Molecular detection of Staphylococcal enterotoxins and mecA genes products in selected food samples collected from different areas in Khartoum state.

Molecular detection of Staphylococcal enterotoxins and mecA genes products in selected food samples collected from different areas in Khartoum state. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research article Molecular detection of Staphylococcal enterotoxins and mecA genes products in selected food samples collected from different areas in Khartoum state. Mohammed Yahya, Hashim Abdalbagi Ali, Babbiker Mohammed Taher Gorish, and 12 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-59354/v3 This work is licensed under a CC BY 4.0 License Status: Posted Version 3 posted You are reading this latest preprint version Show more versions Abstract Background: Staphylococcal food poisoning is an intoxication that results from the consumption of improperly prepared or stored foods containing sufficient amounts of one or more preformed S. aureus enterotoxins. Nowadays many researchers worldwide noted an emergence of resistant strains Staphylococci particularly for the antibiotic methicillin. Therefore, this study was aimed to determine the existence of Staphylococcus aureus and its enterotoxins, mecA genes in selected food samples. Results: A total of 400 selected food samples were collected from different areas in Khartoum state. The selected foods included cheese, meat products, fish and raw milk. One hundred sample from each type of food were cultivated and the resultant growth yielded 137 (34.25 %) S. aureus , 126 (31.5%) bacteria other than S. aureus and 137 (34.25%) yielded no growth. Eighty-four of the137 S. aureus isolates were randomly selected and tested for the presence of mecA and enterotoxin genes. Oxacillin sensitivity test showed that 15(11%) of 137 S. aureus isolates were Oxacillin resistant. The PCR assay showed that the mecA gene was detected in 15 of 84 (17%) S. aureus isolates. Simultaneously, only 2 (2.385%) out of 84 S. aureus isolates showed an enterotoxin B gene product. Conclusion: There was a relatively moderate prevalence of methicillin-resistant staphylococcus aureus with very low frequency of enterotoxin B gene in different kinds of selected food samples that collected from Khartoum state. These findings elucidate the increased risk on public in Khartoum being affected by Staphylococcal food poisoning upon consumption of dairy or meat products prepared in unhygienic conditions that could lead to intoxication by Staphylococcus aureus enterotoxins. General Microbiology Food samples S. aureus Sensitivity test enterotoxin gene mecA gene PCR Figures Figure 1 Figure 2 Background Food-borne diseases (FBD) remain one of the greatest concerns in public health and food safety, they are caused by many pathogens that contaminate food and food products (1). Many food sources may serve as a substrate for many microorganisms which are transmitted during harvesting, storage or food processing and handling by multiple environmental sources such as water, soil, insects, or even by the handlers (2). Staphylococcal Food Poisoning (SFP) is an intoxication that results from the consumption of improperly prepared or stored foods containing sufficient amounts of one or more preformed enterotoxins (3, 4). A wide variety of foods support the growth of Staphylococcus aureus and are ideal for enterotoxin production including milk, meat, meat products, dairy products, and ready-to-eat food (5, 7). Although Staphylococcus aureus may produce a large variety of enterotoxins, 95% of food poisoning outbreaks are caused by classical enterotoxins: A, B, C, D and E (6). Since these toxic proteins are capable of tolerating high temperatures up to 100°C for several minutes, improperly cooked food contaminated with bacteria or its preformed toxins in sufficient amounts could lead to Staphylococcal food poisoning within a few hours characterized by symptoms including nausea, vomiting and diarrhea (8). Some strains of Staphylococcus aureus have the ability to resist heat and drying; hence, it can easily contaminate foods. This contamination might come from food handlers or from the environment, where the bacteria multiply and release toxins in uncooked or inadequately cooked foods, especially if the foods are unrefrigerated (9). The consumption of foods of animal origin contaminated with MRSA or MRSA preformed enterotoxins could lead to serious threats to the well-being of humans due to uncountable clinical implications (10). Non-hygienic handling practices, working conditions, and improper storage and refrigeration; can all increase the opportunity for food contamination. So, it is important to follow the standard practices in food handling such as hand washing, proper cooking, proper storage and others to reduce or prevent food contamination (11, 14). There is paucity of information in Sudan regarding the role Staphylococcus aureus in food poisoning and the presence of enterotoxins in mecA genes in common consumed foods in Khartoum State. Hence, this study was conducted to determine the prevalence of enterotoxins and mecA genes in foods commonly consumed in Khartoum State, Sudan. Result Prevalence of S. aureus isolates in food samples The Presence of S. aureus was observed in 137 (34.25%) of the 400 food samples collected from different areas in Khartoum state. However, 126 (31.5%) of the 400 samples were identified as bacteria other than S. aureus and 137 (34.25%) samples did not yield any growth (Table 1). All isolated S. aureus confirmed by detection of the 16S rRNA housekeeping gene product which correspond to756 bp band size (Figure 1). Detection of mecA and enterotoxins genes among the S. aureus isolates The 84 different S. aureus isolates were randomly selected from a total of 137 S. aureus isolates. The selected isolates were further examined for the presence mecA and enterotoxin genes using specific primer in a conventional PCR assay. The mecA gene was detected in 15 (17%) S. aureus isolates (in samples number 6,13,55,63 and 81 of meat and samples number 2,11,47,72 for cheese and in samples number 19,28,34 and 49 of milk and in samples number 9 and 38 of fish ) (Table 2), (Figure 1, 2). However, only 2 (2.385%) of 84 S. aureus isolates were showed an enterotoxin B gene product (both isolates were from cheese samples and the samples ID were 16 and 31), while the rest of 82 isolates were negative. All isolates were negative for other enterotoxins gene (other than seb gene) (Table 2), (Additional figure 1). Meat isolates antimicrobial susceptibility characteristics Presence of S. aureus was observed in 30 (30%) of the 100 Milk samples (Table3) of which 11 (36.7%) isolates were detected in raw beef and 19 (63.3%) were identified in restaurants meat. However, 20 (20%) samples showed a growth of bacteria other than S. aureus and 50 (50%) samples showed no growth. All tested meat S. aureus isolates, were susceptible to ciprofloxacin. The resistant rates of meat S. aureus isolates to gentamycin was 4 (13.3%) and it was higher than that identified to the antibiotics oxacillin and vancomycin with percentage of 2 (6.6%) and 5 (16.7%) respectively (Table 4). The PCR assay for enterotoxin gene products showed that none of the meat S. aureus isolate produce enterotoxins genes products (Additional figure 1). Cheese isolates antimicrobial susceptibility characteristics The examination of 100 cheese samples collected from different area in Khartoum state revealed that the occurrence of S. aureus Isolate was 20 (20%). While bacteria others than S. aureus were represented 4%. However, none of the rest 76(76%) showed any growth on the agar plate surface (Table 3). We found that all isolates were susceptible to both gentamicin, ciprofloxacin antibiotics. However, vancomycin showed growth-inhibition zones with 17 (85%) isolates out of 20 positive samples. Only one (5%) cheese S. aureus isolate was resistant to oxacillin (Table 4). Enterotoxin gene B ( seb ) was detected only in 2(10%) of cheese isolates (samples ID were 16 and 31). While none of other types of enterotoxin genes products were detected among these isolates (Additional figure 1). Antimicrobial Profile for fish S. aureus isolates In this study a total of 100 fish samples (50 salted fish 50 raw fish) were analyzed for the presence of bacterial pathogens. The study revealed 24/100 (24%) of the fish samples had S. aureus contamination (Table 3). Antibiotic susceptibility of S. aureus was tested using the agar disc diffusion method. The results have shown that all fish originated S. aureus isolates were susceptible to both ciprofloxacin and gentamicin antibiotics. In contrast, the resistance rate was only 8% to both vancomycin and oxacillin antibiotics (Table 4). No enterotoxin gene product was detected during the gel electrophoresis procedure which applied after successful cycles of conventional PCR (Additional figure 1). Antimicrobial Profile for milk S. aureus isolates Out of 100 milk samples collected from different areas in Khartoum state 63(63%) were identified as S. aureus , 26(26%) were identified as bacteria others than S. aureus and 11(11%) showed no growth (Table 3). The antimicrobial susceptibility test was done to all S. aureus isolates and the result showed that the highest susceptibility rate was recorded to ciprofloxacin and gentamicin with a percentage of 98.4% (62/63 isolates) and 87.3% (55/63 isolates) respectively, followed by oxacillin with a percentage of 84% (53/63). However, the least potent antibiotic was vancomycin with a percentage of 65% (41/63) (Table 4). The enterotoxin genes results reveal that no S. aureus isolate produces such genes (Additional figure 1). Table 1. Distribution of bacteria isolated from selected food samples purchased from retailers in Khartoum State Isolate Number Percentage Staphylococcus aureus 137 34.25% Others bacteria 126 31.5% No growth 137 34.25% Total 400 100% Table 2. Distribution of mecA and enterotoxin genes among Staphylococcus aureus isolates Type of gene detected Positive Negative Total mecA gene 15 (17.9%) 69 (82.1%) 84 (100%) Enterotoxin B gene 2 (2.38%) 82 (97,62%) 84 (100%) Other enterotoxin genes 0 (0%) 84 (100%) 84(100%) Table 3. Distribution of Staphylococcus aureus isolates according to the type of food samples Sample S. aureus Isolates Other Bacteria Isolates No growth Total Meat 30 (30%) 20 (20%) 50 (50%) 100 (100%) Cheese 20 (20%) 4 (4%) 76 (76%) 100 (100%) Fish 24 (24%) 76 (76%) 0 (0%) 100 (100%) Milk 63 (63%) 26 (26%) 11(11%) 100 (100%) Total 137 126 137 400 Table 4. Show Antimicrobial sensitivity pattern of Staphylococcus aureus that isolated from different food material samples Isolates Pattern Antibiotics Gentamycin (10mg) Ciprofloxacin (5mg) Oxacillin (5mg) Vancomycin (30mg) Meat Sensitive 26 (86.7%) 30 (100%) 28 (93.4%) 25 (83.3%) Resistant 4 (13.3%) 0 (0%) 2 (6.6%) 5 (16.7%) Cheese Sensitive 20 (100%) 20 (100%) 19 (95%) 17 (85%) Resistant 0 (0%) 0 (0%) 1 (5%) 3 (15%) Fish Sensitive 24 (100%) 100(100%) 22 (92%) 22 (92%) Resistant 0 (0%) 0 (0%) 2 (8%) 2 (8%) Milk Sensitive 55 (87.3%) 62 (98.4%) 53 (84%) 41 (65%) Resistant 8 (12.7%) 1 (1.6%) 10 (16%) 22 (35%) Total 137 137 137 137 Discussion In this study, the prevalence of S. aureus and MRSA and enterotoxin gene products were investigated in various food samples collected from Khartoum state markets (400 samples of milk, cheese, fish, meat). Identification of the bacteria isolated from the selected foods through conventional methods yielded a total of 137 (34.3 %) S. aureus isolates. Similar reports on foods contaminated with S. aureus from Italy and India revealed much lower percentage yielding 17.1% (15) and 12.01% (16) respectively. The previous studies conducted to detect S. aureus in various foods revealed that the contamination levels with S. aureus reported were lower than those obtained in this study. On the other hand, a study in Greece reported 47.8% of north-central and north-eastern Greece foods; which is much higher contamination level compared to those reported in this study (3). Those great discrepancies between our finding and other studies results may be due to variation in foods, habits, cooking behaviors, food keeping hygiene in addition to environmental factors like the weather temperature and moist which significantly affect bacterial growth in food materials. In this study resistance gene ( mecA ) of S. aureus that responsible for resistance to β-lactam antimicrobials was detected by using PCR and we find 15 (17%) of S. aureus isolates are positive for the mecA gene while 69 (83%) were negative. Comparing our finding to previous studies results we realize that most previous studies results showed a significantly higher prevalence than our finding for example in a study done by Khayri in Makkah city he found that about 44.4 % of his S. aureus isolates were positive for mecA gene (4). Similarly, Papadopoulos and his colleagues found that 81.3% of their S. aureus isolates were positive for the mecA gene (3). This variation could be due to the difference in the antibiotic protocol applied by the doctors for their patients in different countries or due to the extensive usage of methicillin antibiotics their communities or by doctors during treatment prescription in these countries and eventually lead to a high prevalence rate of MRSA. On the contrary, the results reported in this study are higher than those reported by Novak et al (5) where the mec A gene prevalence was only 11.4 %. Low rates of mecA gene were also reported in Egypt, Brazil and China where the prevalence of mecA gene was 5.1%, 9% and 7.9%, respectively (6-8). The variation between the results may be due to variation of samples sources and the use of different molecular techniques in different countries for the detection of mecA gene product. In this study, one hundred raw meat samples were obtained from different supermarkets and restaurants in Khartoum state. These samples are examined for the presence of S. aureus . Thirty (30%) samples were found to be contaminated with S. aureus . These findings highlight the high potential risk for consumers of meat and dairy products especially in the absence of strict hygienic and preventive measures to avoid Staphylococcus aureus enterotoxins (SEs) production in foods. In other comparative studies, similar results were reported from USA where the prevalence of S. aureus in meat samples was 29.0% (23). Much lower results were reported in South Africa, who reported that S. aureus was 26.5% (24). Also, our result is lower than that obtained by Das et al . in India who reported that out of 65 samples S. aureus incidence was in 46.1% (25) . In our study, none of the meat S. aureus isolates were resistant to ciprofloxacin and 13.3% were resistant to gentamicin. In disagreement with our result Das et al in India found that 16.66% of S. aureus meat isolates were resistant to ciprofloxacin (25) and Pu S et al., in Louisiana found that 13.0% were resistant to ciprofloxacin. Also, in contrast to our findings. Pu S et al. in Louisiana found that 3.0% were resistant to gentamicin (26). Vancomycin-resistant Staphylococcus aureus (VRSA) is a type of antibiotic-resistant S. aureus which have developed a resistance and can no longer be treated with