15-mediated regulation of hematopoiesis. Future studies should explore these targets to better define PRDM15\u0026rsquo;s broader regulatory network. For example, \u003cem\u003eCited2\u003c/em\u003e may represent a key mediator, as its activity influences HSC metabolism by promoting a shift from glycolysis to oxidative phosphorylation, which is associated with HSC exit from quiescence.\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e\u003cp\u003eInterestingly, CUX1 expression is also decreased in PRDM15-deficient B cell lymphoma models, where loss of PRDM15 impairs lymphomagenesis\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. This shared regulation suggests that CUX1 acts as a downstream effector of PRDM15, linking its transcriptional control in both normal hematopoiesis and oncogenic contexts.\u003c/p\u003e\u003cp\u003eClinically, these findings highlight the potential implications of PRDM15 dysfunction in situations demanding rapid hematopoietic recovery, such as post-chemotherapy or post-transplantation settings. PRDM15 modulation may offer therapeutic avenues for enhancing stem cell resilience and differentiation during hematopoietic stress.\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eIn conclusion, our work underscores PRDM15\u0026rsquo;s role as a key transcription regulator, orchestrating stem cell differentiation and survival under proliferative stress, offering novel therapeutic potential for hematopoietic regeneration and disease management.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e"},{"header":"METHODS","content":"\u003cp\u003e\u003cstrong\u003eAnimal models and genotyping\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe\u0026nbsp;Prdm15\u003csup\u003efl/fl\u003c/sup\u003e;R26\u003csup\u003ecre/cre\u0026nbsp;\u003c/sup\u003emice have been described in detail (Mzoughi, Nature Genetics 2017). To develop PRDM15 FF vav-cre+ animals, Prdm15\u003csup\u003efl/fl\u003c/sup\u003e;R26\u003csup\u003ecre/cre\u0026nbsp;\u003c/sup\u003ewas bred to remove \u003cem\u003eR26\u003c/em\u003e\u003csup\u003ecre/cre\u003c/sup\u003e\u003cem\u003e.\u0026nbsp;\u003c/em\u003eThe resulting animals were bred with \u003cem\u003eB6.Cg-Commd10\u003csup\u003eTg(Vav1-icre)A2Kio\u003c/sup\u003e/J\u0026nbsp;\u003c/em\u003e(Jax: 008610) to develop Prdm15\u003csup\u003efl/fl\u003c/sup\u003e;Vav\u003csup\u003ecre\u003c/sup\u003e animals. CD45.1 (B6.SJL-Ptprca Pepcb/BoyJ) and CD45.1/CD45.2 were bred in house.\u003c/p\u003e\n\u003cp\u003eTo genotype, tails were digested in lysis buffer (100\u0026thinsp;mM sodium chloride, 25\u0026thinsp;mM EDTA, 10\u0026thinsp;mM Tris buffer (pH 8.0), 0.5% SDS, 0.2\u0026thinsp;mg/ml Proteinase K). Following incubation at 56\u0026thinsp;\u0026deg;C overnight, samples were heated at 98\u003csup\u003eo\u003c/sup\u003eC for 10 minutes and resuspended in nuclease free water.\u003c/p\u003e\n\u003cp\u003e100\u0026thinsp;ng of template DNA, 500\u0026thinsp;nM primers, and DreamTaq Green PCR master mix (Thermo Scientific #K10820) were combined for PCR. All primers are listed in \u003cstrong\u003eSupplementary Table S8\u003c/strong\u003e. The following cycling conditions were used: 95\u0026thinsp;\u0026deg;C for 5\u0026thinsp;min; 34 cycles of 95\u0026thinsp;\u0026deg;C for 45\u0026thinsp;s, 60\u0026thinsp;\u0026deg;C for 30\u0026thinsp;s and 72\u0026thinsp;\u0026deg;C for 40\u0026thinsp;s; 72\u0026thinsp;\u0026deg;C for 5\u0026thinsp;min.\u003c/p\u003e\n\u003cp\u003eWhole blood was collected by submandibular bleeds. Bleeds were performed every 4 weeks harvesting a maximum of 10% of circulating blood volume.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor PRDM15\u003csup\u003efl/fl\u003c/sup\u003e;R26\u003csup\u003ecre/cre\u003c/sup\u003e experiments, 1.5mg of tamoxifen was administered intraperitoneally in adult mice (6-8weeks) for 3 consecutive days. R26\u003csup\u003ecre/cre\u003c/sup\u003e was used as control for PRDM15\u003csup\u003efl/fl\u003c/sup\u003e;R26\u003csup\u003ecre/cre\u003c/sup\u003e and was injected with the same dose as the experimental mice.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBone Marrow and Spleen Single Cell Isolation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBone marrow was harvested by isolating the femur and the tibia. The femur and tibia are disconnected by removing the connecting cartilage. The epiphysis is moved to flush bone marrow from the medullary cavity of the femur and tibia. A 10CC syringe filled with cold DMEM with 10% FBS, 1% P/S, 1% HEPES, 1% non-essential amino acids, 1% sodium pyruvate and 0.143mM 2- \u0026beta; -mercaptoethanol, is used to flush bone marrow cells out of long bones. Resulting bone marrow was gently homogenized through a 70uM filter. The cells were incubated in red cell lysis buffer for 30 seconds. Cells are resuspended depending on final analysis or if cells will be used for transplantation.