PTP1B inhibitor alleviates deleterious septic lung injury through Src signaling

preprint OA: closed
Full text JSON View at publisher
Full text 105,092 characters · extracted from preprint-html · click to expand
PTP1B inhibitor alleviates deleterious septic lung injury through Src signaling | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article PTP1B inhibitor alleviates deleterious septic lung injury through Src signaling chong-rong qiu, zhi-jian sun, fen liu, wei deng, xiu-fang ouyang, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3859426/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Septic lung injury is an unmet clinical challenge due to its high mortality, and there is a lack of effective treatment. Accumulating evidence suggests that an uncontrolled pulmonary inflammatory response is important in the pathogenesis of lung injury in sepsis. Therefore, limiting excessive early inflammatory responses may be an effective strategy. Methods We established a septic lung injury model using cecal ligation and puncture. Western blotting and immunofluorescence analyses were performed to assess the expression of PTP1B and endoplasmic reticulum (ER) stress and pyroptosis. Co-immunoprecipitation was used to analyze the binding of PTP1B and Src molecules. Results PTP1B is upregulated in both in vivo and in vitro models of septic lung injury. PTP1B directly binds to Src and aggravates inflammation by regulating the ER stress-pyroptosis axis. The inhibition of PTP1B alleviates inflammation and improves the prognosis of septic mice. Conclusions Our study suggesting that PT1B inhibitors have clinical application value in the treatment of septic lung injury. This may provide a new strategy for the treatment of septic lung injury. Sepsis Protein tyrosine phosphatase 1B endoplasmic reticulum stress pyroptosis Src Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction During sepsis, characterized by organ dysfunction, the lungs are often the first and most frequently affected organ to fail. Although significant progress has been made in the clinical treatment of lung injury in sepsis, such as mechanical ventilation and extracorporeal membrane oxygenation, effective treatment methods are still lacking, and the mortality rate of septic lung injury can be as high as 40% [ 1 – 3 ] . It has been found that an uncontrolled pulmonary inflammatory response is important in the pathogenesis of lung injury in sepsis [ 4 ] . Therefore, early limitation of excessive inflammatory responses may be an effective strategy. Studies have shown that alveolar macrophages (AMs) aggravate inflammation through endoplasmic reticulum stress (ER) and pyroptosis [ 5 – 7 ] , and inhibiting ER stress can reduce inflammation [ 8 ] . Protein tyrosine phosphatase 1B (PTP1B) is an endogenous molecule closely related to inflammation, encoded by the PTPN1 gene, and located in the cytoplasmic region of the ER. It has a variety of biological activities and may play an important role in regulating the inflammatory response [ 9 ] . Inhibition of PTP1B alleviates ER stress and the inflammatory response and improves the prognosis of mice with sepsis [ 10 – 12 ] . However, whether PTP1B has a regulatory effect on pyroptosis has not yet been reported, and the function of PTP1B in macrophages remains controversial. In bone marrow-derived macrophages, PTP1B knockout promotes inflammation by enhancing tyrosine phosphorylation of the macrophage colony-stimulating factor 1 receptor, resulting in increased monocyte/macrophage numbers and macrophage activity [ 13 ] . However, Xu et al. found that PTP1B inhibition could induce M2 polarization, which has anti-inflammatory effects, in mouse mononuclear macrophage leukemia cells [ 14 ] . Therefore, it is important to further study the regulatory role and mechanism of PTP1B in the inflammation of AMs in septic lung injury. In this study, we confirmed that PTP1B regulates the ER stress-pyroptosis axis by directly binding to the Src protein in AMs during septic lung injury and that inhibition of PTP1B can reduce lung injury in sepsis, which is a potential therapeutic target for septic lung injury and may provide a new strategy for its treatment. Materials and methods LPS-Induced AM Cell Modeling Rattus norvegicus (NR) 8383 AM cells were obtained from the Chinese Academy of Sciences Cell Bank (Shanghai, China). NR8383 AM cells were cultured in Ham’s F-12K medium (Boster, China) supplemented with 15% (v/v) fetal bovine serum (FBS, Seo, China). AM cells were seeded into six-well plates at a density of 5 × 10 5 cells per well before being treated with 1 µg/mL lipopolysaccharide (LPS; Escherichia coli 055:B5; Sigma) for 6, 12 and 24 h. The negative control group was treated with an equal volume of phosphate-buffered saline (Biochem, Shenzhen, China). In subsequent experiments, the cells were randomly assigned to five groups: LPS + SC (PTP1B inhibitor, SC-222227; Santa Cruz Biotechnology, CA, USA), LPS + SC + tunicamycin (ER stress inducer, M4798; AbMoleBioScience, Houston, TX, USA), and LPS + SC + PP2 (Src inhibitor, HY-13805; MedChemExpress, USA). According to previous literature [ 15 – 17 ] , the AM cells were pretreated with 2 µM SC for 30 min, 1.5 µg/mL tunicamycin for 24 h before SC, and 15 µM PP2 for 1 h before SC. Next, the AM cells in the LPS group were treated with LPS (1 µg/mL) for 6 h, and then collected for RNA or protein isolation. Inflammatory factors in the collected supernatant were measured using enzyme-linked immunosorbent assay (ELISA). AM cells were collected for western blotting analysis and quantitative reverse transcription-polymerase chain reaction (qRT-PCR). Animals C57BL/6 mice (8 weeks old; body weight: 18–22 g) were purchased from Zhejiang Vital River Laboratory Animal Technology Co., Ltd., China (certificate of conformity: SCXK2019-0001). According to institutional regulations, the mice were fed pathogen-free food and water under standard conditions (12-h light/dark cycle, 25–27°C, humidity of ~ 40%).We performed the invasive procedures with pentobarbital anaesthesia to minimize suffering and killed all the animals by inhaling excessive amounts of isoflurane anaesthetic. Establishment of the Cecal Ligation and Puncture Model Cecal ligation and puncture (CLP) was performed in mice as previously described [ 18 ] . First, after anesthesia and disinfection with betadine solution, laparotomy was performed on the abdomen to expose the cecum and adjoining intestine. Next, a 3.0 thread suture was used to tightly ligate the intestinal canal under the ileocecal section, after which a 20-gauge needle was used to puncture the canal wall, and a small amount of intestinal content was gently squeezed into the abdominal cavity to establish a sepsis mouse model. Finally, the mice received a subcutaneous injection of 1mL of saline for postoperative resuscitation. Mice in the sham group underwent laparotomy techniques without ligation and puncture. As previously described [ 10 , 19 – 20 ] , SC (10 mg/kg) and tunicamycin (1 mg/kg) were intraperitoneally injected into C57BL/6 mice 2 h before CLP surgery, and PP2 (1 mg/kg) injected 1 h before surgery. Lentivirus Gene Delivery Lentivirus gene delivery was conducted as previously described [ 21 ] . Lentiviruses silently expressing PTP1B were constructed by GeneChem Group (Gene Co., Ltd, Shanghai, China). AM cells were cultured in a medium with Ham’s F-12K containing 15% (v/v) FBS. The RNA and protein extraction groups were transfected with the indicated lentiviruses for 72 h in the culture medium. Real-Time Quantitative PCR TransZol Up (O41220; TRANS, China) was used to extract RNA from the samples, and a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific) used to assess the extracted RNA concentration and purity. EasyScript One-Step gDNA Removal and cDNA Synthesis Supermix (AE311; TransGen Biotech) were used to prepare cDNA using a StepOnePlus analyzer Real-Time PCR system (Applied Biosystems, USA). All qRT-PCR analyses were performed using the PerfectStart Green SuperMix kit (AQ601; TransGen Biotech) and an Applied LightCycler96 Real-Time PCR instrument. The qRT-PCR mixtures contained 5.0 µL of PerfectStart Green qPCR SuperMix, 3.6 µL of nuclease-free water, 0.4 µL of primers (10 µM), and 2.0 µL of the reverse transcription product. Optimization of the qRT-PCR amplification conditions was as follows: 94°C for 30 s, 40 cycles of each at 94°C for 5 s, 60°C for 30 s, 95°C for 10 s, 65°C for 60 s, 97°C for 1 s, and 37°C for 30 s. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the internal control. The PCR primer sequences are presented in Tables 1 and 2 . Table 1 The rat primers for qRT-PCR. Primer (5’-3’) GAPDH Forward :GTCATCAACGGGAAACCCAT Reverse :ACGCCAGTAGACTCCACGACAT PTP1B Forward:TGGGCGGCTATTTACCAGGA Reverse:CACCATCTCCCAGAAGTGCC eif2α Forward:TTCGCCATGTTGCTGAGGTA Reverse :TGACAGCTTGTGGGGTCAAA CHOP Forward:AACCTGAGGAGAGAGAAACCG Reverse :TGCAGATCCTCATACCAGGC GSDMD Forward:AGCATCCTTGCATTCCGAGT Reverse :TAAAGTCATGCCGCCTCTGG Caspase-1 Forward: TTTCCTGGACCGAGTGGTTC Reverse: AGGTCAACATCAGCTCCGAC NLRP3 Forward: GCATGCCGTATCTGGTTGTG Reverse: AGGGTACCCCATAGACTGGC IL-1β Forward: AGCTTCAGGAAGGCAGTGTC Reverse: TCAGACAGCACGAGGCATTT IL-18 Forward: TCAGCTCTTCTACCAGCAAACA Reverse: TTCCAACTGAGAGGCTGTGC TNF-α Forward: GGCTTTCGGAACTCACTGGA Reverse: GGGAACAGTCTGGGAAGCTC Table 2 The mice primers for qRT-PCR. Primer (5’-3’) GAPDH Forward :TTTTGTCTACGGGACGAGGC Reverse :TACGGGTCTAGGGATGCTGG PTP1B Forward:GGCTATTTACCAGGACATTCGAC Reverse:TCCATGATGCGGTTGAGCAT eif2α Forward:TCCTCGTTGCCACTAAGCAG Reverse :AACAAGCTGACATAGGCCCC CHOP Forward:TCTTGAGCCTAACACGTCGATT Reverse :ACGTGGACCAGGTTCTCTCT GSDMD Forward:GATCAAGGAGGTAAGCGGCA Reverse :CACTCCGGTTCTGGTTCTGG Caspase-1 Forward: CACTCCGGTTCTGGTTCTGG Reverse: TGATCACATAGGTCCCGTGC NLRP3 Forward: GGCTGCTATCTGGAGGAACTT Reverse: GGGATACAGCCTTTCTCGGG IL-1β Forward: GCCACCTTTTGACAGTGATGAG Reverse: AGCTTCTCCACAGCCACAAT IL-18 Forward: TGAGGCATCCAGGACAAATCA Reverse: GAACCACAGAGAACCCCCAC TNF-α Forward: AGGCACTCCCCCAAAAGATG Reverse: CCACTTGGTGGTTTGTGAGTG Western Blot Total protein was extracted from the cells using lysis buffer containing a protease inhibitor, and protein levels were quantified using a protein quantification kit (Beijing Pulilai Gene Technology Co., Ltd., China). Proteins were separated using 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA). Membranes were blocked with 5% nonfat milk for 1 h at room temperature (RT) and then incubated with primary antibodies for 24 h at 4°C. Subsequently, the membranes were incubated with secondary antibodies at RT for 2 h. GAPDH was used as the internal reference. Blots were visualized using an enhanced chemiluminescence assay kit (Millipore), developed with a Bio-Rad Gel Doc EZ imager (Bio-Rad, USA), and band intensities were analyzed using ImageJ software (NIH Image analysis). Primary antibodies used included anti-PTP1B (1:1000, ab244207; Abcam, UK), anti-p-eif2α (1:1000, 3398; Cell Signaling Technology, USA), anti-eif2α (1:1000, 5324T; Cell Signaling Technology), anti-CHOP (1:1000, T56694; Abmart, China), anti-GSDMD (1:1000, P30823; Abmart), anti-NLRP3 (1:1000, ab263899; Abcam, UK), anti-caspase-1 (1:1000, 22915-1-Ap; Proteintech, China), anti-p-src (1:200, sc-166860; Santa Cruz), anti-Src (1:1000, 2109; Cell Signaling Technology), and anti-GAPDH (1:20000, 60004-1-Ig; Proteintech). Enzyme-Linked Immunosorbent Assay Enzyme-linked immunosorbent assay (ELISA) was performed to assess the concentration of inflammatory cytokines according to the manufacturer’s instructions. Specific ELISA kits were purchased from Fine Test (Wuhan Fine Biotech Co., Ltd, China). Levels of IL-1β and TNFα in mouse plasma and bronchoalveolar lavage fluid (BALF) harvested from each group were detected using commercial mouse IL-1β and TNFα kits. IL-18, IL-1β, and TNF-α release levels in the supernatants were measured using specific rat ELISA kits. Hematoxylin and Eosin Staining and Histopathological Analysis Mice were euthanized after anesthesia, and fresh lung tissues collected, fixed in 4% paraformaldehyde (PFA) buffer, embedded, and sliced into 5-µm-thick sections. The slices were stained with hematoxylin and eosin to assess lung injury. Hematoxylin and eosin-stained images were captured using a microscope (Zeiss) and evaluated by two pathologists to assess the degree of lung injury, as previously reported [ 22 ] . The sections were analyzed to assess inflammatory cell infiltration, epithelial desquamation, edema, and hemorrhage. Each characteristic was scored as 3 (prominent), 2 (moderate), 1 (mild), or 0 (absent). Lung Wet/Dry Ratio Lung edema was evaluated by calculating the lung wet/dry (W/D) ratio. Immediately after euthanasia, the wet weight of the right lung from each mouse was calculated and then dried in an incubator at 65°C for 24 h. The dry weight was measured, and the W/D ratios were calculated. Immunofluorescence Staining Fresh lung tissue was fixed with 4% PFA, dehydrated in a sucrose gradient solution, wrapped in Tissue-Tek OCT, and sectioned into 5-µm-thick slices. The tissue slices were fixed in 4% PFA, permeabilized, blocked with 5% goat serum to minimize nonspecific staining, and then incubated with primary antibodies overnight at 4°C. The primary antibodies used were anti-PTP1B (1:50, ab244207; Abcam, USA), anti-NLRP3 (1:200, WL02635; Wanleibio, China), and anti-caspase-1 (1:100, 22915-1-Ap; Proteintech). After incubation with the secondary antibodies Alexa Fluor 488 (Thermo Fisher Scientific, USA) and Alexa Fluor 594 (Thermo Fisher Scientific) for 1 h at RT, the nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; Boster) for 5 min without exposure to light. The samples were visualized using a confocal laser scanning microscope (Olympus) or a fluorescence microscope (Zeiss). Co-immunoprecipitation Assay Cells were lysed in equal proportions of immunoprecipitation (IP) buffer (Beyotime, China) with a complete protease inhibitor cocktail (MedChemExpress) on ice for 30 min. After centrifugation, protein samples were collected and prepared for IP assays. Protein A/G magnetic beads (MedChemExpress) were coupled to anti-p-Src antibodies (Santa Cruz) at 1–2 µg per 100–500 µg of total protein or anti-PTP1B (1:30; Abcam, UK) and rotated for 2 h at 4°C. After washing three times, 500 µg of total protein was added and co-rotated with the antibody-magnetic bead complex overnight at 4°C. Equivalent amounts of cognate mouse or rabbit IgG antibodies were used as IP controls. Finally, immunoprecipitated proteins were dissolved in 25 µL 1× loading buffer (Solarbio, China) by boiling for 10 min for western blot analysis. Statistical Analysis Three biological replicates were used for all the experiments. Data are expressed as mean ± standard deviation. All data were analyzed using SPSS (version 19.0, IBM, USA) and statistical charts were generated using GraphPad Prism 8 software. Student’s t -test was used to compare differences between two groups and analysis of variance (ANOVA) was used to compare differences between multiple groups. Dunn’s multiple comparison test was used for one-way ANOVA, and Fisher’s least significant difference test was used for two-way ANOVA. The survival of the sham, CLP, and CLP + SC groups was analyzed using Kaplan–Meier curves. Statistical significance was set at P < 0.05. significant. Results Upregulation of PTP1B in LPS-treated NR8383 AM cells Correlates to Inflammation Alveolar macrophages play an important role in the pathogenesis of septic lung injury by producing inflammatory cytokines and presenting antigens that mediate innate and adaptive immunity. We used LPS to stimulate NR8383 to establish a cell model of septic lung injury and selected different time points to determine the optimal time point of PTP1B elevation. After LPS stimulation of NR8383 for 6 h, the expression levels of PTP1B protein and mRNA were significantly increased when compared with the control group and LPS stimulation for 12 and 24 h (Fig. 1A, C, D), and the levels of the inflammatory cytokines IL-1β, IL-18, and TNFα were also significantly increased (Fig. 1B). Protein and mRNA levels of the ER stress molecules p-eif2α and CHOP and pyroptotic molecules GSDMD, caspase1, and NLRP3 were also increased (Fig. 1A, C, D). These results suggested that PTP1B expression was upregulated during lung injury in sepsis. Thus, PTP1B may be a pro-inflammatory molecule, and inflammation may be related to ER stress and pyroptosis. PTP1B Inhibitor Alleviates Inflammation and ER Stress in LPS-treated NR8383 AM Cells To investigate the effect of a PTP1B inhibitor (SC-22227, SC) on inflammation in LPS-treated NR8383 cells, we treated NR8383 with a PTP1B inhibitor and LPS for 6 h. SC pretreatment significantly reduced the levels of LPS-induced inflammatory cytokines compared to the LPS group (Fig. 2B), and the protein and mRNA levels of ER stress and pyroptotic molecules also decreased (Fig. 2A, C, D). These results indicate that PTP1B inhibition could alleviate inflammation, ER stress, and pyroptosis. Lentiviruses silently expressing PTP1B Alleviates Inflammation and ER Stress in LPS-treated NR8383 AM Cells To investigate the effect of Lentiviruses silently expressing PTP1B (Lv-PTP1B) on inflammation in LPS-treated NR8383 cells, we transfected with the indicated lentiviruses in NR8383 for 72 h and LPS for 6 h. Lv-PTP1B significantly reduced the levels of LPS-induced inflammatory cytokines compared to the LPS group (Fig. 3B), and the protein and mRNA levels of ER stress and pyroptotic molecules also decreased (Fig. 3A, C, D). These results indicate that PTP1B inhibition could alleviate inflammation, ER stress, and pyroptosis. PTP1B Inhibitor Treatment Ameliorates Inflammation and Increases Survival Probability in Septic Mice The effect of PTP1B inhibitors on inflammation in mice with septic lung injury was verified, and a mouse sepsis model was established using the CLP method. The lung inflammation and pulmonary edema of mice in the CLP + SC group were reduced compared with those in the CLP group, and the lung injury score was decreased (Fig. 4A–C). Concurrently, the levels of plasma and BALF inflammatory cytokines decreased (Fig. 4D–E), and the protein and mRNA levels of ER stress and pyroptotic molecules decreased (Fig. 4H–M). The levels of PTP1B (green), NLRP3 (red), and caspase1 (red) detected by immunofluorescence were consistent with the above results (Fig. 4N). In addition, the survival rate of septic mice in the CLP + SC group was significantly higher than that of the CLP group (P < 0.001, Fig. 4F). These results indicate that SC can alleviate inflammation, relieve ER stress and pyrogenic death, improve prognosis, reduce death, and protect against lung injury in septic mice. Tunicamycin Exacerbates ER Stress, Pyroptosis and Inflammation In Vivo Next, we demonstrated that PTP1B plays a role in regulating inflammation in mice with septic lung injury via ER stress. The ER stress inducer tunicamycin was administered to mice before CLP, and mice in the CLP + SC + tunicamycin group showed more severe signs of lung inflammation, pulmonary edema, and lung injury than those in the CLP + SC group (Fig. 5A–C). Concurrently, the plasma and BALF inflammatory cytokine levels in mice were also significantly increased (Fig. 5D, E), as were the protein and mRNA levels of ER stress and pyroptotic molecules (Fig. 5F–G, Supplemental Fig. 1A–E). The expression levels of pyroptotic molecules (red) detected by immunofluorescence (Fig. 5H) were consistent with these results. These results indicated that tunicamycin significantly reversed the inhibitory effects of PTP1B inhibitors on pulmonary inflammation, ER stress, and pyroptosis in septic mice, suggesting that PTP1B regulates inflammation in septic mice through the ER stress-pyroptosis axis in vivo. Tunicamycin Exacerbates ER Stress, Pyroptosis and Inflammation In Vitro To further verify the role of PTP1B in regulating inflammation through ER stress in vitro, we pre-treated NR8383 cells with the ER stress inducer, tunicamycin, and then treated them with SC. Finally, the NR8383 cells were stimulated with LPS for 6 h. NR8383 cells were significantly improved compared to those in the LPS + SC group. In the LPS + SC + tunicamycin group, the inflammatory cytokine levels were significantly increased (Fig. 6A–B), and the mRNA and protein levels of ER stress and pyroptotic molecules were significantly increased (Fig. 6C–I). These results indicated that tunicamycin significantly reversed the inhibitory effects of PTP1B inhibitors on LPS-stimulated NR8383 cell inflammation, ER stress, and pyroptosis, and that PTP1B regulated inflammation through the ER stress-pyroptosis axis in vitro. PTP1B Inhibitor Modulates the ER Stress-pyroptosis Axis via Src Signaling In Vitro Next, we explored the molecular mechanism of PTP1B regulation of ER stress-pyroptosis in vitro. We measured the expression level of Src protein. The expression level of P-Src was significantly reduced in the LPS group compared to the control group and increased when the PTP1B inhibitor was applied (Fig. 7A). The levels of inflammatory cytokines in the LPS + SC + PP2 group were significantly higher than those in the LPS + SC group (Fig. 7H), as were the protein and mRNA levels of ER stress and pyrogenic molecules (Fig. 7A–G). In addition, we verified the relationship between PTP1B and Src using co-IP. As shown in Fig. 7I, PTP1B and P-Src expression in LPS-stimulated NR8383 cells increased in the IP group. When the expression level of P-Src decreased, the expression level of PTP1B also decreased (Fig. 7J). These results suggest that PTP1B and Src have a negative regulatory relationship and that PTP1B and Src directly interact with each other and play a role in regulating inflammation. PTP1B Inhibitor Modulates the ER Stress-pyroptosis Axis via Src Signaling In Vivo Finally, in vivo experiments verified the role of Src in the regulation of ER stress-pyroptosis using a PTP1B inhibitor. After the application of the Src inhibitor (PP2), mice in the CLP + SC + PP2 group showed more severe pulmonary inflammation, pulmonary edema, and lung injury than those in the CLP + SC group (Fig. 8A–C). The plasma or BALF inflammatory cytokine levels in mice significantly increased (Fig. 8D–E), as did the expression levels of ER stress and pyroptotic molecules (Fig. 8F–G). The expression