vancomycin. This study showed that 16.6% of the meat isolates were resistant to vancomycin, which suggests that the contamination may be coming from VRSA carrier's food handlers and processors, however Das et al found that 3.33% of the isolates were resistant to vancomycin (VRSA) which is low compared with our findings (25). Methicillin-resistant S. aureus (MRSA) strains have acquired a gene that makes them resistant to nearly all beta-Lactam antibiotics, animal-adapted MRSA strains also exist although it's in small percentage but it's of a clinical importance and may cause serious problems to immunocompromised individuals as well as healthy ones (carriers). In this study 6.6% of meat isolates were resistant to oxacillin, this finding was high compared to Inge et al results whom found that 2.5% of S. aureus meat isolates were resistant to oxacillin (27), and low compared to Das et al results whom found that 23.3% of S. aureus isolates were resistant to oxacillin (25). Investigations through PCR technique on enterotoxin genes in this study showed the absence of enterotoxin genes in meat S. aureus isolates. A similar study in Denmark demonstrated the presence of enterotoxin genes in only 0.2% of the isolates (28). On the other hand, report from China demonstrated prevalence of 46.0% enterotoxin gene (29) and Bergdoll, found that the percentage of enterotoxigenic strains of S. aureus is estimated to be around 25% (30). Moreover, most of S. aureus food isolates are not SEs producers, thus considerable research effort is still required for a better understanding of the interactions between S. aureus and the food matrix and of the mechanism of SEs production in foods stuffs (31). The data obtained in this study probably underestimated the enterotoxigenic properties of the analyzed strains, since the possible presence of newly described SEs was not considered and the sample size was too small to represent S. aureus contaminated meat effectively. However, there is always the possibility of mutation at the level of the corresponding gene, leading to the absence of its detection. Therefore, a positive PCR shows the presence of the enterotoxin genes but a negative PCR does not point to the absence of the corresponding operon because there are many types of enterotoxin genes and we determine only one type (31). In this study, one hundred white cheese samples collected from different retailers in Khartoum State to detect the rate of S. aureus contamination in cheese sample in this study is higher than that reported in Iran and Japan where the reported contamination rates were 16% and 13.3% respectively (32,33), and lower than that reported in Turkey which was 37.5% (34). However, the results in this study disagree with a previous report in Khartoum State where no Staphylococcus aureus were found on white cheese (35). This may be due to variation in sample sources where the cheese was manufactured, the retailers where cheese samples were purchased from, the sampling area, season and environment, all these factors might affect the rate of contamination with microorganisms. The rate of sensitivity of cheese S. aureus isolates to gentamicin and ciprofloxacin was 100%; these findings opposes those reported in the U.S.A, where 75% of S. aureus isolates were resistant to gentamicin (36) and in Iraq where 25% of S. aureus isolates were resistant to ciprofloxacin (37). The resistance of cheese S. aureus to Oxacillin in this study was (5%) which was lower than that reported in Iraq which was 20% (38). The sensitivity to vancomycin was 85% which is lower than that reported in Switzerland which was 100% (39, 40). The molecular detection of Staphylococcus aureus enterotoxins (A, B, C, D and E) genes among cheese isolates resulted in the detection of seb gene in 10% of the 20 isolates, that was lower than the results obtained by Salheen in Sudan who reported 20% of seb gene was detected in cheese samples (41). The variation between results could be due to several factors such as sample source, geographical origin, the sensitivity of identification methods and sample size can affect the outcomes. In this study 108 of fish samples were examined. The contamination rate of fish samples in this study is very low (22%) when compared with a previous report in Khartoum State 72% (42), Egypt 93% (43), India 100% (44) and relatively lower than that reported in Spain (27%) (45). Antimicrobial susceptibility results for fish S. aureus isolates showed 100% sensitivity to ciprofloxacin, which was in agreements with reports in Egypt (43), Turkey (46) and very close to a study in also nearly similar to the Portugal 98% (47). However, lower results in India was 48.5% (48) and in Egypt was 57% (49). gentamycin also showed an efficacy rate of 100% among all S. aureus isolates, which is similar to reports from Egypt (49), Turkey (46), and that of Vázquez-sánchez et al., in Spain (45), and slightly similar to results reported in Egypt 97% (43) and in Portugal, 92% (47). In this study, S. aureus isolated from fish samples showed a sensitivity rate of 92% to vancomycin, which is similar to those, reported in Egypt 91% (43) and Portugal 90% (47) respectively. Another study in Egypt reported higher result 100% (49), while other studies in Turkey reported much lower sensitivity to vancomycin, which was 83% and 78% respectively (46,50). The oxacillin showed 92% potency against fish S. aureus isolates which was higher than that reported in Portugal 62% (47), while it was relatively lower than those reported in Spain and Turkey where both reported 100% (45, 46). The variation between these results could be due to contribution of several factors such as source of samples, geographical origin, the sensitivity of identification methods and sample size can affect the outcomes. The molecular detection of the enterotoxins genes among fish S. aureus isolates gave no band for all genes meaning that none of the all isolates possess such gene in their genetic material this finding was in agreement with those reported in Turkey and USA (46, 51), where no enterotoxins B, C and E genes were found in their food S. aureus isolates. However, a study in Tanzania, reported that enterotoxin B and C genes were detected in 0.3% with the absence of enterotoxin A gene (52), while a study from Turkey reported enterotoxins A and D genes in 10.5% of their samples (46). Variation among researcher studies results and our findings could be due to several factors such as samples source, geographical origin, the sensitivity of identification methods and sample size can affect the outcomes. In this study, S. aureus was isolated in 63% of raw milk samples, which is relatively close to that reported in Brazil 68% (53) and Malaysia 60% (54). However, this finding was lower than those reported in Turkey 75% (55) and Egypt 82% (56). The prevalence of this study is higher than those reported in two different studies in Iraq with prevalence of 53.33%, 43.5%, respectively (57, 58). Moreover, the prevalence of S. aureus in this study is too high compared to reports from Sudan and Egypt where the levels were 30% and 24.8% respectively (59,60) . S. aureus isolated from milk samples in this study were highly sensitive to ciprofloxacin 98.4%, which is close to a report from a study in Bangladesh 93.3% (61). However, relatively lower susceptibility levels were reported in India and Bangladesh where the rate was 80% and 83.3% respectively (62, 63). The sensitivity to gentamycin in this study 87% is lower than that reported in Ethiopia 90% (64, 63), 100% (65) and higher compared to another report in Sudan which was 47.6% (59). While slightly similar to results obtained by Beyene, in Ethiopia, and Thaker et al., in India whom reported that 90% of S. aureus isolates were sensitive to gentamicin (64, 63). Reports from other researchers were indicated a higher level of susceptibility rate to gentamicin for instance Abraha et al., in Ethiopia reported 100% of milk S. aureus isolate are susceptible to gentamycin (65). In this study, vancomycin susceptibility test was determined for all milk originated S. aureus and the result showed that 65% of the S. aureus isolates were susceptible to vancomycin, this finding was completely closed to findings reported by Idbeis, in Basrha in Iraqe, AL –Marsomy, and Bendahou et al ., in North Morocco who mentioned that S. aureus isolated from raw milk and milk product showed sensitivity to vancomycin of 100% (66,67,68). ). On the contrary studies in Ethiopia and Iraq reported 100% resistance to Vancomycin (65, 69). The sensitivity to Oxacillin 84% in this study is higher than that reported in India 70% (63) and lower than that reported in Bangladesh 100% (62). All milk S. aureus isolates tested for the presence of enterotoxins genes yielded negative results. Similar findings were reported in Hungary (70). The variations between results reported in this study and other reports could be attributed to several factors such as samples source, geographical origin, the sensitivity of identification methods and sample size can affect the outcomes. Methods Collection of selected food samples A total of 400 samples were collected from different areas in Khartoum state (Khartoum, Omdurman, East Nile and Khartoum North), during 2018. The type of foods included Cheese, Meat products, Fish and Raw milk. Each sample was aseptically collected, fifteen grams of cheese samples were collected from different retailers by using sterile container, meat samples were collected randomly from supermarkets and restaurants using disposable blades, a small piece of raw meat had been spiltted and transferred to the lab in sterile containers, small pieces fish inner tissues were collected by sterile blade and placed in sterile plain containers and milk samples were collected in sterile containers and stored in a refrigerator at 4°C in microbiology laboratory until examined. Isolation and identification of coagulase positive Staphylococcus isolates Meat, fish and cheese samples were enriched in peptone water. The raw milk and the enriched peptone water samples were swabbed and inoculated in Blood agar medium, Mannitol salt agar medium and MacConkey’s agar medium and incubated aerobically at 37∘C for 24-48 hrs. The presence of Staphylococcus aureus was confirmed based on colony morphology; Gram’s reaction and other biochemical tests including catalase test, coagulase test and DNase test. Antimicrobial susceptibility testing of coagulase positive Staphylococci The antimicrobial susceptibility test was done by disk diffusion method using Mueller-Hinton agar plates (oxoid) according to (12). Where 4 antimicrobial agents belonging to different classes were selected including ciprofloxacin (5 μg), gentamicin (10 μg), oxacillin (5 μg) and vancomycin (30 μg). The S. aureus ATCC 52923 Control strain was used. DNA Extraction DNA was extracted by simple boiling method, in which the extracted product was done from overnight isolates on Nutrient Agar. A loop full of bacterial colony was picked from an isolate and suspended in 300μl of sterile distilled water and 10μl of proteinases K was added and incubated at 6o°C for 60 minutes. Then incubated at 100°C in a water bath for 15 minutes, and then the suspension was centrifuged at high speed (10000 rpm for 10 min). The supernatant containing the genomic DNA was transferred into a fresh sterile Eppendorf tube and stored at -20°C until to be used for PCR (13). PCR Detection of 16s rRNA gene All samples were confirmed as S. aureus by using specific housekeeping gene primer (16s), showed in Table 5 . Negative samples were excluded. The DNA amplifications were performed from a volume of 25 μL of a mixture containing 2 μL Maxime PCR Premix, 0.5 μL of each primer, 2 μL of template DNA and 20 μL of double distilled water. The amplification conditions were included three steps: initial denaturation at 94°C for 5 min; 35 successful cycles of denaturation at 94°C for 45sec, annealing at 50°C for 45sec, and extension at 72°C for 45 sec; and the final extension at 72°C for 7 min (14). PCR Detection of Staphylococca l Enterotoxins Genes Multiplex PCR, amplification was done using (CLASSIC K960, UK) thermo cycle. PCR amplification of Staphylococcal enterotoxins (SE) genes, namely ( sea , seb , sec , sed and see ) was performed using Maxime PCR Premix kit (iNtRON, Korea) and specific primers listed in Table 5 The PCR assay was carried out in a total volume of 25 μL of mixture containing 2 μL Maxime PCR Premix, 0.5 μL of each of the toxin gene-specific primers (5 μL), 2 μL of template DNA and 16 μL of double distilled water. The amplification conditions included three steps: initial denaturation at 94°C for 5 min; 35 successful cycles of denaturation at 94°C for 45sec, annealing at 50°C for 45sec, and extension at 72°C for 45 sec; and the final extension at 72°C for 7 min (14). PCR Detection of mecA Gene Primers were used for the detection of mecA gene, showed in table 5 . DNA amplification was done using Maxime PCR Premix kit (iNtRON, Korea), The PCR assay was carried out in a total volume of 20 μL of mixture containing 2 μL Maxime PCR Premix, 0.5 μL of each of the gene-specific primers (5 μL), 2 μL of template DNA and 13 μL of double distilled water. The amplification conditions included three steps: initial denaturation at 94°C for 5 min; 35 successful cycles of denaturation at 94°C for 45sec, annealing at 52°C for 45sec, and extension at 72°C for 45 sec; and the final extension at 72°C for 7 min. Table 5. Primers used for detection of S. aureus housekeeping gene, enterotoxins and mecA genes. Primer Sequence 5' – 3' Product size (bp) Housekeeping gene primers Staph 756-F AACTCTGTTATTAGGGAAGAACA - Staph 750-R CCACCTTCCTCCGGTTTGTCACC 756 Enterotoxins genes primers SA-Ua- F TGTATGTATGGAGGTGTAAC - SA-A- R ATTAACCGAAGGTTCTGT 270 SA-B-R ATAGTGACGAGTTAGGTA 165 ENT-C-R AAGTACATTTTGTAAGTTCC 102 SA-D-R TTCGGGAAAATCACCCTTAA 303 SA-E-R GCCAAAGCTGTCTGAG 213 mecA gene primers MecA1 – F AACTCTGTTATTAGGGAAGAACA - MecA1 –R CCACCTTCCTCCGGTTTGTCACC 310 Ua: Universal, f: Forward, r: Reverse Quality control All samples were aseptically collected and analyzed, positive control which was a well-known enterotoxin and mecA genes producing Staphylococcus aureus and negative control which was sterile distilled water were included during PCR running. List of Abbreviations FBD: Food borne diseases S. aureus : Staphylococcus aureus PCR: polymerase chain reaction MRSA: Methicillin-Resistant Staphylococcus aureus SEs: Staphylococcus aureus enterotoxins VRSA: Vancomycin-Resistant Staphylococcus aureus Declarations Ethics approval and consent to participate Not applicable Consent for publication Not applicable Availability of data and materials The datasets analyzed during the current study are available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interest. Funding The authors received no specific funding for this work. Authors’ contributions MY, HA, BG, SO, ES, MH, performed main experiments, AA, SK, SO, NA, AS collected’ samples and information. MY, HA, WM, HN, YF, AI designed the experiments and wrote the manuscript. All authors read and approved the final manuscript. Acknowledgments The authors gratefully acknowledge for his great effort Microbiology lab staff in Sudan university of science and technology. We also express our thanks and appreciation to all salles man in all markets whom provide us the samples to achieve this research. References 1-Abd Elsalam, EE. Rapid Method for Detection of Staphylococcus aureus Enterotoxins in Food. B.V.Sc. Cairo University. 