Altered staining patterns and expression level of Engrailed-2 in Benign prostatic hyperplasia and Prostate Cancer predict Prostatic disease progression

preprint OA: closed
Full text JSON View at publisher
AI-generated summary by claude@2026-07, 2026-07-17

This study developed a new antibody to show that Engrailed-2 expression levels and staining patterns differ between benign prostatic hyperplasia and prostate cancer, potentially predicting disease progression.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-17 · read from full text

This preprint investigated Engrailed-2 (EN2), a HOX-family transcription factor, by comparing EN2 immunohistochemical staining patterns and EN2 expression levels between benign prostatic hyperplasia (BPH) and prostate cancer (PC). The authors generated a monoclonal antibody against the EN2 helix 3, validated specificity by Western blotting and immunofluorescence in three PC cell lines (LNCaP, PC3, DU145), and analyzed EN2 expression by RT-PCR and immunohistochemical scoring in 25 PC and 25 BPH cases, then assessed correlations with clinical staging. They found stronger EN2 staining in PC than BPH, with EN2 signal localization differing by diagnosis (BPH mainly nuclear/cytoplasmic, PC mainly cytomembrane), and EN2 expression positively correlated with PC clinical stage/progression, with specificity validated in vitro. A major caveat is the small, single-center human sample size and the fact that the work is presented as a preprint not peer reviewed. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Background: Prostate cancer (PC) , a common malignant tumor, is the second-leading cause of cancer death among American men. Its successful treatment greatly relies on the early diagnose. Engrailed-2 (EN2) has been confirmed being existed with a high level in the urine of PC patients. In this study, to explore the application of EN2 in PC, we detected the immunohistochemical staining difference and EN2 expression level between benign prostatic hyperplasia (BPH) and PC. Methods: We developed a monoclonal antibody against the helix 3 in EN2 and confirmed its specificity with Western blotting (WB) and immunofluorescence detecting the subcellular localization of endogenous and exogenous EN2 in three PC cell lines (LNCap, PC3, and DU145). We conducted immunohistochemical staining using this homemade antibody, and RT-PCR to detect the expression of EN2 in 25 PC and 25 BPH cases , and analyzed the correlation of EN2 expression and PC clinical staging. Results: The results of WB and immunofluorescence showed our homemade EN2 monoclonal antibody could specifically bind endogenous and exogenous EN2 protein in three different PC cell lines. Endogenous EN2 was generally expressed in the cytoplasm and exogenous EN2 mostly existed in the nucleus of these cell lines. Immunohistochemical staining in PC had extremely stronger signals than that in BPH, suggesting a higher EN2 expression level in PC, which was confirmed by RT-PCR. Interestingly, the stained areas in BPH tissues were mainly in nucleus and cytoplasm, while in PC tissues were mainly on cytomembrane. Moreover, the expression level of EN2 was positively correlated with the PC clinical staging. Conclusion: Using our homemade EN2 antibody, we have found different staining patterns and expression level of EN2 in BPH and PC,which may be helpful to predict prostatic disease progression.
Full text 203,221 characters · extracted from preprint-html · click to expand
Altered staining patterns and expression level of Engrailed-2 in Benign prostatic hyperplasia and Prostate Cancer predict Prostatic disease progression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research article Altered staining patterns and expression level of Engrailed-2 in Benign prostatic hyperplasia and Prostate Cancer predict Prostatic disease progression Qi Li, Yibo Shi, Rigai Sa, Jun Hao, Jinhao Hu, Mulun Xiao, Chaoliang Wang, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.2.14625/v3 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 15 Jun, 2020 Read the published version in BMC Cancer → Version 3 posted 11 You are reading this latest preprint version Show more versions Abstract Background: Prostate cancer (PC) , a common malignant tumor, is the second-leading cause of cancer death among American men. Its successful treatment greatly relies on the early diagnose. Engrailed-2 (EN2) has been confirmed being existed with a high level in the urine of PC patients. In this study, to explore the application of EN2 in PC, we detected the immunohistochemical staining difference and EN2 expression level between benign prostatic hyperplasia (BPH) and PC. Methods: We developed a monoclonal antibody against the helix 3 in EN2 and confirmed its specificity with Western blotting (WB) and immunofluorescence detecting the subcellular localization of endogenous and exogenous EN2 in three PC cell lines (LNCap, PC3, and DU145). We conducted immunohistochemical staining using this homemade antibody, and RT-PCR to detect the expression of EN2 in 25 PC and 25 BPH cases , and analyzed the correlation of EN2 expression and PC clinical staging. Results: The results of WB and immunofluorescence showed our homemade EN2 monoclonal antibody could specifically bind endogenous and exogenous EN2 protein in three different PC cell lines. Endogenous EN2 was generally expressed in the cytoplasm and exogenous EN2 mostly existed in the nucleus of these cell lines. Immunohistochemical staining in PC had extremely stronger signals than that in BPH, suggesting a higher EN2 expression level in PC, which was confirmed by RT-PCR. Interestingly, the stained areas in BPH tissues were mainly in nucleus and cytoplasm, while in PC tissues were mainly on cytomembrane. Moreover, the expression level of EN2 was positively correlated with the PC clinical staging. Conclusion: Using our homemade EN2 antibody, we have found different staining patterns and expression level of EN2 in BPH and PC,which may be helpful to predict prostatic disease progression. Cancer Biology Oncology Prostate cancer Benign prostatic hyperplasia Engrailed-2 Immunohistochemical staining Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background Prostate cancer (PC) is the most common cancer diagnosed among males in the US and the second cause of cancer death in men [1]. The extremely high morbidity and mortality make PC one of the most serious threats to men’s health [2]. Nowadays, the PC treatments only rely on surgery or radiotherapy when the cancer is still in the localized stage [3, 4]. Thus the survival rate would be commonly improved if PC could be diagnosed in the early stage. Although there has been vast of progress in understanding PC pathobiology, there is no approved test for the diagnosis and monitoring of PC except for prostate-specific antigen (PSA) test. However, PSA is not used widely as a diagnostic marker for PC due to its low specificity and sensitivity [5]. Benign prostatic hyperplasia (BPH) is a kind of prostatic nonmalignant hyperplasia and may cause serious symptoms such as lower urinary tract symptoms (LUTS) which undermines patients' life quality [6]. Meta-analyses data shows BPH is associated with an increased incidence of prostate cancer and these two prostatic diseases have certain similar traits such as androgen-dependent growth or response to hormonal therapy, which lead to overtreatment or delayed treatment of the diseases[6,7]. To judge the state of prostatic disease better, new biomarkers are needed to show some meaningful clues in the process of prostate diseases. Recently, studies have shown that the dysregulation of homeobox (HOX) gene family occurs in many cancers, including solid and hematological malignancies [8]. Engrailed-2 (EN2), a member of the HOX gene family, has been found to overexpress in various kinds of cancers like PC, breast cancer and bladder cancer, and play important roles in oncogenesis [8, 9]. It has been reported that positive detection of EN2 in patients’ urine with ELISA was predictive of PC with high sensitivity and specificity (66% and 88.2% respectively) [10]. Moreover, a strong positive correlation was shown not only between pre-surgical level of urinary EN2 and the volume of cancerous tissues removed in prostatectomy, but also between EN2 levels and tumor stages[11]. Since EN2 can be detected in urine after prostate carcinogenesis, intracellular EN2 may change to secretory form because normal prostate tissue and hypertrophic prostatic cells do not secrete EN2 [10,11]. All these results suggest a potential for EN2 as a candidate biomarker in early detection of PC or the differential diagnosis for PC and BPH. Structurely, the full length of EN2 protein has 333aa, including three alpha helices,with the helix 1 and 2 at the N end binding DNA, and helix 3 at C end,mainly mediating the exocrine and internalization of EN2 protein [12,19]. We produced a monoclonal antibody targeting Helix 3 in EN2,and conducted immunohistochemical staining with this homemade antibody to detect EN2 expression patterns in 25 BPH and 25 PC cases. EN2 Helix 3 The EN2 expression levels of these cases were confirmed by RT-PCR. We also analyzed the EN2 immunohistochemical scores, the clinical indicators, and their correlation in PC cases and found the expression level of EN2 was positively correlated with PC clinical progress. Methods Ethics Statement This study involving human participants was approved by the ethics committee of The First Affiliated Hospital of Zhengzhou University. The audit number of ethics committee was 2019-KY-185. Written consent was obtained from all human participants. Research was carried out according to the principles expressed in the Declaration of Helsinki. Patients and samples Clinical samples and patient records corresponding to 50 consecutive patients diagnosed as PC or BPH at the Urology Department of The First Affiliated Hospital of Zhengzhou University between January 2017 and October 2018 were examined. The inclusion criteria were as following: (1) Only patients who came to our hospital for the first time for examination and diagnosis were collected; (2) No other systemic tumors, severe infection and trauma; (3) One week before the examination of serum PSA, there was no indwelling catheterization, cystoscopy, digital rectal examination and other operations affecting the result of serum PSA and inflammatory indicators; (4) No endocrine treatment; (5) No coagulation dysfunction, serious cardiovascular and cerebrovascular diseases. Patients underwent Laparoscopic radical prostatectomy and cancer or hyperplasia samples were split in half immediately after resection. One half was embedded with paraffin, and the other half was immediately snap-frozen in liquid nitrogen for RT-PCR analyses. All the samples used were confirmed by a pathologist. Cell Culture and Experimental Reagents Human PC cell lines,LNCaP, DU145 and PC3, were obtained from ATCC. LNCap cells were cultured with Roswell Park Memorial Institute (RPMI) 1640 medium (#11875093, Gibco, USA. DU145 cells were cultured with Dulbecco’s Modified Eagle’s Medium (DMEM) (#11995040, Gibco, USA) And PC3 cells were cultured with DMEM/F12 (#11330057, Gibco, USA). Human embryonic kidney cell line (293T) was preserved in our laboratory. 293T cells were cultured with DMEM. The culture medium was supplemented with 10% fetal bovine serum (#16140089, Gibco, USA), 100 U/ml penicillin and 100 μg/ml streptomycin (#15070063, Gibco, USA) when used and cells were incubated at 37°C in a humidified incubator with 5% CO2. Preparation of monoclonal antibodies against Engrailed-2 C-terminal 114aa of EN2 was selected according to EN2 mRNA sequence (NCBI Reference Sequence: NM_001427.3) to prepare the EN2 monoclonal antibodies. Briefly, the gene encoding C-terminal 114aa of EN2 was synthesized in Sangon Biotech (Shanghai, China) Co., Ltd. A hexahistidine tag was added to the carboxyl terminus to aid in the detection and purification of the final protein product. The resulting gene was cloned into the expression vector pET30a and transformed into E. coli strain BL21(λDE3) . Single bacterial colony was inoculated into LB medium and grown at 37˚C to OD600 of 0.6. Expression of the recombinant EN2C protein was induced with 0.1 mM isopropyl β-D-1-thiogalactopyranoside at 37˚C for 4 hours. The culture mixture was centrifuged at 2000 × g for 15 minutes, and supernatant was collected. Soluble EN2 C-terminal 114aa was purified by Ni+ affinity column and used to immunize Balb/c mice. The spleenocytes from the immunized Balb/c mice were obtained and fused with Balb/c mouse myeloma cells by hybridoma technique, and monoclonal antibodies were obtained by screening. The affinity and specificity of EN2 monoclonal antibodies were identified through ELISA, WB, immunofluorescence and immunohistochemistry. Western blotting EN2 protein or cell total protein were run WB to identify specificity of EN2 monoclonal antibody. Three prostate cancer cell lines, PC3, DU145, LNcap and transfected 293T cell were used. Cells grown in a 100 mm cell culture dish were rinsed with PBS buffer prior to harvesting. Total proteins were extracted with Cell Culture Lysis 1×Reagent (#53711-5399, Promega Inc., USA) according to the product instruction and incubated on ice for 10 minutes. The cell lysate was separated by centrifugation at 12,000 x g for 2 minutes. The protein concentation was measured by BCA Protein Assay Reagent (#PC0020, Solarbio Inc., China). For SDS‑PAGE, a total of 20 µg of protein was loaded per well. Polyvinylidenedifluoride (PVDF) membranes (Roche Diagnostics, USA) were used for the transfer process. For WB, PVDF membranes after protein transfer were incubated in 5% skimmed milk blocking buffer for 1 hour, followed by washing 3 times with PBST (buffered saline plus 0.05% Tween 20). EN2 was detected using the monoclonal antibody and horseradish peroxidase-conjugated goat anti-mouse IgG secondary antibody (1:10,000; #ZB-2305; ZSGB-BIO Inc., China). Immunofluorescence The recombinant pcDNA3.1-EN2-Red fluorescent protein (RFP) was transfected into 293T or prostate cancer cell lines,PC-3, DU-145 or LNCap, using PEI (polyethylenimine linear, #23966, Polysciences Inc., USA). After incubating at 37˚C, 5% CO 2 for 6 hours, the culture medium was replaced with DMEM complete medium and cultured for another 24 hours. The culture medium was aspirated, and cells were fixed by incubating with 4% paraformaldehyde (#P1110,Solarbio Inc., China) for 15 minutes at room temperature. After washing twice in PBS buffer, freshly prepared 0.2% Triton X-100 (#T8200, Solarbio Inc., China) was added and incubated for 10 minutes at room temperature. Block with 5% BSA for 30 minutes. The monoclonal antibody of EN2 was added and incubated at 37˚C for 2 hours. The Goat anti-mouse IgG/FITC (#SF131, Solarbio Inc., China) was added and incubated for 35 minutes at 37˚C in the dark. After washing twice with PBS, it was observed under a fluorescence microscope. Immunohistochemical Staining of EN2 in PC or BPH tissues Briefly, all paraffin embed PC tissues were cut into 3 μm sections. The slides were deparaffinized by heating at 60°C and then immersed in xylene and rehydrated. The sections were boiled in 1 mM EDTA buffer solution (pH 9.0) for 20 minutes in a pressure cooker. Subsequently, endogenous peroxidase activity was quenched by immersing the samples in 3% hydrogen peroxide for 10 minutes. Each section was blocked in Tris-buffered saline with Tween20/5% normal goat serum (#ZLI-9022, ZSGB-Bio Inc., China) for 1 hour at room temperature to block nonspecific binding. Then the sections were incubated with anti–EN2 monoclonal antibody at 37˚C for 60 minutes. Subsequently, a secondary biotinylated horse anti-mouse IgG solution (#ZB-2020, ZSGB-Bio Inc., China) and an avidin-biotin peroxidase reagent (#SPN9002, ZSGB-Bio Inc., China) were added onto the slides. The negative control sample was treated identically but with the isotype antibody. The color reaction was visualized by incubating with DAB solution (#ZLI-9017, ZSGB-Bio Inc., China) for 5 minutes. After washed thoroughly, the slides were placed in hematoxylin for redyeing. After dehydration with xylene and ethanol, the slides were sealed with neutral gum. For HE staining, the slides were placed in xylene and ethanol solution for dewaxing and hydration. After staining with hematoxylin for 5 minutes, the slides were rinsed for 10 minutes, and stained with 0.5% eosin aqueous solution for 1 minute. After dehydration with xylene and ethanol, the slides were sealed with neutral gum. Evaluation of Immunohistochemical Staining Images were captured by a fluorescence microscope (Olympus DP74) and analyzed with the assistance of a histopathologist. The observer was blinded to the clinical diagnosis of the tissues at the time of assessment. A total of 100 cells were counted in 10 random fields (with ×400 objectives) and the percentage of positive cells was calculated. The semi-quantitative immunoreaction scoring system was evaluated based on the percentage of positive cells and the stain intensity. Regarding stain intensity, negative staining was defined as 0, mild positive was defined as 1, moderate positive as 2 and strong positive as 3. The scores of immunopositive cells were defined as follows: 75% immunopositive cells as 3 (strong). The immunohistochemical score of each section is the sum of the stain intensity and positive cell scores. RT-qPCR The EN2 gene expression was measured by reverse transcription quantitative polymerase chain reaction (RT-qPCR). The reverse transcription reaction was performed according to the manufacturer's instructions by PrimeScript TM RT reagent Kit (#RR047A, TAKARA, Japan) and the qPCR reactions were performed at 94 ˚C for 5 minutes, 94 ˚C for 20 seconds, 55 ˚C for 20 seconds and 72 ˚C 15 seconds for 30 cycles, followed by 72 ˚C for 5 minutes using 7500 Fast Real-Time PCR System (Applied Biosystems, ThermoFisher Inc., USA). The sequences of the primers are presented in Table 1. Table 1 qPCR primers Targets F R EGFR ACGGGGTGACTGTTTGGGAGTT ACTTTGGGCGACTATCTGCGTCT VEGF GGCAGAAGGAGGAGGGCAGAAT CATCGCATCAGGGGCACACA EN2 CTACTGTACGCGCTACTCGG CCCGTGGCCTTCTTGATCTT mTOR TGGACACCAACAAGGACGAC GTCCCACTGACCTAAACCCC pTEN TGGGGAAGTAAGGACCAGAGACAAAA TGGCAGACCACAAACTGAGGATTG GAPDH TCGGAGTCAACGGATTTGGT TTCCCGTTCTCAGCCTTGAC The relative transcription level was presented as 2 - △△Ct of each target in PC tissues relative to BPH tissues. For the first step, we subtracted the transcription level of each target in BPH tissues from the corresponding target level in PC tissues, and got a value asΔCt. The 2 - △△Ct value was then be calculated at the second step. In BPH tissues, the relative transcription level of each target was obtained by subtracting the transcription level of an internal reference (GAPDH) from the level of each target in BPH tissues to get ΔCt, and the relative transcription levels ,represented as 2 - △△Ct , was then be calculated at the second step. Statistics and methods Data were expressed as mean ± standard deviation (SD). Data that follow the normal distribution were compared using the t-test, otherwise Mann Whitney U test was used. Counting data was expressed as composition ratio or rate (%), and comparison was made by chi-square test. EN2 immunohistochemical scores in 25 PC and 25 BPH cases were analyzed using Fisher’s Exact Test. The correlation between EN2 immunohistochemical score and clinical indicators was analyzed using spearman rank correlation. Data analysis was performed using SPSS 23 software. P <0.05 was considered statistically significant. Results Homemade monoclonal antibody showed EN2 specificity. The crystal diagram of EN2 protein was shown in Figure 1A. The helix 3 region of EN2 protein was expressed and detected by SDS-PAGE (Figure1B). The band of EN2 Helix 3 , whose size was about 25 KDa, was shown in Figure 1B. The total protein of 293T cells transfected with or without EN2-RFP-expressing plasmid.was shown in Figure 1C, marked with “EN2-RFP+” and “EN2-RFP-” , respectively. The band indicated by the red arrow in the lane of “EN2-RFP+” was the EN2-RFP fusion protein expressed by transfected 293T cells which did