levels of pyroptotic molecules (red) detected by immunofluorescence (Fig. 8H) were consistent with these results. The results showed that PP2 significantly reversed the protective effect of the PTP1B inhibitor (SC) against inflammation and lung injury in mice with sepsis. Src is involved in the regulation of PTP1B during ER stress-pyroptosis, which aggravates the inflammatory response in vivo. Discussions In this study, we found that PTP1B was upregulated in both in vivo and in vitro models of septic lung injury. PTP1B directly binds to Src and aggravates inflammation by regulating the ER stress-pyroptosis axis. PTP1B inhibition alleviated inflammation and improved the prognosis of septic mice. Therefore, PTP1B is a potential therapeutic target for the treatment of lung injury in sepsis. In this study, the upregulation of PTP1B expression was accompanied by increased levels of inflammatory cytokines, pulmonary edema, and alveolar hemorrhage. These observations suggest that PTP1B is a pro-inflammatory molecule involved in septic lung injury [ 23 ] . Inhibition of PTP1B significantly reduced the levels of inflammatory cytokines and alleviated lung injury, which is consistent with previous studies [ 10 ] . PTP1B is a tyrosine phosphatase located in the ER, where proteins are processed, modified, and folded. When protein folding exceeds the capacity of the ER, ER stress results in misfolded or unfolded proteins, a state called ER stress. Sustained ER stress can lead to cell death and inflammation [ 24 ] . This study showed that PTP1B can regulate the stress level of the ER, has a positive effect on maintaining ER homeostasis, and promotes the normal modification and folding of proteins. In addition, this study found that the ER stress inducer tunicamycin blocked the action of PTP1B inhibitors to a certain extent, thereby increasing inflammation and ER stress, which is consistent with previous reports [ 25 – 26 ] . Pyroptosis is a caspase-1-dependent programmed cell death initiated by inflammasomes [ 27 ] . In the livers of obese mice, administration of LPS or itamycin causes the activation of ER stress-related proteins [ 28 ] , which further activates the NLRP3 inflammasome and subsequently initiates pyroptosis of hepatocytes, which can be mitigated by the administration of ER stress inhibitors [ 23 ] . This study also confirmed that PTP1B affects pyroptosis by regulation of ER stress. A decrease in PTP1B levels is accompanied by a reduction in ER stress and pyroptosis, indicating that ER stress and pyroptosis participate in the pathogenesis of sepsis [ 6 – 7 , 29 ] . PTP1B reduces inflammation and protects against lung injury in sepsis by regulating the ER stress-pyroptosis axis. To our knowledge, this is the first report using AMs, confirming that the regulation of ER stress can affect pyroptosis [ 28 ] and further revealing the specific mechanism of PTP1B in alleviating lung injury in sepsis. Src is a membrane-associated non-receptor tyrosine kinase that plays key roles in cell adhesion, proliferation, survival, invasion, cell motility, and cytokine receptor activation. Studies have found that the overactivation and/or overexpression of the Src family of kinases is closely related to the occurrence and development of various cancers [ 30 ] . This may be due to the activation of Src kinases in immune cells through chemokines secreted by tumors, thus inducing the production of cytokines that mutually activate Src in cancer cells and promote cancer progression. Previous studies have found that Src is the substrate of PTP1B, which has a tyrosine kinase with an SH3 structure; the proline-rich region of PTP1B may bind to the SH3 substrate, and PTP1B promotes the proliferation of colon and mammary glands through the activation of Src [ 31 ] . Src also regulates the production of inflammatory cytokines [ 32 – 33 ] . Song et al. [ 34 ] found that the overexpression of PTP1B reduces Src phosphorylation. PTP1B leads to the activation of Src tyrosine kinase activity by the dephosphorylation of Src, thereby negatively regulating nervous system inflammation. This study also confirmed the relationship between PTP1B and Src and found that the expression of PTP1B was higher in the control and sham surgery groups than in the LPS or CLP groups. Conversely, Src was expressed at lower levels in the latter group, whereas the opposite was observed when PTP1B inhibitors were used. These findings suggest that PTP1B negatively regulates Src, which is consistent with previous findings [ 34 ] . In addition, through an IP study of AMs stimulated with LPS, we observed that the binding enrichment of PTP1B and Src and the increase in PTP1B in the LPS group was accompanied by an increase in Src expression, whereas the increase in Src in the control group was accompanied by an increase in PTP1B. This suggests that Src is involved in the regulation of the ER stress-pyroptosis axis by PTP1B in septic lung injury and that PTP1B directly binds to Src to play this role. The present study has several limitations. First, a PTP1B agonist was not used to verify its effect on ER stress-pyroptosis. PTP1B not only has anti-inflammatory effects but also immune regulatory effects. However, the regulatory effect of PTP1B on immunity in septic lung injury requires further investigation. Although previous studies on ER stress-mediated cell death have mainly focused on autophagy and apoptosis [ 35 ] , our current study found that pyroptosis is also involved. However, the specific mechanisms of ER stress that induce different cell death patterns, especially pyroptosis, remain unclear. Third, no exogenous co-IP experiments were conducted to verify the direct binding effect of PTP1B and Src. Finally, this study was conducted only in vivo and in vitro with a relatively limited sample size; therefore, further follow-up studies with human samples are warranted to confirm and extend these results. Conclusions In conclusion, our study suggests that PTP1B may reduce inflammation by regulating pyroptosis through ER stress, and that inhibition of PTP1B may reduce lung injury in sepsis. This study suggests that PT1B inhibitors have clinical application value in the treatment of septic lung injury and may provide a new approach for the treatment of septic lung injury. Declarations Data availability statement The original contributions presented in this study are included in the article/supplementary material. Further inquiries can be directed to the corresponding author. Acknowledgements none. Funding This work was supported by National Natural Science Foundation of China [grant number 81660315] and Natural Science Foundation of Jiangxi Province [grant number 20232BAB206083]. Conflict of interest The authors declare that they have no conflict of interests. Author contributions CQ contributed to the experimentation, analysis, and manuscript preparation. FL and WT contributed to the concept and oversaw the study. ZS and QZ contributed to the experiments. WD and XFOU contributed to immunological evaluation through sample measurements. Ethics approval and consent to participate Animal experimental procedures and protocols were approved by the Ethics Committee of the Medical Innovation Center of the First Affiliated Hospital of Nanchang University (approval no. CDYFY-IACUC-202305QR019) and were performed in accordance with the principles and procedures of the National Institutes of Health Guide for the Care and Use of Laboratory Animals and the Guidelines for Chinese Regulation for the Use and Care of Laboratory Animals. According to institutional regulations, the mice were fed pathogen-free food and water under standard conditions (12-h light/dark cycle, 25–27 °C, humidity of ~40%).We performed the invasive procedures with pentobarbital anaesthesia to minimize suffering and killed all the animals by inhaling excessive amounts of isoflurane anaesthetic. This study does not involve human samples. We confirmed that all methods were carried out in accordance with relevant guidelines and regulations. We confirmed that all methods are reported in accordance with ARRIVE guidelines ( https://arriveguidelines.org ) for the reporting of animal experiments. References Wei JX, Jiang HL, Chen XH. Endothelial cell metabolism in sepsis. World J Emerg Med. 2023;14(1):10–6. Matthay MA, Zemans RL, Zimmerman GA, Arabi YM, Beitler JR, Mercat A, et al. Acute respiratory distress syndrome. Nat Rev Dis Primers. 2019;5(1):18. Lai K, Song C, Gao M, Deng Y, Lu Z, Li N, et al. Uridine Alleviates Sepsis-Induced Acute Lung Injury by Inhibiting Ferroptosis of Macrophage. Int J Mol Sci. 2023;24(6):5093. Matthay MA, Ware LB, Zimmerman GA. The acute respiratory distress syndrome. J Clin Invest. 2012;122(8):2731–40. Kim DI, Song MK, Kim HI, Han KM, Lee K. Diesel Exhaust Particulates Induce Neutrophilic Lung Inflammation by Modulating Endoplasmic Reticulum Stress-Mediated CXCL1/KC Expression in Alveolar Macrophages. Molecules. 2020;25(24):6046. Wu DD, Pan PH, Liu B, Su XL, Zhang LM, Tan HY, et al. Inhibition of Alveolar Macrophage Pyroptosis Reduces Lipopolysaccharide-induced Acute Lung Injury in Mice. Chin Med J (Engl). 2015;128(19):2638–45. Xie K, Chen YQ, Chai YS, Lin SH, Wang CJ, Xu F. HMGB1 suppress the expression of IL-35 by regulating Naïve CD4 + T cell differentiation and aggravating Caspase-11-dependent pyroptosis in acute lung injury. Int Immunopharmacol. 2021;91:107295. Huang J, Lu W, Doycheva DM, Gamdzyk M, Hu X, Liu R, et al. IRE1α inhibition attenuates neuronal pyroptosis via miR-125/NLRP1 pathway in a neonatal hypoxic-ischemic encephalopathy rat model. J Neuroinflammation. 2020;17(1):152. Sharma B, Xie L, Yang F, Wang W, Zhou Q, Xiang M, et al. Recent advance on PTP1B inhibitors and their biomedical applications. Eur J Med Chem. 2020;199:112376. Song D, Adrover JM, Felice C, Christensen LN, He XY, Merrill JR, et al. PTP1B inhibitors protect against acute lung injury and regulate CXCR4 signaling in neutrophils. JCI Insight. 2022;7(14):e158199. Zhang K, Kaufman RJ. From endoplasmic-reticulum stress to the inflammatory response. Nature. 2008;454(7203):455–62. Khan MM, Yang WL, Wang P. ENDOPLASMIC RETICULUM STRESS IN SEPSIS. Shock. 2015;44(4):294–304. Heinonen KM, Dubé N, Bourdeau A, Lapp WS, Tremblay ML. Protein tyrosine phosphatase 1B negatively regulates macrophage development through CSF-1 signaling. Proc Natl Acad Sci U S A. 2006;103(8):2776–81. Xu X, Wang X, Guo Y, Bai Y, He S, Wang N, et al. Inhibition of PTP1B Promotes M2 Polarization via MicroRNA-26a/MKP1 Signaling Pathway in Murine Macrophages. Front Immunol. 2019;10:1930. Zhu Y, Yu J, Gong J, Shen J, Ye D, Cheng D, et al. PTP1B inhibitor alleviates deleterious microglial activation and neuronal injury after ischemic stroke by modulating the ER stress-autophagy axis via PERK signaling in microglia. Aging. 2021;13(3):3405–27. Nisha VM, Anusree SS, Priyanka A, Raghu KG. Apigenin and quercetin ameliorate mitochondrial alterations by tunicamycin-induced ER stress in 3T3-L1 adipocytes. Appl Biochem Biotechnol. 2014;174(4):1365–75. Lee S, Park S, Ryu JS, Kang J, Kim I, Son S, et al. c-Src inhibitor PP2 inhibits head and neck cancer progression through regulation of the epithelial-mesenchymal transition. Exp Biol Med (Maywood). 