2008. 2- Ubiebi CO. Isolation and Identification of Bacterial Isolates from Poultry and Fish Feeds sold In Abraka, Delta State, Nigeria. Journal of Industrial Technology, 2017; 2(1): 14- 20. 3- Niveditha P, Shylaja R, Radhika M, Murali S, Harshvardhan B. A novel mPCR for the detection of prominent toxins in MRSA strains of S. aureus recovered from diverse sources. Int J Res Biol Sci. 2014, 2 (4): 1-3. 4- Schelin J, Wallin-Carlquist N, Cohn MT, Lindqvist R, Barker GC, Rådström P. The formation of Staphylococcus aureus enterotoxin in food environments and advances in risk assessment. Virulence. 2011; 2(6):580-592. doi:10.4161/viru.2.6.18122 5- Aydin A, Sudagidan M, Muratoglu K. Prevalence of staphylococcal enterotoxins, toxin genes and genetic-relatedness of foodborne Staphylococcus aureus strains isolated in the Marmara Region of Turkey. Int J Food Microbiol. 2011;148(2):99-106. doi: 10.1016/j.ijfoodmicro.2011.05.007. 6- Letertre C, Perelle S, Dilasser F, Fach P. Identification of a new putative enterotoxin SEU encoded by the egc cluster of Staphylococcus aureus. J Appl Microbiol. 2003;95(1):38-43. doi:10.1046/j.1365-2672.2003. 01957.x 7- Techer C, Salmain M, Tranquet O, Echasserieau Valérie, Le Moigne V, Hennekinne J, Gautier M, Val Florence. Detection and quantification of staphylococcal enterotoxin A in foods with specific and sensitive polyclonal antibodies, Food Control. 2013; https://doi.org/10.1016/j.foodcont.2012.11.021. 8-Carroll K C, Butel, J, Morse S. Jawetz Melnick & Adelberg Medical Microbiology 27th edition. New York. Mc Graw Hill Professional, 2012; p203-208. 9-Black JG. Microbiology Principles and Explorations”.7thed. United States of America: John Wiley and Sons, 2008; Pp 684-685 10- Monecke S, Coombs G, Shore AC, et al. A field guide to pandemic, epidemic and sporadic clones of methicillin-resistant Staphylococcus aureus. PLoS One. 2011; doi: 10.1371/journal.pone.0017936 11- Ezzeldeen NA, Mansour HA, Ahmed AA. Phenotypic and Molecular Identification of Staphylococcus aureus Isolated from some Egyptian Salted Fish”. World Applied Science Journal. 2015; 15 (12):1703-1712. 12- Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-First Informational Supplement. M100-S21. 2011. 13- Compain F, Babosan A, Brisse S, et al. Multiplex PCR for detection of seven virulence factors and K1/K2 capsular serotypes of Klebsiella pneumoniae. J Clin Microbiol. 2014;52(12):4377-4380. doi:10.1128/JCM.02316-14. 14-Mahmoud L H. Molecular detection of Staphylococcus aureus toxin genes isolated from different clinical samples in Khartoum state. PhD thesis. Sudan University of Science and Technology. 15- Traversa A, Gariano GR, Gallina S, Bianchi DM, Orusa R, Domenis L, Cavallerio P, Fossati L, Serra R, Decastelli L. Methicillin resistance in Staphylococcus aureus strains isolated from food and wild animal carcasses in Italy. Food Microbiol. 2015; 52:154-8. doi: 10.1016/j.fm.2015.07.012. 16- Sivakumar M, Dubal ZB, Kumar A. Virulent methicillin resistant Staphylococcus aureus (MRSA) in street vended foods. J Food Sci Technol. 2019; 56, 1116–1126 https://doi.org/10.1007/s13197-019-03572-5. 17- Papadopoulos P, Papadopoulos T, Angelidis AS, Kotzamanidis C, Zdragas A, Papa A, Filioussis G, Sergelidis D. Prevalence antimicrobial susceptibility and characterization of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus isolated from dairy industries in north-central and north-eastern Greece. Int J Food Microbiol. 2019; 16; 291:35-41. doi: 10.1016/j.ijfoodmicro.2018.11.007. 18- Khayri A, Al-Ouqaili M, Hassan A. Molecular detection of MEC A and FEM A genes in methicillin-resistant Staphylococcus aureus isolated from patients with skin infections, Research Gate 2011; pp.20 19- Novak F R, Almeida J A, Warnken GD, Ferreira-Carvalho MB, Hagler A N. Methicillin-resistant Staphylococcus aureus in human milk. Memórias do Instituto Oswaldo Cruz, 2009; 95(1), 29-33.‏ 20- Rania M K, Mohamed A B, Salah FA. MRSA detection in raw milk, some dairy products and hands of dairy workers in Egypt, a mini-survey, Food Control, 2013; 33 (1): 49-53, https://doi.org/10.1016/j.foodcont.2013.02.017 21- Rizek CF, Matté MH, Dropa M, Mamizuka EM, de Almeida LM, Lincopan N, Matté GR, Germano PM. Identification of Staphylococcus aureus carrying the mecA gene in ready-to-eat food products sold in Brazil. Foodborne Pathog Dis. 2011; 8(4):561-3. doi: 10.1089/fpd.2010.0706. 22- Wang W, Baloch Z, Jiang T, Zhang C, Peng Z, Li F, Fanning S, Ma A, Xu J. Enterotoxigenicity and Antimicrobial Resistance of Staphylococcus aureus Isolated from Retail Food in China. Front Microbiol. 2017; 21; 8:2256. doi: 10.3389/fmicb.2017.02256. 23- Kelman A, Soong YA, Dupuy N, Shafer D, Richbourg W, Johnson K, Brown T, Kestler E, Li Y, Zheng J, McDermott P, Meng J. Antimicrobial susceptibility of Staphylococcus aureus from retail ground meats. J Food Prot. 2011; 74(10):1625-9. doi: 10.4315/0362-028X.JFP-10-571 24- Ramatla T, Nthabiseng M, Kutswa G, Moeti T, Oriel MM, Thekisoe, Michelo S. “Identification of Rodent Species That Infest Poultry Houses in Mafikeng, North West Province, South Africa.” International Journal of Zoology, 2019. 25- Das, Piyali and Pranab Behari Mazumder. “Prevalence of Staphylococcus in raw meat samples in Southern Assam, India.” (2016); 9(1), 23–29. 26- Pu S, Wang F, Ge B. Characterization of toxin genes and antimicrobial susceptibility of Staphylococcus aureus isolates from Louisiana retail meats. Foodborne Pathog Dis. 2011; 8(2):299-306. doi: 10.1089/fpd.2010.0679. 27- van Loo IH, Diederen BM, Savelkoul PH, Woudenberg JH, Roosendaal R, van Belkum A, Lemmens-den Toom N, Verhulst C, van Keulen PH, Kluytmans JA. Methicillin-resistant Staphylococcus aureus in meat products, the Netherlands. Emerg Infect Dis. 2007; 13(11):1753-5. doi: 10.3201/eid1311.070358. 28- Larsen HD, Huda A, Eriksen NH, Jensen NE. Differences between Danish bovine and human Staphylococcus aureus isolates in possession of superantigens. Vet Microbiol. 2000 Sep 25;76(2):153-62. doi: 10.1016/s0378-1135(00)00232-7. 29- Li S, Wang P, Zhao J, Zhou L, Zhang P, Fu C, Meng J, Wang X. Characterization of Toxin Genes and Antimicrobial Susceptibility of Staphylococcus aureus from Retail Raw Chicken Meat. J Food Prot. 2018; 81(4):528-533. doi: 10.4315/0362-028X.JFP-17-309. 30- Bergdoll MS. Staphylococcus aureus. In: Food borne Bacterial Pathogens, Doyle, M. (Ed.). CRC Press, New York, USA, ISBN: 9780824778668, 1989; PP: 463-523. 31- Le Loir Y, Baron F, Gautier M. Staphylococcus aureus and food poisoning. Genet Mol Res. 2003; 31;2(1):63-76. 32- Shanehbandi D, Baradaran B, Sadigh-Eteghad S, Zarredar H. Occurrence of Methicillin Resistant and Enterotoxigenic Staphylococcus aureus in Traditional Cheeses in the North West of Iran. ISRN Microbiol. 2014; doi: 10.1155/2014/129580. 33- Katsuda K, Hata E, Kobayashi H, et al. Molecular typing of Staphylococcus aureus isolated from bovine mastitic milk on the basis of toxin genes and coagulase gene polymorphisms. Veterinary Microbiology. 2005; 105(3-4):301-305. DOI: 10.1016/j.vetmic.2004.12.004. 34- Gucukoglu A, Kevenk TO, Uyanik T, Cadirci O, Terzi G, Alisarli M. Detection of enterotoxigenic Staphylococcus aureus in raw milk and dairy products by multiplex PCR. Journal of Food Sciense. 2012; 77(11); 1750-3841. 35- Mohamed TA, Kalid AE, Saaclaki AM. Isolation of Staphylococcus aureus from semi preserved udanese food. Research Journal of Microbiology, 2014; 9(5); 246-250. 36- Seguin JC, Walker RD, Caron JP, Kloos WE, George CG, Hollis RJ, Jones RN, Pfaller MA. Methicillin-resistant Staphylococcus aureus outbreak in a veterinary teaching hospital: potential human-to-animal transmission. J Clin Microbiol. 1999; 37(5):1459-63. doi: 10.1128/JCM.37.5.1459-1463. 37-Jaber, NN. Isolation and biotyping of Staphylococcus aureus from white cheese in Basrah local markets. Journal of Veterinary Research, 2011; 10(2). 38- Alshammary AH, and Galfoori MH. Detection of methicillin or multidrug resistant Staphylococcus aureus (MRSA) in locally produced raw millk and soft cheese in Baihadad markets Irag. Journal of Veterinary medicine, 2013; 37(2); 226-231. 39- Gentilini E, Denamiel G, Llorente P, Godaly S, Rebuelto M, DeGregorio O. Antimicrobial susceptibility of Staphylococcus aureus isolated from bovine mastitis in Argentina. J Dairy Sci. 2000; 83(6):1224-7. doi: 10.3168/jds. S0022-0302(00)74988-5. 40- Gentilini E, Denamiel G, Llorente P, Godaly S, Rebuelto M, DeGregorio O. Antimicrobial susceptibility of Staphylococcus aureus isolated from bovine mastitis in Argentina. J Dairy Sci. 2000; 83(6):1224-7. doi: 10.3168/jds. S0022-0302(00)74988-5. 41- Salheen EM. Molecular detection of staphylococcus aureus enterotoxin B in milk and milk product using PCR. M.Sc. Sudan University of Science and Technology. 2016. 42. Mohammed TA, Khalid A.E, Saadabi, AM. PCR Detection of Staphylococcal Enterotoxin A and B genes in Staphylococcus aureus isolates from salted fermented fish. Microbiology journal, 2014; 4:51-56. 43. Ezzeldeen NA, Mansour HA, Ahmed,AA. Phenotypic and Molecular Identification of Staphylococcus aureus Isolated from some Egyptian Salted Fish”. World Applied Science Journal, 2011; 15 (12):1703-1712. 44. Geetha S, Govinda RV, Mudula KN, Ram RN, Ramesh BK. Some aspects of biochemical and microbial analysis of sundry fish Trichurus Linnaeus, 1758, from the east coast of Visakhapantam”. I.J.A.B.R., 2014; 4(4): 462-465. 45- Vázquez-Sánchez D, López-Cabo M, Saá-Ibusquiza P, Rodríguez-Herrera JJ. Incidence and characterization of Staphylococcus aureus in fishery products marketed in Galicia (Northwest Spain). Int J Food Microbiol. 2012;157(2):286-96. doi: 10.1016/j.ijfoodmicro.2012.05.021. 46. Arslan S, Özdemir F. Molecular characterization and detection of enterotoxins, methicillin resistance genes and antimicrobial resistance of Staphylococcus aureus from fish and ground beef. Polish Journal of Veterinary Sciences. 2017; 20(1):85-94. DOI: 10.1515/pjvs-2017-0012. 47. Pereira V, Lopes C, Castro A, Silva J, Gibbs P, Teixeira P. Characterization for enterotoxin production, virulence factors, and antibiotic susceptibility of Staphylococcus aureus isolates from various foods in Portugal. Food Microbiol. 2009; 26(3):278-82. doi: 10.1016/j.fm.2008.12.008. 48. Parmar BC, Pal M., Dhami AJ. In vitro antimicrobial drug susceptibility pattern of Staphylococcus aureus strain”. Indian journal of field Veterinarians, 2006; 2(1): 46-48. 49. Afifi SI, Al-Newery HA. Bacteriological studies on some virulence factors of Staphylococcus aureus isolated from chicken and Nile tilapia”. J.Chem. Environ,Healt, 2017; 3(1): 20-36. 50. Guven K, Mutlu MB, Gulbandilar A, Cakir P. Occurrence and characterization of Staphylococcus aureus isolated from meat and dairy products consumed in Turkey”. J Food Safety, 2010; 30:196-212. 51. Pu S, Wang F, Ge B. Characterization of toxin genes and antimicrobial susceptibility of Staphylococcus aureus isolates from Louisiana retail meats”. Foodborne Pathog D, 2013; 8:299-306. 52. Ali H H. Isolation and identification of Staphylococcus bacteria from fish of fresh water and its antibiotics sensitivity in Mosul city”. Basrah J Vet Res, 2014; 13(1):33–42. 53. de Oliveira L P, Barros L S S, Silva, V C, Cirqueira M G. Study of Staphylococcus aureus in raw and pasteurized milk consumed in the Reconcavo area of the State of Bahia. Food Processing & Technology. 2011; 2(6): 128. 54- Chye FY, Abdullah A, Ayob MK. Bacteriological quality and safety of raw milk in Malaysia. Food Microbiology. 2004; 21(5):535-541. DOI: 10.1016/j.fm.2003.11.007. 55- Ekici K, Bozkurt H, Isleyici, O. Isolation of some Pathogens from raw milk of different milch animals. Pakistan Journal of Nutrition. 2014; 3 (3): 161-162. 56- Agban N M, Ahmad S A. Detection and Identification of Staphylococcus Aureus Enterotoxins in Some Milk Products and their Handlers. Egyptian Journal of Medical Microbiology. 2013; 22 (2): 101-108. 57- Al-khafaji, H M. Detection of Enterotoxins Genes in Staphylococci Isolated from Milk and Cheese. Ph D. Thesis, College of Science-University of Baghdad. 2013. 58- Mustafa J Y. Isolation of some bacterial causative agent of bovine mastitis, with extraction and purification of Staphylococcus aureus B lactamase. M Sc. Thesis, College of Veterinary Medicine, University of Basrah. 2007. 59- Sanaa OY, Nazik A, Ibtisam Z. Incidence of Some Potential Pathogens in Raw Milk in Khartoum North (Sudan) and Their Susceptibility to Antimicrobial Agents. Journal of Animal and Veterinary Advances, 2005; 4: 341-344. 60- Abdel-hameed K G, El-Malt LM. Public health hazard of the Staphylococcus aureus isolated from raw milk and ice cream in Qena governorate. Journal of Veterinary Medicine. 2009; 55 (121):191-200. 61- Islam MA, Kabir M L, Rahman MT. Molecular detection and characterization of staphylococcus aureus isolated from raw milk sold in different markets of bangladesh. Journal of Veterinary Medicine. 2016; 14 (2): 277-282. 62- Jahan M, Rahman M., Parvej S, Chowdhury Md., Haque E, Talukder AK. and Ahmed S. Isolation and characterization of Staphylococcus aureus from raw cow milk in Bangladesh. Journal of advanced veterinary and animal reserch. 2016; 2(1): 49-55. 63- Thaker HC, Manoj NB, Jitendra BN. Isolation and identification of Staphylococcus aureus from milk and milk products and their drug resistance patterns in Anand, Gujarat. Veterinary World. 2013; 10-13. 64- Beyene G F. Antimicrobial Susceptibility of Staphylococcus aureus in Cow Milk, Afar Ethiopia. International Journal of Modern Chemistry and Applied Science. 2016; 3 (1): 280- 283. 65- Abraha H, Hadish G, Aligaz B, Eyas G, Workelule K. Antimicrobial resistance profile of Staphylococcus aureus isolated from raw cow milk and fresh fruit juice in Mekelle, Tigray, Ethiopia. Journal of Veterinary Medicine and Animal Health, 2018 10(4), 106-113. 66- Idbeis HI. Detection of enterotoxin genes (sea-see) of Staphylococcus aureus isolated from raw milk by multiplex PCR and study of their pathogenicity. M. Sc. Thesis. College of Veterinary Medicine- University of Basrah (Microbiology). 2008. 67- AL - Marsomy H M. Isolation and diagnostic some bacterial causes of mastitis in cows and role of lactobacillus secretion on inhibition growth of Staphylococcus aureus. M.Sc., Thesis, College of Veterinary Medicine, University of Baghdad. 2008. 68- Bendahou A, Lebbadi M, Ennanei L, Essadqui FZ, Abid M. Characterization of Staphylococcus species isolated from raw milk and milk products (lben and jben) in North Morocco. J Infect Dev Ctries. 2008; 2(3):218-25. doi: 10.3855/jidc.266. 69- AL - Saady A A. Extraction and characterization of surface adherence protein from methicillin resistance Staphylococcus aureus and study of the pathogenic effects. Ph.D., Thesis, College of science, University of Baghdad. 2007. 