not appear in the lane of “EN2-RFP-”. The endogenous and exogenous EN2 identified by WB using our homemade EN2 monoclonal antibody was shown in Figure 1D, where two bands appeared in “EN2-RFP+” line while only one band appeared in “EN2-RFP-” line. The band at 40 KDa was exogenous EN2-RFP which has the same size as the one indicated by the red arrow in Figure 1C. The band at 33 KDa was endogenous EN2 protein in 293T cells. Band of endogenous EN2 in the “EN2-RFP+” lane was weaker than what in the “EN2-RFP-” lane, suggesting the expression of exogenous EN2 weakened that of endogenous EN2. It could also be seen that in 293T cells, the expression of endogenous EN2 was quite weak, ompared with the exogenous one. To validate the specificity of our homemade EN2 antibody in prostate cancer cell lines, total cell proteins of LNCap, DU145 and PC3 were used to identify the endogenous EN2 expression by WB, shown in Figure 1E. Only one band at 33 KDa appeared in these three cell lines, with the same size as endogenous EN2 in 293T. To further validate the antibody specificity, we used the homemade EN2 monoclonal antibody or its isotype control as the first antibody in immunofluorescence to detect the exogenous EN2-RFP fusion protein expressed by transfected 293T cells, and used FITC-labeled anti-mouse IgG polyclonal antibody as the second antibody to get the green positive signals. The 293T cells transfected with EN2-RFP-expressing plasmid turned red in color. The representative images were shown in Figure 1F. Twelve hours after transfection, strong red fluorescence in the nuclei of transfected 293T cells could be observed through a fluorescence microscope, , while no strong red fluorescence was observed on cytomembrane or in cytoplasma. Immunofluorescence results also showed the green signals resulted from EN2 –EN2 antibody-IgG-FITC complex existed mainly in the cell nuclei. The green signals in immunofluorescence merged well with the red fluorescence from EN2-RFP. As a negative control, the images stained with isotype antibody have no green signals since the isotype antibody could not bind the EN2-RFP transfected protein in 293T cell. All the photos were taken at the magnification of 400×. Subcellular localization of endogenous and exogenous EN2 in LNcap, DU145 and PC3. To detect the subcellular localization of endogenous and exogenous EN2 in different types of PC cell lines, LNCap, DU145 and PC3 cell lines which represented different stages of PC, were transfected with EN2-RFP-expressing plasmid and then detected by immunofluorescence using our homemade EN2 monoclonal antibody or its isotype control antibody. Twelve hours after transfection, red fluorescence which indicated the exogenous EN2 could be observed through a fluorescence microscope. Then the cells were fixed and immunostained with our homemade antibody or its isotype control, the FITC labeled second antibody against EN2 monoclonal antibody could indicate all EN2 protein, both endogenous and exogenous EN2, in these cells. The representative images were shown in Figure 2. All the photos were taken at the magnification of 1000×. As shown in the left panel of Figure 2, the exogenous EN2 with red color only distributed in the nuclei of all three cell lines, and there was almost no exogenous EN2 existed in the cytoplasm. As shown in the middle panel of Figure 2, endogenous EN2 stained with grainy green flurescence distributed in the cytoplasm of three PC cell lines uniformly. And the strong green staining indicating the exogenous EN2 was observed in the nuclei of these three PC cell lines. In those cells not successfully transfected with exogenous EN2, a dark and round nucleus outlined in the cells with weak green signals distributed in the cytoplasm. While in the cells expressing exogenous EN2, the green color was much heavier in nucleus than in cytoplasm. The merged images were shown in the right penal of Figure 2, indicating only successfully transfected cells had strong yellow staining merged in the nucleus. Other cells without EN2-RFP transfection showed no sign of color in the nucleus, there was the only dark image in the nucleus. The results demonstrated different expression patterns of endogenous and exogenous EN2 in PC cells. As nagetive controls , images stained with isotype antibody showed no green signal. PC tissues have generally stronger EN2 staining on cytomembrane than BPH tissues. To detect the expression patterns of EN2 in PC and BPH tissues, we performed immunohistochemical staining to a series of paraffin-embedded slices from human prostatic samples collected as previously described, and evaluated the staining results by 2 independent pathologists who were both blind to the groups. Carcinoma tissue was confirmed in the PC samples and no carcinoma tissue was confirmed in the BPH samples by the pathologists and EN2 was mainly expressed in glandular and/or carcinoma cells. Table 2 summarized EN2 immunohistochemical scores of BPH and PC. 48% (12/25) of BPH tissues and 100% (25/25) of PC tissues showed EN2 positive staining. Among them, 12% (3/25) of BPH tissues and 72% (18/25) of PC tissues showed EN2 strong staining as well. 52% (13/25) of BPH tissues and 0% (0/25) of PC tissues showed EN2 negative staining. Fisher’s Exact Test showed that the expression level of EN2 in PC and BPH was significantly different, and the expression level of EN2 was much higher in PC group than that in BPH group (P<0.001). The representative immunohistochemical images of BPH and PC were shown in Figure 3A. Three images above were BPH slices and the three images below were PC slices. The photos were taken at the magnification of 40×. The staining intensity was weaker in BPH slices than in PC slices. Two strong positive BPH slices stained with EN2 antibody and one stained with negative isotype control antibody were shown in Figure 3B and four partial enlargements of the photos were shown in I, II, III and IV. In the left panel of Figure 3B, EN2 was strongly stained mostly in neovascularization endothelial cells and glandular epithelial cells, as shown in “I” and“II” , respectively. Strong EN2 staining on nuclear membrane in BPH tissues was indicated by the red arrow. In the middle panel of Figure 3B, strong EN2 staining on the gland could be observed. Cytoplasm staining of EN2 was shown in “III”, while scattered EN2 staining in the nuclei of lymphocytes infiltrating in interstitial tissues was shown in “IV”. A negative control stained with isotype antibody was shown in the right panel of Figure 3B. The photos were taken at the magnification of 400×. Two PC slices stained with EN2 antibody and one stained with isotype control antibody were shown in Figure 3C (at the magnification of 400× as well). Four partial enlargements of the photos were shown in V, VI, VII, and VIII. In the left panel of Figure 3C, cytomembrane staining of EN2 on the glandular epithelial cells with well-defined honeycomb-like was shown in “V” and “VI”. In the middle panel of Figure 3C, strong nuclear membrane staining of EN2 was shown in “VII” and EN2 staining on the tumor neovascularization endothelial cells was shown in “VIII”. The negative control stained with isotype antibody was shown in the right panel of Figure 3C. The photos were taken at the magnification of 400×. Cerebellum is known for its high expression of EN2 and was stained as a positive control. EN2 antibody staining was shown in Figure 4A and isotype control antibody staining was shown in Figure 4B. The magnification of left and right panel was 40× and 400× respectively. EN2 staining was apparently observed in the nucleus in cerebellar tissues The positive staining was indicated by the red arrow. In summary, EN2 could be stained in both glandular epithelial cells and neovascularization endothelial cells which are both epithelial original. In glandular epithelial cells, EN2 could be stained on cytomembraneand nuclear membrane , as well as in the cytoplasm and nucleus. Strong staining on cytomembrane was always found in PC slices. The results indicated that EN2 expression patterns changed and the expression level increased as the growth of cells. Different states of the EN2 staining patterns, from the nucleus, nuclear membrane, cytoplasm and cytomembrane in BPH to mainly appeared on cytomembrane in PC suggest that EN2 might be secreted out of epithelial cells especially glandular epithelial cells during the malignant transformation of PC cells. Infiltrating lymphocytes in BPH could also be stained with EN2 antibody suggesting that EN2 protein could be expressed or endocytosed by infiltrating lymphocytes. High Expression of EN2 both in PC and BHP compared to other four biomarkers. To further confirm the overexpression of EN2 in PC, we detected the expression of four well-studied biomarker proteins, mTOR(mechanistic target of rapamycin kinase), VEGF(vascular endothelial growth factor), EGFR(epidermal growth factor receptor) and PTEN( gene of phosphate and tension homology deleted on chromsome ten) ,together with EN2 in these 25 PC and 25 BPH tissues, at mRNA level through real-time PCR. Transcription levels of glyceraldehyde phosphate dehydrogenase (GAPDH ) were used as the internal quantitative control for those five targets in BPH tissues and transcription levels of these five targets in BPH tissues were used as control in PC tissues. Three duplicated wells of each target gene were set and three independent tests were done in this study. The results were summarized in Figure 5A and B, and relative transcription levels of those target genes in 25 cases were represented as dots separately. The relative EN2 expression in 25 PC and 25 BPH tissues was the highest compared to other 4 targets (P<0.01). Also the transcription of EN2 was higher in PC tissues than in BPH tissues, and the transcription level of EN2 in 25 PC tissues had the largest variation. As shown in Figure 5A, in PC tissues, the highest relative expression of EN2 was above 140 while the lowest was less than 1. Because the control of PC tissues was BPH tissues, 1 stands for the transcription level of EN2 in PC tissues was same as the level in BPH tissues. This result indicated other indexes should be added to make definite diagnosis when the expression level of EN2 is low. All these PC cases in our study were clinically diagnosed, and about 3/25 (12%) cases with low EN2 expression (shown in Table2) should be re-considered to avoid excessive medical treatment, since all these 3 PC patients with low EN2 expression had no lymph node metastasis and good prognosis after excision. For the BPH patients with high level of EN2, regular review should be required since it had possibility for carcinogenesis. Correlation analysis was performed among mTOR, VEGF, EGFR, PTEN and EN2 both in PC and BPH tissues. There were a negative correlation between EN2 and PTEN in 25 PC tissues (R=-0.399, P=0.048) (Figure 5C) and a positive correlation between EN2 and VEGF in 25 BPH tissues (R= 0.47, P=0.019) (Figure 5D). Since PTEN is a tumor suppressor protein proven in several tumors and VEGF is an inflammatory cytokine related to hyperplasia and tumor, EN2 has been confirmed to be positively related to the carcinogenesis of prostatic diseases. EN2 had positive correlation with PC clinical staging. The results above indicated that EN2 has different expression level and distribution in PC and BPH. To further confirm the relationship between EN2 and the progression of PC, we analyzed the clinical indicators among these cases (Table 3), and the correlation between EN2 immunohistochemical scores and clinical indicators in PC (Table 4). As shown in Table 3, only lymphocyte count between BPH and PC groups was significantly different (P=0.001). Peripheral blood lymphocyte number in PC group was higher than that in BPH group. Through Mann-Whitney U Test, the difference of PSA and EN2 immunohistochemical scores between PC and BPH groups were statistically significant (P <0.0001). The PSA and EN2 immunohistochemical scores in PC group were higher than those in BPH group. As shown in Table 4, there was a positive correlation between EN2 immunohistochemical score and PC clinical staging, with the correlation coefficient of 0.428 and the P value of 0.033. And more advanced clinical staging, higher EN2 immunohistochemical scoreclinical staging. Clinical staginging was based on the AJCC guidelines for prostate cancer. EN2 was correlated with clinical stage could be proven from one sight. In this study, neutrophil or lymphocyte infiltration were found in some cases, where the EN2 expression also could be detected. One patient with neutrophil infiltration was at clinical stage IV, and one patient with lymphocyte infiltration was at clinical stage II. The distribution, morphology and expression level of EN2 were also different in these two cases. As shown in the previous studies, prognosis of tumor tissues infiltrated by neutrophil was poor, while that of tumor tissues infiltrated by lymphocytes was good [13,14]. In Figure 6A, high expression level of EN2 and cell heteromorphosis were indicated by the red arrows. Numerous lobulated neutrophils in capillaries (indicated by the red arrow) could be observed in Figure 6C, the same tissues as in Figure 6A but were stained with HE . The PC patient at clinical stage IV was relapsed one month after resection. The expression level of EN2 was low In another case shown in Figure 6B, whose . glandular morphology was intact and EN2 distributed on the edge of the glandular cells ,indicated by the red arrow. A large amount of lymphocyte infiltration could be observed (indicated by the red arrow) in Figure 6D, the same tissue as in Figure 6B were stained with HE. This PC patient at clinical stage II had never relapsed in one year since recovery and never been subjected to hormonotherapy. Discussion BPH and PC are progressive diseases [15]. Accurate diagnosis can not only improve the cancer treatment but also avoid clinical overtreatment. EN2 expression pattern and level change as the prostatic disease progresses. Continuous monitoring of EN2 might be a helpful method for prognosis judgment. The EN2 Helix 3 has been confirmed to be the main functional structural domain of the protein, mediating its exocrine and internalization [16, 17]. Some studies have reported that antibodies against this domain of EN2 were found inPC patients’ urine [10, 11, so the monoclonal antibody against EN2 Helix 3 could be used to detect EN2 expression in BPH and PC . EN2 had been well studied in the field of neurodevelopment. It was found to mostly express in the nuclei of cerebellar tissue. Interestingly, in this study we have found that EN2 in PC mainly expressed on cytomembrane or expressed as an exocrine expression, while EN2 in BPH mostly expressed in cytoplasm and nuclei. Furthermore, the expression level of EN2 in PC was higher than that in BPH. This interesting finding can help doctors to judge the progress of prostatic diseases and help scientists to understand the characteristics of EN2 in different tissues. However, the precise criteria of EN2 to define PC or BPH can't been given from this study because of the limited samples. It is noteworthy that the subcellular distribution of EN2 in PC cell lines and PC tissues were not exactly the same. Cytoplasm staining pattern was observed in all three PC cell lines which was usually seen in BPH tissues. Weak nucleus staining pattern in all three PC cell lines was usually in PC tissues. But strong cytomembrane staining pattern was only observed in prostatic malignant tissues. EN2 itself is a transcription factor that interacts with DNA and is supposed to exist in the nucleus for normal cells. Because the expression and characteristic of EN2 could change due to the change of cell proliferation , EN2 could be secreted into the cytoplasm and even extracellular in cancer cells [18,19]. Some studies have reported that LNCap, DU145 and PC3 cells represent three different stages of prostate cancer [20-22], but in this study, no significant differences of EN2 in the subcellular localization was found among these three cell lines. It is possible that the number of passages and the artificial medium conditions in vitro led to changes in the original tumor malignancy of the cell lines. Limited to the sample number, no statistical difference between any two clinical indexes was found, except for significant difference between EN2 and the clinical stagings of PC. This result further confirmed the difference of EN2 expression level and patterns between BPH and PC could suggest the progress and prognosis of prostatic diseases. Studies with more clinical samples are needed to confirm our new finding and set up a precise criteria for using EN2 as a biomarker in prostatic diseases. Conclusions HOX family plays a key role in cell proliferation. EN2, one member in HOX family, was found to have different expression levels and patterns in PC and BPH, and its expression level was positively correlated with the PC clinical staging, suggesting its use to predict prostatic disease progression. List of Abbreviation EN2 Engrailed-2 PSA Prostate-specific antigen PC Prostate cancer BPH Benign prostatic hyperplasia RT-qPCR Reverse Transcription quantitative Polymerase Chain Reaction WB Western Blotting ELISA Enzyme-linked immunosorbent assay LUTS Lower urinary tract symptoms HOX Homeobox DNA DeoxyriboNucleic Acid RFP Red fluorescent protein PEI Polyethylenimine linear DMEM Gibco Dulbecco's Modified Eagle Medium PBS Phosphate buffer saline BSA Bovine serum albumin FITC Fluorescein isothiocyanate EDTA Ethylene Diamine Tetraacetic Acid DAB Diaminobenzidine HE Hematoxylin-eosin GAPDH Glyceraldehyde-3-phosphate dehydrogenase SDS-PAGE Dodecyl sulfate,sodium salt-Polyacrylamide gel electrophoresis mTOR Mechanistic target of rapamycin kinase VEGF Vascular endothelial growth factor EGFR Epidermal growth factor receptor PTEN Gene of phosphate and tension homology deleted on chromsome ten Declarations Ethics approval and consent to participate Ethics Statement This study involving human participants was approved by the ethics committee of The First Affiliated Hospital of Zhengzhou University. The audit number of ethics committee was 2019-KY-185. Written consent was obtained from all human participants. The research was carried out according to the principles expressed in the Declaration of Helsinki. Consent for publication Written informed consent for publication has been obtained from all participants. Availability of data and material The authors declare that they have no competing interests. Competing interests No conflict of interest exits in the submission of this manuscript, and the manuscript has been approved by all authors for publication. Funding This research was supported by Key Scientific Research Projects of Institutions in Henan Province, China. Grant number was 18A320014. The funder had a role in patient sample collection. Authors' contributions QL and BQ conceived and designed the study. YS, RS, JH, JHH and MX performed the experiments. CW and LY collected the patient samples. JH wrote the paper. QL and GC reviewed and edited the manuscript. All authors read and approved the final manuscript. Acknowledgements Not applicable References [1]. Grozescu, T ., et al., Prostate cancer between prognosis and adequate/proper therapy. J Med Life , 2017.10:p.5-12. [2]. Barry, MJ ., et al., Prevention of Prostate Cancer Morbidity and Mortality: Primary Prevention and Early Detection. Med Clin North Am, 2017. 101:p.787-806. [3]. Sebesta, EM ., et al., The Surgical Management of Prostate Cancer. Semin Oncol, 2017. 44:p.347-357. [4]. Wallis, CJD ., Surgery Versus Radiotherapy for Clinically-localized Prostate Cancer: A Systematic Review and Meta-analysis. Eur Urol, 2016.70:p.21-30. [5]. Andriole, G.L., et al., Mortality results from a randomized prostate-cancer screening trial. N Engl J Med, 2009. 360(13): p. 1310-9. [6].Dai, X., et al., Benign Prostatic Hyperplasia and the Risk of Prostate Cancer and Bladder Cancer: A Meta-Analysis of Observational Studies. Medicine (Baltimore), 2016. 