2023;248(6):492–500. Rittirsch D, Huber-Lang MS, Flierl MA, Flierl MA, Ward PA. Immunodesign of experimental sepsis by cecal ligation and puncture. Nat Protoc. 2009;4(1):31–6. Abdullahi A, Stanojcic M, Parousis A, Patsouris D, Jeschke MG. Modeling Acute ER Stress in Vivo and in Vitro. Shock. 2017;47(4):506–13. Lennmyr F, Ericsson A, Gerwins P, Akterin S, Ahlström H, Terént A. Src family kinase-inhibitor PP2 reduces focal ischemic brain injury. Acta Neurol Scand. 2004;110(3):175–9. Luo D, Liu F, Zhang J, Shao Q, Tao W, Xiao R, et al. Comprehensive Analysis of LncRNA-mRNA Expression Profiles and the ceRNA Network Associated with Pyroptosis in LPS-Induced Acute Lung Injury. J Inflamm Res. 2021;14:413–28. Liu S, Su X, Pan P, Zhang L, Hu Y, Tan H, et al. Neutrophil extracellular traps are indirectly triggered by lipopolysaccharide and contribute to acute lung injury. Sci Rep. 2016;6:37252. Bourebaba L, Serwotka-Suszczak A, Pielok A, Sikora M, Mularczyk M, Marycz K. The PTP1B inhibitor MSI-1436 ameliorates liver insulin sensitivity by modulating autophagy, ER stress and systemic inflammation in Equine metabolic syndrome affected horses. Front Endocrinol (Lausanne). 2023;14:1149610. Zhang J, Guo J, Yang N, Huang Y, Hu T, Rao C. Endoplasmic reticulum stress-mediated cell death in liver injury. Cell Death Dis. 2022;13(12):1051. Hui Z, Wang S, Li J, Wang J, Zhang Z. Compound Tongluo Decoction inhibits endoplasmic reticulum stress-induced ferroptosis and promoted angiogenesis by activating the Sonic Hedgehog pathway in cerebral infarction. J Ethnopharmacol. 2022;283:114634. Li Q, Zhang K, Hou L, Liao J, Zhang H, Han Q, et al. Endoplasmic reticulum stress contributes to pyroptosis through NF-κB/NLRP3 pathway in diabetic nephropathy. Life Sci. 2023;322:121656. Cui Y, Yang Y, Tao W, Peng W, Luo D, Zhao N, et al. Neutrophil Extracellular Traps Induce Alveolar Macrophage Pyroptosis by Regulating NLRP3 Deubiquitination, Aggravating the Development of Septic Lung Injury. J Inflamm Res. 2023;16:861–77. Lebeaupin C, Proics E, de Bieville CH, Rousseau D, Bonnafous S, Patouraux S, et al. ER stress induces NLRP3 inflammasome activation and hepatocyte death. Cell Death Dis. 2015;6(9):e1879. Huang J, Lu W, Doycheva DM, Gamdzyk M, Hu X, Liu R, et al. IRE1α inhibition attenuates neuronal pyroptosis via miR-125/NLRP1 pathway in a neonatal hypoxic-ischemic encephalopathy rat model. J Neuroinflammation. 2020;17(1):152. Liu ST, Pham H, Pandol SJ, Ptasznik A. Src as the link between inflammation and cancer. Front Physiol. 2014;4:416. Liu H, Wu Y, Zhu S, Liang W, Wang Z, Wang Y, et al. PTP1B promotes cell proliferation and metastasis through activating src and ERK1/2 in non-small cell lung cancer. Cancer Lett. 2015;359(2):218–25. Okenwa C, Kumar A, Rego D, Konarski Y, Nilchi L, Wright K, et al. SHP-1-Pyk2-Src protein complex and p38 MAPK pathways independently regulate IL-10 production in lipopolysaccharide-stimulated macrophages. J Immunol. 2013;191(5):2589–603. Cheng XL, Ding F, Li H, Tan XQ, Liu X, Cao JM, et al. Activation of AMPA receptor promotes TNF-α release via the ROS-cSrc-NFκB signaling cascade in RAW264.7 macrophages. Biochem Biophys Res Commun. 2015;461(2):275–80. Song GJ, Jung M, Kim JH, Park H, Rahman MH, Zhang S, et al. A novel role for protein tyrosine phosphatase 1B as a positive regulator of neuroinflammation. J Neuroinflammation. 2016;13(1):86. Ajoolabady A, Lebeaupin C, Wu NN, Kaufman RJ, Ren J. ER stress and inflammation crosstalk in obesity. Med Res Rev. 2023;43(1):5–30. Additional Declarations No competing interests reported. Supplementary Files westernoriginal.docx SupplementalFigure1.tif Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3859426","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":269085804,"identity":"5d699d2e-de5c-4c7a-b43c-893faa00c65b","order_by":0,"name":"chong-rong qiu","email":"","orcid":"","institution":"Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"chong-rong","middleName":"","lastName":"qiu","suffix":""},{"id":269085805,"identity":"a35bb021-1c70-41f7-a442-309a2857fc0f","order_by":1,"name":"zhi-jian sun","email":"","orcid":"","institution":"Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"zhi-jian","middleName":"","lastName":"sun","suffix":""},{"id":269085806,"identity":"52ef8761-257b-4cf5-b0f9-f0f3089d188a","order_by":2,"name":"fen liu","email":"","orcid":"","institution":"Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"fen","middleName":"","lastName":"liu","suffix":""},{"id":269085807,"identity":"6e098874-36a7-47a2-95c0-f858d0ad05dd","order_by":3,"name":"wei deng","email":"","orcid":"","institution":"Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"wei","middleName":"","lastName":"deng","suffix":""},{"id":269085808,"identity":"867c4102-0a22-46e6-b4cc-f1e3390b8649","order_by":4,"name":"xiu-fang ouyang","email":"","orcid":"","institution":"Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"xiu-fang","middleName":"","lastName":"ouyang","suffix":""},{"id":269085809,"identity":"8dcc7fdc-5b13-427f-9486-76e344dc8f92","order_by":5,"name":"qing-qing zhang","email":"","orcid":"","institution":"Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"qing-qing","middleName":"","lastName":"zhang","suffix":""},{"id":269085810,"identity":"15b0e628-1847-4a4c-a7d0-91879b385c9f","order_by":6,"name":"Wen-Qiang Tao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7klEQVRIiWNgGAWjYFCCBIYPDAY29W3MzAcgAgcIa2GcwVCRxtjP3pZAipYzhxln9pwxIE6LOXuOYTNv22Fmgxs53x78bGOQ47uRwPi5AI8Wy543IC3pbAY3crcb9rYxGEveSGCWnoFHC9Bw88e8bdY8QC3bpBnbGBI33EhgY+bBrwVkC7MEkPEMpKWeOC08Z5wNJHvOsIG0JBgQ1HLmWWHjnIq0BH72NjPJnnMShjPPPGyWxqvlePLGhjcGNkCTmZ9J/Cizkec7nnzwMz4tDAwcBkxICiSAmLEBrwYGBvYHjD8IKBkFo2AUjIIRDgBojlBgaMYSvQAAAABJRU5ErkJggg==","orcid":"","institution":"Nanchang University","correspondingAuthor":true,"prefix":"","firstName":"Wen-Qiang","middleName":"","lastName":"Tao","suffix":""}],"badges":[],"createdAt":"2024-01-13 07:59:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3859426/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3859426/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":50156245,"identity":"dcd2c419-8365-45c3-b9ba-08c8b3062e8b","added_by":"auto","created_at":"2024-01-25 11:46:45","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":569405,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-3859426/v1/bf911ea02dc38251e2d6c137.png"},{"id":50155464,"identity":"55acbb1d-e5c9-4ff3-b524-67653a5dc10f","added_by":"auto","created_at":"2024-01-25 11:30:45","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":490413,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-3859426/v1/a3fa7d1dd234c86f0062873d.png"},{"id":50155465,"identity":"e176c2ab-fd85-41e2-bf0c-3c6362865a7d","added_by":"auto","created_at":"2024-01-25 11:30:45","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":484247,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-3859426/v1/caab189bda0434d7d5bdc43b.png"},{"id":50155467,"identity":"89d93b41-aa12-41a3-888a-20913e8dbcaf","added_by":"auto","created_at":"2024-01-25 11:30:45","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":841859,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-3859426/v1/4cef6dcd70726d366b1d0d45.png"},{"id":50155472,"identity":"b6c03f1f-bd22-4e06-92c8-2790c2f02218","added_by":"auto","created_at":"2024-01-25 11:30:45","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":789908,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-3859426/v1/3445bc1838023ec5af6446e8.png"},{"id":50155468,"identity":"f4d21f95-717d-49ff-905f-aedb6297a9a2","added_by":"auto","created_at":"2024-01-25 11:30:45","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":644283,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-3859426/v1/aa6ce6322ac04b2de3659d2c.png"},{"id":50155471,"identity":"450467c7-684c-4436-ac91-fae0ab43a6a6","added_by":"auto","created_at":"2024-01-25 11:30:45","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":792178,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-3859426/v1/b68c4ca876a7d49b7ae09951.png"},{"id":50155470,"identity":"1434e6ca-ac62-4632-87ef-16f2e40ee9c1","added_by":"auto","created_at":"2024-01-25 11:30:45","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1068140,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-3859426/v1/a00d387ce4ec5e39a07f0eaf.png"},{"id":58205398,"identity":"e92766ca-7f85-4770-9bbc-e6f246adcd90","added_by":"auto","created_at":"2024-06-12 11:55:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6296775,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3859426/v1/4282550a-0521-40d2-80ce-41daa9f98128.pdf"},{"id":50155474,"identity":"fb0b50a1-0cc3-4239-92c2-2f5051f58f70","added_by":"auto","created_at":"2024-01-25 11:30:51","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":102924778,"visible":true,"origin":"","legend":"","description":"","filename":"westernoriginal.docx","url":"https://assets-eu.researchsquare.com/files/rs-3859426/v1/1a4fcc82e4ecd1287861192a.docx"},{"id":50155821,"identity":"bd6f116e-645f-4167-92da-5be6deffe4a0","added_by":"auto","created_at":"2024-01-25 11:38:45","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":745156,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalFigure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-3859426/v1/15105f8f11da6c35332715db.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"PTP1B inhibitor alleviates deleterious septic lung injury through Src signaling","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDuring sepsis, characterized by organ dysfunction, the lungs are often the first and most frequently affected organ to fail. Although significant progress has been made in the clinical treatment of lung injury in sepsis, such as mechanical ventilation and extracorporeal membrane oxygenation, effective treatment methods are still lacking, and the mortality rate of septic lung injury can be as high as 40% \u003csup\u003e[\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. It has been found that an uncontrolled pulmonary inflammatory response is important in the pathogenesis of lung injury in sepsis \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. Therefore, early limitation of excessive inflammatory responses may be an effective strategy.\u003c/p\u003e \u003cp\u003eStudies have shown that alveolar macrophages (AMs) aggravate inflammation through endoplasmic reticulum stress (ER) and pyroptosis \u003csup\u003e[\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e, and inhibiting ER stress can reduce inflammation \u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Protein tyrosine phosphatase 1B (PTP1B) is an endogenous molecule closely related to inflammation, encoded by the \u003cem\u003ePTPN1\u003c/em\u003e gene, and located in the cytoplasmic region of the ER. It has a variety of biological activities and may play an important role in regulating the inflammatory response \u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. Inhibition of PTP1B alleviates ER stress and the inflammatory response and improves the prognosis of mice with sepsis \u003csup\u003e[\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. However, whether PTP1B has a regulatory effect on pyroptosis has not yet been reported, and the function of PTP1B in macrophages remains controversial. In bone marrow-derived macrophages, PTP1B knockout promotes inflammation by enhancing tyrosine phosphorylation of the macrophage colony-stimulating factor 1 receptor, resulting in increased monocyte/macrophage numbers and macrophage activity \u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. However, Xu et al. found that PTP1B inhibition could induce M2 polarization, which has anti-inflammatory effects, in mouse mononuclear macrophage leukemia cells \u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. Therefore, it is important to further study the regulatory role and mechanism of PTP1B in the inflammation of AMs in septic lung injury.