\u003c/p\u003e\n\u003cp\u003eSpleen single cell isolation was performed by homogenizing the spleen into a 70uM cell filter with a plunger into cold PBS. After initial spin, cells were incubated in red cell lysis buffer for 30 seconds. The cells are filtered a second time with a 40uM cell filter. After the final spin, cells are resuspended depending on final analysis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRecombination PCR\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRecombination PCR. To confirm the deletion of the Prdm15 floxed exon (exon 4) following activation of Cre-recombinase, genomic DNA from cells was isolated using the Qiagen DNeasy blood \u0026amp; Tissue kit (cat. No. 69506). DNA was isolated from mouse tissues according to the genotyping protocol described above. The following primers were used for amplification:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFwd-AAGACATTGGGTGCACAG, Rev-GGCTTCTGGGGTTCACTTT. The following cycling conditions were used for PCRs: an initial incubation at 95 \u0026deg;C for 5 min, followed by 36 cycles of denaturation (45s at 95\u0026deg;C), annealing (30s at 57\u0026deg;C), elongation (2 min at 72 \u0026deg;C), and a terminal incubation at 72 \u0026deg;C for 7 min.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eKIT isolation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSingle cell bone marrow suspension cells were sorted into c-Kit+ and c-Kit- populations with Miltenyi Biotec Beads. CD117 MicroBeads (Catalog Number \u0026ndash; 130-097-146) were incubated with bone marrow cells for 15 minutes at 4\u003csup\u003eo\u003c/sup\u003eC. Spin the cells and resuspend in PBS Buffer (PBS, 0.5% FBS, 2mM EDTA). Placed Miltenyi columns in appropriate magnetic field and transferred resuspended cells into Miltenyi columns. Washed with PBS buffer until negative fraction clears columns. Removed column from magnetic field and flushed positive cells out of Miltenyi columns with PBS buffer and plunger.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMouse Bone Marrow Transplant\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCD45.1 animals (B6.SJL-Ptprca Pepcb/BoyJ) were pretreated with neomycin at a dose of 1mg/ml in drinking water, 1 week prior to irradiation and transplant. Animals were irradiated twice within 3-4 hours at 550 cGy and 500 cGy with a total radiation dose of 1050 cGy. 24 hours after the first dose of radiation, 5E6 of total bone marrow cells in 200ul of PBS are transplanted retro orbitally. Animals are anesthetized with isoflurane. Irradiated animals continued to be treated with neomycin for 2 weeks post-transplant, providing fresh neomycin every 2 days to ensure antibiotics are not degraded. Experimental analysis was performed after 1 month post-transplant to allow for engraftment.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor competition studies, CD45.1 animals were crossed to CD45.2 B6 animals to produce CD45.1/CD45.2 heterozygotes. CD45.1/CD45.2 animals were irradiated at age 10-12 weeks old. Mice were irradiated as described above. 2.5E6 of CD45.1 WT bone marrow cells were harvested at 6-8 weeks old and combined with 2.5E6 of Prdm15\u003csup\u003efl/fl\u003c/sup\u003e Vav\u003csup\u003ecre\u003c/sup\u003e or Vav\u003csup\u003ecre\u003c/sup\u003e bone marrow cells. Cells were injected retro-orbitally. Experimental analysis was performed 1 month after transplantation to allow for engraftment. Blood samples were collected at weeks 4, 8, 12 and 16.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow cytometry of whole blood, bone marrow and spleen\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor whole blood immunostaining, 20ul of blood whole blood were used and stained with antibody cocktail resuspended in FACS buffer (PBS, 2% FBS, 1mM EDTA). After 30 minutes of staining, blood is resuspended in eBioscience 1-step Fix/Lyse Solution (Catalog Number - 00-5333-54) for 30 minutes. Whole blood and solution were spun at 700g for 5 mins and resuspended in FACS buffer for flow cytometry acquisition. To determine absolute number of cells, Precision Count Beads (Catalog Number \u0026ndash; 424902) were added and the published equation was used to calculate total number of cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSingle cell bone marrow and spleen samples were stained with antibody cocktail resuspended in FACS buffer for 30 minutes. The following antibodies were used:\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-CD11b, SuperBright 436, clone M1/70, Invitrogen, Cat# 62-0112-82\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-CD8, BV510, clone 53-6.7, Biolegend, Cat# 100751\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-CD19, BV570, clone 6D5, Biolegend, Cat# 115535\u003c/p\u003e\n\u003cp\u003eMonoclonal anti- I-A/I-E, BV605, clone M5/114.15.2, Biolegend, Cat# 107639\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-NK1.1, BV650, clone PK136, Biolegend, Cat# 108736\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-CD45, BV750, clone 30-F11, Biolegend, Cat# 103157\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-CD3, Alexa Fluor 532, clone 17A2, Invitrogen, Cat# 58-0032-82\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-CD4, PerCP, clone GK1.5, Biolegend, Cat# 100432\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-CD11c, PerCP/Cyanine 5.5, clone N418, Biolegend, Cat# 117328\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-NKp46, PE/Dazzle 594, clone 29A1.4, Biolegend, Cat# 137630\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-Ly-6G, PE/Cyanine 7, clone 1A8, Biolegend, Cat # 127618\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-Ki67, Alexa Fluor 700, clone B56, BD, Cat# 561277\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-CD45.2, BUV661, clone 