95(18): p. e3493. [7]. Mokhtari, M ., et al., The Prevalence of Prostatic Stromal Tumor of Uncertain Malignant Potential in Specimens Diagnosed as Prostatic Hyperplasia. Arch Iran Med, 2016.19(7):p.488-90. [8].Morgan, R., et al., Targeting HOX/PBX dimers in cancer. Oncotarget, 2017. 8(19): p. 32322-32331. [9].Lai, C.Y., et al., Engrailed-2 might play an anti-oncogenic role in clear-cell renal cell carcinoma. J Mol Histol, 2016. 47(3): p. 229-37. [10].McGrath, SE., et al., EN2 in Prostate Cancer. Adv Clin Chem, 2015.71:p.47-76. [11].Pandha, H., et al., Urinary engrailed-2 (EN2) levels predict tumour volume in men undergoing radical prostatectomy for prostate cancer. BJU Int, 2012. 110(6 Pt B): p. E287-92. [12].Carlier, L., et al., Investigation of homeodomain membrane translocation properties: insights from the structure determination of engrailed-2 homeodomain in aqueous and membrane-mimetic environments. Biophys J, 2013. 105(3): p. 667-78. [13].Watanabe, A., et al., Absolute Neutrophil Count Predicts Postoperative Prognosis in Mass-forming Intrahepatic Cholangiocarcinoma. Anticancer Res, 2019. 39(2): p. 941-947. [14].Kim, J., et al., Tumor-Associated Macrophages and Neutrophils in Tumor Microenvironment. Mediators Inflamm, 2016. 2016: p. 6058147. [15] Donnel, RF ., et al., Benign prostate hyperplasia: a review of the year's progress from bench to clinic. Curr Opin Urol, 2011. 21(1):p.22-6. [16].Joliot, A., et al., Identification of a signal sequence necessary for the unconventional secretion of Engrailed homeoprotein. CurrBiol, 1998. 8(15): p. 856-63. [17].Logan, C., et al., Cloning and sequence comparison of the mouse, human, and chicken engrailed genes reveal potential functional domains and regulatory regions. Dev Genet, 1992. 13(5): p. 345-58. [18].McGrath, S.E., et al., Engrailed-2 (EN2) - a novel biomarker in epithelial ovarian cancer. BMC Cancer, 2018. 18(1): p. 943. [19]. Natasha, P., et al., Membrane insertion and secretion of the Engrailed-2 (EN2) transcription factor by prostate cancer cells may induce antiviral activity in the stroma. Sci Rep, 2019. 9(1): p. 5138. [20]. Eugenia Scaccianoce, et al., Characterization of Prostate Cancer DU145 Cells Expressing the Recombinant Androgen Receptor. Oncology Research, 2003. 14,:p. 101–112. [21]. Saleh Altuwaijri, et al., Expression of human AR cDNA driven by its own promoter results in mild promotion, but not suppression, of growth in human prostate cancer PC-3 cells. Asian J Androl, 2007. 9 (2): p.181–188. [22].Jin Li, et al., SHARPIN overexpression induces tumorigenesis in human prostate cancer LNCaP, DU145 and PC-3 cells via NF-jB/ERK/Akt signaling pathway. Med Oncol, 2015. 32(1). Tables Table 1 qPCR primers Targets F R EGFR ACGGGGTGACTGTTTGGGAGTT ACTTTGGGCGACTATCTGCGTCT VEGF GGCAGAAGGAGGAGGGCAGAAT CATCGCATCAGGGGCACACA EN2 CTACTGTACGCGCTACTCGG CCCGTGGCCTTCTTGATCTT mTOR TGGACACCAACAAGGACGAC GTCCCACTGACCTAAACCCC pTEN TGGGGAAGTAAGGACCAGAGACAAAA TGGCAGACCACAAACTGAGGATTG GAPDH TCGGAGTCAACGGATTTGGT TTCCCGTTCTCAGCCTTGAC Table 2 EN2 immunohistochemical scores of BPH and PC BPH(n=25) PC(n=25) P Negative 13(52%) 0 <0.001* Positive 12(48%) 25 Mild 5(20%) 3(12%) <0.001* Moderate 4(16%) 4(16%) Strong 3(12%) 18(72%) *Fisher’s Exact Test Table 3 Clinical indicators of PC and BPH Parameters PC(n=25) Mean±SD BPH(n=25) Mean±SD t/U P Age(years) 67.80±7.41 66.12±5.019 0.939 0.352 Smoking history(%) 10(40%) 7(28%) 0.802 0.370** drinking history(%) 9(36%) 7(28%) 0.368 0.544** White Blood Cell Count(×10 9 /L) 6.36±1.93 5.91±1.46 0.930 0.357 Platelets Count(×10 9 /L) 201.68±67.20 170.60±63.58 1.680 0.099 Neutrophil Count(×10 9 /L) 3.70±1.57 3.66±1.33 -0.068 0.946* Lymphocyte Count(×10 9 /L) 1.89±0.63 1.18±0.74 3.636 0.001 Monocyte Count(×10 9 /L) 0.54±0.18 0.50±0.19 -0.903 0.367* PSA(ng/ml) 88.76±97.36 2.90±1.47 -6.066 <0.0001* Immunohistochemical staining score of EN2 3.34±0.96 1.10±1.39 -4.472 <0.0001* *Mann-Whitney U Test **Chi-square Test Table 4 Correlation between EN2 immunohistochemical scores and clinical indicators in PC Clinical indicators r P PC clinical stage 0.428 0.033 Gleason 0.040 0.849 PSA 0.108 0.606 Age -0.148 0.479 Smoking history 0.238 0.252 drinking history 0.241 0.246 White Blood Cell Count -0.230 0.268 Platelets Count 0.022 0.916 Neutrophil Count -0.282 0.172 Lymphocyte Count -0.015 0.942 Monocyte Count -0.028 0.895 Supplementary Files WB3.jpg renamedb1745.jpg EN2SDS.jpg Cite Share Download PDF Status: Published Journal Publication published 15 Jun, 2020 Read the published version in BMC Cancer → Version 3 posted Review # 3 received at journal 07 May, 2020 Editorial decision: Minor revision 07 May, 2020 Review # 2 received at journal 02 May, 2020 Reviewer # 2 agreed at journal 23 Apr, 2020 Reviewer # 3 agreed at journal 23 Apr, 2020 Reviewer # 1 agreed at journal 22 Apr, 2020 Review # 1 received at journal 22 Apr, 2020 Editor assigned by journal 20 Apr, 2020 Reviewers invited by journal 20 Apr, 2020 Submission checks completed at journal 19 Apr, 2020 Editor invited by journal 19 Apr, 2020 You are reading this latest preprint version Show more versions Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5302","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research article","associatedPublications":[],"authors":[{"id":507824,"identity":"a74b87aa-0d75-4720-8d16-9d56f99dbaef","order_by":1,"name":"Qi Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtklEQVRIiWNgGAWjYDACZgY2IGkD4fCQoCWNFC0MYC2HSdBi3s787MGHivP28jMSGB+8bWOQNyekReYwm7nhjDO3mRlnJDAbzm1jMNzZQECLBDMPmzRv2202ZokEEIMhweAAMVr+/jvHwyaRwP6beC2MDQckeIC2MBOphc1MsudYsoEEz8NmyTnnJAw3ENTCf/iZxI8aO3v59uSDH96U2cgTtAUJMDaAjCBe/SgYBaNgFIwC3AAArtwxZ1TCkAsAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-7380-8703","institution":"The first Affiliated Hospital of Zhengzhou University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Qi","middleName":"","lastName":"Li","suffix":""},{"id":507825,"identity":"47466970-1cf9-496d-ae38-383492b42586","order_by":2,"name":"Yibo Shi","email":"","orcid":"","institution":"First Affilated Hospital of Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yibo","middleName":"","lastName":"Shi","suffix":""},{"id":507826,"identity":"f4bb454c-8070-4103-b617-577b543adc36","order_by":3,"name":"Rigai Sa","email":"","orcid":"","institution":"Beijing Gegen Biotechnology co.,Ltd","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Rigai","middleName":"","lastName":"Sa","suffix":""},{"id":507827,"identity":"e43d3043-8722-4b07-9787-8aa0660e484e","order_by":4,"name":"Jun Hao","email":"","orcid":"","institution":"Purdue University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jun","middleName":"","lastName":"Hao","suffix":""},{"id":507828,"identity":"0d6671c3-eb8b-4c2e-9fb4-b2abd384a618","order_by":5,"name":"Jinhao Hu","email":"","orcid":"","institution":"First Affiliated Hospital of Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jinhao","middleName":"","lastName":"Hu","suffix":""},{"id":507829,"identity":"3b390bc4-52f7-48af-b0e0-597274be46b8","order_by":6,"name":"Mulun Xiao","email":"","orcid":"","institution":"First Affiliated Hospital of Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mulun","middleName":"","lastName":"Xiao","suffix":""},{"id":507830,"identity":"b0b923eb-62c9-4df9-b054-f09b3d3f9a97","order_by":7,"name":"Chaoliang Wang","email":"","orcid":"","institution":"First Affiliated Hospital of Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Chaoliang","middleName":"","lastName":"Wang","suffix":""},{"id":507831,"identity":"0ea20542-f481-4eef-830c-594d13bbb528","order_by":8,"name":"Liang Yan","email":"","orcid":"","institution":"First Affiliated Hospital of Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Liang","middleName":"","lastName":"Yan","suffix":""},{"id":507832,"identity":"dcdf41f4-e876-4e19-a079-495086149d97","order_by":9,"name":"Baoping Qiao","email":"","orcid":"","institution":"First Affiliated Hospital of Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Baoping","middleName":"","lastName":"Qiao","suffix":""},{"id":507833,"identity":"511ff409-678b-4673-81aa-40ac1490fca9","order_by":10,"name":"Guoxun Chen","email":"","orcid":"","institution":"University of Tennessee Knoxville","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Guoxun","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2019-09-13 14:58:42","currentVersionCode":3,"declarations":"","doi":"10.21203/rs.2.14625/v3","doiUrl":"https://doi.org/10.21203/rs.2.14625/v3","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12885-020-07049-z","type":"published","date":"2020-06-15T12:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":1005619,"identity":"28e2a7a7-feb7-4ec8-8c5a-796402ba3a94","added_by":"auto","created_at":"2020-04-30 22:32:16","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":6494804,"visible":true,"origin":"","legend":"A. Simulation structure of EN2. B. C-terminal of EN2 used as immunogen. C. Total proteins of 293T transfected with or without EN2-RFP-expressing plasmid. Lane M was the protein marker, lane \"EN2-RFP+\" was 293T cell transfected with EN2-RFP, as the arrow points out, the band was the EN2-RFP fusion protein. Lane \"EN2-RFP-\" was the total 293T cell protein. D. Western blot analysis of extracts from 293T cells with or without transfection of EN2-RFP by homemade EN2 monoclonal antibody. The lane on the left was 293T cells with EN2-RFP fusion protein (+) while the lane on the right was 293T cells without EN2-RFP fusion protein (-). The molecular weight of EN2-RFP fusion protein was 40 KDa while the molecular weight of endogenous EN2 was 33 KDa. E. WB of EN2 in LNCap, DU145 and PC3 cell lines blotted with homemade EN2 monoclonal antibody. Total cell proteins were extracted and used. Only one bande at 33 KDa appeared in extracts of all three PC cell lines. F. Immunofluorescence assay with homemade EN2 monoclonal antibody. From left to right: the image \" EN2-RFP \" was 293T cells transfected with EN2-RFP, the image \"anti-EN2-FITC\" was 293T cells stained with homemade EN2 monoclonal antibody, the image \"isotype antibody\" was 293T cells stained with an control antibody, the image \"merge\" was merged image of \" EN2-RFP \" and \"anti-EN2-FITC\" or \"isotype antibody\". Zoom in×400. EN2-RFP fusion protein gave off red fluorescence, EN2 monoclonal antibody gave off green fluorescence since FITC was labeled at the second detection antibodies, the merged region in \"merge\" turned yellow in color. These experiments were repeated independently 3 times with similar results.","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5302/v3/Figure1.jpg"},{"id":1005621,"identity":"a089f534-7598-41c4-a444-16155fefc3e9","added_by":"auto","created_at":"2020-04-30 22:32:16","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":21317474,"visible":true,"origin":"","legend":"Subcellular localization of exogenous and endogenous EN2 proteins in three PC cell lines. From top to bottom were LNCap, DU145, PC3 cell lines. From left to right: the images \" EN2-RFP \" were LNCap, DU145, PC3 cell lines transfected with EN2-RFP, the images \"Anti-EN2-FITC\" were LNCap, DU145, PC3 cell lines stained with homemade EN2 monoclonal antibody, the image \"isotype antibody\" was a negative control, the images \"merge\" were merged images of \" EN2-RFP \" and \"Anti-EN2-FITC\" or \"isotype antibody\". In the left panel, exogenous EN2-RFP fusion protein gave off red fluorescence. In the middle panel, EN2 recognized by the monoclonal antibody gave off green fluorescence while no green fluorescence was detected when isotype antibody used as a negative control. Exogenous EN2-RFP fusion protein showed bright green while endogenous EN2 protein showed weak green stained with EN2 monoclonal antibody. Exogenous EN2-RFP fusion protein distributed in nucleus while the nucleus without exogenous EN2-RFP fusion protein showed as dark hole. The right panel was the merged images of left and middle panel. The sites with yellow color was the overlay of bright green and red color. The magnification of all image was 1000×. These experiments were repeated independently 3 times with similar results.","description":"","filename":"figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5302/v3/figure2.jpg"},{"id":1005623,"identity":"9bdb0c46-9ce0-425a-9213-26d8f4ba4b67","added_by":"auto","created_at":"2020-04-30 22:32:17","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":53456876,"visible":true,"origin":"","legend":"Representative EN2 immunohistochemical images of PC and BPH. A. Representative PC and BPH slices. The upper 3 were BPH slices, the lower 3 were PC slices. Zoom in ×40. B. Two representative BPH slices with strong staining of EN2 and one negative BPH slice with isotype antibody. The staining patterns of EN2 in the left panel was mainly cytomembrane staining, with clear boundaries and sharp contours among cells. There was shallow staining inside the cells, but nuclear membrane of glandular epithelial cells in the basal part of the prostate gland was obviously stained. \"I\" was neovascularization endothelial membrane stained with EN2 antibody. \"II\" was glandular epithelial membranes, nucleus and nuclear membrane (indicated by the red arrow) stained with EN2 antibody. In the middle panel, strong staining in glands was shown. \"III\" wa's glandular epithelial cytoplasm stained with EN2 antibody. \"IV\" was nuclear staining in interstitial tissue. The positive staining cells with round nucleus confirmed by the HE staining were infiltrating lymphocytes. In the right panel, negative BPH slice stained with an isotype antibody. C. Two representative PC slices stained with EN2 antibody and one negative PC slice stained with isotype antibody. The EN2 staining sites were mainly focused on the glandular epithelial membrane, glandular cells were well-defined honeycomb-like. \"V\" and \"VI\" were cytomembrane staining of EN2 on glandular epithelium cells. \"VII\" was nuclear membrane staining of EN2 on glandular epithelium cells (indicated by the red arrow). \"VIII\" was EN2 staining on tumor neovascularization endothelial cells.","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5302/v3/Figure3.jpg"},{"id":1005625,"identity":"faa39635-13a8-4260-a6c1-67928d5e3f16","added_by":"auto","created_at":"2020-04-30 22:32:19","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":67256650,"visible":true,"origin":"","legend":"Nucleus expression of EN2 in cerebellar tissues. A Representative cerebellar slice stained with EN2 antibody. B Representative cerebellar slice stained with isotype antibody as a negative control. Left panel was magnified at 40×. Right panel was magnified at 400×. Positive nucleus staining was indicated by the red arrow.","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5302/v3/Figure4.jpg"},{"id":1005626,"identity":"62876876-00eb-45ec-8d8e-340c8e53d2d2","added_by":"auto","created_at":"2020-04-30 22:32:19","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1377347,"visible":true,"origin":"","legend":"RT-PCR assay of mTOR, PTEN, VEGF, EGFR and EN2. A. Relative transcription level of mTOR, PTEN, VEGF, EGFR and EN2 in 25 PC cases. B. Relative transcription level of mTOR, PTEN, VEGF, EGFR and EN2 in 25 BPH cases. Each dot represented one case. The mean of relative transcription level of EN2 was the significant highest among the mean of relative transcription level of the other four targets both in PC and BPH cases (P\u003c0.01). C. The negative correlation between PTEN and EN2 in 25 PC cases (R=-0.399, P=0.048). D. The positive correlation between VEGF and EN2 in 25 BPH cases (R=-0.47, P=0.019).","description":"","filename":"figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5302/v3/figure5.jpg"},{"id":1005627,"identity":"07f58aa3-eede-49db-b35e-1adef574d6f6","added_by":"auto","created_at":"2020-04-30 22:32:20","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":6822288,"visible":true,"origin":"","legend":"EN2 expression and immune cell infiltration in two PC cases. A. Strong EN2 staining in PC slice. There were clear and deep staining in linear boundaries of basilar and lumen sides (indicated by the red arrow). Gland structure was heterogeneous. B. Moderate EN2 staining in PC slice. There were strong EN2 staining in lumen sides. EN2 distribution in lumen sides showed ascending form with obvious polarized distribution (indicated by the red arrow). C and D were corresponding HE staining to A and B. There were numerous neutrophils infiltration (shown in C) and lymphocytes infiltration (shown in D), neutrophils mainly distributed in the blood vessels, while lymphocytes mainly distributed in the interstitial indicated by red arrow.","description":"","filename":"figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5302/v3/figure6.jpg"},{"id":13500946,"identity":"1b3c92af-a366-4ac1-b817-c32fa96ecd27","added_by":"auto","created_at":"2021-09-16 23:08:30","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1165968,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5302/v3/f75d9543-dcdf-4ade-8f89-5ea73ebd8bdd.pdf"},{"id":1005624,"identity":"2dd0e99a-ef5c-400a-bf73-81fb53a429d3","added_by":"auto","created_at":"2020-04-30 22:32:18","extension":"jpg","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":1857149,"visible":true,"origin":"","legend":"","description":"","filename":"WB3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5302/v3/WB3.jpg"},{"id":1005622,"identity":"76b8effe-25c9-46fb-9236-62ed00dfcffd","added_by":"auto","created_at":"2020-04-30 22:32:17","extension":"jpg","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":110783,"visible":true,"origin":"","legend":"","description":"","filename":"renamedb1745.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5302/v3/renamedb1745.jpg"},{"id":1005620,"identity":"1c0f9d1a-1118-4e28-84d6-9d4138e930fb","added_by":"auto","created_at":"2020-04-30 22:32:16","extension":"jpg","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":65629,"visible":true,"origin":"","legend":"","description":"","filename":"EN2SDS.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5302/v3/EN2SDS.jpg"}],"financialInterests":"","formattedTitle":"Altered staining patterns and expression level of Engrailed-2 in Benign prostatic hyperplasia and Prostate Cancer predict Prostatic disease progression","fulltext":[{"header":"Background","content":"\u003cp\u003eProstate cancer (PC) is the most common cancer diagnosed among males in the US and the second cause of cancer death in men [1]. The extremely high morbidity and mortality make PC one of the most serious threats to men\u0026rsquo;s health [2]. Nowadays, the PC treatments only rely on surgery or radiotherapy when the cancer is still in the localized stage [3, 4]. Thus the survival rate would be commonly improved if PC could be diagnosed in the early stage. Although there has been vast of progress in understanding PC pathobiology, there is no approved test for the diagnosis and monitoring of PC except for prostate-specific antigen (PSA) test. However, PSA is not used widely as a diagnostic marker for PC due to its low specificity and sensitivity [5].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBenign prostatic hyperplasia (BPH) is a kind of prostatic nonmalignant hyperplasia and may cause serious symptoms such as lower urinary tract symptoms (LUTS) which undermines patients' life quality [6]. Meta-analyses data shows BPH is associated with an increased incidence of prostate cancer and these two prostatic diseases have certain similar traits such as androgen-dependent growth or response to hormonal therapy, which lead to overtreatment or delayed treatment of the diseases[6,7]. To judge the state of prostatic disease better, new biomarkers are needed to show some meaningful clues in the process of prostate diseases.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eRecently, studies have shown that the dysregulation of homeobox (HOX) gene family occurs in many cancers, including solid and hematological malignancies [8]. Engrailed-2 (EN2), a member of the HOX gene family, has been found to overexpress in various kinds of cancers like PC, breast cancer and bladder cancer, and play important roles in oncogenesis [8, 9]. It has been reported that positive detection of EN2 in patients\u0026rsquo; urine with ELISA was predictive of PC with high sensitivity and specificity (66% and 88.2% respectively) [10]. Moreover, a strong positive correlation was shown not only between pre-surgical level of urinary EN2 and the volume of cancerous tissues removed in prostatectomy, but also between EN2 levels and tumor stages[11]. Since EN2 can be detected in urine after prostate carcinogenesis, intracellular EN2 may change \u0026nbsp;to secretory form because normal prostate tissue and hypertrophic prostatic cells do not secrete EN2 [10,11]. All these results suggest a potential for EN2 as a candidate biomarker in early detection of PC or the differential diagnosis for PC and BPH.