\u003c/p\u003e \u003cp\u003eIn this study, we confirmed that PTP1B regulates the ER stress-pyroptosis axis by directly binding to the Src protein in AMs during septic lung injury and that inhibition of PTP1B can reduce lung injury in sepsis, which is a potential therapeutic target for septic lung injury and may provide a new strategy for its treatment.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eLPS-Induced AM Cell Modeling\u003c/h2\u003e \u003cp\u003e \u003cem\u003eRattus norvegicus\u003c/em\u003e (NR) 8383 AM cells were obtained from the Chinese Academy of Sciences Cell Bank (Shanghai, China). NR8383 AM cells were cultured in Ham\u0026rsquo;s F-12K medium (Boster, China) supplemented with 15% (v/v) fetal bovine serum (FBS, Seo, China). AM cells were seeded into six-well plates at a density of 5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells per well before being treated with 1 \u0026micro;g/mL lipopolysaccharide (LPS; \u003cem\u003eEscherichia coli\u003c/em\u003e 055:B5; Sigma) for 6, 12 and 24 h. The negative control group was treated with an equal volume of phosphate-buffered saline (Biochem, Shenzhen, China). In subsequent experiments, the cells were randomly assigned to five groups: LPS\u0026thinsp;+\u0026thinsp;SC (PTP1B inhibitor, SC-222227; Santa Cruz Biotechnology, CA, USA), LPS\u0026thinsp;+\u0026thinsp;SC\u0026thinsp;+\u0026thinsp;tunicamycin (ER stress inducer, M4798; AbMoleBioScience, Houston, TX, USA), and LPS\u0026thinsp;+\u0026thinsp;SC\u0026thinsp;+\u0026thinsp;PP2 (Src inhibitor, HY-13805; MedChemExpress, USA). According to previous literature \u003csup\u003e[\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e, the AM cells were pretreated with 2 \u0026micro;M SC for 30 min, 1.5 \u0026micro;g/mL tunicamycin for 24 h before SC, and 15 \u0026micro;M PP2 for 1 h before SC. Next, the AM cells in the LPS group were treated with LPS (1 \u0026micro;g/mL) for 6 h, and then collected for RNA or protein isolation. Inflammatory factors in the collected supernatant were measured using enzyme-linked immunosorbent assay (ELISA). AM cells were collected for western blotting analysis and quantitative reverse transcription-polymerase chain reaction (qRT-PCR).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eC57BL/6 mice (8 weeks old; body weight: 18\u0026ndash;22 g) were purchased from Zhejiang Vital River Laboratory Animal Technology Co., Ltd., China (certificate of conformity: SCXK2019-0001). According to institutional regulations, the mice were fed pathogen-free food and water under standard conditions (12-h light/dark cycle, 25\u0026ndash;27\u0026deg;C, humidity of ~\u0026thinsp;40%).We performed the invasive procedures with pentobarbital anaesthesia to minimize suffering and killed all the animals by inhaling excessive amounts of isoflurane anaesthetic.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eEstablishment of the Cecal Ligation and Puncture Model\u003c/h2\u003e \u003cp\u003eCecal ligation and puncture (CLP) was performed in mice as previously described \u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. First, after anesthesia and disinfection with betadine solution, laparotomy was performed on the abdomen to expose the cecum and adjoining intestine. Next, a 3.0 thread suture was used to tightly ligate the intestinal canal under the ileocecal section, after which a 20-gauge needle was used to puncture the canal wall, and a small amount of intestinal content was gently squeezed into the abdominal cavity to establish a sepsis mouse model. Finally, the mice received a subcutaneous injection of 1mL of saline for postoperative resuscitation. Mice in the sham group underwent laparotomy techniques without ligation and puncture. As previously described \u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e, SC (10 mg/kg) and tunicamycin (1 mg/kg) were intraperitoneally injected into C57BL/6 mice 2 h before CLP surgery, and PP2 (1 mg/kg) injected 1 h before surgery.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eLentivirus Gene Delivery\u003c/h2\u003e \u003cp\u003eLentivirus gene delivery was conducted as previously described \u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. Lentiviruses silently expressing PTP1B were constructed by GeneChem Group (Gene Co., Ltd, Shanghai, China). AM cells were cultured in a medium with Ham\u0026rsquo;s F-12K containing 15% (v/v) FBS. The RNA and protein extraction groups were transfected with the indicated lentiviruses for 72 h in the culture medium.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eReal-Time Quantitative PCR\u003c/h2\u003e \u003cp\u003eTransZol Up (O41220; TRANS, China) was used to extract RNA from the samples, and a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific) used to assess the extracted RNA concentration and purity. EasyScript One-Step gDNA Removal and cDNA Synthesis Supermix (AE311; TransGen Biotech) were used to prepare cDNA using a StepOnePlus analyzer Real-Time PCR system (Applied Biosystems, USA). All qRT-PCR analyses were performed using the PerfectStart Green SuperMix kit (AQ601; TransGen Biotech) and an Applied LightCycler96 Real-Time PCR instrument. The qRT-PCR mixtures contained 5.0 \u0026micro;L of PerfectStart Green qPCR SuperMix, 3.6 \u0026micro;L of nuclease-free water, 0.4 \u0026micro;L of primers (10 \u0026micro;M), and 2.0 \u0026micro;L of the reverse transcription product. Optimization of the qRT-PCR amplification conditions was as follows: 94\u0026deg;C for 30 s, 40 cycles of each at 94\u0026deg;C for 5 s, 60\u0026deg;C for 30 s, 95\u0026deg;C for 10 s, 65\u0026deg;C for 60 s, 97\u0026deg;C for 1 s, and 37\u0026deg;C for 30 s. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the internal control. The PCR primer sequences are presented in Tables\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and \u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe rat primers for qRT-PCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward :GTCATCAACGGGAAACCCAT\u003c/p\u003e \u003cp\u003eReverse :ACGCCAGTAGACTCCACGACAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePTP1B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward:TGGGCGGCTATTTACCAGGA\u003c/p\u003e \u003cp\u003eReverse:CACCATCTCCCAGAAGTGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eeif2α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward:TTCGCCATGTTGCTGAGGTA\u003c/p\u003e \u003cp\u003eReverse :TGACAGCTTGTGGGGTCAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCHOP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward:AACCTGAGGAGAGAGAAACCG\u003c/p\u003e \u003cp\u003eReverse :TGCAGATCCTCATACCAGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGSDMD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward:AGCATCCTTGCATTCCGAGT\u003c/p\u003e \u003cp\u003eReverse :TAAAGTCATGCCGCCTCTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCaspase-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: TTTCCTGGACCGAGTGGTTC\u003c/p\u003e \u003cp\u003eReverse: AGGTCAACATCAGCTCCGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNLRP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: GCATGCCGTATCTGGTTGTG\u003c/p\u003e \u003cp\u003eReverse: AGGGTACCCCATAGACTGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: AGCTTCAGGAAGGCAGTGTC\u003c/p\u003e \u003cp\u003eReverse: TCAGACAGCACGAGGCATTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: TCAGCTCTTCTACCAGCAAACA\u003c/p\u003e \u003cp\u003eReverse: TTCCAACTGAGAGGCTGTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: GGCTTTCGGAACTCACTGGA\u003c/p\u003e \u003cp\u003eReverse: GGGAACAGTCTGGGAAGCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe mice primers for qRT-PCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward :TTTTGTCTACGGGACGAGGC\u003c/p\u003e \u003cp\u003eReverse :TACGGGTCTAGGGATGCTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePTP1B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward:GGCTATTTACCAGGACATTCGAC\u003c/p\u003e \u003cp\u003eReverse:TCCATGATGCGGTTGAGCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eeif2α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward:TCCTCGTTGCCACTAAGCAG\u003c/p\u003e \u003cp\u003eReverse :AACAAGCTGACATAGGCCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCHOP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward:TCTTGAGCCTAACACGTCGATT\u003c/p\u003e \u003cp\u003eReverse :ACGTGGACCAGGTTCTCTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGSDMD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward:GATCAAGGAGGTAAGCGGCA\u003c/p\u003e \u003cp\u003eReverse :CACTCCGGTTCTGGTTCTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCaspase-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: CACTCCGGTTCTGGTTCTGG\u003c/p\u003e \u003cp\u003eReverse: TGATCACATAGGTCCCGTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNLRP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: GGCTGCTATCTGGAGGAACTT\u003c/p\u003e \u003cp\u003eReverse: GGGATACAGCCTTTCTCGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: GCCACCTTTTGACAGTGATGAG\u003c/p\u003e \u003cp\u003eReverse: AGCTTCTCCACAGCCACAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: TGAGGCATCCAGGACAAATCA\u003c/p\u003e \u003cp\u003eReverse: GAACCACAGAGAACCCCCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: AGGCACTCCCCCAAAAGATG\u003c/p\u003e \u003cp\u003eReverse: CCACTTGGTGGTTTGTGAGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eWestern Blot\u003c/h2\u003e \u003cp\u003eTotal protein was extracted from the cells using lysis buffer containing a protease inhibitor, and protein levels were quantified using a protein quantification kit (Beijing Pulilai Gene Technology Co., Ltd., China). Proteins were separated using 10% sodium dodecyl sulfate\u0026ndash;polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA). Membranes were blocked with 5% nonfat milk for 1 h at room temperature (RT) and then incubated with primary antibodies for 24 h at 4\u0026deg;C. Subsequently, the membranes were incubated with secondary antibodies at RT for 2 h. GAPDH was used as the internal reference. Blots were visualized using an enhanced chemiluminescence assay kit (Millipore), developed with a Bio-Rad Gel Doc EZ imager (Bio-Rad, USA), and band intensities were analyzed using ImageJ software (NIH Image analysis). Primary antibodies used included anti-PTP1B (1:1000, ab244207; Abcam, UK), anti-p-eif2α (1:1000, 3398; Cell Signaling Technology, USA), anti-eif2α (1:1000, 5324T; Cell Signaling Technology), anti-CHOP (1:1000, T56694; Abmart, China), anti-GSDMD (1:1000, P30823; Abmart), anti-NLRP3 (1:1000, ab263899; Abcam, UK), anti-caspase-1 (1:1000, 22915-1-Ap; Proteintech, China), anti-p-src (1:200, sc-166860; Santa Cruz), anti-Src (1:1000, 2109; Cell Signaling Technology), and anti-GAPDH (1:20000, 60004-1-Ig; Proteintech).