70- Peles F, Wagner M, Varga L, Hein I, Rieck P, Gutser K, Keresztúri P, Kardos G, Turcsányi I, Béri B, Szabó A. Characterization of Staphylococcus aureus strains isolated from bovine milk in Hungary', International Journal of Food Microbiology, 2007; 118 (2)186-193. https://doi.org/10.1016/j.ijfoodmicro.2007.07.010 Supplementary Files AdditionalFigure1.png Additional Figure 1. Agarose gel electrophoresis for PCR product of enterotoxin B gene (165pb) and 16s rRNA(756BP). Lane 1, DNA ladder 50 pb. Lane 2 shows a typical band of the positive control S. aureus enterotoxin B seb gene. Lane 3 show a positive enterotoxin B gene product of S. aureus isolated from cheese samples (Sample ID 16). Bands 4, 5 and 6 shows a positive sample for 16s rRNA gene (Isolates IDs: 16, 17 and 31). Cite Share Download PDF Status: Posted Version 3 posted You are reading this latest preprint version Show more versions Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-59354","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research article","associatedPublications":[],"authors":[{"id":5457505,"identity":"da2f47b7-2476-4a42-b8ac-210e0f70dc36","order_by":0,"name":"Mohammed Yahya","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABHklEQVRIiWNgGAWjYFACHjDJ2CABIv9J1PeDuAkFxGphYLNhnNkA0mJAvJY0xg0HQAw8WnTbew9+upljI7vhdvMziR88h5mNz69O/PDAgEGeX+wAVi1mZ84lS+duSzPecOeYmWSPxGE2sxtvN0sAHWY4c3YCdi03cgyAWg4nbriRYCbBY3CYx+zG2Q0gLQkGt3FqMf6du+0/UEv6N8k/CYcljGec3fyDgBYzoC0HgFqADJ4DaQYG/L3b8Nty5oyZde62ZOOZN3KKrWUbbBIkbvBus0gwkMDtl+M9xrdzt9nJ9t1I33jzbYNEAn//2c03f1TYyPNLY9cCBwoHGFjAUcMgAVYpgV85CMg3MDB/ALP4DxBWPQpGwSgYBSMKAADxT2sdyer5qgAAAABJRU5ErkJggg==","orcid":"","institution":"Sudan University of Science and Technology","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Mohammed","middleName":"","lastName":"Yahya","suffix":""},{"id":5457506,"identity":"dea77611-7a14-4d05-888e-b4ade9f58f36","order_by":1,"name":"Hashim Abdalbagi Ali","email":"","orcid":"","institution":"Sudan University for Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hashim","middleName":"Abdalbagi","lastName":"Ali","suffix":""},{"id":5457507,"identity":"1c95d865-75cf-4ad6-af5f-1389c115bedd","order_by":2,"name":"Babbiker Mohammed Taher Gorish","email":"","orcid":"","institution":"Omdurman Islamic University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Babbiker","middleName":"Mohammed Taher","lastName":"Gorish","suffix":""},{"id":5457508,"identity":"1869b90f-ae18-4cc1-8355-36ab327eeae1","order_by":3,"name":"Sara Omer Ali","email":"","orcid":"","institution":"Sudan University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Sara","middleName":"Omer","lastName":"Ali","suffix":""},{"id":5457509,"identity":"c91f4ed3-e2fb-42a8-bae6-81abedcfb8c6","order_by":4,"name":"Eman Saif Aldein Abdalrhim","email":"","orcid":"","institution":"Sudan University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Eman","middleName":"Saif Aldein","lastName":"Abdalrhim","suffix":""},{"id":5457510,"identity":"97abf95e-d814-4250-8e60-ebcf0a9cc19f","order_by":5,"name":"Mawada Hamza Mergani","email":"","orcid":"","institution":"Sudan University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mawada","middleName":"Hamza","lastName":"Mergani","suffix":""},{"id":5457511,"identity":"953107e6-4be7-4db1-93f6-69b014bfcf94","order_by":6,"name":"Asmaa Abass Abd Elgadir","email":"","orcid":"","institution":"Sudan University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Asmaa","middleName":"Abass Abd","lastName":"Elgadir","suffix":""},{"id":5457512,"identity":"98945c80-2af7-4f9b-860a-f29942d8d389","order_by":7,"name":"Somaya Khalid Mohammed","email":"","orcid":"","institution":"Sudan University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Somaya","middleName":"Khalid","lastName":"Mohammed","suffix":""},{"id":5457513,"identity":"6afa0648-6dc7-470a-b0b5-4dff5d4d35ae","order_by":8,"name":"Salma Omer Ahmed","email":"","orcid":"","institution":"Sudan University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Salma","middleName":"Omer","lastName":"Ahmed","suffix":""},{"id":5457514,"identity":"5c1ad217-1694-4ed0-b584-3b1a1b91abe5","order_by":9,"name":"Naglaa Alsaeid Musa","email":"","orcid":"","institution":"Sudan University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Naglaa","middleName":"Alsaeid","lastName":"Musa","suffix":""},{"id":5457515,"identity":"93d0c5e9-a886-4c90-950c-5d9fab5d0835","order_by":10,"name":"Alaa Saeed Ahmed","email":"","orcid":"","institution":"Sudan University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Alaa","middleName":"Saeed","lastName":"Ahmed","suffix":""},{"id":5457516,"identity":"7d4ec003-8bb9-4ccc-aede-e488cd9eeb0b","order_by":11,"name":"Wafaa Mohammed Abdalla","email":"","orcid":"","institution":"Sudan University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Wafaa","middleName":"Mohammed","lastName":"Abdalla","suffix":""},{"id":5457517,"identity":"1e9d71c8-e49c-43d8-9e39-7b67bd9e11d0","order_by":12,"name":"Yousif Fadlallah Hamedelnil","email":"","orcid":"","institution":"Sudan University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yousif","middleName":"Fadlallah","lastName":"Hamedelnil","suffix":""},{"id":5457518,"identity":"85113196-4f22-4f9e-be50-56855ae957f9","order_by":13,"name":"Ahmed Ibrahim Hashim","email":"","orcid":"","institution":"Sudan University of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ahmed","middleName":"Ibrahim","lastName":"Hashim","suffix":""},{"id":5457519,"identity":"e24dba0b-90ef-4971-9d76-f5465181ba41","order_by":14,"name":"Hisham N. Altayeb","email":"","orcid":"","institution":"King Abdulaziz University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hisham","middleName":"N.","lastName":"Altayeb","suffix":""}],"badges":[],"createdAt":"2020-08-14 10:15:50","currentVersionCode":3,"declarations":"","doi":"10.21203/rs.3.rs-59354/v3","doiUrl":"https://doi.org/10.21203/rs.3.rs-59354/v3","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":4082701,"identity":"c88dfd53-cd40-4258-9bc1-ef3cae06056b","added_by":"auto","created_at":"2020-12-07 22:55:55","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":260685,"visible":true,"origin":"","legend":"PCR amplification of 16S rRNA gene of S. aureus on 2% agarose gel electrophoresis. Lane 1 DNA ladder: MW 100-1500 bp fragments. Lanes 5, 6 and 7 shows a typical band size of (756 bp) corresponding to 16S rRNA of positive control isolates (isolates IDs 13, 55, and 63 respectively). Lanes 2,3,4 and 8 are negative samples.","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-59354/v3/db5d07b2c45ba6af5c7ab8ef.png"},{"id":4082702,"identity":"ddfeb7d5-6bd0-4413-8ad1-dde196854e9e","added_by":"auto","created_at":"2020-12-07 22:55:55","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":250791,"visible":true,"origin":"","legend":"PCR amplification of mecA gene of S. aureus on 2% agarose gel electrophoresis. Lane 1 DNA ladder: MW 100-1500 bp fragments. Lanes 2, 4, 5, and 6 are typical band size of (310bp) corresponding to mecA gene products of S. aureus isolated from samples number 13, 55, 63, and 81. Lanes 3, 7, 8, and 9 are negative sample.","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-59354/v3/5aaa1ff1e363b8ebd79a9b21.png"},{"id":13624446,"identity":"a34e5797-84a1-4535-97a9-4bb5dc463308","added_by":"auto","created_at":"2021-09-17 07:22:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1054578,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-59354/v3/3b8f9c0e-3218-404c-a8be-01115b7612ec.pdf"},{"id":4082700,"identity":"9fc9d3d2-2193-4889-bcbd-62fc100cd89a","added_by":"auto","created_at":"2020-12-07 22:55:54","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":357295,"visible":true,"origin":"","legend":"Additional Figure 1. Agarose gel electrophoresis for PCR product of enterotoxin B gene (165pb) and 16s rRNA(756BP). Lane 1, DNA ladder 50 pb. Lane 2 shows a typical band of the positive control S. aureus enterotoxin B seb gene. Lane 3 show a positive enterotoxin B gene product of S. aureus isolated from cheese samples (Sample ID 16). Bands 4, 5 and 6 shows a positive sample for 16s rRNA gene (Isolates IDs: 16, 17 and 31).","description":"","filename":"AdditionalFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-59354/v3/38fa85f85f29db5af73c1453.png"}],"financialInterests":"","formattedTitle":"Molecular detection of Staphylococcal enterotoxins and mecA genes products in selected food samples collected from different areas in Khartoum state.","fulltext":[{"header":"Background","content":"\u003cp\u003eFood-borne diseases (FBD) remain one of the greatest concerns in public health and food safety, they are caused by many pathogens that contaminate food and food products (1). Many food sources may serve as a substrate for many microorganisms which are transmitted during harvesting, storage or food processing and handling by multiple environmental sources such as water, soil, insects, or even by the handlers (2).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eStaphylococcal \u003c/em\u003eFood Poisoning (SFP) is an intoxication that results from the consumption of improperly prepared or stored foods containing sufficient amounts of one or more preformed enterotoxins (3, 4). A wide variety of foods support the growth of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e and are ideal for enterotoxin production including milk, meat, meat products, dairy products, and ready-to-eat food (5, 7).\u003c/p\u003e\n\u003cp\u003eAlthough\u003cem\u003e Staphylococcus aureus\u003c/em\u003e may produce a large variety of enterotoxins, 95% of food poisoning outbreaks are caused by classical enterotoxins: A, B, C, D and E (6). Since these toxic proteins are capable of tolerating high temperatures up to 100\u0026deg;C for several minutes, improperly cooked food contaminated with bacteria or its preformed toxins in sufficient amounts could lead to Staphylococcal food poisoning within a few hours characterized by symptoms including nausea, vomiting and diarrhea (8). Some strains of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e have the ability to resist heat and drying; hence, it can easily contaminate foods. This contamination might come from food handlers or from the environment, where the bacteria multiply and release toxins in uncooked or inadequately cooked foods, especially if the foods are unrefrigerated (9). The consumption of foods of animal origin contaminated with MRSA or MRSA preformed enterotoxins could lead to serious threats to the well-being of humans due to uncountable clinical implications (10).\u0026nbsp;\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNon-hygienic handling practices, working conditions, and improper storage and refrigeration; can all increase the opportunity for food contamination. So, it is important to follow the standard practices in food handling such as hand washing, proper cooking, proper storage and others to reduce or prevent food contamination (11, 14).\u003c/p\u003e\n\u003cp\u003eThere is paucity of information in Sudan regarding the role \u003cem\u003eStaphylococcus aureus\u003c/em\u003e in food poisoning and the presence of enterotoxins in \u003cem\u003emecA \u003c/em\u003egenes in common consumed foods in Khartoum State. Hence, this study was conducted to determine the prevalence of enterotoxins and \u003cem\u003emecA\u003c/em\u003e genes in foods commonly consumed in Khartoum State, Sudan.\u003c/p\u003e"},{"header":"Result","content":"\u003cp\u003e\u003cstrong\u003ePrevalence of \u003cem\u003eS. aureus \u003c/em\u003eisolates in food samples\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Presence of \u003cem\u003eS. aureus \u003c/em\u003ewas observed in 137 (34.25%) of the 400 food samples collected from different areas in Khartoum state. However, 126 (31.5%) of the 400 samples were identified as bacteria other than \u003cem\u003eS. aureus \u003c/em\u003eand 137 (34.25%) samples did not yield any growth (Table 1). All isolated \u003cem\u003eS. aureus\u003c/em\u003e confirmed by detection of the 16S rRNA housekeeping gene product which correspond to756 bp band size (Figure 1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Detection of \u003cem\u003emecA\u003c/em\u003e and enterotoxins genes among the \u003cem\u003eS. aureus \u003c/em\u003eisolates\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe 84 different \u003cem\u003eS. aureus\u003c/em\u003e isolates were randomly selected from a total of 137 \u003cem\u003eS. aureus\u003c/em\u003e isolates. The selected isolates were further examined for the presence \u003cem\u003emecA\u003c/em\u003e and enterotoxin genes using specific primer in a conventional PCR assay. The \u003cem\u003emecA\u003c/em\u003e gene was detected in 15 (17%) \u003cem\u003eS. aureus\u003c/em\u003e isolates (in samples number 6,13,55,63 and 81 of meat and samples number 2,11,47,72 for cheese and in samples number 19,28,34 and 49 of milk and in samples number 9 and 38 of fish ) (Table 2), (Figure 1, 2). However, only 2 (2.385%) of 84 \u003cem\u003eS. aureus\u003c/em\u003e isolates were showed an enterotoxin B gene product (both isolates were from cheese samples and the samples ID were 16 and 31), while the rest of 82 isolates were negative. All isolates were negative for other enterotoxins gene (other than\u003cem\u003e seb\u003c/em\u003e gene) (Table 2), (Additional figure 1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeat isolates antimicrobial susceptibility characteristics \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePresence of \u003cem\u003eS. aureus \u003c/em\u003ewas observed in 30 (30%) of the 100 Milk samples (Table3) of which 11 (36.7%) isolates were detected in raw beef and 19 (63.3%) were identified in restaurants meat. However, 20 (20%) samples showed a growth of bacteria other than \u003cem\u003eS. aureus \u003c/em\u003eand 50 (50%) samples showed no growth. All tested meat \u003cem\u003eS. aureus \u003c/em\u003eisolates, were susceptible to ciprofloxacin. The resistant rates of meat \u003cem\u003eS. aureus\u003c/em\u003e isolates to gentamycin was 4 (13.3%) and it was higher than that identified to the antibiotics oxacillin and vancomycin with percentage of 2 (6.6%) and 5 (16.7%) respectively (Table 4). The PCR assay for enterotoxin gene products showed that none of the meat \u003cem\u003eS. aureus\u003c/em\u003e isolate produce enterotoxins genes products (Additional figure 1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCheese isolates antimicrobial susceptibility characteristics \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe examination of 100 cheese samples collected from different area in Khartoum state revealed that the occurrence of S.\u003cem\u003e aureus \u003c/em\u003eIsolate was 20 (20%). While bacteria others than \u003cem\u003eS. aureus \u003c/em\u003ewere represented 4%. However, none of the rest 76(76%) showed any growth on the agar plate surface (Table 3). We found that all \u003cem\u003eisolates\u003c/em\u003e were susceptible to both gentamicin, ciprofloxacin antibiotics. However, vancomycin showed growth-inhibition zones with 17 (85%) isolates out of 20 positive samples. Only one (5%) cheese \u003cem\u003eS. aureus \u003c/em\u003eisolate was resistant to oxacillin (Table 4). Enterotoxin gene B (\u003cem\u003eseb\u003c/em\u003e) was detected only in 2(10%) of cheese isolates (samples ID were 16 and 31). While none of other types of enterotoxin genes products were detected among these isolates (Additional figure 1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntimicrobial Profile for fish \u003cem\u003eS. aureus\u003c/em\u003e isolates\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study a total of 100 fish samples (50 salted fish 50 raw fish) were analyzed for the presence of bacterial pathogens. The study revealed 24/100 (24%) of the fish samples had \u003cem\u003eS. aureus\u003c/em\u003e contamination (Table 3). Antibiotic susceptibility of \u003cem\u003eS. aureus \u003c/em\u003ewas tested using the agar disc diffusion method. The results have shown that all fish originated S.