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eStructurely, the full length of EN2 protein has 333aa, including three alpha helices,with the helix 1 and 2 at the N end binding DNA, and helix 3 at C end,mainly mediating the exocrine and internalization of EN2 protein [12,19]. We produced a monoclonal antibody targeting Helix 3 in EN2,and conducted immunohistochemical staining with this homemade antibody to detect EN2 expression patterns in 25 BPH and 25 PC cases. EN2 Helix 3 The EN2 expression levels of these cases were confirmed by RT-PCR. We also analyzed the EN2 immunohistochemical scores, the clinical indicators, and their correlation in PC cases and found the expression level of EN2 was positively correlated with PC clinical progress.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eEthics Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study involving human participants was approved by the ethics committee of The First Affiliated Hospital of Zhengzhou University. The audit number of ethics committee was 2019-KY-185. Written consent was obtained from all human participants. Research was carried out according to the principles expressed in the Declaration of Helsinki.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePatients and samples\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eClinical samples and patient records corresponding to 50 consecutive patients diagnosed as PC or BPH at the Urology Department of The First Affiliated Hospital of Zhengzhou University between January 2017 and October 2018 were examined. The inclusion criteria were as following: (1) Only patients who came to our hospital for the first time for examination and diagnosis were collected; (2) No other systemic tumors, severe infection and trauma; (3) One week before the examination of serum PSA, there was no indwelling catheterization, cystoscopy, digital rectal examination and other operations affecting the result of serum PSA and inflammatory indicators; (4) No endocrine treatment; (5) No coagulation dysfunction, serious cardiovascular and cerebrovascular diseases. Patients underwent Laparoscopic radical prostatectomy and cancer or hyperplasia samples were split in half immediately after resection. One half was embedded with paraffin, and the other half was immediately snap-frozen in liquid nitrogen for RT-PCR analyses. All the samples used were confirmed by a pathologist.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Culture and Experimental Reagents\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman PC cell lines,LNCaP, DU145 and PC3, were obtained from ATCC. LNCap cells were cultured with Roswell Park Memorial Institute (RPMI) 1640 medium (#11875093, Gibco, USA. DU145 cells were cultured with Dulbecco\u0026rsquo;s Modified Eagle\u0026rsquo;s Medium (DMEM) (#11995040, Gibco, USA) And PC3 cells were cultured with DMEM/F12 (#11330057, Gibco, USA). Human embryonic kidney\u0026nbsp;cell line (293T) was preserved in our laboratory. 293T cells were cultured with DMEM. The culture medium was supplemented with 10% fetal bovine serum (#16140089, Gibco, USA), 100 U/ml penicillin and 100 \u0026mu;g/ml streptomycin (#15070063, Gibco, USA) when used and cells were incubated at 37\u0026deg;C in a humidified incubator with 5% CO2.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePreparation of monoclonal antibodies against Engrailed-2\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eC-terminal 114aa of EN2 was selected according to EN2 mRNA sequence (NCBI Reference Sequence: NM_001427.3) to prepare the EN2 monoclonal antibodies. Briefly, the gene encoding C-terminal 114aa of EN2 was synthesized in Sangon Biotech (Shanghai, China) Co., Ltd. A hexahistidine tag was added to the carboxyl terminus to aid in the detection and purification of the final protein product. The resulting gene was cloned into the expression vector pET30a and transformed into\u003cem\u003e E. coli\u003c/em\u003e strain \u003cem\u003eBL21(\u0026lambda;DE3)\u003c/em\u003e. Single bacterial colony was inoculated into LB medium and grown at 37˚C to OD600 of 0.6. Expression of the recombinant EN2C protein was induced with 0.1 mM isopropyl \u0026beta;-D-1-thiogalactopyranoside at 37˚C for 4 hours. The culture mixture was centrifuged at 2000 \u0026times; g for 15 minutes, and supernatant was collected. Soluble EN2 C-terminal 114aa was purified by Ni+ affinity column and used to immunize Balb/c mice. The spleenocytes from the immunized Balb/c mice were obtained and fused with Balb/c mouse myeloma cells by hybridoma technique, and monoclonal antibodies were obtained by screening. The affinity and specificity of EN2 monoclonal antibodies were identified through ELISA, WB, immunofluorescence and immunohistochemistry.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blotting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEN2 protein or cell total protein were run WB to identify specificity of EN2 monoclonal antibody. Three prostate cancer cell lines, PC3, DU145, LNcap and transfected 293T cell were used. Cells grown in a 100 mm cell culture dish were rinsed with PBS buffer prior to harvesting. Total proteins were extracted with Cell Culture Lysis 1\u0026times;Reagent (#53711-5399, Promega Inc., USA) according to the product instruction and incubated on ice for 10 minutes. The cell lysate was separated by centrifugation at 12,000 x g for 2 minutes. The protein concentation was measured by BCA Protein Assay Reagent (#PC0020, Solarbio Inc., China). For SDS‑PAGE, a total of 20 \u0026micro;g of protein was loaded per well. Polyvinylidenedifluoride (PVDF) membranes (Roche Diagnostics, USA) were used for the transfer process. For WB, PVDF membranes after protein transfer were incubated in 5% skimmed milk blocking buffer for 1 hour, followed by washing 3 times with PBST (buffered saline plus 0.05% Tween 20). EN2 was detected using the monoclonal antibody and horseradish peroxidase-conjugated goat anti-mouse IgG secondary antibody (1:10,000; #ZB-2305; ZSGB-BIO Inc., China).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunofluorescence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe recombinant pcDNA3.1-EN2-Red fluorescent protein (RFP) was transfected into 293T or prostate cancer cell lines,PC-3, DU-145 or LNCap, using PEI (polyethylenimine linear, #23966, Polysciences Inc., USA). After incubating at 37˚C, 5% CO\u003csub\u003e2\u003c/sub\u003e for 6 hours, the culture medium was replaced with DMEM complete medium and cultured for another 24 hours. The culture medium was aspirated, and cells were fixed by incubating with 4% paraformaldehyde (#P1110,Solarbio Inc., China) for 15 minutes at room temperature. After washing twice in PBS buffer, freshly prepared 0.2% Triton X-100 (#T8200, Solarbio Inc., China) was added and incubated for 10 minutes at room temperature. Block with 5% BSA for 30 minutes. The monoclonal antibody of EN2 was added and incubated at 37˚C for 2 hours. The Goat anti-mouse IgG/FITC (#SF131, Solarbio Inc., China) \u0026nbsp;was added and incubated for 35 minutes at 37˚C in the dark. After washing twice with PBS, it was observed under a fluorescence microscope.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunohistochemical Staining of EN2 in PC or BPH tissues\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBriefly, all paraffin embed PC tissues were cut into 3 \u0026mu;m sections. The slides were deparaffinized by heating at 60\u0026deg;C and then immersed in xylene and rehydrated. The sections were boiled in 1 mM EDTA buffer solution (pH 9.0) for 20 minutes in a pressure cooker. Subsequently, endogenous peroxidase activity was quenched by immersing the samples in 3% hydrogen peroxide for 10 minutes. Each section was blocked in Tris-buffered saline with Tween20/5% normal goat serum (#ZLI-9022, ZSGB-Bio Inc., China) for 1 hour at room temperature to block nonspecific binding. Then the sections were incubated with anti\u0026ndash;EN2 monoclonal antibody at 37˚C for 60 minutes. Subsequently, a secondary biotinylated horse anti-mouse IgG solution (#ZB-2020, ZSGB-Bio Inc., China) and an avidin-biotin peroxidase reagent (#SPN9002, ZSGB-Bio Inc., China) were added onto the slides. The negative control sample was treated identically but with the isotype antibody. The color reaction was visualized by incubating with DAB solution (#ZLI-9017, ZSGB-Bio Inc., China) for 5 minutes. After washed thoroughly, the slides were placed in hematoxylin for redyeing. After dehydration with xylene and ethanol, the slides were sealed with neutral gum. For HE staining, the slides were placed in xylene and ethanol solution for dewaxing and hydration. After staining with hematoxylin for 5 minutes, the slides were rinsed for 10 minutes, and stained with 0.5% eosin aqueous solution for 1 minute. After dehydration with xylene and ethanol, the slides were sealed with neutral gum.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEvaluation of Immunohistochemical Staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eImages were captured by a fluorescence microscope (Olympus DP74) and analyzed with the assistance of a histopathologist. The observer was blinded to the clinical diagnosis of the tissues at the time of assessment. A total of 100 cells were counted in 10 random fields (with \u0026times;400 objectives) and the percentage of positive cells was calculated. The semi-quantitative immunoreaction scoring system was evaluated based on the percentage of positive cells and \u0026nbsp;the stain intensity. Regarding stain intensity, negative staining was defined as 0, mild positive was defined as 1, moderate positive as 2 and strong positive as 3. The scores of immunopositive cells were defined as follows: \u0026lt;5% immunopositive cells was defined as 0 (negative); 5\u0026ndash;25% immunopositive cells as 1 (mild); 25\u0026ndash;75% immunopositive cells as 2 (moderate); and \u0026gt;75% immunopositive cells as 3 (strong). The immunohistochemical score of each section is the sum of the stain intensity and positive cell scores.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRT-qPCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe EN2 gene expression was measured by reverse transcription quantitative polymerase chain reaction (RT-qPCR). The reverse transcription reaction was performed according to the manufacturer's instructions by PrimeScript\u003csup\u003eTM\u003c/sup\u003e RT reagent Kit (#RR047A, TAKARA, Japan) and the qPCR reactions were performed at 94 ˚C for 5 minutes, 94 ˚C for 20 seconds, 55 ˚C for 20 seconds and 72 ˚C 15 seconds for 30 cycles, followed by 72 ˚C for 5 minutes using 7500 Fast Real-Time PCR System (Applied Biosystems, ThermoFisher Inc., USA). The sequences of the primers are presented in Table 1.\u003c/p\u003e\n\u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0); font-family: Helvetica; font-size: 12px;\"\u003eTable 1 qPCR primers\u003c/span\u003e\u003c/p\u003e\n\u003ctable style=\"width: 4.4e+2pt;border-collapse:collapse;border:none;\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:83.4pt;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eTargets\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:184.25pt;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eF\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:170.1pt;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eR\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:83.4pt;border:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eEGFR\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:184.25pt;border:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eACGGGGTGACTGTTTGGGAGTT\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:170.1pt;border:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eACTTTGGGCGACTATCTGCGTCT\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:83.4pt;border:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eVEGF\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:184.25pt;border:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eGGCAGAAGGAGGAGGGCAGAAT\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:170.1pt;border:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eCATCGCATCAGGGGCACACA\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:83.4pt;border:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eEN2\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:184.25pt;border:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eCTACTGTACGCGCTACTCGG\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:170.1pt;border:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eCCCGTGGCCTTCTTGATCTT\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:83.4pt;border:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003emTOR\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:184.25pt;border:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eTGGACACCAACAAGGACGAC\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:170.1pt;border:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eGTCCCACTGACCTAAACCCC\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:83.4pt;border:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003epTEN\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:184.25pt;border:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eTGGGGAAGTAAGGACCAGAGACAAAA\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:170.1pt;border:none;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eTGGCAGACCACAAACTGAGGATTG\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:83.4pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eGAPDH\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:184.25pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eTCGGAGTCAACGGATTTGGT\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:170.1pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;\"\u003e\n \u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u003cspan style=\"font-size: \n 12px;\"\u003e\u003cspan style=\"font-family: \n Helvetica;\"\u003eTTCCCGTTCTCAGCCTTGAC\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp style='margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:\"Calibri\",sans-serif;'\u003e\u003cspan style=\"color: rgb(0, 0, 0); font-family: Helvetica; font-size: 12px;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\u003cbr\u003e\n\u003cp\u003eThe relative transcription level was presented as 2\u003csup\u003e-\u003c/sup\u003e\u003csup\u003e△△Ct\u003c/sup\u003e of each target in PC tissues relative to BPH tissues. For the first step, we subtracted the transcription level of each target in BPH tissues from the corresponding target level in PC tissues, and got a value as\u0026Delta;Ct. The 2\u003csup\u003e-\u003c/sup\u003e\u003csup\u003e△△Ct\u003c/sup\u003e value was then be calculated at the second step. In BPH tissues, the relative transcription level of each target was obtained by subtracting the transcription level of an internal reference (GAPDH) from the level of each target in BPH tissues to get \u0026Delta;Ct, and the relative transcription levels ,represented as 2\u003csup\u003e-\u003c/sup\u003e\u003csup\u003e△△Ct\u003c/sup\u003e, was then be calculated at the second step.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistics and methods\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData were expressed as mean \u0026plusmn; standard deviation (SD). Data that follow the normal distribution were compared using the t-test, otherwise Mann Whitney U test was used. Counting data was expressed as composition ratio or rate (%), and comparison was made by chi-square test. EN2 immunohistochemical scores in 25 PC and 25 BPH cases were analyzed using Fisher\u0026rsquo;s Exact Test. The correlation between EN2 immunohistochemical score and clinical indicators was analyzed using spearman rank correlation. Data analysis was performed using SPSS 23 software. P \u0026lt;0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eHomemade monoclonal antibody showed EN2 specificity.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe crystal diagram of EN2 protein was shown in Figure 1A. The helix 3 region of EN2 protein was expressed and detected by SDS-PAGE (Figure1B). The band of EN2 Helix 3 , whose size was about 25 KDa, was shown in Figure 1B. The total protein of 293T cells transfected with or without EN2-RFP-expressing plasmid.was shown in Figure 1C, marked with \u0026ldquo;EN2-RFP+\u0026rdquo; and \u0026ldquo;EN2-RFP-\u0026rdquo; , respectively. The band indicated by the red arrow in the lane of \u0026ldquo;EN2-RFP+\u0026rdquo; was the EN2-RFP fusion protein expressed by transfected 293T cells which did not appear in the lane of \u0026ldquo;EN2-RFP-\u0026rdquo;. The endogenous and exogenous EN2 identified by WB using our homemade EN2 monoclonal antibody was shown in Figure 1D, where two bands appeared in \u0026ldquo;EN2-RFP+\u0026rdquo; line while only one band appeared in \u0026ldquo;EN2-RFP-\u0026rdquo; line. The band at 40 KDa was exogenous EN2-RFP which has the same size as the one indicated by the red arrow in Figure 1C. The band at 33 KDa was endogenous EN2 protein in 293T cells. Band of endogenous EN2 in the \u0026ldquo;EN2-RFP+\u0026rdquo; lane was weaker than what in the \u0026ldquo;EN2-RFP-\u0026rdquo; lane, suggesting the expression of exogenous EN2 weakened that of endogenous EN2. It could also be seen that in 293T cells, the expression of endogenous EN2 was quite weak, ompared with the exogenous one. To validate the specificity of our homemade EN2 antibody in prostate cancer cell lines, total cell proteins of LNCap, DU145 and PC3 were used to identify the endogenous EN2 expression by WB, shown in Figure 1E. Only one band at 33 KDa appeared in these three cell lines, with the same size as endogenous EN2 in 293T.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo further validate the antibody specificity, we used the homemade EN2 monoclonal antibody or its isotype control as the first antibody in immunofluorescence to detect the exogenous EN2-RFP fusion protein expressed by transfected 293T cells,\u0026nbsp; and used FITC-labeled anti-mouse IgG polyclonal antibody as the second antibody to get the green positive signals. The 293T cells transfected with EN2-RFP-expressing plasmid turned red in color. The representative images were shown in Figure 1F. Twelve hours after transfection, strong red fluorescence in the nuclei of transfected 293T cells could be observed through a fluorescence microscope, , while no strong red fluorescence was observed on cytomembrane or in cytoplasma. Immunofluorescence results also showed the green signals resulted from EN2 \u0026ndash;EN2 antibody-IgG-FITC complex existed mainly in the cell nuclei. The green signals in immunofluorescence merged well with the red fluorescence from EN2-RFP. As a negative control, the images stained with isotype antibody have no green signals since the isotype antibody could not bind the EN2-RFP transfected protein in 293T cell. All the photos were taken at the magnification of 400\u0026times;.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSubcellular localization of endogenous and exogenous EN2 in LNcap, DU145 and PC3. \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo detect the subcellular localization of endogenous and exogenous EN2 in different types of PC cell lines, LNCap, DU145 and PC3 cell lines which represented different stages of PC, were transfected with EN2-RFP-expressing plasmid and then detected by immunofluorescence using our homemade EN2 monoclonal antibody or its isotype control antibody. Twelve hours after transfection, red fluorescence which indicated the exogenous EN2 could be observed through a fluorescence microscope. Then the cells were fixed and immunostained with our homemade antibody or its isotype control, the FITC labeled second antibody against EN2 monoclonal antibody could indicate all EN2 protein, both endogenous and exogenous EN2, in these cells. The representative images were shown in Figure 2. All the photos were taken at the magnification of 1000\u0026times;.