104, BD, Cat# 741516\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-CD135, BV421, clone A2F10, Biolegend, Cat# 135315\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-CD117, BV650, clone 2B8, Biolegend, Cat# 105853\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-CD16/32. BV711, clone 93, Biolegend, Cat# 101337\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-CD45.1, PerCP-Cy5.5, clone A20, Biolegend, Cat# 110727\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-CD34, PE, clone HM34, Biolegend, Cat# 128609\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-CD217, APC, clone PAJ-17R, Invitrogen, Cat# 17-7182-82\u003c/p\u003e\n\u003cp\u003eMonoclonal anti-Ly6A/E, BUV395, Clone D7, Invitrogen, Cat# 363-5981-82\u003c/p\u003e\n\u003cp\u003eLIVE/DEAD Fixable Dead Cell Stain Kit, Invitrogen, Cat# L23105\u003c/p\u003e\n\u003cp\u003eCentrifuge the cells after 30 minutes and incubate with 4% paraformaldehyde (PFA) for 30 minutes in room temperature. Wash the cells with FACS buffer and resuspend fixed cells in FACS buffer for acquisition. Stained samples were acquired with AuroraCS. Antibodies were titrated with splenocytes prior to experiment.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNAseq\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAt least 500,000 cells snap-frozen bone marrow cells were used for the RNA sequencing protocol. The cells were lysed and homogenized with Trizol. The lysate was incubated and centrifuged with chloroform. After centrifuge separation, transferred aqueous upper layer into a new tube and bind RNA by adding one volume of 70% ethanol. Transferred mixture into Spin Cartridges from PureLink RNA MiniKit (Invitrogen), spin and wash the column. Performed DNase treatment by adding DNase mixture to column. After incubation columns were washed per PureLink RNA MiniKit protocol. The RNA were quantified with Qubit RNA High Sensitivity Assay (Invitrogen) and quality was determined by Agilent Tape Station. Only RNA samples with RNA Integrity Number equivalent (RIN\u003csup\u003ee\u003c/sup\u003e) scores greater than 7 were used for further sequencing and analysis.\u003c/p\u003e\n\u003cp\u003eLibrary preparation was per- formed following the TruSeq RNA sample preparation v2 guide (Illumina).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eRaw sequencing read quality was assessed using FastQC v0.11.9. Adapter trimming and removal of low-quality bases were performed with Trim Galore v0.6.6. Trimmed reads were aligned to the mouse genome GRCm39 (GENCODE v34) using the STAR aligner v2.7.10a in solo/single-cell mode, following guidelines from the Deplancke Lab GitHub repository. Gene-level count tables were generated in R using the Matrix v1.6-5 and tidyverse v2.0.0 packages and served as input for differential expression analysis with DESeq2 v1.42.1. Genes were considered differentially expressed when the adjusted \u003cem\u003ep\u003c/em\u003e-value \u0026lt; 0.05 and the absolute log₂ fold change \u0026gt; 0.5. Gene Set Enrichment Analysis (GSEA) was performed using the fgsea v1.28.0 package in R, ranking genes by the DESeq2 Wald statistic and testing against the GO:BP library (Gene Ontology Consortium, 2023). Plots were generated using ggplot2 v3.5.2.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eChIPseq\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll steps of ChIP experiments were carried at 4 \u0026deg;C in the presence of protease inhibitors, unless stated otherwise. In brief, 10 million cells were fixed in 1% formaldehyde for 10 min at RT. The reaction was quenched by adding glycine to a final concentration of 0.125 M. The cells were washed in PBS, harvested in SDS lysis buffer and frozen at \u0026minus;80 \u0026deg;C overnight. The next day, the cells were pelleted by centrifugation, resuspended in ice-cold IP buffer and sonicated for 10 cycles of (30 s ON/60 s OFF) with Diagenode Bioruptor Homogenizer to obtain chromatin fragments of ~300\u0026ndash;800 bp. The lysates were precleared for 4 h in a 1:1 A/G Dynabeads mix (blocked in 5 mg/ml lipid-free BSA). The beads were removed by centrifugation and samples were incubated with PRDM15 antibody with rotation overnight at 4 \u0026deg;C. The next day, pre-washed dynabeads were added, and the samples were incubated with rotation for 4h at 4\u0026deg;C. The beads were then pelleted by centrifugation and washed. The immunoprecipitated DNA was eluted in 1% SDS and 0.1 M NaHCO3, and the samples were de- crosslinked overnight at 65 \u0026deg;C. The eluted material was purified with MinElute PCR purification Kit (Qiagen 28804), and the DNA was resuspended in T- buffer (10 mM Tris\u0026ndash;HCl, pH 8). ChIP qPCR was used to validate results.