\u003cem\u003e aureus \u003c/em\u003eisolates were susceptible to both ciprofloxacin and gentamicin antibiotics. In contrast, the resistance rate was only 8% to both vancomycin and oxacillin antibiotics (Table 4). No enterotoxin gene product was detected during the gel electrophoresis procedure which applied after successful cycles of conventional PCR (Additional figure 1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntimicrobial Profile for milk \u003cem\u003eS. aureus\u003c/em\u003e isolates\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOut of 100 milk samples collected from different areas in Khartoum state 63(63%) were identified as \u003cem\u003eS. aureus\u003c/em\u003e, 26(26%) were identified as bacteria others than \u003cem\u003eS. aureus \u003c/em\u003eand 11(11%) showed no growth (Table 3). The antimicrobial susceptibility test was done to all \u003cem\u003eS. aureus \u003c/em\u003eisolates and the result showed that the highest susceptibility rate was recorded to ciprofloxacin and gentamicin with a percentage of 98.4% (62/63 isolates) and 87.3% (55/63 isolates) respectively, followed by oxacillin with a percentage of 84% (53/63). However, the least potent antibiotic was vancomycin with a percentage of 65% (41/63) (Table 4). The enterotoxin genes results reveal that no \u003cem\u003eS. aureus\u003c/em\u003e isolate produces such genes (Additional figure 1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1. \u003c/strong\u003e\u003cstrong\u003eDistribution of bacteria isolated from selected food samples purchased from retailers in Khartoum State\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" width=\"590\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"203\"\u003e\n\u003cp\u003eIsolate\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"206\"\u003e\n\u003cp\u003eNumber\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"182\"\u003e\n\u003cp\u003ePercentage\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"203\"\u003e\n\u003cp\u003e\u003cem\u003eStaphylococcus aureus\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"206\"\u003e\n\u003cp\u003e137\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"182\"\u003e\n\u003cp\u003e34.25%\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"203\"\u003e\n\u003cp\u003eOthers bacteria\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"206\"\u003e\n\u003cp\u003e126\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"182\"\u003e\n\u003cp\u003e31.5%\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"203\"\u003e\n\u003cp\u003eNo growth\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"206\"\u003e\n\u003cp\u003e137\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"182\"\u003e\n\u003cp\u003e34.25%\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"203\"\u003e\n\u003cp\u003eTotal\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"206\"\u003e\n\u003cp\u003e400\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"182\"\u003e\n\u003cp\u003e100%\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2. \u003c/strong\u003e\u003cstrong\u003eDistribution of \u003c/strong\u003e\u003cem\u003emecA\u003c/em\u003e and \u003cstrong\u003eenterotoxin genes among \u003cem\u003eStaphylococcus aureus \u003c/em\u003eisolates\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" width=\"590\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"145\"\u003e\n\u003cp\u003eType of gene detected\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"144\"\u003e\n\u003cp\u003ePositive\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"154\"\u003e\n\u003cp\u003eNegative\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"147\"\u003e\n\u003cp\u003eTotal\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"145\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003emecA\u003c/em\u003e gene\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"144\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e15 (17.9%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"154\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e69 (82.1%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"147\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e84 (100%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"145\"\u003e\n\u003cp\u003eEnterotoxin B gene\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"144\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2 (2.38%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"154\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e82 (97,62%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"147\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e84 (100%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"145\"\u003e\n\u003cp\u003eOther enterotoxin genes\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"144\"\u003e\n\u003cp\u003e0 (0%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"154\"\u003e\n\u003cp\u003e84 (100%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"147\"\u003e\n\u003cp\u003e84(100%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cbr /\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3. \u003c/strong\u003e\u003cstrong\u003eDistribution of \u003cem\u003eStaphylococcus aureus \u003c/em\u003eisolates according to the type of food samples \u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" width=\"636\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"95\"\u003e\n\u003cp\u003eSample\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e\u003cem\u003eS. aureus \u003c/em\u003eIsolates\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003eOther Bacteria Isolates\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003eNo growth\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003eTotal\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"95\"\u003e\n\u003cp\u003eMeat\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e30 (30%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e20 (20%)\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e50 (50%)\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e100 (100%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"95\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCheese\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e20 (20%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e4 (4%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e76 (76%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e100 (100%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"95\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFish\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e24 (24%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e76 (76%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e0 (0%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e100 (100%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"95\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMilk\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e63 (63%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e26 (26%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e11(11%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e100 (100%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"95\"\u003e\n\u003cp\u003eTotal\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e137\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e126\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e137\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"135\"\u003e\n\u003cp\u003e400\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 4. Show Antimicrobial sensitivity pattern of \u003cem\u003eStaphylococcus aureus \u003c/em\u003ethat isolated from different food material samples \u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" width=\"701\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" width=\"79\"\u003e\n\u003cp\u003e\u003cstrong\u003eIsolates\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" width=\"78\"\u003e\n\u003cp\u003e\u003cstrong\u003ePattern\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"4\" width=\"544\"\u003e\n\u003cp\u003e\u003cstrong\u003eAntibiotics\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"138\"\u003e\n\u003cp\u003e\u003cstrong\u003eGentamycin\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(10mg)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"144\"\u003e\n\u003cp\u003e\u003cstrong\u003eCiprofloxacin\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(5mg)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"114\"\u003e\n\u003cp\u003e\u003cstrong\u003eOxacillin\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(5mg)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"148\"\u003e\n\u003cp\u003e\u003cstrong\u003eVancomycin\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(30mg)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" width=\"79\"\u003e\n\u003cp\u003e\u003cstrong\u003eMeat \u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"78\"\u003e\n\u003cp\u003eSensitive\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"138\"\u003e\n\u003cp\u003e26 (86.7%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"144\"\u003e\n\u003cp\u003e30 (100%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"114\"\u003e\n\u003cp\u003e28 (93.4%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"148\"\u003e\n\u003cp\u003e25 (83.3%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"78\"\u003e\n\u003cp\u003eResistant\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"138\"\u003e\n\u003cp\u003e4 (13.3%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"144\"\u003e\n\u003cp\u003e0 (0%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"114\"\u003e\n\u003cp\u003e2 (6.6%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"148\"\u003e\n\u003cp\u003e5 (16.7%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" width=\"79\"\u003e\n\u003cp\u003e\u003cstrong\u003eCheese \u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"78\"\u003e\n\u003cp\u003eSensitive\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"138\"\u003e\n\u003cp\u003e20 (100%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"144\"\u003e\n\u003cp\u003e20 (100%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"114\"\u003e\n\u003cp\u003e19 (95%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"148\"\u003e\n\u003cp\u003e17 (85%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"78\"\u003e\n\u003cp\u003eResistant\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"138\"\u003e\n\u003cp\u003e0 (0%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"144\"\u003e\n\u003cp\u003e0 (0%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"114\"\u003e\n\u003cp\u003e1 (5%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"148\"\u003e\n\u003cp\u003e3 (15%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" width=\"79\"\u003e\n\u003cp\u003e\u003cstrong\u003eFish \u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"78\"\u003e\n\u003cp\u003eSensitive\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"138\"\u003e\n\u003cp\u003e24 (100%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"144\"\u003e\n\u003cp\u003e100(100%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"114\"\u003e\n\u003cp\u003e22 (92%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"148\"\u003e\n\u003cp\u003e22 (92%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"78\"\u003e\n\u003cp\u003eResistant\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"138\"\u003e\n\u003cp\u003e0 (0%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"144\"\u003e\n\u003cp\u003e0 (0%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"114\"\u003e\n\u003cp\u003e2 (8%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"148\"\u003e\n\u003cp\u003e2 (8%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" width=\"79\"\u003e\n\u003cp\u003e\u003cstrong\u003eMilk \u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"78\"\u003e\n\u003cp\u003eSensitive\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"138\"\u003e\n\u003cp\u003e55 (87.3%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"144\"\u003e\n\u003cp\u003e62 (98.4%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"114\"\u003e\n\u003cp\u003e53 (84%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"148\"\u003e\n\u003cp\u003e41 (65%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"78\"\u003e\n\u003cp\u003eResistant\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"138\"\u003e\n\u003cp\u003e8 (12.7%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"144\"\u003e\n\u003cp\u003e1 (1.6%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"114\"\u003e\n\u003cp\u003e10 (16%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"148\"\u003e\n\u003cp\u003e22 (35%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"2\" width=\"157\"\u003e\n\u003cp\u003e\u003cstrong\u003eTotal \u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"138\"\u003e\n\u003cp\u003e137\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"144\"\u003e\n\u003cp\u003e137\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"114\"\u003e\n\u003cp\u003e137\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"148\"\u003e\n\u003cp\u003e137\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, the prevalence of \u003cem\u003eS. aureus\u003c/em\u003e and MRSA and enterotoxin gene products were investigated in various food samples collected from Khartoum state markets (400 samples of milk, cheese, fish, meat). Identification of the bacteria isolated from the selected foods through conventional methods yielded a total of 137 (34.3 %) \u003cem\u003eS. aureus\u003c/em\u003e isolates. Similar reports on foods contaminated with \u003cem\u003eS. aureus\u003c/em\u003e from Italy and India revealed much lower percentage yielding 17.1% (15) and 12.01% (16) respectively. The previous studies conducted to detect \u003cem\u003eS. aureus\u003c/em\u003e in various foods revealed that the contamination levels with \u003cem\u003eS. aureus \u003c/em\u003ereported were lower than those obtained in this study. On the other hand, a study in Greece reported 47.8% of north-central and north-eastern Greece foods; which is much higher contamination level compared to those reported in this study (3). Those great discrepancies between our finding and other studies results may be due to variation in foods, habits, cooking behaviors, food keeping hygiene in addition to environmental factors like the weather temperature and moist which significantly affect bacterial growth in food materials.