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAs shown in the left panel of Figure 2, the exogenous EN2 with red color only distributed in the nuclei of all three cell lines, and there was almost no exogenous EN2 existed in the cytoplasm. As shown in the middle panel of Figure 2, endogenous EN2 stained with grainy green flurescence distributed in the cytoplasm of three PC cell lines uniformly. And the strong green staining indicating the exogenous EN2 was observed in the nuclei of these three PC cell lines. In those cells not successfully transfected with exogenous EN2, a dark and round nucleus outlined in the cells with weak green signals distributed in the cytoplasm. While in the cells expressing exogenous EN2, the green color was much heavier in nucleus than in cytoplasm. The merged images were shown in the right penal of Figure 2, indicating only successfully transfected cells had strong yellow staining merged in the nucleus. Other cells without EN2-RFP transfection showed no sign of color in the nucleus, there was the only dark image in the nucleus. The results demonstrated different expression patterns of endogenous and exogenous EN2 in PC cells. As nagetive controls , images stained with isotype antibody showed no green signal.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePC tissues have generally stronger EN2 staining on cytomembrane than BPH tissues. \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo detect the expression patterns of EN2 in PC and BPH tissues, we performed immunohistochemical staining to a series of paraffin-embedded slices from human prostatic samples collected as previously described, and evaluated the staining results by 2 independent pathologists who were both blind to the groups. Carcinoma tissue was confirmed in the PC samples and no carcinoma tissue was confirmed in the BPH samples by the pathologists and EN2 was mainly expressed in glandular and/or carcinoma cells. Table 2 summarized EN2 immunohistochemical scores of BPH and PC. 48% (12/25) of BPH tissues and 100% (25/25) of PC tissues showed EN2 positive staining. Among them, 12% (3/25) of BPH tissues and 72% (18/25) of PC tissues showed EN2 strong staining as well. 52% (13/25) of BPH tissues and 0% (0/25) of PC tissues showed EN2 negative staining. Fisher\u0026rsquo;s Exact Test showed that the expression level of EN2 in PC and BPH was significantly different, and the expression level of EN2 was much higher in PC group than that in BPH group (P\u0026lt;0.001).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe representative immunohistochemical images of BPH and PC were shown in Figure 3A. Three images above were BPH slices and the three images below were PC slices. The photos were taken at the magnification of 40\u0026times;. The staining intensity was weaker in BPH slices than in PC slices. Two strong positive BPH slices stained with EN2 antibody and one stained with negative isotype control antibody were shown in Figure 3B and four partial enlargements of the photos were shown in I, II, III and IV. In the left panel of Figure 3B, EN2 was strongly stained mostly in neovascularization endothelial cells and glandular epithelial cells, as shown in \u0026ldquo;I\u0026rdquo; and\u0026ldquo;II\u0026rdquo; , respectively. Strong EN2 staining on nuclear membrane in BPH tissues was indicated by the red arrow. In the middle panel of Figure 3B, strong EN2 staining on the gland could be observed. Cytoplasm staining of EN2 was shown in \u0026ldquo;III\u0026rdquo;, while scattered EN2 staining in the nuclei of lymphocytes infiltrating in interstitial tissues was shown in \u0026ldquo;IV\u0026rdquo;. A negative control stained with isotype antibody was shown in the right panel of Figure 3B. The photos were taken at the magnification of 400\u0026times;. Two PC slices stained with EN2 antibody and one stained with isotype control antibody were shown in Figure 3C (at the magnification of 400\u0026times; as well). Four partial enlargements of the photos were shown in V, VI, VII, and VIII. In the left panel of Figure 3C, cytomembrane staining of EN2 on the glandular epithelial cells with well-defined honeycomb-like was shown in \u0026ldquo;V\u0026rdquo; and \u0026ldquo;VI\u0026rdquo;. In the middle panel of Figure 3C, strong nuclear membrane staining of EN2 was shown in \u0026ldquo;VII\u0026rdquo; and EN2 staining on the tumor neovascularization endothelial cells was shown in \u0026ldquo;VIII\u0026rdquo;. The negative control stained with isotype antibody was shown in the right panel of Figure 3C. The photos were taken at the magnification of 400\u0026times;. Cerebellum is known for its high expression of EN2 and was stained as a positive control. EN2 antibody staining was shown in Figure 4A and isotype control antibody staining was shown in Figure 4B. The magnification of left and right panel was 40\u0026times; and 400\u0026times; respectively. EN2 staining was apparently observed in the nucleus in cerebellar tissues The positive staining was indicated by the red arrow.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn summary, EN2 could be stained in both glandular epithelial cells and neovascularization endothelial cells which are both epithelial original. In glandular epithelial cells, EN2 could be stained on cytomembraneand nuclear membrane , as well as in the cytoplasm and nucleus. Strong staining on cytomembrane was always found in PC slices. The results indicated that\u0026nbsp; EN2 expression patterns changed and the expression level increased as the growth of cells. Different states of the EN2 staining patterns, from the nucleus, nuclear membrane, cytoplasm and cytomembrane in BPH to mainly appeared on cytomembrane in PC suggest that EN2 might be secreted out of epithelial cells especially glandular epithelial cells during the malignant transformation of PC cells. Infiltrating lymphocytes in BPH could also be stained with EN2 antibody suggesting that EN2 protein could be expressed or endocytosed by infiltrating lymphocytes.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHigh Expression of EN2 both in PC and BHP compared to other four biomarkers.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further confirm the overexpression of EN2 in PC, we detected the expression of four well-studied\u0026nbsp; biomarker proteins, mTOR(mechanistic target of rapamycin kinase), VEGF(vascular endothelial growth factor), EGFR(epidermal growth factor receptor) and \u0026nbsp;PTEN(\u0026nbsp;gene of phosphate and tension homology deleted on chromsome ten) ,together with EN2 in these 25 PC and 25 BPH tissues, \u0026nbsp;at mRNA level through real-time PCR. Transcription levels of glyceraldehyde phosphate dehydrogenase (GAPDH ) were used as the internal quantitative control for those five targets in BPH tissues and transcription levels of these five targets in BPH tissues were used as control in PC tissues. Three duplicated wells of each target gene were set and three independent tests were done in this study. The results were summarized in Figure 5A and B, and relative transcription levels of those target genes in 25 cases were represented as dots separately. The relative EN2 expression in 25 PC and 25 BPH tissues was the highest compared to other 4 targets (P\u0026lt;0.01). Also the transcription of EN2 was higher in PC tissues than in BPH tissues, and the transcription level of EN2 in 25 PC tissues had the largest variation. As\u0026nbsp; shown in Figure 5A, in PC tissues, the highest relative expression of EN2 was above 140 while the lowest was less than 1. Because the control of PC tissues was BPH tissues, 1 stands for the transcription level of EN2 in PC tissues was same as the level in BPH tissues. This result indicated other indexes should be added to make definite diagnosis when the expression level of EN2 is low. All these PC cases in our study were clinically diagnosed, and about 3/25 (12%) cases with low EN2 expression (shown in Table2) should be re-considered \u0026nbsp;to avoid excessive medical treatment, since all these 3 PC patients with low EN2 expression had no lymph node metastasis and good prognosis after excision. For the BPH patients with high level of EN2, regular review should be required since it had possibility for carcinogenesis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCorrelation analysis was performed among mTOR, VEGF, EGFR, PTEN and EN2 both in PC and BPH tissues. There were a negative correlation between EN2 and PTEN in 25 PC tissues (R=-0.399, P=0.048) (Figure 5C) and a positive correlation between EN2 and VEGF in 25 BPH tissues (R= 0.47, P=0.019) (Figure 5D). Since PTEN is a tumor suppressor protein proven in several tumors and VEGF is an inflammatory cytokine related to hyperplasia and tumor, EN2 has been confirmed to be positively related to the carcinogenesis of prostatic diseases.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEN2 had positive correlation with PC clinical staging.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results above indicated that EN2 has different expression level and distribution in PC and BPH. To further confirm the relationship between EN2 and the progression of PC, we analyzed the clinical indicators among these cases (Table 3), and the correlation between EN2 immunohistochemical scores and clinical indicators in PC (Table 4). As shown in Table 3, only lymphocyte count between BPH and PC groups was significantly different (P=0.001). Peripheral blood lymphocyte number in PC group was higher than that in BPH group. Through Mann-Whitney U Test, the difference of PSA and EN2 immunohistochemical scores between PC and BPH groups were statistically significant (P \u0026lt;0.0001). The PSA and EN2 immunohistochemical scores in PC group were higher than those in BPH group. As shown in Table 4, there was a positive correlation between EN2 immunohistochemical score and PC clinical staging, with the correlation coefficient of 0.428 and the P value of 0.033. And more advanced clinical staging, higher EN2 immunohistochemical scoreclinical staging. Clinical staginging was based on the AJCC guidelines for prostate cancer.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eEN2 was correlated with clinical stage could be proven from one sight. In this study, neutrophil or lymphocyte infiltration were found in some cases, where the EN2 expression also could be detected. One patient with neutrophil infiltration was at clinical stage IV, and one patient with lymphocyte infiltration was at clinical stage II. The distribution, morphology and expression level of EN2 were also different in these two cases. As shown in the previous studies, prognosis of tumor tissues infiltrated by neutrophil was poor, while that of tumor tissues infiltrated by lymphocytes was good [13,14]. In Figure 6A, high expression level of EN2 and cell heteromorphosis were indicated by the red arrows. Numerous lobulated neutrophils in capillaries (indicated by the red arrow) could be observed in Figure 6C, the same tissues as in Figure 6A but were stained with HE . The PC patient at clinical stage IV was relapsed one month after resection. The expression level of EN2 was low In another case shown in Figure 6B, whose . glandular morphology was intact and EN2 distributed on the edge of the glandular cells ,indicated by the red arrow. A large amount of lymphocyte infiltration could be observed (indicated by the red arrow) in Figure 6D, the same tissue as in Figure 6B were stained with HE. This PC patient at clinical stage II had never relapsed in one year since recovery and never been subjected to hormonotherapy.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eBPH and \u0026nbsp;PC are progressive diseases [15]. Accurate diagnosis can not only improve \u0026nbsp;the cancer treatment but also avoid clinical overtreatment. EN2 expression pattern and level change as the prostatic disease progresses. Continuous monitoring of EN2 might be a helpful method for prognosis judgment. The EN2 Helix 3 has been confirmed to be the main functional structural domain of the protein, mediating its exocrine and internalization [16, 17]. Some studies have reported that antibodies against this domain of EN2 were found inPC patients\u0026rsquo; urine [10, 11, so the monoclonal antibody against EN2 Helix 3 could be used to detect EN2 expression in BPH and PC .\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eEN2 had been well studied in the field of neurodevelopment. It was found\u0026nbsp; to mostly \u0026nbsp;express in the nuclei of cerebellar tissue. Interestingly, in this study we have found that EN2 in PC mainly expressed on cytomembrane or expressed as an exocrine expression, while EN2 in BPH mostly expressed in cytoplasm and nuclei. Furthermore, the expression level of EN2 in PC was higher than that in BPH. This interesting finding can help doctors to judge the progress of prostatic diseases and help scientists to understand the characteristics of EN2 in different tissues. However, the precise criteria of EN2 to define PC or BPH can't been given from this study because of the limited samples.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIt is noteworthy that the subcellular distribution of EN2 in PC cell lines and PC tissues were not exactly the same. Cytoplasm staining pattern was observed in all three PC cell lines which was usually seen in BPH tissues. Weak nucleus staining pattern in all three PC cell lines was usually in PC tissues. But strong cytomembrane staining pattern was only observed in prostatic malignant tissues. EN2 itself is a transcription factor that interacts with DNA and is supposed to exist in the nucleus for normal cells. Because the expression and characteristic of EN2 could change due to the change of cell proliferation , EN2 could be secreted into the cytoplasm and even extracellular in cancer cells [18,19]. Some studies have reported that LNCap, DU145 and PC3 cells represent three different stages of prostate cancer [20-22], but in this study, no significant differences of EN2 in the subcellular localization was found among these three cell lines. It is possible that the number of passages and the artificial medium conditions in vitro led to changes in the original tumor malignancy of the cell lines.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLimited to the sample number, no statistical difference between any two clinical indexes was found, except for significant difference between EN2 and the clinical stagings of PC. This result further confirmed the difference of EN2 expression level and patterns between BPH and PC could suggest the progress and prognosis of prostatic diseases. Studies with more clinical samples are needed to confirm our new finding and set up a precise criteria for using EN2 as a biomarker in prostatic diseases.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eHOX family plays a key role in cell proliferation. EN2, one member in HOX family, was found to have different expression levels and patterns in PC and BPH, and its expression level was positively correlated with the PC clinical staging, suggesting its use to predict prostatic disease progression. \u0026nbsp;\u003c/p\u003e"},{"header":"List of Abbreviation","content":"\u003cp\u003eEN2\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Engrailed-2\u003c/p\u003e\n\u003cp\u003ePSA\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Prostate-specific antigen\u003c/p\u003e\n\u003cp\u003ePC\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Prostate cancer\u003c/p\u003e\n\u003cp\u003eBPH\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Benign prostatic hyperplasia\u003c/p\u003e\n\u003cp\u003eRT-qPCR\u0026nbsp; \u0026nbsp;Reverse Transcription quantitative Polymerase Chain Reaction\u003c/p\u003e\n\u003cp\u003eWB\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Western Blotting\u003c/p\u003e\n\u003cp\u003eELISA\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Enzyme-linked immunosorbent assay\u003c/p\u003e\n\u003cp\u003eLUTS\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Lower urinary tract symptoms\u003c/p\u003e\n\u003cp\u003eHOX\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Homeobox\u003c/p\u003e\n\u003cp\u003eDNA\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; DeoxyriboNucleic Acid\u003c/p\u003e\n\u003cp\u003eRFP\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Red fluorescent protein\u003c/p\u003e\n\u003cp\u003ePEI\u0026nbsp;\u0026nbsp; \u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;Polyethylenimine linear\u003c/p\u003e\n\u003cp\u003eDMEM\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Gibco Dulbecco's Modified Eagle Medium\u003c/p\u003e\n\u003cp\u003ePBS\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Phosphate buffer saline\u003c/p\u003e\n\u003cp\u003eBSA\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Bovine serum albumin\u003c/p\u003e\n\u003cp\u003eFITC\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Fluorescein isothiocyanate\u003c/p\u003e\n\u003cp\u003eEDTA\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Ethylene Diamine Tetraacetic Acid\u003c/p\u003e\n\u003cp\u003eDAB\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Diaminobenzidine\u003c/p\u003e\n\u003cp\u003eHE\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Hematoxylin-eosin\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGAPDH\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Glyceraldehyde-3-phosphate dehydrogenase\u003c/p\u003e\n\u003cp\u003eSDS-PAGE\u0026nbsp; Dodecyl sulfate,sodium salt-Polyacrylamide gel electrophoresis\u003c/p\u003e\n\u003cp\u003emTOR\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Mechanistic target of rapamycin kinase\u003c/p\u003e\n\u003cp\u003eVEGF\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Vascular endothelial growth factor\u003c/p\u003e\n\u003cp\u003eEGFR\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Epidermal growth factor receptor\u003c/p\u003e\n\u003cp\u003ePTEN\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Gene of phosphate and tension homology deleted on chromsome ten\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study involving human participants was approved by the ethics committee of The First Affiliated Hospital of Zhengzhou University. The audit number of ethics committee was 2019-KY-185. Written consent was obtained from all human participants. The research was carried out according to the principles expressed in the Declaration of Helsinki.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWritten informed consent for publication has been obtained from all participants.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo conflict of interest exits in the submission of this manuscript, and the manuscript has been approved by all authors for publication.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by Key Scientific Research Projects of Institutions in Henan Province, China. Grant number was 18A320014. The funder had a role in patient sample collection.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eQL and BQ conceived and designed the study. YS, RS, JH, JHH and MX performed the experiments. CW and LY collected the patient samples. JH wrote the paper. QL and GC reviewed and edited the manuscript. All authors read and approved the final manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e"},{"header":"References","content":"\u003cp\u003e[1]. \u003ca href=\"https://www.ncbi.nlm.nih.gov/pubmed/?term=Grozescu%20T%5BAuthor%5D\u0026amp;cauthor=true\u0026amp;cauthor_uid=28255369\"\u003eGrozescu, T\u003c/a\u003e., et al., Prostate cancer\u0026nbsp;between prognosis and adequate/proper therapy. \u003ca href=\"https://www.ncbi.nlm.nih.gov/pubmed/28255369\"\u003eJ Med Life\u003c/a\u003e,\u0026nbsp;2017.10:p.5-12.\u003c/p\u003e\n\u003cp\u003e[2].