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eChIP qPCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCux1 Primers:\u003c/p\u003e\n\u003cp\u003eForward: GGCCGCCATCTTGAGACATA\u003c/p\u003e\n\u003cp\u003eReverse: TCAGGCTTCGGACTCCATG\u003c/p\u003e\n\u003cp\u003eSpry1 Primers: (Positive Control)\u003c/p\u003e\n\u003cp\u003eForward:\u0026nbsp;GGCAATCGACTTTTGTTAGAGCGT\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eReverse: AAACCCCTGCGTGCTGAGCACT\u003c/p\u003e\n\u003cp\u003eCad Primers: (Negative Control)\u003c/p\u003e\n\u003cp\u003eForward: GGCTGCTTGCGCCGT\u003c/p\u003e\n\u003cp\u003eReverse: CAGAGCCCTAAGCGTAGTGAGC\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eChIP sequencing and bioinformatics:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRaw sequencing read quality was assessed using FastQC v0.11.9. Adapter trimming and removal of low-quality bases were performed using Trim Galore v0.6.6. Trimmed reads were aligned to the mouse reference genome GRCm39 (Gencode M34) using Bowtie2 v2.4.4 with default parameters. Read alignment quality was assessed using FastQC and aligned reads were filtered to retain those with MAPQ \u0026ge;20, excluding mitochondrial reads and those mapping to unplaced or random contigs, using SAMtools v1.11. PCR duplicates were removed using Picard v3.1.1. bamCoverage from deepTools v3.2.1 was used to generate normalized coverage tracks with parameters \u0026ndash;normalizeUsingRPKM \u0026ndash;binsize 10. Peak calling was performed using MACS3 v3.0.2 with a q-value threshold of 0.05, selected after evaluating multiple cutoffs. Peaks were called for both treatment and input samples against an IgG control. To identify treatment-specific binding events, peaks overlapping with input-derived peaks were removed. Resulting peaks were filtered against ENCODE blacklist regions for mm39 using BEDTools v2.31.0. Genomic annotation of peak regions was performed using ChIPseeker with UCSC mm39 knownGene annotations. Motif enrichment was performed using HOMER v4.10 (findMotifsGenome.pl) with default parameters. For \u003cem\u003eckit\u0026minus;\u003c/em\u003e, the analysis was restricted to the top 200 peaks ranked by fold enrichment. For \u003cem\u003eckit+\u003c/em\u003e, all identified peaks were used without further subsetting. Gene Ontology (GO) enrichment analysis was carried out using the clusterProfiler 4.10.1 R package with the org.Mm.eg.db database, focusing on Biological Process terms. Results were filtered at an adjusted \u003cem\u003ep\u003c/em\u003e-value \u0026lt; 0.05 using the Benjamini\u0026ndash;Hochberg correction.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRescue Experiments with CUX1 Overexpression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRescue experiments performed with bone marrow cells from PRDM15\u003csup\u003efl/fl\u003c/sup\u003e Vav\u003csup\u003ecre\u003c/sup\u003e or Vav\u003csup\u003ecre\u003c/sup\u003e sorted for LKS cells. LKS cells were plated at 150,000-200,000 cells per mL in SFEM-medium with thrombopoietic (100ng/mL), SCF (100ng/mL), Flt3 ligand (50ng/mL), IL7 (50ng/mL) and 1% penicillin/streptomycin. After overnight incubation, cells were plated in RetroNectin coated plate and infected with lentivirus containing Cux1 overexpression plasmid. Plasmid procured from VectorBuilder with full length Cux1 (NM_001291233.2) overexpression controlled by EF1alpha promoter and an EGFP marker. 293T were transfected to produce lentivirus containing plasmids. Cells infected with lentivirus were sorted by GFP expression and plated in MethoCult (\u003cem\u003eM3434\u003cstrong\u003e)\u0026nbsp;\u003c/strong\u003e\u003c/em\u003eat 5,000 cells per 3 mL split into duplicates. Colonies counted after 12-14 days. Colonies were counted by 3 separate individuals to ensure colony count trends are consistent. CUX1 overexpression was verified by qPCR (Primers listed on \u003cstrong\u003eSupplementary Table S8\u003c/strong\u003e) of methylcellulose colonies.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePRDM15 Knockout in Human HSPCs\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFetal liver CD34+ HSPCs were sorted and cultured 96 well round-bottom plates (VWR) for 48 hours in serum-free X-VIVO 10 medium (Lonza) supplemented with 1 % bovine serum albumin fraction V (Roche), 1x L-glutamine (Thermo Fisher), 1x penicillin-streptomycin (Thermo Fisher) and the following cytokines (Biotechne): FLT3 Ligand (100 ng/mL), G-CSF (10 ng/mL), SCF (100 ng/mL), TPO (15 ng/mL) and IL-6 (10 ng/mL)(here you can cite our recent preprint paper: PMID: 40166161). CRISPR/Cas9 RNP electroporations were performed using chemically synthesized gRNAs (IDT), recombinant Cas9 nuclease (IDT), and the 4D-Nucleofector (Lonza). For the preparation of the RNP complex, Alt-R CRISPR/Cas9 crRNA and tracrRNA (IDT) were reconstituted to a concentration of 200 \u0026mu;M in TE Buffer (IDT). The crRNA and tracrRNA were then mixed in a 1:1 ratio and annealed using a thermocycler at 95\u0026deg; C for 5 min, followed by cooling to room temperature. For each electroporation reaction, 1.2 \u0026mu;l of crRNA:tracrRNA complex, 1.7 \u0026mu;l of Cas9 protein, and 2.1 \u0026mu;l of PBS (Cytiva) were combined in a low-binding Eppendorf tube and incubated at room temperature for 15 min to form the complex. After incubation,1 \u0026mu;l of 100 \u0026mu;M electroporation enhancer (IDT) was added to the mixture.\u003c/p\u003e\n\u003cp\u003ePre-cultured cells were washed with pre-warmed PBS and centrifuged at 350 x g for 10 min. Approximately 2.5x10\u003csup\u003e5\u003c/sup\u003e cells were resuspended in 20 \u0026mu;l of Buffer P3 (Lonza) per reaction and added to the tube containing the CRISPR/Cas9 gRNA RNP complex. The mixture was thoroughly mixed by pipetting and then transferred to the electroporation chamber (Lonza). The cells were electroporated using the 4D-Nucleofector with the program DZ-100. Immediately following electroporation, 180 \u0026mu;l of pre-warmed X-VIVO 10 medium (as described above) was added to the electroporation chamber, and cells were transferred to a 96-well round-bottom plate. The electroporated cells were allowed to recover overnight at 37\u0026deg; C in a tissue culture incubator. Then, cells were transplanted into sublethally irradiated NSG mice via intrafemoral injection. 