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study resistance gene (\u003cem\u003emecA\u003c/em\u003e) of \u003cem\u003eS. aureus\u003c/em\u003e that responsible for resistance to \u0026beta;-lactam antimicrobials was detected by using PCR and we find 15 (17%) of \u003cem\u003eS. aureus \u003c/em\u003eisolates are positive for the \u003cem\u003emecA \u003c/em\u003egene while 69 (83%) were negative. Comparing our finding to previous studies results we realize that most previous studies results showed a significantly higher prevalence than our finding for example in a study done by Khayri in Makkah city he found that about 44.4 % of his \u003cem\u003eS. aureus \u003c/em\u003eisolates were positive for \u003cem\u003emecA \u003c/em\u003egene (4). Similarly, Papadopoulos and his colleagues found that 81.3% of \u003cem\u003etheir S. aureus\u003c/em\u003e isolates were positive for the \u003cem\u003emecA\u003c/em\u003e gene (3). This variation could be due to the difference in the antibiotic protocol applied by the doctors for their patients in different countries or due to the extensive usage of methicillin antibiotics their communities or by doctors during treatment prescription \u003cem\u003ein\u003c/em\u003e these countries and eventually lead to a high prevalence rate of MRSA. On the contrary, the results reported in this study are higher than those reported by Novak \u003cem\u003eet al \u003c/em\u003e(5) where the \u003cem\u003emec\u003c/em\u003eA gene prevalence was only 11.4 %. Low rates of \u003cem\u003emecA\u003c/em\u003e gene were also reported in Egypt, Brazil and China where the prevalence of \u003cem\u003emecA\u003c/em\u003e gene was 5.1%, 9% and 7.9%, respectively (6-8). The variation between the results may be due to variation of samples sources and the use of different molecular techniques in different countries for the detection of \u003cem\u003emecA\u003c/em\u003e gene product.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this study, one hundred raw meat samples were obtained from different supermarkets and restaurants in Khartoum state. These samples are examined for the presence of \u003cem\u003eS. aureus\u003c/em\u003e. Thirty (30%) samples were found to be contaminated with \u003cem\u003eS. aureus\u003c/em\u003e. These findings highlight the high potential risk for consumers of meat and dairy products especially in the absence of strict hygienic and preventive measures to avoid \u003cem\u003eStaphylococcus aureus\u003c/em\u003e enterotoxins (SEs) production in foods. In other comparative studies, similar results were reported from USA where the prevalence of \u003cem\u003eS. aureus\u003c/em\u003e in meat samples was 29.0% (23). Much lower results were reported in South Africa, who reported that S. \u003cem\u003eaureus\u003c/em\u003e was 26.5% (24). Also, our result is lower than that obtained by Das \u003cem\u003eet al\u003c/em\u003e. in India who reported that out of 65 samples \u003cem\u003eS. aureus \u003c/em\u003eincidence was in 46.1% (25)\u003cem\u003e.\u003c/em\u003e In our study, none of the meat \u003cem\u003eS. aureus isolates\u003c/em\u003e were resistant to ciprofloxacin and 13.3% were resistant to gentamicin. In disagreement with our result Das \u003cem\u003eet al\u003c/em\u003e in India found that 16.66% of \u003cem\u003eS. aureus\u003c/em\u003e meat isolates were resistant to ciprofloxacin (25) and Pu S \u003cem\u003eet al.,\u003c/em\u003e in Louisiana found that 13.0% were resistant to ciprofloxacin. Also, in contrast to our findings. Pu S \u003cem\u003eet al.\u003c/em\u003e in Louisiana found that 3.0% were resistant to gentamicin (26). Vancomycin-resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e (VRSA) is a type of antibiotic-resistant \u003cem\u003eS. aureus\u003c/em\u003e which have developed a resistance and can no longer be treated with vancomycin. This study showed that 16.6% of the meat isolates were resistant to vancomycin, which suggests that the contamination may be coming from VRSA carrier's food handlers and processors, however Das \u003cem\u003eet al\u003c/em\u003e found that 3.33% of the isolates were resistant to vancomycin (VRSA) which is low compared with our findings (25). Methicillin-resistant \u003cem\u003eS. aureus \u003c/em\u003e(MRSA) strains have acquired a gene that makes them resistant to nearly all beta-Lactam antibiotics, animal-adapted MRSA strains also exist although it's in small percentage but it's of a clinical importance and may cause serious problems to immunocompromised individuals as well as healthy ones (carriers). In this study 6.6% of meat isolates were resistant to oxacillin, this finding was high compared to Inge\u003cem\u003e et al \u003c/em\u003eresults whom found that 2.5% of \u003cem\u003eS. aureus \u003c/em\u003emeat isolates were resistant to oxacillin (27), and low compared to Das \u003cem\u003eet al\u003c/em\u003e results whom found that 23.3% of \u003cem\u003eS. aureus\u003c/em\u003e isolates were resistant to oxacillin (25).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eInvestigations through PCR technique on enterotoxin genes in this study showed the absence of enterotoxin genes in meat \u003cem\u003eS. aureus \u003c/em\u003eisolates. A similar study in Denmark demonstrated the presence of enterotoxin genes in only 0.2% of the isolates (28). On the other hand, report from China demonstrated\u0026nbsp;\u0026nbsp; prevalence of 46.0% enterotoxin gene (29) and Bergdoll, found that the percentage of enterotoxigenic strains of \u003cem\u003eS. aureus\u003c/em\u003e is estimated to be around 25% (30). Moreover, most of \u003cem\u003eS. aureus\u003c/em\u003e food isolates are not SEs producers, thus considerable research effort is still required for a better understanding of the interactions between \u003cem\u003eS. aureus\u003c/em\u003e and the food matrix and of the mechanism of SEs production in foods stuffs (31). The data obtained in this study probably underestimated the enterotoxigenic properties of the analyzed strains, since the possible presence of newly described SEs was not considered and the sample size was too small to represent \u003cem\u003eS. aureus\u003c/em\u003e contaminated meat effectively. However, there is always the possibility of mutation at the level of the corresponding gene, leading to the absence of its detection. Therefore, a positive PCR shows the presence of the enterotoxin genes but a negative PCR does not point to the absence of the corresponding operon because there are many types of enterotoxin genes and we determine only one type (31).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this study, one hundred white cheese samples collected from different retailers in Khartoum State to detect the rate of \u003cem\u003eS. aureus\u003c/em\u003e contamination in cheese sample in this study is higher than that reported in Iran and Japan where the reported contamination rates were 16% and 13.3% respectively (32,33), and lower than that reported in Turkey which was 37.5% (34). However, the results in this study disagree with a previous report in Khartoum State where no \u003cem\u003eStaphylococcus aureus\u003c/em\u003e were found on white cheese (35). This may be due to variation in sample sources where the cheese was manufactured, the retailers where cheese samples were purchased from, the sampling area, season and environment, all these factors might affect the rate of contamination with microorganisms. The rate of sensitivity of cheese \u003cem\u003eS. aureus \u003c/em\u003eisolates to gentamicin and ciprofloxacin was 100%; these findings opposes those reported in the U.S.A, where 75% of S.\u003cem\u003e aureus\u003c/em\u003e isolates were resistant to gentamicin (36) and in Iraq where 25% of \u003cem\u003eS. aureus\u003c/em\u003e isolates were resistant to ciprofloxacin (37). The resistance of cheese \u003cem\u003eS. aureus\u003c/em\u003e to Oxacillin in this study was (5%) which was lower than that reported in Iraq which was 20% (38). The sensitivity to vancomycin was 85% which is lower than that reported in Switzerland which was 100% (39, 40).\u003c/p\u003e\n\u003cp\u003eThe molecular detection of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e enterotoxins (A, B, C, D and E) genes among cheese isolates resulted in the detection of \u003cem\u003eseb\u003c/em\u003e gene in 10% of the 20 isolates, that was lower than the results obtained by Salheen in Sudan who reported 20% of \u003cem\u003eseb\u003c/em\u003e gene was detected in cheese samples (41). The variation between results could be due to several factors such as sample source, geographical origin, the sensitivity of identification methods and sample size can affect the outcomes.\u003c/p\u003e\n\u003cp\u003eIn this study 108 of fish samples were examined. The contamination rate of fish samples in this study is very low (22%) when compared with a previous report in Khartoum State 72% (42), Egypt 93% (43), India 100% (44) and relatively lower than that reported in Spain (27%) (45). Antimicrobial susceptibility results for fish S. aureus isolates showed 100% sensitivity to ciprofloxacin, which was in agreements with reports in Egypt (43), Turkey (46) and very close to a study in also nearly similar to the Portugal 98% (47).\u0026nbsp; However, lower results in India was 48.5% (48) and in Egypt was 57% (49). gentamycin also showed an efficacy rate of 100% among all S. aureus isolates, which is similar to reports from Egypt (49), Turkey (46), and that of V\u0026aacute;zquez-s\u0026aacute;nchez et al., in Spain (45), and slightly similar to results reported\u0026nbsp;\u0026nbsp; in Egypt 97% (43) and\u0026nbsp;\u0026nbsp; in Portugal, 92% (47). In this study, S. aureus isolated from fish samples showed a sensitivity rate of 92% to vancomycin, which is similar to those, reported in Egypt 91% (43) and Portugal 90% (47) respectively. Another study in Egypt reported higher result 100% (49), while other studies in Turkey reported much lower sensitivity to vancomycin, which was 83% and 78% respectively (46,50). The oxacillin showed 92% potency against fish S. aureus isolates which was higher than that reported in Portugal 62% (47), while it was relatively lower than those reported in Spain and Turkey where both reported 100% (45, 46). \u0026nbsp;The variation between these results could be due to contribution of several factors such as source of samples, geographical origin, the sensitivity of identification methods and sample size can affect the outcomes.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe molecular detection of the enterotoxins genes among fish \u003cem\u003eS. aureus \u003c/em\u003eisolates gave no band for all genes meaning that none of the all isolates possess such gene in their genetic material this finding was in agreement with those reported in Turkey and USA (46, 51), where no enterotoxins B, C and E genes were found in their food \u003cem\u003eS. aureus\u003c/em\u003e isolates. However, a study in Tanzania, reported that enterotoxin B and C genes were detected in 0.3% with the absence of enterotoxin A gene (52), while a study from Turkey reported enterotoxins A and D genes in 10.5% of their samples (46). Variation among researcher studies results and our findings could be due to several factors such as samples source, geographical origin, the sensitivity of identification methods and sample size can affect the outcomes.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this study, \u003cem\u003eS. aureus \u003c/em\u003ewas isolated in 63% of raw milk samples, which is relatively close to that reported in Brazil 68% (53) and Malaysia 60% (54). However, this finding was lower than those reported in Turkey 75% (55) and Egypt 82% (56). The prevalence of this study is higher than those reported in two different studies in Iraq with prevalence of 53.33%, 43.5%, respectively (57, 58). Moreover, the prevalence of S. aureus in this study is too high compared to reports from Sudan and Egypt where the levels were 30% and 24.8% respectively (59,60)\u003cu\u003e.\u003c/u\u003e\u0026nbsp; \u003cem\u003eS. aureus\u003c/em\u003e isolated from milk samples in this study were highly sensitive to ciprofloxacin 98.4%, which is close to a report from a study in Bangladesh 93.3% (61). However, relatively lower susceptibility levels were reported in India and Bangladesh where the rate was 80% and 83.3% respectively (62, 63). The sensitivity to gentamycin in this study 87% is lower than that reported in Ethiopia 90% (64, 63), 100% (65) and higher compared to another report in Sudan which was 47.6% (59).\u003c/p\u003e\n\u003cp\u003eWhile slightly similar to results obtained by Beyene, in Ethiopia, and Thaker \u003cem\u003eet al.,\u003c/em\u003e in India whom reported that 90% of \u003cem\u003eS. aureus \u003c/em\u003eisolates were sensitive to gentamicin (64, 63). Reports from other researchers were indicated a higher level of susceptibility rate to gentamicin for instance Abraha \u003cem\u003eet al., \u003c/em\u003ein Ethiopia reported 100% of milk \u003cem\u003eS. aureus\u003c/em\u003e isolate are susceptible to gentamycin (65). In this study, vancomycin susceptibility test was determined for all milk originated \u003cem\u003eS. aureus\u003c/em\u003e and the result showed that 65% of the \u003cem\u003eS. aureus\u003c/em\u003e isolates were susceptible to vancomycin, this finding was completely closed to findings reported by Idbeis, in Basrha \u0026nbsp;in Iraqe, AL \u0026ndash;Marsomy, and Bendahou \u003cem\u003eet al\u003c/em\u003e., in North Morocco who mentioned that \u003cem\u003eS. aureus \u003c/em\u003eisolated from raw milk and milk product showed sensitivity to vancomycin of 100% (66,67,68). ). On the contrary studies in Ethiopia and Iraq reported 100% resistance to Vancomycin (65, 69). The sensitivity to Oxacillin 84% in this study is higher than that reported in India 70% (63) and lower than that reported in Bangladesh 100% (62). All milk \u003cem\u003eS. aureus\u003c/em\u003e isolates tested for the presence of enterotoxins genes yielded negative results. Similar findings were reported in Hungary (70). The variations between results reported in this study and other reports could be attributed to several factors such as samples source, geographical origin, the sensitivity of identification methods and sample size can affect the outcomes.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eCollection of selected food samples \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 400 samples were collected from different areas in Khartoum state (Khartoum, Omdurman, East Nile and Khartoum North), during 2018. The type of foods included Cheese, Meat products, Fish and Raw milk.\u0026nbsp;\u0026nbsp;\u0026nbsp; Each sample was aseptically collected, fifteen grams of cheese samples were collected from different retailers by using sterile container, meat samples were collected randomly from supermarkets and restaurants using disposable blades, a small piece of raw meat had been spiltted and transferred to the lab in sterile containers, small pieces fish inner tissues were collected by sterile blade and placed in sterile plain containers and milk samples were collected in sterile containers and stored in a refrigerator at 4\u0026deg;C in microbiology laboratory until examined.