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eEnzyme-Linked Immunosorbent Assay\u003c/h2\u003e \u003cp\u003eEnzyme-linked immunosorbent assay (ELISA) was performed to assess the concentration of inflammatory cytokines according to the manufacturer\u0026rsquo;s instructions. Specific ELISA kits were purchased from Fine Test (Wuhan Fine Biotech Co., Ltd, China). Levels of IL-1β and TNFα in mouse plasma and bronchoalveolar lavage fluid (BALF) harvested from each group were detected using commercial mouse IL-1β and TNFα kits. IL-18, IL-1β, and TNF-α release levels in the supernatants were measured using specific rat ELISA kits.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eHematoxylin and Eosin Staining and Histopathological Analysis\u003c/h2\u003e \u003cp\u003eMice were euthanized after anesthesia, and fresh lung tissues collected, fixed in 4% paraformaldehyde (PFA) buffer, embedded, and sliced into 5-\u0026micro;m-thick sections. The slices were stained with hematoxylin and eosin to assess lung injury. Hematoxylin and eosin-stained images were captured using a microscope (Zeiss) and evaluated by two pathologists to assess the degree of lung injury, as previously reported \u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. The sections were analyzed to assess inflammatory cell infiltration, epithelial desquamation, edema, and hemorrhage. Each characteristic was scored as 3 (prominent), 2 (moderate), 1 (mild), or 0 (absent).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eLung Wet/Dry Ratio\u003c/h2\u003e \u003cp\u003eLung edema was evaluated by calculating the lung wet/dry (W/D) ratio. Immediately after euthanasia, the wet weight of the right lung from each mouse was calculated and then dried in an incubator at 65\u0026deg;C for 24 h. The dry weight was measured, and the W/D ratios were calculated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence Staining\u003c/h2\u003e \u003cp\u003eFresh lung tissue was fixed with 4% PFA, dehydrated in a sucrose gradient solution, wrapped in Tissue-Tek OCT, and sectioned into 5-\u0026micro;m-thick slices. The tissue slices were fixed in 4% PFA, permeabilized, blocked with 5% goat serum to minimize nonspecific staining, and then incubated with primary antibodies overnight at 4\u0026deg;C. The primary antibodies used were anti-PTP1B (1:50, ab244207; Abcam, USA), anti-NLRP3 (1:200, WL02635; Wanleibio, China), and anti-caspase-1 (1:100, 22915-1-Ap; Proteintech). After incubation with the secondary antibodies Alexa Fluor 488 (Thermo Fisher Scientific, USA) and Alexa Fluor 594 (Thermo Fisher Scientific) for 1 h at RT, the nuclei were stained with 4\u0026prime;,6-diamidino-2-phenylindole (DAPI; Boster) for 5 min without exposure to light. The samples were visualized using a confocal laser scanning microscope (Olympus) or a fluorescence microscope (Zeiss).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eCo-immunoprecipitation Assay\u003c/h2\u003e \u003cp\u003eCells were lysed in equal proportions of immunoprecipitation (IP) buffer (Beyotime, China) with a complete protease inhibitor cocktail (MedChemExpress) on ice for 30 min. After centrifugation, protein samples were collected and prepared for IP assays. Protein A/G magnetic beads (MedChemExpress) were coupled to anti-p-Src antibodies (Santa Cruz) at 1\u0026ndash;2 \u0026micro;g per 100\u0026ndash;500 \u0026micro;g of total protein or anti-PTP1B (1:30; Abcam, UK) and rotated for 2 h at 4\u0026deg;C. After washing three times, 500 \u0026micro;g of total protein was added and co-rotated with the antibody-magnetic bead complex overnight at 4\u0026deg;C. Equivalent amounts of cognate mouse or rabbit IgG antibodies were used as IP controls. Finally, immunoprecipitated proteins were dissolved in 25 \u0026micro;L 1\u0026times; loading buffer (Solarbio, China) by boiling for 10 min for western blot analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eThree biological replicates were used for all the experiments. Data are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. All data were analyzed using SPSS (version 19.0, IBM, USA) and statistical charts were generated using GraphPad Prism 8 software. Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test was used to compare differences between two groups and analysis of variance (ANOVA) was used to compare differences between multiple groups. Dunn\u0026rsquo;s multiple comparison test was used for one-way ANOVA, and Fisher\u0026rsquo;s least significant difference test was used for two-way ANOVA. The survival of the sham, CLP, and CLP\u0026thinsp;+\u0026thinsp;SC groups was analyzed using Kaplan\u0026ndash;Meier curves. Statistical significance was set at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05. significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eUpregulation of PTP1B in LPS-treated NR8383 AM cells Correlates to Inflammation\u003c/h2\u003e \u003cp\u003eAlveolar macrophages play an important role in the pathogenesis of septic lung injury by producing inflammatory cytokines and presenting antigens that mediate innate and adaptive immunity. We used LPS to stimulate NR8383 to establish a cell model of septic lung injury and selected different time points to determine the optimal time point of PTP1B elevation. After LPS stimulation of NR8383 for 6 h, the expression levels of PTP1B protein and mRNA were significantly increased when compared with the control group and LPS stimulation for 12 and 24 h (Fig.\u0026nbsp;1A, C, D), and the levels of the inflammatory cytokines IL-1β, IL-18, and TNFα were also significantly increased (Fig.\u0026nbsp;1B). Protein and mRNA levels of the ER stress molecules p-eif2α and CHOP and pyroptotic molecules GSDMD, caspase1, and NLRP3 were also increased (Fig.\u0026nbsp;1A, C, D). These results suggested that PTP1B expression was upregulated during lung injury in sepsis. Thus, PTP1B may be a pro-inflammatory molecule, and inflammation may be related to ER stress and pyroptosis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003ePTP1B Inhibitor Alleviates Inflammation and ER Stress in LPS-treated NR8383 AM Cells\u003c/h2\u003e \u003cp\u003eTo investigate the effect of a PTP1B inhibitor (SC-22227, SC) on inflammation in LPS-treated NR8383 cells, we treated NR8383 with a PTP1B inhibitor and LPS for 6 h. SC pretreatment significantly reduced the levels of LPS-induced inflammatory cytokines compared to the LPS group (Fig.\u0026nbsp;2B), and the protein and mRNA levels of ER stress and pyroptotic molecules also decreased (Fig.\u0026nbsp;2A, C, D). These results indicate that PTP1B inhibition could alleviate inflammation, ER stress, and pyroptosis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eLentiviruses silently expressing PTP1B Alleviates Inflammation and ER Stress in LPS-treated NR8383 AM Cells\u003c/h2\u003e \u003cp\u003eTo investigate the effect of Lentiviruses silently expressing PTP1B (Lv-PTP1B) on inflammation in LPS-treated NR8383 cells, we transfected with the indicated lentiviruses in NR8383 for 72 h and LPS for 6 h. Lv-PTP1B significantly reduced the levels of LPS-induced inflammatory cytokines compared to the LPS group (Fig.\u0026nbsp;3B), and the protein and mRNA levels of ER stress and pyroptotic molecules also decreased (Fig.\u0026nbsp;3A, C, D). These results indicate that PTP1B inhibition could alleviate inflammation, ER stress, and pyroptosis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003ePTP1B Inhibitor Treatment Ameliorates Inflammation and Increases Survival Probability in Septic Mice\u003c/h2\u003e \u003cp\u003eThe effect of PTP1B inhibitors on inflammation in mice with septic lung injury was verified, and a mouse sepsis model was established using the CLP method. The lung inflammation and pulmonary edema of mice in the CLP\u0026thinsp;+\u0026thinsp;SC group were reduced compared with those in the CLP group, and the lung injury score was decreased (Fig.\u0026nbsp;4A\u0026ndash;C). Concurrently, the levels of plasma and BALF inflammatory cytokines decreased (Fig.\u0026nbsp;4D\u0026ndash;E), and the protein and mRNA levels of ER stress and pyroptotic molecules decreased (Fig.\u0026nbsp;4H\u0026ndash;M). The levels of PTP1B (green), NLRP3 (red), and caspase1 (red) detected by immunofluorescence were consistent with the above results (Fig.\u0026nbsp;4N). In addition, the survival rate of septic mice in the CLP\u0026thinsp;+\u0026thinsp;SC group was significantly higher than that of the CLP group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;4F). These results indicate that SC can alleviate inflammation, relieve ER stress and pyrogenic death, improve prognosis, reduce death, and protect against lung injury in septic mice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eTunicamycin Exacerbates ER Stress, Pyroptosis and Inflammation In Vivo\u003c/h2\u003e \u003cp\u003eNext, we demonstrated that PTP1B plays a role in regulating inflammation in mice with septic lung injury via ER stress. The ER stress inducer tunicamycin was administered to mice before CLP, and mice in the CLP\u0026thinsp;+\u0026thinsp;SC\u0026thinsp;+\u0026thinsp;tunicamycin group showed more severe signs of lung inflammation, pulmonary edema, and lung injury than those in the CLP\u0026thinsp;+\u0026thinsp;SC group (Fig.\u0026nbsp;5A\u0026ndash;C). Concurrently, the plasma and BALF inflammatory cytokine levels in mice were also significantly increased (Fig.\u0026nbsp;5D, E), as were the protein and mRNA levels of ER stress and pyroptotic molecules (Fig.\u0026nbsp;5F\u0026ndash;G, Supplemental Fig.\u0026nbsp;1A\u0026ndash;E). The expression levels of pyroptotic molecules (red) detected by immunofluorescence (Fig.\u0026nbsp;5H) were consistent with these results. These results indicated that tunicamycin significantly reversed the inhibitory effects of PTP1B inhibitors on pulmonary inflammation, ER stress, and pyroptosis in septic mice, suggesting that PTP1B regulates inflammation in septic mice through the ER stress-pyroptosis axis in vivo.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eTunicamycin Exacerbates ER Stress, Pyroptosis and Inflammation In Vitro\u003c/h2\u003e \u003cp\u003eTo further verify the role of PTP1B in regulating inflammation through ER stress in vitro, we pre-treated NR8383 cells with the ER stress inducer, tunicamycin, and then treated them with SC. Finally, the NR8383 cells were stimulated with LPS for 6 h. NR8383 cells were significantly improved compared to those in the LPS\u0026thinsp;+\u0026thinsp;SC group. In the LPS\u0026thinsp;+\u0026thinsp;SC\u0026thinsp;+\u0026thinsp;tunicamycin group, the inflammatory cytokine levels were significantly increased (Fig.\u0026nbsp;6A\u0026ndash;B), and the mRNA and protein levels of ER stress and pyroptotic molecules were significantly increased (Fig.