10 weeks post-transplantation, the mice were euthanized, and bone marrow cells were isolated. Human cells engraftment, different human cell populations were subsequently analyzed by flow cytometry. Engraftment was considered positive if the human CD45+ engraftment level in the bone marrow was greater than 1%, with the population presenting as dense clusters rather than dispersed signals.\u003c/p\u003e\n\u003cp\u003ePRDM15 gRNA\u003c/p\u003e\n\u003cp\u003egRNA-1: CCCAGAAAACAGCGCCCCCG\u003c/p\u003e\n\u003cp\u003egRNA-2: CTCATGTCTTTTGAAGCTGC\u003c/p\u003e\n\u003cp\u003eControl (OR2W5) gRNA\u003c/p\u003e\n\u003cp\u003egRNA-1: GACAACCAGGAGGACGCACT\u003c/p\u003e\n\u003cp\u003egRNA-2: CTCCCGGTGTGGACGTCGCA\u003c/p\u003e\n\u003cp\u003egenotyping primers\u003c/p\u003e\n\u003cp\u003ePRDM15-F: ACAGTCACACGACCGTATCAG\u003c/p\u003e\n\u003cp\u003ePRDM15-R: TGGAAGGGGCTGTCAAGTAG\u003c/p\u003e\n\u003cp\u003eOR2W5-F: TCGGCCTGGACTGGAGAAAA\u003c/p\u003e\n\u003cp\u003eOR2W5-R: GAGACCACTGTGAGGTGAGA\u003c/p\u003e\n\u003cp\u003eAntibodies used in this in vivo experiment:\u003c/p\u003e\n\u003cp\u003eMouse monoclonal anti-CD45, V500, clone HI30, BD, Cat#560777\u003c/p\u003e\n\u003cp\u003eMouse monoclonal anti-CD3, FITC, clone SK7, BD, Cat#349201\u003c/p\u003e\n\u003cp\u003eMouse monoclonal anti-CD19, PE-Cy7, clone HIB19, BD, Cat#560728\u003c/p\u003e\n\u003cp\u003eMouse monoclonal anti-CD33, BV711, clone WM53,BD. Cat#563171\u003c/p\u003e\n\u003cp\u003eMouse monoclonal anti-CD34, APC-Cy7, clone 581,BD, Custom conjugation\u003c/p\u003e\n\u003cp\u003eMouse monoclonal anti-CD117, APC, clone 104D2, BD, Cat#333233\u003c/p\u003e\n\u003cp\u003eMouse monoclonal anti-CD41, PE-Cy5, clone P2, Beckman Coulter, Cat#6607116\u003c/p\u003e\n\u003cp\u003eMouse monoclonal anti-GlyA, PE, clone KC16, Beckman Coulter, Cat# IM2211U\u003c/p\u003e\n\u003cp\u003eMouse monoclonal anti-CD71, BV650, clone L01.1, BD, Cat#745273\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eACKNOWLEDGMENTS\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eResearch reported in this publication was supported by ISMMS seed fund to EG\u0026nbsp;NICHD/NIH grant\u0026nbsp;R01CA248984 to EG. The authors gratefully acknowledge use of the services and facilities of the Tisch Cancer Institute supported by the NCI Cancer Center Support Grant (P30 CA196521). This work was supported in part by the Bioinformatics for Next Generation Sequencing (BiNGS) shared resource facility within the Tisch Cancer Institute at the Icahn School of Medicine at Mount Sinai, which is partially supported by NIH grant P30CA196521.\u0026nbsp;This work was also supported in part through the computational resources and staff expertise provided by Scientific Computing at the Icahn School of Medicine at Mount Sinai and supported by the Clinical and Translational Science Awards (CTSA) grant UL1TR004419 from the National Center for Advancing Translational Sciences. Research reported in this paper was in part supported by the Office of Research Infrastructure of the National Institutes of Health under award number S10OD026880.\u0026nbsp;We are grateful to the members of the Dean\u0026rsquo;s Flow Cytometry CORE at Mount Sinai.\u003c/p\u003e\n\u003cp\u003eThe following figure panels were\u0026nbsp;created in BioRender: 1b, 2a, 2c 3a, 3f, and 5d.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEG and NJP conceptualized the project, designed experiments and supervised research with the help of DDS. NJP and EG wrote the manuscript, with critical inputs from all authors. NJP, and KW performed the experiments and acquired the data. NJP, AR, HZ and KM prepared ChIP-seq and RNA-seq experiments and libraries. NGT and MFP performed computational and omics analysis with input from EG and NJP. DLO provided guidance for flow cytometry data collection and acquisition. All authors provided scientific input and contributed to writing the materials and methods.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Guccione laboratory received research funds from AZ and Prelude Therapeutics (for unrelated projects), EG is a cofounder shareholder, consultant, and advisory board member of Prometeo Therapeutics. The remaining authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eThor\u0026eacute;n, L. A.\u003cem\u003e et al.\u003c/em\u003e Kit regulates maintenance of quiescent hematopoietic stem cells. \u003cem\u003eJ Immunol\u003c/em\u003e \u003cstrong\u003e180\u003c/strong\u003e, 2045-2053 (2008). https://doi.org:10.4049/jimmunol.180.4.2045\u003c/li\u003e\n\u003cli\u003eYoshihara, H.\u003cem\u003e et al.\u003c/em\u003e Thrombopoietin/MPL signaling regulates hematopoietic stem cell quiescence and interaction with the osteoblastic niche. \u003cem\u003eCell Stem Cell\u003c/em\u003e \u003cstrong\u003e1\u003c/strong\u003e, 685-697 (2007). https://doi.org:10.1016/j.stem.2007.10.020\u003c/li\u003e\n\u003cli\u003eBrenet, F., Kermani, P., Spektor, R., Rafii, S. \u0026amp; Scandura, J. M. TGF\u0026beta; restores hematopoietic homeostasis after myelosuppressive chemotherapy. \u003cem\u003eJ Exp Med\u003c/em\u003e \u003cstrong\u003e210\u003c/strong\u003e, 623-639 (2013). https://doi.org:10.1084/jem.20121610\u003c/li\u003e\n\u003cli\u003eEssers, M. A. G.