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation and identification of coagulase positive Staphylococcus isolates\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMeat, fish and cheese samples were enriched in peptone water. The raw milk and the enriched peptone water samples were swabbed and inoculated in Blood agar medium, Mannitol salt agar medium and MacConkey\u0026rsquo;s agar medium and incubated aerobically at 37∘C for 24-48 hrs. The presence of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e was confirmed based on colony morphology; Gram\u0026rsquo;s reaction and other biochemical tests including catalase test, coagulase test and DNase test.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eAntimicrobial susceptibility testing of coagulase positive Staphylococci\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe antimicrobial susceptibility test was done by disk diffusion method using Mueller-Hinton agar plates (oxoid) according to (12). Where 4 antimicrobial agents belonging to different classes were selected including ciprofloxacin (5 \u0026mu;g), gentamicin (10 \u0026mu;g), oxacillin (5 \u0026mu;g) and vancomycin (30 \u0026mu;g). The \u003cem\u003eS. aureus \u003c/em\u003eATCC 52923 Control strain was used.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDNA Extraction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDNA was extracted by simple boiling method, in which the extracted product was done from overnight isolates on Nutrient Agar. A loop full of bacterial colony was picked from an isolate and suspended in 300\u0026mu;l of sterile distilled water and 10\u0026mu;l of proteinases K was added and incubated at 6o\u0026deg;C for 60 minutes. Then incubated at 100\u0026deg;C in a water bath for 15 minutes, and then the suspension was centrifuged at high speed (10000 rpm for 10 min). The supernatant containing the genomic DNA was transferred into a fresh sterile Eppendorf tube and stored at -20\u0026deg;C until to be used for PCR (13).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePCR Detection of 16s rRNA gene\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll samples were confirmed as \u003cem\u003eS. aureus\u003c/em\u003e by using specific housekeeping gene primer (16s), showed in \u003cstrong\u003eTable 5\u003c/strong\u003e. Negative samples were excluded.\u0026nbsp; The DNA amplifications were performed from a volume of 25 \u0026mu;L of a mixture containing 2 \u0026mu;L Maxime PCR Premix, 0.5 \u0026mu;L of each primer, 2 \u0026mu;L of template DNA and 20 \u0026mu;L of double distilled water. The amplification conditions were included three steps: initial denaturation at 94\u0026deg;C for 5 min; 35 successful cycles of denaturation at 94\u0026deg;C for 45sec, annealing at 50\u0026deg;C for 45sec, and extension at 72\u0026deg;C for 45 sec; and the final extension at 72\u0026deg;C for 7 min (14).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePCR Detection of \u003cem\u003eStaphylococca\u003c/em\u003el Enterotoxins Genes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMultiplex PCR, amplification was done using (CLASSIC K960, UK) thermo\u0026nbsp;\u0026nbsp; cycle. PCR amplification of \u003cem\u003eStaphylococcal \u003c/em\u003eenterotoxins (SE) genes, namely (\u003cem\u003esea\u003c/em\u003e, \u003cem\u003eseb\u003c/em\u003e, \u003cem\u003esec\u003c/em\u003e,\u003cem\u003e sed \u003c/em\u003eand \u003cem\u003esee\u003c/em\u003e) was performed using Maxime PCR Premix kit (iNtRON, Korea) and specific primers listed in \u003cstrong\u003eTable 5\u003c/strong\u003e \u0026nbsp;The PCR assay was carried out in a total volume of 25 \u0026mu;L of mixture containing 2 \u0026mu;L Maxime PCR Premix, 0.5 \u0026mu;L of each of the toxin gene-specific primers (5 \u0026mu;L), 2 \u0026mu;L of template DNA and 16 \u0026mu;L of double distilled water. The amplification conditions included three steps: initial denaturation at 94\u0026deg;C for 5 min; 35 successful cycles of denaturation at 94\u0026deg;C for 45sec, annealing at 50\u0026deg;C for 45sec, and extension at 72\u0026deg;C for 45 sec; and the final extension at 72\u0026deg;C for 7 min (14).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePCR Detection of \u003cem\u003emecA \u003c/em\u003eGene\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrimers were used for the detection of \u003cem\u003emecA\u003c/em\u003e gene, showed in \u003cstrong\u003etable 5\u003c/strong\u003e. DNA amplification was done using Maxime PCR Premix kit (iNtRON, Korea), The PCR assay was carried out in a total volume of 20 \u0026mu;L of mixture containing 2 \u0026mu;L Maxime PCR Premix, 0.5 \u0026mu;L of each of the gene-specific primers (5 \u0026mu;L), 2 \u0026mu;L of template DNA and 13 \u0026mu;L of double distilled water. The amplification conditions included three steps: initial denaturation at 94\u0026deg;C for 5 min; 35 successful cycles of denaturation at 94\u0026deg;C for 45sec, annealing at 52\u0026deg;C for 45sec, and extension at 72\u0026deg;C for 45 sec; and the final extension at 72\u0026deg;C for 7 min.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eTable 5. Primers used for detection of \u003cem\u003eS. aureus\u003c/em\u003e\u003c/strong\u003e \u003cstrong\u003ehousekeeping gene, \u003c/strong\u003e\u003cstrong\u003eenterotoxins and \u003cem\u003emecA\u003c/em\u003e genes.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" width=\"584\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003e\u003cstrong\u003ePrimer\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"314\"\u003e\n\u003cp\u003e\u003cstrong\u003eSequence 5' \u0026ndash; 3'\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"159\"\u003e\n\u003cp\u003e\u003cstrong\u003eProduct size (bp)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"3\" width=\"584\"\u003e\n\u003cp\u003e\u003cstrong\u003eHousekeeping gene primers\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eStaph 756-F\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"314\"\u003e\n\u003cp\u003eAACTCTGTTATTAGGGAAGAACA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"159\"\u003e\n\u003cp\u003e-\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eStaph 750-R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"314\"\u003e\n\u003cp\u003eCCACCTTCCTCCGGTTTGTCACC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"159\"\u003e\n\u003cp\u003e756\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"3\" width=\"584\"\u003e\n\u003cp\u003e\u003cstrong\u003eEnterotoxins genes primers\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eSA-Ua- F\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"314\"\u003e\n\u003cp\u003eTGTATGTATGGAGGTGTAAC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"159\"\u003e\n\u003cp\u003e-\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eSA-A- R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"314\"\u003e\n\u003cp\u003eATTAACCGAAGGTTCTGT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"159\"\u003e\n\u003cp\u003e270\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eSA-B-R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"314\"\u003e\n\u003cp\u003eATAGTGACGAGTTAGGTA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"159\"\u003e\n\u003cp\u003e165\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eENT-C-R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"314\"\u003e\n\u003cp\u003eAAGTACATTTTGTAAGTTCC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"159\"\u003e\n\u003cp\u003e102\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eSA-D-R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"314\"\u003e\n\u003cp\u003eTTCGGGAAAATCACCCTTAA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"159\"\u003e\n\u003cp\u003e303\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eSA-E-R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"314\"\u003e\n\u003cp\u003eGCCAAAGCTGTCTGAG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"159\"\u003e\n\u003cp\u003e213\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"3\" width=\"584\"\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003emecA\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e gene primers\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eMecA1 \u0026ndash; F\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"314\"\u003e\n\u003cp\u003eAACTCTGTTATTAGGGAAGAACA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"159\"\u003e\n\u003cp\u003e-\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"111\"\u003e\n\u003cp\u003eMecA1 \u0026ndash;R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"314\"\u003e\n\u003cp\u003eCCACCTTCCTCCGGTTTGTCACC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"159\"\u003e\n\u003cp\u003e310\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eUa: Universal, f: Forward, r: Reverse\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuality control\u0026nbsp; \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll samples were aseptically collected and analyzed, positive control which was a well-known enterotoxin and \u003cem\u003emecA\u003c/em\u003e genes producing \u003cem\u003eStaphylococcus aureus\u003c/em\u003e and negative control which was sterile distilled water were included during PCR running.\u003c/p\u003e"},{"header":"List of Abbreviations","content":"\u003cp\u003eFBD: Food borne diseases\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eS. aureus\u003c/em\u003e: \u003cem\u003eStaphylococcus aureus\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003ePCR: polymerase chain reaction\u003c/p\u003e\n\u003cp\u003eMRSA: Methicillin-Resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eSEs: \u003cem\u003eStaphylococcus aureus\u003c/em\u003e enterotoxins\u003c/p\u003e\n\u003cp\u003eVRSA: Vancomycin-Resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent\u003c/strong\u003e \u003cstrong\u003eto participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors received no specific funding for this work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMY, HA, BG, SO, ES, MH, performed main experiments, AA, SK, SO, NA, AS collected\u0026rsquo; samples and information. MY, HA, WM, HN, YF, AI designed the experiments and wrote the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors gratefully acknowledge for his great effort Microbiology lab staff in Sudan university of science and technology. We also express our thanks and appreciation to all salles man in all markets whom provide us the samples to achieve this research.\u003c/p\u003e"},{"header":"References","content":"\u003cp\u003e1-Abd Elsalam, EE. Rapid Method for Detection of Staphylococcus aureus Enterotoxins in Food. B.V.Sc. Cairo University. 2008.\u003cbr /\u003e2- Ubiebi CO. Isolation and Identification of Bacterial Isolates from Poultry and Fish Feeds sold In Abraka, Delta State, Nigeria. Journal of Industrial Technology, 2017; 2(1): 14- 20.\u003cbr /\u003e3- Niveditha P, Shylaja R, Radhika M, Murali S, Harshvardhan B. A novel mPCR for the detection of prominent toxins in MRSA strains of S. aureus recovered from diverse sources. Int J Res Biol Sci. 2014, 2 (4): 1-3.\u003cbr /\u003e4- Schelin J, Wallin-Carlquist N, Cohn MT, Lindqvist R, Barker GC, R\u0026aring;dstr\u0026ouml;m P. The formation of Staphylococcus aureus enterotoxin in food environments and advances in risk assessment. Virulence. 2011; 2(6):580-592. doi:10.4161/viru.2.6.18122\u003cbr /\u003e5- Aydin A, Sudagidan M, Muratoglu K. Prevalence of staphylococcal enterotoxins, toxin genes and genetic-relatedness of foodborne Staphylococcus aureus strains isolated in the Marmara Region of Turkey. Int J Food Microbiol. 2011;148(2):99-106. doi: 10.1016/j.ijfoodmicro.2011.05.007.\u003cbr /\u003e6- Letertre C, Perelle S, Dilasser F, Fach P. Identification of a new putative enterotoxin SEU encoded by the egc cluster of Staphylococcus aureus. J Appl Microbiol. 2003;95(1):38-43. doi:10.1046/j.1365-2672.2003. 01957.x\u003cbr /\u003e7- Techer C, Salmain M, Tranquet O, Echasserieau Val\u0026eacute;rie, Le Moigne V, Hennekinne J, Gautier M, Val Florence. Detection and quantification of staphylococcal enterotoxin A in foods with specific and sensitive polyclonal antibodies, Food Control. 2013; https://doi.org/10.1016/j.foodcont.2012.11.021.\u003cbr /\u003e8-Carroll K C, Butel, J, Morse S. Jawetz Melnick \u0026amp; Adelberg Medical Microbiology 27th edition. New York. Mc Graw Hill Professional, 2012; p203-208.\u003cbr /\u003e9-Black JG. Microbiology Principles and Explorations\u0026rdquo;.7thed. United States of America: John Wiley and Sons, 2008; Pp 684-685\u003cbr /\u003e10- Monecke S, Coombs G, Shore AC, et al. A field guide to pandemic, epidemic and sporadic clones of methicillin-resistant Staphylococcus aureus. PLoS One. 2011; doi: 10.1371/journal.pone.0017936\u003cbr /\u003e11- Ezzeldeen NA, Mansour HA, Ahmed AA. Phenotypic and Molecular Identification of Staphylococcus aureus Isolated from some Egyptian Salted Fish\u0026rdquo;. World Applied Science Journal. 2015; 15 (12):1703-1712.\u003cbr /\u003e12- Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-First Informational Supplement. M100-S21. 2011.\u003cbr /\u003e13- Compain F, Babosan A, Brisse S, et al. Multiplex PCR for detection of seven virulence factors and K1/K2 capsular serotypes of Klebsiella pneumoniae. J Clin Microbiol. 2014;52(12):4377-4380. doi:10.1128/JCM.02316-14.\u003cbr /\u003e14-Mahmoud L H. Molecular detection of Staphylococcus aureus toxin genes isolated from different clinical samples in Khartoum state. PhD thesis. Sudan University of Science and Technology. \u003cbr /\u003e15- Traversa A, Gariano GR, Gallina S, Bianchi DM, Orusa R, Domenis L, Cavallerio P, Fossati L, Serra R, Decastelli L. Methicillin resistance in Staphylococcus aureus strains isolated from food and wild animal carcasses in Italy. Food Microbiol. 2015; 52:154-8. doi: 10.1016/j.fm.2015.07.012. \u003cbr /\u003e16- Sivakumar M, Dubal ZB, Kumar A. Virulent methicillin resistant Staphylococcus aureus (MRSA) in street vended foods. J Food Sci Technol. 2019; 56, 1116\u0026ndash;1126 https://doi.org/10.1007/s13197-019-03572-5.\u003cbr /\u003e17- Papadopoulos P, Papadopoulos T, Angelidis AS, Kotzamanidis C, Zdragas A, Papa A, Filioussis G, Sergelidis D. Prevalence antimicrobial susceptibility and characterization of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus isolated from dairy industries in north-central and north-eastern Greece. Int J Food Microbiol. 2019; 16; 291:35-41. doi: 10.1016/j.ijfoodmicro.2018.11.007.\u003cbr /\u003e18- Khayri A, Al-Ouqaili M, Hassan A. Molecular detection of MEC A and FEM A genes in methicillin-resistant Staphylococcus aureus isolated from patients with skin infections, Research Gate 2011; pp.20\u003cbr /\u003e19- Novak F R, Almeida J A, Warnken GD, Ferreira-Carvalho MB, Hagler A N. Methicillin-resistant Staphylococcus aureus in human milk. Mem\u0026oacute;rias do Instituto Oswaldo Cruz, 2009; 95(1), 29-33.\u0026rlm;\u003cbr /\u003e20- Rania M K, Mohamed A B, Salah FA. MRSA detection in raw milk, some dairy products and hands of dairy workers in Egypt, a mini-survey, Food Control, 2013; 33 (1): 49-53, https://doi.org/10.1016/j.foodcont.2013.02.017\u003cbr /\u003e21- Rizek CF, Matt\u0026eacute; MH, Dropa M, Mamizuka EM, de Almeida LM, Lincopan N, Matt\u0026eacute; GR, Germano PM. Identification of Staphylococcus aureus carrying the mecA gene in ready-to-eat food products sold in Brazil. Foodborne Pathog Dis. 2011; 8(4):561-3. doi: 10.1089/fpd.2010.0706.\u003cbr /\u003e22- Wang W, Baloch Z, Jiang T, Zhang C, Peng Z, Li F, Fanning S, Ma A, Xu J. Enterotoxigenicity and Antimicrobial Resistance of Staphylococcus aureus Isolated from Retail Food in China. Front Microbiol. 