\u0026nbsp;6C\u0026ndash;I). These results indicated that tunicamycin significantly reversed the inhibitory effects of PTP1B inhibitors on LPS-stimulated NR8383 cell inflammation, ER stress, and pyroptosis, and that PTP1B regulated inflammation through the ER stress-pyroptosis axis in vitro.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003ePTP1B Inhibitor Modulates the ER Stress-pyroptosis Axis via Src Signaling In Vitro\u003c/h2\u003e \u003cp\u003eNext, we explored the molecular mechanism of PTP1B regulation of ER stress-pyroptosis in vitro. We measured the expression level of Src protein. The expression level of P-Src was significantly reduced in the LPS group compared to the control group and increased when the PTP1B inhibitor was applied (Fig.\u0026nbsp;7A). The levels of inflammatory cytokines in the LPS\u0026thinsp;+\u0026thinsp;SC\u0026thinsp;+\u0026thinsp;PP2 group were significantly higher than those in the LPS\u0026thinsp;+\u0026thinsp;SC group (Fig.\u0026nbsp;7H), as were the protein and mRNA levels of ER stress and pyrogenic molecules (Fig.\u0026nbsp;7A\u0026ndash;G). In addition, we verified the relationship between PTP1B and Src using co-IP. As shown in Fig.\u0026nbsp;7I, PTP1B and P-Src expression in LPS-stimulated NR8383 cells increased in the IP group. When the expression level of P-Src decreased, the expression level of PTP1B also decreased (Fig.\u0026nbsp;7J). These results suggest that PTP1B and Src have a negative regulatory relationship and that PTP1B and Src directly interact with each other and play a role in regulating inflammation.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003ePTP1B Inhibitor Modulates the ER Stress-pyroptosis Axis via Src Signaling In Vivo\u003c/h2\u003e \u003cp\u003eFinally, in vivo experiments verified the role of Src in the regulation of ER stress-pyroptosis using a PTP1B inhibitor. After the application of the Src inhibitor (PP2), mice in the CLP\u0026thinsp;+\u0026thinsp;SC\u0026thinsp;+\u0026thinsp;PP2 group showed more severe pulmonary inflammation, pulmonary edema, and lung injury than those in the CLP\u0026thinsp;+\u0026thinsp;SC group (Fig.\u0026nbsp;8A\u0026ndash;C). The plasma or BALF inflammatory cytokine levels in mice significantly increased (Fig.\u0026nbsp;8D\u0026ndash;E), as did the expression levels of ER stress and pyroptotic molecules (Fig.\u0026nbsp;8F\u0026ndash;G). The expression levels of pyroptotic molecules (red) detected by immunofluorescence (Fig.\u0026nbsp;8H) were consistent with these results. The results showed that PP2 significantly reversed the protective effect of the PTP1B inhibitor (SC) against inflammation and lung injury in mice with sepsis. Src is involved in the regulation of PTP1B during ER stress-pyroptosis, which aggravates the inflammatory response in vivo.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussions","content":"\u003cp\u003eIn this study, we found that PTP1B was upregulated in both in vivo and in vitro models of septic lung injury. PTP1B directly binds to Src and aggravates inflammation by regulating the ER stress-pyroptosis axis. PTP1B inhibition alleviated inflammation and improved the prognosis of septic mice. Therefore, PTP1B is a potential therapeutic target for the treatment of lung injury in sepsis.\u003c/p\u003e \u003cp\u003eIn this study, the upregulation of PTP1B expression was accompanied by increased levels of inflammatory cytokines, pulmonary edema, and alveolar hemorrhage. These observations suggest that PTP1B is a pro-inflammatory molecule involved in septic lung injury \u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. Inhibition of PTP1B significantly reduced the levels of inflammatory cytokines and alleviated lung injury, which is consistent with previous studies \u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. PTP1B is a tyrosine phosphatase located in the ER, where proteins are processed, modified, and folded. When protein folding exceeds the capacity of the ER, ER stress results in misfolded or unfolded proteins, a state called ER stress. Sustained ER stress can lead to cell death and inflammation \u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. This study showed that PTP1B can regulate the stress level of the ER, has a positive effect on maintaining ER homeostasis, and promotes the normal modification and folding of proteins. In addition, this study found that the ER stress inducer tunicamycin blocked the action of PTP1B inhibitors to a certain extent, thereby increasing inflammation and ER stress, which is consistent with previous reports \u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePyroptosis is a caspase-1-dependent programmed cell death initiated by inflammasomes \u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. In the livers of obese mice, administration of LPS or itamycin causes the activation of ER stress-related proteins \u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e, which further activates the NLRP3 inflammasome and subsequently initiates pyroptosis of hepatocytes, which can be mitigated by the administration of ER stress inhibitors \u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. This study also confirmed that PTP1B affects pyroptosis by regulation of ER stress. A decrease in PTP1B levels is accompanied by a reduction in ER stress and pyroptosis, indicating that ER stress and pyroptosis participate in the pathogenesis of sepsis \u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. PTP1B reduces inflammation and protects against lung injury in sepsis by regulating the ER stress-pyroptosis axis. To our knowledge, this is the first report using AMs, confirming that the regulation of ER stress can affect pyroptosis \u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e and further revealing the specific mechanism of PTP1B in alleviating lung injury in sepsis.\u003c/p\u003e \u003cp\u003eSrc is a membrane-associated non-receptor tyrosine kinase that plays key roles in cell adhesion, proliferation, survival, invasion, cell motility, and cytokine receptor activation. Studies have found that the overactivation and/or overexpression of the Src family of kinases is closely related to the occurrence and development of various cancers \u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. This may be due to the activation of Src kinases in immune cells through chemokines secreted by tumors, thus inducing the production of cytokines that mutually activate Src in cancer cells and promote cancer progression. Previous studies have found that Src is the substrate of PTP1B, which has a tyrosine kinase with an SH3 structure; the proline-rich region of PTP1B may bind to the SH3 substrate, and PTP1B promotes the proliferation of colon and mammary glands through the activation of Src \u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. Src also regulates the production of inflammatory cytokines \u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. Song et al. \u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e found that the overexpression of PTP1B reduces Src phosphorylation. PTP1B leads to the activation of Src tyrosine kinase activity by the dephosphorylation of Src, thereby negatively regulating nervous system inflammation.\u003c/p\u003e \u003cp\u003eThis study also confirmed the relationship between PTP1B and Src and found that the expression of PTP1B was higher in the control and sham surgery groups than in the LPS or CLP groups. Conversely, Src was expressed at lower levels in the latter group, whereas the opposite was observed when PTP1B inhibitors were used. These findings suggest that PTP1B negatively regulates Src, which is consistent with previous findings \u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. In addition, through an IP study of AMs stimulated with LPS, we observed that the binding enrichment of PTP1B and Src and the increase in PTP1B in the LPS group was accompanied by an increase in Src expression, whereas the increase in Src in the control group was accompanied by an increase in PTP1B. This suggests that Src is involved in the regulation of the ER stress-pyroptosis axis by PTP1B in septic lung injury and that PTP1B directly binds to Src to play this role.\u003c/p\u003e \u003cp\u003eThe present study has several limitations. First, a PTP1B agonist was not used to verify its effect on ER stress-pyroptosis. PTP1B not only has anti-inflammatory effects but also immune regulatory effects. However, the regulatory effect of PTP1B on immunity in septic lung injury requires further investigation. Although previous studies on ER stress-mediated cell death have mainly focused on autophagy and apoptosis \u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e, our current study found that pyroptosis is also involved. However, the specific mechanisms of ER stress that induce different cell death patterns, especially pyroptosis, remain unclear. Third, no exogenous co-IP experiments were conducted to verify the direct binding effect of PTP1B and Src. Finally, this study was conducted only in vivo and in vitro with a relatively limited sample size; therefore, further follow-up studies with human samples are warranted to confirm and extend these results.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn conclusion, our study suggests that PTP1B may reduce inflammation by regulating pyroptosis through ER stress, and that inhibition of PTP1B may reduce lung injury in sepsis. This study suggests that PT1B inhibitors have clinical application value in the treatment of septic lung injury and may provide a new approach for the treatment of septic lung injury.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe original contributions presented in this study are included in the article/supplementary material. Further inquiries can be directed to the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003enone.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by National Natural Science Foundation of China [grant number 81660315] and Natural Science Foundation of Jiangxi Province [grant number 20232BAB206083].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCQ contributed to the experimentation, analysis, and manuscript preparation. FL and WT contributed to the concept and oversaw the study. ZS and QZ contributed to the experiments. WD and XFOU contributed to immunological evaluation through sample measurements.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAnimal experimental procedures and protocols were approved by the Ethics Committee of the\u0026nbsp;Medical Innovation Center\u0026nbsp;of the First Affiliated Hospital of Nanchang University (approval no.\u0026nbsp;CDYFY-IACUC-202305QR019) and\u0026nbsp;were\u0026nbsp;performed\u0026nbsp;in\u0026nbsp;accordance with the principles and procedures of the National Institutes of Health Guide for the Care and Use of Laboratory Animals and the Guidelines for Chinese Regulation for the Use and Care of Laboratory Animals.\u0026nbsp;According to\u0026nbsp;institutional regulations, the mice were fed pathogen-free food and water under standard conditions (12-h light/dark cycle, 25\u0026ndash;27 \u0026deg;C, humidity of ~40%).We performed the invasive procedures with pentobarbital anaesthesia to minimize suffering and killed all the animals by inhaling excessive amounts of isoflurane anaesthetic.