\u003cem\u003e et al.\u003c/em\u003e IFN\u0026alpha; activates dormant haematopoietic stem cells in vivo. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e458\u003c/strong\u003e, 904-908 (2009). https://doi.org:10.1038/nature07815\u003c/li\u003e\n\u003cli\u003eSchuettpelz, L. G.\u003cem\u003e et al.\u003c/em\u003e G-CSF regulates hematopoietic stem cell activity, in part, through activation of Toll-like receptor signaling. \u003cem\u003eLeukemia\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 1851-1860 (2014). https://doi.org:10.1038/leu.2014.68\u003c/li\u003e\n\u003cli\u003eMaillard, I.\u003cem\u003e et al.\u003c/em\u003e Canonical notch signaling is dispensable for the maintenance of adult hematopoietic stem cells. \u003cem\u003eCell Stem Cell\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 356-366 (2008). https://doi.org:10.1016/j.stem.2008.02.011\u003c/li\u003e\n\u003cli\u003eIchikawa, M.\u003cem\u003e et al.\u003c/em\u003e AML-1 is required for megakaryocytic maturation and lymphocytic differentiation, but not for maintenance of hematopoietic stem cells in adult hematopoiesis. \u003cem\u003eNat Med\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 299-304 (2004). https://doi.org:10.1038/nm997\u003c/li\u003e\n\u003cli\u003eKataoka, K.\u003cem\u003e et al.\u003c/em\u003e Evi1 is essential for hematopoietic stem cell self-renewal, and its expression marks hematopoietic cells with long-term multilineage repopulating activity. \u003cem\u003eJ Exp Med\u003c/em\u003e \u003cstrong\u003e208\u003c/strong\u003e, 2403-2416 (2011). https://doi.org:10.1084/jem.20110447\u003c/li\u003e\n\u003cli\u003eDakic, A.\u003cem\u003e et al.\u003c/em\u003e PU.1 regulates the commitment of adult hematopoietic progenitors and restricts granulopoiesis. \u003cem\u003eJ Exp Med\u003c/em\u003e \u003cstrong\u003e201\u003c/strong\u003e, 1487-1502 (2005). https://doi.org:10.1084/jem.20050075\u003c/li\u003e\n\u003cli\u003eTothova, Z.\u003cem\u003e et al.\u003c/em\u003e FoxOs are critical mediators of hematopoietic stem cell resistance to physiologic oxidative stress. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e128\u003c/strong\u003e, 325-339 (2007). https://doi.org:10.1016/j.cell.2007.01.003\u003c/li\u003e\n\u003cli\u003eIto, K. \u0026amp; Ito, K. Hematopoietic stem cell fate through metabolic control. \u003cem\u003eExp Hematol\u003c/em\u003e \u003cstrong\u003e64\u003c/strong\u003e, 1-11 (2018). https://doi.org:10.1016/j.exphem.2018.05.005\u003c/li\u003e\n\u003cli\u003eCao, J.\u003cem\u003e et al.\u003c/em\u003e Deciphering the metabolic heterogeneity of hematopoietic stem cells with single-cell resolution. \u003cem\u003eCell Metab\u003c/em\u003e \u003cstrong\u003e36\u003c/strong\u003e, 209-221.e206 (2024). https://doi.org:10.1016/j.cmet.2023.12.005\u003c/li\u003e\n\u003cli\u003eWang, Z.\u003cem\u003e et al.\u003c/em\u003e Interplay between cofactors and transcription factors in hematopoiesis and hematological malignancies. \u003cem\u003eSignal Transduction and Targeted Therapy\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 24 (2021). https://doi.org:10.1038/s41392-020-00422-1\u003c/li\u003e\n\u003cli\u003eFog, C. K., Galli, G. G. \u0026amp; Lund, A. H. PRDM proteins: important players in differentiation and disease. \u003cem\u003eBioessays\u003c/em\u003e \u003cstrong\u003e34\u003c/strong\u003e, 50-60 (2012). https://doi.org:10.1002/bies.201100107\u003c/li\u003e\n\u003cli\u003eGoyama, S.\u003cem\u003e et al.\u003c/em\u003e Evi-1 is a critical regulator for hematopoietic stem cells and transformed leukemic cells. \u003cem\u003eCell Stem Cell\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 207-220 (2008). https://doi.org:10.1016/j.stem.2008.06.002\u003c/li\u003e\n\u003cli\u003eAguilo, F.\u003cem\u003e et al.\u003c/em\u003e Prdm16 is a physiologic regulator of hematopoietic stem cells. \u003cem\u003eBlood\u003c/em\u003e \u003cstrong\u003e117\u003c/strong\u003e, 5057-5066 (2011). https://doi.org:10.1182/blood-2010-08-300145\u003c/li\u003e\n\u003cli\u003eChuikov, S., Levi, B. P., Smith, M. L. \u0026amp; Morrison, S. J. Prdm16 promotes stem cell maintenance in multiple tissues, partly by regulating oxidative stress. \u003cem\u003eNat Cell Biol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 999-1006 (2010). https://doi.org:10.1038/ncb2101\u003c/li\u003e\n\u003cli\u003eLakshmikuttyamma, A.\u003cem\u003e et al.\u003c/em\u003e RIZ1 is potential CML tumor suppressor that is down-regulated during disease progression. \u003cem\u003eJ Hematol Oncol\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 28 (2009). https://doi.org:10.1186/1756-8722-2-28\u003c/li\u003e\n\u003cli\u003eShaffer, A. L.\u003cem\u003e et al.\u003c/em\u003e Blimp-1 orchestrates plasma cell differentiation by extinguishing the mature B cell gene expression program. \u003cem\u003eImmunity\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 51-62 (2002). https://doi.org:10.1016/s1074-7613(02)00335-7\u003c/li\u003e\n\u003cli\u003eRutishauser, R. L.\u003cem\u003e et al.