2017; 21; 8:2256. doi: 10.3389/fmicb.2017.02256.\u003cbr /\u003e23- Kelman A, Soong YA, Dupuy N, Shafer D, Richbourg W, Johnson K, Brown T, Kestler E, Li Y, Zheng J, McDermott P, Meng J. Antimicrobial susceptibility of Staphylococcus aureus from retail ground meats. J Food Prot. 2011; 74(10):1625-9. doi: 10.4315/0362-028X.JFP-10-571 \u003cbr /\u003e24- Ramatla T, Nthabiseng M, Kutswa G, Moeti T, Oriel MM, Thekisoe, Michelo S. \u0026ldquo;Identification of Rodent Species That Infest Poultry Houses in Mafikeng, North West Province, South Africa.\u0026rdquo; International Journal of Zoology, 2019.\u003cbr /\u003e25- Das, Piyali and Pranab Behari Mazumder. \u0026ldquo;Prevalence of Staphylococcus in raw meat samples in Southern Assam, India.\u0026rdquo; (2016); 9(1), 23\u0026ndash;29.\u003cbr /\u003e26- Pu S, Wang F, Ge B. Characterization of toxin genes and antimicrobial susceptibility of Staphylococcus aureus isolates from Louisiana retail meats. Foodborne Pathog Dis. 2011; 8(2):299-306. doi: 10.1089/fpd.2010.0679.\u003cbr /\u003e27- van Loo IH, Diederen BM, Savelkoul PH, Woudenberg JH, Roosendaal R, van Belkum A, Lemmens-den Toom N, Verhulst C, van Keulen PH, Kluytmans JA. Methicillin-resistant Staphylococcus aureus in meat products, the Netherlands. Emerg Infect Dis. 2007; 13(11):1753-5. doi: 10.3201/eid1311.070358.\u003cbr /\u003e28- Larsen HD, Huda A, Eriksen NH, Jensen NE. Differences between Danish bovine and human Staphylococcus aureus isolates in possession of superantigens. Vet Microbiol. 2000 Sep 25;76(2):153-62. doi: 10.1016/s0378-1135(00)00232-7.\u003c/p\u003e\n\u003cp\u003e29- Li S, Wang P, Zhao J, Zhou L, Zhang P, Fu C, Meng J, Wang X. Characterization of Toxin Genes and Antimicrobial Susceptibility of Staphylococcus aureus from Retail Raw Chicken Meat. J Food Prot. 2018; 81(4):528-533. doi: 10.4315/0362-028X.JFP-17-309.\u003cbr /\u003e30- Bergdoll MS. Staphylococcus aureus. In: Food borne Bacterial Pathogens, Doyle, M. (Ed.). CRC Press, New York, USA, ISBN: 9780824778668, 1989; PP: 463-523.\u003cbr /\u003e31- Le Loir Y, Baron F, Gautier M. Staphylococcus aureus and food poisoning. Genet Mol Res. 2003; 31;2(1):63-76. \u003cbr /\u003e32- Shanehbandi D, Baradaran B, Sadigh-Eteghad S, Zarredar H. Occurrence of Methicillin Resistant and Enterotoxigenic Staphylococcus aureus in Traditional Cheeses in the North West of Iran. ISRN Microbiol. 2014; doi: 10.1155/2014/129580.\u003cbr /\u003e33- Katsuda K, Hata E, Kobayashi H, et al. Molecular typing of Staphylococcus aureus isolated from bovine mastitic milk on the basis of toxin genes and coagulase gene polymorphisms. Veterinary Microbiology. 2005; 105(3-4):301-305. DOI: 10.1016/j.vetmic.2004.12.004.\u003cbr /\u003e34- Gucukoglu A, Kevenk TO, Uyanik T, Cadirci O, Terzi G, Alisarli M. Detection of enterotoxigenic Staphylococcus aureus in raw milk and dairy products by multiplex PCR. Journal of Food Sciense. 2012; 77(11); 1750-3841. \u003cbr /\u003e35- Mohamed TA, Kalid AE, Saaclaki AM. Isolation of Staphylococcus aureus from semi preserved udanese food. Research Journal of Microbiology, 2014; 9(5); 246-250.\u003cbr /\u003e36- Seguin JC, Walker RD, Caron JP, Kloos WE, George CG, Hollis RJ, Jones RN, Pfaller MA. Methicillin-resistant Staphylococcus aureus outbreak in a veterinary teaching hospital: potential human-to-animal transmission. J Clin Microbiol. 1999; 37(5):1459-63. doi: 10.1128/JCM.37.5.1459-1463. \u003cbr /\u003e37-Jaber, NN. Isolation and biotyping of Staphylococcus aureus from white cheese in Basrah local markets. Journal of Veterinary Research, 2011; 10(2).\u003cbr /\u003e38- Alshammary AH, and Galfoori MH. Detection of methicillin or multidrug resistant Staphylococcus aureus (MRSA) in locally produced raw millk and soft cheese in Baihadad markets Irag. Journal of Veterinary medicine, 2013; 37(2); 226-231.\u003cbr /\u003e39- Gentilini E, Denamiel G, Llorente P, Godaly S, Rebuelto M, DeGregorio O. Antimicrobial susceptibility of Staphylococcus aureus isolated from bovine mastitis in Argentina. J Dairy Sci. 2000; 83(6):1224-7. doi: 10.3168/jds. S0022-0302(00)74988-5. \u003cbr /\u003e40- Gentilini E, Denamiel G, Llorente P, Godaly S, Rebuelto M, DeGregorio O. Antimicrobial susceptibility of Staphylococcus aureus isolated from bovine mastitis in Argentina. J Dairy Sci. 2000; 83(6):1224-7. doi: 10.3168/jds. S0022-0302(00)74988-5. \u003cbr /\u003e41- Salheen EM. Molecular detection of staphylococcus aureus enterotoxin B in milk and milk product using PCR. M.Sc. Sudan University of Science and Technology. 2016.\u003cbr /\u003e42. Mohammed TA, Khalid A.E, Saadabi, AM. PCR Detection of Staphylococcal Enterotoxin A and B genes in Staphylococcus aureus isolates from salted fermented fish. Microbiology journal, 2014; 4:51-56.\u003cbr /\u003e43. Ezzeldeen NA, Mansour HA, Ahmed,AA. Phenotypic and Molecular Identification of Staphylococcus aureus Isolated from some Egyptian Salted Fish\u0026rdquo;. World Applied Science Journal, 2011; 15 (12):1703-1712.\u003cbr /\u003e44. Geetha S, Govinda RV, Mudula KN, Ram RN, Ramesh BK. Some aspects of biochemical and microbial analysis of sundry fish Trichurus Linnaeus, 1758, from the east coast of Visakhapantam\u0026rdquo;. I.J.A.B.R., 2014; 4(4): 462-465.\u003cbr /\u003e45- V\u0026aacute;zquez-S\u0026aacute;nchez D, L\u0026oacute;pez-Cabo M, Sa\u0026aacute;-Ibusquiza P, Rodr\u0026iacute;guez-Herrera JJ. Incidence and characterization of Staphylococcus aureus in fishery products marketed in Galicia (Northwest Spain). Int J Food Microbiol. 2012;157(2):286-96. doi: 10.1016/j.ijfoodmicro.2012.05.021. \u003cbr /\u003e46. Arslan S, \u0026Ouml;zdemir F. Molecular characterization and detection of enterotoxins, methicillin resistance genes and antimicrobial resistance of Staphylococcus aureus from fish and ground beef. Polish Journal of Veterinary Sciences. 2017; 20(1):85-94. DOI: 10.1515/pjvs-2017-0012.\u003cbr /\u003e47. Pereira V, Lopes C, Castro A, Silva J, Gibbs P, Teixeira P. Characterization for enterotoxin production, virulence factors, and antibiotic susceptibility of Staphylococcus aureus isolates from various foods in Portugal. Food Microbiol. 2009; 26(3):278-82. doi: 10.1016/j.fm.2008.12.008.\u003cbr /\u003e48. Parmar BC, Pal M., Dhami AJ. In vitro antimicrobial drug susceptibility pattern of Staphylococcus aureus strain\u0026rdquo;. Indian journal of field Veterinarians, 2006; 2(1): 46-48.\u003cbr /\u003e49. Afifi SI, Al-Newery HA. Bacteriological studies on some virulence factors of Staphylococcus aureus isolated from chicken and Nile tilapia\u0026rdquo;. J.Chem. Environ,Healt, 2017; 3(1): 20-36.\u003cbr /\u003e50. Guven K, Mutlu MB, Gulbandilar A, Cakir P. Occurrence and characterization of Staphylococcus aureus isolated from meat and dairy products consumed in Turkey\u0026rdquo;. J Food Safety, 2010; 30:196-212.\u003cbr /\u003e51. Pu S, Wang F, Ge B. Characterization of toxin genes and antimicrobial susceptibility of Staphylococcus aureus isolates from Louisiana retail meats\u0026rdquo;. Foodborne Pathog D, 2013; 8:299-306.\u003cbr /\u003e52. Ali H H. Isolation and identification of Staphylococcus bacteria from fish of fresh water and its antibiotics sensitivity in Mosul city\u0026rdquo;. Basrah J Vet Res, 2014; 13(1):33\u0026ndash;42.\u003cbr /\u003e53. de Oliveira L P, Barros L S S, Silva, V C, Cirqueira M G. Study of Staphylococcus aureus in raw and pasteurized milk consumed in the Reconcavo area of the State of Bahia. Food Processing \u0026amp; Technology. 2011; 2(6): 128.\u003cbr /\u003e54- Chye FY, Abdullah A, Ayob MK. Bacteriological quality and safety of raw milk in Malaysia. Food Microbiology. 2004; 21(5):535-541. DOI: 10.1016/j.fm.2003.11.007.\u003cbr /\u003e55- Ekici K, Bozkurt H, Isleyici, O. Isolation of some Pathogens from raw milk of different milch animals. Pakistan Journal of Nutrition. 2014; 3 (3): 161-162.\u003cbr /\u003e56- Agban N M, Ahmad S A. Detection and Identification of Staphylococcus Aureus Enterotoxins in Some Milk Products and their Handlers. Egyptian Journal of Medical Microbiology. 2013; 22 (2): 101-108.\u003cbr /\u003e57- Al-khafaji, H M. Detection of Enterotoxins Genes in Staphylococci Isolated from Milk and Cheese. Ph D. Thesis, College of Science-University of Baghdad. 2013.\u003cbr /\u003e58- Mustafa J Y. Isolation of some bacterial causative agent of bovine mastitis, with extraction and purification of Staphylococcus aureus B lactamase. M Sc. Thesis, College of Veterinary Medicine, University of Basrah. 2007.\u003cbr /\u003e59- Sanaa OY, Nazik A, Ibtisam Z. Incidence of Some Potential Pathogens in Raw Milk in Khartoum North (Sudan) and Their Susceptibility to Antimicrobial Agents. Journal of Animal and Veterinary Advances, 2005; 4: 341-344.\u003cbr /\u003e60- Abdel-hameed K G, El-Malt LM. Public health hazard of the Staphylococcus aureus isolated from raw milk and ice cream in Qena governorate. Journal of Veterinary Medicine. 2009; 55 (121):191-200.\u003cbr /\u003e61- Islam MA, Kabir M L, Rahman MT. Molecular detection and characterization of staphylococcus aureus isolated from raw milk sold in different markets of bangladesh. Journal of Veterinary Medicine. 2016; 14 (2): 277-282.\u003cbr /\u003e62- Jahan M, Rahman M., Parvej S, Chowdhury Md., Haque E, Talukder AK. and Ahmed S. Isolation and characterization of Staphylococcus aureus from raw cow milk in Bangladesh. Journal of advanced veterinary and animal reserch. 2016; 2(1): 49-55.\u003cbr /\u003e63- Thaker HC, Manoj NB, Jitendra BN. Isolation and identification of Staphylococcus aureus from milk and milk products and their drug resistance patterns in Anand, Gujarat. Veterinary World. 2013; 10-13.\u003cbr /\u003e64- Beyene G F. Antimicrobial Susceptibility of Staphylococcus aureus in Cow Milk, Afar Ethiopia. International Journal of Modern Chemistry and Applied Science. 2016; 3 (1): 280- 283.\u003cbr /\u003e65- Abraha H, Hadish G, Aligaz B, Eyas G, Workelule K. Antimicrobial resistance profile of Staphylococcus aureus isolated from raw cow milk and fresh fruit juice in Mekelle, Tigray, Ethiopia. Journal of Veterinary Medicine and Animal Health, 2018 10(4), 106-113. \u003cbr /\u003e66- Idbeis HI. Detection of enterotoxin genes (sea-see) of Staphylococcus aureus isolated from raw milk by multiplex PCR and study of their pathogenicity. M. Sc. Thesis. College of Veterinary Medicine- University of Basrah (Microbiology). 2008.\u003cbr /\u003e67- AL - Marsomy H M. Isolation and diagnostic some bacterial causes of mastitis in cows and role of lactobacillus secretion on inhibition growth of Staphylococcus aureus. M.Sc., Thesis, College of Veterinary Medicine, University of Baghdad. 2008.\u003cbr /\u003e68- Bendahou A, Lebbadi M, Ennanei L, Essadqui FZ, Abid M. Characterization of Staphylococcus species isolated from raw milk and milk products (lben and jben) in North Morocco. J Infect Dev Ctries. 2008; 2(3):218-25. doi: 10.3855/jidc.266. \u003cbr /\u003e69- AL - Saady A A. Extraction and characterization of surface adherence protein from methicillin resistance Staphylococcus aureus and study of the pathogenic effects. Ph.D., Thesis, College of science, University of Baghdad. 2007.\u003cbr /\u003e70- Peles F, Wagner M, Varga L, Hein I, Rieck P, Gutser K, Kereszt\u0026uacute;ri P, Kardos G, Turcs\u0026aacute;nyi I, B\u0026eacute;ri B, Szab\u0026oacute; A. Characterization of Staphylococcus aureus strains isolated from bovine milk in Hungary', International Journal of Food Microbiology, 2007; 118 (2)186-193. https://doi.org/10.1016/j.ijfoodmicro.2007.07.010\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Food samples, S. aureus, Sensitivity test, enterotoxin gene, mecA gene, PCR","lastPublishedDoi":"10.21203/rs.3.rs-59354/v3","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-59354/v3","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e \u003cem\u003eStaphylococcal\u003c/em\u003e food poisoning is an intoxication that results from the consumption of improperly prepared or stored foods containing sufficient amounts of one or more preformed \u003cem\u003eS. aureus\u003c/em\u003e enterotoxins. Nowadays many researchers worldwide noted an emergence of resistant strains \u003cem\u003eStaphylococci\u003c/em\u003e particularly for the antibiotic methicillin. Therefore, this study was aimed to determine the existence of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e and its enterotoxins, \u003cem\u003emecA\u003c/em\u003e genes in selected food samples.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e A total of 400 selected food samples were collected from different areas in Khartoum state. The selected foods included cheese, meat products, fish and raw milk. One hundred sample from each type of food were cultivated and the resultant growth yielded 137 (34.25 %) \u003cem\u003eS. aureus\u003c/em\u003e, 126 (31.5%) bacteria other than \u003cem\u003eS. aureus \u003c/em\u003eand 137 (34.25%) yielded no growth. Eighty-four of the137 \u003cem\u003eS. aureus\u003c/em\u003e isolates were randomly selected and tested for the presence of \u003cem\u003emecA\u003c/em\u003e and enterotoxin genes. Oxacillin sensitivity test showed that 15(11%) of 137 \u003cem\u003eS. aureus\u003c/em\u003e isolates were Oxacillin resistant. The PCR assay showed that the \u003cem\u003emecA\u003c/em\u003e gene was detected in 15 of 84 (17%) \u003cem\u003eS. aureus\u003c/em\u003e isolates. Simultaneously, only 2 (2.385%) out of 84 \u003cem\u003eS. aureus\u003c/em\u003e isolates showed an enterotoxin B gene product. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eThere was a relatively moderate prevalence of methicillin-resistant \u003cem\u003estaphylococcus aureus \u003c/em\u003ewith very low frequency of enterotoxin B gene\u003cem\u003e in\u003c/em\u003e different kinds of selected food samples that collected from Khartoum state. These findings elucidate the increased risk on public in Khartoum being affected by Staphylococcal food poisoning upon consumption of dairy or meat products prepared in unhygienic conditions that could lead to intoxication by \u003cem\u003eStaphylococcus aureus\u003c/em\u003e enterotoxins.\u003c/p\u003e","manuscriptTitle":"Molecular detection of Staphylococcal enterotoxins and mecA genes products in selected food samples collected from different areas in Khartoum state.","msid":"","msnumber":"","nonDraftVersions":[{"code":3,"date":"2020-12-07 22:55:53","doi":"10.21203/rs.3.rs-59354/v3","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}},{"code":2,"date":"2020-09-22 17:16:34","doi":"10.21203/rs.3.rs-59354/v2","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}},{"code":1,"date":"2020-09-03 16:21:19","doi":"10.21203/rs.3.rs-59354/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"50d7ab97-a77f-4974-a107-6ebeade77113","owner":[],"postedDate":"December 7th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":583268,"name":"General Microbiology"}],"tags":[],"updatedAt":"2020-11-27T15:24:34+00:00","versionOfRecord":[],"versionCreatedAt":"2020-12-07 22:55:53","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v3","identity":"rs-59354","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-59354","identity":"rs-59354","version":["v3"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}