\u003c/p\u003e\n\u003cp\u003eThis study does not involve human samples.\u003c/p\u003e\n\u003cp\u003eWe confirmed that all methods were carried out in accordance with relevant\u0026nbsp;guidelines and regulations.\u003c/p\u003e\n\u003cp\u003eWe confirmed that all methods are reported in accordance with ARRIVE guidelines (\u003cu\u003ehttps://arriveguidelines.org\u003c/u\u003e) for the reporting of animal experiments.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eWei JX, Jiang HL, Chen XH. Endothelial cell metabolism in sepsis. World J Emerg Med. 2023;14(1):10\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatthay MA, Zemans RL, Zimmerman GA, Arabi YM, Beitler JR, Mercat A, et al. Acute respiratory distress syndrome. Nat Rev Dis Primers. 2019;5(1):18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLai K, Song C, Gao M, Deng Y, Lu Z, Li N, et al. Uridine Alleviates Sepsis-Induced Acute Lung Injury by Inhibiting Ferroptosis of Macrophage. Int J Mol Sci. 2023;24(6):5093.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatthay MA, Ware LB, Zimmerman GA. The acute respiratory distress syndrome. J Clin Invest. 2012;122(8):2731\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim DI, Song MK, Kim HI, Han KM, Lee K. Diesel Exhaust Particulates Induce Neutrophilic Lung Inflammation by Modulating Endoplasmic Reticulum Stress-Mediated CXCL1/KC Expression in Alveolar Macrophages. Molecules. 2020;25(24):6046.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu DD, Pan PH, Liu B, Su XL, Zhang LM, Tan HY, et al. Inhibition of Alveolar Macrophage Pyroptosis Reduces Lipopolysaccharide-induced Acute Lung Injury in Mice. Chin Med J (Engl). 2015;128(19):2638\u0026ndash;45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie K, Chen YQ, Chai YS, Lin SH, Wang CJ, Xu F. HMGB1 suppress the expression of IL-35 by regulating Na\u0026iuml;ve CD4\u0026thinsp;+\u0026thinsp;T cell differentiation and aggravating Caspase-11-dependent pyroptosis in acute lung injury. Int Immunopharmacol. 2021;91:107295.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang J, Lu W, Doycheva DM, Gamdzyk M, Hu X, Liu R, et al. IRE1α inhibition attenuates neuronal pyroptosis via miR-125/NLRP1 pathway in a neonatal hypoxic-ischemic encephalopathy rat model. J Neuroinflammation. 2020;17(1):152.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma B, Xie L, Yang F, Wang W, Zhou Q, Xiang M, et al. Recent advance on PTP1B inhibitors and their biomedical applications. Eur J Med Chem. 2020;199:112376.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong D, Adrover JM, Felice C, Christensen LN, He XY, Merrill JR, et al. PTP1B inhibitors protect against acute lung injury and regulate CXCR4 signaling in neutrophils. JCI Insight. 2022;7(14):e158199.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang K, Kaufman RJ. From endoplasmic-reticulum stress to the inflammatory response. Nature. 2008;454(7203):455\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhan MM, Yang WL, Wang P. ENDOPLASMIC RETICULUM STRESS IN SEPSIS. Shock. 2015;44(4):294\u0026ndash;304.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeinonen KM, Dub\u0026eacute; N, Bourdeau A, Lapp WS, Tremblay ML. Protein tyrosine phosphatase 1B negatively regulates macrophage development through CSF-1 signaling. Proc Natl Acad Sci U S A. 2006;103(8):2776\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu X, Wang X, Guo Y, Bai Y, He S, Wang N, et al. Inhibition of PTP1B Promotes M2 Polarization via MicroRNA-26a/MKP1 Signaling Pathway in Murine Macrophages. Front Immunol. 2019;10:1930.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu Y, Yu J, Gong J, Shen J, Ye D, Cheng D, et al. PTP1B inhibitor alleviates deleterious microglial activation and neuronal injury after ischemic stroke by modulating the ER stress-autophagy axis via PERK signaling in microglia. Aging. 2021;13(3):3405\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNisha VM, Anusree SS, Priyanka A, Raghu KG. Apigenin and quercetin ameliorate mitochondrial alterations by tunicamycin-induced ER stress in 3T3-L1 adipocytes. Appl Biochem Biotechnol. 2014;174(4):1365\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee S, Park S, Ryu JS, Kang J, Kim I, Son S, et al. c-Src inhibitor PP2 inhibits head and neck cancer progression through regulation of the epithelial-mesenchymal transition. Exp Biol Med (Maywood). 2023;248(6):492\u0026ndash;500.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRittirsch D, Huber-Lang MS, Flierl MA, Flierl MA, Ward PA. Immunodesign of experimental sepsis by cecal ligation and puncture. Nat Protoc. 2009;4(1):31\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdullahi A, Stanojcic M, Parousis A, Patsouris D, Jeschke MG. Modeling Acute ER Stress in Vivo and in Vitro. Shock. 2017;47(4):506\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLennmyr F, Ericsson A, Gerwins P, Akterin S, Ahlstr\u0026ouml;m H, Ter\u0026eacute;nt A. Src family kinase-inhibitor PP2 reduces focal ischemic brain injury. Acta Neurol Scand. 2004;110(3):175\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo D, Liu F, Zhang J, Shao Q, Tao W, Xiao R, et al. Comprehensive Analysis of LncRNA-mRNA Expression Profiles and the ceRNA Network Associated with Pyroptosis in LPS-Induced Acute Lung Injury. J Inflamm Res. 2021;14:413\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu S, Su X, Pan P, Zhang L, Hu Y, Tan H, et al. Neutrophil extracellular traps are indirectly triggered by lipopolysaccharide and contribute to acute lung injury. Sci Rep. 2016;6:37252.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBourebaba L, Serwotka-Suszczak A, Pielok A, Sikora M, Mularczyk M, Marycz K. The PTP1B inhibitor MSI-1436 ameliorates liver insulin sensitivity by modulating autophagy, ER stress and systemic inflammation in Equine metabolic syndrome affected horses. Front Endocrinol (Lausanne). 2023;14:1149610.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang J, Guo J, Yang N, Huang Y, Hu T, Rao C. Endoplasmic reticulum stress-mediated cell death in liver injury. Cell Death Dis. 2022;13(12):1051.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHui Z, Wang S, Li J, Wang J, Zhang Z. Compound Tongluo Decoction inhibits endoplasmic reticulum stress-induced ferroptosis and promoted angiogenesis by activating the Sonic Hedgehog pathway in cerebral infarction. J Ethnopharmacol. 2022;283:114634.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Q, Zhang K, Hou L, Liao J, Zhang H, Han Q, et al. Endoplasmic reticulum stress contributes to pyroptosis through NF-κB/NLRP3 pathway in diabetic nephropathy. Life Sci. 2023;322:121656.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCui Y, Yang Y, Tao W, Peng W, Luo D, Zhao N, et al. Neutrophil Extracellular Traps Induce Alveolar Macrophage Pyroptosis by Regulating NLRP3 Deubiquitination, Aggravating the Development of Septic Lung Injury. J Inflamm Res. 2023;16:861\u0026ndash;77.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLebeaupin C, Proics E, de Bieville CH, Rousseau D, Bonnafous S, Patouraux S, et al. ER stress induces NLRP3 inflammasome activation and hepatocyte death. Cell Death Dis. 2015;6(9):e1879.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang J, Lu W, Doycheva DM, Gamdzyk M, Hu X, Liu R, et al. IRE1α inhibition attenuates neuronal pyroptosis via miR-125/NLRP1 pathway in a neonatal hypoxic-ischemic encephalopathy rat model. J Neuroinflammation. 2020;17(1):152.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu ST, Pham H, Pandol SJ, Ptasznik A. Src as the link between inflammation and cancer. Front Physiol. 2014;4:416.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu H, Wu Y, Zhu S, Liang W, Wang Z, Wang Y, et al. PTP1B promotes cell proliferation and metastasis through activating src and ERK1/2 in non-small cell lung cancer. Cancer Lett. 2015;359(2):218\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOkenwa C, Kumar A, Rego D, Konarski Y, Nilchi L, Wright K, et al. SHP-1-Pyk2-Src protein complex and p38 MAPK pathways independently regulate IL-10 production in lipopolysaccharide-stimulated macrophages. J Immunol. 2013;191(5):2589\u0026ndash;603.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng XL, Ding F, Li H, Tan XQ, Liu X, Cao JM, et al. Activation of AMPA receptor promotes TNF-α release via the ROS-cSrc-NFκB signaling cascade in RAW264.7 macrophages. Biochem Biophys Res Commun. 2015;461(2):275\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong GJ, Jung M, Kim JH, Park H, Rahman MH, Zhang S, et al. A novel role for protein tyrosine phosphatase 1B as a positive regulator of neuroinflammation. J Neuroinflammation. 2016;13(1):86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAjoolabady A, Lebeaupin C, Wu NN, Kaufman RJ, Ren J. ER stress and inflammation crosstalk in obesity. Med Res Rev. 2023;43(1):5\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Sepsis, Protein tyrosine phosphatase 1B, endoplasmic reticulum stress, pyroptosis, Src","lastPublishedDoi":"10.21203/rs.3.rs-3859426/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3859426/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eSeptic lung injury is an unmet clinical challenge due to its high mortality, and there is a lack of effective treatment. Accumulating evidence suggests that an uncontrolled pulmonary inflammatory response is important in the pathogenesis of lung injury in sepsis. Therefore, limiting excessive early inflammatory responses may be an effective strategy.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eWe established a septic lung injury model using cecal ligation and puncture. Western blotting and immunofluorescence analyses were performed to assess the expression of PTP1B and endoplasmic reticulum (ER) stress and pyroptosis. Co-immunoprecipitation was used to analyze the binding of PTP1B and Src molecules.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003ePTP1B is upregulated in both in vivo and in vitro models of septic lung injury. PTP1B directly binds to Src and aggravates inflammation by regulating the ER stress-pyroptosis axis. The inhibition of PTP1B alleviates inflammation and improves the prognosis of septic mice.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eOur study suggesting that PT1B inhibitors have clinical application value in the treatment of septic lung injury. This may provide a new strategy for the treatment of septic lung injury.\u003c/p\u003e","manuscriptTitle":"PTP1B inhibitor alleviates deleterious septic lung injury through Src signaling","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-25 11:30:39","doi":"10.21203/rs.3.rs-3859426/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"13666d44-af29-4e7e-b2e0-201124fc292e","owner":[],"postedDate":"January 25th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-06-12T11:47:33+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-25 11:30:39","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3859426","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3859426","identity":"rs-3859426","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00