\u003c/em\u003e Transcriptional repressor Blimp-1 promotes CD8(+) T cell terminal differentiation and represses the acquisition of central memory T cell properties. \u003cem\u003eImmunity\u003c/em\u003e \u003cstrong\u003e31\u003c/strong\u003e, 296-308 (2009). https://doi.org:10.1016/j.immuni.2009.05.014\u003c/li\u003e\n\u003cli\u003eŚledzińska, A.\u003cem\u003e et al.\u003c/em\u003e Regulatory T Cells Restrain Interleukin-2- and Blimp-1-Dependent Acquisition of Cytotoxic Function by CD4(+) T Cells. \u003cem\u003eImmunity\u003c/em\u003e \u003cstrong\u003e52\u003c/strong\u003e, 151-166.e156 (2020). https://doi.org:10.1016/j.immuni.2019.12.007\u003c/li\u003e\n\u003cli\u003eMzoughi, S.\u003cem\u003e et al.\u003c/em\u003e PRDM15 safeguards naive pluripotency by transcriptionally regulating WNT and MAPK-ERK signaling. \u003cem\u003eNat Genet\u003c/em\u003e \u003cstrong\u003e49\u003c/strong\u003e, 1354-1363 (2017). https://doi.org:10.1038/ng.3922\u003c/li\u003e\n\u003cli\u003eMzoughi, S.\u003cem\u003e et al.\u003c/em\u003e PRDM15 loss of function links NOTCH and WNT/PCP signaling to patterning defects in holoprosencephaly. \u003cem\u003eSci Adv\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, eaax9852 (2020). https://doi.org:10.1126/sciadv.aax9852\u003c/li\u003e\n\u003cli\u003eMzoughi, S.\u003cem\u003e et al.\u003c/em\u003e PRDM15 is a key regulator of metabolism critical to sustain B-cell lymphomagenesis. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 3520 (2020). https://doi.org:10.1038/s41467-020-17064-0\u003c/li\u003e\n\u003cli\u003eMartelli, A. M.\u003cem\u003e et al.\u003c/em\u003e The emerging role of the phosphatidylinositol 3-kinase/Akt/mammalian target of rapamycin signaling network in normal myelopoiesis and leukemogenesis. \u003cem\u003eBiochim Biophys Acta\u003c/em\u003e \u003cstrong\u003e1803\u003c/strong\u003e, 991-1002 (2010). https://doi.org:10.1016/j.bbamcr.2010.04.005\u003c/li\u003e\n\u003cli\u003eOrkin, S. H. \u0026amp; Zon, L. I. Hematopoiesis: an evolving paradigm for stem cell biology. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e132\u003c/strong\u003e, 631-644 (2008). https://doi.org:10.1016/j.cell.2008.01.025\u003c/li\u003e\n\u003cli\u003eWeissman, I. L. \u0026amp; Shizuru, J. A. The origins of the identification and isolation of hematopoietic stem cells, and their capability to induce donor-specific transplantation tolerance and treat autoimmune diseases. \u003cem\u003eBlood\u003c/em\u003e \u003cstrong\u003e112\u003c/strong\u003e, 3543-3553 (2008). https://doi.org:10.1182/blood-2008-08-078220\u003c/li\u003e\n\u003cli\u003eCoqueret, O., B\u0026eacute;rub\u0026eacute;, G. \u0026amp; Nepveu, A. The mammalian Cut homeodomain protein functions as a cell-cycle-dependent transcriptional repressor which downmodulates p21WAF1/CIP1/SDI1 in S phase. \u003cem\u003eEmbo j\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 4680-4694 (1998). https://doi.org:10.1093/emboj/17.16.4680\u003c/li\u003e\n\u003cli\u003eHarada, R.\u003cem\u003e et al.\u003c/em\u003e Genome-wide location analysis and expression studies reveal a role for p110 CUX1 in the activation of DNA replication genes. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e36\u003c/strong\u003e, 189-202 (2008). https://doi.org:10.1093/nar/gkm970\u003c/li\u003e\n\u003cli\u003eVadnais, C.\u003cem\u003e et al.\u003c/em\u003e CUX1 transcription factor is required for optimal ATM/ATR-mediated responses to DNA damage. \u003cem\u003eNucleic Acids Research\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e, 4483-4495 (2012). https://doi.org:10.1093/nar/gks041\u003c/li\u003e\n\u003cli\u003eSansregret, L.\u003cem\u003e et al.\u003c/em\u003e Cut homeobox 1 causes chromosomal instability by promoting bipolar division after cytokinesis failure. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e \u003cstrong\u003e108\u003c/strong\u003e, 1949-1954 (2011). https://doi.org:doi:10.1073/pnas.1008403108\u003c/li\u003e\n\u003cli\u003eAn, N.\u003cem\u003e et al.\u003c/em\u003e Gene dosage effect of CUX1 in a murine model disrupts HSC homeostasis and controls the severity and mortality of MDS. \u003cem\u003eBlood\u003c/em\u003e \u003cstrong\u003e131\u003c/strong\u003e, 2682-2697 (2018). https://doi.org:10.1182/blood-2017-10-810028\u003c/li\u003e\n\u003cli\u003eMartinez, T. C.\u003cem\u003e et al.\u003c/em\u003e CUX1 restrains latent hematopoietic stem cell plasticity by suppressing stem cell-intrinsic inflammatory pathways. \u003cem\u003eBlood\u003c/em\u003e (2025). https://doi.org:10.1182/blood.2024026815\u003c/li\u003e\n\u003cli\u003eLiu, W.\u003cem\u003e et al.\u003c/em\u003e CUX1 regulates human hematopoietic stem cell chromatin accessibility via the BAF complex. \u003cem\u003eCell Rep\u003c/em\u003e \u003cstrong\u003e43\u003c/strong\u003e, 114227 (2024). https://doi.org:10.1016/j.celrep.2024.114227\u003c/li\u003e\n\u003cli\u003eG\u0026iacute;slason, M. H.\u003cem\u003e et al.\u003c/em\u003e BloodSpot 3.0: a database of gene and protein expression data in normal and malignant haematopoiesis. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e52\u003c/strong\u003e, D1138-d1142 (2024). https://doi.org:10.1093/nar/gkad993\u003c/li\u003e\n\u003cli\u003eMann, N.\u003cem\u003e et al.