\u003ca href=\"https://www.ncbi.nlm.nih.gov/pubmed/?term=Barry%20MJ%5BAuthor%5D\u0026amp;cauthor=true\u0026amp;cauthor_uid=28577627\"\u003eBarry, MJ\u003c/a\u003e., et al., Prevention of \u0026nbsp;Prostate Cancer\u0026nbsp;Morbidity and Mortality: Primary Prevention\u0026nbsp;and\u0026nbsp;Early Detection. Med Clin North Am,\u0026nbsp;2017. 101:p.787-806.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e[3].\u003ca href=\"https://www.ncbi.nlm.nih.gov/pubmed/?term=Sebesta%20EM%5BAuthor%5D\u0026amp;cauthor=true\u0026amp;cauthor_uid=29580436\"\u003eSebesta, EM\u003c/a\u003e., et al., The Surgical Management of\u0026nbsp;Prostate Cancer. Semin Oncol,\u0026nbsp;2017. 44:p.347-357.\u003c/p\u003e\n\u003cp\u003e[4].\u003ca href=\"https://www.ncbi.nlm.nih.gov/pubmed/?term=Wallis%20CJD%5BAuthor%5D\u0026amp;cauthor=true\u0026amp;cauthor_uid=26700655\"\u003eWallis, CJD\u003c/a\u003e., Surgery Versus Radiotherapy for Clinically-localized\u0026nbsp;Prostate Cancer: A Systematic Review and Meta-analysis. Eur Urol,\u0026nbsp;2016.70:p.21-30.\u003c/p\u003e\n\u003cp\u003e[5]. Andriole, G.L., et al., Mortality results from a randomized prostate-cancer screening trial. N Engl J Med, 2009. 360(13): p. 1310-9.\u003c/p\u003e\n\u003cp\u003e[6].Dai, X., et al., Benign Prostatic Hyperplasia and the Risk of Prostate Cancer and Bladder Cancer:\u0026nbsp; A Meta-Analysis of Observational Studies. Medicine (Baltimore), 2016. 95(18): p. e3493.\u003c/p\u003e\n\u003cp\u003e[7].\u003ca href=\"https://www.ncbi.nlm.nih.gov/pubmed/?term=Mokhtari%20M%5BAuthor%5D\u0026amp;cauthor=true\u0026amp;cauthor_uid=27362242\"\u003eMokhtari, M\u003c/a\u003e., et al., The Prevalence of\u0026nbsp;Prostatic\u0026nbsp;Stromal Tumor of Uncertain Malignant Potential in Specimens Diagnosed as\u0026nbsp;Prostatic Hyperplasia. Arch Iran Med, 2016.19(7):p.488-90.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e[8].Morgan, R., et al., Targeting HOX/PBX dimers in cancer. Oncotarget, 2017. 8(19): p. 32322-32331.\u003c/p\u003e\n\u003cp\u003e[9].Lai, C.Y., et al., Engrailed-2 might play an anti-oncogenic role in clear-cell renal cell carcinoma. J Mol Histol, 2016. 47(3): p. 229-37.\u003c/p\u003e\n\u003cp\u003e[10].McGrath, SE., et al., \u003ca href=\"https://www.ncbi.nlm.nih.gov/pubmed/26411411\"\u003eEN2\u0026nbsp;in\u0026nbsp;Prostate Cancer.\u003c/a\u003eAdv Clin Chem, 2015.71:p.47-76.\u003c/p\u003e\n\u003cp\u003e[11].Pandha, H., et al., Urinary engrailed-2 (EN2) levels predict tumour volume in men undergoing radical prostatectomy for prostate cancer. BJU Int, 2012. 110(6 Pt B): p. E287-92.\u003c/p\u003e\n\u003cp\u003e[12].Carlier, L., et al., Investigation of homeodomain membrane translocation properties: insights from the structure determination of engrailed-2 homeodomain in aqueous and membrane-mimetic environments. Biophys J, 2013. 105(3): p. 667-78.\u003c/p\u003e\n\u003cp\u003e[13].Watanabe, A., et al., Absolute Neutrophil Count Predicts Postoperative Prognosis in Mass-forming Intrahepatic Cholangiocarcinoma. Anticancer Res, 2019. 39(2): p. 941-947.\u003c/p\u003e\n\u003cp\u003e[14].Kim, J., et al.,\u0026nbsp; Tumor-Associated Macrophages and Neutrophils in Tumor Microenvironment. Mediators Inflamm, 2016. 2016: p. 6058147.\u003c/p\u003e\n\u003cp\u003e[15] \u003ca href=\"https://www.ncbi.nlm.nih.gov/pubmed/?term=Donnell%20RF%5BAuthor%5D\u0026amp;cauthor=true\u0026amp;cauthor_uid=21171199\"\u003eDonnel, RF\u003c/a\u003e., et al., Benign prostate hyperplasia: a review of the year's progress from bench to clinic. Curr Opin Urol, 2011. 21(1):p.22-6.\u003c/p\u003e\n\u003cp\u003e[16].Joliot, A., et al., Identification of a signal sequence necessary for the unconventional secretion of Engrailed homeoprotein. CurrBiol, 1998. 8(15): p. 856-63.\u003c/p\u003e\n\u003cp\u003e[17].Logan, C., et al., Cloning and sequence comparison of the mouse, human, and chicken engrailed genes reveal potential functional domains and regulatory regions. Dev Genet, 1992. 13(5): p. 345-58.\u003c/p\u003e\n\u003cp\u003e[18].McGrath, S.E., et al., Engrailed-2 (EN2) - a novel biomarker in epithelial ovarian cancer. BMC Cancer, 2018. 18(1): p. 943.\u003c/p\u003e\n\u003cp\u003e[19]. Natasha, P., et al., Membrane insertion and secretion of the Engrailed-2 (EN2) transcription factor by prostate cancer cells may induce antiviral activity in the stroma. \u003ca href=\"https://www.ncbi.nlm.nih.gov/pubmed/?term=Membrane+insertion+and+secretion+of+the+Engrailed-2+%28EN2%29+transcription+factor+by+prostate+cancer+cells+may+induce+antiviral+activity+in+the+stroma\"\u003eSci Rep,\u003c/a\u003e\u0026nbsp;2019. 9(1): p. 5138.\u003c/p\u003e\n\u003cp\u003e[20]. Eugenia Scaccianoce, et al., Characterization of Prostate Cancer DU145 Cells Expressing the Recombinant Androgen Receptor. Oncology Research, 2003. 14,:p. 101\u0026ndash;112.\u003c/p\u003e\n\u003cp\u003e[21]. Saleh Altuwaijri, et al., Expression of human AR cDNA driven by its own promoter results in mild promotion, but not suppression, of growth in human prostate cancer PC-3 cells. Asian J Androl, 2007. 9 (2): p.181\u0026ndash;188.\u003c/p\u003e\n\u003cp\u003e[22].Jin Li, et al., SHARPIN overexpression induces tumorigenesis in human prostate cancer LNCaP, DU145 and PC-3 cells via NF-jB/ERK/Akt signaling pathway. Med Oncol, 2015. 32(1).\u003c/p\u003e"},{"header":"Tables","content":"\u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eTable 1 qPCR primers\u003c/span\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" style=\"border-collapse:collapse;border:none;\" width=\"584\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:83.4pt;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"19.006849315068493%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eTargets\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:184.25pt;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"42.12328767123287%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eF\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:170.1pt;border-top:solid windowtext 1.0pt;border-left:none;border-bottom:solid windowtext 1.0pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"38.86986301369863%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eR\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:83.4pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"19.006849315068493%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eEGFR\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:184.25pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"42.12328767123287%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eACGGGGTGACTGTTTGGGAGTT\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:170.1pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"38.86986301369863%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eACTTTGGGCGACTATCTGCGTCT\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:83.4pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"19.006849315068493%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eVEGF\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:184.25pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"42.12328767123287%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eGGCAGAAGGAGGAGGGCAGAAT\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:170.1pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"38.86986301369863%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eCATCGCATCAGGGGCACACA\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:83.4pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"19.006849315068493%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eEN2\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:184.25pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"42.12328767123287%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eCTACTGTACGCGCTACTCGG\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:170.1pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"38.86986301369863%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eCCCGTGGCCTTCTTGATCTT\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:83.4pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"19.006849315068493%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003emTOR\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:184.25pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"42.12328767123287%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eTGGACACCAACAAGGACGAC\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:170.1pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"38.86986301369863%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eGTCCCACTGACCTAAACCCC\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:83.4pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"19.006849315068493%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003epTEN\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:184.25pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"42.12328767123287%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eTGGGGAAGTAAGGACCAGAGACAAAA\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:170.1pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"38.86986301369863%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eTGGCAGACCACAAACTGAGGATTG\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:83.4pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"19.006849315068493%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eGAPDH\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:184.25pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"42.12328767123287%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eTCGGAGTCAACGGATTTGGT\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:170.1pt;border:none;border-bottom:solid windowtext 1.0pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"38.86986301369863%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eTTCCCGTTCTCAGCCTTGAC\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:left;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eTable 2 EN2 immunohistochemical scores of BPH and PC\u003c/span\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\" style=\"border-collapse:collapse;border:none;\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:174.1pt;border-top:solid windowtext 1.5pt;border-left:none;border-bottom:solid windowtext 1.5pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"25%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.15pt;border-top:solid windowtext 1.5pt;border-left:none;border-bottom:solid windowtext 1.5pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"25%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eBPH(n=25)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.1pt;border-top:solid windowtext 1.5pt;border-left:none;border-bottom:solid windowtext 1.5pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"25%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003ePC(n=25)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.05pt;border-top:solid windowtext 1.5pt;border-left:none;border-bottom:solid windowtext 1.5pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"25%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eP\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:174.1pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"25%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eNegative\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.15pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"25%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e13(52%)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.1pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"25%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 174.05pt;border: none;padding: 0in 5.4pt;vertical-align: bottom;\" valign=\"bottom\" width=\"25%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e<0.001*\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:174.1pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003ePositive\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.15pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e12(48%)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.1pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e25\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:174.1pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"25%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Mild\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.15pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"25%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e5(20%)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.1pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"25%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e3(12%)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"3\" style=\"width: 174.05pt;border-top: none;border-right: none;border-left: none;border-image: initial;border-bottom: 1.5pt solid windowtext;padding: 0in 5.4pt;vertical-align: bottom;\" valign=\"bottom\" width=\"25%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e<0.001*\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:174.1pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Moderate\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.15pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e4(16%)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.1pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e4(16%)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:174.1pt;border:none;border-bottom:solid windowtext 1.5pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Strong\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.15pt;border:none;border-bottom:solid windowtext 1.5pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e3(12%)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.1pt;border:none;border-bottom:solid windowtext 1.5pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e18(72%)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e*Fisher’s Exact Test\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eTable 3 Clinical indicators of PC and BPH\u003c/span\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\" style=\"border-collapse:collapse;border:none;\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:146.8pt;border-top:solid windowtext 2.25pt;border-left:none;border-bottom:solid windowtext 2.25pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"21.65745856353591%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eParameters\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:139.85pt;border-top:solid windowtext 2.25pt;border-left:none;border-bottom:solid windowtext 2.25pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.552486187845304%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003ePC(n=25)\u003c/span\u003e\u003c/p\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eMean±SD\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;border-top:solid windowtext 2.25pt;border-left:none;border-bottom:solid windowtext 2.25pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eBPH(n=25)\u003c/span\u003e\u003c/p\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eMean±SD\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;border-top:solid windowtext 2.25pt;border-left:none;border-bottom:solid windowtext 2.25pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003et/U\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:137.5pt;border-top:solid windowtext 2.25pt;border-left:none;border-bottom:solid windowtext 2.25pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.22099447513812%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eP\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:146.8pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"21.65745856353591%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eAge(years)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:139.85pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.552486187845304%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e67.80±7.41\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e66.12±5.019\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.939\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:137.5pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.22099447513812%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.352\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:146.8pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"21.65745856353591%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eSmoking history(%)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:139.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.552486187845304%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e10(40%)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e7(28%)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.802\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:137.5pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.22099447513812%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.370**\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:146.8pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"21.65745856353591%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003edrinking history(%)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:139.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.552486187845304%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e9(36%)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e7(28%)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.368\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:137.5pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.22099447513812%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.544**\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:146.8pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"21.65745856353591%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eWhite Blood Cell Count(×10\u003csup\u003e9\u003c/sup\u003e/L)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:139.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.552486187845304%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e6.36±1.93\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e5.91±1.46\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.930\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:137.5pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.22099447513812%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.357\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:146.8pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"21.65745856353591%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003ePlatelets Count(×10\u003csup\u003e9\u003c/sup\u003e/L)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:139.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.552486187845304%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e201.68±67.20\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e170.60±63.58\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e1.680\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:137.5pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.22099447513812%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.099\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:146.8pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"21.65745856353591%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eNeutrophil Count(×10\u003csup\u003e9\u003c/sup\u003e/L)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:139.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.552486187845304%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e3.70±1.57\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e3.66±1.33\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e-0.068\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:137.5pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.22099447513812%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.946*\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:146.8pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"21.65745856353591%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eLymphocyte Count(×10\u003csup\u003e9\u003c/sup\u003e/L)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:139.