\u003c/em\u003e Mutations in PRDM15 Are a Novel Cause of Galloway-Mowat Syndrome. \u003cem\u003eJ Am Soc Nephrol\u003c/em\u003e \u003cstrong\u003e32\u003c/strong\u003e, 580-596 (2021). https://doi.org:10.1681/asn.2020040490\u003c/li\u003e\n\u003cli\u003eMiettinen, M. \u0026amp; Lasota, J. KIT (CD117): A Review on Expression in Normal and Neoplastic Tissues, and Mutations and Their Clinicopathologic Correlation. \u003cem\u003eApplied Immunohistochemistry \u0026amp; Molecular Morphology\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 205-220 (2005). https://doi.org:10.1097/01.pai.0000173054.83414.22\u003c/li\u003e\n\u003cli\u003eLudes-Meyers, J. H.\u003cem\u003e et al.\u003c/em\u003e WWOX hypomorphic mice display a higher incidence of B-cell lymphomas and develop testicular atrophy. \u003cem\u003eGenes Chromosomes Cancer\u003c/em\u003e \u003cstrong\u003e46\u003c/strong\u003e, 1129-1136 (2007). https://doi.org:10.1002/gcc.20497\u003c/li\u003e\n\u003cli\u003eCui, Z.\u003cem\u003e et al.\u003c/em\u003e The role of the WWOX gene in leukemia and its mechanisms of action. \u003cem\u003eOncol Rep\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 2154-2162 (2013). https://doi.org:10.3892/or.2013.2361\u003c/li\u003e\n\u003cli\u003eLawson, H.\u003cem\u003e et al.\u003c/em\u003e CITED2 coordinates key hematopoietic regulatory pathways to maintain the HSC pool in both steady-state hematopoiesis and transplantation. \u003cem\u003eStem Cell Reports\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 2784-2797 (2021). https://doi.org:10.1016/j.stemcr.2021.10.001\u003c/li\u003e\n\u003cli\u003eChen, Y., Haviernik, P., Bunting, K. D. \u0026amp; Yang, Y. C. Cited2 is required for normal hematopoiesis in the murine fetal liver. \u003cem\u003eBlood\u003c/em\u003e \u003cstrong\u003e110\u003c/strong\u003e, 2889-2898 (2007). https://doi.org:10.1182/blood-2007-01-066316\u003c/li\u003e\n\u003cli\u003eLiu, N.\u003cem\u003e et al.\u003c/em\u003e CUX1, A Controversial Player in Tumor Development. \u003cem\u003eFrontiers in Oncology\u003c/em\u003e \u003cstrong\u003eVolume 10 - 2020\u003c/strong\u003e (2020). https://doi.org:10.3389/fonc.2020.00738\u003c/li\u003e\n\u003cli\u003eLaFleur, M. W.\u003cem\u003e et al.\u003c/em\u003e X-CHIME enables combinatorial, inducible, lineage-specific and sequential knockout of genes in the immune system. \u003cem\u003eNature Immunology\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 178-188 (2024). https://doi.org:10.1038/s41590-023-01689-6\u003c/li\u003e\n\u003cli\u003eDu, J.\u003cem\u003e et al.\u003c/em\u003e Cited2 Is Required For The Maintenance Of Glycolytic Metabolism In Adult Hematopoietic Stem Cells. \u003cem\u003eBlood\u003c/em\u003e \u003cstrong\u003e122\u003c/strong\u003e, 794 (2013). https://doi.org:https://doi.org/10.1182/blood.V122.21.794.794\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7956606/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7956606/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHematopoietic stem cells (HSCs) sustain lifelong hematopoiesis through a tightly regulated balance of self-renewal, proliferation and differentiation, particularly under stress conditions.\u003c/p\u003e\u003cp\u003eHere, we identify PRDM15, a transcription factor with well described roles in early embryonic development, as a crucial regulator of hematopoiesis during stress responses. While PRDM15 deletion is tolerated at steady state in adult hematopoiesis, its absence severely impairs bone marrow reconstitution following transplantation, causing sustained reduction in bone marrow cellularity and differentiation blocks. Notably, PRDM15-deleted bone marrow exhibited an accumulation of stem and progenitor cells, indicating a block in lineage differentiation. Furthermore, in competitive transplantation assays, PRDM15-deficient cells were unable to compete with wild-type counterparts, demonstrating a profound loss of fitness.\u003c/p\u003e\u003cp\u003eTranscriptomic and epigenomic analyses reveal PRDM15 as a critical regulator of differentiation and proliferation of HSCs. Mechanistically, PRDM15 directly regulates the expression of several key genes involved in proliferation and differentiation pathways, including the transcription factor \u003cem\u003eCux1\u003c/em\u003e. \u003cem\u003eCux1\u003c/em\u003e overexpression partially rescues colony-forming ability of PRDM15-deficient HSCs.\u003c/p\u003e\u003cp\u003eThese findings establish PRDM15 as a pivotal stress-responsive regulator of HSC differentiation and survival, with implications for therapeutic modulation of hematopoiesis.\u003c/p\u003e","manuscriptTitle":"PRDM15 regulates differentiation and proliferation of hematopoietic stem cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-03 04:09:55","doi":"10.21203/rs.3.rs-7956606/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"95ef2063-9434-42e7-81a4-d4a6ccf87b8a","owner":[],"postedDate":"November 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":57239784,"name":"Biological sciences/Developmental biology/Haematopoiesis"},{"id":57239785,"name":"Biological sciences/Molecular biology/Transcriptomics"}],"tags":[],"updatedAt":"2025-12-22T09:06:19+00:00","versionOfRecord":[],"versionCreatedAt":"2025-11-03 04:09:55","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7956606","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7956606","identity":"rs-7956606","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}