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.552486187845304%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e1.89±0.63\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e1.18±0.74\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e3.636\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:137.5pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.22099447513812%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.001\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:146.8pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"21.65745856353591%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eMonocyte Count(×10\u003csup\u003e9\u003c/sup\u003e/L)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:139.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.552486187845304%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.54±0.18\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.50±0.19\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e-0.903\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:137.5pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.22099447513812%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.367*\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:146.8pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"21.65745856353591%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003ePSA(ng/ml)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:139.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.552486187845304%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e88.76±97.36\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e2.90±1.47\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e-6.066\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:137.5pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.22099447513812%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e<0.0001*\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:146.8pt;border:none;border-bottom:solid windowtext 2.25pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"21.65745856353591%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eImmunohistochemical staining score of EN2\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:139.85pt;border:none;border-bottom:solid windowtext 2.25pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.552486187845304%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e3.34±0.96\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;border:none;border-bottom:solid windowtext 2.25pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e1.10±1.39\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:127.85pt;border:none;border-bottom:solid windowtext 2.25pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"18.784530386740332%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e-4.472\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:137.5pt;border:none;border-bottom:solid windowtext 2.25pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"20.22099447513812%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e<0.0001*\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e*Mann-Whitney U Test\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e**Chi-square Test\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:justify;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eTable 4\u0026nbsp;Correlation between EN2 immunohistochemical scores and clinical indicators in PC\u003c/span\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" style=\"border-collapse:collapse;border:none;\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:174.35pt;border-top:solid windowtext 1.5pt;border-left:none;border-bottom:solid windowtext 1.5pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eClinical indicators\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border-top:solid windowtext 1.5pt;border-left:none;border-bottom:solid windowtext 1.5pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003er\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border-top:solid windowtext 1.5pt;border-left:none;border-bottom:solid windowtext 1.5pt;border-right:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eP\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003ePC clinical stage\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.428\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.033\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eGleason\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.040\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.849\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003ePSA\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.108\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.606\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eAge\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e-0.148\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.479\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eSmoking history\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.238\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.252\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003edrinking history\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.241\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.246\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eWhite Blood Cell Count\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e-0.230\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.268\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003ePlatelets Count\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.022\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.916\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eNeutrophil Count\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e-0.282\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.172\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eLymphocyte Count\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e-0.015\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.942\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width:174.35pt;border:none;border-bottom:solid windowtext 1.5pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003eMonocyte Count\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;border-bottom:solid windowtext 1.5pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e-0.028\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width:174.35pt;border:none;border-bottom:solid windowtext 1.5pt;padding:0in 5.4pt 0in 5.4pt;\" width=\"33.333333333333336%\"\u003e\n \u003cp style=\"margin:0in;margin-bottom:.0001pt;text-align:center;font-size:14px;font-family:DengXian;\"\u003e\u003cspan style=\"color: rgb(0, 0, 0);\"\u003e0.895\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-cancer","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bcan","sideBox":"Learn more about [BMC Cancer](http://bmccancer.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bcan/default.aspx","title":"BMC Cancer","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Prostate cancer, Benign prostatic hyperplasia, Engrailed-2, Immunohistochemical staining","lastPublishedDoi":"10.21203/rs.2.14625/v3","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.2.14625/v3","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eProstate cancer (PC) , a common malignant tumor, is the second-leading cause of cancer death among American men. Its successful treatment greatly relies on the early diagnose. Engrailed-2 (EN2) has been confirmed being existed with a high level in the urine of PC patients. In this study, to explore the application of EN2 in PC, we detected the immunohistochemical staining difference and EN2 expression level between benign prostatic hyperplasia (BPH) and PC.\u0026nbsp;\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eWe developed a monoclonal antibody against the helix 3 in EN2 and confirmed its specificity with Western blotting (WB) and immunofluorescence detecting the subcellular localization of endogenous and exogenous EN2 in three PC cell lines (LNCap, PC3, and DU145). We conducted immunohistochemical staining using this homemade antibody, and RT-PCR to detect the expression of EN2 in 25 PC and 25 BPH cases , and analyzed the correlation of EN2 expression and PC clinical staging.\u0026nbsp;\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eThe results of WB and immunofluorescence showed our homemade EN2 monoclonal antibody could specifically bind endogenous and exogenous EN2 protein in three different PC cell lines. Endogenous EN2 was generally expressed in the cytoplasm and exogenous EN2 mostly existed in the nucleus of these cell lines. Immunohistochemical staining in PC had extremely stronger signals than that in BPH, suggesting a higher EN2 expression level in PC, which was confirmed by RT-PCR. Interestingly, the stained areas in BPH tissues were mainly in nucleus and cytoplasm, while in PC tissues were mainly on cytomembrane. Moreover, the expression level of EN2 was positively correlated with the PC clinical staging. \u0026nbsp;\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eUsing our homemade EN2 antibody, we have found different staining patterns and expression level of EN2 in BPH and PC,which may be helpful to predict prostatic disease progression. \u0026nbsp;\u003c/p\u003e","manuscriptTitle":"Altered staining patterns and expression level of Engrailed-2 in Benign prostatic hyperplasia and Prostate Cancer predict Prostatic disease progression","msid":"","msnumber":"","nonDraftVersions":[{"code":3,"date":"2020-04-30 18:03:59","doi":"10.21203/rs.2.14625/v3","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2020-05-07T12:00:00+00:00","index":3,"fulltext":"Recommendation: Accept after minor essential revisions\nForm responses:\n---\n\nComments to Author:\n---\nRe: Manuscript BCAN-D-19-02646_R2\n\nThe authors have significantly improved the quality of the manuscript and have responded to most of my comments satisfactorily.\n\nComments to the authors:\n1- The response to comment 2, about the lack of information about the 293T cell line is not sufficient. Please provide more information about the origin of the cell line (the authors currently say it was preserved in the lab).\n2- The response to comment 9 about Figure 4. It is still difficult to see the positive cells that were indicated by the arrows, but this could be related to the way the files were uploaded.\n3- There are still some grammatical and typographical errors that could be easily addressed.\n4- For previous comment 12, Labelling for Figure 5 is still confusing, as it seems that correlations were made for cancer cases between EN2 and PTEN, while a different correlation (EN2 to VEGF) was made for hyperplasia cases. Please make sure all the data are included and that the labelling is clear or explain that you only showed the correlations that showed significant differences\n5- The conclusion section is much clearer now, however, the discussion is still very weak and needs to be strengthened significantly.\n* Are the methods appropriate and well described?: **Yes**\n* Does the work include the necessary controls?: **Yes**\n* Are the conclusions drawn adequately supported by the data shown?: **Yes**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I am able to assess the statistics**\n* Quality of written English: **Needs some language corrections before being published**\n* Declaration of competing interests: **I declare that I have no competing interests**\n* Reviewer Publication Consent. I agree for my report to be made available under an Open Access Creative Commons CC-BY License (http://creativecommons.org/licenses/by/4.0) if this manuscript is accepted for publication. Any comments that I do not wish to be included in the published report have been included as confidential comments to the editor, which will not be published.: **I agree to the terms of the CC-BY 4.0 license; please publish my name with my report.**\n"},{"type":"decision","content":"Minor revision","date":"2020-05-07T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2020-05-02T12:00:00+00:00","index":2,"fulltext":"Recommendation: Accept without revision\nForm responses:\n---\n\nComments to Author:\n---\nThe secondly revised manuscript entitled \"Altered staining patterns and expression level of Engrailed-2 in Benign prostatic hyperplasia and Prostate Cancer predict Prostatic disease progression\" by Li et al. improved sufficiently by new additional comments.\nThe authors did not respond to the recommended improvement of histopathological quantification (glandular/fibromuscular/carcinoma) but answered necessary formal questions.\nI recommend this manuscript for publication as is.\n* Are the methods appropriate and well described?: **Yes**\n* Does the work include the necessary controls?: **Yes**\n* Are the conclusions drawn adequately supported by the data shown?: **Yes**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I am able to assess the statistics**\n* Quality of written English: **Acceptable**\n* Declaration of competing interests: **I declare that I have no competing interests**\n* Reviewer Publication Consent. I agree for my report to be made available under an Open Access Creative Commons CC-BY License (http://creativecommons.org/licenses/by/4.0) if this manuscript is accepted for publication. Any comments that I do not wish to be included in the published report have been included as confidential comments to the editor, which will not be published.: **I agree to the terms of the CC-BY 4.0 license; please publish my name with my report.**\n"},{"type":"reviewerAgreed","content":"","date":"2020-04-23T12:00:00+00:00","index":2,"fulltext":""},{"type":"reviewerAgreed","content":"","date":"2020-04-23T12:00:00+00:00","index":3,"fulltext":""},{"type":"reviewerAgreed","content":"","date":"2020-04-22T12:00:00+00:00","index":1,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2020-04-22T12:00:00+00:00","index":1,"fulltext":"Recommendation: Accept without revision\nForm responses:\n---\n\nComments to Author:\n---\n* Are the methods appropriate and well described?: **Yes**\n* Does the work include the necessary controls?: **Yes**\n* Are the conclusions drawn adequately supported by the data shown?: **Yes**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I am able to assess the statistics**\n* Quality of written English: **Acceptable**\n* Declaration of competing interests: **I declare that I have no competing interests.**\n* I agree to the open peer review policy of the journal. I understand that my name will be included on my report to the authors and, if the manuscript is accepted for publication, my named report including any attachments I upload will be posted on the website along with the authors' responses. I agree for my report to be made available under an Open Access Creative Commons CC-BY license (http://creativecommons.org/licenses/by/4.0/). I understand that any comments which I do not wish to be included in my named report can be included as confidential comments to the editors, which will not be published.: ** I agree to the open peer review policy of the journal**\n"},{"type":"editorAssigned","content":"","date":"2020-04-20T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewersInvited","content":"","date":"2020-04-20T12:00:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2020-04-19T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2020-04-19T12:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-cancer","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bcan","sideBox":"Learn more about [BMC Cancer](http://bmccancer.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bcan/default.aspx","title":"BMC Cancer","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}},{"code":2,"date":"2020-01-28 15:52:36","doi":"10.21203/rs.2.14625/v2","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2020-03-03T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2020-02-22T12:00:00+00:00","index":3,"fulltext":"Recommendation: Reject\nForm responses:\n---\n\nComments to Author:\n---\nRe: Manuscript BCAN-D-19-02646_R1\n\nComments to the authors:\nThis is an interesting manuscript describing the expression of Engrailed-2 (EN2) in prostate cancer and benign hyperplasia patient samples and in three prostate cancer cell lines. The results are interesting and have clinical translational potential. However, the manuscript is poorly written making it difficult to read.\nThere are some clarifications that are needed to render certain aspect of the manuscript clearer.\nThe following are the specific comments:\n1- Overall, the paper is poorly written. There are many linguistic and grammatical errors that require attention. This makes the manuscript difficult to read.\n2- There are no details about 293T under the cell culture section.\n3- Figure 1F, it is impossible to decipher the handwriting on the figure.\n4- Figure 1, were the data reproducible? Was this repeated more than once?\n5- Figures 1 and 2, were there any positive and negative controls used? If so, they need to be shown.\n6- Figure 3 is not clear at all as the images seem to be hazy and pixelated. It is therefore impossible to provide feedback on that.\n7- Figure 3, for the immunohistochemistry, did the authors consider using automated image analysis to quantify the DAB staining?\n8- Also for Figure 3, the authors indicate that the negative control is not shown, please add it to give strength and validity to the positive staining.\n9- Figure 4 is not clear. It is actually impossible to decipher the differences between the different panels. It is also impossible to see the positive staining indicated by the arrow.\n10- Figure 4, was there any quantification done to these images?\n11- Figure 5, were correlation analyses performed between EN2 and mTOR and EGFR?\n12- Figure 5, were correlation analyses performed for hyperplasia cases?\n13- The discussion is very weak and requires re-writing\n14- The conclusion section is difficult to understand.\n* Are the methods appropriate and well described?: **Yes**\n* Does the work include the necessary controls?: **No**\n* Are the conclusions drawn adequately supported by the data shown?: **No**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I am able to assess the statistics**\n* Quality of written English: **Not suitable for publication unless extensively edited**\n* Declaration of competing interests: **I declare that I have no competing interests**\n* I agree to the open peer review policy of the journal. I understand that my name will be included on my report to the authors and, if the manuscript is accepted for publication, my named report including any attachments I upload will be posted on the website along with the authors' responses. I agree for my report to be made available under an Open Access Creative Commons CC-BY license (http://creativecommons.org/licenses/by/4.0/). I understand that any comments which I do not wish to be included in my named report can be included as confidential comments to the editors, which will not be published.: ** I agree to the open peer review policy of the journal**\n"},{"type":"editorInvitedReview","content":"","date":"2020-02-12T12:00:00+00:00","index":1,"fulltext":"Recommendation: Accept after minor essential revisions\nForm responses:\n---\n\nComments to Author:\n---\nThe revised manuscript entitled \"Altered staining patterns and expression level of Engrailed-2 in Benign prostatic hyperplasia and Prostate Cancer predict Prostatic disease progression\" by Li et al. improved much.\nThe authors responded well to most of the questions.\nOne major question remains open and I recommend truly solving this. The additional information would be very helpful for the conclusions of the manuscript.\nThe authors state in respect to my raised question that all samples were seen and evaluated by a pathologist, but confirming only that there were prostate tissues present.\nIt is needed that the pathologist confirms that in the PC samples carcinoma tissue is present and in BPH samples no carcinoma is present. Also it is of high importance to know what the percentage of glandular and/or carcinoma tissue is in the sample unless EN2 is mainly described as being expressed in glandular and/or carcinoma cells. In BPH it might be that there is mainly fibromuscular tissue present.\nTherefor, but not as a concern but rather an advice to improve statistics and conclusions on EN2 in PC vs PBH, this histopathological quantification (glandular/fibromuscular/carcinoma) is needed. Made in the best case on the frozen tissue samples or good, but less precise, made on paraffin blocks made of the same tissue sample.\nI would recommend this manuscript for publication after this minor revision.\n* Are the methods appropriate and well described?: **Yes**\n* Does the work include the necessary controls?: **Yes**\n* Are the conclusions drawn adequately supported by the data shown?: **Yes**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I am able to assess the statistics**\n* Quality of written English: **Needs some language corrections before being published**\n* Declaration of competing interests: **I declare that I have no competing interests**\n* I agree to the open peer review policy of the journal. I understand that my name will be included on my report to the authors and, if the manuscript is accepted for publication, my named report including any attachments I upload will be posted on the website along with the authors' responses. I agree for my report to be made available under an Open Access Creative Commons CC-BY license (http://creativecommons.org/licenses/by/4.0/). I understand that any comments which I do not wish to be included in my named report can be included as confidential comments to the editors, which will not be published.: ** I agree to the open peer review policy of the journal**\n"},{"type":"reviewerAgreed","content":"","date":"2020-02-10T12:00:00+00:00","index":4,"fulltext":""},{"type":"reviewerAgreed","content":"","date":"2020-01-31T12:00:00+00:00","index":2,"fulltext":""},{"type":"reviewerAgreed","content":"","date":"2020-01-31T12:00:00+00:00","index":3,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2020-01-31T12:00:00+00:00","index":2,"fulltext":"Recommendation: Accept after minor essential revisions\nForm responses:\n---\n\nComments to Author:\n---\nThank you for addressing the comments raised in the previous version.\n\nPlease include your responses to comment 3 about inclusion and exclusion criteria and sample selection criteria in the manuscript.* Are the methods appropriate and well described?: **Yes**\n* Does the work include the necessary controls?: **Yes**\n* Are the conclusions drawn adequately supported by the data shown?: **Yes**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I am able to assess the statistics**\n* Quality of written English: **Acceptable**\n* Declaration of competing interests: **I declare that I have no competing interests.**\n* I agree to the open peer review policy of the journal. I understand that my name will be included on my report to the authors and, if the manuscript is accepted for publication, my named report including any attachments I upload will be posted on the website along with the authors' responses. I agree for my report to be made available under an Open Access Creative Commons CC-BY license (http://creativecommons.org/licenses/by/4.0/). I understand that any comments which I do not wish to be included in my named report can be included as confidential comments to the editors, which will not be published.: ** I agree to the open peer review policy of the journal**\n"},{"type":"reviewerAgreed","content":"","date":"2020-01-28T12:00:00+00:00","index":1,"fulltext":""},{"type":"editorAssigned","content":"","date":"2020-01-27T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewersInvited","content":"","date":"2020-01-27T12:00:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2020-01-26T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2020-01-26T12:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-cancer","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bcan","sideBox":"Learn more about [BMC Cancer](http://bmccancer.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bcan/default.aspx","title":"BMC Cancer","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}},{"code":1,"date":"2019-09-18 03:36:11","doi":"10.21203/rs.2.14625/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2019-11-30T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2019-11-28T12:00:00+00:00","index":4,"fulltext":"Recommendation: Major revisions required\nForm responses:\n---\n* Are the methods appropriate and well described?: **Yes**\n* Does the work include the necessary controls?: **No**\n* Are the conclusions drawn adequately supported by the data shown?: **Yes**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I am able to assess the statistics**\n* Quality of written English: **Not suitable for publication unless extensively edited**\n* Declaration of competing interests: **I declare that I have no competing interests.**\n\nComments to Author:\n---\nThe manuscript entitled \"Altered staining patterns and expression level of Engrailed-2 in Benign prostatic hyperplasia and Prostate Cancer predict Prostatic disease progression\" by Li et al. is written in basic English.\nThe authors searched for expression profiles of cell lines and tissue samples for Engrailed-2 by means of western blotting, immunofluorescence and immunohistochemistry using self-made mouse monoclonal antibodies of immunized mice using c-terminal 114 amino acid frequency.\nResults of western blotting as well as immunofluorescence are showing conclusive results in respect to known protein size and location. A whole picture of western blotting of cell extracts including the mass marker would be of interest to confirm specificity (see fig 1, F).\nImmunohistochemistry is showing inconclusive results compared to immunofluorescence, presenting cytoplasmic and membranous staining. By having also heavy stains of different other cell types, as endothelial cells and infiltrating immune cells, specificity of the staining might be an issue.\nRT-PCR data are of interest showing high levels of EN2 gene expression in both, prostate cancer and prostate hyperplasia as well as some correlation to VEGF and PTEN expression but with larger distribution.\n\nThe presented data are of interest to the research field and the effort of the authors is remarkable. The data if the clinical samples are not impressive by means of immunohistochemistry, demonstrating marked staining in glands of hyperplastic and carcinoma of the prostate. But IHC results match in some extend to RT-PCR data.\nThe correlation to clinical stage is significant of low positive correlation level.\n\nI would recommend this manuscript for publication after major revisions:\n\nA) Language needs revision.\n\nB) Immunohistochemistry results are inconclusive to prior results in this manuscript and already published data.\nSome additional works are needed:\n1. Negative control using a unspecific mouse antibody of the same kind.\n2. Stains of control tissue with known high expression of EN2 are necessary for the establishment, as e.g. cerebellar tissue\n3. Probably including a pathologist in reading the results for the establishment of the staining is useful.\n4. I recommend changing the protocol of staining: longer antigene retrieval von 20 minutes, trying pH6 and pH9; incubation time of primary antibody of 30-60 minutes.\nOver-night incubation often leads to unspecific binding.\n\nC) It remains unclear, what tissue areas were extracted for RT-PCR analyses (whole sections? microdissection? Was a pathologist involved?)\nPlease clarify.\n\nD) It remains unclear, which characteristics lead to the clinical stage. Please include information about this and include additional information about the differentiation of prostate cancer samples, as Gleason Score or ISUP Grade. A correlation to tumor differentiation might be of interest, too.\n\n\n"},{"type":"editorInvitedReview","content":"","date":"2019-11-21T12:00:00+00:00","index":3,"fulltext":"Recommendation: Major revisions required\nForm responses:\n---\n* Are the methods appropriate and well described?: **Yes**\n* Does the work include the necessary controls?: **Yes**\n* Are the conclusions drawn adequately supported by the data shown?: **Yes**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I am able to assess the statistics**\n* Quality of written English: **Needs some language corrections before being published**\n* Declaration of competing interests: **I declare that I have no competing interests' below**\n\nComments to Author:\n---\nI reviewed the manuscript by Qi L et al. This is an interesting topic of current issue. However, I think that this manuscript should be re-written.\nAuthors assumed in the discussion that their result confirmed that EN2 is more suitable as a diagnose target than PSA with better veracity and sensitivity, which consistent with the previous studies. The present study is size limited and no firm conclusion could be drawn based on it. As such, I encourage them to modify all the points of the paper in order to give the correct message that they are not giving firm conclusions. Moreover, some references were inadequatly inserted in the text. As an example they are talking about epidemiology and treatment of PC in the text but they cited studies which are about EN2 (references 1, 2, 3 and 4). Another example : the positive detection of EN2 in patients'urine with ELISA was predictive of PC with high sensitivity and specificity (66% and 88.2% respectively) [1, 10]. Bose et al. (10) is in vitro study demonstrating that En-2 is over-expressed in human prostate cancer cells as compared to normal prostate epithelial cells. In addition, it suggests that EN2 expression may be positively modulated by PAX2 transcription factor. This study should not be cited here. Please go through the whole manuscript and verify if references are inserted in the right place.\n\nOther remarks are detailed below.\n\nAbstract\nBackground: Authors stated here that EN2 has not been reported as a histochemical diagnostic biomarker of PC. However, Morgan et al. (2011) investigated in this regard and they did not found any evidence of EN2 staining in normal prostate tissue, benign hypertrophy nor in men with HGPIN (high grade prostatic intraepithelial neoplasia) in any tissue array section or biopsy from their patients.\n\n\"In this study, we analyzed the EN2 expression level and staining patterns in PC and benign prostatic hyperplasia (BPH) samples for seeing the change of EN2 in PC early stage. \" the real main of the study was to determine the staining patterns and expression level of Engrailed-2 in Benign prostatic hyperplasia and Prostate Cancer. Please change this\n\n\n\n\nIntroduction\n- Please replace 'prostate cancer' by its abreviation in the whole manuscript.\n\n\n- Authors claim that PSA has been found to be a widely used serum-based marker for early detection of cancers including PC. This is not correct, currently PSA is not really used as a diagnostic marker for PC, it is used especially in disease follow up due its low specificity and sensitivity. Moreover, Data about EN2 in other cancers are still preliminary and controversial. Personally, I do not know any other cancer for which PSA is used in clinical practice as an early detection biomarker.\n\n- \"…which would lead to the decline of patients' life quality…\". I propose : which could undermine patients' life quality\n\n- \"There are meta-analyses data shows BPH was associated with an increased incidence of prostate cancer …\". I propose: one meta-analysis showed that BPH was associated with an increased incidence of PC…\n\n- I do not really understand what do authors mean by \"How can we better judge the state of prostate disease? One is the need for more sophisticated testing instruments, one is the need for more sensitive diagnostic indicators\". Please reformulate the sentence.\n\n- \" A member of the HOX gene family, Engrailed-2 (EN2) has been justified overexpressing and playing important roles of oncogenesis…\" please modify: …has been found to be overexpressed…in oncogenesis\n\n\n- \"…and there are more and more studies keep showing ….without the need for other aided operations\" I propose: and there is some evidence showing that…what do you mean by aided operations?\n\n- \"All these results suggest a strong potential for EN2 becoming the most appropriate biomarker …\". … suggest a strong potential for EN2 as candidate biomarker…\n\n\n- \"Currently, urine EN2 detection is most widely accepted. Whether EN2 can be used as an indicator of histochemical diagnosis has not been reported\". Please modify: Currently, urine EN2 detection has become most widely accepted, but whether EN2 could be used as an histochemical diagnostic biomarker is yet to be determined\n\n- \"Current studies have mostly used polyclonal antibodies targeted at EN2 helix 3, and\nno monoclonal antibody targeted at this region…\". Please correct: most current studies have used polyclonal antibodies targeting EN2 helix 3, and no monoclonal antibody targeting this region… and also insert adequate references for these studies\n\n- \"In this study, we used a monoclonal antibody targeted…to clarify the malignancy degree of other indicators to avoid overtreatment\" here authors are giving a summary about their findings. I think it is more appropriate to move only the most important findings that will be discussed later in the discussion section and to include here the main objective of the study\n\n- I suggest revising the grammar and language of the manuscript\n"},{"type":"reviewerAgreed","content":"","date":"2019-11-13T12:00:00+00:00","index":5,"fulltext":""},{"type":"reviewerAgreed","content":"","date":"2019-10-16T12:00:00+00:00","index":4,"fulltext":""},{"type":"reviewerAgreed","content":"","date":"2019-10-14T12:00:00+00:00","index":3,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2019-09-25T12:00:00+00:00","index":2,"fulltext":"Recommendation: Reject\nForm responses:\n---\n* Are the methods appropriate and well described?: **No**\n* Does the work include the necessary controls?: **Unable to assess**\n* Are the conclusions drawn adequately supported by the data shown?: **No**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I am able to assess the statistics**\n* Quality of written English: **Not suitable for publication unless extensively edited**\n* Declaration of competing interests: **I declare that I have no competing interests' below**\n\nComments to Author:\n---\n"},{"type":"editorInvitedReview","content":"","date":"2019-09-25T12:00:00+00:00","index":1,"fulltext":"Recommendation: Major revisions required\nForm responses:\n---\n* Are the methods appropriate and well described?: **No**\n* Does the work include the necessary controls?: **Yes**\n* Are the conclusions drawn adequately supported by the data shown?: **Yes**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I am able to assess the statistics**\n* Quality of written English: **Not suitable for publication unless extensively edited**\n* Declaration of competing interests: **I declare that I have no competing interests.**\n\nComments to Author:\n---\nThe authors investigated if there were differences in the staining patterns and expression level of Engrailed-2 (EN2) monoclonal antibody in benign prostatic hyperplasia (BPH) and prostatic cancer (PC) among 25 tissues from each outcome. The authors found that EN2 was expressed in the cytoplasm and nucleus of tissues from BPH but in the cell membrane of tissues from PC. The authors also found EN2 expression was higher among tissues from PC than BPH. The study result if confirmed in other studies might help distinguish PC cases from BPH early and may become another useful biomarker in addition to the prostate-specific antigen (PSA). However, the sample size used in the current study is too small and the methodology used to compare the groups was less described.\n\nSpecific comments:\n\n1. The authors should describe the statistical analysis in greater detail. How did the author decide to use Student's t test? Have you tested for the distribution assumption?\n2. What type of correlation analysis did the authors conduct, is that Pearson correlation or Spearman correlation? Given that clinical stage is an ordinal variable, rank based correlation should be conducted.\n3. How did the author arrive at a sample size of 25 in each group?\n4. Tables 1 to 3 are repeated in the manuscript.\n5. Figures are also repeated in the manuscript and none of the second group of figures have any legend. In Figure 1 C, there are no lanes labelled 1 and 2 but + and -.\n6. In this study the author used sensitivity and specificity but none of these tests were conducted.\n7. The authors should describe the in more detail the strengths and limitations of the study.\n8. The conclusion that EN2 is a better diagnostic biomarker than PSA is questionable given that the sample size is too small.\n9. How did the authors assign clinical stages?\n10. The authors may also add the Gleason scores and examine any relationship with the EN2.\n11. In the abstract: The authors said they used case analysis. What do the authors refer to here?\n12. Please use consistently use cell membrane or cytomembrane.\n13. In the introduction: The authors should describe the background, what is already known, if there is any discrepancy in the literature on the topic, and the knowledge gap the current study is supposed to fill. Finally, the authors should describe their objective/aim and how they plan to do it. Please do not include the results from the current study in the introduction.\n\n\nMinor comments:\n\n1. In the abstract: Methods section, the \"of\" between exogenic EN2 is not necessary. In the next sentence, again \"of\" is not important between 25 and PC or BPH.\n2. In the next sentence, \"…further conforming…\" should be \"…further confirming…\"\n3. Please define all abbreviations before using, e.g. WB in abstract under Results.\n4. Introduction Line 38-39: \"…patients'urine…\" should be \"…patients' urine…\"\n5. Under Western Blotting: Line 34, \"…corroding…\" might have been used to mean \"…according…\"\n6. Under the Real-Time PCR: The expression level of EN2 in PC and BPH were calculated with \"2-△△Ct values\". What does \"2-△△Ct\" stand for?\n7. In Discussion first sentence, prostatic cancer, prostate cancer is redundant.\n8. Capitalize the first letter of urology in the author affiliations.\n\n\n"},{"type":"reviewerAgreed","content":"","date":"2019-09-23T12:00:00+00:00","index":2,"fulltext":""},{"type":"reviewerAgreed","content":"","date":"2019-09-20T12:00:00+00:00","index":1,"fulltext":""},{"type":"editorAssigned","content":"","date":"2019-09-19T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewersInvited","content":"","date":"2019-09-19T12:00:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2019-09-11T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2019-09-11T12:00:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"","date":"2019-09-02T12:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-cancer","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bcan","sideBox":"Learn more about [BMC Cancer](http://bmccancer.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bcan/default.aspx","title":"BMC Cancer","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5493e23e-7f06-4178-b6cb-cf986d5640f2","owner":[],"postedDate":"April 30th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":92039,"name":"Cancer Biology"},{"id":92040,"name":"Oncology"}],"tags":[],"updatedAt":"2020-06-22T17:36:58+00:00","versionOfRecord":{"articleIdentity":"rs-5302","link":"https://doi.org/10.1186/s12885-020-07049-z","journal":{"identity":"bmc-cancer","isVorOnly":false,"title":"BMC Cancer"},"publishedOn":"2020-06-15 12:00:00","publishedOnDateReadable":"June 15th, 2020"},"versionCreatedAt":"2020-04-30 18:03:59","video":"","vorDoi":"10.1186/s12885-020-07049-z","vorDoiUrl":"https://doi.org/10.1186/s12885-020-07049-z","workflowStages":[]},"version":"v3","identity":"rs-5302","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"identity":"rs-5302","version":["v3"]},"buildId":"FbvkV6FR0MCFSLy54lSbu","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00